Emerging patterns of somatic mutations in cancer

PubMed Central

Watson, Ian R.; Takahashi, Koichi; Futreal, P. Andrew; Chin, Lynda

2014-01-01

The advance in technological tools for massively parallel, high-throughput sequencing of DNA has enabled the comprehensive characterization of somatic mutations in large number of tumor samples. Here, we review recent cancer genomic studies that have assembled emerging views of the landscapes of somatic mutations through deep sequencing analyses of the coding exomes and whole genomes in various cancer types. We discuss the comparative genomics of different cancers, including mutation rates, spectrums, and roles of environmental insults that influence these processes. We highlight the developing statistical approaches used to identify significantly mutated genes, and discuss the emerging biological and clinical insights from such analyses as well as the challenges ahead translating these genomic data into clinical impacts. PMID:24022702

Clock-like mutational processes in human somatic cells

PubMed Central

Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; Sale, Julian E.; Campbell, Peter J.; Nik-Zainal, Serena; Stratton, Michael R.

2016-01-01

During the course of a lifetime somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell’s genome. Some processes generate mutations throughout life at a constant rate in all individuals and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutation rates in different tissues. However, their mutation rates are not correlated indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This study provides the first survey of clock-like mutational processes operative in human somatic cells. PMID:26551669

Clock-like mutational processes in human somatic cells

DOE PAGES

Alexandrov, Ludmil B.; Jones, Philip H.; Wedge, David C.; ...

2015-11-09

During the course of a lifetime, somatic cells acquire mutations. Different mutational processes may contribute to the mutations accumulated in a cell, with each imprinting a mutational signature on the cell's genome. Some processes generate mutations throughout life at a constant rate in all individuals, and the number of mutations in a cell attributable to these processes will be proportional to the chronological age of the person. Using mutations from 10,250 cancer genomes across 36 cancer types, we investigated clock-like mutational processes that have been operating in normal human cells. Two mutational signatures show clock-like properties. Both exhibit different mutationmore » rates in different tissues. However, their mutation rates are not correlated, indicating that the underlying processes are subject to different biological influences. For one signature, the rate of cell division may influence its mutation rate. This paper provides the first survey of clock-like mutational processes operating in human somatic cells.« less

Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data.

PubMed

Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A; Larsen, Martin Jakob

2016-01-01

Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths.

Somatic mutations affect key pathways in lung adenocarcinoma

PubMed Central

Ding, Li; Getz, Gad; Wheeler, David A.; Mardis, Elaine R.; McLellan, Michael D.; Cibulskis, Kristian; Sougnez, Carrie; Greulich, Heidi; Muzny, Donna M.; Morgan, Margaret B.; Fulton, Lucinda; Fulton, Robert S.; Zhang, Qunyuan; Wendl, Michael C.; Lawrence, Michael S.; Larson, David E.; Chen, Ken; Dooling, David J.; Sabo, Aniko; Hawes, Alicia C.; Shen, Hua; Jhangiani, Shalini N.; Lewis, Lora R.; Hall, Otis; Zhu, Yiming; Mathew, Tittu; Ren, Yanru; Yao, Jiqiang; Scherer, Steven E.; Clerc, Kerstin; Metcalf, Ginger A.; Ng, Brian; Milosavljevic, Aleksandar; Gonzalez-Garay, Manuel L.; Osborne, John R.; Meyer, Rick; Shi, Xiaoqi; Tang, Yuzhu; Koboldt, Daniel C.; Lin, Ling; Abbott, Rachel; Miner, Tracie L.; Pohl, Craig; Fewell, Ginger; Haipek, Carrie; Schmidt, Heather; Dunford-Shore, Brian H.; Kraja, Aldi; Crosby, Seth D.; Sawyer, Christopher S.; Vickery, Tammi; Sander, Sacha; Robinson, Jody; Winckler, Wendy; Baldwin, Jennifer; Chirieac, Lucian R.; Dutt, Amit; Fennell, Tim; Hanna, Megan; Johnson, Bruce E.; Onofrio, Robert C.; Thomas, Roman K.; Tonon, Giovanni; Weir, Barbara A.; Zhao, Xiaojun; Ziaugra, Liuda; Zody, Michael C.; Giordano, Thomas; Orringer, Mark B.; Roth, Jack A.; Spitz, Margaret R.; Wistuba, Ignacio I.; Ozenberger, Bradley; Good, Peter J.; Chang, Andrew C.; Beer, David G.; Watson, Mark A.; Ladanyi, Marc; Broderick, Stephen; Yoshizawa, Akihiko; Travis, William D.; Pao, William; Province, Michael A.; Weinstock, George M.; Varmus, Harold E.; Gabriel, Stacey B.; Lander, Eric S.; Gibbs, Richard A.; Meyerson, Matthew; Wilson, Richard K.

2009-01-01

Determining the genetic basis of cancer requires comprehensive analyses of large collections of histopathologically well-classified primary tumours. Here we report the results of a collaborative study to discover somatic mutations in 188 human lung adenocarcinomas. DNA sequencing of 623 genes with known or potential relationships to cancer revealed more than 1,000 somatic mutations across the samples. Our analysis identified 26 genes that are mutated at significantly high frequencies and thus are probably involved in carcinogenesis. The frequently mutated genes include tyrosine kinases, among them the EGFR homologue ERBB4; multiple ephrin receptor genes, notably EPHA3; vascular endothelial growth factor receptor KDR; and NTRK genes. These data provide evidence of somatic mutations in primary lung adenocarcinoma for several tumour suppressor genes involved in other cancers—including NF1, APC, RB1 and ATM—and for sequence changes in PTPRD as well as the frequently deleted gene LRP1B. The observed mutational profiles correlate with clinical features, smoking status and DNA repair defects. These results are reinforced by data integration including single nucleotide polymorphism array and gene expression array. Our findings shed further light on several important signalling pathways involved in lung adenocarcinoma, and suggest new molecular targets for treatment. PMID:18948947

Evaluation of Nine Somatic Variant Callers for Detection of Somatic Mutations in Exome and Targeted Deep Sequencing Data

PubMed Central

Krøigård, Anne Bruun; Thomassen, Mads; Lænkholm, Anne-Vibeke; Kruse, Torben A.; Larsen, Martin Jakob

2016-01-01

Next generation sequencing is extensively applied to catalogue somatic mutations in cancer, in research settings and increasingly in clinical settings for molecular diagnostics, guiding therapy decisions. Somatic variant callers perform paired comparisons of sequencing data from cancer tissue and matched normal tissue in order to detect somatic mutations. The advent of many new somatic variant callers creates a need for comparison and validation of the tools, as no de facto standard for detection of somatic mutations exists and only limited comparisons have been reported. We have performed a comprehensive evaluation using exome sequencing and targeted deep sequencing data of paired tumor-normal samples from five breast cancer patients to evaluate the performance of nine publicly available somatic variant callers: EBCall, Mutect, Seurat, Shimmer, Indelocator, Somatic Sniper, Strelka, VarScan 2 and Virmid for the detection of single nucleotide mutations and small deletions and insertions. We report a large variation in the number of calls from the nine somatic variant callers on the same sequencing data and highly variable agreement. Sequencing depth had markedly diverse impact on individual callers, as for some callers, increased sequencing depth highly improved sensitivity. For SNV calling, we report EBCall, Mutect, Virmid and Strelka to be the most reliable somatic variant callers for both exome sequencing and targeted deep sequencing. For indel calling, EBCall is superior due to high sensitivity and robustness to changes in sequencing depths. PMID:27002637

Landscape of somatic mutations in 560 breast cancer whole-genome sequences

DOE PAGES

Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; ...

2016-05-02

Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

Landscape of somatic mutations in 560 breast cancer whole-genome sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nik-Zainal, Serena; Davies, Helen; Staaf, Johan

Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

Landscape of somatic mutations in 560 breast cancer whole genome sequences

PubMed Central

Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; Ramakrishna, Manasa; Glodzik, Dominik; Zou, Xueqing; Martincorena, Inigo; Alexandrov, Ludmil B.; Martin, Sancha; Wedge, David C.; Van Loo, Peter; Ju, Young Seok; Smid, Marcel; Brinkman, Arie B; Morganella, Sandro; Aure, Miriam R.; Lingjærde, Ole Christian; Langerød, Anita; Ringnér, Markus; Ahn, Sung-Min; Boyault, Sandrine; Brock, Jane E.; Broeks, Annegien; Butler, Adam; Desmedt, Christine; Dirix, Luc; Dronov, Serge; Fatima, Aquila; Foekens, John A.; Gerstung, Moritz; Hooijer, Gerrit KJ; Jang, Se Jin; Jones, David R.; Kim, Hyung-Yong; King, Tari A.; Krishnamurthy, Savitri; Lee, Hee Jin; Lee, Jeong-Yeon; Li, Yilong; McLaren, Stuart; Menzies, Andrew; Mustonen, Ville; O’Meara, Sarah; Pauporté, Iris; Pivot, Xavier; Purdie, Colin A.; Raine, Keiran; Ramakrishnan, Kamna; Rodríguez-González, F. Germán; Romieu, Gilles; Sieuwerts, Anieta M.; Simpson, Peter T; Shepherd, Rebecca; Stebbings, Lucy; Stefansson, Olafur A; Teague, Jon; Tommasi, Stefania; Treilleux, Isabelle; Van den Eynden, Gert G.; Vermeulen, Peter; Vincent-Salomon, Anne; Yates, Lucy; Caldas, Carlos; van’t Veer, Laura; Tutt, Andrew; Knappskog, Stian; Tan, Benita Kiat Tee; Jonkers, Jos; Borg, Åke; Ueno, Naoto T; Sotiriou, Christos; Viari, Alain; Futreal, P. Andrew; Campbell, Peter J; Span, Paul N.; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E.; Thompson, Alastair M.; Birney, Ewan; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W.M.; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Kong, Gu; Thomas, Gilles; Stratton, Michael R.

2016-01-01

We analysed whole genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. 93 protein-coding cancer genes carried likely driver mutations. Some non-coding regions exhibited high mutation frequencies but most have distinctive structural features probably causing elevated mutation rates and do not harbour driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed 12 base substitution and six rearrangement signatures. Three rearrangement signatures, characterised by tandem duplications or deletions, appear associated with defective homologous recombination based DNA repair: one with deficient BRCA1 function; another with deficient BRCA1 or BRCA2 function; the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operative, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer. PMID:27135926

Bloom syndrome: a mendelian prototype of somatic mutational disease.

PubMed

German, J

1993-11-01

Spontaneous mutations in human somatic cells occur far more often than normal in individuals with Bloom syndrome. The basis for understanding these mutations and their developmental consequences emerges from examination of BS at the molecular, cellular, and clinical levels. The major clinical feature of BS, proportional dwarfism, as well as its major clinical complication, an exceptionally early emergence of neoplasia of the types and sites that affect the general population, are attributable to the excessive occurrence of mutations in somatic cells. Here, the following aspects of BS are discussed: (i) the BS phenotype; (ii) neoplasia in BS, including the means--the Bloom's Syndrome Registry--by which the significant risk for diverse sites and types of cancer in these patients was revealed; (iii) the biological basis for the cancer proneness of BS; and, finally, (iv) the significance for both basic human biology and clinical medicine of BS as the prototype of somatic mutational disease.

Fungal Infection Increases the Rate of Somatic Mutation in Scots Pine (Pinus sylvestris L.).

PubMed

Ranade, Sonali Sachin; Ganea, Laura-Stefana; Razzak, Abdur M; García Gil, M R

2015-01-01

Somatic mutations are transmitted during mitosis in developing somatic tissue. Somatic cells bearing the mutations can develop into reproductive (germ) cells and the somatic mutations are then passed on to the next generation of plants. Somatic mutations are a source of variation essential to evolve new defense strategies and adapt to the environment. Stem rust disease in Scots pine has a negative effect on wood quality, and thus adversely affects the economy. It is caused by the 2 most destructive fungal species in Scandinavia: Peridermium pini and Cronartium flaccidum. We studied nuclear genome stability in Scots pine under biotic stress (fungus-infected, 22 trees) compared to a control population (plantation, 20 trees). Stability was assessed as accumulation of new somatic mutations in 10 microsatellite loci selected for genotyping. Microsatellites are widely used as molecular markers in population genetics studies of plants, and are particularly used for detection of somatic mutations as their rate of mutation is of a much higher magnitude when compared with other DNA markers. We report double the rate of somatic mutation per locus in the fungus-infected trees (4.8×10(-3) mutations per locus), as compared to the controls (2.0×10(-3) mutations per locus) when individual samples were analyzed at 10 different microsatellite markers. Pearson's chi-squared test indicated a significant effect of the fungal infection which increased the number of mutations in the fungus-infected trees (χ(2) = 12.9883, df = 1, P = 0.0003134). © The American Genetic Association 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Somatic deleterious mutation rate in a woody plant: estimation from phenotypic data

PubMed Central

Bobiwash, K; Schultz, S T; Schoen, D J

2013-01-01

We conducted controlled crosses in populations of the long-lived clonal shrub, Vaccinium angustifolium (lowbush blueberry) to estimate inbreeding depression and mutation parameters associated with somatic deleterious mutation. Inbreeding depression level was high, with many plants failing to set fruit after self-pollination. We also compared fruit set from autogamous pollinations (pollen collected from within the same inflorescence) with fruit set from geitonogamous pollinations (pollen collected from the same plant but from inflorescences separated by several meters of branch growth). The difference between geitonogamous versus autogamous fitness within single plants is referred to as ‘autogamy depression' (AD). AD can be caused by somatic deleterious mutation. AD was significantly different from zero for fruit set. We developed a maximum-likelihood procedure to estimate somatic mutation parameters from AD, and applied it to geitonogamous and autogamous fruit set data from this experiment. We infer that, on average, approximately three sublethal, partially dominant somatic mutations exist within the crowns of the plants studied. We conclude that somatic mutation in this woody plant results in an overall genomic deleterious mutation rate that exceeds the rate measured to date for annual plants. Some implications of this result for evolutionary biology and agriculture are discussed. PMID:23778990

Somatic Mutations and Neoepitope Homology in Melanomas Treated with CTLA-4 Blockade.

PubMed

Nathanson, Tavi; Ahuja, Arun; Rubinsteyn, Alexander; Aksoy, Bulent Arman; Hellmann, Matthew D; Miao, Diana; Van Allen, Eliezer; Merghoub, Taha; Wolchok, Jedd D; Snyder, Alexandra; Hammerbacher, Jeff

2017-01-01

Immune checkpoint inhibitors are promising treatments for patients with a variety of malignancies. Toward understanding the determinants of response to immune checkpoint inhibitors, it was previously demonstrated that the presence of somatic mutations is associated with benefit from checkpoint inhibition. A hypothesis was posited that neoantigen homology to pathogens may in part explain the link between somatic mutations and response. To further examine this hypothesis, we reanalyzed cancer exome data obtained from our previously published study of 64 melanoma patients treated with CTLA-4 blockade and a new dataset of RNA-Seq data from 24 of these patients. We found that the ability to accurately predict patient benefit did not increase as the analysis narrowed from somatic mutation burden, to inclusion of only those mutations predicted to be MHC class I neoantigens, to only including those neoantigens that were expressed or that had homology to pathogens. The only association between somatic mutation burden and response was found when examining samples obtained prior to treatment. Neoantigen and expressed neoantigen burden were also associated with response, but neither was more predictive than somatic mutation burden. Neither the previously described tetrapeptide signature nor an updated method to evaluate neoepitope homology to pathogens was more predictive than mutation burden. Cancer Immunol Res; 5(1); 84-91. ©2016 AACR. ©2016 American Association for Cancer Research.

Somatic mitochondrial mutation in gastric cancer.

PubMed Central

Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.

1995-01-01

Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355

Cancer-Associated Mutations in Endometriosis without Cancer

PubMed Central

Anglesio, M.S.; Papadopoulos, N.; Ayhan, A.; Nazeran, T.M.; Noë, M.; Horlings, H.M.; Lum, A.; Jones, S.; Senz, J.; Seckin, T.; Ho, J.; Wu, R.-C.; Lac, V.; Ogawa, H.; Tessier-Cloutier, B.; Alhassan, R.; Wang, A.; Wang, Y.; Cohen, J.D.; Wong, F.; Hasanovic, A.; Orr, N.; Zhang, M.; Popoli, M.; McMahon, W.; Wood, L.D.; Mattox, A.; Allaire, C.; Segars, J.; Williams, C.; Tomasetti, C.; Boyd, N.; Kinzler, K.W.; Gilks, C.B.; Diaz, L.; Wang, T.-L.; Vogelstein, B.; Yong, P.J.; Huntsman, D.G.; Shih, I.-M.

2017-01-01

BACKGROUND Endometriosis, defined as the presence of ectopic endometrial stroma and epithelium, affects approximately 10% of reproductive-age women and can cause pelvic pain and infertility. Endometriotic lesions are considered to be benign inflammatory lesions but have cancerlike features such as local invasion and resistance to apoptosis. METHODS We analyzed deeply infiltrating endometriotic lesions from 27 patients by means of exomewide sequencing (24 patients) or cancer-driver targeted sequencing (3 patients). Mutations were validated with the use of digital genomic methods in micro-dissected epithelium and stroma. Epithelial and stromal components of lesions from an additional 12 patients were analyzed by means of a droplet digital polymerase-chain-reaction (PCR) assay for recurrent activating KRAS mutations. RESULTS Exome sequencing revealed somatic mutations in 19 of 24 patients (79%). Five patients harbored known cancer driver mutations in ARID1A, PIK3CA, KRAS, or PPP2R1A, which were validated by Safe-Sequencing System or immunohistochemical analysis. The likelihood of driver genes being affected at this rate in the absence of selection was estimated at P = 0.001 (binomial test). Targeted sequencing and a droplet digital PCR assay identified KRAS mutations in 2 of 3 patients and 3 of 12 patients, respectively, with mutations in the epithelium but not the stroma. One patient harbored two different KRAS mutations, c.35G→T and c.35G→C, and another carried identical KRAS c.35G→A mutations in three distinct lesions. CONCLUSIONS We found that lesions in deep infiltrating endometriosis, which are associated with virtually no risk of malignant transformation, harbor somatic cancer driver mutations. Ten of 39 deep infiltrating lesions (26%) carried driver mutations; all the tested somatic mutations appeared to be confined to the epithelial compartment of endometriotic lesions. PMID:28489996

Somatic CALR Mutations in Myeloproliferative Neoplasms with Nonmutated JAK2

PubMed Central

Baxter, E.J.; Nice, F.L.; Gundem, G.; Wedge, D.C.; Avezov, E.; Li, J.; Kollmann, K.; Kent, D.G.; Aziz, A.; Godfrey, A.L.; Hinton, J.; Martincorena, I.; Van Loo, P.; Jones, A.V.; Guglielmelli, P.; Tarpey, P.; Harding, H.P.; Fitzpatrick, J.D.; Goudie, C.T.; Ortmann, C.A.; Loughran, S.J.; Raine, K.; Jones, D.R.; Butler, A.P.; Teague, J.W.; O’Meara, S.; McLaren, S.; Bianchi, M.; Silber, Y.; Dimitropoulou, D.; Bloxham, D.; Mudie, L.; Maddison, M.; Robinson, B.; Keohane, C.; Maclean, C.; Hill, K.; Orchard, K.; Tauro, S.; Du, M.-Q.; Greaves, M.; Bowen, D.; Huntly, B.J.P.; Harrison, C.N.; Cross, N.C.P.; Ron, D.; Vannucchi, A.M.; Papaemmanuil, E.; Campbell, P.J.; Green, A.R.

2014-01-01

BACKGROUND Somatic mutations in the Janus kinase 2 gene (JAK2) occur in many myeloproliferative neoplasms, but the molecular pathogenesis of myeloproliferative neoplasms with nonmutated JAK2 is obscure, and the diagnosis of these neoplasms remains a challenge. METHODS We performed exome sequencing of samples obtained from 151 patients with myeloproliferative neoplasms. The mutation status of the gene encoding calreticulin (CALR) was assessed in an additional 1345 hematologic cancers, 1517 other cancers, and 550 controls. We established phylogenetic trees using hematopoietic colonies. We assessed calreticulin subcellular localization using immunofluorescence and flow cytometry. RESULTS Exome sequencing identified 1498 mutations in 151 patients, with medians of 6.5, 6.5, and 13.0 mutations per patient in samples of polycythemia vera, essential thrombocythemia, and myelofibrosis, respectively. Somatic CALR mutations were found in 70 to 84% of samples of myeloproliferative neoplasms with nonmutated JAK2, in 8% of myelodysplasia samples, in occasional samples of other myeloid cancers, and in none of the other cancers. A total of 148 CALR mutations were identified with 19 distinct variants. Mutations were located in exon 9 and generated a +1 base-pair frameshift, which would result in a mutant protein with a novel C-terminal. Mutant calreticulin was observed in the endoplasmic reticulum without increased cell-surface or Golgi accumulation. Patients with myeloproliferative neoplasms carrying CALR mutations presented with higher platelet counts and lower hemoglobin levels than patients with mutated JAK2. Mutation of CALR was detected in hematopoietic stem and progenitor cells. Clonal analyses showed CALR mutations in the earliest phylogenetic node, a finding consistent with its role as an initiating mutation in some patients. CONCLUSIONS Somatic mutations in the endoplasmic reticulum chaperone CALR were found in a majority of patients with myeloproliferative neoplasms with

Somatic mutations in salivary duct carcinoma and potential therapeutic targets

PubMed Central

Smith, Joel A.; Clarke, Angus J.; Luk, Peter P.; Selinger, Christina I.; Mahon, Kate L.; Kraitsek, Spiridoula; Palme, Carsten; Boyer, Michael J.; Dinger, Marcel E.; Cowley, Mark J.; O’Toole, Sandra A.

2017-01-01

Background Salivary duct carcinomas (SDCa) are rare highly aggressive malignancies. Most patients die from distant metastatic disease within three years of diagnosis. There are limited therapeutic options for disseminated disease. Results 11 cases showed androgen receptor expression and 6 cases showed HER2 amplification. 6 Somatic mutations with additional available targeted therapies were identified: EGFR (p.G721A: Gefitinib), PDGFRA (p.H845Y: Imatinib and Crenolanib), PIK3CA (p.H1047R: Everolimus), ERBB2 (p.V842I: Lapatinib), HRAS (p.Q61R: Selumetinib) and KIT (p.T670I: Sorafenib). Furthermore, alterations in PTEN, PIK3CA and HRAS that alter response to androgen deprivation therapy and HER2 inhibition were also seen. Materials and Methods Somatic mutation analysis was performed on DNA extracted from 15 archival cases of SDCa using the targeted Illumina TruSeq Amplicon Cancer Panel. Potential targetable genetic alterations were identified using extensive literature and international somatic mutation database (COSMIC, KEGG) search. Immunohistochemistry for androgen receptor and immunohistochemistry and fluorescent in situ hybridization for HER2 were also performed. Conclusions SDCa show multiple somatic mutations, some that are amenable to pharmacologic manipulation and others that confer resistance to treatments currently under investigation. These findings emphasize the need to develop testing and treatment strategies for SDCa. PMID:29100278

Somatic mutation detection in human biomonitoring.

PubMed

Olsen, L S; Nielsen, L R; Nexø, B A; Wassermann, K

1996-06-01

Somatic cell gene mutation arising in vivo may be considered to be a biomarker for genotoxicity. Assays detecting mutations of the haemoglobin and glycophorin A genes in red blood cells and of the hypoxanthine-guanine phosphoribosyltransferase and human leucocyte antigenes in T-lymphocytes are available in humans. This MiniReview describes these assays and their application to studies of individuals exposed to genotoxic agents. Moreover, with the implementation of techniques of molecular biology mutation spectra can now be defined in addition to the quantitation of in vivo mutant frequencies. We describe current screening methods for unknown mutations, including the denaturing gradient gel electrophoresis, single strand conformation polymorphism analysis, heteroduplex analysis, chemical modification techniques and enzymatic cleavage methods. The advantage of mutation detection as a biomarker is that it integrates exposure and sensitivity in one measurement. With the analysis of mutation spectra it may thus be possible to identify the causative genotoxic agent.

Somatic diversification of chicken immunoglobulin light chains by point mutations.

PubMed

Parvari, R; Ziv, E; Lantner, F; Heller, D; Schechter, I

1990-04-01

The light-chain locus of chicken has 1 functional V lambda 1 gene, 1 J gene, and 25 pseudo-V lambda-genes (where V = variable and J = joining). A major problem is which somatic mechanisms expand this extremely limited germ-line information to generate many different antibodies. Weill's group [Reynaud, C. A., Anquez, V., Grimal, H. & Weill, J. C. (1987) Cell 48, 379-388] has shown that the pseudo-V lambda-genes diversify the rearranged V lambda 1 by gene conversion. Here we demonstrate that chicken light chains are further diversified by somatic point mutations and by V lambda 1-J flexible joining. Somatic point mutations were identified in the J and 3' noncoding DNA of rearranged light-chain genes of chicken. These regions were analyzed because point mutations in V lambda 1 are obscured by gene conversion; the J and 3' noncoding DNA are presented in one copy per haploid genome and are not subject to gene conversion. In rodents point mutations occur as frequently in the V-J coding regions as in the adjacent flanking DNA. Therefore, we conclude that somatic point mutations diversify the V lambda 1 of chicken. The frequency (0-1%) and distribution of the mutations (decreasing in number with increased distance from the V lambda 1 segment) in chicken were as observed in rodents. Sequence variability at the V lambda 1-J junctions could be attributed to imprecise joining of the V lambda 1 and J genes. The modification by gene conversion of rearranged V lambda 1 genes in the bursa was similar in chicken aged 3 months (9.5%) or 3 weeks (9.1%)--i.e., gene conversion that generates the preimmune repertoire in the bursa seems to level off around 3 weeks of age. This preimmune repertoire can be further diversified by somatic point mutations that presumably lead to the formation of antibodies with increased affinity. A segment with structural features of a matrix association region [(A + T)-rich and four topoisomerase II binding sites] was identified in the middle of the J

Recurrent PTPRB and PLCG1 mutations in angiosarcoma.

PubMed

Behjati, Sam; Tarpey, Patrick S; Sheldon, Helen; Martincorena, Inigo; Van Loo, Peter; Gundem, Gunes; Wedge, David C; Ramakrishna, Manasa; Cooke, Susanna L; Pillay, Nischalan; Vollan, Hans Kristian M; Papaemmanuil, Elli; Koss, Hans; Bunney, Tom D; Hardy, Claire; Joseph, Olivia R; Martin, Sancha; Mudie, Laura; Butler, Adam; Teague, Jon W; Patil, Meena; Steers, Graham; Cao, Yu; Gumbs, Curtis; Ingram, Davis; Lazar, Alexander J; Little, Latasha; Mahadeshwar, Harshad; Protopopov, Alexei; Al Sannaa, Ghadah A; Seth, Sahil; Song, Xingzhi; Tang, Jiabin; Zhang, Jianhua; Ravi, Vinod; Torres, Keila E; Khatri, Bhavisha; Halai, Dina; Roxanis, Ioannis; Baumhoer, Daniel; Tirabosco, Roberto; Amary, M Fernanda; Boshoff, Chris; McDermott, Ultan; Katan, Matilda; Stratton, Michael R; Futreal, P Andrew; Flanagan, Adrienne M; Harris, Adrian; Campbell, Peter J

2014-04-01

Angiosarcoma is an aggressive malignancy that arises spontaneously or secondarily to ionizing radiation or chronic lymphoedema. Previous work has identified aberrant angiogenesis, including occasional somatic mutations in angiogenesis signaling genes, as a key driver of angiosarcoma. Here we employed whole-genome, whole-exome and targeted sequencing to study the somatic changes underpinning primary and secondary angiosarcoma. We identified recurrent mutations in two genes, PTPRB and PLCG1, which are intimately linked to angiogenesis. The endothelial phosphatase PTPRB, a negative regulator of vascular growth factor tyrosine kinases, harbored predominantly truncating mutations in 10 of 39 tumors (26%). PLCG1, a signal transducer of tyrosine kinases, encoded a recurrent, likely activating p.Arg707Gln missense variant in 3 of 34 cases (9%). Overall, 15 of 39 tumors (38%) harbored at least one driver mutation in angiogenesis signaling genes. Our findings inform and reinforce current therapeutic efforts to target angiogenesis signaling in angiosarcoma.

Somatic Mutations and Clonal Hematopoiesis in Aplastic Anemia.

PubMed

Yoshizato, Tetsuichi; Dumitriu, Bogdan; Hosokawa, Kohei; Makishima, Hideki; Yoshida, Kenichi; Townsley, Danielle; Sato-Otsubo, Aiko; Sato, Yusuke; Liu, Delong; Suzuki, Hiromichi; Wu, Colin O; Shiraishi, Yuichi; Clemente, Michael J; Kataoka, Keisuke; Shiozawa, Yusuke; Okuno, Yusuke; Chiba, Kenichi; Tanaka, Hiroko; Nagata, Yasunobu; Katagiri, Takamasa; Kon, Ayana; Sanada, Masashi; Scheinberg, Phillip; Miyano, Satoru; Maciejewski, Jaroslaw P; Nakao, Shinji; Young, Neal S; Ogawa, Seishi

2015-07-02

In patients with acquired aplastic anemia, destruction of hematopoietic cells by the immune system leads to pancytopenia. Patients have a response to immunosuppressive therapy, but myelodysplastic syndromes and acute myeloid leukemia develop in about 15% of the patients, usually many months to years after the diagnosis of aplastic anemia. We performed next-generation sequencing and array-based karyotyping using 668 blood samples obtained from 439 patients with aplastic anemia. We analyzed serial samples obtained from 82 patients. Somatic mutations in myeloid cancer candidate genes were present in one third of the patients, in a limited number of genes and at low initial variant allele frequency. Clonal hematopoiesis was detected in 47% of the patients, most frequently as acquired mutations. The prevalence of the mutations increased with age, and mutations had an age-related signature. DNMT3A-mutated and ASXL1-mutated clones tended to increase in size over time; the size of BCOR- and BCORL1-mutated and PIGA-mutated clones decreased or remained stable. Mutations in PIGA and BCOR and BCORL1 correlated with a better response to immunosuppressive therapy and longer and a higher rate of overall and progression-free survival; mutations in a subgroup of genes that included DNMT3A and ASXL1 were associated with worse outcomes. However, clonal dynamics were highly variable and might not necessarily have predicted the response to therapy and long-term survival among individual patients. Clonal hematopoiesis was prevalent in aplastic anemia. Some mutations were related to clinical outcomes. A highly biased set of mutations is evidence of Darwinian selection in the failed bone marrow environment. The pattern of somatic clones in individual patients over time was variable and frequently unpredictable. (Funded by Grant-in-Aid for Scientific Research and others.).

Discordance of somatic mutations between Asian and Caucasian patient populations with gastric cancer

PubMed Central

Jia, Feifei; Teer, Jamie K.; Knepper, Todd C.; Lee, Jae K.; Zhou, Hong-Hao; He, Yi-Jing; McLeod, Howard L.

2017-01-01

Background Differences in response to cancer treatments have been observed among racially and ethnically diverse gastric cancer patient populations. In the era of targeted therapy, mutation profiling of cancer is a crucial aspect of making therapeutic decisions. Mapping driver gene mutations for the gastric cancer patient population as a whole has significant potential to advance precision therapy. Methods Gastric cancer patient cases with sequencing data (total n=473) were obtained from The Cancer Genome Atlas (TCGA; n=295), Moffitt Cancer Center Total Cancer Care™ (TCC; n=33), and three published studies (n=145). Relevant somatic mutation frequency data were obtained from cBioPortal, TCC database and in-house analysis tool, and relevant publication Results We have found somatic mutation rates of several driver genes significantly vary between gastric cancer patients of Asian and Caucasian descent, with substantial variation across different geographic regions. Non-parametric statistical tests were performed to examine significant differences in protein-altering somatic mutations between Asian and Caucasian gastric cancer patient groups. Frequencies of somatic mutations of 5 genes were APC(Asian: Caucasian 6.06% vs. 14.40%, p=0.0076) ARIDIA(20.7% vs. 32.1%, p=0.01) KMT2A(4.04% vs. 12.35%, p=0.003) PIK3CA(9.6% vs. 18.52%, p=0.01) PTEN(2.52% vs. 9.05%, p=0.008), showing significant differences between Asian and Caucasian gastric cancer patients. Conclusions Our study has found significant differences in protein-altering somatic mutation frequencies in diverse geographic populations. In particular, we found that the somatic patterns may offer better insight and important opportunities for both targeted drug development and precision therapeutic strategies between Asian and Caucasian gastric cancer patients. PMID:28039579

Discordance of Somatic Mutations Between Asian and Caucasian Patient Populations with Gastric Cancer.

PubMed

Jia, Feifei; Teer, Jamie K; Knepper, Todd C; Lee, Jae K; Zhou, Hong-Hao; He, Yi-Jing; McLeod, Howard L

2017-04-01

Differences in response to cancer treatments have been observed among racially and ethnically diverse gastric cancer (GC) patient populations. In the era of targeted therapy, mutation profiling of cancer is a crucial aspect of making therapeutic decisions. Mapping driver gene mutations for the GC patient population as a whole has significant potential to advance precision therapy. GC patients with sequencing data (N = 473) were obtained from The Cancer Genome Atlas (TCGA; n = 295), Moffitt Cancer Center Total Cancer Care™ (TCC; n = 33), and three published studies (n = 145). In addition, relevant somatic mutation frequency data were obtained from cBioPortal, the TCC database, and an in-house analysis tool, as well as relevant publications. We found that the somatic mutation rates of several driver genes vary significantly between GC patients of Asian and Caucasian descent, with substantial variation across different geographic regions. Non-parametric statistical tests were performed to examine the significant differences in protein-altering somatic mutations between Asian and Caucasian GC patient groups. The frequencies of somatic mutations of five genes were: APC (Asian: Caucasian 6.06 vs. 14.40%, p = 0.0076), ARIDIA (20.7 vs. 32.1%, p = 0.01), KMT2A (4.04 vs. 12.35%, p = 0.003), PIK3CA (9.6 vs. 18.52%, p = 0.01), and PTEN (2.52 vs. 9.05%, p = 0.008), showing significant differences between Asian and Caucasian GC patients. Our study found significant differences in protein-altering somatic mutation frequencies in diverse geographic populations. In particular, we found that the somatic patterns may offer better insight and important opportunities for both targeted drug development and precision therapeutic strategies between Asian and Caucasian GC patients.

Molecular methods for somatic mutation testing in lung adenocarcinoma: EGFR and beyond

PubMed Central

Rogers, Toni-Maree; Fellowes, Andrew; Bell, Anthony; Fox, Stephen

2015-01-01

Somatic mutational profiling in cancer has revolutionized the practice of clinical oncology. The discovery of driver mutations in non-small cell lung cancer (NSCLC) is an example of this. Molecular testing of lung adenocarcinoma is now considered standard of care and part of the diagnostic algorithm. This article provides an overview of the workflow of molecular testing in a clinical diagnostic laboratory discussing in particular novel assays that are currently in use for somatic mutation detection in NSCLC focussing on epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK), ROS1 and RET rearrangements. PMID:25870795

Mutalisk: a web-based somatic MUTation AnaLyIS toolKit for genomic, transcriptional and epigenomic signatures.

PubMed

Lee, Jongkeun; Lee, Andy Jinseok; Lee, June-Koo; Park, Jongkeun; Kwon, Youngoh; Park, Seongyeol; Chun, Hyonho; Ju, Young Seok; Hong, Dongwan

2018-05-22

Somatic genome mutations occur due to combinations of various intrinsic/extrinsic mutational processes and DNA repair mechanisms. Different molecular processes frequently generate different signatures of somatic mutations in their own favored contexts. As a result, the regional somatic mutation rate is dependent on the local DNA sequence, the DNA replication/RNA transcription dynamics and epigenomic chromatin organization landscape in the genome. Here, we propose an online computational framework, termed Mutalisk, which correlates somatic mutations with various genomic, transcriptional and epigenomic features in order to understand mutational processes that contribute to the generation of the mutations. This user-friendly tool explores the presence of localized hypermutations (kataegis), dissects the spectrum of mutations into the maximum likelihood combination of known mutational signatures and associates the mutation density with numerous regulatory elements in the genome. As a result, global patterns of somatic mutations in any query sample can be efficiently screened, thus enabling a deeper understanding of various mutagenic factors. This tool will facilitate more effective downstream analyses of cancer genome sequences to elucidate the diversity of mutational processes underlying the development and clonal evolution of cancer cells. Mutalisk is freely available at http://mutalisk.org.

Cryopyrin-associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation

PubMed Central

Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M.; Walts, Avram D.; Hoffmann, Patrycja; Remmers, Elaine F.; Kastner, Daniel L.; Ombrello, Amanda K.

2015-01-01

Objective To identify the cause of disease in an adult patient presenting with recent onset fevers, chills, urticaria, fatigue, and profound myalgia, who was negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. Methods We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient’s whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively-selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. Results We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3%–16.8% in monocytes and 15.2%–18% in granulocytes; Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, buccal cells, and in the patient’s cultured fibroblasts. Conclusion These data document the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively-parallel sequencing in clinical diagnosis. PMID:25988971

Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

PubMed Central

Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

2014-01-01

Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to

Differential analysis between somatic mutation and germline variation profiles reveals cancer-related genes.

PubMed

Przytycki, Pawel F; Singh, Mona

2017-08-25

A major aim of cancer genomics is to pinpoint which somatically mutated genes are involved in tumor initiation and progression. We introduce a new framework for uncovering cancer genes, differential mutation analysis, which compares the mutational profiles of genes across cancer genomes with their natural germline variation across healthy individuals. We present DiffMut, a fast and simple approach for differential mutational analysis, and demonstrate that it is more effective in discovering cancer genes than considerably more sophisticated approaches. We conclude that germline variation across healthy human genomes provides a powerful means for characterizing somatic mutation frequency and identifying cancer driver genes. DiffMut is available at https://github.com/Singh-Lab/Differential-Mutation-Analysis .

Characterization of Somatic Mutations in Air Pollution-Related Lung Cancer.

PubMed

Yu, Xian-Jun; Yang, Min-Jun; Zhou, Bo; Wang, Gui-Zhen; Huang, Yun-Chao; Wu, Li-Chuan; Cheng, Xin; Wen, Zhe-Sheng; Huang, Jin-Yan; Zhang, Yun-Dong; Gao, Xiao-Hong; Li, Gao-Feng; He, Shui-Wang; Gu, Zhao-Hui; Ma, Liang; Pan, Chun-Ming; Wang, Ping; Chen, Hao-Bin; Hong, Zhi-Peng; Wang, Xiao-Lu; Mao, Wen-Jing; Jin, Xiao-Long; Kang, Hui; Chen, Shu-Ting; Zhu, Yong-Qiang; Gu, Wen-Yi; Liu, Zi; Dong, Hui; Tian, Lin-Wei; Chen, Sai-Juan; Cao, Yi; Wang, Sheng-Yue; Zhou, Guang-Biao

2015-06-01

Air pollution has been classified as Group 1 carcinogenic to humans, but the underlying tumorigenesis remains unclear. In Xuanwei City of Yunnan Province, the lung cancer incidence is among the highest in China attributed to severe air pollution generated by combustion of smoky coal, providing a unique opportunity to dissect lung carcinogenesis of air pollution. Here we analyzed the somatic mutations of 164 non-small cell lung cancers (NSCLCs) from Xuanwei and control regions (CR) where smoky coal was not used. Whole genome sequencing revealed a mean of 289 somatic exonic mutations per tumor and the frequent C:G → A:T nucleotide substitutions in Xuanwei NSCLCs. Exome sequencing of 2010 genes showed that Xuanwei and CR NSCLCs had a mean of 68 and 22 mutated genes per tumor, respectively (p < 0.0001). We found 167 genes (including TP53, RYR2, KRAS, CACNA1E) which had significantly higher mutation frequencies in Xuanwei than CR patients, and mutations in most genes in Xuanwei NSCLCs differed from those in CR cases. The mutation rates of 70 genes (e.g., RYR2, MYH3, GPR144, CACNA1E) were associated with patients' lifetime benzo(a)pyrene exposure. This study uncovers the mutation spectrum of air pollution-related lung cancers, and provides evidence for pollution exposure-genomic mutation relationship at a large scale.

Prevalence and Characterization of Somatic Mutations in Chinese Aldosterone-Producing Adenoma Patients

PubMed Central

Wang, Baojun; Li, Xintao; Zhang, Xu; Ma, Xin; Chen, Luyao; Zhang, Yu; Lyu, Xiangjun; Tang, Yuzhe; Huang, Qingbo; Gao, Yu; Fan, Yang; Ouyang, Jinzhi

2015-01-01

Abstract Recently somatic mutations of KCNJ5, ATP1A1, ATP2B3, and CACNA1D have been identified in patients with aldosterone-producing adenoma (APA). The present study sequenced the DNA in the tissues and blood samples from Chinese patients with APA for KCNJ5, ATP1A1, ATP2B3, and CACNA1D gene mutations. Among the 114 patients, 86 (75.4%) were identified with KCNJ5 somatic mutations, including 3 previously reported (G151R, L168R, T158A) and 2 other unreported mutations. One patient presented with both a point mutation (E147) and an insertion mutation, whereas another had a 36-base duplication, G153_G164dup. No mutation of ATP1A1 and ATP2B3 in the known hotspots was identified and only 1 male patient was detected with a novel CACNA1D mutation, V748I. Unlike other studies, male and female patients had similar KCNJ5 mutation rates (76.9% vs 74.2%). Mutation carriers were younger and had lower preoperative potassium level, whereas male (but not female) mutation carriers had higher preoperative plasma aldosterone concentration and preoperative blood pressures. Mutation carriers also had higher LV mass index (LVMI) than nonmutation carriers. After surgery, LVMI improved significantly in the KCNJ5 mutation group but not in the nonmutation group. The mRNA expression of KCNJ5, CYP11B2, and ATP2B3 was higher in the KCNJ5-mutated APA tissues. Functional characterization of the 2 novel KCNJ5 mutations showed that they were associated with decreased proliferation, membrane depolarization, elevated secretion of aldosterone, and increased expression of CYP11B1 and CYP11B2. In conclusion, Chinese APA patients appear to have a high frequency of somatic KCNJ5 mutation. Mutation prevalence rates are similar among men and women and 2 novel mutations are identified. KCNJ5-mutated patients benefit more from surgical resection of APA than nonmutated patients. PMID:25906099

Elevated Levels of Somatic Mutation as a Biomarker of Environmental Effects Contributing to Breast Carcinogenesis

DTIC Science & Technology

2001-07-01

and hepatocellular carcinoma patients have been shown to exhibit elevated somatic mutation frequencies with the GPA assay (Okada et al., 1997...T, Kyogoku A, Yoshimori M (1997) Evidence for increased somatic cell mutations in patients with hepatocellular carcinoma . Carcinogenesis 18: 445-449...significant increase in mutation at the GPA locus has been reported for a population of hepatocellular carcinoma patients (Okada et al., 1997

Human mitochondrial DNA: roles of inherited and somatic mutations

PubMed Central

Schon, Eric A.; DiMauro, Salvatore; Hirano, Michio

2014-01-01

Mutations in the human mitochondrial genome are known to cause an array of diverse disorders, most of which are maternally inherited, and all of which are associated with defects in oxidative energy metabolism. It is now emerging that somatic mutations in mitochondrial DNA (mtDNA) are also linked to other complex traits, including neurodegenerative diseases, ageing and cancer. Here we discuss insights into the roles of mtDNA mutations in a wide variety of diseases, highlighting the interesting genetic characteristics of the mitochondrial genome and challenges in studying its contribution to pathogenesis. PMID:23154810

CSN1 Somatic Mutations in Penile Squamous Cell Carcinoma.

PubMed

Feber, Andrew; Worth, Daniel C; Chakravarthy, Ankur; de Winter, Patricia; Shah, Kunal; Arya, Manit; Saqib, Muhammad; Nigam, Raj; Malone, Peter R; Tan, Wei Shen; Rodney, Simon; Freeman, Alex; Jameson, Charles; Wilson, Gareth A; Powles, Tom; Beck, Stephan; Fenton, Tim; Sharp, Tyson V; Muneer, Asif; Kelly, John D

2016-08-15

Other than an association with HPV infection, little is known about the genetic alterations determining the development of penile cancer. Although penile cancer is rare in the developed world, it presents a significant burden in developing countries. Here, we report the findings of whole-exome sequencing (WES) to determine the somatic mutational landscape of penile cancer. WES was performed on penile cancer and matched germline DNA from 27 patients undergoing surgical resection. Targeted resequencing of candidate genes was performed in an independent 70 patient cohort. Mutation data were also integrated with DNA methylation and copy-number information from the same patients. We identified an HPV-associated APOBEC mutation signature and an NpCpG signature in HPV-negative disease. We also identified recurrent mutations in the novel penile cancer tumor suppressor genes CSN1(GPS1) and FAT1 Expression of CSN1 mutants in cells resulted in colocalization with AGO2 in cytoplasmic P-bodies, ultimately leading to the loss of miRNA-mediated gene silencing, which may contribute to disease etiology. Our findings represent the first comprehensive analysis of somatic alterations in penile cancer, highlighting the complex landscape of alterations in this malignancy. Cancer Res; 76(16); 4720-7. ©2016 AACR. ©2016 American Association for Cancer Research.

Variation of mutational burden in healthy human tissues suggests non-random strand segregation and allows measuring somatic mutation rates.

PubMed

Werner, Benjamin; Sottoriva, Andrea

2018-06-01

The immortal strand hypothesis poses that stem cells could produce differentiated progeny while conserving the original template strand, thus avoiding accumulating somatic mutations. However, quantitating the extent of non-random DNA strand segregation in human stem cells remains difficult in vivo. Here we show that the change of the mean and variance of the mutational burden with age in healthy human tissues allows estimating strand segregation probabilities and somatic mutation rates. We analysed deep sequencing data from healthy human colon, small intestine, liver, skin and brain. We found highly effective non-random DNA strand segregation in all adult tissues (mean strand segregation probability: 0.98, standard error bounds (0.97,0.99)). In contrast, non-random strand segregation efficiency is reduced to 0.87 (0.78,0.88) in neural tissue during early development, suggesting stem cell pool expansions due to symmetric self-renewal. Healthy somatic mutation rates differed across tissue types, ranging from 3.5 × 10-9/bp/division in small intestine to 1.6 × 10-7/bp/division in skin.

Germline mutations and somatic inactivation of TRIM28 in Wilms tumour

PubMed Central

Halliday, Benjamin J.; Markie, David M.; Grundy, Richard G.; Ludgate, Jackie L.; Black, Michael A.; Weeks, Robert J.; Catchpoole, Daniel R.; Reeve, Anthony E.

2018-01-01

Wilms tumour is a childhood tumour that arises as a consequence of somatic and rare germline mutations, the characterisation of which has refined our understanding of nephrogenesis and carcinogenesis. Here we report that germline loss of function mutations in TRIM28 predispose children to Wilms tumour. Loss of function of this transcriptional co-repressor, which has a role in nephrogenesis, has not previously been associated with cancer. Inactivation of TRIM28, either germline or somatic, occurred through inactivating mutations, loss of heterozygosity or epigenetic silencing. TRIM28-mutated tumours had a monomorphic epithelial histology that is uncommon for Wilms tumour. Critically, these tumours were negative for TRIM28 immunohistochemical staining whereas the epithelial component in normal tissue and other Wilms tumours stained positively. These data, together with a characteristic gene expression profile, suggest that inactivation of TRIM28 provides the molecular basis for defining a previously described subtype of Wilms tumour, that has early age of onset and excellent prognosis. PMID:29912901

Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

DOE PAGES

Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz; ...

2017-03-22

Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

Somatic mutations reveal asymmetric cellular dynamics in the early human embryo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ju, Young Seok; Martincorena, Inigo; Gerstung, Moritz

Somatic cells acquire mutations throughout the course of an individual’s life. Mutations occurring early in embryogenesis are often present in a substantial proportion of, but not all, cells in postnatal humans and thus have particular characteristics and effects. Depending on their location in the genome and the proportion of cells they are present in, these mosaic mutations can cause a wide range of genetic disease syndromes and predispose carriers to cancer. They have a high chance of being transmitted to offspring as de novo germline mutations and, in principle, can provide insights into early human embryonic cell lineages and theirmore » contributions to adult tissues. Although it is known that gross chromosomal abnormalities are remarkably common in early human embryos, our understanding of early embryonic somatic mutations is very limited. Here we use whole-genome sequences of normal blood from 241 adults to identify 163 early embryonic mutations. We estimate that approximately three base substitution mutations occur per cell per cell-doubling event in early human embryogenesis and these are mainly attributable to two known mutational signatures. We used the mutations to reconstruct developmental lineages of adult cells and demonstrate that the two daughter cells of many early embryonic cell-doubling events contribute asymmetrically to adult blood at an approximately 2:1 ratio. As a result, this study therefore provides insights into the mutation rates, mutational processes and developmental outcomes of cell dynamics that operate during early human embryogenesis.« less

Somatic GNAQ Mutation is Enriched in Brain Endothelial Cells in Sturge-Weber Syndrome.

PubMed

Huang, Lan; Couto, Javier A; Pinto, Anna; Alexandrescu, Sanda; Madsen, Joseph R; Greene, Arin K; Sahin, Mustafa; Bischoff, Joyce

2017-02-01

Sturge-Weber syndrome (SWS) is a rare congenital neurocutaneous disorder characterized by facial and extracraniofacial capillary malformations and capillary-venule malformations in the leptomeninges. A somatic mosaic mutation in GNAQ (c.548G>A; p.R183Q) was found in SWS brain and skin capillary malformations. Our laboratory showed endothelial cells in skin capillary malformations are enriched for the GNAQ mutation. The purpose of this study is to determine whether the GNAQ mutation is also enriched in endothelial cells in affected SWS brain. Two human SWS brain specimens were fractionated by fluorescence-activated cell sorting into hematopoietic (CD45), endothelial (CD31, VE-Cadherin, and vascular endothelial growth factor receptor 2), and perivascular (platelet-derived growth factor receptor beta) cells and cells negative for all markers. The sorted cell populations were analyzed for GNAQ p.R183Q mutation by droplet digital polymerase chain reaction. SWS patient-derived brain endothelial cells were selected by anti-CD31-coated magnetic beads and cultured in endothelial growth medium in vitro. The GNAQ p.R183Q mutation was present in brain endothelial cells in two SWS specimens, with mutant allelic frequencies of 34.7% and 24.0%. Cells negative for all markers also harbored the GNAQ mutation. The mutant allelic frequencies in these unidentified cells were 9.2% and 8.4%. SWS patient-derived brain endothelial cells with mutant allelic frequencies of 14.7% and 21% survived and proliferated in vitro. Our study provides evidence that GNAQ p.R183Q mutation is enriched in endothelial cells in SWS brain lesions and thereby reveals endothelial cells as a source of aberrant Gαq signaling. This will help to understand the pathophysiology of SWS, to discover biomarkers for predicting cerebral involvement, and to develop therapeutic targets to prevent neurological impairments in SWS. Copyright © 2016 Elsevier Inc. All rights reserved.

Somatic mutations of amino acid metabolism-related genes in gastric and colorectal cancers and their regional heterogeneity--a short report.

PubMed

Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung

2014-12-01

Metabolic reprogramming is an emerging topic in cancer research. However, genetic alterations in genes encoding enzymes involved in amino acid metabolism are largely unknown. The aim of this study was to explore whether genes known to be involved in amino acid metabolism are mutated in gastric cancer (GC) and/or colorectal cancer (CRC). Through a public database search, we found that a number of genes known to be involved in amino acid metabolism, i.e., AGXT, ALDH2, APIP, MTR, DNMT1, ASH1L, ASPA, CAD, DDC, GCDH, DLD, LAP3, MCEE and MUT, harbor mononucleotide repeats that may serve as mutation targets in cancers exhibiting microsatellite instability (MSI). We assessed these genes for the presence of the mutations in 79 GCs and 124 CRCs using single-strand conformation polymorphism (SSCP) and direct sequencing analyses. Using SSCP in conjunction with DNA sequencing we detected frameshift mutations in AGXT (17 cases), ALDH2 (3 cases), APIP (4 cases), MTR (5 cases), DNMT1 (1 case), ASH1L (1 case), ASPA (2 cases), CAD (2 cases), DDC (1 case), GCDH (3 cases), DLD (1 case), LAP3 (1 case), MCEE (5 cases) and MUT (1 case). These mutations were exclusively detected in MSI-high (MSI-H), and not in MSI-low or MSI-stable (MSI-L/MSS) cases. In addition, we analyzed 16 CRCs for the presence of intra-tumor heterogeneity (ITH) and found that two CRCs harbored regional ITH for GCDH frameshift mutations. Our data indicate that genes known to be involved in amino acid metabolism recurrently acquire somatic mutations in MSH-H GCs and MSH-H CRCs and that, in addition, mutation ITH does occur in at least some of these tumors. Together, these data suggest that metabolic reprogramming may play a role in the etiology of MSI-H GCs and CRCs. Our data also suggest that ultra-regional mutation analysis is required for a more comprehensive evaluation of the mutation status in these tumors.

Proteogenomics connects somatic mutations to signalling in breast cancer.

PubMed

Mertins, Philipp; Mani, D R; Ruggles, Kelly V; Gillette, Michael A; Clauser, Karl R; Wang, Pei; Wang, Xianlong; Qiao, Jana W; Cao, Song; Petralia, Francesca; Kawaler, Emily; Mundt, Filip; Krug, Karsten; Tu, Zhidong; Lei, Jonathan T; Gatza, Michael L; Wilkerson, Matthew; Perou, Charles M; Yellapantula, Venkata; Huang, Kuan-lin; Lin, Chenwei; McLellan, Michael D; Yan, Ping; Davies, Sherri R; Townsend, R Reid; Skates, Steven J; Wang, Jing; Zhang, Bing; Kinsinger, Christopher R; Mesri, Mehdi; Rodriguez, Henry; Ding, Li; Paulovich, Amanda G; Fenyö, David; Ellis, Matthew J; Carr, Steven A

2016-06-02

Somatic mutations have been extensively characterized in breast cancer, but the effects of these genetic alterations on the proteomic landscape remain poorly understood. Here we describe quantitative mass-spectrometry-based proteomic and phosphoproteomic analyses of 105 genomically annotated breast cancers, of which 77 provided high-quality data. Integrated analyses provided insights into the somatic cancer genome including the consequences of chromosomal loss, such as the 5q deletion characteristic of basal-like breast cancer. Interrogation of the 5q trans-effects against the Library of Integrated Network-based Cellular Signatures, connected loss of CETN3 and SKP1 to elevated expression of epidermal growth factor receptor (EGFR), and SKP1 loss also to increased SRC tyrosine kinase. Global proteomic data confirmed a stromal-enriched group of proteins in addition to basal and luminal clusters, and pathway analysis of the phosphoproteome identified a G-protein-coupled receptor cluster that was not readily identified at the mRNA level. In addition to ERBB2, other amplicon-associated highly phosphorylated kinases were identified, including CDK12, PAK1, PTK2, RIPK2 and TLK2. We demonstrate that proteogenomic analysis of breast cancer elucidates the functional consequences of somatic mutations, narrows candidate nominations for driver genes within large deletions and amplified regions, and identifies therapeutic targets.

Brief Report: Cryopyrin-Associated Periodic Syndrome Caused by a Myeloid-Restricted Somatic NLRP3 Mutation.

PubMed

Zhou, Qing; Aksentijevich, Ivona; Wood, Geryl M; Walts, Avram D; Hoffmann, Patrycja; Remmers, Elaine F; Kastner, Daniel L; Ombrello, Amanda K

2015-09-01

To identify the cause of disease in an adult patient presenting with recent-onset fevers, chills, urticaria, fatigue, and profound myalgia, who was found to be negative for cryopyrin-associated periodic syndrome (CAPS) NLRP3 mutations by conventional Sanger DNA sequencing. We performed whole-exome sequencing and targeted deep sequencing using DNA from the patient's whole blood to identify a possible NLRP3 somatic mutation. We then screened for this mutation in subcloned NLRP3 amplicons from fibroblasts, buccal cells, granulocytes, negatively selected monocytes, and T and B lymphocytes and further confirmed the somatic mutation by targeted sequencing of exon 3. We identified a previously reported CAPS-associated mutation, p.Tyr570Cys, with a mutant allele frequency of 15% based on exome data. Targeted sequencing and subcloning of NLRP3 amplicons confirmed the presence of the somatic mutation in whole blood at a ratio similar to the exome data. The mutant allele frequency was in the range of 13.3-16.8% in monocytes and 15.2-18% in granulocytes. Notably, this mutation was either absent or present at a very low frequency in B and T lymphocytes, in buccal cells, and in the patient's cultured fibroblasts. Our findings indicate the possibility of myeloid-restricted somatic mosaicism in the pathogenesis of CAPS, underscoring the emerging role of massively parallel sequencing in clinical diagnosis. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

Paternal Somatic Mosaicism of a Novel Frameshift Mutation in ELANE Causing Severe Congenital Neutropenia.

PubMed

Kim, Hee-Jung; Song, Min-Jung; Lee, Ki-O; Kim, Sun-Hee; Kim, Hee-Jin

2015-12-01

Severe congenital neutropenia (SCN) is a bone marrow failure disease with an autosomal dominant inheritance from mutations in ELANE. Here, we report a 7-week-old Korean male with SCN. His elder sister died from pneumonia at 2 years. Direct sequencing of ELANE in the proband identified a heterozygous novel frameshift mutation: c.658delC (p.Arg220Glyfs20*). Family study involving his asymptomatic parents with normal cell counts revealed that his father had the same mutation, but at a lower burden than expected in a typical heterozygous state. Further molecular investigation demonstrated somatic mosaicism with ~18% mutant alleles. We concluded the proband inherited the mutation from his somatic mosaic father. © 2015 Wiley Periodicals, Inc.

Somatic mutations of the histone H3K27 demethylase, UTX, in human cancer

PubMed Central

van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O’Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Dunmore, Rebecca; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Lee, Mulderrig; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J.; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

2010-01-01

Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase, UTX, pointing to histone H3 lysine methylation deregulation in multiple tumour types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene. PMID:19330029

Oncogenetic tree model of somatic mutations and DNA methylation in colon tumors.

PubMed

Sweeney, Carol; Boucher, Kenneth M; Samowitz, Wade S; Wolff, Roger K; Albertsen, Hans; Curtin, Karen; Caan, Bette J; Slattery, Martha L

2009-01-01

Our understanding of somatic alterations in colon cancer has evolved from a concept of a series of events taking place in a single sequence to a recognition of multiple pathways. An oncogenetic tree is a model intended to describe the pathways and sequence of somatic alterations in carcinogenesis without assuming that tumors will fall in mutually exclusive categories. We applied this model to data on colon tumor somatic alterations. An oncogenetic tree model was built using data on mutations of TP53, KRAS2, APC, and BRAF genes, methylation at CpG sites of MLH1 and TP16 genes, methylation in tumor (MINT) markers, and microsatellite instability (MSI) for 971 colon tumors from a population-based series. Oncogenetic tree analysis resulted in a reproducible tree with three branches. The model represents methylation of MINT markers as initiating a branch and predisposing to MSI, methylation of MHL1 and TP16, and BRAF mutation. APC mutation is the first alteration in an independent branch and is followed by TP53 mutation. KRAS2 mutation was placed a third independent branch, implying that it neither depends on, nor predisposes to, the other alterations. Individual tumors were observed to have alteration patterns representing every combination of one, two, or all three branches. The oncogenetic tree model assumptions are appropriate for the observed heterogeneity of colon tumors, and the model produces a useful visual schematic of the sequence of events in pathways of colon carcinogenesis.

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

PubMed

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

Oncogenic PIK3CA mutations occur in epidermal nevi and seborrheic keratoses with a characteristic mutation pattern

PubMed Central

Hafner, Christian; López-Knowles, Elena; Luis, Nuno M.; Toll, Agustí; Baselga, Eulàlia; Fernández-Casado, Alex; Hernández, Silvia; Ribé, Adriana; Mentzel, Thomas; Stoehr, Robert; Hofstaedter, Ferdinand; Landthaler, Michael; Vogt, Thomas; Pujol, Ramòn M.; Hartmann, Arndt; Real, Francisco X.

2007-01-01

Activating mutations of the p110 α subunit of PI3K (PIK3CA) oncogene have been identified in a broad spectrum of malignant tumors. However, their role in benign or preneoplastic conditions is unknown. Activating FGF receptor 3 (FGFR3) mutations are common in benign skin lesions, either as embryonic mutations in epidermal nevi (EN) or as somatic mutations in seborrheic keratoses (SK). FGFR3 mutations are also common in low-grade malignant bladder tumors, where they often occur in association with PIK3CA mutations. Therefore, we examined exons 9 and 20 of PIK3CA and FGFR3 hotspot mutations in EN (n = 33) and SK (n = 62), two proliferative skin lesions lacking malignant potential. Nine of 33 (27%) EN harbored PIK3CA mutations; all cases showed the E545G substitution, which is uncommon in cancers. In EN, R248C was the only FGFR3 mutation identified. By contrast, 10 of 62 (16%) SK revealed the typical cancer-associated PIK3CA mutations E542K, E545K, and H1047R. The same lesions displayed a wide range of FGFR3 mutations. Corresponding unaffected tissue was available for four EN and two mutant SK: all control samples displayed a WT sequence, confirming the somatic nature of the mutations found in lesional tissue. Forty of 95 (42%) lesions showed at least one mutation in either gene. PIK3CA and FGFR3 mutations displayed an independent distribution; 5/95 lesions harbored mutations in both genes. Our findings suggest that, in addition to their role in cancer, oncogenic PIK3CA mutations contribute to the pathogenesis of skin tumors lacking malignant potential. The remarkable genotype–phenotype correlation as observed in this study points to a distinct etiopathogenesis of the mutations in keratinocytes occuring either during fetal development or in adult life. PMID:17673550

Impact of Somatic Mutations in the D-Loop of Mitochondrial DNA on the Survival of Oral Squamous Cell Carcinoma Patients

PubMed Central

Lin, Jin-Ching; Wang, Chen-Chi; Jiang, Rong-San; Wang, Wen-Yi; Liu, Shih-An

2015-01-01

Objectives The aim of this study was to investigate somatic mutations in the D-loop of mitochondrial DNA (mtDNA) and their impact on survival in oral squamous cell carcinoma patients. Materials and Methods Surgical specimen confirmed by pathological examination and corresponding non-cancerous tissues were collected from 120 oral squamous cell carcinoma patients. The sequence in the D-loop of mtDNA from non-cancerous tissues was compared with that from paired cancer samples and any sequence differences were recognized as somatic mutations. Results Somatic mutations in the D-loop of mtDNA were identified in 75 (62.5%) oral squamous cell carcinoma patients and most of them occurred in the poly-C tract. Although there were no significant differences in demographic and tumor-related features between participants with and without somatic mutation, the mutation group had a better survival rate (5 year disease-specific survival rate: 64.0% vs. 43.0%, P = 0.0266). Conclusion Somatic mutation in D-loop of mtDNA was associated with a better survival in oral squamous cell carcinoma patients. PMID:25906372

Somatic mutations of the histone H3K27 demethylase gene UTX in human cancer.

PubMed

van Haaften, Gijs; Dalgliesh, Gillian L; Davies, Helen; Chen, Lina; Bignell, Graham; Greenman, Chris; Edkins, Sarah; Hardy, Claire; O'Meara, Sarah; Teague, Jon; Butler, Adam; Hinton, Jonathan; Latimer, Calli; Andrews, Jenny; Barthorpe, Syd; Beare, Dave; Buck, Gemma; Campbell, Peter J; Cole, Jennifer; Forbes, Simon; Jia, Mingming; Jones, David; Kok, Chai Yin; Leroy, Catherine; Lin, Meng-Lay; McBride, David J; Maddison, Mark; Maquire, Simon; McLay, Kirsten; Menzies, Andrew; Mironenko, Tatiana; Mulderrig, Lee; Mudie, Laura; Pleasance, Erin; Shepherd, Rebecca; Smith, Raffaella; Stebbings, Lucy; Stephens, Philip; Tang, Gurpreet; Tarpey, Patrick S; Turner, Rachel; Turrell, Kelly; Varian, Jennifer; West, Sofie; Widaa, Sara; Wray, Paul; Collins, V Peter; Ichimura, Koichi; Law, Simon; Wong, John; Yuen, Siu Tsan; Leung, Suet Yi; Tonon, Giovanni; DePinho, Ronald A; Tai, Yu-Tzu; Anderson, Kenneth C; Kahnoski, Richard J; Massie, Aaron; Khoo, Sok Kean; Teh, Bin Tean; Stratton, Michael R; Futreal, P Andrew

2009-05-01

Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

Polycythemia and paraganglioma with a novel somatic HIF2A mutation in a male.

PubMed

Toyoda, Hidemi; Hirayama, Jyunya; Sugimoto, Yuka; Uchida, Keiichi; Ohishi, Kohshi; Hirayama, Masahiro; Komada, Yoshihiro

2014-06-01

Recently, a new syndrome of paraganglioma, somatostatinoma, and polycythemia has been discovered (known as Pacak-Zhuang syndrome). This new syndrome, with somatic HIF2A gain-of-function mutations, has never been reported in male patients. We describe a male patient with Pacak-Zhuang syndrome who carries a newly discovered HIF2A mutation. Congenital polycythemias have diverse etiologies, including germline mutations in the oxygen-sensing pathway. These include von Hippel-Lindau (Chuvash polycythemia), prolyl hydroxylase domain-containing protein-2, and hypoxia-inducible factor-2α (HIF-2α). Somatic gain-of-function mutations in the gene encoding HIF-2α were reported in patients with paraganglioma and polycythemia and have been found exclusively in female patients. Through sequencing of the HIF2A using DNA from paraganglioma in 15-year-old male patient, we identified a novel mutation of HIF2A: a heterozygous C to A substitution at base 1589 in exon 12 of HIF2A. The mutation was not found in germline DNA from leukocytes. The C1589A mutations resulted in substitution of alanine 530 in the HIF-2α protein with glutamic acid. This mutation is undoubtedly associated with increased HIF-2α activity and increased protein half-life, because it affects the vicinity of the prolyl hydroxylase target residue, proline 531. To our knowledge, this is the first report describing Pacak-Zhuang syndrome with somatic gain-of-function mutation in HIF2A in a male patient. Congenital polycythemia of unknown origin should raise suspicion for the novel disorder Pacak-Zhuang syndrome, even in male patients. Copyright © 2014 by the American Academy of Pediatrics.

Transcriptional Noise and Somatic Mutations in the Aging Pancreas.

PubMed

Swisa, Avital; Kaestner, Klaus H; Dor, Yuval

2017-12-05

The underlying mechanisms and functional significance of pancreatic β cell heterogeneity are an intensive area of investigation. In a recent Cell paper, Enge and colleagues (2017) performed single-cell RNA sequencing of human pancreatic cells and concluded that with age, pancreatic cells become transcriptionally noisy and accumulate somatic mutations. Copyright © 2017. Published by Elsevier Inc.

A MELAS syndrome family harboring two mutations in mitochondrial genome.

PubMed

Choi, Byung-Ok; Hwang, Jung Hee; Kim, Joonki; Cho, Eun Min; Cho, Sun Young; Hwang, Su Jin; Lee, Hyang Woon; Kim, Song Ja; Chung, Ki Wha

2008-06-30

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a genetically heterogeneous mitochondrial disorder with variable clinical symptoms. Here, from the sequencing of the entire mitochondrial genome, we report a Korean MELAS family harboring two homoplasmic missense mutations, which were reported 9957T>C (Phe251Leu) transition mutation in the cytochrome c oxidase subunit 3 (COX3) gene and a novel 13849A>C (Asn505His) transversion mutation in the NADH dehydrogenase subunit 5 (ND5) gene. Neither of these mutations was found in 205 normal controls. Both mutations were identified from the proband and his mother, but not his father. The patients showed cataract symptom in addition to MELAS phenotype. We believe that the 9957T>C mutation is pathogenic, however, the 13849A>C mutation is of unclear significance. It is likely that the 13849A>C mutation might function as the secondary mutation which increase the expressivity of overlapping phenotypes of MELAS and cataract. This study also demonstrates the importance of full sequencing of mtDNA for the molecular genetic understanding of mitochondrial disorders.

A comprehensive analysis of clinical outcomes in lung cancer patients harboring a MET exon 14 skipping mutation compared to other driver mutations in an East Asian population.

PubMed

Gow, Chien-Hung; Hsieh, Min-Shu; Wu, Shang-Gin; Shih, Jin-Yuan

2017-01-01

Recurrent somatic splice-site alterations at MET exon 14 (MET Δ14 ), which result in exon skipping and MET proto-oncogene, receptor tyrosine kinase (MET) activation, have been characterised. However, their demographic features and clinical outcomes in East Asian lung cancer patients have yet to be determined. A one-step reverse transcription-polymerase chain reaction (RT-PCR), using RNA samples from 850 East Asian lung cancer patients, was performed in order to detect MET Δ14 and five other major driver mutations, including those in the EGFR, KRAS, ALK, HER2, and ROS1 genes. Immunohistochemistry (IHC) was used to confirm the overexpression of MET in patients harbouring the MET Δ14 mutation. We analysed the demographic data and clinical outcomes of MET Δ14 mutation positive lung cancer patients and compared them to those of MET Δ14 mutation negative lung cancer patients. In total, 27 lung adenocarcinoma (ADC) patients and 1 squamous cell carcinoma patient with the MET Δ14 mutation were identified. The overall incidence was 3.3% for lung cancer and 4.0% for lung ADC. IHC demonstrated that the majority of lung cancer patients harboring a MET Δ14 mutation exhibited a strong cytoplasmic expression of MET. MET Δ14 mutation positive patients were generally quite elderly individuals. Stage IV MET Δ14 mutation positive lung cancer patients receiving no specific anti-MET therapy were observed to have a similar overall survival (OS) compared to patients in the all negative group (P>0.05). In the multivariate analysis, mutation status was found not to be a major risk factor for OS in lung cancer patients without appropriate tyrosine kinase inhibitors treatment. The OS of MET Δ14 mutation positive lung cancer patients is comparable to that of the major driver gene mutation negative lung cancer patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Novel homozygous FANCL mutation and somatic heterozygous SETBP1 mutation in a Chinese girl with Fanconi Anemia.

PubMed

Wu, Weiqing; Liu, Yang; Zhou, Qinghua; Wang, Qin; Luo, Fuwei; Xu, Zhiyong; Geng, Qian; Li, Peining; Zhang, Hui Z; Xie, Jiansheng

2017-07-01

Fanconi Anemia (FA) is a rare genetically heterogeneous disorder with 17 known complement groups caused by mutations in different genes. FA complementation group L (FA-L, OMIM #608111) occurred in 0.2% of all FA and only eight mutant variants in the FANCL gene were documented. Phenotype and genotype correlation in FANCL associated FA is still obscure. Here we describe a Chinese girl with FA-L caused by a novel homozygous mutation c.822_823insCTTTCAGG (p.Asp275LeufsX13) in the FANCL gene. The patient's clinical course was typical for FA with progression to bone marrow failure, and death from acute myelomonocytic leukemia (AML-M4) at 9 years of age. Mutation analysis also detected a likely somatic c.2608G > A (p.Gly870Ser) in the SETBP1 gene. Consistent copy number losses of 7q and 18p and gains of 3q and 21q and accumulated non-clonal single cell chromosomal abnormalities were detected in blood leukocytes as her FA progressed. This is the first Chinese FA-L case caused by a novel FANCL mutation. The somatic gene mutation and copy number aberrations could be used to monitor disease progression and the clinical findings provide further information for genotype-phenotype correlation for FA-L. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

The prevalence of CTNNB1 mutations in primary aldosteronism and consequences for clinical outcomes.

PubMed

Wu, Vin-Cent; Wang, Shuo-Meng; Chueh, Shih-Chieh Jeff; Yang, Shao-Yu; Huang, Kuo-How; Lin, Yen-Hung; Wang, Jian-Jhong; Connolly, Rory; Hu, Ya-Hui; Gomez-Sanchez, Celso E; Peng, Kang-Yung; Wu, Kwan-Dun

2017-01-19

Constitutive activation of the Wnt pathway/β-catenin signaling may be important in aldosterone-producing adenoma (APA). However, significant gaps remain in our understanding of the prevalence and clinical outcomes after adrenalectomy in APA patients harboring CTNNB1 mutations. The molecular expression of CYP11B2 and gonadal receptors in adenomas were also explored. Adenomas from 219 APA patients (95 men; 44.2%; aged 50.5 ± 11.9 years) showed a high rate of somatic mutations (n = 128, 58.4%). The majority of them harbored KCNJ5 mutations (n = 116, 52.9%); 8 patients (3.7%, 6 women) had CTNNB1 mutations. Patients with APAs harboring CTNNB1 mutations were older and had shorter duration of hypertension. After adrenalectomy, CTNNB1 mutation carriers had a higher possibility (87.5%) of residual hypertension than other APA patients. APAs harboring CTNNB1 mutations have heterogeneous staining of β-catenin and variable expression of gonadal receptors and both CYP11B1 and CYP11B2. This suggests that CTNNB1 mutations may be more related to tumorigenesis rather than excessive aldosterone production.

Somatic mutations in cancer: Stochastic versus predictable.

PubMed

Gold, Barry

2017-02-01

The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

A novel somatic JAK2 kinase-domain mutation in pediatric acute lymphoblastic leukemia with rapid on-treatment development of LOH.

PubMed

Sadras, Teresa; Heatley, Susan L; Kok, Chung H; McClure, Barbara J; Yeung, David; Hughes, Timothy P; Sutton, Rosemary; Ziegler, David S; White, Deborah L

2017-10-01

We report a novel somatic mutation in the kinase domain of JAK2 (R938Q) in a high-risk pediatric case of B-cell acute lymphoblastic leukemia (ALL). The patient developed on-therapy relapse at 12 months, and interestingly, the JAK2 locus acquired loss of heterozygosity during treatment resulting in 100% mutation load. Furthermore, we show that primary ALL mononuclear cells harboring the JAK2 R938Q mutation display reduced sensitivity to the JAK1/2 ATP-competitive inhibitor ruxolitinib in vitro, compared to ALL cells that carry a more common JAK2 pseudokinase domain mutation. Our findings are in line with previous reports that demonstrate that mutations within the kinase domain of JAK2 are associated with resistance to type I JAK inhibitors. Importantly, given the recent inclusion of ruxolitinib in trial protocols for children with JAK pathway alterations, we predict that inter-patient genetic variability may result in suboptimal responses to JAK inhibitor therapy in a subset of cases. The need for alternate targeted and/or combination therapies for patients who display inherent or developed resistance to JAK inhibitor therapy will be warranted, and we propose that kinase-mutants less sensitive to type I JAK inhibitors may present a currently unexplored platform for investigation of improved therapies. Copyright © 2017. Published by Elsevier Inc.

Correlation of RET somatic mutations with clinicopathological features in sporadic medullary thyroid carcinomas

PubMed Central

Moura, M M; Cavaco, B M; Pinto, A E; Domingues, R; Santos, J R; Cid, M O; Bugalho, M J; Leite, V

2009-01-01

Screening of REarranged during Transfection (RET) gene mutations has been carried out in different series of sporadic medullary thyroid carcinomas (MTC). RET-positive tumours seem to be associated to a worse clinical outcome. However, the correlation between the type of RET mutation and the patients' clinicopathological data has not been evaluated yet. We analysed RET exons 5, 8, 10–16 in fifty-one sporadic MTC, and found somatic mutations in thirty-three (64.7%) tumours. Among the RET-positive cases, exon 16 was the most frequently affected (60.6%). Two novel somatic mutations (Cys630Gly, c.1881del18) were identified. MTC patients were divided into three groups: group 1, with mutations in RET exons 15 and 16; group 2, with other RET mutations; group 3, having no RET mutations. Group 1 had higher prevalence (P=0.0051) and number of lymph node metastases (P=0.0017), and presented more often multifocal tumours (P=0.037) and persistent disease at last control (P=0.0242) than group 2. Detectable serum calcitonin levels at last screening (P=0.0119) and stage IV disease (P=0.0145) were more frequent in group 1, than in the other groups. Our results suggest that, among the sporadic MTC, cases with RET mutations in exons 15 and 16 are associated with the worst prognosis. Cases with other RET mutations have the most indolent course, and those with no RET mutations have an intermediate risk. PMID:19401695

Monitoring exposure to atomic bomb radiation by somatic mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akiyama, Mitoshi; Kyoizumi, Seishi; Kusunoki, Yoichiro

Atomic bomb survivors are a population suitable for studying the relationship between somatic mutation and cancer risk because their exposure doses are relatively well known and their dose responses in terms of cancer risk have also been thoroughly studied. An analysis has been made of erythrocyte glycophorin A (GPA) gene mutations in 1,226 atomic bomb survivors in Hiroshima and Nagasaki. The GPA mutation frequency (Mf) increased slightly but significantly with age at the time of measurement and with the number of cigarettes smoked. After adjustment for the effect of smoking, the Mf was significantly higher in males than in femalesmore » and higher in Hiroshima than in Nagasaki. All of these characteristics of the background GPA Mf were in accord with those of solid tumor incidence obtained from an earlier epidemiological study of A-bomb survivors. Analysis of the dose effect on Mf revealed the doubling dose to be about 1.20 Sv and the minimum dose for detection of a significant increase to be about 0.24 Sv. No significant dose effect for difference in sex, city, or age at the time of bombing was observed. Interestingly, the doubling dose for the GPA Mf approximated that for solid cancer incidence (1.59 Sv). And the minimum dose for detection was not inconsistent with the data for solid cancer incidence. The dose effect was significantly higher in those diagnosed with cancer before or after measurement than in those without a history of cancer. These findings are consistent with the hypothesis that somatic mutations are the main cause of excess cancer risk from radiation exposure. 27 refs., 2 figs.« less

A MELAS syndrome family harboring two mutations in mitochondrial genome

PubMed Central

Choi, Byung-Ok; Hwang, Jung Hee; Kim, Joonki; Cho, Eun Min; Cho, Sun Young; Hwang, Su Jin; Lee, Hyang Woon; Kim, Song Ja

2008-01-01

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a genetically heterogeneous mitochondrial disorder with variable clinical symptoms. Here, from the sequencing of the entire mitochondrial genome, we report a Korean MELAS family harboring two homoplasmic missense mutations, which were reported 9957T > C (Phe251Leu) transition mutation in the cytochrome c oxidase subunit 3 (COX3) gene and a novel 13849A > C (Asn505His) transversion mutation in the NADH dehydrogenase subunit 5 (ND5) gene. Neither of these mutations was found in 205 normal controls. Both mutations were identified from the proband and his mother, but not his father. The patients showed cataract symptom in addition to MELAS phenotype. We believe that the 9957T > C mutation is pathogenic, however, the 13849A > C mutation is of unclear significance. It is likely that the 13849A > C mutation might function as the secondary mutation which increase the expressivity of overlapping phenotypes of MELAS and cataract. This study also demonstrates the importance of full sequencing of mtDNA for the molecular genetic understanding of mitochondrial disorders. PMID:18587274

Distinct cellular pathways select germline-encoded and somatically mutated antibodies into immunological memory

PubMed Central

Kaji, Tomohiro; Ishige, Akiko; Hikida, Masaki; Taka, Junko; Hijikata, Atsushi; Kubo, Masato; Nagashima, Takeshi; Takahashi, Yoshimasa; Kurosaki, Tomohiro; Okada, Mariko; Ohara, Osamu

2012-01-01

One component of memory in the antibody system is long-lived memory B cells selected for the expression of somatically mutated, high-affinity antibodies in the T cell–dependent germinal center (GC) reaction. A puzzling observation has been that the memory B cell compartment also contains cells expressing unmutated, low-affinity antibodies. Using conditional Bcl6 ablation, we demonstrate that these cells are generated through proliferative expansion early after immunization in a T cell–dependent but GC-independent manner. They soon become resting and long-lived and display a novel distinct gene expression signature which distinguishes memory B cells from other classes of B cells. GC-independent memory B cells are later joined by somatically mutated GC descendants at roughly equal proportions and these two types of memory cells efficiently generate adoptive secondary antibody responses. Deletion of T follicular helper (Tfh) cells significantly reduces the generation of mutated, but not unmutated, memory cells early on in the response. Thus, B cell memory is generated along two fundamentally distinct cellular differentiation pathways. One pathway is dedicated to the generation of high-affinity somatic antibody mutants, whereas the other preserves germ line antibody specificities and may prepare the organism for rapid responses to antigenic variants of the invading pathogen. PMID:23027924

Sun exposure causes somatic second-hit mutations and angiofibroma development in tuberous sclerosis complex

PubMed Central

Tyburczy, Magdalena E.; Wang, Ji-an; Li, Shaowei; Thangapazham, Rajesh; Chekaluk, Yvonne; Moss, Joel; Kwiatkowski, David J.; Darling, Thomas N.

2014-01-01

Tuberous sclerosis complex (TSC) is characterized by the formation of tumors in multiple organs and is caused by germline mutation in one of two tumor suppressor genes, TSC1 and TSC2. As for other tumor suppressor gene syndromes, the mechanism of somatic second-hit events in TSC tumors is unknown. We grew fibroblast-like cells from 29 TSC skin tumors from 22 TSC subjects and identified germline and second-hit mutations in TSC1/TSC2 using next-generation sequencing. Eighteen of 22 (82%) subjects had a mutation identified, and 8 of the 18 (44%) subjects were mosaic with mutant allele frequencies of 0 to 19% in normal tissue DNA. Multiple tumors were available from four patients, and in each case, second-hit mutations in TSC2 were distinct indicating they arose independently. Most remarkably, 7 (50%) of the 14 somatic point mutations were CC>TT ultraviolet ‘signature’ mutations, never seen as a TSC germline mutation. These occurred exclusively in facial angiofibroma tumors from sun-exposed sites. These results implicate UV-induced DNA damage as a cause of second-hit mutations and development of TSC facial angiofibromas and suggest that measures to limit UV exposure in TSC children and adults should reduce the frequency and severity of these lesions. PMID:24271014

NetNorM: Capturing cancer-relevant information in somatic exome mutation data with gene networks for cancer stratification and prognosis.

PubMed

Le Morvan, Marine; Zinovyev, Andrei; Vert, Jean-Philippe

2017-06-01

Genome-wide somatic mutation profiles of tumours can now be assessed efficiently and promise to move precision medicine forward. Statistical analysis of mutation profiles is however challenging due to the low frequency of most mutations, the varying mutation rates across tumours, and the presence of a majority of passenger events that hide the contribution of driver events. Here we propose a method, NetNorM, to represent whole-exome somatic mutation data in a form that enhances cancer-relevant information using a gene network as background knowledge. We evaluate its relevance for two tasks: survival prediction and unsupervised patient stratification. Using data from 8 cancer types from The Cancer Genome Atlas (TCGA), we show that it improves over the raw binary mutation data and network diffusion for these two tasks. In doing so, we also provide a thorough assessment of somatic mutations prognostic power which has been overlooked by previous studies because of the sparse and binary nature of mutations.

NetNorM: Capturing cancer-relevant information in somatic exome mutation data with gene networks for cancer stratification and prognosis

PubMed Central

2017-01-01

Genome-wide somatic mutation profiles of tumours can now be assessed efficiently and promise to move precision medicine forward. Statistical analysis of mutation profiles is however challenging due to the low frequency of most mutations, the varying mutation rates across tumours, and the presence of a majority of passenger events that hide the contribution of driver events. Here we propose a method, NetNorM, to represent whole-exome somatic mutation data in a form that enhances cancer-relevant information using a gene network as background knowledge. We evaluate its relevance for two tasks: survival prediction and unsupervised patient stratification. Using data from 8 cancer types from The Cancer Genome Atlas (TCGA), we show that it improves over the raw binary mutation data and network diffusion for these two tasks. In doing so, we also provide a thorough assessment of somatic mutations prognostic power which has been overlooked by previous studies because of the sparse and binary nature of mutations. PMID:28650955

Global Gene Expression Patterns and Somatic Mutations in Sporadic Intracranial Aneurysms.

PubMed

Li, Zhili; Tan, Haibin; Shi, Yi; Huang, Guangfu; Wang, Zhenyu; Liu, Ling; Yin, Cheng; Wang, Qi

2017-04-01

High-throughput sequencing technologies can expand our understanding of the pathologic basis of intracranial aneurysms (IAs). Our study was aimed to decipher the gene expression signature and genetic factors associated with IAs. We determined the gene expression levels of 3 cases of IAs by RNA sequencing. Bioinformatics analysis was conducted to identify the differentially expressed genes (DEGs) and uncover their biological function. In addition, whole genome sequencing was performed on an additional 6 cases of IAs to detect the potential somatic alterations in DEGs. Compared with the normal arterial tissue, 1709 genes were differentially expressed in IAs arterial tissue. The most significantly up-regulated gene and down-regulated gene, H19 and HIST1H3J, may be essential for tumorigenesis of IAs. Hub protein of IKBKG in protein-protein interaction network was probably involved in the inflammation process in aneurysms. Another 2 hub proteins, ACTB and MKI67IP, as well as up-regulated genes, might be abnormally activated in aneurysms and involved in the pathogenesis of IAs. Further whole genome sequencing and filtering yielded 4 candidate somatic single nucleotide variants including MUC3B, and BLM may be involved in the pathogenesis of IAs. Even though, our results do not support the hypothesis of somatic mutations occurred in the DEGs. Two-dimensional genomic data from transcriptome and whole genome sequencing indicated that no somatic mutations occurred in DEGs. In addition, 3 DEGs (IKBKG, ACTB, and MKI67IP) and 2 mutant genes (MUC3B and BLM) were essential in IAs. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

PubMed

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

Brooke-Spiegler syndrome: report of 10 patients from 8 families with novel germline mutations: evidence of diverse somatic mutations in the same patient regardless of tumor type.

PubMed

Sima, Radek; Vanecek, Tomas; Kacerovska, Denisa; Trubac, Pavel; Cribier, Bernard; Rutten, Arno; Vazmitel, Marina; Spagnolo, Dominic V; Litvik, Radek; Vantuchova, Yvetta; Weyers, Wolfgang; Pearce, Robert L; Pearn, John; Michal, Michal; Kazakov, Dmitry V

2010-06-01

Brooke-Spiegler syndrome (BSS) is an inherited autosomal dominant disease characterized by the development of multiple adnexal cutaneous neoplasms including spiradenoma, cylindroma, spiradenocylindroma, and trichoepithelioma (cribriform trichoblastoma). BSS patients have various mutations in the CYLD gene, a tumor suppressor gene located on chromosome 16q. Our search of the literature revealed 51 germline CYLD mutations reported to date. Somatic CYLD mutations have rarely been investigated. We studied 10 patients from 8 families with BSS. Analysis of germline mutations of the CYLD gene was performed using either peripheral blood or nontumorous tissue. In addition, 19 formalin-fixed paraffin-embedded tumor samples were analyzed for somatic mutations, including loss of heterozygosity studies. A total of 38 tumors were available for histopathologic review. We have identified 8 novel germline mutations, all of which consisted of substitutions, deletions, and insertions/duplications and all except one led to premature stop codons. The substitution mutation in a single case was also predicted to disrupt protein function and seems causally implicated in tumor formation. We demonstrate for the first time that somatic events, loss of heterozygosity, or sequence mutations may differ among multiple neoplasms even of the same histologic type, occurring in the same patient.

Protein Domain-Level Landscape of Cancer-Type-Specific Somatic Mutations

PubMed Central

Yang, Fan; Petsalaki, Evangelia; Rolland, Thomas; Hill, David E.; Vidal, Marc; Roth, Frederick P.

2015-01-01

Identifying driver mutations and their functional consequences is critical to our understanding of cancer. Towards this goal, and because domains are the functional units of a protein, we explored the protein domain-level landscape of cancer-type-specific somatic mutations. Specifically, we systematically examined tumor genomes from 21 cancer types to identify domains with high mutational density in specific tissues, the positions of mutational hotspots within these domains, and the functional and structural context where possible. While hotspots corresponding to specific gain-of-function mutations are expected for oncoproteins, we found that tumor suppressor proteins also exhibit strong biases toward being mutated in particular domains. Within domains, however, we observed the expected patterns of mutation, with recurrently mutated positions for oncogenes and evenly distributed mutations for tumor suppressors. For example, we identified both known and new endometrial cancer hotspots in the tyrosine kinase domain of the FGFR2 protein, one of which is also a hotspot in breast cancer, and found new two hotspots in the Immunoglobulin I-set domain in colon cancer. Thus, to prioritize cancer mutations for further functional studies aimed at more precise cancer treatments, we have systematically correlated mutations and cancer types at the protein domain level. PMID:25794154

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

PubMed Central

2013-01-01

Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

PubMed

Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

2013-05-04

The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

DeepGene: an advanced cancer type classifier based on deep learning and somatic point mutations.

PubMed

Yuan, Yuchen; Shi, Yi; Li, Changyang; Kim, Jinman; Cai, Weidong; Han, Zeguang; Feng, David Dagan

2016-12-23

With the developments of DNA sequencing technology, large amounts of sequencing data have become available in recent years and provide unprecedented opportunities for advanced association studies between somatic point mutations and cancer types/subtypes, which may contribute to more accurate somatic point mutation based cancer classification (SMCC). However in existing SMCC methods, issues like high data sparsity, small volume of sample size, and the application of simple linear classifiers, are major obstacles in improving the classification performance. To address the obstacles in existing SMCC studies, we propose DeepGene, an advanced deep neural network (DNN) based classifier, that consists of three steps: firstly, the clustered gene filtering (CGF) concentrates the gene data by mutation occurrence frequency, filtering out the majority of irrelevant genes; secondly, the indexed sparsity reduction (ISR) converts the gene data into indexes of its non-zero elements, thereby significantly suppressing the impact of data sparsity; finally, the data after CGF and ISR is fed into a DNN classifier, which extracts high-level features for accurate classification. Experimental results on our curated TCGA-DeepGene dataset, which is a reformulated subset of the TCGA dataset containing 12 selected types of cancer, show that CGF, ISR and DNN all contribute in improving the overall classification performance. We further compare DeepGene with three widely adopted classifiers and demonstrate that DeepGene has at least 24% performance improvement in terms of testing accuracy. Based on deep learning and somatic point mutation data, we devise DeepGene, an advanced cancer type classifier, which addresses the obstacles in existing SMCC studies. Experiments indicate that DeepGene outperforms three widely adopted existing classifiers, which is mainly attributed to its deep learning module that is able to extract the high level features between combinatorial somatic point mutations and

Somatic mutations contribute to genotypic diversity in sterile and fertile populations of the threatened shrub, Grevillea rhizomatosa (Proteaceae).

PubMed

Gross, C L; Nelson, Penelope A; Haddadchi, Azadeh; Fatemi, Mohammad

2012-02-01

Grevillea rhizomatosa is a spreading shrub which exhibits multiple breeding strategies within a narrow area in the fire-prone heathlands of eastern Australia. Reproductive strategies include self-compatibility, self-incompatibility and clonality (with and without sterility). The close proximity of contrasting breeding systems provides an opportunity to explore the evolution of sterility and to compare and contrast the origins of genotypic diversity (recombinant or somatic) against degrees of sexual expression. ISSR markers for 120 band positions (putative loci) were used to compare genetic diversity among five populations at a macro-scale of 5 m between samples (n = 244 shrubs), and at a micro-scale of nearest neighbours for all plants in five 25-m(2) quadrats with contrasting fertilities (n = 162 shrubs). Nearest-neighbour sampling included several clusters of connected ramets. Matrix incompatibility (MIC) analyses were used to evaluate the relative contribution of recombination and somatic mutation to genotype diversity. High levels of genotypic diversity were found in all populations regardless of fertilities (fertile populations, G/N ≥ 0·94; sterile populations, G/N ≥ 0·97) and most sterile populations had a unique genetic profile. Somatic mutations were detected along connected ramets in ten out of 42 ramet clusters. MIC analyses showed that somatic mutations have contributed to diversity in all populations and particularly so in sterile populations. Somatic mutations contribute significantly to gene diversity in sterile populations of Grevillea rhizomatosa, the accumulation of which is the likely cause of male and female sterility. High levels of genetic diversity therefore may not always be synonymous with sexual fitness and genetic health. We hypothesize that frequent fires drive selection for clonal reproduction, at the cost of flowering such that sexual functions are not maintained through selection, and the build-up of somatic mutations in

Biallelic germline and somatic mutations in malignant mesothelioma: multiple mutations in transcription regulators including mSWI/SNF genes.

PubMed

Yoshikawa, Yoshie; Sato, Ayuko; Tsujimura, Tohru; Otsuki, Taiichiro; Fukuoka, Kazuya; Hasegawa, Seiki; Nakano, Takashi; Hashimoto-Tamaoki, Tomoko

2015-02-01

We detected low levels of acetylation for histone H3 tail lysines in malignant mesothelioma (MM) cell lines resistant to histone deacetylase inhibitors. To identify the possible genetic causes related to the low histone acetylation levels, whole-exome sequencing was conducted with MM cell lines established from eight patients. A mono-allelic variant of BRD1 was common to two MM cell lines with very low acetylation levels. We identified 318 homozygous protein-damaging variants/mutations (18-78 variants/mutations per patient); annotation analysis showed enrichment of the molecules associated with mammalian SWI/SNF (mSWI/SNF) chromatin remodeling complexes and co-activators that facilitate initiation of transcription. In seven of the patients, we detected a combination of variants in histone modifiers or transcription factors/co-factors, in addition to variants in mSWI/SNF. Direct sequencing showed that homozygous mutations in SMARCA4, PBRM1 and ARID2 were somatic. In one patient, homozygous germline variants were observed for SMARCC1 and SETD2 in chr3p22.1-3p14.2. These exhibited extended germline homozygosity and were in regions containing somatic mutations, leading to a loss of BAP1 and PBRM1 expression in MM cell line. Most protein-damaging variants were heterozygous in normal tissues. Heterozygous germline variants were often converted into hemizygous variants by mono-allelic deletion, and were rarely homozygous because of acquired uniparental disomy. Our findings imply that MM might develop through the somatic inactivation of mSWI/SNF complex subunits and/or histone modifiers, including BAP1, in subjects that have rare germline variants of these transcription regulators and/or transcription factors/co-factors, and in regions prone to mono-allelic deletion during oncogenesis. © 2014 UICC.

Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

PubMed

de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

2016-10-01

Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

Somatic mutations of GUCY2F, EPHA3, and NTRK3 in human cancers.

PubMed

Wood, Laura D; Calhoun, Eric S; Silliman, Natalie; Ptak, Janine; Szabo, Steve; Powell, Steve M; Riggins, Gregory J; Wang, Tian-Li; Yan, Hai; Gazdar, Adi; Kern, Scott E; Pennacchio, Len; Kinzler, Kenneth W; Vogelstein, Bert; Velculescu, Victor E

2006-10-01

Tyrosine kinases are major regulators of signal transduction cascades involved in cellular proliferation and have important roles in tumorigenesis. We have recently analyzed the tyrosine kinase gene family for alterations in human colorectal cancers and identified somatic mutations in seven members of this gene family. In this study we have used high-throughput sequencing approaches to further evaluate this subset of genes for genetic alterations in other human tumors. We identified somatic mutations in GUCY2F, EPHA3, and NTRK3 in breast, lung, and pancreatic cancers. Our results implicate these tyrosine kinase genes in the pathogenesis of other tumor types and suggest that they may be useful targets for diagnostic and therapeutic intervention in selected patients.

Environmental modulation of somatic mutations: nature of interactions. Final report, 1 June 1974--31 May 1977. [Effects of diurnal temperature changes in Tradescantia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mericle, L.W.

1977-05-01

Research on this project has had as a major goal a combined ecologic-genetic investigation of somatic mutations in order to evaluate the impacts of certain changing environmental parameters. The ultimate aim, to better understand how such environmental-mutation interactions operate and to assure the information obtained be extrapolatable to conditions and events in nature. Higher plants delineate reproductive tissues late in development from meristematic, somatic tissues. Moreover, the prevailing method of reproduction may be without sexual fusion of gametes and/or wholly asexual (vegetative). Therefore, somatic mutations can have as far-reaching genetic significance for a plant population as when germ cells, themselves,more » are directly affected. Our data show diurnal temperature differences (DTD) of greater than or equal to 22.2 C-degrees to be very effective mutagenic agents in the Tradescantia somatic mutation system. Further, these ranges of DTD were found to occur often in important seed production areas. A DTD of 22.2 in magnitude can increase mutations 10-fold. And, durations short as 1-day can induce significant increases in mutation rate. Whether interaction of 22.2 DTD with low-level radiation (800 mR/day) is synergistic or attenuative is still debatable. We believe, however, that spontaneous, and 22.2 DTD induced, mutations occur mainly via the genetic mechanism of somatic crossing-over; mutations from acute ionizing radiation (e.g., 30-60 R ..gamma..) via chromosome breakage, producing micronuclei. Requirements for maximizing the Discriminatory Response Capability (DRC) in the Tradescantia somatic mutation system are set forth.« less

An integrative somatic mutation analysis to identify pathways linked with survival outcomes across 19 cancer types

PubMed Central

Park, Sunho; Kim, Seung-Jun; Yu, Donghyeon; Peña-Llopis, Samuel; Gao, Jianjiong; Park, Jin Suk; Chen, Beibei; Norris, Jessie; Wang, Xinlei; Chen, Min; Kim, Minsoo; Yong, Jeongsik; Wardak, Zabi; Choe, Kevin; Story, Michael; Starr, Timothy; Cheong, Jae-Ho; Hwang, Tae Hyun

2016-01-01

Motivation: Identification of altered pathways that are clinically relevant across human cancers is a key challenge in cancer genomics. Precise identification and understanding of these altered pathways may provide novel insights into patient stratification, therapeutic strategies and the development of new drugs. However, a challenge remains in accurately identifying pathways altered by somatic mutations across human cancers, due to the diverse mutation spectrum. We developed an innovative approach to integrate somatic mutation data with gene networks and pathways, in order to identify pathways altered by somatic mutations across cancers. Results: We applied our approach to The Cancer Genome Atlas (TCGA) dataset of somatic mutations in 4790 cancer patients with 19 different types of tumors. Our analysis identified cancer-type-specific altered pathways enriched with known cancer-relevant genes and targets of currently available drugs. To investigate the clinical significance of these altered pathways, we performed consensus clustering for patient stratification using member genes in the altered pathways coupled with gene expression datasets from 4870 patients from TCGA, and multiple independent cohorts confirmed that the altered pathways could be used to stratify patients into subgroups with significantly different clinical outcomes. Of particular significance, certain patient subpopulations with poor prognosis were identified because they had specific altered pathways for which there are available targeted therapies. These findings could be used to tailor and intensify therapy in these patients, for whom current therapy is suboptimal. Availability and implementation: The code is available at: http://www.taehyunlab.org. Contact: jhcheong@yuhs.ac or taehyun.hwang@utsouthwestern.edu or taehyun.cs@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26635139

Novel Secondary Somatic Mutations in Ewing's Sarcoma and Desmoplastic Small Round Cell Tumors

PubMed Central

Janku, Filip; Ludwig, Joseph A.; Naing, Aung; Benjamin, Robert S.; Brown, Robert E.; Anderson, Pete; Kurzrock, Razelle

2014-01-01

Background Ewing's sarcoma (ES) and desmoplastic small round cell tumors (DSRCT) are small round blue cell tumors driven by an N-terminal containing EWS translocation. Very few somatic mutations have been reported in ES, and none have been identified in DSRCT. The aim of this study is to explore potential actionable mutations in ES and DSRCT. Methodology Twenty eight patients with ES or DSRCT had tumor tissue available that could be analyzed by one of the following methods: 1) Next-generation exome sequencing platform; 2) Multiplex PCR/Mass Spectroscopy; 3) Polymerase chain reaction (PCR)-based single- gene mutation screening; 4) Sanger sequencing; 5) Morphoproteomics. Principal Findings Novel somatic mutations were identified in four out of 18 patients with advanced ES and two of 10 patients with advanced DSRCT (six out of 28 (21.4%));KRAS (n = 1), PTPRD (n = 1), GRB10 (n = 2), MET (n = 2) and PIK3CA (n = 1). One patient with both PTPRD and GRB10 mutations and one with a GRB10 mutation achieved a complete remission (CR) on an Insulin like growth factor 1 receptor (IGF1R) inhibitor based treatment. One patient, who achieved a partial remission (PR) with IGF1R inhibitor treatment, but later developed resistance, demonstrated a KRAS mutation in the post-treatment resistant tumor, but not in the pre-treatment tumor suggesting that the RAF/RAS/MEK pathway was activated with progression. Conclusions We have reported several different mutations in advanced ES and DSRCT that have direct implications for molecularly-directed targeted therapy. Our technology agnostic approach provides an initial mutational roadmap used in the path towards individualized combination therapy. PMID:25119929

Discovery and prioritization of somatic mutations in diffuse large B-cell lymphoma (DLBCL) by whole-exome sequencing

PubMed Central

Lohr, Jens G.; Stojanov, Petar; Lawrence, Michael S.; Auclair, Daniel; Chapuy, Bjoern; Sougnez, Carrie; Cruz-Gordillo, Peter; Knoechel, Birgit; Asmann, Yan W.; Slager, Susan L.; Novak, Anne J.; Dogan, Ahmet; Ansell, Stephen M.; Zou, Lihua; Gould, Joshua; Saksena, Gordon; Stransky, Nicolas; Rangel-Escareño, Claudia; Fernandez-Lopez, Juan Carlos; Hidalgo-Miranda, Alfredo; Melendez-Zajgla, Jorge; Hernández-Lemus, Enrique; Schwarz-Cruz y Celis, Angela; Imaz-Rosshandler, Ivan; Ojesina, Akinyemi I.; Jung, Joonil; Pedamallu, Chandra S.; Lander, Eric S.; Habermann, Thomas M.; Cerhan, James R.; Shipp, Margaret A.; Getz, Gad; Golub, Todd R.

2012-01-01

To gain insight into the genomic basis of diffuse large B-cell lymphoma (DLBCL), we performed massively parallel whole-exome sequencing of 55 primary tumor samples from patients with DLBCL and matched normal tissue. We identified recurrent mutations in genes that are well known to be functionally relevant in DLBCL, including MYD88, CARD11, EZH2, and CREBBP. We also identified somatic mutations in genes for which a functional role in DLBCL has not been previously suspected. These genes include MEF2B, MLL2, BTG1, GNA13, ACTB, P2RY8, PCLO, and TNFRSF14. Further, we show that BCL2 mutations commonly occur in patients with BCL2/IgH rearrangements as a result of somatic hypermutation normally occurring at the IgH locus. The BCL2 point mutations are primarily synonymous, and likely caused by activation-induced cytidine deaminase–mediated somatic hypermutation, as shown by comprehensive analysis of enrichment of mutations in WRCY target motifs. Those nonsynonymous mutations that are observed tend to be found outside of the functionally important BH domains of the protein, suggesting that strong negative selection against BCL2 loss-of-function mutations is at play. Last, by using an algorithm designed to identify likely functionally relevant but infrequent mutations, we identify KRAS, BRAF, and NOTCH1 as likely drivers of DLBCL pathogenesis in some patients. Our data provide an unbiased view of the landscape of mutations in DLBCL, and this in turn may point toward new therapeutic strategies for the disease. PMID:22343534

Somatic mutation profiles of clear cell endometrial tumors revealed by whole exome and targeted gene sequencing.

PubMed

Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Zhang, Suiyuan; Lozy, Fred; Sgroi, Dennis C; Vidal Bel, August; Matias-Guiu, Xavier; Broaddus, Russell R; Lu, Karen H; Levine, Douglas A; Mutch, David G; Goodfellow, Paul J; Salvesen, Helga B; Mullikin, James C; Bell, Daphne W

2017-09-01

The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome-wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. We conducted whole exome sequencing of paired tumor-normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty-two genes-of-interest were Sanger-sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein-encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1, a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261-8. © 2017 American Cancer Society. © 2017 American Cancer Society.

PTEN/MMAC1 Mutations in Hepatocellular Carcinomas: Somatic Inactivation of Both Alleles in Tumors

PubMed Central

Kawamura, Naoki; Nagai, Hisaki; Bando, Koichi; Koyama, Masaaki; Matsumoto, Satoshi; Tajiri, Takashi; Onda, Masahiko; Fujimoto, Jiro; Ueki, Takahiro; Konishi, Noboru; Shiba, Tadayoshi

1999-01-01

Allelic loss of loci on chromosome 10q occurs frequently in hepatocellular carcinomas. Somatic mutations of the PTEN/MMAC1 gene on this chromosome at 10q23 were recently identified in sporadic cancers of the uterus, brain, prostate and breast. To investigate the potential role of PTEN/MMAC1 gene in the genesis of hepatocellular carcinomas, we examined 96 tumors for allelic loss on 10q and also for subtle mutations anywhere within the coding region of PTEN/MMAC1 gene. Allelic loss was identified in 25 of the 89 (27%) tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in five of those tumors: three frameshift mutations, a 1‐bp insertion at codon 83–84 in exon 4 and two 4‐bp deletions, both at codon 318–319 in exon 8; two C‐to‐G transversion mutation, both at ‐9 bp from the initiation codon in the 5’non‐coding region of exon 1. No missense mutation was observed in this panel of tumors. In most of the informative tumors carrying intragenic mutations of one allele, we were able to detect loss of heterozygosity as well. These findings suggest that two alleles of the PTEN/MMAC1 gene may be inactivated by a combination of intragenic point mutation on one allele and loss of chromosomal material on the other allele in some of these tumors. PMID:10363579

Whole exome sequencing reveals recurrent mutations in BRCA2 and FAT genes in acinar cell carcinomas of the pancreas.

PubMed

Furukawa, Toru; Sakamoto, Hitomi; Takeuchi, Shoko; Ameri, Mitra; Kuboki, Yuko; Yamamoto, Toshiyuki; Hatori, Takashi; Yamamoto, Masakazu; Sugiyama, Masanori; Ohike, Nobuyuki; Yamaguchi, Hiroshi; Shimizu, Michio; Shibata, Noriyuki; Shimizu, Kyoko; Shiratori, Keiko

2015-03-06

Acinar cell carcinoma of the pancreas is a rare tumor with a poor prognosis. Compared to pancreatic ductal adenocarcinoma, its molecular features are poorly known. We studied a total of 11 acinar cell carcinomas, including 3 by exome and 4 by target sequencing. Exome sequencing revealed 65 nonsynonymous mutations and 22 indels with a mutation rate of 3.4 mutations/Mb per tumor, on average. By accounting for not only somatic but also germline mutations with loss of the wild-type allele, we identified recurrent mutations of BRCA2 and FAT genes. BRCA2 showed somatic or germline premature termination mutations, with loss of the wild-type allele in 3 of 7 tumors. FAT1, FAT3, and FAT4 showed somatic or germline missense mutations in 4 of 7 tumors. The germline FAT mutations were with loss of the wild-type allele. Loss of BRCA2 expression was observed in 5 of 11 tumors. One patient with a BRCA2-mutated tumor experienced complete remission of liver metastasis following cisplatinum chemotherapy. In conclusion, acinar cell carcinomas show a distinct mutation pattern and often harbor somatic or germline mutations of BRCA2 and FAT genes. This result may warrant assessment of BRCA2 abrogation in patients with the carcinoma to determine their sensitivity to chemotherapy.

Somatic Mutations in NEK9 Cause Nevus Comedonicus

PubMed Central

Levinsohn, Jonathan L.; Sugarman, Jeffrey L.; McNiff, Jennifer M.; Antaya, Richard J.; Choate, Keith A.

2016-01-01

Acne vulgaris (AV) affects most adolescents, and of those affected, moderate to severe disease occurs in 20%. Comedones, follicular plugs consisting of desquamated keratinocytes and sebum, are central to its pathogenesis. Despite high heritability in first-degree relatives, AV genetic determinants remain incompletely understood. We therefore employed whole-exome sequencing (WES) in nevus comedonicus (NC), a rare disorder that features comedones and inflammatory acne cysts in localized, linear configurations. WES identified somatic NEK9 mutations, each affecting highly conserved residues within its kinase or RCC1 domains, in affected tissue of three out of three NC-affected subjects. All mutations are gain of function, resulting in increased phosphorylation at Thr210, a hallmark of NEK9 kinase activation. We found that comedo formation in NC is marked by loss of follicular differentiation markers, expansion of keratin-15-positive cells from localization within the bulge to the entire sub-bulge follicle and cyst, and ectopic expression of keratin 10, a marker of interfollicular differentiation not present in normal follicles. These findings suggest that NEK9 mutations in NC disrupt normal follicular differentiation and identify NEK9 as a potential regulator of follicular homeostasis. PMID:27153399

A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

PubMed

Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

2015-08-07

Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

Interferon-α Based Individualized Treatment of a High Risk Chronic Myelogenous Leukemia Patient Harboring T315I Mutation.

PubMed

Zeng, Yunxin; Zhang, Jingwen; Li, Xiaoqing; Zhang, Ling; Liu, Jiajun

2018-06-01

T315I mutation is the most common BCR-ABL mutation and confers resistance to all the first and second generation BCR-ABL tyrosine kinases, including nilotinib and dasatinib. We report a high risk chronic myelogenous leukemia (CML) patient harboring the T315I mutation treated by Interferon-α (INF-α) solo and subsequently combined with dasatinib. Hematological investigation, bone marrow cytology inspection, chromosomal analysis (G-banding), and real-time quantitative polymerase chain reaction (RQ-PCR) were performed on a 47-year-old male patient. After 8 months IFN-α monotherapy, the patient lost the T315I mutation but acquired a new F359V mutation. After 2 months on dasatinib and INF-α treatment, the patient achieved complete hematologic response (CHR). IFN-α based combination therapy could be a viable treatment option for CML patients harboring T315I BCR-ABL mutation.

Effect of actionable somatic mutations on racial/ethnic disparities in head and neck cancer prognosis.

PubMed

Wu, Evan S; Park, Jong Y; Zeitouni, Joseph A; Gomez, Carmen R; Reis, Isildinha M; Zhao, Wei; Kwon, Deukwoo; Lee, Eunkyung; Nelson, Omar L; Lin, Hui-Yi; Franzmann, Elizabeth J; Savell, Jason; McCaffrey, Thomas V; Goodwin, W Jarrard; Hu, Jennifer J

2016-08-01

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and minorities have the worst survival. However, the molecular mechanisms underlying survival disparities have not been elucidated. In a retrospective study, we assessed association between HNSCC early death (<2 years) and 208 somatic mutations of 10 cancer-related genes in 214 patients: 98 non-Hispanic whites (46%), 72 Hispanic whites (34%), and 44 African Americans (20%). Hispanic whites and African Americans had significantly higher mutation rates for EGFR, HRAS, KRAS, and TP53. HNSCC early death was significantly associated with 3+ mutations (odds ratio [OR] = 2.78, 95% confidence interval [CI] = 1.16, 6.69), NOTCH1 mutations in non-Hispanic whites (OR = 5.51; 95% CI = 1.22-24.83) and TP53 mutations in Hispanic whites (OR = 3.84; 95% CI = 1.08-13.68) in multivariable analysis adjusted for age, sex, tumor site, and tumor stage. We have provided the proof-of-principal data to link racial/ethnic-specific somatic mutations and HNSCC prognosis and pave the way for precision medicine to overcome HNSCC survival disparities. © 2016 Wiley Periodicals, Inc. Head Neck 38:1234-1241, 2016. © 2016 Wiley Periodicals, Inc.

Multiple independent second-site mutations in two siblings with somatic mosaicism for Wiskott-Aldrich syndrome.

PubMed

Boztug, K; Germeshausen, M; Avedillo Díez, I; Gulacsy, V; Diestelhorst, J; Ballmaier, M; Welte, K; Maródi, L; Chernyshova, Li; Klein, C

2008-07-01

Wiskott-Aldrich syndrome (WAS) is an X-linked primary immunodeficiency disorder associated with microthrombocytopenia, eczema, autoimmunity and predisposition to malignant lymphoma. Although rare, few cases of somatic mosaicism have been published in WAS patients to date. We here report on two Ukrainian siblings who were referred to us at the age of 3 and 4 years, respectively. Both patients suffered from severe WAS caused by a nonsense mutation in exon 1 of the WAS gene. In both siblings, flow cytometric analysis revealed the presence of Wiskott-Aldrich syndrome protein (WASp)-positive and WASp-negative cell populations among T and B lymphocytes as well as natural killer (NK) cells. In contrast to previously described cases of revertant mosaicism in WAS, molecular analyses in both children showed that the WASp-positive T cells, B cells, and NK cells carried multiple different second-site mutations, resulting in different missense mutations. To our knowledge, this is the first report describing somatic mosaicism in WAS patients caused by several independent second-site mutations in the WAS gene.

Prevalence of somatic mitochondrial mutations and spatial distribution of mitochondria in non-small cell lung cancer.

PubMed

Kazdal, Daniel; Harms, Alexander; Endris, Volker; Penzel, Roland; Kriegsmann, Mark; Eichhorn, Florian; Muley, Thomas; Stenzinger, Albrecht; Pfarr, Nicole; Weichert, Wilko; Warth, Arne

2017-07-11

Mitochondria are considered relevant players in many tumour entities and first data indicate beneficial effects of mitochondria-targeted antioxidants in both cancer prevention and anticancer therapies. To further dissect the potential roles of mitochondria in NSCLC we comprehensively analysed somatic mitochondrial mutations, determined the spatial distribution of mitochondrial DNA within complete tumour sections and investigated the mitochondrial load in a large-scale approach. Whole mitochondrial genome sequencing of 26 matched tumour and non-neoplastic tissue samples extended by reviewing published data of 326 cases. Systematical stepwise real-time PCR quantification of mitochondrial DNA covering 16 whole surgical tumour sections. Immunohistochemical determination of the mitochondrial load in 171 adenocarcinoma and 145 squamous cell carcinoma. Our results demonstrate very low recurrences (max. 1.7%) and a broad distribution of 456 different somatic mitochondrial mutations. Large inter- and intra-tumour heterogeneity were seen for mitochondrial DNA copy numbers in conjunction with a correlation to the predominant histological growth pattern. Furthermore, tumour cells had significantly higher mitochondrial level compared to adjacent stroma, whereas differences between tumour entities were negligible. Non-evident somatic mitochondrial mutations and highly varying mitochondrial DNA level delineate challenges for the approach of mitochondria-targeted anticancer therapies in NSCLC.

Recurrent Somatic PDGFRB Mutations in Sporadic Infantile/Solitary Adult Myofibromas But Not in Angioleiomyomas and Myopericytomas.

PubMed

Agaimy, Abbas; Bieg, Matthias; Michal, Michael; Geddert, Helene; Märkl, Bruno; Seitz, Jan; Moskalev, Evgeny A; Schlesner, Matthias; Metzler, Markus; Hartmann, Arndt; Wiemann, Stefan; Michal, Michal; Mentzel, Thomas; Haller, Florian

2017-02-01

Infantile myofibroma (MF) is an uncommon benign myofibroblastic tumor of infancy and childhood. Solitary adult MF shares similar features with infantile MF. The lesions occur in 3 clinicopathologic settings: solitary, multicentric, and generalized and can be either sporadic or familial. Traditionally, infantile MF has been included in the spectrum of infantile hemangiopericytoma. The recent World Health Organization classification listed MF, angioleiomyoma, and myopericytoma under the general heading of perivascular tumors in the sense of a morphologic spectrum of perivascular myoid cell neoplasms. Although activating germline PDGFRB mutations have recently been linked to familial infantile MF, the molecular pathogenesis of sporadic infantile and adult solitary MF remained unclear. In this study, we analyzed 25 solitary MFs without evidence of familial disease (9 infantile and 16 adult MFs) to address the question whether somatic PDGFRB mutations might be responsible for the sporadic form of the disease. Given the presumed histogenetic link of MF to myopericytoma and angioleiomyoma, we additionally analyzed a control group of 6 myopericytomas and 9 angioleiomyomas for PDGFRB mutations. We detected PDGFRB mutations in 6/8 (75%) analyzable infantile and in 11/16 (69%) adult MFs but in none of the angioleiomyomas or myopericytomas. In 2 infantile MFs, additional sequencing of the germline confirmed the somatic nature of PDGFRB mutations. To our knowledge, this is the first study reporting apparently somatic recurrent PDGFRB mutations as molecular driver events in the majority of sporadic infantile and adult solitary MFs. Our results suggest molecular distinctness of MF as compared with angioleiomyoma/myopericytoma. Investigation of more cases including those with atypical and worrisome features, as well as other mimickers in the heterogenous morphologic spectrum of MF, is mandatory for validating the potential diagnostic value of PDGFRB mutation testing as a possible

Cutaneous-Skeletal Hypophosphatemia Syndrome is a Multilineage Somatic Mosaic RASopathy

PubMed Central

Lim, Young H.; Ovejero, Diana; Derrick, Kristina M.; Collins, Michael T.; Choate, Keith A.

2016-01-01

Background We recently demonstrated multilineage somatic mosaicism in cutaneous-skeletal hypophosphatemia syndrome (CSHS), which features epidermal or melanocytic nevi, elevated fibroblast growth factor-23 (FGF23) and hypophosphatemia, finding identical RAS mutations in affected skin and bone. Objective 1) To provide an updated overview of CSHS; 2) To review its pathobiology; 3) To present a new CSHS patient; and 4) To discuss treatment modalities. Methods We searched PubMed for “nevus AND rickets,” and “nevus AND hypophosphatemia,” identifying cases of nevi with hypophosphatemic rickets or elevated serum FGF23. For our additional CSHS patient, we performed histopathologic and radiographic surveys of skin and skeletal lesions, respectively. Sequencing was performed for HRAS, KRAS, and NRAS to determine causative mutations. Results Our new case harbored somatic activating HRAS p.G13R mutation in affected tissue, consistent with previous findings. While the mechanism of FGF23 dysregulation is unknown in CSHS, interaction between FGF and MAPK pathways may provide insight into pathobiology. Anti-FGF23 antibody KRN23 may be useful in managing CSHS. Limitations Multilineage RAS mutation in CSHS was recently identified; further studies on mechanism are unavailable. Conclusion Patients with nevi in association with skeletal disease should be evaluated for serum phosphate and FGF23. Further studies investigating the role of RAS in FGF23 regulation are needed. PMID:27444071

Somatic mutation load of estrogen receptor-positive breast tumors predicts overall survival: an analysis of genome sequence data.

PubMed

Haricharan, Svasti; Bainbridge, Matthew N; Scheet, Paul; Brown, Powel H

2014-07-01

Breast cancer is one of the most commonly diagnosed cancers in women. While there are several effective therapies for breast cancer and important single gene prognostic/predictive markers, more than 40,000 women die from this disease every year. The increasing availability of large-scale genomic datasets provides opportunities for identifying factors that influence breast cancer survival in smaller, well-defined subsets. The purpose of this study was to investigate the genomic landscape of various breast cancer subtypes and its potential associations with clinical outcomes. We used statistical analysis of sequence data generated by the Cancer Genome Atlas initiative including somatic mutation load (SML) analysis, Kaplan-Meier survival curves, gene mutational frequency, and mutational enrichment evaluation to study the genomic landscape of breast cancer. We show that ER(+), but not ER(-), tumors with high SML associate with poor overall survival (HR = 2.02). Further, these high mutation load tumors are enriched for coincident mutations in both DNA damage repair and ER signature genes. While it is known that somatic mutations in specific genes affect breast cancer survival, this study is the first to identify that SML may constitute an important global signature for a subset of ER(+) tumors prone to high mortality. Moreover, although somatic mutations in individual DNA damage genes affect clinical outcome, our results indicate that coincident mutations in DNA damage response and signature ER genes may prove more informative for ER(+) breast cancer survival. Next generation sequencing may prove an essential tool for identifying pathways underlying poor outcomes and for tailoring therapeutic strategies.

Impact of experimental design on PET radiomics in predicting somatic mutation status.

PubMed

Yip, Stephen S F; Parmar, Chintan; Kim, John; Huynh, Elizabeth; Mak, Raymond H; Aerts, Hugo J W L

2017-12-01

PET-based radiomic features have demonstrated great promises in predicting genetic data. However, various experimental parameters can influence the feature extraction pipeline, and hence, Here, we investigated how experimental settings affect the performance of radiomic features in predicting somatic mutation status in non-small cell lung cancer (NSCLC) patients. 348 NSCLC patients with somatic mutation testing and diagnostic PET images were included in our analysis. Radiomic feature extractions were analyzed for varying voxel sizes, filters and bin widths. 66 radiomic features were evaluated. The performance of features in predicting mutations status was assessed using the area under the receiver-operating-characteristic curve (AUC). The influence of experimental parameters on feature predictability was quantified as the relative difference between the minimum and maximum AUC (δ). The large majority of features (n=56, 85%) were significantly predictive for EGFR mutation status (AUC≥0.61). 29 radiomic features significantly predicted EGFR mutations and were robust to experimental settings with δ Overall <5%. The overall influence (δ Overall ) of the voxel size, filter and bin width for all features ranged from 5% to 15%, respectively. For all features, none of the experimental designs was predictive of KRAS+ from KRAS- (AUC≤0.56). The predictability of 29 radiomic features was robust to the choice of experimental settings; however, these settings need to be carefully chosen for all other features. The combined effect of the investigated processing methods could be substantial and must be considered. Optimized settings that will maximize the predictive performance of individual radiomic features should be investigated in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

EZH2 is required for germinal center formation and somatic EZH2 mutations promote lymphoid transformation

PubMed Central

Béguelin, Wendy; Popovic, Relja; Teater, Matt; Jiang, Yanwen; Bunting, Karen L.; Rosen, Monica; Shen, Hao; Yang, Shao Ning; Wang, Ling; Ezponda, Teresa; Martinez-Garcia, Eva; Zhang, Haikuo; Zhang, Yupeng; Verma, Sharad K.; McCabe, Michael T.; Ott, Heidi M.; Van Aller, Glenn S.; Kruger, Ryan G.; Liu, Yan; McHugh, Charles F.; Scott, David W.; Chung, Young Rock; Kelleher, Neil; Shaknovich, Rita; Creasy, Caretha L.; Gascoyne, Randy D.; Wong, Kwok-Kin; Cerchietti, Leandro C.; Levine, Ross L.; Abdel-Wahab, Omar; Licht, Jonathan D.; Elemento, Olivier; Melnick, Ari M.

2013-01-01

The EZH2 histone methyltransferase is highly expressed in germinal center (GC) B-cells and targeted by somatic mutations in B-cell lymphomas. Here we find that EZH2 deletion or pharmacologic inhibition suppresses GC formation and functions in mice. EZH2 represses proliferation checkpoint genes and helps establish bivalent chromatin domains at key regulatory loci to transiently suppress GC B-cell differentiation. Somatic mutations reinforce these physiological effects through enhanced silencing of EZH2 targets in B-cells, and in human B-cell lymphomas. Conditional expression of mutant EZH2 in mice induces GC hyperplasia and accelerated lymphomagenesis in cooperation with BCL2. GCB-type DLBCLs are mostly addicted to EZH2, regardless of mutation status, but not the more differentiated ABC-type DLBCLs, thus clarifying the therapeutic scope of EZH2 targeting. PMID:23680150

Somatic Mutation Patterns in Hemizygous Genomic Regions Unveil Purifying Selection during Tumor Evolution

PubMed Central

Basu, Swaraj; Larsson, Erik

2016-01-01

Identification of cancer driver genes using somatic mutation patterns indicative of positive selection has become a major goal in cancer genomics. However, cancer cells additionally depend on a large number of genes involved in basic cellular processes. While such genes should in theory be subject to strong purifying (negative) selection against damaging somatic mutations, these patterns have been elusive and purifying selection remains inadequately explored in cancer. Here, we hypothesized that purifying selection should be evident in hemizygous genomic regions, where damaging mutations cannot be compensated for by healthy alleles. Using a 7,781-sample pan-cancer dataset, we first confirmed this in POLR2A, an essential gene where hemizygous deletions are known to confer elevated sensitivity to pharmacological suppression. We next used this principle to identify several genes and pathways that show patterns indicative of purifying selection to avoid deleterious mutations. These include the POLR2A interacting protein INTS10 as well as genes involved in mRNA splicing, nonsense-mediated mRNA decay and other RNA processing pathways. Many of these genes belong to large protein complexes, and strong overlaps were observed with recent functional screens for gene essentiality in human cells. Our analysis supports that purifying selection acts to preserve the remaining function of many hemizygously deleted essential genes in tumors, indicating vulnerabilities that might be exploited by future therapeutic strategies. PMID:28027311

Clonal hematopoiesis as determined by the HUMARA assay is a marker for acquired mutations in epigenetic regulators in older women.

PubMed

Wiedmeier, Julia Erin; Kato, Catherine; Zhang, Zhenzhen; Lee, Hyunjung; Dunlap, Jennifer; Nutt, Eric; Rattray, Rogan; McKay, Sarah; Eide, Christopher; Press, Richard; Mori, Motomi; Druker, Brian; Dao, Kim-Hien

2016-09-01

Recent large cohort studies revealed that healthy older individuals harbor somatic mutations that increase their risk for hematologic malignancy and all-cause cardiovascular deaths. The majority of these mutations are in chromatin and epigenetic regulatory genes (CERGs). CERGs play a key role in regulation of DNA methylation (DNMT3A and TET2) and histone function (ASXL1) and in clonal proliferation of hematopoietic stem cells. We hypothesize that older women manifesting clonal hematopoiesis, defined here as a functional phenomenon in which a hematopoietic stem cell has acquired a survival and proliferative advantage, harbor a higher frequency of somatic mutations in CERGs. The human androgen receptor gene (HUMARA) assay was used in our study to detect the presence of nonrandom X inactivation in women, a marker for clonal hematopoiesis. In our pilot study, we tested 127 blood samples from women ≥65 years old without a history of invasive cancer or hematologic malignancies. Applying stringent qualitative criteria, we found that 26% displayed clonal hematopoiesis; 52.8% displayed polyclonal hematopoiesis; and 21.3% had indeterminate patterns (too close to call by qualitative assessment). Using Illumina MiSeq next-generation sequencing, we identified somatic mutations in CERGs in 15.2% of subjects displaying clonal hematopoiesis (three ASXL1 and two DNMT3A mutations with an average variant allele frequency of 15.7%, range: 6.3%-23.3%). In a more limited sequencing analysis, we evaluated the frequency of ASXL1 mutations by Sanger sequencing and found mutations in 9.7% of the clonal samples and 0% of the polyclonal samples. By comparing several recent studies (with some caveats as described), we determined the fold enrichment of detecting CERG mutations by using the HUMARA assay as a functional screen for clonal hematopoiesis. We conclude that a functional assay of clonal hematopoiesis is enriching for older women with somatic mutations in CERGs, particularly for ASXL

Germ cell regeneration-mediated, enhanced mutagenesis in the ascidian Ciona intestinalis reveals flexible germ cell formation from different somatic cells.

PubMed

Yoshida, Keita; Hozumi, Akiko; Treen, Nicholas; Sakuma, Tetsushi; Yamamoto, Takashi; Shirae-Kurabayashi, Maki; Sasakura, Yasunori

2017-03-15

The ascidian Ciona intestinalis has a high regeneration capacity that enables the regeneration of artificially removed primordial germ cells (PGCs) from somatic cells. We utilized PGC regeneration to establish efficient methods of germ line mutagenesis with transcription activator-like effector nucleases (TALENs). When PGCs were artificially removed from animals in which a TALEN pair was expressed, somatic cells harboring mutations in the target gene were converted into germ cells, this germ cell population exhibited higher mutation rates than animals not subjected to PGC removal. PGC regeneration enables us to use TALEN expression vectors of specific somatic tissues for germ cell mutagenesis. Unexpectedly, cis elements for epidermis, neural tissue and muscle could be used for germ cell mutagenesis, indicating there are multiple sources of regenerated PGCs, suggesting a flexibility of differentiated Ciona somatic cells to regain totipotency. Sperm and eggs of a single hermaphroditic, PGC regenerated animal typically have different mutations, suggesting they arise from different cells. PGCs can be generated from somatic cells even though the maternal PGCs are not removed, suggesting that the PGC regeneration is not solely an artificial event but could have an endogenous function in Ciona. This study provides a technical innovation in the genome-editing methods, including easy establishment of mutant lines. Moreover, this study suggests cellular mechanisms and the potential evolutionary significance of PGC regeneration in Ciona. Copyright © 2017 Elsevier Inc. All rights reserved.

Germline MC1R status influences somatic mutation burden in melanoma.

PubMed

Robles-Espinoza, Carla Daniela; Roberts, Nicola D; Chen, Shuyang; Leacy, Finbarr P; Alexandrov, Ludmil B; Pornputtapong, Natapol; Halaban, Ruth; Krauthammer, Michael; Cui, Rutao; Timothy Bishop, D; Adams, David J

2016-07-12

The major genetic determinants of cutaneous melanoma risk in the general population are disruptive variants (R alleles) in the melanocortin 1 receptor (MC1R) gene. These alleles are also linked to red hair, freckling, and sun sensitivity, all of which are known melanoma phenotypic risk factors. Here we report that in melanomas and for somatic C>T mutations, a signature linked to sun exposure, the expected single-nucleotide variant count associated with the presence of an R allele is estimated to be 42% (95% CI, 15-76%) higher than that among persons without an R allele. This figure is comparable to the expected mutational burden associated with an additional 21 years of age. We also find significant and similar enrichment of non-C>T mutation classes supporting a role for additional mutagenic processes in melanoma development in individuals carrying R alleles.

Coexistence of EGFR with KRAS, or BRAF, or PIK3CA somatic mutations in lung cancer: a comprehensive mutation profiling from 5125 Chinese cohorts

PubMed Central

Li, S; Li, L; Zhu, Y; Huang, C; Qin, Y; Liu, H; Ren-Heidenreich, L; Shi, B; Ren, H; Chu, X; Kang, J; Wang, W; Xu, J; Tang, K; Yang, H; Zheng, Y; He, J; Yu, G; Liang, N

2014-01-01

Background: Determining the somatic mutations of epidermal growth factor receptor (EGFR)-pathway networks is the key to effective treatment for non-small cell lung cancer (NSCLC) with tyrosine kinase inhibitors (TKIs).The somatic mutation frequencies and their association with gender, smoking history and histology was analysed and reported in this study. Methods: Five thousand one hundred and twenty-five NSCLC patients' pathology samples were collected, and EGFR, KRAS, BRAF and PIK3CA mutations were detected by multiplex testing. The mutation status of EGFR, KRAS, BRAF and PIK3CA and their association with gender, age, smoking history and histological type were evaluated by appropriate statistical analysis. Results: EGFR, KRAS, BRAF and PIK3CA mutation rates revealed 36.2%, 8.4%, 0.5% and 3.3%, respectively, across the 5125 pathology samples. For the first time, evidence of KRAS mutations were detected in two female, non-smoking patients, age 5 and 14, with NSCLC. Furthermore, we identified 153 double and coexisting mutations and 7 triple mutations. Interestingly, the second drug-resistant mutations, T790M or E545K, were found in 44 samples from patients who had never received TKI treatments. Conclusions: EGFR exons 19, 20 and 21, and BRAF mutations tend to happen in females and non-smokers, whereas KRAS mutations were more inclined to males and smokers. Activating and resistant mutations to EGFR-TKI drugs can coexist and ‘second drug-resistant mutations', T790M or E545K, may be primary mutations in some patients. These results will help oncologists to decide candidates for mutation testing and EGFR-TKI treatment. PMID:24743704

Cutaneous skeletal hypophosphatemia syndrome (CSHS) is a multilineage somatic mosaic RASopathy.

PubMed

Lim, Young H; Ovejero, Diana; Derrick, Kristina M; Collins, Michael T; Choate, Keith A

2016-08-01

We recently demonstrated multilineage somatic mosaicism in cutaneous skeletal hypophosphatemia syndrome (CSHS), which features epidermal or melanocytic nevi, elevated fibroblast growth factor (FGF)-23, and hypophosphatemia, finding identical RAS mutations in affected skin and bone. We sought to: (1) provide an updated overview of CSHS; (2) review its pathobiology; (3) present a new patient with CSHS; and (4) discuss treatment modalities. We searched PubMed for "nevus AND rickets," and "nevus AND hypophosphatemia," identifying cases of nevi with hypophosphatemic rickets or elevated serum FGF-23. For our additional patient with CSHS, we performed histopathologic and radiographic surveys of skin and skeletal lesions, respectively. Sequencing was performed for HRAS, KRAS, and NRAS to determine causative mutations. Our new case harbored somatic activating HRAS p.G13 R mutation in affected tissue, consistent with previous findings. Although the mechanism of FGF-23 dysregulation is unknown in CSHS, interaction between FGF and MAPK pathways may provide insight into pathobiology. Anti-FGF-23 antibody KRN-23 may be useful in managing CSHS. Multilineage RAS mutation in CSHS was recently identified; further studies on mechanism are unavailable. Patients with nevi in association with skeletal disease should be evaluated for serum phosphate and FGF-23. Further studies investigating the role of RAS in FGF-23 regulation are needed. Published by Elsevier Inc.

Next-Generation Sequencing of Matched Primary and Metastatic Rectal Adenocarcinomas Demonstrates Minimal Mutation Gain and Concordance to Colonic Adenocarcinomas.

PubMed

Crumley, Suzanne M; Pepper, Kristi L; Phan, Alexandria T; Olsen, Randall J; Schwartz, Mary R; Portier, Bryce P

2016-06-01

-Colorectal carcinoma is the third most common cause of cancer death in males and females in the United States. Rectal adenocarcinoma can have distinct therapeutic and surgical management from colonic adenocarcinoma owing to its location and anatomic considerations. -To determine the oncologic driver mutations and better understand the molecular pathogenesis of rectal adenocarcinoma in relation to colon adenocarcinoma. -Next-generation sequencing was performed on 20 cases of primary rectal adenocarcinoma with a paired lymph node or solid organ metastasis by using an amplicon-based assay of more than 2800 Catalogue of Somatic Mutations in Cancer (COSMIC)-identified somatic mutations. -Next-generation sequencing data were obtained on both the primary tumor and metastasis from 16 patients. Most rectal adenocarcinoma cases demonstrated identical mutations in the primary tumor and metastasis (13 of 16, 81%). The mutations identified, listed in order of frequency, included TP53, KRAS, APC, FBXW7, GNAS, FGFR3, BRAF, NRAS, PIK3CA, and SMAD4. -The somatic mutations identified in our rectal adenocarcinoma cohort showed a strong correlation to those previously characterized in colonic adenocarcinoma. In addition, most rectal adenocarcinomas harbored identical somatic mutations in both the primary tumor and metastasis. These findings demonstrate evidence that rectal adenocarcinoma follows a similar molecular pathogenesis as colonic adenocarcinoma and that sampling either the primary or metastatic lesion is valid for initial evaluation of somatic mutations and selection of possible targeted therapy.

Abnormal Expressions of DNA Glycosylase Genes NEIL1, NEIL2, and NEIL3 Are Associated with Somatic Mutation Loads in Human Cancer.

PubMed

Shinmura, Kazuya; Kato, Hisami; Kawanishi, Yuichi; Igarashi, Hisaki; Goto, Masanori; Tao, Hong; Inoue, Yusuke; Nakamura, Satoki; Misawa, Kiyoshi; Mineta, Hiroyuki; Sugimura, Haruhiko

2016-01-01

The effects of abnormalities in the DNA glycosylases NEIL1, NEIL2, and NEIL3 on human cancer have not been fully elucidated. In this paper, we found that the median somatic total mutation loads and the median somatic single nucleotide mutation loads exhibited significant inverse correlations with the median NEIL1 and NEIL2 expression levels and a significant positive correlation with the median NEIL3 expression level using data for 13 cancer types from the Cancer Genome Atlas (TCGA) database. A subset of the cancer types exhibited reduced NEIL1 and NEIL2 expressions and elevated NEIL3 expression, and such abnormal expressions of NEIL1, NEIL2, and NEIL3 were also significantly associated with the mutation loads in cancer. As a mechanism underlying the reduced expression of NEIL1 in cancer, the epigenetic silencing of NEIL1 through promoter hypermethylation was found. Finally, we investigated the reason why an elevated NEIL3 expression level was associated with an increased number of somatic mutations in cancer and found that NEIL3 expression was positively correlated with the expression of APOBEC3B, a potent inducer of mutations, in diverse cancers. These results suggested that the abnormal expressions of NEIL1, NEIL2, and NEIL3 are involved in cancer through their association with the somatic mutation load.

Novel somatic and germline mutations in intracranial germ cell tumours.

PubMed

Wang, Linghua; Yamaguchi, Shigeru; Burstein, Matthew D; Terashima, Keita; Chang, Kyle; Ng, Ho-Keung; Nakamura, Hideo; He, Zongxiao; Doddapaneni, Harshavardhan; Lewis, Lora; Wang, Mark; Suzuki, Tomonari; Nishikawa, Ryo; Natsume, Atsushi; Terasaka, Shunsuke; Dauser, Robert; Whitehead, William; Adekunle, Adesina; Sun, Jiayi; Qiao, Yi; Marth, Gábor; Muzny, Donna M; Gibbs, Richard A; Leal, Suzanne M; Wheeler, David A; Lau, Ching C

2014-07-10

Intracranial germ cell tumours (IGCTs) are a group of rare heterogeneous brain tumours that are clinically and histologically similar to the more common gonadal GCTs. IGCTs show great variation in their geographical and gender distribution, histological composition and treatment outcomes. The incidence of IGCTs is historically five- to eightfold greater in Japan and other East Asian countries than in Western countries, with peak incidence near the time of puberty. About half of the tumours are located in the pineal region. The male-to-female incidence ratio is approximately 3-4:1 overall, but is even higher for tumours located in the pineal region. Owing to the scarcity of tumour specimens available for research, little is currently known about this rare disease. Here we report the analysis of 62 cases by next-generation sequencing, single nucleotide polymorphism array and expression array. We find the KIT/RAS signalling pathway frequently mutated in more than 50% of IGCTs, including novel recurrent somatic mutations in KIT, its downstream mediators KRAS and NRAS, and its negative regulator CBL. Novel somatic alterations in the AKT/mTOR pathway included copy number gains of the AKT1 locus at 14q32.33 in 19% of patients, with corresponding upregulation of AKT1 expression. We identified loss-of-function mutations in BCORL1, a transcriptional co-repressor and tumour suppressor. We report significant enrichment of novel and rare germline variants in JMJD1C, which codes for a histone demethylase and is a coactivator of the androgen receptor, among Japanese IGCT patients. This study establishes a molecular foundation for understanding the biology of IGCTs and suggests potentially promising therapeutic strategies focusing on the inhibition of KIT/RAS activation and the AKT1/mTOR pathway.

Novel somatic and germline mutations in intracranial germ cell tumors

PubMed Central

Wang, Linghua; Yamaguchi, Shigeru; Burstein, Matthew D.; Terashima, Keita; Chang, Kyle; Ng, Ho-Keung; Nakamura, Hideo; He, Zongxiao; Doddapaneni, Harshavardhan; Lewis, Lora; Wang, Mark; Suzuki, Tomonari; Nishikawa, Ryo; Natsume, Atsushi; Terasaka, Shunsuke; Dauser, Robert; Whitehead, William; Adekunle, Adesina; Sun, Jiayi; Qiao, Yi; Marth, Gábor; Muzny, Donna M.; Gibbs, Richard A.; Leal, Suzanne M.; Wheeler, David A.; Lau, Ching C.

2015-01-01

Intracranial germ cell tumors (IGCTs) are a group of rare heterogeneous brain tumors which are clinically and histologically similar to the more common gonadal GCTs. IGCTs show great variation in their geographic and gender distribution, histological composition and treatment outcomes. The incidence of IGCTs is historically 5–8 fold greater in Japan and other East Asian countries than in Western countries1 with peak incidence near the time of puberty2. About half of the tumors are located in the pineal region. The male-to-female incidence ratio is approximately 3–4:1 overall but even higher for tumors located in the pineal region3. Due to the scarcity of tumor specimens available for research, little is currently known about this rare disease. Here we report the analysis of 62 cases by next generation sequencing, SNP array and expression array. We find the KIT/RAS signaling pathway frequently mutated in over 50% of IGCTs including novel recurrent somatic mutations in KIT, its downstream mediators KRAS and NRAS, and its negative regulator CBL. Novel somatic alterations in the AKT/mTOR pathway included copy number gain of the AKT1 locus at 14q32.33 in 19% of patients, with corresponding upregulation of AKT1 expression. We identified loss-of-function mutations in BCORL1, a transcriptional corepressor and tumor suppressor. We report significant enrichment of novel and rare germline variants in JMJD1C, a histone demethylase and coactivator of the androgen receptor, among Japanese IGCT patients. This study establishes a molecular foundation for understanding the biology of IGCTs and suggests potentially promising therapeutic strategies focusing on the inhibition of KIT/RAS activation and the AKT1/mTOR pathway. PMID:24896186

Mutational pattern of the nurse shark antigen receptor gene (NAR) is similar to that of mammalian Ig genes and to spontaneous mutations in evolution: the translesion synthesis model of somatic hypermutation.

PubMed

Diaz, M; Velez, J; Singh, M; Cerny, J; Flajnik, M F

1999-05-01

The pattern of somatic mutations of shark and frog Ig is distinct from somatic hypermutation of Ig in mammals in that there is a bias to mutate GC base pairs and a low frequency of mutations. Previous analysis of the new antigen receptor gene in nurse sharks (NAR), however, revealed no bias to mutate GC base pairs and the frequency of mutation was comparable to that of mammalian IgG. Here, we analyzed 1023 mutations in NAR and found no targeting of the mechanism to any particular nucleotide but did obtain strong evidence for a transition bias and for strand polarity. As seen for all species studied to date, the serine codon AGC/T in NAR was a mutational hotspot. The NAR mutational pattern is most similar to that of mammalian IgG and furthermore both are strikingly akin to mutations acquired during the neutral evolution of nuclear pseudogenes, suggesting that a similar mechanism is at work for both processes. In yeast, most spontaneous mutations are introduced by the translesion synthesis DNA polymerase zeta (REV3) and in various DNA repair-deficient backgrounds transitions were more often REV3-dependent than were transversions. Therefore, we propose a model of somatic hypermutation where DNA polymerase zeta is recruited to the Ig locus. An excess of DNA glycosylases in germinal center reactions may further enhance the mutation frequency by a REV3-dependent mutagenic process known as imbalanced base excision repair.

Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures.

PubMed

Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

2014-01-01

High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5-13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known. We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations.

Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures

PubMed Central

Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

2014-01-01

High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5–13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known.     We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations. PMID:24879340

DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

PubMed Central

Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

2005-01-01

Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

PubMed

Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

2015-04-23

With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

PubMed

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

2011-11-24

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

PubMed Central

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

2011-01-01

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

Somatic activating mutations in MAP2K1 cause melorheostosis.

PubMed

Kang, Heeseog; Jha, Smita; Deng, Zuoming; Fratzl-Zelman, Nadja; Cabral, Wayne A; Ivovic, Aleksandra; Meylan, Françoise; Hanson, Eric P; Lange, Eileen; Katz, James; Roschger, Paul; Klaushofer, Klaus; Cowen, Edward W; Siegel, Richard M; Marini, Joan C; Bhattacharyya, Timothy

2018-04-11

Melorheostosis is a sporadic disease of uncertain etiology characterized by asymmetric bone overgrowth and functional impairment. Using whole exome sequencing, we identify somatic mosaic MAP2K1 mutations in affected, but not unaffected, bone of eight unrelated patients with melorheostosis. The activating mutations (Q56P, K57E and K57N) cluster tightly in the MEK1 negative regulatory domain. Affected bone displays a mosaic pattern of increased p-ERK1/2 in osteoblast immunohistochemistry. Osteoblasts cultured from affected bone comprise two populations with distinct p-ERK1/2 levels by flow cytometry, enhanced ERK1/2 activation, and increased cell proliferation. However, these MAP2K1 mutations inhibit BMP2-mediated osteoblast mineralization and differentiation in vitro, underlying the markedly increased osteoid detected in affected bone histology. Mosaicism is also detected in the skin overlying bone lesions in four of five patients tested. Our data show that the MAP2K1 oncogene is important in human bone formation and implicate MEK1 inhibition as a potential treatment avenue for melorheostosis.

ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification.

PubMed

Bao, Riyue; Hernandez, Kyle; Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

2015-01-01

Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud.

Somatic gain-of-function mutations in PIK3CA in patients with macrodactyly.

PubMed

Rios, Jonathan J; Paria, Nandina; Burns, Dennis K; Israel, Bonnie A; Cornelia, Reuel; Wise, Carol A; Ezaki, Marybeth

2013-02-01

Macrodactyly is a discrete congenital anomaly consisting of enlargement of all tissues localized to the terminal portions of a limb, typically within a 'nerve territory'. The classic terminology for this condition is 'lipofibromatous hamartoma of nerve' or Type I macrodactyly. The peripheral nerve, itself, is enlarged both in circumference and in length. It is not related to neurofibromatosis (NF1), nor is it associated with vascular malformations, such as in the recently reported CLOVES syndrome. The specific nerve pathophysiology in this form of macrodactyly has not been well described and a genetic etiology for this specific form of enlargement is unknown. To identify the genetic cause of macrodactyly, we used whole-exome sequencing to identify somatic mutations present in the affected nerve of a single patient. We confirmed a novel mutation in PIK3CA (R115P) present in the patient's affected nerve tissue but not in blood DNA. Sequencing PIK3CA exons identified gain-of-function mutations (E542K, H1047L or H1047R) in the affected tissue of five additional unrelated patients; mutations were absent in blood DNA available from three patients. Immunocytochemistry confirmed AKT activation in cultured cells from the nerve of a macrodactyly patient. Additionally, we found that the most abnormal structure within the involved nerve in a macrodactylous digit is the perineurium, with additional secondary effects on the axon number and size. Thus, isolated congenital macrodactyly is caused by somatic activation of the PI3K/AKT cell-signaling pathway and is genetically and biochemically related to other overgrowth syndromes.

Germline and somatic polymerase ε and δ mutations define a new class of hypermutated colorectal and endometrial cancers

PubMed Central

Briggs, Sarah; Tomlinson, Ian

2013-01-01

Polymerases ϵ and δ are the main enzymes that replicate eukaryotic DNA. Accurate replication occurs through Watson–Crick base pairing and also through the action of the polymerases' exonuclease (proofreading) domains. We have recently shown that germline exonuclease domain mutations (EDMs) of POLE and POLD1 confer a high risk of multiple colorectal adenomas and carcinoma (CRC). POLD1 mutations also predispose to endometrial cancer (EC). These mutations are associated with high penetrance and dominant inheritance, although the phenotype can be variable. We have named the condition polymerase proofreading-associated polyposis (PPAP). Somatic POLE EDMs have also been found in sporadic CRCs and ECs, although very few somatic POLD1 EDMs have been detected. Both the germline and the somatic DNA polymerase EDMs cause an ‘ultramutated’, apparently microsatellite-stable, type of cancer, sometimes leading to over a million base substitutions per tumour. Here, we present the evidence for POLE and POLD1 as important contributors to the pathogenesis of CRC and EC, and highlight some of the key questions in this emerging field. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd PMID:23447401

UV-induced somatic mutations elicit a functional T cell response in the YUMMER1.7 mouse melanoma model.

PubMed

Wang, Jake; Perry, Curtis J; Meeth, Katrina; Thakral, Durga; Damsky, William; Micevic, Goran; Kaech, Susan; Blenman, Kim; Bosenberg, Marcus

2017-07-01

Human melanomas exhibit relatively high somatic mutation burden compared to other malignancies. These somatic mutations may produce neoantigens that are recognized by the immune system, leading to an antitumor response. By irradiating a parental mouse melanoma cell line carrying three driver mutations with UVB and expanding a single-cell clone, we generated a mutagenized model that exhibits high somatic mutation burden. When inoculated at low cell numbers in immunocompetent C57BL/6J mice, YUMMER1.7 (Yale University Mouse Melanoma Exposed to Radiation) regresses after a brief period of growth. This regression phenotype is dependent on T cells as YUMMER1.7 tumors grow significantly faster in immunodeficient Rag1 -/- mice and C57BL/6J mice depleted of CD4 and CD8 T cells. Interestingly, regression can be overcome by injecting higher cell numbers of YUMMER1.7, which results in tumors that grow without effective rejection. Mice that have previously rejected YUMMER1.7 tumors develop immunity against higher doses of YUMMER1.7 tumor challenge. In addition, escaping YUMMER1.7 tumors are sensitive to anti-CTLA-4 and anti-PD-1 therapy, establishing a new model for the evaluation of immune checkpoint inhibition and antitumor immune responses. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genotoxicity testing of different types of beverages in the Drosophila wing Somatic Mutation And Recombination Test.

PubMed

Graf, U; Moraga, A A; Castro, R; Díaz Carrillo, E

1994-05-01

Five wines and one brandy of Spanish origin as well as three herbal teas and ordinary black tea were tested for genotoxicity in the wing Somatic Mutation And Recombination Test (SMART) which makes use of the two recessive wing cell markers multiple wing hairs (mwh) and flare (flr3) on the left arm of chromosome 3 of Drosophila melanogaster. 3-day-old larvae trans-heterozygous for these two markers were fed the beverages at different concentrations and for different feeding periods using Drosophila instant medium. Somatic mutations or mitotic recombinations induced in the cells of the wing imaginal discs give rise to mutant single or twin spots on the wing blade of the emerging adult flies showing either the mwh phenotype or/and the flr phenotype. One of the red wines showed a clear genotoxic activity that was not due to its ethanol content. Two herbal teas (Urtica dioica, Achillea millefolium) and black tea (Camellia sinensis) proved to be weakly genotoxic as well. Furthermore, it was shown that quercetin and rutin, two flavonols present in beverages of plant origin, also exhibited weak genotoxic activity in the somatic cells of Drosophila. These results demonstrate that Drosophila in vivo somatic assays can detect the genotoxicity of complex mixtures such as beverages. In particular, it is possible to administer these test materials in the same form as that in which they are normally consumed.

KIT mutations in Russian patients with mucosal melanoma.

PubMed

Abysheva, Svetlana N; Iyevleva, Aglaya G; Efimova, Nina V; Mokhina, Yulia B; Sabirova, Feruza A; Ivantsov, Alexandr O; Artemieva, Anna S; Togo, Alexandr V; Moiseyenko, Vladimir M; Matsko, Dmitry E; Imyanitov, Evgeny N

2011-12-01

A single institution series of 48 mucosal melanomas (MMs) has been analyzed for the presence of KIT mutations using high-resolution melting and sequencing of abnormally melted DNA fragments. The analysis of exons 9, 11, 13, and 17 has revealed eight of 48 (17%) nonsynonymous alterations, including zero of seven head and neck, six of 24 anorectal, one of 15 genitourinary, one of one gastric, and zero of one mediastinal MMs. Seven of these mutations were potentially associated with the tumor sensitivity to KIT tyrosine kinase inhibitors. One tumor harbored somatically acquired silent nucleotide substitution c.1383A>G (T461T). This study adds to the evidence that a substantial portion of MMs carry a therapeutically relevant mutation in the KIT oncogene.

Multilineage somatic activating mutations in HRAS and NRAS cause mosaic cutaneous and skeletal lesions, elevated FGF23 and hypophosphatemia

PubMed Central

Lim, Young H.; Ovejero, Diana; Sugarman, Jeffrey S.; DeKlotz, Cynthia M.C.; Maruri, Ann; Eichenfield, Lawrence F.; Kelley, Patrick K.; Jüppner, Harald; Gottschalk, Michael; Tifft, Cynthia J.; Gafni, Rachel I.; Boyce, Alison M.; Cowen, Edward W.; Bhattacharyya, Nisan; Guthrie, Lori C.; Gahl, William A.; Golas, Gretchen; Loring, Erin C.; Overton, John D.; Mane, Shrikant M.; Lifton, Richard P.; Levy, Moise L.; Collins, Michael T.; Choate, Keith A.

2014-01-01

Pathologically elevated serum levels of fibroblast growth factor-23 (FGF23), a bone-derived hormone that regulates phosphorus homeostasis, result in renal phosphate wasting and lead to rickets or osteomalacia. Rarely, elevated serum FGF23 levels are found in association with mosaic cutaneous disorders that affect large proportions of the skin and appear in patterns corresponding to the migration of ectodermal progenitors. The cause and source of elevated serum FGF23 is unknown. In those conditions, such as epidermal and large congenital melanocytic nevi, skin lesions are variably associated with other abnormalities in the eye, brain and vasculature. The wide distribution of involved tissues and the appearance of multiple segmental skin and bone lesions suggest that these conditions result from early embryonic somatic mutations. We report five such cases with elevated serum FGF23 and bone lesions, four with large epidermal nevi and one with a giant congenital melanocytic nevus. Exome sequencing of blood and affected skin tissue identified somatic activating mutations of HRAS or NRAS in each case without recurrent secondary mutation, and we further found that the same mutation is present in dysplastic bone. Our finding of somatic activating RAS mutation in bone, the endogenous source of FGF23, provides the first evidence that elevated serum FGF23 levels, hypophosphatemia and osteomalacia are associated with pathologic Ras activation and may provide insight in the heretofore limited understanding of the regulation of FGF23. PMID:24006476

Multilineage somatic activating mutations in HRAS and NRAS cause mosaic cutaneous and skeletal lesions, elevated FGF23 and hypophosphatemia.

PubMed

Lim, Young H; Ovejero, Diana; Sugarman, Jeffrey S; Deklotz, Cynthia M C; Maruri, Ann; Eichenfield, Lawrence F; Kelley, Patrick K; Jüppner, Harald; Gottschalk, Michael; Tifft, Cynthia J; Gafni, Rachel I; Boyce, Alison M; Cowen, Edward W; Bhattacharyya, Nisan; Guthrie, Lori C; Gahl, William A; Golas, Gretchen; Loring, Erin C; Overton, John D; Mane, Shrikant M; Lifton, Richard P; Levy, Moise L; Collins, Michael T; Choate, Keith A

2014-01-15

Pathologically elevated serum levels of fibroblast growth factor-23 (FGF23), a bone-derived hormone that regulates phosphorus homeostasis, result in renal phosphate wasting and lead to rickets or osteomalacia. Rarely, elevated serum FGF23 levels are found in association with mosaic cutaneous disorders that affect large proportions of the skin and appear in patterns corresponding to the migration of ectodermal progenitors. The cause and source of elevated serum FGF23 is unknown. In those conditions, such as epidermal and large congenital melanocytic nevi, skin lesions are variably associated with other abnormalities in the eye, brain and vasculature. The wide distribution of involved tissues and the appearance of multiple segmental skin and bone lesions suggest that these conditions result from early embryonic somatic mutations. We report five such cases with elevated serum FGF23 and bone lesions, four with large epidermal nevi and one with a giant congenital melanocytic nevus. Exome sequencing of blood and affected skin tissue identified somatic activating mutations of HRAS or NRAS in each case without recurrent secondary mutation, and we further found that the same mutation is present in dysplastic bone. Our finding of somatic activating RAS mutation in bone, the endogenous source of FGF23, provides the first evidence that elevated serum FGF23 levels, hypophosphatemia and osteomalacia are associated with pathologic Ras activation and may provide insight in the heretofore limited understanding of the regulation of FGF23.

Germline PMS2 and somatic POLE exonuclease mutations cause hypermutability of the leading DNA strand in biallelic mismatch repair deficiency syndrome brain tumours.

PubMed

Andrianova, Maria A; Chetan, Ghati Kasturirangan; Sibin, Madathan Kandi; Mckee, Thomas; Merkler, Doron; Narasinga, Rao Kvl; Ribaux, Pascale; Blouin, Jean-Louis; Makrythanasis, Periklis; Seplyarskiy, Vladimir B; Antonarakis, Stylianos E; Nikolaev, Sergey I

2017-11-01

Biallelic mismatch repair deficiency (bMMRD) in tumours is frequently associated with somatic mutations in the exonuclease domains of DNA polymerases POLE or POLD1, and results in a characteristic mutational profile. In this article, we describe the genetic basis of ultramutated high-grade brain tumours in the context of bMMRD. We performed exome sequencing of two second-cousin patients from a large consanguineous family of Indian origin with early onset of high-grade glioblastoma and astrocytoma. We identified a germline homozygous nonsense variant, p.R802*, in the PMS2 gene. Additionally, by genome sequencing of these tumours, we found extremely high somatic mutation rates (237/Mb and 123/Mb), as well as somatic mutations in the proofreading domain of POLE polymerase (p.P436H and p.L424V), which replicates the leading DNA strand. Most interestingly, we found, in both cancers, that the vast majority of mutations were consistent with the signature of POLE exo - , i.e. an abundance of C>A and C>T mutations, particularly in special contexts, on the leading strand. We showed that the fraction of mutations under positive selection among mutations in tumour suppressor genes is more than two-fold lower in ultramutated tumours than in other glioblastomas. Genetic analyses enabled the diagnosis of the two consanguineous childhood brain tumours as being due to a combination of PMS2 germline and POLE somatic variants, and confirmed them as bMMRD/POLE exo - disorders. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

ExScalibur: A High-Performance Cloud-Enabled Suite for Whole Exome Germline and Somatic Mutation Identification

PubMed Central

Huang, Lei; Kang, Wenjun; Bartom, Elizabeth; Onel, Kenan; Volchenboum, Samuel; Andrade, Jorge

2015-01-01

Whole exome sequencing has facilitated the discovery of causal genetic variants associated with human diseases at deep coverage and low cost. In particular, the detection of somatic mutations from tumor/normal pairs has provided insights into the cancer genome. Although there is an abundance of publicly-available software for the detection of germline and somatic variants, concordance is generally limited among variant callers and alignment algorithms. Successful integration of variants detected by multiple methods requires in-depth knowledge of the software, access to high-performance computing resources, and advanced programming techniques. We present ExScalibur, a set of fully automated, highly scalable and modulated pipelines for whole exome data analysis. The suite integrates multiple alignment and variant calling algorithms for the accurate detection of germline and somatic mutations with close to 99% sensitivity and specificity. ExScalibur implements streamlined execution of analytical modules, real-time monitoring of pipeline progress, robust handling of errors and intuitive documentation that allows for increased reproducibility and sharing of results and workflows. It runs on local computers, high-performance computing clusters and cloud environments. In addition, we provide a data analysis report utility to facilitate visualization of the results that offers interactive exploration of quality control files, read alignment and variant calls, assisting downstream customization of potential disease-causing mutations. ExScalibur is open-source and is also available as a public image on Amazon cloud. PMID:26271043

Clinical characteristics of non-small cell lung cancer harboring mutations in exon 20 of EGFR or HER2.

PubMed

Takeda, Masayuki; Sakai, Kazuko; Hayashi, Hidetoshi; Tanaka, Kaoru; Tanizaki, Junko; Takahama, Takayuki; Haratani, Koji; Nishio, Kazuto; Nakagawa, Kazuhiko

2018-04-20

Unlike common epidermal growth factor receptor gene ( EGFR ) mutations that confer sensitivity to tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC), mutations in exon 20 of either EGFR or the human EGFR2 gene ( HER2 ) are associated with insensitivity to EGFR-TKIs, with treatment options for patients with such mutations being limited. Clinical characteristics, outcome of EGFR-TKI or nivolumab treatment, and the presence of coexisting mutations were reviewed for NSCLC patients with exon-20 mutations of EGFR or HER2 as detected by routine application of an amplicon-based next-generation sequencing panel. Between July 2013 and June 2017, 206 patients with pathologically confirmed lung cancer were screened for genetic alterations including HER2 and EGFR mutations. Ten patients harbored HER2 exon-20 insertions (one of whom also carried an exon-19 deletion of EGFR ), and 12 patients harbored EGFR exon-20 mutations. Five of the 13 patients with EGFR mutations were treated with EGFR-TKIs, two of whom manifested a partial response, two stable disease, and one progressive disease. Among the seven patients treated with nivolumab, one patient manifested a partial response, three stable disease, and three progressive disease, with most (86%) of these patients discontinuing treatment as a result of disease progression within 4 months. The H1047R mutation of PIK3CA detected in one patient was the only actionable mutation coexisting with the exon-20 mutations of EGFR or HER2 . Potentially actionable mutations thus rarely coexist with exon-20 mutations of EGFR or HER2 , and EGFR-TKIs and nivolumab show limited efficacy in patients with such exon-20 mutations.

Somatic gain-of-function mutations in PIK3CA in patients with macrodactyly

PubMed Central

Rios, Jonathan J.; Paria, Nandina; Burns, Dennis K.; Israel, Bonnie A.; Cornelia, Reuel; Wise, Carol A.; Ezaki, Marybeth

2013-01-01

Macrodactyly is a discrete congenital anomaly consisting of enlargement of all tissues localized to the terminal portions of a limb, typically within a ‘nerve territory’. The classic terminology for this condition is ‘lipofibromatous hamartoma of nerve’ or Type I macrodactyly. The peripheral nerve, itself, is enlarged both in circumference and in length. It is not related to neurofibromatosis (NF1), nor is it associated with vascular malformations, such as in the recently reported CLOVES syndrome. The specific nerve pathophysiology in this form of macrodactyly has not been well described and a genetic etiology for this specific form of enlargement is unknown. To identify the genetic cause of macrodactyly, we used whole-exome sequencing to identify somatic mutations present in the affected nerve of a single patient. We confirmed a novel mutation in PIK3CA (R115P) present in the patient's affected nerve tissue but not in blood DNA. Sequencing PIK3CA exons identified gain-of-function mutations (E542K, H1047L or H1047R) in the affected tissue of five additional unrelated patients; mutations were absent in blood DNA available from three patients. Immunocytochemistry confirmed AKT activation in cultured cells from the nerve of a macrodactyly patient. Additionally, we found that the most abnormal structure within the involved nerve in a macrodactylous digit is the perineurium, with additional secondary effects on the axon number and size. Thus, isolated congenital macrodactyly is caused by somatic activation of the PI3K/AKT cell-signaling pathway and is genetically and biochemically related to other overgrowth syndromes. PMID:23100325

Spectrum of somatic EGFR, KRAS, BRAF, PTEN mutations and TTF-1 expression in Brazilian lung cancer patients.

PubMed

Carneiro, Juliana G; Couto, Patricia G; Bastos-Rodrigues, Luciana; Bicalho, Maria Aparecida C; Vidigal, Paula V; Vilhena, Alyne; Amaral, Nilson F; Bale, Allen E; Friedman, Eitan; De Marco, Luiz

2014-01-01

Lung cancer is the leading global cause of cancer-related mortality. Inter-individual variability in treatment response and prognosis has been associated with genetic polymorphisms in specific genes: EGFR, KRAS, BRAF, PTEN and TTF-1. Somatic mutations in EGFR and KRAS genes are reported at rates of 15-40% in non-small cell lung cancer (NSCLC) in ethnically diverse populations. BRAF and PTEN are commonly mutated genes in various cancer types, including NSCLC, with PTEN mutations exerting an effect on the therapeutic response of EGFR/AKT/PI3K pathway inhibitors. TTF-1 is expressed in approximately 80% of lung adenocarcinomas and its positivity correlates with higher prevalence of EGFR mutation in this cancer type. To determine molecular markers for lung cancer in Brazilian patients, the rate of the predominant EGFR, KRAS, BRAF and PTEN mutations, as well as TTF-1 expression, was assessed in 88 Brazilian NSCLC patients. EGFR exon 19 deletions (del746-750) were detected in 3/88 (3·4%) patients. Activating KRAS mutations in codons 12 and 61 were noted in five (5·7%) and two (2·3%) patients, respectively. None of the common somatic mutations were detected in either the BRAF or PTEN genes. TTF-1 was overexpressed in 40·7% of squamous-cell carcinoma (SCC). Our findings add to a growing body of data that highlights the genetic heterogeneity of the abnormal EGFR pathway in lung cancer among ethnically diverse populations.

Somatic HLA Mutations Expose the Role of Class I-Mediated Autoimmunity in Aplastic Anemia and its Clonal Complications.

PubMed

Babushok, Daria V; Duke, Jamie L; Xie, Hongbo M; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J D; Kearns, Jane; Porter, David L; Podsakoff, Gregory M; Eisenlohr, Laurence C; Biegel, Jaclyn A; Chou, Stella T; Monos, Dimitrios S; Bessler, Monica; Olson, Timothy S

2017-10-10

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by Human Leukocyte Antigen (HLA)-restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole exome sequencing (WES), we recently identified two aAA patients with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the Major Histocompatibility Complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping we screened 66 aAA patients for somatic HLA class I loss. We found somatic HLA loss in eleven patients (17%), with thirteen loss-of-function mutations in HLA-A *33:03, HLA-A *68:01, HLA-B *14:02 and HLA-B *40:02 alleles. Three patients had more than one mutation targeting the same HLA allele. Interestingly, HLA-B *14:02 and HLA-B *40:02 were significantly overrepresented in aAA patients, compared to ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA, and establishes a novel link between aAA patients' immunogenetics and clonal evolution.

Somatic HLA mutations expose the role of class I–mediated autoimmunity in aplastic anemia and its clonal complications

PubMed Central

Duke, Jamie L.; Xie, Hongbo M.; Stanley, Natasha; Atienza, Jamie; Perdigones, Nieves; Nicholas, Peter; Ferriola, Deborah; Li, Yimei; Huang, Hugh; Ye, Wenda; Morrissette, Jennifer J. D.; Kearns, Jane; Porter, David L.; Podsakoff, Gregory M.; Eisenlohr, Laurence C.; Biegel, Jaclyn A.; Chou, Stella T.; Monos, Dimitrios S.; Bessler, Monica; Olson, Timothy S.

2017-01-01

Acquired aplastic anemia (aAA) is an acquired deficiency of early hematopoietic cells, characterized by inadequate blood production, and a predisposition to myelodysplastic syndrome (MDS) and leukemia. Although its exact pathogenesis is unknown, aAA is thought to be driven by human leukocyte antigen (HLA)–restricted T cell immunity, with earlier studies favoring HLA class II-mediated pathways. Using whole-exome sequencing (WES), we recently identified 2 patients with aAA with somatic mutations in HLA class I genes. We hypothesized that HLA class I mutations are pathognomonic for autoimmunity in aAA, but were previously underappreciated because the major histocompatibility complex (MHC) region is notoriously difficult to analyze by WES. Using a combination of targeted deep sequencing of HLA class I genes and single nucleotide polymorphism array (SNP-A) genotyping, we screened 66 patients with aAA for somatic HLA class I loss. We found somatic HLA loss in 11 patients (17%), with 13 loss-of-function mutations in HLA-A*33:03, HLA-A*68:01, HLA-B*14:02, and HLA-B*40:02 alleles. Three patients had more than 1 mutation targeting the same HLA allele. Interestingly, HLA-B*14:02 and HLA-B*40:02 were significantly overrepresented in patients with aAA compared with ethnicity-matched controls. Patients who inherited the targeted HLA alleles, regardless of HLA mutation status, had a more severe disease course with more frequent clonal complications as assessed by WES, SNP-A, and metaphase cytogenetics, and more frequent secondary MDS. The finding of recurrent HLA class I mutations provides compelling evidence for a predominant HLA class I-driven autoimmunity in aAA and establishes a novel link between immunogenetics and clonal evolution of patients with aAA. PMID:28971166

Imatinib for melanomas harboring mutationally activated or amplified KIT arising on mucosal, acral, and chronically sun-damaged skin.

PubMed

Hodi, F Stephen; Corless, Christopher L; Giobbie-Hurder, Anita; Fletcher, Jonathan A; Zhu, Meijun; Marino-Enriquez, Adrian; Friedlander, Philip; Gonzalez, Rene; Weber, Jeffrey S; Gajewski, Thomas F; O'Day, Steven J; Kim, Kevin B; Lawrence, Donald; Flaherty, Keith T; Luke, Jason J; Collichio, Frances A; Ernstoff, Marc S; Heinrich, Michael C; Beadling, Carol; Zukotynski, Katherine A; Yap, Jeffrey T; Van den Abbeele, Annick D; Demetri, George D; Fisher, David E

2013-09-10

Amplifications and mutations in the KIT proto-oncogene in subsets of melanomas provide therapeutic opportunities. We conducted a multicenter phase II trial of imatinib in metastatic mucosal, acral, or chronically sun-damaged (CSD) melanoma with KIT amplifications and/or mutations. Patients received imatinib 400 mg once per day or 400 mg twice per day if there was no initial response. Dose reductions were permitted for treatment-related toxicities. Additional oncogene mutation screening was performed by mass spectroscopy. Twenty-five patients were enrolled (24 evaluable). Eight patients (33%) had tumors with KIT mutations, 11 (46%) with KIT amplifications, and five (21%) with both. Median follow-up was 10.6 months (range, 3.7 to 27.1 months). Best overall response rate (BORR) was 29% (21% excluding nonconfirmed responses) with a two-stage 95% CI of 13% to 51%. BORR was significantly greater than the hypothesized null of 5% and statistically significantly different by mutation status (7 of 13 or 54% KIT mutated v 0% KIT amplified only). There were no statistical differences in rates of progression or survival by mutation status or by melanoma site. The overall disease control rate was 50% but varied significantly by KIT mutation status (77% mutated v 18% amplified). Four patients harbored pretreatment NRAS mutations, and one patient acquired increased KIT amplification after treatment. Melanomas that arise on mucosal, acral, or CSD skin should be assessed for KIT mutations. Imatinib can be effective when tumors harbor KIT mutations, but not if KIT is amplified only. NRAS mutations and KIT copy number gain may be mechanisms of therapeutic resistance to imatinib.

Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

PubMed

Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

2017-07-01

Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

Efficacy and safety of cytotoxic drug chemotherapy after first-line EGFR-TKI treatment in elderly patients with non-small-cell lung cancer harboring sensitive EGFR mutations.

PubMed

Imai, Hisao; Minemura, Hiroyuki; Sugiyama, Tomohide; Yamada, Yutaka; Kaira, Kyoichi; Kanazawa, Kenya; Kasai, Takashi; Kaburagi, Takayuki; Minato, Koichi

2018-05-08

Epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is effective as first-line chemotherapy for patients with advanced non-small-cell lung cancer (NSCLC) harboring sensitive EGFR mutations. However, whether the efficacy of second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment is similar to that of first-line cytotoxic drug chemotherapy in elderly patients aged ≥ 75 years harboring sensitive EGFR mutations is unclear. Therefore, we aimed to investigate the efficacy and safety of cytotoxic drug chemotherapy after first-line EGFR-TKI treatment in elderly patients with NSCLC harboring sensitive EGFR mutations. We retrospectively evaluated the clinical effects and safety profiles of second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment in elderly patients with NSCLC harboring sensitive EGFR mutations (exon 19 deletion/exon 21 L858R mutation). Between April 2008 and December 2015, 78 elderly patients with advanced NSCLC harboring sensitive EGFR mutations received first-line EGFR-TKI at four Japanese institutions. Baseline characteristics, regimens, responses to first- and second-line treatments, whether or not patients received subsequent treatment, and if not, the reasons for non-administration were recorded. Overall, 20 patients with a median age of 79.5 years (range 75-85 years) were included in our analysis. The overall response, disease control, median progression-free survival, and overall survival rates were 15.0, 60.0%, 2.4, and 13.2 months, respectively. Common adverse events included leukopenia, neutropenia, anemia, thrombocytopenia, malaise, and anorexia. Major grade 3 or 4 toxicities included leukopenia (25.0%) and neutropenia (45.0%). No treatment-related deaths were noted. Second-line cytotoxic drug chemotherapy after first-line EGFR-TKI treatment among elderly patients with NSCLC harboring sensitive EGFR mutations was effective and safe and showed equivalent outcomes to first

Somatic Host Cell Alterations in HPV Carcinogenesis

PubMed Central

Litwin, Tamara R.; Clarke, Megan A.; Dean, Michael; Wentzensen, Nicolas

2017-01-01

High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha (PIK3CA) and phosphatase and tensin homolog (PTEN), human leukocyte antigen A and B (HLA-A and HLA-B)-A/B, and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 (TP53) and RB transcriptional corepressor 1 (RB1) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions. PMID:28771191

Somatic Host Cell Alterations in HPV Carcinogenesis.

PubMed

Litwin, Tamara R; Clarke, Megan A; Dean, Michael; Wentzensen, Nicolas

2017-08-03

High-risk human papilloma virus (HPV) infections cause cancers in different organ sites, most commonly cervical and head and neck cancers. While carcinogenesis is initiated by two viral oncoproteins, E6 and E7, increasing evidence shows the importance of specific somatic events in host cells for malignant transformation. HPV-driven cancers share characteristic somatic changes, including apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC)-driven mutations and genomic instability leading to copy number variations and large chromosomal rearrangements. HPV-associated cancers have recurrent somatic mutations in phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha ( PIK3CA ) and phosphatase and tensin homolog ( PTEN ), human leukocyte antigen A and B ( HLA-A and HLA-B ) -A/B , and the transforming growth factor beta (TGFβ) pathway, and rarely have mutations in the tumor protein p53 ( TP53 ) and RB transcriptional corepressor 1 ( RB1 ) tumor suppressor genes. There are some variations by tumor site, such as NOTCH1 mutations which are primarily found in head and neck cancers. Understanding the somatic events following HPV infection and persistence can aid the development of early detection biomarkers, particularly when mutations in precancers are characterized. Somatic mutations may also influence prognosis and treatment decisions.

Mitochondrial DNA mutations in single human blood cells.

PubMed

Yao, Yong-Gang; Kajigaya, Sachiko; Young, Neal S

2015-09-01

Determination mitochondrial DNA (mtDNA) sequences from extremely small amounts of DNA extracted from tissue of limited amounts and/or degraded samples is frequently employed in medical, forensic, and anthropologic studies. Polymerase chain reaction (PCR) amplification followed by DNA cloning is a routine method, especially to examine heteroplasmy of mtDNA mutations. In this review, we compare the mtDNA mutation patterns detected by three different sequencing strategies. Cloning and sequencing methods that are based on PCR amplification of DNA extracted from either single cells or pooled cells yield a high frequency of mutations, partly due to the artifacts introduced by PCR and/or the DNA cloning process. Direct sequencing of PCR product which has been amplified from DNA in individual cells is able to detect the low levels of mtDNA mutations present within a cell. We further summarize the findings in our recent studies that utilized this single cell method to assay mtDNA mutation patterns in different human blood cells. Our data show that many somatic mutations observed in the end-stage differentiated cells are found in hematopoietic stem cells (HSCs) and progenitors within the CD34(+) cell compartment. Accumulation of mtDNA variations in the individual CD34+ cells is affected by both aging and family genetic background. Granulocytes harbor higher numbers of mutations compared with the other cells, such as CD34(+) cells and lymphocytes. Serial assessment of mtDNA mutations in a population of single CD34(+) cells obtained from the same donor over time suggests stability of some somatic mutations. CD34(+) cell clones from a donor marked by specific mtDNA somatic mutations can be found in the recipient after transplantation. The significance of these findings is discussed in terms of the lineage tracing of HSCs, aging effect on accumulation of mtDNA mutations and the usage of mtDNA sequence in forensic identification. Copyright © 2015 Elsevier B.V. All rights

Germline and somatic JAK2 mutations and susceptibility to chronic myeloproliferative neoplasms

PubMed Central

2009-01-01

Myeloproliferative neoplasms (MPNs) are a group of closely related stem-cell-derived clonal proliferative diseases. Most cases are sporadic but first-degree relatives of MPN patients have a five- to seven-fold increased risk for developing an MPN. The tumors of most patients carry a mutation in the Janus kinase 2 gene (JAK2V617F). Recently, three groups have described a strong association of JAK2 germline polymorphisms with MPN in patients positive for JAK2V617F. The somatic mutation occurs primarily on one particular germline JAK2 haplotype, which may account for as much as 50% of the risk to first-degree relatives. This finding provides new directions for unraveling the pathogenesis of MPN. PMID:19490586

Somatic POLE exonuclease domain mutations are early events in sporadic endometrial and colorectal carcinogenesis, determining driver mutational landscape, clonal neoantigen burden and immune response.

PubMed

Temko, Daniel; Van Gool, Inge C; Rayner, Emily; Glaire, Mark; Makino, Seiko; Brown, Matthew; Chegwidden, Laura; Palles, Claire; Depreeuw, Jeroen; Beggs, Andrew; Stathopoulou, Chaido; Mason, John; Baker, Ann-Marie; Williams, Marc; Cerundolo, Vincenzo; Rei, Margarida; Taylor, Jenny C; Schuh, Anna; Ahmed, Ahmed; Amant, Frédéric; Lambrechts, Diether; Smit, Vincent Thbm; Bosse, Tjalling; Graham, Trevor A; Church, David N; Tomlinson, Ian

2018-03-31

Genomic instability, which is a hallmark of cancer, is generally thought to occur in the middle to late stages of tumourigenesis, following the acquisition of permissive molecular aberrations such as TP53 mutation or whole genome doubling. Tumours with somatic POLE exonuclease domain mutations are notable for their extreme genomic instability (their mutation burden is among the highest in human cancer), distinct mutational signature, lymphocytic infiltrate, and excellent prognosis. To what extent these characteristics are determined by the timing of POLE mutations in oncogenesis is unknown. Here, we have shown that pathogenic POLE mutations are detectable in non-malignant precursors of endometrial and colorectal cancer. Using genome and exome sequencing, we found that multiple driver mutations in POLE-mutant cancers show the characteristic POLE mutational signature, including those in genes conventionally regarded as initiators of tumourigenesis. In POLE-mutant cancers, the proportion of monoclonal predicted neoantigens was similar to that in other cancers, but the absolute number was much greater. We also found that the prominent CD8 + T-cell infiltrate present in POLE-mutant cancers was evident in their precursor lesions. Collectively, these data indicate that somatic POLE mutations are early, quite possibly initiating, events in the endometrial and colorectal cancers in which they occur. The resulting early onset of genomic instability may account for the striking immune response and excellent prognosis of these tumours, as well as their early presentation. © 2018 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. © 2018 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

Radiological Features of Brain Metastases from Non-small Cell Lung Cancer Harboring EGFR Mutation.

PubMed

Takamori, Shinkichi; Toyokawa, Gouji; Shimokawa, Mototsugu; Kinoshita, Fumihiko; Kozuma, Yuka; Matsubara, Taichi; Haratake, Naoki; Akamine, Takaki; Mukae, Nobutaka; Hirai, Fumihiko; Tagawa, Tetsuzo; Oda, Yoshinao; Iwaki, Toru; Iihara, Koji; Honda, Hiroshi; Maehara, Yoshihiko

2018-06-01

To investigate the radiological features on computed tomography (CT) of brain metastasis (BM) from epidermal growth factor receptor (EGFR)-mutated non-small cell lung cancer (NSCLC). Thirty-four patients with NSCLC with BMs who underwent surgical resection of the BMs at the Department of Neurosurgery, Kyushu University from 2005 to 2016 were enrolled in the study. The EGFR statuses of the 34 BMs were investigated. Radiological features, including the number, size, and location of the tumor, were delineated by CT. Patients with EGFR-mutated BMs had significantly higher frequencies of multiple metastases than those with the non-EGFR-mutated type (p=0.042). BMs harboring mutations in EGFR were more frequently observed in the central area of the brain compared to those without mutations in EGFR (p=0.037). Careful follow-up of patients with EGFR-mutated NSCLC may be necessary given the high frequencies of multiple BMs and their location in the central area of the brain. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Identical mitochondrial somatic mutations unique to chronic periodontitis and coronary artery disease

PubMed Central

Pallavi, Tokala; Chandra, Rampalli Viswa; Reddy, Aileni Amarender; Reddy, Bavigadda Harish; Naveen, Anumala

2016-01-01

Context: The inflammatory processes involved in chronic periodontitis and coronary artery diseases (CADs) are similar and produce reactive oxygen species that may result in similar somatic mutations in mitochondrial deoxyribonucleic acid (mtDNA). Aims: The aims of the present study were to identify somatic mtDNA mutations in periodontal and cardiac tissues from subjects undergoing coronary artery bypass surgery and determine what fraction was identical and unique to these tissues. Settings and Design: The study population consisted of 30 chronic periodontitis subjects who underwent coronary artery surgery after an angiogram had indicated CAD. Materials and Methods: Gingival tissue samples were taken from the site with deepest probing depth; coronary artery tissue samples were taken during the coronary artery bypass grafting procedures, and blood samples were drawn during this surgical procedure. These samples were stored under aseptic conditions and later transported for mtDNA analysis. Statistical Analysis Used: Complete mtDNA sequences were obtained and aligned with the revised Cambridge reference sequence (NC_012920) using sequence analysis and auto assembler tools. Results: Among the complete mtDNA sequences, a total of 162 variations were spread across the whole mitochondrial genome and present only in the coronary artery and the gingival tissue samples but not in the blood samples. Among the 162 variations, 12 were novel and four of the 12 novel variations were found in mitochondrial NADH dehydrogenase subunit 5 complex I gene (33.3%). Conclusions: Analysis of mtDNA mutations indicated 162 variants unique to periodontitis and CAD. Of these, 12 were novel and may have resulted from destructive oxidative forces common to these two diseases. PMID:27041832

B cell Variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions

PubMed Central

Saini, Jasmine; Hershberg, Uri

2015-01-01

The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire towards the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased towards focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased towards using only highly skewed V genes at all stages of their response. PMID:25660968

B cell variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions.

PubMed

Saini, Jasmine; Hershberg, Uri

2015-05-01

The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire toward the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased toward focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased toward using only highly skewed V genes at all stages of their response. Copyright © 2015 Elsevier Ltd. All rights reserved.

Somatic mosaicism of a CDKL5 mutation identified by next-generation sequencing.

PubMed

Kato, Takeshi; Morisada, Naoya; Nagase, Hiroaki; Nishiyama, Masahiro; Toyoshima, Daisaku; Nakagawa, Taku; Maruyama, Azusa; Fu, Xue Jun; Nozu, Kandai; Wada, Hiroko; Takada, Satoshi; Iijima, Kazumoto

2015-10-01

CDKL5-related encephalopathy is an X-linked dominantly inherited disorder that is characterized by early infantile epileptic encephalopathy or atypical Rett syndrome. We describe a 5-year-old Japanese boy with intractable epilepsy, severe developmental delay, and Rett syndrome-like features. Onset was at 2 months, when his electroencephalogram showed sporadic single poly spikes and diffuse irregular poly spikes. We conducted a genetic analysis using an Illumina® TruSight™ One sequencing panel on a next-generation sequencer. We identified two epilepsy-associated single nucleotide variants in our case: CDKL5 p.Ala40Val and KCNQ2 p.Glu515Asp. CDKL5 p.Ala40Val has been previously reported to be responsible for early infantile epileptic encephalopathy. In our case, the CDKL5 heterozygous mutation showed somatic mosaicism because the boy's karyotype was 46,XY. The KCNQ2 variant p.Glu515Asp is known to cause benign familial neonatal seizures-1, and this variant showed paternal inheritance. Although we believe that the somatic mosaic CDKL5 mutation is mainly responsible for the neurological phenotype in the patient, the KCNQ2 variant might have some neurological effect. Genetic analysis by next-generation sequencing is capable of identifying multiple variants in a patient. Copyright © 2015 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

2010-11-05

Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer

PubMed Central

An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

2015-01-01

Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan–Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients. PMID:26691761

Developmental genes significantly afflicted by aberrant promoter methylation and somatic mutation predict overall survival of late-stage colorectal cancer.

PubMed

An, Ning; Yang, Xue; Cheng, Shujun; Wang, Guiqi; Zhang, Kaitai

2015-12-22

Carcinogenesis is an exceedingly complicated process, which involves multi-level dysregulations, including genomics (majorly caused by somatic mutation and copy number variation), DNA methylomics, and transcriptomics. Therefore, only looking into one molecular level of cancer is not sufficient to uncover the intricate underlying mechanisms. With the abundant resources of public available data in the Cancer Genome Atlas (TCGA) database, an integrative strategy was conducted to systematically analyze the aberrant patterns of colorectal cancer on the basis of DNA copy number, promoter methylation, somatic mutation and gene expression. In this study, paired samples in each genomic level were retrieved to identify differentially expressed genes with corresponding genetic or epigenetic dysregulations. Notably, the result of gene ontology enrichment analysis indicated that the differentially expressed genes with corresponding aberrant promoter methylation or somatic mutation were both functionally concentrated upon developmental process, suggesting the intimate association between development and carcinogenesis. Thus, by means of random walk with restart, 37 significant development-related genes were retrieved from a priori-knowledge based biological network. In five independent microarray datasets, Kaplan-Meier survival and Cox regression analyses both confirmed that the expression of these genes was significantly associated with overall survival of Stage III/IV colorectal cancer patients.

Antitumor activity of alectinib, a selective ALK inhibitor, in an ALK-positive NSCLC cell line harboring G1269A mutation: Efficacy of alectinib against ALK G1269A mutated cells.

PubMed

Yoshimura, Yasushi; Kurasawa, Mitsue; Yorozu, Keigo; Puig, Oscar; Bordogna, Walter; Harada, Naoki

2016-03-01

Alectinib is a highly selective next-generation anaplastic lymphoma kinase (ALK) inhibitor. Although alectinib shows inhibitory activity against various crizotinib-resistant ALK mutations in studies using cell-free kinase assays and Ba/F3 cell-based assays, it has not been tested for efficacy against non-small cell lung cancer (NSCLC) with the ALK mutations. We conducted in vitro and in vivo investigations into the antitumor activity of alectinib against an ALK-positive NSCLC cell line, SNU-2535, which harbors an ALK G1269A mutation. The clinical efficacy of alectinib against a NSCLC patient harboring ALK G1269A mutation was evaluated in the phase I part of the North American study. Alectinib exhibited antiproliferative activity against SNU-2535 cells in vitro with IC50 of 33.1 nM. Alectinib strongly inhibited phosphorylation of ALK and its downstream signaling molecules ERK1/2, AKT, and STAT3. In a mouse xenograft model, once-daily oral administration of alectinib for 21 days resulted in strong tumor regression. In addition, administration of alectinib for 100 days achieved continuous tumor regression without tumor regrowth in all mice. Notably, eradication of tumor cells was observed in half of the mice. In the clinical study, a patient with ALK G1269A mutation showed partial response to alectinib with a duration of response of 84 days. These results indicated that alectinib has potent antitumor activity against NSCLC cells harboring the crizotinib-resistant mutation ALK G1269A. It is expected that alectinib would provide a valuable therapeutic option for patients with NSCLC having not only native ALK but also crizotinib-resistant ALK mutations.

Correlation of somatic mutations and clinical outcome in melanoma patients treated with carboplatin, paclitaxel, and sorafenib

PubMed Central

Wilson, Melissa A.; Zhao, Fengmin; Letrero, Richard; D’Andrea, Kurt; Rimm, David L.; Kirkwood, John M.; Kluger, Harriet M.; Lee, Sandra J.; Schuchter, Lynn M.; Flaherty, Keith T.; Nathanson, Katherine L.

2014-01-01

Purpose Sorafenib is an inhibitor of VEGFR, PDGFR, and RAF kinases, amongst others. We assessed the association of somatic mutations with clinicopathologic features and clinical outcomes in patients with metastatic melanoma treated on E2603, comparing treatment with carboplatin, paclitaxel +/− sorafenib (CP vs. CPS). Experimental Design Pre-treatment tumor samples from 179 unique individuals enrolled on E2603 were analyzed. Genotyping was performed using a custom iPlex panel interrogating 74 mutations in 13 genes. Statistical analysis was performed using Fisher’s exact test, logistic regression, and Cox’s proportional-hazards models. Progression free survival and overall survival were estimated using Kaplan-Meier methods. Results BRAF and NRAS mutations were found at frequencies consistent with other metastatic melanoma cohorts. BRAF-mutant melanoma was associated with worse performance status, increased number of disease sites, and younger age at diagnosis; NRAS-mutant melanoma was associated with better performance status, fewer sites of disease, and female gender. BRAF and NRAS mutations were not significantly predictive of response or survival when treated with CPS vs. CP. However, patients with NRAS-mutant melanoma trended towards a worse response and PFS on CP than those with BRAF-mutant or WT/WT melanoma, an association that was reversed for this group on the CPS arm. Conclusions This study of somatic mutations in melanoma is the last prospectively collected phase III clinical trial population prior to the era of BRAF targeted therapy. A trend towards improved clinical response in patients with NRAS-mutant melanoma treated with CPS was observed, possibly due to sorafenib’s effect on CRAF. PMID:24714776

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

PubMed

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Differences in somatic mutation landscape of hepatocellular carcinoma in Asian American and European American populations

PubMed Central

Hu, Qiang; Yan, Li; Liu, Biao; Ambrosone, Christine B.; Wang, Jianmin; Liu, Song

2016-01-01

The incidence rate of hepatocellular carcinoma (HCC) is higher in populations of Asian ancestry than European ancestry (EA). We sought to investigate HCC mutational differences between the two populations, which may reflect differences in the prevalence of etiological factors. We compared HCC somatic mutations in patients of self-reported Asian American and EA from The Cancer Genome Atlas (TCGA), and assessed associations of tumor mutations with established HCC risk factors. Although the average mutation burden was similar, TP53 and RB1 were mutated at a much higher frequency in Asian Americans than in EAs (TP53: 43% vs. 21%; RB1: 19% vs. 2%). Three putative oncogenic genes, including TRPM3, SAGE1, and ADAMTS7, were mutated exclusively in Asians. In addition, VEGF binding pathway, a druggable target by tyrosine kinase inhibitors such as sorafenib, was mutated at a higher frequency among Asians (13% vs. 2%); while the negative regulation of IL17 production, involved in inflammation and autoimmunity, was mutated only in EAs (12% vs. 0). Accounting for HCC risk factors had little impact on any of the mutational differences. In conclusion, we demonstrated here mutational differences in important cancer genes and pathways between Asian and European ancestries. These differences may have implications for the prevention and treatment of HCC. PMID:27246981

Differences in somatic mutation landscape of hepatocellular carcinoma in Asian American and European American populations.

PubMed

Yao, Song; Johnson, Christopher; Hu, Qiang; Yan, Li; Liu, Biao; Ambrosone, Christine B; Wang, Jianmin; Liu, Song

2016-06-28

The incidence rate of hepatocellular carcinoma (HCC) is higher in populations of Asian ancestry than European ancestry (EA). We sought to investigate HCC mutational differences between the two populations, which may reflect differences in the prevalence of etiological factors. We compared HCC somatic mutations in patients of self-reported Asian American and EA from The Cancer Genome Atlas (TCGA), and assessed associations of tumor mutations with established HCC risk factors. Although the average mutation burden was similar, TP53 and RB1 were mutated at a much higher frequency in Asian Americans than in EAs (TP53: 43% vs. 21%; RB1: 19% vs. 2%). Three putative oncogenic genes, including TRPM3, SAGE1, and ADAMTS7, were mutated exclusively in Asians. In addition, VEGF binding pathway, a druggable target by tyrosine kinase inhibitors such as sorafenib, was mutated at a higher frequency among Asians (13% vs. 2%); while the negative regulation of IL17 production, involved in inflammation and autoimmunity, was mutated only in EAs (12% vs. 0). Accounting for HCC risk factors had little impact on any of the mutational differences. In conclusion, we demonstrated here mutational differences in important cancer genes and pathways between Asian and European ancestries. These differences may have implications for the prevention and treatment of HCC.

Low frequency of broadly neutralizing HIV antibodies during chronic infection even in quaternary epitope targeting antibodies containing large numbers of somatic mutations.

PubMed

Hicar, Mark D; Chen, Xuemin; Kalams, Spyros A; Sojar, Hakimuddin; Landucci, Gary; Forthal, Donald N; Spearman, Paul; Crowe, James E

2016-02-01

Neutralizing antibodies (Abs) are thought to be a critical component of an appropriate HIV vaccine response. It has been proposed that Abs recognizing conformationally dependent quaternary epitopes on the HIV envelope (Env) trimer may be necessary to neutralize diverse HIV strains. A number of recently described broadly neutralizing monoclonal Abs (mAbs) recognize complex and quaternary epitopes. Generally, many such Abs exhibit extensive numbers of somatic mutations and unique structural characteristics. We sought to characterize the native antibody (Ab) response against circulating HIV focusing on such conformational responses, without a prior selection based on neutralization. Using a capture system based on VLPs incorporating cleaved envelope protein, we identified a selection of B cells that produce quaternary epitope targeting Abs (QtAbs). Similar to a number of broadly neutralizing Abs, the Ab genes encoding these QtAbs showed extensive numbers of somatic mutations. However, when expressed as recombinant molecules, these Abs failed to neutralize virus or mediate ADCVI activity. Molecular analysis showed unusually high numbers of mutations in the Ab heavy chain framework 3 region of the variable genes. The analysis suggests that large numbers of somatic mutations occur in Ab genes encoding HIV Abs in chronically infected individuals in a non-directed, stochastic, manner. Copyright © 2015 Elsevier Ltd. All rights reserved.

A somatic-mutational process recurrently duplicates germline susceptibility loci and tissue-specific super-enhancers in breast cancers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glodzik, Dominik; Morganella, Sandro; Davies, Helen

Somatic rearrangements contribute to the mutagenized landscape of cancer genomes. Here, we systematically interrogated rearrangements in 560 breast cancers by using a piecewise constant fitting approach. We identified 33 hotspots of large (>100 kb) tandem duplications, a mutational signature associated with homologous-recombination-repair deficiency. Notably, these tandem-duplication hotspots were enriched in breast cancer germline susceptibility loci (odds ratio (OR) = 4.28) and breast-specific 'super-enhancer' regulatory elements (OR = 3.54). These hotspots may be sites of selective susceptibility to double-strand-break damage due to high transcriptional activity or, through incrementally increasing copy number, may be sites of secondary selective pressure. Furthermore, the transcriptomicmore » consequences ranged from strong individual oncogene effects to weak but quantifiable multigene expression effects. We thus present a somatic-rearrangement mutational process affecting coding sequences and noncoding regulatory elements and contributing a continuum of driver consequences, from modest to strong effects, thereby supporting a polygenic model of cancer development.« less

A somatic-mutational process recurrently duplicates germline susceptibility loci and tissue-specific super-enhancers in breast cancers

DOE PAGES

Glodzik, Dominik; Morganella, Sandro; Davies, Helen; ...

2017-01-23

Somatic rearrangements contribute to the mutagenized landscape of cancer genomes. Here, we systematically interrogated rearrangements in 560 breast cancers by using a piecewise constant fitting approach. We identified 33 hotspots of large (>100 kb) tandem duplications, a mutational signature associated with homologous-recombination-repair deficiency. Notably, these tandem-duplication hotspots were enriched in breast cancer germline susceptibility loci (odds ratio (OR) = 4.28) and breast-specific 'super-enhancer' regulatory elements (OR = 3.54). These hotspots may be sites of selective susceptibility to double-strand-break damage due to high transcriptional activity or, through incrementally increasing copy number, may be sites of secondary selective pressure. Furthermore, the transcriptomicmore » consequences ranged from strong individual oncogene effects to weak but quantifiable multigene expression effects. We thus present a somatic-rearrangement mutational process affecting coding sequences and noncoding regulatory elements and contributing a continuum of driver consequences, from modest to strong effects, thereby supporting a polygenic model of cancer development.« less

Ultra-sensitive Sequencing Identifies High Prevalence of Clonal Hematopoiesis-Associated Mutations throughout Adult Life.

PubMed

Acuna-Hidalgo, Rocio; Sengul, Hilal; Steehouwer, Marloes; van de Vorst, Maartje; Vermeulen, Sita H; Kiemeney, Lambertus A L M; Veltman, Joris A; Gilissen, Christian; Hoischen, Alexander

2017-07-06

Clonal hematopoiesis results from somatic mutations in hematopoietic stem cells, which give an advantage to mutant cells, driving their clonal expansion and potentially leading to leukemia. The acquisition of clonal hematopoiesis-driver mutations (CHDMs) occurs with normal aging and these mutations have been detected in more than 10% of individuals ≥65 years. We aimed to examine the prevalence and characteristics of CHDMs throughout adult life. We developed a targeted re-sequencing assay combining high-throughput with ultra-high sensitivity based on single-molecule molecular inversion probes (smMIPs). Using smMIPs, we screened more than 100 loci for CHDMs in more than 2,000 blood DNA samples from population controls between 20 and 69 years of age. Loci screened included 40 regions known to drive clonal hematopoiesis when mutated and 64 novel candidate loci. We identified 224 somatic mutations throughout our cohort, of which 216 were coding mutations in known driver genes (DNMT3A, JAK2, GNAS, TET2, and ASXL1), including 196 point mutations and 20 indels. Our assay's improved sensitivity allowed us to detect mutations with variant allele frequencies as low as 0.001. CHDMs were identified in more than 20% of individuals 60 to 69 years of age and in 3% of individuals 20 to 29 years of age, approximately double the previously reported prevalence despite screening a limited set of loci. Our findings support the occurrence of clonal hematopoiesis-associated mutations as a widespread mechanism linked with aging, suggesting that mosaicism as a result of clonal evolution of cells harboring somatic mutations is a universal mechanism occurring at all ages in healthy humans. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

The Impact of Environmental and Endogenous Damage on Somatic Mutation Load in Human Skin Fibroblasts

PubMed Central

Saini, Natalie; Chan, Kin; Grimm, Sara A.; Dai, Shuangshuang; Fargo, David C.; Kaufmann, William K.; Taylor, Jack A.; Lee, Eunjung; Cortes-Ciriano, Isidro; Park, Peter J.; Schurman, Shepherd H.; Malc, Ewa P.; Mieczkowski, Piotr A.

2016-01-01

Accumulation of somatic changes, due to environmental and endogenous lesions, in the human genome is associated with aging and cancer. Understanding the impacts of these processes on mutagenesis is fundamental to understanding the etiology, and improving the prognosis and prevention of cancers and other genetic diseases. Previous methods relying on either the generation of induced pluripotent stem cells, or sequencing of single-cell genomes were inherently error-prone and did not allow independent validation of the mutations. In the current study we eliminated these potential sources of error by high coverage genome sequencing of single-cell derived clonal fibroblast lineages, obtained after minimal propagation in culture, prepared from skin biopsies of two healthy adult humans. We report here accurate measurement of genome-wide magnitude and spectra of mutations accrued in skin fibroblasts of healthy adult humans. We found that every cell contains at least one chromosomal rearrangement and 600–13,000 base substitutions. The spectra and correlation of base substitutions with epigenomic features resemble many cancers. Moreover, because biopsies were taken from body parts differing by sun exposure, we can delineate the precise contributions of environmental and endogenous factors to the accrual of genetic changes within the same individual. We show here that UV-induced and endogenous DNA damage can have a comparable impact on the somatic mutation loads in skin fibroblasts. Trial Registration ClinicalTrials.gov NCT01087307 PMID:27788131

Somatic mutations in benign breast disease tissue and risk of subsequent invasive breast cancer.

PubMed

Rohan, Thomas E; Miller, Christopher A; Li, Tiandao; Wang, Yihong; Loudig, Olivier; Ginsberg, Mindy; Glass, Andrew; Mardis, Elaine

2018-06-06

Insights into the molecular pathogenesis of breast cancer might come from molecular analysis of tissue from early stages of the disease. We conducted a case-control study nested in a cohort of women who had biopsy-confirmed benign breast disease (BBD) diagnosed between 1971 and 2006 at Kaiser Permanente Northwest and who were followed to mid-2015 to ascertain subsequent invasive breast cancer (IBC); cases (n = 218) were women with BBD who developed subsequent IBC and controls, individually matched (1:1) to cases, were women with BBD who did not develop IBC in the same follow-up interval as that for the corresponding case. Targeted sequence capture and sequencing were performed for 83 genes of importance in breast cancer. There were no significant case-control differences in mutation burden overall, for non-silent mutations, for individual genes, or with respect either to the nature of the gene mutations or to mutational enrichment at the pathway level. For seven subjects with DNA from the BBD and ipsilateral IBC, virtually no mutations were shared. This study, the first to use a targeted multi-gene sequencing approach on early breast cancer precursor lesions to investigate the genomic basis of the disease, showed that somatic mutations detected in BBD tissue were not associated with breast cancer risk.

Endometrial cancer and somatic G>T KRAS transversion in patients with constitutional MUTYH biallelic mutations.

PubMed

Tricarico, Rossella; Bet, Paola; Ciambotti, Benedetta; Di Gregorio, Carmela; Gatteschi, Beatrice; Gismondi, Viviana; Toschi, Benedetta; Tonelli, Francesco; Varesco, Liliana; Genuardi, Maurizio

2009-02-18

MUTYH-associated polyposis (MAP) is an autosomal recessive condition predisposing to colorectal cancer, caused by constitutional biallelic mutations in the base excision repair (BER) gene MUTYH. Colorectal tumours from MAP patients display an excess of somatic G>T mutations in the APC and KRAS genes due to defective BER function. To date, few extracolonic manifestations have been observed in MAP patients, and the clinical spectrum of this condition is not yet fully established. Recently, one patient with a diagnosis of endometrial cancer and biallelic MUTYH mutations has been described. We here report on two additional unrelated MAP patients with biallelic MUTYH germline mutations who developed endometrioid endometrial carcinoma. The endometrial tumours were evaluated for PTEN, PIK3CA, KRAS, BRAF and CTNNB1 mutations. A G>T transversion at codon 12 of the KRAS gene was observed in one tumour. A single 1bp frameshift deletion of PTEN was observed in the same sample. Overall, these findings suggest that endometrial carcinoma is a phenotypic manifestations of MAP and that inefficient repair of oxidative damage can be involved in its pathogenesis.

Somatic INK4a-ARF locus mutations: a significant mechanism of gene inactivation in squamous cell carcinomas of the head and neck.

PubMed

Poi, M J; Yen, T; Li, J; Song, H; Lang, J C; Schuller, D E; Pearl, D K; Casto, B C; Tsai, M D; Weghorst, C M

2001-01-01

The INK4a-ARF locus is located on human chromosome 9p21 and is known to encode two functionally distinct tumor-suppressor genes. The p16(INK4a) (p16) tumor-suppressor gene product is a negative regulator of cyclin-dependent kinases 4 and 6, which in turn positively regulate progression of mammalian cells through the cell cycle. The p14(ARF) tumor-suppressor gene product specifically interacts with human double minute 2, leading to the subsequent stabilization of p53 and G(1) arrest. Previous investigations analyzing the p16 gene in squamous cell carcinomas of the head and neck (SCCHNs) have suggested the predominate inactivating events to be homozygous gene deletions and hypermethylation of the p16 promoter. Somatic mutational inactivation of p16 has been reported to be low (0-10%, with a combined incidence of 25 of 279, or 9%) and to play only a minor role in the development of SCCHN. The present study examined whether this particular mechanism of INK4a/ARF inactivation, specifically somatic mutation, has been underestimated in SCCHN by determining the mutational status of the p16 and p14(ARF) genes in 100 primary SCCHNs with the use of polymerase chain reaction technology and a highly sensitive, nonradioactive modification of single-stranded conformational polymorphism (SSCP) analysis termed "cold" SSCP. Exons 1alpha, 1beta, and 2 of INK4a/ARF were amplified using intron-based primers or a combination of intron- and exon-based primers. A total of 27 SCCHNs (27%) exhibited sequence alterations in this locus, 22 (22%) of which were somatic sequence alterations and five (5%) of which were a single polymorphism in codon 148. Of the 22 somatic alterations, 20 (91%) directly or indirectly involved exon 2, and two (9%) were located within exon 1alpha. No mutations were found in exon 1beta. All 22 somatic mutations would be expected to yield altered p16 proteins, but only 15 of them should affect p14(ARF) proteins. Specific somatic alterations included microdeletions or

DNA polymerase ι functions in the generation of tandem mutations during somatic hypermutation of antibody genes.

PubMed

Maul, Robert W; MacCarthy, Thomas; Frank, Ekaterina G; Donigan, Katherine A; McLenigan, Mary P; Yang, William; Saribasak, Huseyin; Huston, Donald E; Lange, Sabine S; Woodgate, Roger; Gearhart, Patricia J

2016-08-22

DNA polymerase ι (Pol ι) is an attractive candidate for somatic hypermutation in antibody genes because of its low fidelity. To identify a role for Pol ι, we analyzed mutations in two strains of mice with deficiencies in the enzyme: 129 mice with negligible expression of truncated Pol ι, and knock-in mice that express full-length Pol ι that is catalytically inactive. Both strains had normal frequencies and spectra of mutations in the variable region, indicating that loss of Pol ι did not change overall mutagenesis. We next examined if Pol ι affected tandem mutations generated by another error-prone polymerase, Pol ζ. The frequency of contiguous mutations was analyzed using a novel computational model to determine if they occur during a single DNA transaction or during two independent events. Analyses of 2,000 mutations from both strains indicated that Pol ι-compromised mice lost the tandem signature, whereas C57BL/6 mice accumulated significant amounts of double mutations. The results support a model where Pol ι occasionally accesses the replication fork to generate a first mutation, and Pol ζ extends the mismatch with a second mutation. @2016.

DNA polymerase ι functions in the generation of tandem mutations during somatic hypermutation of antibody genes

PubMed Central

Donigan, Katherine A.; Huston, Donald E.; Lange, Sabine S.

2016-01-01

DNA polymerase ι (Pol ι) is an attractive candidate for somatic hypermutation in antibody genes because of its low fidelity. To identify a role for Pol ι, we analyzed mutations in two strains of mice with deficiencies in the enzyme: 129 mice with negligible expression of truncated Pol ι, and knock-in mice that express full-length Pol ι that is catalytically inactive. Both strains had normal frequencies and spectra of mutations in the variable region, indicating that loss of Pol ι did not change overall mutagenesis. We next examined if Pol ι affected tandem mutations generated by another error-prone polymerase, Pol ζ. The frequency of contiguous mutations was analyzed using a novel computational model to determine if they occur during a single DNA transaction or during two independent events. Analyses of 2,000 mutations from both strains indicated that Pol ι–compromised mice lost the tandem signature, whereas C57BL/6 mice accumulated significant amounts of double mutations. The results support a model where Pol ι occasionally accesses the replication fork to generate a first mutation, and Pol ζ extends the mismatch with a second mutation. PMID:27455952

Novel somatic mutations in the catalytic subunit of the protein kinase A as a cause of adrenal Cushing's syndrome: a European multicentric study.

PubMed

Di Dalmazi, Guido; Kisker, Caroline; Calebiro, Davide; Mannelli, Massimo; Canu, Letizia; Arnaldi, Giorgio; Quinkler, Marcus; Rayes, Nada; Tabarin, Antoine; Laure Jullié, Marie; Mantero, Franco; Rubin, Beatrice; Waldmann, Jens; Bartsch, Detlef K; Pasquali, Renato; Lohse, Martin; Allolio, Bruno; Fassnacht, Martin; Beuschlein, Felix; Reincke, Martin

2014-10-01

Somatic mutations in PRKACA gene, encoding the catalytic subunit of protein kinase A (PKA), have been recently found in a high proportion of sporadic adenomas associated with Cushing's syndrome. The aim was to analyze the PRKACA mutation in a large cohort of patients with adrenocortical masses. Samples from nine European centers were included (Germany, n = 4; Italy, n = 4; France, n = 1). Samples were drawn from 149 patients with nonsecreting adenomas (n = 32 + 2 peritumoral), subclinical hypercortisolism (n = 36), Cushing's syndrome (n = 64 + 2 peritumoral), androgen-producing tumors (n = 4), adrenocortical carcinomas (n = 5 + 2 peritumoral), and primary bilateral macronodular adrenal hyperplasias (n = 8). Blood samples were available from patients with nonsecreting adenomas (n = 15), subclinical hypercortisolism (n = 10), and Cushing's syndrome (n = 35). Clinical and hormonal data were collected. DNA amplification by PCR of exons 6 and 7 of the PRKACA gene and direct sequencing were performed. PRKACA heterozygous mutations were found in 22/64 samples of Cushing's syndrome patients (34%). No mutations were found in peritumoral tissue and blood samples or in other tumors examined. The c.617A>C (p.Leu206Arg) occurred in 18/22 patients. Furthermore, two novel mutations were identified: c.600_601insGTG/p.Cys200_Gly201insVal in three patients and c.639C>G+c.638_640insATTATCCTGAGG/p.Ser213Arg+p.Leu212_Lys214insIle-Ile-Leu-Arg) in one. All the mutations involved a region implicated in interaction between PKA regulatory and catalytic subunits. Patients with somatic PRKACA mutations showed higher levels of cortisol after dexamethasone test and a smaller adenoma size, compared with nonmutated subjects. These data confirm and extend previous observations that somatic PRKACA mutations are specific for adrenocortical adenomas causing Cushing's syndrome.

Multiplex Droplet Digital PCR Quantification of Recurrent Somatic Mutations in Diffuse Large B-Cell and Follicular Lymphoma.

PubMed

Alcaide, Miguel; Yu, Stephen; Bushell, Kevin; Fornika, Daniel; Nielsen, Julie S; Nelson, Brad H; Mann, Koren K; Assouline, Sarit; Johnson, Nathalie A; Morin, Ryan D

2016-09-01

A plethora of options to detect mutations in tumor-derived DNA currently exist but each suffers limitations in analytical sensitivity, cost, or scalability. Droplet digital PCR (ddPCR) is an appealing technology for detecting the presence of specific mutations based on a priori knowledge and can be applied to tumor biopsies, including formalin-fixed paraffin embedded (FFPE) tissues. More recently, ddPCR has gained popularity in its utility in quantifying circulating tumor DNA. We have developed a suite of novel ddPCR assays for detecting recurrent mutations that are prevalent in common B-cell non-Hodgkin lymphomas (NHLs), including diffuse large B-cell lymphoma, follicular lymphoma, and lymphoplasmacytic lymphoma. These assays allowed the differentiation and counting of mutant and wild-type molecules using one single hydrolysis probe. We also implemented multiplexing that allowed the simultaneous detection of distinct mutations and an "inverted" ddPCR assay design, based on employing probes matching wild-type alleles, capable of detecting the presence of multiple single nucleotide polymorphisms. The assays successfully detected and quantified somatic mutations commonly affecting enhancer of zeste 2 polycomb repressive complex 2 subunit (EZH2) (Y641) and signal transducer and activator of transcription 6 (STAT6) (D419) hotspots in fresh tumor, FFPE, and liquid biopsies. The "inverted" ddPCR approach effectively reported any single nucleotide variant affecting either of these 2 hotspots as well. Finally, we could effectively multiplex hydrolysis probes targeting 2 additional lymphoma-related hotspots: myeloid differentiation primary response 88 (MYD88; L265P) and cyclin D3 (CCND3; I290R). Our suite of ddPCR assays provides sufficient analytical sensitivity and specificity for either the invasive or noninvasive detection of multiple recurrent somatic mutations in B-cell NHLs. © 2016 American Association for Clinical Chemistry.

Kv1.1 channelopathy abolishes presynaptic spike width modulation by subthreshold somatic depolarization

PubMed Central

Vivekananda, Umesh; Novak, Pavel; Bello, Oscar D.; Korchev, Yuri E.; Krishnakumar, Shyam S.; Volynski, Kirill E.; Kullmann, Dimitri M.

2017-01-01

Although action potentials propagate along axons in an all-or-none manner, subthreshold membrane potential fluctuations at the soma affect neurotransmitter release from synaptic boutons. An important mechanism underlying analog–digital modulation is depolarization-mediated inactivation of presynaptic Kv1-family potassium channels, leading to action potential broadening and increased calcium influx. Previous studies have relied heavily on recordings from blebs formed after axon transection, which may exaggerate the passive propagation of somatic depolarization. We recorded instead from small boutons supplied by intact axons identified with scanning ion conductance microscopy in primary hippocampal cultures and asked how distinct potassium channels interact in determining the basal spike width and its modulation by subthreshold somatic depolarization. Pharmacological or genetic deletion of Kv1.1 broadened presynaptic spikes without preventing further prolongation by brief depolarizing somatic prepulses. A heterozygous mouse model of episodic ataxia type 1 harboring a dominant Kv1.1 mutation had a similar broadening effect on basal spike shape as deletion of Kv1.1; however, spike modulation by somatic prepulses was abolished. These results argue that the Kv1.1 subunit is not necessary for subthreshold modulation of spike width. However, a disease-associated mutant subunit prevents the interplay of analog and digital transmission, possibly by disrupting the normal stoichiometry of presynaptic potassium channels. PMID:28193892

Ultrasensitive Detection of Multiplexed Somatic Mutations Using MALDI-TOF Mass Spectrometry.

PubMed

Mosko, Michael J; Nakorchevsky, Aleksey A; Flores, Eunice; Metzler, Heath; Ehrich, Mathias; van den Boom, Dirk J; Sherwood, James L; Nygren, Anders O H

2016-01-01

Multiplex detection of low-frequency mutations is becoming a necessary diagnostic tool for clinical laboratories interested in noninvasive prognosis and prediction. Challenges include the detection of minor alleles among abundant wild-type alleles, the heterogeneous nature of tumors, and the limited amount of available tissue. A method that can reliably detect minor variants <1% in a multiplexed reaction using a platform amenable to a variety of throughputs would meet these requirements. We developed a novel approach, UltraSEEK, for high-throughput, multiplexed, ultrasensitive mutation detection and used it for detection of mutant sequence mixtures as low as 0.1% minor allele frequency. The process consisted of multiplex PCR, followed by mutation-specific, single-base extension using chain terminators labeled with a moiety for solid phase capture. The captured and enriched products were then identified using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. For verification, we successfully analyzed ultralow fractions of mutations in a set of characterized cell lines, and included a direct comparison to droplet digital PCR. Finally, we verified the specificity in a set of 122 paired tumor and circulating cell-free DNA samples from melanoma patients. Our results show that the UltraSEEK chemistry is a particularly powerful approach for the detection of somatic variants, with the potential to be an invaluable resource to investigators in saving time and material without compromising analytical sensitivity and accuracy. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Correlation of ophthalmic examination with carrier status in females potentially harboring a severe Norrie disease gene mutation.

PubMed

Khan, Arif O; Aldahmesh, Mohammed A; Meyer, Brian

2008-04-01

To correlate ophthalmic findings with carrier status for a severe Norrie disease (ND) gene mutation (C95F). Prospective interventional case series. Six potential carriers and 1 obligate carrier from a family harboring the mutation. An ophthalmologist blind to the pedigree performed a full ophthalmic examination for the 7 asymptomatic family members. A peripheral blood sample was collected from each for ND gene sequencing. Ophthalmic examination findings (with attention to the presence or absence of retinal findings) and results of ND gene sequencing. Three carriers were identified by molecular genetics, and all 3 of them had peripheral retinal abnormality. However, 3 of the 4 genetically identified noncarriers also exhibited peripheral retinal abnormality. Two of these noncarriers with retinal findings were the offspring of a confirmed noncarrier. The genetically identified noncarrier with a normal peripheral retinal examination was the daughter of an obligate carrier. The presence of peripheral retinal changes was not useful for carrier prediction in a family harboring ND. There are likely additional loci responsible for phenotypic expression.

Clinical implications of somatic mutations in aplastic anemia and myelodysplastic syndrome in genomic age.

PubMed

Maciejewski, Jaroslaw P; Balasubramanian, Suresh K

2017-12-08

Recent technological advances in genomics have led to the discovery of new somatic mutations and have brought deeper insights into clonal diversity. This discovery has changed not only the understanding of disease mechanisms but also the diagnostics and clinical management of bone marrow failure. The clinical applications of genomics include enhancement of current prognostic schemas, prediction of sensitivity or refractoriness to treatments, and conceptualization and selective application of targeted therapies. However, beyond these traditional clinical aspects, complex hierarchical clonal architecture has been uncovered and linked to the current concepts of leukemogenesis and stem cell biology. Detection of clonal mutations, otherwise typical of myelodysplastic syndrome, in the course of aplastic anemia (AA) and paroxysmal nocturnal hemoglobinuria has led to new pathogenic concepts in these conditions and created a new link between AA and its clonal complications, such as post-AA and paroxysmal nocturnal hemoglobinuria. Distinctions among founder vs subclonal mutations, types of clonal evolution (linear or branching), and biological features of individual mutations (sweeping, persistent, or vanishing) will allow for better predictions of the biologic impact they impart in individual cases. As clonal markers, mutations can be used for monitoring clonal dynamics of the stem cell compartment during physiologic aging, disease processes, and leukemic evolution. © 2016 by The American Society of Hematology. All rights reserved.

Mutational landscape of EGFR-, MYC-, and Kras-driven genetically engineered mouse models of lung adenocarcinoma

PubMed Central

McFadden, David G.; Politi, Katerina; Bhutkar, Arjun; Chen, Frances K.; Song, Xiaoling; Pirun, Mono; Santiago, Philip M.; Kim-Kiselak, Caroline; Platt, James T.; Lee, Emily; Hodges, Emily; Rosebrock, Adam P.; Bronson, Roderick T.; Socci, Nicholas D.; Hannon, Gregory J.; Jacks, Tyler; Varmus, Harold

2016-01-01

Genetically engineered mouse models (GEMMs) of cancer are increasingly being used to assess putative driver mutations identified by large-scale sequencing of human cancer genomes. To accurately interpret experiments that introduce additional mutations, an understanding of the somatic genetic profile and evolution of GEMM tumors is necessary. Here, we performed whole-exome sequencing of tumors from three GEMMs of lung adenocarcinoma driven by mutant epidermal growth factor receptor (EGFR), mutant Kirsten rat sarcoma viral oncogene homolog (Kras), or overexpression of MYC proto-oncogene. Tumors from EGFR- and Kras-driven models exhibited, respectively, 0.02 and 0.07 nonsynonymous mutations per megabase, a dramatically lower average mutational frequency than observed in human lung adenocarcinomas. Tumors from models driven by strong cancer drivers (mutant EGFR and Kras) harbored few mutations in known cancer genes, whereas tumors driven by MYC, a weaker initiating oncogene in the murine lung, acquired recurrent clonal oncogenic Kras mutations. In addition, although EGFR- and Kras-driven models both exhibited recurrent whole-chromosome DNA copy number alterations, the specific chromosomes altered by gain or loss were different in each model. These data demonstrate that GEMM tumors exhibit relatively simple somatic genotypes compared with human cancers of a similar type, making these autochthonous model systems useful for additive engineering approaches to assess the potential of novel mutations on tumorigenesis, cancer progression, and drug sensitivity. PMID:27702896

Mutational landscape of EGFR-, MYC-, and Kras-driven genetically engineered mouse models of lung adenocarcinoma.

PubMed

McFadden, David G; Politi, Katerina; Bhutkar, Arjun; Chen, Frances K; Song, Xiaoling; Pirun, Mono; Santiago, Philip M; Kim-Kiselak, Caroline; Platt, James T; Lee, Emily; Hodges, Emily; Rosebrock, Adam P; Bronson, Roderick T; Socci, Nicholas D; Hannon, Gregory J; Jacks, Tyler; Varmus, Harold

2016-10-18

Genetically engineered mouse models (GEMMs) of cancer are increasingly being used to assess putative driver mutations identified by large-scale sequencing of human cancer genomes. To accurately interpret experiments that introduce additional mutations, an understanding of the somatic genetic profile and evolution of GEMM tumors is necessary. Here, we performed whole-exome sequencing of tumors from three GEMMs of lung adenocarcinoma driven by mutant epidermal growth factor receptor (EGFR), mutant Kirsten rat sarcoma viral oncogene homolog (Kras), or overexpression of MYC proto-oncogene. Tumors from EGFR- and Kras-driven models exhibited, respectively, 0.02 and 0.07 nonsynonymous mutations per megabase, a dramatically lower average mutational frequency than observed in human lung adenocarcinomas. Tumors from models driven by strong cancer drivers (mutant EGFR and Kras) harbored few mutations in known cancer genes, whereas tumors driven by MYC, a weaker initiating oncogene in the murine lung, acquired recurrent clonal oncogenic Kras mutations. In addition, although EGFR- and Kras-driven models both exhibited recurrent whole-chromosome DNA copy number alterations, the specific chromosomes altered by gain or loss were different in each model. These data demonstrate that GEMM tumors exhibit relatively simple somatic genotypes compared with human cancers of a similar type, making these autochthonous model systems useful for additive engineering approaches to assess the potential of novel mutations on tumorigenesis, cancer progression, and drug sensitivity.

Diphtheria toxin resistance in human lymphocytes and lymphoblasts in the in vivo somatic cell mutation test

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkins, D.J.; Wei, L.; Laurie, K.E.

1985-01-01

It has been shown that circulating peripheral blood lymphocytes can be used for the enumeration of 6-thioguanine-resistant cells that presumably arise by mutation in vivo. This somatic cell mutation test has been studied in lymphocytes from human populations exposed to known mutagens and/or carcinogens. The sensitivity of the test could be further enhanced by including other gene markers, since there is evidence for locus-specific differences in response to mutagens. Resistance to diphtheria toxin (Dip/sup r/) seemed like a potential marker to incorporate into the test because the mutation acts codominantly, can readily be selected in human diploid fibroblasts and Chinesemore » hamster cells with no evidence for cell density or cross-feeding effects, and can be assayed for in nondividing cells by measuring protein synthesis inhibition. Blood samples were collected from seven individuals, and fresh, cryopreserved, or Epstein-Barr virus (EBV)-transformed lymphocytes were tested for continued DNA synthesis (TH-thymidine, autoradiography) or protein synthesis (TVS-methionine, scintillation counting). Both fresh and cryopreserved lymphocytes, stimulated to divide with phytohemagglutinin (PHA), continued to synthesize DNA in the presence of high doses of diphtheria toxin (DT). Similarly, both dividing (PHA-stimulated) and nondividing fresh lymphocytes carried on significant levels of protein synthesis even 68 hr after exposure to 100 flocculating units (LF)/ml DT. The results suggest that human T and B lymphocytes may not be as sensitive to DT protein synthesis inhibition as human fibroblast and Chinese hamster cells. For this reason, Dip/sup r/ may not be a suitable marker for the somatic cell mutation test.« less

Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression

PubMed Central

Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D.; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

2016-01-01

The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma. Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines. We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK. Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%. Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression. Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants. In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression. PMID:27009842

Exome and deep sequencing of clinically aggressive neuroblastoma reveal somatic mutations that affect key pathways involved in cancer progression.

PubMed

Lasorsa, Vito Alessandro; Formicola, Daniela; Pignataro, Piero; Cimmino, Flora; Calabrese, Francesco Maria; Mora, Jaume; Esposito, Maria Rosaria; Pantile, Marcella; Zanon, Carlo; De Mariano, Marilena; Longo, Luca; Hogarty, Michael D; de Torres, Carmen; Tonini, Gian Paolo; Iolascon, Achille; Capasso, Mario

2016-04-19

The spectrum of somatic mutation of the most aggressive forms of neuroblastoma is not completely determined. We sought to identify potential cancer drivers in clinically aggressive neuroblastoma.Whole exome sequencing was conducted on 17 germline and tumor DNA samples from high-risk patients with adverse events within 36 months from diagnosis (HR-Event3) to identify somatic mutations and deep targeted sequencing of 134 genes selected from the initial screening in additional 48 germline and tumor pairs (62.5% HR-Event3 and high-risk patients), 17 HR-Event3 tumors and 17 human-derived neuroblastoma cell lines.We revealed 22 significantly mutated genes, many of which implicated in cancer progression. Fifteen genes (68.2%) were highly expressed in neuroblastoma supporting their involvement in the disease. CHD9, a cancer driver gene, was the most significantly altered (4.0% of cases) after ALK.Other genes (PTK2, NAV3, NAV1, FZD1 and ATRX), expressed in neuroblastoma and involved in cell invasion and migration were mutated at frequency ranged from 4% to 2%.Focal adhesion and regulation of actin cytoskeleton pathways, were frequently disrupted (14.1% of cases) thus suggesting potential novel therapeutic strategies to prevent disease progression.Notably BARD1, CHEK2 and AXIN2 were enriched in rare, potentially pathogenic, germline variants.In summary, whole exome and deep targeted sequencing identified novel cancer genes of clinically aggressive neuroblastoma. Our analyses show pathway-level implications of infrequently mutated genes in leading neuroblastoma progression.

Combined hereditary and somatic mutations of replication error repair genes result in rapid onset of ultra-hypermutated cancers.

PubMed

Shlien, Adam; Campbell, Brittany B; de Borja, Richard; Alexandrov, Ludmil B; Merico, Daniele; Wedge, David; Van Loo, Peter; Tarpey, Patrick S; Coupland, Paul; Behjati, Sam; Pollett, Aaron; Lipman, Tatiana; Heidari, Abolfazl; Deshmukh, Shriya; Avitzur, Na'ama; Meier, Bettina; Gerstung, Moritz; Hong, Ye; Merino, Diana M; Ramakrishna, Manasa; Remke, Marc; Arnold, Roland; Panigrahi, Gagan B; Thakkar, Neha P; Hodel, Karl P; Henninger, Erin E; Göksenin, A Yasemin; Bakry, Doua; Charames, George S; Druker, Harriet; Lerner-Ellis, Jordan; Mistry, Matthew; Dvir, Rina; Grant, Ronald; Elhasid, Ronit; Farah, Roula; Taylor, Glenn P; Nathan, Paul C; Alexander, Sarah; Ben-Shachar, Shay; Ling, Simon C; Gallinger, Steven; Constantini, Shlomi; Dirks, Peter; Huang, Annie; Scherer, Stephen W; Grundy, Richard G; Durno, Carol; Aronson, Melyssa; Gartner, Anton; Meyn, M Stephen; Taylor, Michael D; Pursell, Zachary F; Pearson, Christopher E; Malkin, David; Futreal, P Andrew; Stratton, Michael R; Bouffet, Eric; Hawkins, Cynthia; Campbell, Peter J; Tabori, Uri

2015-03-01

DNA replication-associated mutations are repaired by two components: polymerase proofreading and mismatch repair. The mutation consequences of disruption to both repair components in humans are not well studied. We sequenced cancer genomes from children with inherited biallelic mismatch repair deficiency (bMMRD). High-grade bMMRD brain tumors exhibited massive numbers of substitution mutations (>250/Mb), which was greater than all childhood and most cancers (>7,000 analyzed). All ultra-hypermutated bMMRD cancers acquired early somatic driver mutations in DNA polymerase ɛ or δ. The ensuing mutation signatures and numbers are unique and diagnostic of childhood germ-line bMMRD (P < 10(-13)). Sequential tumor biopsy analysis revealed that bMMRD/polymerase-mutant cancers rapidly amass an excess of simultaneous mutations (∼600 mutations/cell division), reaching but not exceeding ∼20,000 exonic mutations in <6 months. This implies a threshold compatible with cancer-cell survival. We suggest a new mechanism of cancer progression in which mutations develop in a rapid burst after ablation of replication repair.

Clinical significance of acquired somatic mutations in aplastic anaemia.

PubMed

Marsh, J C W; Mufti, G J

2016-08-01

Aplastic anaemia (AA) is frequently associated with other disorders of clonal haemopoiesis such as paroxysmal nocturnal haemoglobinuria (PNH), myelodysplastic syndrome (MDS) and T-large granular lymphocytosis. Certain clones may escape the immune attack within the bone marrow environment and proliferate and attain a survival advantage over normal haemopoietic stem cells, such as trisomy 8, loss of heterozygosity of short arm of chromosome 6 and del13q clones. Recently acquired somatic mutations (SM), excluding PNH clones, have been reported in around 20-25 % of patients with AA, which predispose to a higher risk of later malignant transformation to MDS/acute myeloid leukaemia. Furthermore, certain SM, such as ASXL1 and DNMT3A are associated with poor survival following immunosuppressive therapy, whereas PIGA, BCOR/BCORL1 predict for good response and survival. Further detailed and serial analysis of the immune signature in AA is needed to understand the pathogenetic basis for the presence of clones with SM in a significant proportion of patients.

Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation.

PubMed

Harms, Paul W; Collie, Angela M B; Hovelson, Daniel H; Cani, Andi K; Verhaegen, Monique E; Patel, Rajiv M; Fullen, Douglas R; Omata, Kei; Dlugosz, Andrzej A; Tomlins, Scott A; Billings, Steven D

2016-03-01

Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin 20 (CK20) is expressed in ~95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small-cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (10 Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high-confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping genetic changes

Next Generation Sequencing of Cytokeratin 20-Negative Merkel Cell Carcinoma Reveals Ultraviolet Signature Mutations and Recurrent TP53 and RB1 Inactivation

PubMed Central

Harms, Paul W.; Collie, Angela M. B.; Hovelson, Daniel H.; Cani, Andi K.; Verhaegen, Monique E.; Patel, Rajiv M.; Fullen, Douglas R.; Omata, Kei; Dlugosz, Andrzej A.; Tomlins, Scott A.; Billings, Steven D.

2016-01-01

Merkel cell carcinoma is a rare but highly aggressive cutaneous neuroendocrine carcinoma. Cytokeratin-20 (CK20) is expressed in approximately 95% of Merkel cell carcinomas and is useful for distinction from morphologically similar entities including metastatic small cell lung carcinoma. Lack of CK20 expression may make diagnosis of Merkel cell carcinoma more challenging, and has unknown biological significance. Approximately 80% of CK20-positive Merkel cell carcinomas are associated with the oncogenic Merkel cell polyomavirus. Merkel cell carcinomas lacking Merkel cell polyomavirus display distinct genetic changes from Merkel cell polyomavirus-positive Merkel cell carcinoma, including RB1 inactivating mutations. Unlike CK20-positive Merkel cell carcinoma, the majority of CK20-negative Merkel cell carcinomas are Merkel cell polyomavirus-negative, suggesting CK20-negative Merkel cell carcinomas predominantly arise through virus-independent pathway(s) and may harbor additional genetic differences from conventional Merkel cell carcinoma. Hence, we analyzed 15 CK20-negative Merkel cell carcinoma tumors (ten Merkel cell polyomavirus-negative, four Merkel cell polyomavirus-positive, and one undetermined) using the Ion Ampliseq Comprehensive Cancer Panel, which assesses copy number alterations and mutations in 409 cancer-relevant genes. Twelve tumors displayed prioritized high-level chromosomal gains or losses (average 1.9 per tumor). Non-synonymous high confidence somatic mutations were detected in 14 tumors (average 11.9 per tumor). Assessing all somatic coding mutations, an ultraviolet-signature mutational profile was present, and more prevalent in Merkel cell polyomavirus-negative tumors. Recurrent deleterious tumor suppressor mutations affected TP53 (9/15, 60%), RB1 (3/15, 20%), and BAP1 (2/15, 13%). Oncogenic activating mutations included PIK3CA (3/15, 20%), AKT1 (1/15, 7%)) and EZH2 (1/15, 7%). In conclusion, CK20-negative Merkel cell carcinoma display overlapping

PPM1D Mosaic Truncating Variants in Ovarian Cancer Cases May Be Treatment-Related Somatic Mutations

PubMed Central

Pharoah, Paul D. P.; Song, Honglin; Dicks, Ed; Intermaggio, Maria P.; Harrington, Patricia; Baynes, Caroline; Alsop, Kathryn; Bogdanova, Natalia; Cicek, Mine S.; Cunningham, Julie M.; Fridley, Brooke L.; Gentry-Maharaj, Aleksandra; Hillemanns, Peter; Lele, Shashi; Lester, Jenny; McGuire, Valerie; Moysich, Kirsten B.; Poblete, Samantha; Sieh, Weiva; Sucheston-Campbell, Lara; Widschwendter, Martin; Whittemore, Alice S.; Dörk, Thilo; Menon, Usha; Odunsi, Kunle; Goode, Ellen L.; Karlan, Beth Y.; Bowtell, David D.; Gayther, Simon A.; Ramus, Susan J.

2016-01-01

Mosaic truncating mutations in the protein phosphatase, Mg2+/Mn2+-dependent, 1D (PPM1D) gene have recently been reported with a statistically significantly greater frequency in lymphocyte DNA from ovarian cancer case patients compared with unaffected control patients. Using massively parallel sequencing (MPS) we identified truncating PPM1D mutations in 12 of 3236 epithelial ovarian cancer (EOC) case patients (0.37%) but in only one of 3431 unaffected control patients (0.03%) (P = .001). All statistical tests were two-sided. A combination of Sanger sequencing, pyrosequencing, and MPS data suggested that 12 of the 13 mutations were mosaic. All mutations were identified in post-chemotherapy treatment blood samples from case patients (n = 1827) (average 1234 days post-treatment in carriers) rather than from cases collected pretreatment (less than 14 days after diagnosis, n = 1384) (P = .002). These data suggest that PPM1D variants in EOC cases are primarily somatic mosaic mutations caused by treatment and are not associated with germline predisposition to EOC. PMID:26823519

SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing

PubMed Central

Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q.; Karchin, Rachel

2015-01-01

Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones—cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single

Somatic gene mutations in African Americans may predict worse outcomes in colorectal cancer.

PubMed

Kang, Melissa; Shen, Xiang J; Kim, Sangmi; Araujo-Perez, Felix; Galanko, Joseph A; Martin, Chris F; Sandler, Robert S; Keku, Temitope O

2013-01-01

African Americans have worse outcomes in colorectal cancer (CRC) than Caucasians. We sought to determine if KRAS, BRAF and PIK3CA mutations might contribute to the racial differences in CRC outcome. DNA was extracted from tissue microarrays made from CRC samples from 67 African Americans and 237 Caucasians. Mutations in KRAS, BRAF, and PIK3CA were evaluated by PCR sequencing. We also examined microsatellite instability (MSI) status. Associations of mutation status with tumor stage and grade were examined using a logistic regression model. Cox proportional hazards models were used to estimate the all-cause mortality associated with mutational status, race and other clinicopathologic features. KRAS mutations were more common in African Americans than among Caucasians (37% vs 21%, p=0.01) and were associated with advanced stage (unadjusted odds ratio (OR)=3.31, 95% confidence interval (CI) 1.03-10.61) and grade (unadjusted OR=5.60, 95% CI 1.01-31.95) among African Americans. Presence of BRAF mutations was also positively associated with advanced tumor stage (adjusted OR=3.99, 95%CI 1.43-11.12) and grade (adjusted OR=3.93, 95%CI 1.05-14.69). PIK3CA mutations showed a trend toward an association with an increased risk of death compared to absence of those mutations (adjusted for age, sex and CRC site HR=1.89, 95% CI 0.98-3.65). Among African Americans, the association was more evident (adjusted for age, sex and CRC site HR=3.92, 95% CI 1.03-14.93) and remained significant after adjustment for MSI-H status and combined education-income level, with HR of 12.22 (95%CI 1.32-121.38). Our results suggest that African Americans may have different frequencies of somatic genetic alterations that may partially explain the worse prognosis among African Americans with CRC compared to whites.

Immunostaining with EGFR mutation-specific antibodies: a reliable screening method for lung adenocarcinomas harboring EGFR mutation in biopsy and resection samples.

PubMed

Fan, Xiangshan; Liu, Biao; Xu, Haodong; Yu, Bo; Shi, Shanshan; Zhang, Jin; Wang, Xuan; Wang, Jiandong; Lu, Zhenfeng; Ma, Henghui; Zhou, Xiaojun

2013-08-01

Mutation analysis of epidermal growth factor receptor (EGFR) is essential in determining the therapeutic strategy for lung adenocarcinoma. Immunohistochemical (IHC) staining with EGFR mutation-specific antibodies of del E746-A750 in exon 19 and L858R in exon 21 has been evaluated in resection specimens in a few studies but rarely in biopsy samples. A total of 169 cases (78 biopsies and 91 resected specimens) of lung adenocarcinoma with EGFR mutation status predefined by direct DNA sequencing were histologically examined, and IHC was performed using EGFR mutation-specific antibodies of del E746-A750 and L858R. The cases with positive results by IHC but negative results by direct DNA sequencing were examined by amplified refractory mutation system. Our results showed that the frequency of EGFR mutations for both E746-A750 deletion and L858R mutation was 38.5% (65/169) by DNA sequencing or amplified refractory mutation system and 34.3% (58/169) by IHC in lung adenocarcinomas. Based on molecular test results, the overall sensitivity, specificity, positive predictive value, and negative predictive value of IHC using these 2 antibodies in all (biopsy/resection) cases were 87.7% (80%/94.3%), 99.0% (97.9%/100%), 98.3% (96%/100%), and 92.8% (88.7%/96.6%), respectively. Lung adenocarcinomas with a predominant acinar, papillary, lepidic, or solid growth pattern more often harbor EGFR mutation of del E746-A750 or L858R. In conclusion, the immunostaining with EGFR del E746-A750 and L858R mutation antibodies is a reliable screening method with high specificity and sensitivity for identifying the EGFR mutation in both resected and biopsied lung adenocarcinomas. Copyright © 2013 Elsevier Inc. All rights reserved.

The somatic POLE P286R mutation defines a unique subclass of colorectal cancer featuring hypermutation, representing a potential genomic biomarker for immunotherapy

PubMed Central

Kim, Jihun; Kim, Deokhoon; Chun, Sung-Min; Kim, Jiyun; Kim, Tae Won; Park, Inja; Yu, Chang-Sik; Jang, Se Jin

2016-01-01

Early-onset colorectal cancers (EOCRCs) may have biological or genomic features distinct from late-onset CRCs (LOCRCs). Previous studies have mostly focused on the germline predisposition conditions of EOCRCs, but we hypothesized that EOCRCs may have distinct somatic aberrations that accelerate cancer development. To identify the somatic aberrations that accelerate cancer development at an early age, we conducted whole exome sequencing for 28 polyposis-unrelated, microsatellite stable (MSS) EOCRCs with no known germline predisposition conditions. Surprisingly, we found two distinct groups in the context of mutational burden: 6 hypermutated cases with 2325 to 10973 mutations and 22 nonhypermutated cases with 47 to 154 mutations. Further analysis revealed that four of the six hypermutated cases had the same POLE P286R mutation. We validated this finding in 83 MSS EOCRCs and 27 MSS LOCRCs, which revealed that 7.2% of EOCRCs (6/83) had the POLE P286R mutation, which was not found in LOCRCs. Clinicopathologically, EOCRCs with POLE mutations occurred far more frequently in the right colon than in the left colon, affecting men more frequently than women. In summary, we have identified a unique subclass of colon cancer characterized by a hypermutation associated with the POLE mutation. The acquisition of the POLE mutation leading to hypermutation can accelerate cancer development. Clinically, this subset with hypermutation may be susceptible to immune checkpoint blockade. PMID:27612425

Genomic profiling of multiple sequentially acquired tumor metastatic sites from an “exceptional responder” lung adenocarcinoma patient reveals extensive genomic heterogeneity and novel somatic variants driving treatment response

PubMed Central

Biswas, Romi; Gao, Shaojian; Cultraro, Constance M.; Maity, Tapan K.; Venugopalan, Abhilash; Abdullaev, Zied; Shaytan, Alexey K.; Carter, Corey A.; Thomas, Anish; Rajan, Arun; Song, Young; Pitts, Stephanie; Chen, Kevin; Bass, Sara; Boland, Joseph; Hanada, Ken-Ichi; Chen, Jinqiu; Meltzer, Paul S.; Panchenko, Anna R.; Yang, James C.; Pack, Svetlana; Giaccone, Giuseppe; Schrump, David S.; Khan, Javed; Guha, Udayan

2016-01-01

We used next-generation sequencing to identify somatic alterations in multiple metastatic sites from an “exceptional responder” lung adenocarcinoma patient during his 7-yr course of ERBB2-directed therapies. The degree of heterogeneity was unprecedented, with ∼1% similarity between somatic alterations of the lung and lymph nodes. One novel translocation, PLAG1-ACTA2, present in both sites, up-regulated ACTA2 expression. ERBB2, the predominant driver oncogene, was amplified in both sites, more pronounced in the lung, and harbored an L869R mutation in the lymph node. Functional studies showed increased proliferation, migration, metastasis, and resistance to ERBB2-directed therapy because of L869R mutation and increased migration because of ACTA2 overexpression. Within the lung, a nonfunctional CDK12, due to a novel G879V mutation, correlated with down-regulation of DNA damage response genes, causing genomic instability, and sensitivity to chemotherapy. We propose a model whereby a subclone metastasized early from the primary site and evolved independently in lymph nodes. PMID:27900369

Somatic Crossing over in GLYCINE MAX (L.) Merrill: Effect of Some Inhibitors of DNA Synthesis on the Induction of Somatic Crossing over and Point Mutations.

PubMed

Vig, B K

1973-04-01

Glycine max (soybean) is the only known higher plant with a definitely established occurrence of somatic crossing over. This material lends itself to the analysis of somatic crossing over, gross chromosomal aberrations and mutations, all of which may be induced by the same treatment of the mutagen given to seeds. This is made possible because gene Y(11) for chlorophyll development in the variety L65-1237 is incompletely dominant over its allele y(11), so that twin or double spots composed of a dark green (Y(11)Y(11)) and a yellow (y(11)y(11)) component can be observed adjacent to and as mirror images of each other on the light green Y(11)y(11) leaves in the areas of complementary exchange for these genes. Lack of growth of either component of this double spot as well as several types of chromosomal disturbances give rise to single spots resembling phenotypes of y(11)y(11) or Y(11)Y(11) leaves. Point mutations can be studied by looking for green sectors originating from Y(11)y(11) genotype on the y(11)y(11) plants. Seeds obtained from heterozygous plants were treated with caffeine, cytosine arabinoside, actinomycin D and 5-fluoro-deoxyuridine, all known inhibitors of DNA synthesis, and puromycin, an inhibitor of synthesis of proteins. The treatments with caffeine and actinomycin D increased the frequency of somatic crossing over as measured by the frequency of double spots on Y(11)y(11) leaves, but cytosine arabinoside, 5-fluorodeoxyuridine and puromycin did not. Thus somatic crossing over was induced only by those chemicals which are known to allow rejoining of chromosomes, thereby suggesting a correlation between the two phenomena. These observations indicate that it is not the mere inhibition of DNA synthesis, but some rather more specific event in DNA repair which is responsible for complementary exchanges. Some of these results differ from studies carried out with fungi. The main effect of all chemicals tested, except caffeine and actinomycin D, was inferred to

Acquired Resistance Mechanisms to Combination Met-TKI/EGFR-TKI Exposure in Met-Amplified EGFR-TKI-Resistant Lung Adenocarcinoma Harboring an Activating EGFR Mutation.

PubMed

Yamaoka, Toshimitsu; Ohmori, Tohru; Ohba, Motoi; Arata, Satoru; Kishino, Yasunari; Murata, Yasunori; Kusumoto, Sojiro; Ishida, Hiroo; Shirai, Takao; Hirose, Takashi; Ohnishi, Tsukasa; Sasaki, Yasutsuna

2016-12-01

Met-amplified EGFR-tyrosine kinase inhibitor (TKI)-resistant non-small cell lung cancer (NSCLC) harboring an activating EGFR mutation is responsive to concurrent EGFR-TKI and Met-TKI treatment in a preclinical model. Here, we determined that Met-amplified gefitinib-resistant cells acquire dual resistance to inhibition of EGFR and Met tyrosine kinase activities. PC-9 lung adenocarcinoma cells harboring 15-bp deletions (Del E746_A750) in EGFR exon 19 were treated with increasing concentrations of the Met-TKI PHA665752 and 1 μmol/L gefitinib for 1 year; three resistant clones were established via Met amplification. The three dual-resistance cell lines (PC-9DR2, PC-9DR4, and PC-9DR6, designated as DR2, DR4, and DR6, respectively) exhibited different mechanisms for evading both EGFR and Met inhibition. None of the clones harbored a secondary mutation of EGFR T790M or a Met mutation. Insulin-like growth factor (IGF)/IGF1 receptor activation in DR2 and DR4 cells acted as a bypass signaling pathway. Met expression was attenuated to a greater extent in DR2 than in PC-9 cells, but was maintained in DR4 cells by overexpression of IGF-binding protein 3. In DR6 cells, Met was further amplified by association with HSP90, which protected Met from degradation and induced SET and MYND domain-containing 3 (SMYD3)-mediated Met transcription. This is the first report describing the acquisition of dual resistance mechanisms in NSCLC harboring an activating EGFR mutation to Met-TKI and EGFR-TKI following previous EGFR-TKI treatment. These results might inform the development of more effective therapeutic strategies for NSCLC treatment. Mol Cancer Ther; 15(12); 3040-54. ©2016 AACR. ©2016 American Association for Cancer Research.

Molecular and clinical evidence for an ARMC5 tumor syndrome: concurrent inactivating germline and somatic mutations are associated with both primary macronodular adrenal hyperplasia and meningioma.

PubMed

Elbelt, Ulf; Trovato, Alessia; Kloth, Michael; Gentz, Enno; Finke, Reinhard; Spranger, Joachim; Galas, David; Weber, Susanne; Wolf, Cristina; König, Katharina; Arlt, Wiebke; Büttner, Reinhard; May, Patrick; Allolio, Bruno; Schneider, Jochen G

2015-01-01

Primary macronodular adrenal hyperplasia (PMAH) is a rare cause of Cushing's syndrome, which may present in the context of different familial multitumor syndromes. Heterozygous inactivating germline mutations of armadillo repeat containing 5 (ARMC5) have very recently been described as cause for sporadic PMAH. Whether this genetic condition also causes familial PMAH in association with other neoplasias is unclear. The aim of the present study was to delineate the molecular cause in a large family with PMAH and other neoplasias. Whole-genome sequencing and comprehensive clinical and biochemical phenotyping was performed in members of a PMAH affected family. Nodules derived from adrenal surgery and pancreatic and meningeal tumor tissue were analyzed for accompanying somatic mutations in the identified target genes. PMAH presenting either as overt or subclinical Cushing's syndrome was accompanied by a heterozygous germline mutation in ARMC5 (p.A110fs*9) located on chromosome 16. Analysis of tumor tissue showed different somatic ARMC5 mutations in adrenal nodules supporting a second hit hypothesis with inactivation of a tumor suppressor gene. A damaging somatic ARMC5 mutation was also found in a concomitant meningioma (p.R502fs) but not in a pancreatic tumor, suggesting biallelic inactivation of ARMC5 as causal also for the intracranial meningioma. Our analysis further confirms inherited inactivating ARMC5 mutations as a cause of familial PMAH and suggests an additional role for the development of concomitant intracranial meningiomas.

Coats' disease of the retina (unilateral retinal telangiectasis) caused by somatic mutation in the NDP gene: a role for norrin in retinal angiogenesis.

PubMed

Black, G C; Perveen, R; Bonshek, R; Cahill, M; Clayton-Smith, J; Lloyd, I C; McLeod, D

1999-10-01

Coats' disease is characterized by abnormal retinal vascular development (so-called 'retinal telangiectasis') which results in massive intraretinal and subretinal lipid accumulation (exudative retinal detachment). The classical form of Coats' disease is almost invariably isolated, unilateral and seen in males. A female with a unilateral variant of Coats' disease gave birth to a son affected by Norrie disease. Both carried a missense mutation within the NDP gene on chromosome Xp11.2. Subsequently analysis of the retinas of nine enucleated eyes from males with Coats' disease demonstrated in one a somatic mutation in the NDP gene which was not present within non-retinal tissue. We suggest that Coats' telangiectasis is secondary to somatic mutation in the NDP gene which results in a deficiency of norrin (the protein product of the NDP gene) within the developing retina. This supports recent observations that the protein is critical for normal retinal vasculogenesis.

Detection of somatic mutations in the mitochondrial DNA control region D-loop in brain tumors: The first report in Malaysian patients.

PubMed

Mohamed Yusoff, Abdul Aziz; Mohd Nasir, Khairol Naaim; Haris, Khalilah; Mohd Khair, Siti Zulaikha Nashwa; Abdul Ghani, Abdul Rahman Izaini; Idris, Zamzuri; Abdullah, Jafri Malin

2017-11-01

Although the role of nuclear-encoded gene alterations has been well documented in brain tumor development, the involvement of the mitochondrial genome in brain tumorigenesis has not yet been fully elucidated and remains controversial. The present study aimed to identify mutations in the mitochondrial DNA (mtDNA) control region D-loop in patients with brain tumors in Malaysia. A mutation analysis was performed in which DNA was extracted from paired tumor tissue and blood samples obtained from 49 patients with brain tumors. The D-loop region DNA was amplified using the PCR technique, and genetic data from DNA sequencing analyses were compared with the published revised Cambridge sequence to identify somatic mutations. Among the 49 brain tumor tissue samples evaluated, 25 cases (51%) had somatic mutations of the mtDNA D-loop, with a total of 48 mutations. Novel mutations that had not previously been identified in the D-loop region (176 A-deletion, 476 C>A, 566 C>A and 16405 A-deletion) were also classified. No significant associations between the D-loop mutation status and the clinicopathological parameters were observed. To the best of our knowledge, the current study presents the first evidence of alterations in the mtDNA D-loop regions in the brain tumors of Malaysian patients. These results may provide an overview and data regarding the incidence of mitochondrial genome alterations in Malaysian patients with brain tumors. In addition to nuclear genome aberrations, these specific mitochondrial genome alterations may also be considered as potential cancer biomarkers for the diagnosis and staging of brain cancers.

Prolonged Response to Trastuzumab in a Patient With HER2-Nonamplified Breast Cancer With Elevated HER2 Dimerization Harboring an ERBB2 S310F Mutation.

PubMed

Chumsri, Saranya; Weidler, Jodi; Ali, Siraj; Balasubramanian, Sohail; Wallweber, Gerald; DeFazio-Eli, Lisa; Chenna, Ahmed; Huang, Weidong; DeRidder, Angela; Goicocheal, Lindsay; Perez, Edith A

2015-09-01

In the current genomic era, increasing evidence demonstrates that approximately 2% of HER2-negative breast cancers, by current standard testings, harbor activating mutations of ERBB2. However, whether patients with HER2-negative breast cancer with activating mutations of ERBB2 also experience response to anti-HER2 therapies remains unclear. This case report describes a patient with HER2-nonamplified heavily pretreated breast cancer who experienced prolonged response to trastuzumab in combination with pertuzumab and fulvestrant. Further molecular analysis demonstrated that her tumors had an elevated HER2 dimerization that corresponded to ERBB2 S310F mutation. Located in the extracellular domain of the HER2 protein, this mutation was reported to promote noncovalent dimerization that results in the activation of the downstream signaling pathways. This case highlights the fact that HER2-targeted therapy may be valuable in patients harboring an ERBB2 S310F mutation. Copyright © 2015 by the National Comprehensive Cancer Network.

A marked response to icotinib in a patient with large cell neuroendocrine carcinoma harboring an EGFR mutation: A case report.

PubMed

Wang, Yuehong; Shen, Yi Hong; Ma, Shanni; Zhou, Jianying

2015-09-01

The present study reports the case of an 84-year-old male with primary pulmonary large cell neuroendocrine carcinoma (LCNEC) harboring an epidermal growth factor receptor (EGFR) gene mutation that exhibited a long-lasting response to the EGFR-tyrosine kinase inhibitor (EGFR-TKI) icotinib. The patient had an extensive smoking history, a poor performance status, and presented with an irregular mass in the middle lobe of the right lung on computed tomography (CT) and an enlarged left supraclavicular lymph node on physical examination. Right middle lobe bronchial brushing during fiberoptic bronchoscopy identified poorly-differentiated cancer cells. The left supraclavicular lymph node was biopsied and a diagnosis of metastatic LCNEC was determined. Furthermore, an EGFR exon 19 deletion was identified by DNA sequencing. Following diagnosis, icotinib was administered at a dose of 125 mg three times a day. Chest CT scans were performed after 1 month of treatment, which indicated that the tumor was in partial remission. This marked response to icotinib lasted for 8 months. Thus, the present case illustrates the possibility of identifying EGFR mutations in LCNEC and indicates that EGFR-tyrosine kinase inhibitors may be an alternative treatment strategy for patients with LCNEC harboring activating EGFR mutations.

A comparison of somatic mutational spectra in healthy study populations from Russia, Sweden and USA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noori, P; Hou, S; Jones, I M

Comparison of mutation spectra at the hypoxanthine-phosphoribosyl transferase (HPRT) gene of peripheral blood T lymphocytes may provide insight into the aetiology of somatic mutation contributing to carcinogenesis and other diseases. To increase knowledge of mutation spectra in healthy people, we have analyzed HPRT mutant T-cells of 50 healthy Russians originally recruited as controls for a study of Chernobyl clean-up workers (Jones et al. Radiation Res. 158, 2002, 424). Reverse transcriptase polymerase chain reactions and DNA sequencing identified 161 independent mutations among 176 thioguanine resistant mutants. Forty (40) mutations affected splicing mechanisms and 27 deletions or insertions of 1 to 60more » nucleotides were identified. Ninety four (94) single base substitutions were identified, including 62 different mutations at 55 different nucleotide positions, of which 19 had not previously been reported in human T-cells. Comparison of this base substitution spectrum with mutation spectra in a USA (Burkhart-Schultz et al. Carcinogenesis 17, 1996, 1871) and two Swedish populations (Podlutsky et al, Carcinogenesis 19, 1998, 557, Podlutsky et al. Mutation Res. 431, 1999, 325) revealed similarity in the type, frequency and distribution of mutations in the four spectra, consistent with aetiologies inherent in human metabolism. There were 15-19 identical mutations in the three pair-wise comparisons of Russian with USA and Swedish spectra. Intriguingly, there were 21 mutations unique to the Russian spectrum, and comparison by the Monte Carlo method of Adams and Skopek (J. Mol. Biol. 194, 1987, 391) indicated that the Russian spectrum was different from both Swedish spectra (P=0.007, 0.002) but not different from the USA spectrum (P=0.07), when Bonferroni correction for multiple comparisons was made (p < 0.008 required for significance). Age and smoking did not account for these differences. Other factors causing mutational differences need to be explored.« less

PPM1D Mosaic Truncating Variants in Ovarian Cancer Cases May Be Treatment-Related Somatic Mutations.

PubMed

Pharoah, Paul D P; Song, Honglin; Dicks, Ed; Intermaggio, Maria P; Harrington, Patricia; Baynes, Caroline; Alsop, Kathryn; Bogdanova, Natalia; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Gentry-Maharaj, Aleksandra; Hillemanns, Peter; Lele, Shashi; Lester, Jenny; McGuire, Valerie; Moysich, Kirsten B; Poblete, Samantha; Sieh, Weiva; Sucheston-Campbell, Lara; Widschwendter, Martin; Whittemore, Alice S; Dörk, Thilo; Menon, Usha; Odunsi, Kunle; Goode, Ellen L; Karlan, Beth Y; Bowtell, David D; Gayther, Simon A; Ramus, Susan J

2016-03-01

Mosaic truncating mutations in the protein phosphatase, Mg(2+)/Mn(2+)-dependent, 1D (PPM1D) gene have recently been reported with a statistically significantly greater frequency in lymphocyte DNA from ovarian cancer case patients compared with unaffected control patients. Using massively parallel sequencing (MPS) we identified truncating PPM1D mutations in 12 of 3236 epithelial ovarian cancer (EOC) case patients (0.37%) but in only one of 3431 unaffected control patients (0.03%) (P = .001). All statistical tests were two-sided. A combination of Sanger sequencing, pyrosequencing, and MPS data suggested that 12 of the 13 mutations were mosaic. All mutations were identified in post-chemotherapy treatment blood samples from case patients (n = 1827) (average 1234 days post-treatment in carriers) rather than from cases collected pretreatment (less than 14 days after diagnosis, n = 1384) (P = .002). These data suggest that PPM1D variants in EOC cases are primarily somatic mosaic mutations caused by treatment and are not associated with germline predisposition to EOC. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Somatic mutation of EZH2 (Y641) in follicular and diffuse large B-cell lymphomas of germinal center origin | Office of Cancer Genomics

Cancer.gov

Morin et al. describe recurrent somatic mutations in EZH2, a polycomb group oncogene. The mutation, found in the SET domain of this gene encoding a histone methyltransferase, is found only in a subset of lymphoma samples. Specifically, EZH2 mutations are found in about 12% of follicular lymphomas (FL) and almost 23% of diffuse large B-cell lymphomas (DLBCL) of germinal center origin. This paper goes on to demonstrate that altered EZH2 proteins, corresponding to the most frequent mutations found in human lymphomas, have reduced activity using in vitro histone methylation assays.

A Somatic HIF2α Mutation-Induced Multiple and Recurrent Pheochromocytoma/Paraganglioma with Polycythemia: Clinical Study with Literature Review.

PubMed

Liu, Qiuli; Wang, Yan; Tong, Dali; Liu, Gaolei; Yuan, Wenqiang; Zhang, Jun; Ye, Jin; Zhang, Yao; Yuan, Gang; Feng, Qingxing; Zhang, Dianzheng; Jiang, Jun

2017-03-01

A syndrome known as pheochromocytomas (PCC)/paragangliomas (PGL) and polycythemia resulted from gain-of-function mutation of hypoxia-inducible factor 2α (HIF2α) has been reported recently. However, clinical features of this syndrome vary from patient to patient. In our study, we described the clinical features of the patient within 15-year follow-up with a literature review. The patient presented with "red face" since childhood and was diagnosed with polycythemia and pheochromocytoma in 2000, and then, tumor was removed at his age of 27 (year 2000). However, 13 years later (2013), he was diagnosed with multiple paragangliomas. Moreover, 2 years later (2015), another two paragangaliomas were also confirmed. Genetic analysis of hereditary PCC/PGL-related genes was conducted. A somatic heterozygous missense mutation of HIF2α (c.1589C>T) was identified at exon 12, which is responsible for the elevated levels of HIF2α and erythropoietin (EPO) and subsequent development of paragangaliomas. However, this mutation was only found in the tumors from three different areas, not in the blood. So far, 13 cases of PCC/PGL with polycythemia have been reported. Among them, somatic mutations of HIF2α at exon 12 are responsible for 12 cases, and only 1 case was caused by germline mutation of HIF2α at exon 9. The HIF2α mutation-induced polycythemia with PCC/PGL is a rare syndrome with no treatment for cure. Comprehensive therapies for this disease include removal of the tumors and intermittent phlebotomies; administration of medications to control blood pressure and to prevent complications or death resulted from high concentration of red blood cell (RBC). Genetic test is strongly recommended for patients with early onset of polycythemia and multiple/recurrent PCC/PGL.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Molecular profiling of appendiceal epithelial tumors using massively parallel sequencing to identify somatic mutations.

PubMed

Liu, Xiaoying; Mody, Kabir; de Abreu, Francine B; Pipas, J Marc; Peterson, Jason D; Gallagher, Torrey L; Suriawinata, Arief A; Ripple, Gregory H; Hourdequin, Kathryn C; Smith, Kerrington D; Barth, Richard J; Colacchio, Thomas A; Tsapakos, Michael J; Zaki, Bassem I; Gardner, Timothy B; Gordon, Stuart R; Amos, Christopher I; Wells, Wendy A; Tsongalis, Gregory J

2014-07-01

Some epithelial neoplasms of the appendix, including low-grade appendiceal mucinous neoplasm and adenocarcinoma, can result in pseudomyxoma peritonei (PMP). Little is known about the mutational spectra of these tumor types and whether mutations may be of clinical significance with respect to therapeutic selection. In this study, we identified somatic mutations using the Ion Torrent AmpliSeq Cancer Hotspot Panel v2. Specimens consisted of 3 nonneoplastic retention cysts/mucocele, 15 low-grade mucinous neoplasms (LAMNs), 8 low-grade/well-differentiated mucinous adenocarcinomas with pseudomyxoma peritonei, and 12 adenocarcinomas with/without goblet cell/signet ring cell features. Barcoded libraries were prepared from up to 10 ng of extracted DNA and multiplexed on single 318 chips for sequencing. Data analysis was performed using Golden Helix SVS. Variants that remained after the analysis pipeline were individually interrogated using the Integrative Genomics Viewer. A single Janus kinase 3 (JAK3) mutation was detected in the mucocele group. Eight mutations were identified in the V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) and GNAS complex locus (GNAS) genes among LAMN samples. Additional gene mutations were identified in the AKT1 (v-akt murine thymoma viral oncogene homolog 1), APC (adenomatous polyposis coli), JAK3, MET (met proto-oncogene), phosphatidylinositol-4,5-bisphosphate 3-kinase (PIK3CA), RB1 (retinoblastoma 1), STK11 (serine/threonine kinase 11), and tumor protein p53 (TP53) genes. Among the PMPs, 6 mutations were detected in the KRAS gene and also in the GNAS, TP53, and RB1 genes. Appendiceal cancers showed mutations in the APC, ATM (ataxia telangiectasia mutated), KRAS, IDH1 [isocitrate dehydrogenase 1 (NADP+)], NRAS [neuroblastoma RAS viral (v-ras) oncogene homolog], PIK3CA, SMAD4 (SMAD family member 4), and TP53 genes. Our results suggest molecular heterogeneity among epithelial tumors of the appendix. Next generation sequencing efforts

β-catenin contributes to lung tumor development induced by EGFR mutations

PubMed Central

Nakayama, Sohei; Sng, Natasha; Carretero, Julian; Welner, Robert; Hayashi, Yuichiro; Yamamoto, Mihoko; Tan, Alistair J.; Yamaguchi, Norihiro; Yasuda, Hiroyuki; Li, Danan; Soejima, Kenzo; Soo, Ross A.; Costa, Daniel B.; Wong, Kwok-Kin; Kobayashi, Susumu S.

2014-01-01

The discovery of somatic mutations in epidermal growth factor receptor (EGFR) and development of EGFR tyrosine kinase inhibitors (TKIs) have revolutionized treatment for lung cancer. However, resistance to TKIs emerges in almost all patients and currently no effective treatment is available. Here we show that β-catenin is essential for development of EGFR mutated lung cancers. β-catenin was upregulated and activated in EGFR mutated cells. Mutant EGFR preferentially bound to and tyrosine-phosphorylated β-catenin, leading to increase in β-catenin-mediated transactivation, particularly in cells harboring the gefitinib/erlotinib-resistant gatekeeper EGFR-T790M mutation. Pharmacological inhibition of β-catenin suppressed EGFR-L858R-T790M mutated lung tumor growth and genetic deletion of the β-catenin gene dramatically reduced lung tumor formation in EGFR-L858R-T790M transgenic mice. These data suggest that β-catenin plays an essential role in lung tumorigenesis and that targeting the β-catenin pathway may provide novel strategies to prevent lung cancer development or overcome resistance to EGFR TKIs. PMID:25164010

Combined "Infiltrating Astrocytoma/Pleomorphic Xanthoastrocytoma" Harboring IDH1 R132H and BRAF V600E Mutations.

PubMed

Yamada, Seiji; Kipp, Benjamin R; Voss, Jesse S; Giannini, Caterina; Raghunathan, Aditya

2016-02-01

Pleomorphic xanthoastrocytoma (PXA) has rarely been reported in combination with infiltrating glioma, historically interpreted as a "collision tumor." Isocitrate dehydrogenase 1 (IDH1) and BRAF V600E mutations are usually not concurrent. The former is typical of adult infiltrating gliomas, and the latter is identified in a variety of primary central nervous system neoplasms, including PXA, ganglioglioma, pilocytic astrocytoma, and rarely infiltrating gliomas. We report the case of a 56-year-old man presenting with seizures and headaches. Magnetic resonance imaging revealed a large right temporal lobe mass with low T1 and high T2/FLAIR signal and a discrete contrast-enhancing focus. Histologically, the tumor showed 2 distinct components: an infiltrating astrocytoma harboring 5 mitoses/10 high-power fields and a relatively circumscribed focus, resembling PXA with, at most, 2 mitoses/10 high-power fields. No microvascular proliferation or necrosis was present in either component. The infiltrating astrocytoma component contained numerous axons, whereas the PXA-like component had sparse axons, as demonstrated by the neurofilament immunostain. Both components were positive for the mutant IDH1 R132H and showed loss of ATRX expression, whereas BRAF V600E was restricted to the PXA-like component. On sequencing of the 2 components separately after microdissection, both showed identical IDH1 R132H and TP53 R273C point mutations, whereas the BRAF V600E mutation was limited to the PXA-like component. These findings are consistent with clonal expansion of a morphologically distinct focus, harboring a private BRAF V600E mutation within an IDH1-mutant glioma. Intratumoral heterogeneity and clonal evolution, as seems to have occurred here, suggest reevaluation of "collision tumors" as a concept.

Smoking History as a Predictor of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Patients with Non-Small Cell Lung Cancer Harboring EGFR Mutations.

PubMed

Nishinarita, Noriko; Igawa, Satoshi; Kasajima, Masashi; Kusuhara, Seiichiro; Harada, Shinya; Okuma, Yuriko; Sugita, Keisuke; Ozawa, Takahiro; Fukui, Tomoya; Mitsufuji, Hisashi; Yokoba, Masanori; Katagiri, Masato; Kubota, Masaru; Sasaki, Jiichiro; Naoki, Katsuhiko

2018-04-26

Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKIs) therapy has been recognized as the standard treatment for patients with non-small cell lung cancer (NSCLC) harboring EGFR mutations. However, resistance to EGFR-TKIs has been observed in certain subpopulations of these patients. We aimed to evaluate the impact of smoking history on the efficacy of EGFR-TKIs. The records of patients (n = 248) with NSCLC harboring activating EGFR mutations who were treated with gefitinib or erlotinib at our institution between March 2010 and June 2016 were retrospectively reviewed, and the treatment outcomes were evaluated. The overall response rate and median progression-free survival (PFS) were 59.7% and 10.7 months, respectively. The overall response rate was significantly higher in the ex- and nonsmokers than in the current smokers (64.6 vs. 51.1%, p = 0.038). PFS also differed significantly between the current smokers and the ex- and nonsmokers (12.4 vs. 7.4 months, p = 0.016). Multivariate analysis identified smoking history as an independent predictor of PFS and overall survival. The clinical data obtained in this study provide a valuable rationale for considering smoking history as a predictor of the efficacy of EGFR-TKI in NSCLC patients harboring activating EGFR mutations. © 2018 S. Karger AG, Basel.

The Genomic Evolution of Prostate Cancer

DTIC Science & Technology

2014-10-01

Mutation characteristics. (a) Number of high-confidence somatic mutations across all foci. Non- silent , non- silent mutations; Unique, number of unique...genes harboring a non- silent mutation; Reported, gene reported to be mutated in references 9–12 and 14. (b) Spectrum of unique high confidence somatic...epigenetic and micr- oRNA-mediated inactivation of LRP1B, a modulator of the extracellular environment of thyroid cancer cells. Oncogene 2011; 30

AIP mutations in Brazilian patients with sporadic pituitary adenomas: a single-center evaluation

PubMed Central

Kasuki, Leandro; de Azeredo Lima, Carlos Henrique; Ogino, Liana; Camacho, Aline H S; Chimelli, Leila; Korbonits, Márta

2017-01-01

Aryl hydrocarbon receptor-interacting protein (AIP) gene mutations (AIPmut) are the most frequent germline mutations found in apparently sporadic pituitary adenomas (SPA). Our aim was to evaluate the frequency of AIPmut among young Brazilian patients with SPA. We performed an observational cohort study between 2013 and 2016 in a single referral center. AIPmut screening was carried out in 132 SPA patients with macroadenomas diagnosed up to 40 years or in adenomas of any size diagnosed until 18 years of age. Twelve tumor samples were also analyzed. Leukocyte DNA and tumor tissue DNA were sequenced for the entire AIP-coding region for evaluation of mutations. Eleven (8.3%) of the 132 patients had AIPmut, comprising 9/74 (12%) somatotropinomas, 1/38 (2.6%) prolactinoma, 1/10 (10%) corticotropinoma and no non-functioning adenomas. In pediatric patients (≤18 years), AIPmut frequency was 13.3% (2/15). Out of the 5 patients with gigantism, two had AIPmut, both truncating mutations. The Y268* mutation was described in Brazilian patients and the K273Rfs*30 mutation is a novel mutation in our patient. No somatic AIP mutations were found in the 12 tumor samples. A tumor sample from an acromegaly patient harboring the A299V AIPmut showed loss of heterozygosity. In conclusion, AIPmut frequency in SPA Brazilian patients is similar to other populations. Our study identified two mutations exclusively found in Brazilians and also shows, for the first time, loss of heterozygosity in tumor DNA from an acromegaly patient harboring the A299V AIPmut. Our findings corroborate previous observations that AIPmut screening should be performed in young patients with SPA. PMID:29074612

IgV(H) and bcl6 somatic mutation analysis reveals the heterogeneity of cutaneous B-cell lymphoma, and indicates the presence of undisclosed local antigens.

PubMed

Franco, Renato; Camacho, Francisca I; Fernández-Vázquez, Amalia; Algara, Patrocinio; Rodríguez-Peralto, José L; De Rosa, Gaetano; Piris, Miguel A

2004-06-01

Our understanding of the ontology of B-cell lymphomas (BCL) has been improved by the study of mutational status of IgV(H) and bcl6 genes, but only a few cases of cutaneous BCL have been examined for this status. We analyzed IgV(H) and bcl6 somatic mutations in 10 cutaneous BCL, classified as follicular (three primary and one secondary), primary marginal zone (two cases), and diffuse large BCL (three primary and one secondary). We observed a lower rate (<2%) of IgV(H) mutation in all marginal zone lymphomas, and a preferential usage of V(H)2-70 (one primary follicular and two primary diffuse large BCL). Fewer than expected replacement mutations in framework regions (FR) were observed in three primary follicular lymphomas (FLs) and in all diffuse large BCL, indicating a negative antigen selection pressure. Ongoing mutations were observed in eight of 10 cases. Only two primary FLs and two diffuse large BCL showed bcl6 somatic mutation. These data support the heterogeneous nature of the different cutaneous BCL, and specifically the distinction between cutaneous follicular and marginal zone lymphomas. The biased usage of V(H)2-70, the low rate of replacement mutation in the FR, and the presence of ongoing mutation imply that local antigens could modulate the growth of primary cutaneous BCL.

Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

PubMed

Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

2015-07-01

Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96

Biological implications of somatic DDX41 p.R525H mutation in acute myeloid leukemia.

PubMed

Kadono, Moe; Kanai, Akinori; Nagamachi, Akiko; Shinriki, Satoru; Kawata, Jin; Iwato, Koji; Kyo, Taiichi; Oshima, Kumi; Yokoyama, Akihiko; Kawamura, Takeshi; Nagase, Reina; Inoue, Daichi; Kitamura, Toshio; Inaba, Toshiya; Ichinohe, Tatsuo; Matsui, Hirotaka

2016-08-01

The DDX41 gene, encoding a DEAD-box type ATP-dependent RNA helicase, is rarely but reproducibly mutated in myeloid diseases. The acquired mutation in DDX41 is highly concentrated at c.G1574A (p.R525H) in the conserved motif VI located at the C-terminus of the helicase core domain where ATP interacts and is hydrolyzed. Therefore, it is likely that the p.R525H mutation perturbs ATPase activity in a dominant-negative manner. In this study, we screened for the DDX41 mutation of CD34-positive tumor cells based on mRNA sequencing and identified the p.R525H mutation in three cases among 23 patients. Intriguingly, these patients commonly exhibited acute myeloid leukemia (AML) with peripheral blood cytopenias and low blast counts, suggesting that the mutation inhibits the growth and differentiation of hematopoietic cells. Data from cord blood cells and leukemia cell lines suggest a role for DDX41 in preribosomal RNA processing, in which the expression of the p.R525H mutant causes a certain ribosomopathy phenotype in hematopoietic cells by suppressing MDM2-mediated RB degradation, thus triggering the inhibition of E2F activity. This study uncovered a pathogenic role of p.R525H DDX41 in the slow growth rate of tumor cells. Age-dependent epigenetic alterations or other somatic changes might collaborate with the mutation to cause AML. Copyright © 2016 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Mutational landscape of MCPyV-positive and MCPyV-negative Merkel cell carcinomas with implications for immunotherapy.

PubMed

Goh, Gerald; Walradt, Trent; Markarov, Vladimir; Blom, Astrid; Riaz, Nadeem; Doumani, Ryan; Stafstrom, Krista; Moshiri, Ata; Yelistratova, Lola; Levinsohn, Jonathan; Chan, Timothy A; Nghiem, Paul; Lifton, Richard P; Choi, Jaehyuk

2016-01-19

Merkel cell carcinoma (MCC) is a rare but highly aggressive cutaneous neuroendocrine carcinoma, associated with the Merkel cell polyomavirus (MCPyV) in 80% of cases. To define the genetic basis of MCCs, we performed exome sequencing of 49 MCCs. We show that MCPyV-negative MCCs have a high mutation burden (median of 1121 somatic single nucleotide variants (SSNVs) per-exome with frequent mutations in RB1 and TP53 and additional damaging mutations in genes in the chromatin modification (ASXL1, MLL2, and MLL3), JNK (MAP3K1 and TRAF7), and DNA-damage pathways (ATM, MSH2, and BRCA1). In contrast, MCPyV-positive MCCs harbor few SSNVs (median of 12.5 SSNVs/tumor) with none in the genes listed above. In both subgroups, there are rare cancer-promoting mutations predicted to activate the PI3K pathway (HRAS, KRAS, PIK3CA, PTEN, and TSC1) and to inactivate the Notch pathway (Notch1 and Notch2). TP53 mutations appear to be clinically relevant in virus-negative MCCs as 37% of these tumors harbor potentially targetable gain-of-function mutations in TP53 at p.R248 and p.P278. Moreover, TP53 mutational status predicts death in early stage MCC (5-year survival in TP53 mutant vs wild-type stage I and II MCCs is 20% vs. 92%, respectively; P = 0.0036). Lastly, we identified the tumor neoantigens in MCPyV-negative and MCPyV-positive MCCs. We found that virus-negative MCCs harbor more tumor neoantigens than melanomas or non-small cell lung cancers (median of 173, 65, and 111 neoantigens/sample, respectively), two cancers for which immune checkpoint blockade can produce durable clinical responses. Collectively, these data support the use of immunotherapies for virus-negative MCCs.

Prevalence and clinical significance of mediator complex subunit 12 mutations in 362 Han Chinese samples with uterine leiomyoma.

PubMed

Wu, Juan; Zou, Yang; Luo, Yong; Guo, Jiu-Bai; Liu, Fa-Ying; Zhou, Jiang-Yan; Zhang, Zi-Yu; Wan, Lei; Huang, Ou-Ping

2017-07-01

Uterine leiomyomas (ULs) are the most common gynecological benign tumors originating from the myometrium. Prevalent mutations in the mediator complex subunit 12 (MED12) gene have been identified in ULs, and functional evidence has revealed that these mutations may promote the development of ULs. However, whether MED12 mutations are associated with certain clinical characteristics in ULs remains largely unknown. In the present study, the potential mutations of MED12 and its paralogous gene, mediator complex subunit 12-like (MED12L), were screened in 362 UL tumors from Han Chinese patients. A total of 158 out of 362 UL tumors (43.6%) were identified as harboring MED12 somatic mutations, and the majority of these mutations were restricted to the 44th residue. MED12 mutations were also observed in 2 out of 145 (1.4%) adjacent control myometrium. Furthermore, the mutation spectrum of MED12 in the concurrent leiomyomas was noticeably different. Correlation analysis of MED12 mutations with the available clinical features indicated that patients with mutated MED12 tended to have smaller cervical diameters. By contrast, no MED12L mutation was identified in the present samples. In summary, the present study demonstrated the presence of prevalent MED12 somatic mutations in UL samples, and the MED12 mutation was associated with smaller cervical diameters. The low mutation frequency of MED12 in adjacent control myometrium indicated that MED12 mutation may be an early event in the pathogenesis of ULs. Furthermore, MED12 mutation status in concurrent tumors from multiple leiomyomas supported several prior observations that the majority of these tumors arose independently.

The effect of icotinib combined with chemotherapy in untreated non-small-cell lung cancer that harbored EGFR-sensitive mutations in a real-life setting: a retrospective analysis.

PubMed

Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin

2018-01-01

This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion.

The effect of icotinib combined with chemotherapy in untreated non-small-cell lung cancer that harbored EGFR-sensitive mutations in a real-life setting: a retrospective analysis

PubMed Central

Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin

2018-01-01

Purpose This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. Patients and methods One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Results Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. Conclusion The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion. PMID:29731642

Novel mutations in the CDKL5 gene in complex genotypes associated with West syndrome with variable phenotype: First description of somatic mosaic state.

PubMed

Jdila, Marwa Ben; Issa, Abir Ben; Khabou, Boudour; Rhouma, Bochra Ben; Kamoun, Fatma; Ammar-Keskes, Leila; Triki, Chahnez; Fakhfakh, Faiza

2017-10-01

West syndrome is a rare epileptic encephalopathy of early infancy, characterized by epileptic spasms, hypsarrhythmia, and psychomotor retardation beginning in the first year of life. The present study reports the clinical, molecular and bioinformatic investigation in the three studied West patients. The results revealed a complex genotype with more than one mutation in each patient including the known mutations c.1910C>G (P2, P3); c.2372A>C in P3 and c.2395C>G in P1 and novel variants including c.616G>A, shared by the three patients P1, P2 and P3; c.1403G>C shared by P2 and P3 and c.2288A>G in patient P1. All the mutations were at somatic mosaic state and were de novo in the patients except ones (c.2372A>C). To our knowledge; the somatic mosaic state is described for the first time in patients with West syndrome. Five identified mutations were located in the C-terminal domain of the protein, while the novel mutation (c.616G>A) was in the catalytic domain. Bioinformatic tools predicted that this latter is the most pathogenic substitution affecting 3D protein structure and the secondary mRNA structure. Complex genotype composed of different combinations of mutations in each patient seems to be related to the phenotype variability. Copyright © 2017. Published by Elsevier B.V.

Infrequent detectable somatic mutations of the RET and glial cell line-derived neurotrophic factor (GDNF) genes in human pituitary adenomas.

PubMed

Yoshimoto, K; Tanaka, C; Moritani, M; Shimizu, E; Yamaoka, T; Yamada, S; Sano, T; Itakura, M

1999-02-01

RET is a receptor tyrosine kinase expressed in neuroendocrine cells and tumors. RET is activated by a ligand complex comprising glial cell line-derived neurotrophic factor (GDNF) and GDNF receptor-alpha (GDNFR-alpha). Activating mutations of the RET proto-oncogene were found in multiple endocrine neoplasia (MEN) 2 and in sporadic medullary thyroid carcinoma and pheochromocytoma of neuroendocrine origin. Mutations of the RET proto-oncogene and the glial cell line-derived neurotrophic factor (GDNF) gene were examined in human pituitary tumors. No mutations of the RET proto-oncogene including the cysteine-rich region or codon 768 and 918 in the tyrosine kinase domain were detected in 172 human pituitary adenomas either by polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) or by PCR-restriction fragment length polymorphism (RFLP). Further, somatic mutations of the GDNF gene in 33 human pituitary adenomas were not detected by PCR-SSCP. One polymorphism of the GDNF gene at codon 145 of TGC or TGT was observed in a prolactinoma. The RET proto-oncogene message was detected in a normal human pituitary gland or 4 of 4 human pituitary adenomas with reverse transcription (RT)-PCR, and in rodent pituitary tumor cell lines with Western blotting. The expression of GDNF gene was detected in 1 of 4 human somatotroph adenomas, 1 of 2 corticotroph adenomas, and 2 of 6 rodent pituitary tumor cell lines with RT-PCR. Based on these, it is concluded that somatic mutations of the RET proto-oncogene or the GDNF gene do not appear to play a major role in the pituitary tumorigenesis in examined tumors.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma.

PubMed

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-03-03

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies.

Exome Sequencing Identifies Potentially Druggable Mutations in Nasopharyngeal Carcinoma

PubMed Central

Chow, Yock Ping; Tan, Lu Ping; Chai, San Jiun; Abdul Aziz, Norazlin; Choo, Siew Woh; Lim, Paul Vey Hong; Pathmanathan, Rajadurai; Mohd Kornain, Noor Kaslina; Lum, Chee Lun; Pua, Kin Choo; Yap, Yoke Yeow; Tan, Tee Yong; Teo, Soo Hwang; Khoo, Alan Soo-Beng; Patel, Vyomesh

2017-01-01

In this study, we first performed whole exome sequencing of DNA from 10 untreated and clinically annotated fresh frozen nasopharyngeal carcinoma (NPC) biopsies and matched bloods to identify somatically mutated genes that may be amenable to targeted therapeutic strategies. We identified a total of 323 mutations which were either non-synonymous (n = 238) or synonymous (n = 85). Furthermore, our analysis revealed genes in key cancer pathways (DNA repair, cell cycle regulation, apoptosis, immune response, lipid signaling) were mutated, of which those in the lipid-signaling pathway were the most enriched. We next extended our analysis on a prioritized sub-set of 37 mutated genes plus top 5 mutated cancer genes listed in COSMIC using a custom designed HaloPlex target enrichment panel with an additional 88 NPC samples. Our analysis identified 160 additional non-synonymous mutations in 37/42 genes in 66/88 samples. Of these, 99/160 mutations within potentially druggable pathways were further selected for validation. Sanger sequencing revealed that 77/99 variants were true positives, giving an accuracy of 78%. Taken together, our study indicated that ~72% (n = 71/98) of NPC samples harbored mutations in one of the four cancer pathways (EGFR-PI3K-Akt-mTOR, NOTCH, NF-κB, DNA repair) which may be potentially useful as predictive biomarkers of response to matched targeted therapies. PMID:28256603

Inducing Somatic Pkd1 Mutations in Vivo in a Mouse Model of Autosomal-Dominant Polycystic Kidney Disease

DTIC Science & Technology

2016-10-01

AWARD NUMBER: W81XWH-15-1-0237 TITLE: Inducing Somatic Pkd1 Mutations in Vivo in a Mouse Model of Autosomal-Dominant Polycystic Kidney ... Kidney Disease 5b. GRANT NUMBER W81XWH-15-1-0237 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Cristina Cebrian-Ligero 5d. PROJECT NUMBER 5e. TASK...Autosomal Dominant Polycystic Kidney Disease (ADPKD) is one of the world’s most common life-threatening genetic diseases. Over 95% of diagnosed cases of

Distinct subtype distribution and somatic mutation spectrum of lymphomas in East Asia.

PubMed

Ren, Weicheng; Li, Wei; Ye, Xiaofei; Liu, Hui; Pan-Hammarström, Qiang

2017-07-01

Here, we give an updated overview of the subtype distribution of lymphomas in East Asia and also present the genome sequencing data on two major subtypes of these tumors. The distribution of lymphoma types/subtypes among East Asian countries is very similar, with a lower proportion of B-cell malignancies and a higher proportion of T/natural killer (NK)-cell lymphomas as compared to Western populations. Extranodal NK/T-cell lymphoma is more frequently observed in East Asia, whereas follicular lymphoma and chronic lymphocytic leukemia, are proportionally lower. The incidence rate of lymphoma subtypes in Asians living in the US was generally intermediate to the general rate in US and Asia, suggesting that both genetic and environmental factors may underlie the geographical variations observed.Key cancer driver mutations have been identified in Asian patients with diffuse large B-cell lymphoma or extranodal NK/T-cell lymphoma through genome sequencing. A distinct somatic mutation profile has also been observed in Chinese diffuse large B-cell lymphoma patients. The incidence and distribution of lymphoma subtypes differed significantly between patients from East Asia and Western countries, suggesting subtype-specific etiologic mechanisms. Further studies on the mechanism underlying these geographical variations may give new insights into our understanding of lymphomagenesis.

Combining molecular and immunohistochemical analyses of key drivers in primary melanomas: interplay between germline and somatic variations.

PubMed

Bruno, William; Martinuzzi, Claudia; Dalmasso, Bruna; Andreotti, Virginia; Pastorino, Lorenza; Cabiddu, Francesco; Gualco, Marina; Spagnolo, Francesco; Ballestrero, Alberto; Queirolo, Paola; Grillo, Federica; Mastracci, Luca; Ghiorzo, Paola

2018-01-19

Due to the high mutational somatic burden of Cutaneous Malignant Melanoma (CMM) a thorough profiling of the driver mutations and their interplay is necessary to explain the timing of tumorigenesis or for the identification of actionable genetic events. The aim of this study was to establish the mutation rate of some of the key drivers in melanoma tumorigenesis combining molecular analyses and/or immunohistochemistry in 93 primary CMMs from an Italian cohort also characterized for germline status, and to investigate an interplay between germline and somatic variants. BRAF mutations were present in 68% of cases, while CDKN2A germline mutations were found in 16 % and p16 loss in tissue was found in 63%. TERT promoter somatic mutations were detected in 38% of cases while the TERT -245T>C polymorphism was found in 51% of cases. NRAS mutations were found in 39% of BRAF negative or undetermined cases. NF1 was expressed in all cases analysed. MC1R variations were both considered as a dichotomous variable or scored. While a positive, although not significant association between CDKN2A germline mutations, but not MC1R variants, and BRAF somatic mutation was found, we did not observe other associations between germline and somatic events. A yet undescribed inverse correlation between TERT -245T>C polymorphism and the presence of BRAF mutation was found. It is possible to hypothesize that -245T>C polymorphism could be included in those genotypes which may influence the occurrence of BRAF mutations. Further studies are needed to investigate the role of -245T>C polymorphism as a germline predictor of BRAF somatic mutation status.

Development of breast tumors in CHEK2, NBN/NBS1 and BLM mutation carriers does not commonly involve somatic inactivation of the wild-type allele.

PubMed

Suspitsin, Evgeny N; Yanus, Grigory A; Sokolenko, Anna P; Yatsuk, Olga S; Zaitseva, Olga A; Bessonov, Alexandr A; Ivantsov, Alexandr O; Heinstein, Valeria A; Klimashevskiy, Valery F; Togo, Alexandr V; Imyanitov, Evgeny N

2014-02-01

Somatic inactivation of the remaining allele is a characteristic feature of cancers arising in BRCA1 and BRCA2 mutation carriers, which determines their unprecedented sensitivity to some DNA-damaging agents. Data on tumor-specific status of the involved gene in novel varieties of hereditary breast cancer (BC) remain incomplete. We analyzed 32 tumors obtained from 30 patients with non-BRCA1/2 BC-associated germ-line mutations: 25 women were single mutation carriers (7 BLM, 15 CHEK2 and 3 NBN/NBS1) and 5 were double mutation carriers (2 BLM/BRCA1, 1 CHEK2/BLM, 1 CHEK2/BRCA1 and 1 NBN/BLM). Losses of heterozygosity affecting the wild-type allele were detected in none of the tumors from BLM mutation carriers, 3/18 (17 %) CHEK2-associated BC and 1/4 (25 %) NBN/NBS1-driven tumors. The remaining 28 BC were subjected to the sequence analysis of entire coding region of the involved gene; no somatic mutations were identified. We conclude that the tumor-specific loss of the wild-type allele is not characteristic for BC arising in CHEK2, NBN/NBS1 and BLM mutation carriers. Rarity of "second-hit" inactivation of the involved gene in CHEK2-, NBN/NBS1- and BLM-associated BC demonstrates their substantial biological difference from BRCA1/2-driven cancers and makes them poorly suitable for the clinical trials with cisplatin and PARP inhibitors.

Rapid intracranial response to osimertinib, without radiotherapy, in nonsmall cell lung cancer patients harboring the EGFR T790M mutation

PubMed Central

Koba, Taro; Kijima, Takashi; Takimoto, Takayuki; Hirata, Haruhiko; Naito, Yujiro; Hamaguchi, Masanari; Otsuka, Tomoyuki; Kuroyama, Muneyoshi; Nagatomo, Izumi; Takeda, Yoshito; Kida, Hiroshi; Kumanogoh, Atsushi

2017-01-01

Abstract Rationale: Most of nonsmall cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR) activating mutations eventually acquire resistance to the first EGFR-tyrosine kinase inhibitors (TKIs) therapy after varying periods of treatment. Of note, approximately one-third of those patients develop brain metastases, which deteriorate their quality of life and survival. The effect of systemic chemotherapy on brain metastases after acquisition of EGFR-TKI resistance is limited, and thus far, whole-brain radiation therapy, which may cause the harmful effect on neurocognitive functions, has been the only established therapeutic option for especially symptomatic brain metastases. Osimertinib is a third-generation oral, potent, and irreversible EGFR-TKI. It can bind to EGFRs with high affinity even when the EGFR T790M mutation exists in addition to the sensitizing mutations. Its clinical efficacy for NSCLC patients harboring the T790M mutation has already been shown; however, the evidence of osimertinib on brain metastases has not been documented well, especially in terms of the appropriate timing for treatment and its response evaluation. Patient concerns, Diagnoses, and Interventions: We experienced 2 NSCLC patients with the EGFR T790M mutation; a 67-year-old woman with symptomatic multiple brain metastases administered osimertinib as seventh-line chemotherapy, and a 76-year old man with an asymptomatic single brain metastasis administered osimertinib as fifth-line chemotherapy. Outcomes: These patients showed great response to osimertinib within 2 weeks without radiation therapy. Lessons: These are the first reports to reveal the rapid response of the brain metastases to osimertinib within 2 weeks. These cases suggest the possibility that preemptive administration of osimertinib may help patients to postpone or avoid radiation exposures. In addition, rapid reassessment of the effect of osimertinib on brain metastases could prevent patients

Hyperfunctioning thyroid nodules in toxic multinodular goiter share activating thyrotropin receptor mutations with solitary toxic adenoma.

PubMed

Tonacchera, M; Chiovato, L; Pinchera, A; Agretti, P; Fiore, E; Cetani, F; Rocchi, R; Viacava, P; Miccoli, P; Vitti, P

1998-02-01

Toxic multinodular goiter is a cause of nonautoimmune hyperthyroidism and is believed to differ in its nature and pathogenesis from toxic adenoma. Gain-of-function mutations of the TSH receptor gene have been identified as a cause of toxic adenoma. The pathogenesis at the molecular level of hyperfunctioning nodules in toxic multinodular goiter has yet not been reported. Six patients with a single hot nodule within a multinodular goiter and 11 patients with toxic thyroid adenoma were enrolled in our study. At histology five hyperfunctioning nodules in multinodular goiters showed the features of adenomas, and one was identified as a hyperplastic nodule. The entire exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from genomic DNA obtained from surgical specimens. Functional studies of mutated receptors were performed in COS-7 cells. Five out of 6 (83%) hyperfunctioning nodules within toxic multinodular goiters harbored a TSH receptor mutation. A TSH receptor mutation was also evident in the hyperfunctioning nodule that at histology had the features of noncapsulated hyperplastic nodule. Among toxic adenomas, 8 out of 11 (72%) nodules harbored a TSH receptor mutation. All the mutations were heterozygotic and somatic. Nonfunctioning nodules, whether adenomas or hyperplastic nodules present in association with hyperfunctioning nodules in the same multinodular goiters, had no TSH receptor mutation. All the mutations identified had constitutive activity as assessed by cAMP production after expression in COS-7 cells. Hyperfunctioning thyroid nodules in multinodular goiters recognize the same pathogenetic event (TSH receptor mutation) as toxic adenoma. Other mechanisms are implicated in the growth of nonfunctioning thyroid nodules coexistent in the same gland.

Right ventricular outflow tract tachycardia due to a somatic cell mutation in G protein subunitalphai2.

PubMed Central

Lerman, B B; Dong, B; Stein, K M; Markowitz, S M; Linden, J; Catanzaro, D F

1998-01-01

Idiopathic ventricular tachycardia is a generic term that describes the various forms of ventricular arrhythmias that occur in patients without structural heart disease and in the absence of the long QT syndrome. Many of these tachycardias are focal in origin, localize to the right ventricular outflow tract (RVOT), terminate in response to beta blockers, verapamil, vagal maneuvers, and adenosine, and are thought to result from cAMP-mediated triggered activity. DNA was prepared from biopsy samples obtained from myocardial tissue from a patient with adenosine-insensitive idiopathic ventricular tachycardia arising from the RVOT. Genomic sequences of the inhibitory G protein Galphai2 were determined after amplification by PCR and subcloning. A point mutation (F200L) in the GTP binding domain of the inhibitory G protein Galphai2 was identified in a biopsy sample from the arrhythmogenic focus. This mutation was shown to increase intracellular cAMP concentration and inhibit suppression of cAMP by adenosine. No mutations were detected in Galphai2 sequences from myocardial tissue sampled from regions remote from the origin of tachycardia, or from peripheral lymphocytes. These findings suggest that somatic cell mutations in the cAMP-dependent signal transduction pathway occurring during myocardial development may be responsible for some forms of idiopathic ventricular tachycardia. PMID:9637720

Advances in computational approaches for prioritizing driver mutations and significantly mutated genes in cancer genomes.

PubMed

Cheng, Feixiong; Zhao, Junfei; Zhao, Zhongming

2016-07-01

Cancer is often driven by the accumulation of genetic alterations, including single nucleotide variants, small insertions or deletions, gene fusions, copy-number variations, and large chromosomal rearrangements. Recent advances in next-generation sequencing technologies have helped investigators generate massive amounts of cancer genomic data and catalog somatic mutations in both common and rare cancer types. So far, the somatic mutation landscapes and signatures of >10 major cancer types have been reported; however, pinpointing driver mutations and cancer genes from millions of available cancer somatic mutations remains a monumental challenge. To tackle this important task, many methods and computational tools have been developed during the past several years and, thus, a review of its advances is urgently needed. Here, we first summarize the main features of these methods and tools for whole-exome, whole-genome and whole-transcriptome sequencing data. Then, we discuss major challenges like tumor intra-heterogeneity, tumor sample saturation and functionality of synonymous mutations in cancer, all of which may result in false-positive discoveries. Finally, we highlight new directions in studying regulatory roles of noncoding somatic mutations and quantitatively measuring circulating tumor DNA in cancer. This review may help investigators find an appropriate tool for detecting potential driver or actionable mutations in rapidly emerging precision cancer medicine. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Somatic KRAS mutation in an infant with linear nevus sebaceous syndrome associated with lymphatic malformations: A case report and literature review.

PubMed

Lihua, Jiang; Feng, Gao; Shanshan, Mao; Jialu, Xu; Kewen, Jiang

2017-11-01

Linear nevus sebaceous syndrome (LNSS) is a rare neurocutaneous syndrome, characterized by nevus sebaceous,central nervous system (CNS), ocular and skeletal abnormalities. The present study describes KRAS somatic mosaic mutation in a case of LNSS with lymphatic malformations (LMs). A 4-month-old female with a clinical diagnosis of LNSS presented with infantile spasms, mental retardation, skull dysplasia, ocular abnormalities, congenital atrial septal defect, and LMs. Cervical ultrasonography revealed a 4.6 × 4.6 × 2.2cm no echo packet with clear boundary in the subcutaneous tissues of the right neck. The neck MRI indicated a cyst in the subcutaneous tissues of the right neck. Whole-exome sequencing revealed a low-level heterozygous mutation of the KRAS gene (c.35C > T; p.G12D, 19%) in the skin lesion sample. This mutation was not present in the blood samples of the patient and her parents. The patient received sclerotherapy with paicibanil (OK-432) injection for the cyst. Following 1 year of treatment, the patient exhibited fewer seizures. The mental and motor development was significantly improved. The patient can currently walk with assistance and speak simple words. LNSS is a rare, congenital neurocutaneous syndrome consisting of a spectrum of abnormalities involving the skin, central nervous system, eyes, LMs and other systems. LNSS can be caused by postzygotic somatic mutation in the RAS family of genes. Multidisciplinary evaluation and treatment is needed. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

Discovery of somatic mutations in the progression of chronic myeloid leukemia by whole-exome sequencing.

PubMed

Huang, Y; Zheng, J; Hu, J D; Wu, Y A; Zheng, X Y; Liu, T B; Chen, F L

2014-02-19

We performed whole-exome sequencing in samples representing accelerated phase (AP) and blastic crisis (BC) in a subject with chronic myeloid leukemia (CML). A total of 12.74 Gb clean data were generated, achieving a mean depth coverage of 64.45 and 69.53 for AP and BC samples, respectively, of the target region. A total of 148 somatic variants were detected, including 76 insertions and deletions (indels), 64 single-nucleotide variations (SNV), and 8 structural variations (SV). On the basis of annotation and functional prediction analysis, we identified 3 SNVs and 6 SVs that showed a potential association with CML progression. Among the genes that harbor the identified variants, GATA2 has previously been reported to play important roles in the progression from AP to BC in CML. Identification of these genes will allow us to gain a better understanding of the pathological mechanism of CML and represents a critical advance toward new molecular diagnostic tests for the development of potential therapies for CML.

Somatic alterations of the serine/threonine kinase LKB1 gene in squamous cell (SCC) and large cell (LCC) lung carcinoma.

PubMed

Strazisar, Mojca; Mlakar, Vid; Rott, Tomaz; Glavac, Damjan

2009-05-01

Somatic LKB1 serine/threonine kinase alterations are rare in sporadic cancers, with the exception lung adenocarcinoma, but no mutations in squamous cell or large cell primary carcinoma were discovered. We screened the LKB1 gene in 129 primary nonsmall cell lung carcinomas, adjacent healthy lung tissue, and control blood samples. Forty-five percent of nonsmall cell lung tumors harbored either intron or exon alterations. We identified R86G, F354L, Y272Y and three polymorphisms: 290+36G/T, 386+156G/T, and 862+145C/T (novel). R86G (novel) and F354L mutations were found in six squamous cell carcinomas and three large cell cancer carcinomas, but not in the adjacent healthy tissue or controls samples. The F354L mutation was found in advanced squamous cell carcinomas with elevated COX-2 expression, rare P53, and no K-RAS mutation. Results indicate that the LKB1 gene is changed in a certain proportion of nonsmall cell lung tumors, predominately in advanced squamous lung carcinoma. Inactivation of the gene takes place via the C-terminal domain and could be related to mechanisms influencing tumor initiation, differentiation, and metastasis.

Somatic mutation dynamics in MDS patients treated with azacitidine indicate clonal selection in patients-responders

PubMed Central

Polgarova, Kamila; Vargova, Karina; Kulvait, Vojtech; Dusilkova, Nina; Minarik, Lubomir; Zemanova, Zuzana; Pesta, Michal; Jonasova, Anna; Stopka, Tomas

2017-01-01

Azacitidine (AZA) for higher risk MDS patients is a standard therapy with limited durability. To monitor mutation dynamics during AZA therapy we utilized massive parallel sequencing of 54 genes previously associated with MDS/AML pathogenesis. Serial sampling before and during AZA therapy of 38 patients (reaching median overall survival 24 months (Mo) with 60% clinical responses) identified 116 somatic pathogenic variants with allele frequency (VAF) exceeding 5%. High accuracy of data was achieved via duplicate libraries from myeloid cells and T-cell controls. We observed that nearly half of the variants were stable while other variants were highly dynamic. Patients with marked decrease of allelic burden upon AZA therapy achieved clinical responses. In contrast, early-progressing patients on AZA displayed minimal changes of the mutation pattern. We modeled the VAF dynamics on AZA and utilized a joint model for the overall survival and response duration. While the presence of certain variants associated with clinical outcomes, such as the mutations of CDKN2A were adverse predictors while KDM6A mutations yield lower risk of dying, the data also indicate that allelic burden volatility represents additional important prognostic variable. In addition, preceding 5q- syndrome represents strong positive predictor of longer overall survival and response duration in high risk MDS patients treated with AZA. In conclusion, variants dynamics detected via serial sampling represents another parameter to consider when evaluating AZA efficacy and predicting outcome. PMID:29340104

Intersection of diverse neuronal genomes and neuropsychiatric disease: The Brain Somatic Mosaicism Network.

PubMed

McConnell, Michael J; Moran, John V; Abyzov, Alexej; Akbarian, Schahram; Bae, Taejeong; Cortes-Ciriano, Isidro; Erwin, Jennifer A; Fasching, Liana; Flasch, Diane A; Freed, Donald; Ganz, Javier; Jaffe, Andrew E; Kwan, Kenneth Y; Kwon, Minseok; Lodato, Michael A; Mills, Ryan E; Paquola, Apua C M; Rodin, Rachel E; Rosenbluh, Chaggai; Sestan, Nenad; Sherman, Maxwell A; Shin, Joo Heon; Song, Saera; Straub, Richard E; Thorpe, Jeremy; Weinberger, Daniel R; Urban, Alexander E; Zhou, Bo; Gage, Fred H; Lehner, Thomas; Senthil, Geetha; Walsh, Christopher A; Chess, Andrew; Courchesne, Eric; Gleeson, Joseph G; Kidd, Jeffrey M; Park, Peter J; Pevsner, Jonathan; Vaccarino, Flora M

2017-04-28

Neuropsychiatric disorders have a complex genetic architecture. Human genetic population-based studies have identified numerous heritable sequence and structural genomic variants associated with susceptibility to neuropsychiatric disease. However, these germline variants do not fully account for disease risk. During brain development, progenitor cells undergo billions of cell divisions to generate the ~80 billion neurons in the brain. The failure to accurately repair DNA damage arising during replication, transcription, and cellular metabolism amid this dramatic cellular expansion can lead to somatic mutations. Somatic mutations that alter subsets of neuronal transcriptomes and proteomes can, in turn, affect cell proliferation and survival and lead to neurodevelopmental disorders. The long life span of individual neurons and the direct relationship between neural circuits and behavior suggest that somatic mutations in small populations of neurons can significantly affect individual neurodevelopment. The Brain Somatic Mosaicism Network has been founded to study somatic mosaicism both in neurotypical human brains and in the context of complex neuropsychiatric disorders. Copyright © 2017, American Association for the Advancement of Science.

TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome.

PubMed

Gray, Phillip N; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M

2018-04-17

The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2 , MSH6 , MLH1 , PMS2 and EPCAM . Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases.

TumorNext-Lynch-MMR: a comprehensive next generation sequencing assay for the detection of germline and somatic mutations in genes associated with mismatch repair deficiency and Lynch syndrome

PubMed Central

Gray, Phillip N.; Tsai, Pei; Chen, Daniel; Wu, Sitao; Hoo, Jayne; Mu, Wenbo; Li, Bing; Vuong, Huy; Lu, Hsiao-Mei; Batth, Navanjot; Willett, Sara; Uyeda, Lisa; Shah, Swati; Gau, Chia-Ling; Umali, Monalyn; Espenschied, Carin; Janicek, Mike; Brown, Sandra; Margileth, David; Dobrea, Lavinia; Wagman, Lawrence; Rana, Huma; Hall, Michael J.; Ross, Theodora; Terdiman, Jonathan; Cullinane, Carey; Ries, Savita; Totten, Ellen; Elliott, Aaron M.

2018-01-01

The current algorithm for Lynch syndrome diagnosis is highly complex with multiple steps which can result in an extended time to diagnosis while depleting precious tumor specimens. Here we describe the analytical validation of a custom probe-based NGS tumor panel, TumorNext-Lynch-MMR, which generates a comprehensive genetic profile of both germline and somatic mutations that can accelerate and streamline the time to diagnosis and preserve specimen. TumorNext-Lynch-MMR can detect single nucleotide variants, small insertions and deletions in 39 genes that are frequently mutated in Lynch syndrome and colorectal cancer. Moreover, the panel provides microsatellite instability status and detects loss of heterozygosity in the five Lynch genes; MSH2, MSH6, MLH1, PMS2 and EPCAM. Clinical cases are described that highlight the assays ability to differentiate between somatic and germline mutations, precisely classify variants and resolve discordant cases. PMID:29755653

Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

PubMed

Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

2016-12-01

Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

Evidence that the oxygen enhancement ratio for pink somatic mutations in Tradescantia stamen hairs may approach unity at very low x-ray doses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Underbrink, A.G.; Woch, B.

1980-11-01

Experimental evidence was found that the oxygen enhancement ratio (OER) for pink somatic mutations in the stamen hairs of Tradescantia clone 02 appears to reach unity at X-ray doses of 2 to 3 rad. There is also a small segment on the dose-response curves from about 3 to 10 rad where the OER appears to be dose-dependent. At higher doses the aerated and hypoxic curves are parallel, and the OER is 3.2 up to doses where the mutation frequency reaches a plateau.

Novel KRAS Gene Mutations in Sporadic Colorectal Cancer

PubMed Central

Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.

2014-01-01

Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182

A phase II trial of regorafenib in patients with metastatic and/or a unresectable gastrointestinal stromal tumor harboring secondary mutations of exon 17.

PubMed

Yeh, Chun-Nan; Chen, Ming-Huang; Chen, Yen-Yang; Yang, Ching-Yao; Yen, Chueh-Chuan; Tzen, Chin-Yuan; Chen, Li-Tzong; Chen, Jen-Shi

2017-07-04

Gastrointestinal stromal tumors (GISTs) are caused by the constitutive activation of KIT or platelet-derived growth factor receptor alpha (PDGFRA) mutations. Imatinib selectively inhibits KIT and PDGFR, leading to disease control for 80%-90% of patients with metastatic GIST. Imatinib resistance can occur within a median of 2-3 years due to secondary mutations in KIT. According to preclinical studies, both imatinib and sunitinib are ineffective against exon 17 mutations. However, the treatment efficacy of regorafenib for patients with GIST with exon 17 mutations is still unknown. Documented patients with GIST with exon 17 mutations were enrolled in this study. Patients received 160 mg of oral regorafenib daily on days 1-21 of a 28-day cycle. The primary end point of this trial was the clinical benefit rate (CBR; i.e., complete or partial response [PR], as well as stable disease [SD]) at 16 weeks. The secondary end points of this study included progression free survival (PFS), overall survival, and safety. Between June 2014 to May 2016, 18 patients were enrolled (15 of which were eligible for response evaluation). The CBR at 16 weeks was 93.3% (14 of 15; 6 PR and 8 SD). The median PFS was 22.1 months. The most common grade 3 toxicities were hand-and-foot skin reactions (10 of 18; 55.6%), followed by hypertension (5 of 18; 27.8%). Regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17. A phase III trial of regorafenib versus placebo is warranted. This trial is registered at ClinicalTrials.gov in November 2015, number NCT02606097.Key message: This phase II trial was conducted to assess the efficacy and safety of regorafenib in patients with GIST with exon 17 mutations. The results provide strong evidence that regorafenib significantly prolonged PFS in patients with advanced GIST harboring secondary mutations of exon 17.

Post-irradiation somatic mutation and clonal stabilisation time in the human colon.

PubMed Central

Campbell, F; Williams, G T; Appleton, M A; Dixon, M F; Harris, M; Williams, E D

1996-01-01

BACKGROUND: Colorectal crypts are clonal units in which somatic mutation of marker genes in stem cells leads to crypt restricted phenotypic conversion initially involving part of the crypt, later the whole crypt. Studies in mice show that the time taken for the great majority of mutated crypts to be completely converted, the clonal stabilisation time, is four weeks in the colon and 21 weeks in the ileum. Differences in the clonal stabilisation time between tissues and species are thought to reflect differences in stem cell organisation and crypt kinetics. AIM: To study the clonal stabilisation time in the human colorectum. METHODS: Stem cell mutation can lead to crypt restricted loss of O-acetylation of sialomucins in subjects heterozygous for O-acetyltransferase gene activity. mPAS histochemistry was used to visualise and quantify crypts partially or wholly involved by the mutant phenotype in 21 informative cases who had undergone colectomy up to 34 years after radiotherapy. RESULTS: Radiotherapy was followed by a considerable increase in the discordant crypt frequency that remained significantly increased for many years. The proportion of discordant crypts showing partial involvement was initially high but fell to normal levels about 12 months after irradiation. CONCLUSIONS: Crypts wholly involved by a mutant phenotype are stable and persistent while partially involved crypts are transient. The clonal stabilisation time is approximately one year in the human colon compared with four weeks in the mouse. The most likely reason for this is a difference in the number of stem cells in a crypt stem cell niche, although differences in stem cell cycle time and crypt fission may also contribute. These findings are of relevance to colorectal gene therapy and carcinogenesis in stem cell systems. PMID:8944567

JAK2V617F somatic mutation in the general population: myeloproliferative neoplasm development and progression rate

PubMed Central

Nielsen, Camilla; Bojesen, Stig E.; Nordestgaard, Børge G.; Kofoed, Klaus F.; Birgens, Henrik S.

2014-01-01

Clinical significance of the JAK2V617F mutation in patients with a myeloproliferative neoplasm has been the target of intensive research in recent years. However, there is considerably uncertainty about prognosis in JAK2V617F positive individuals without overt signs of myeloproliferative disease. In this study, we tested the hypothesis that increased JAK2V617F somatic mutation burden is associated with myeloproliferative neoplasm progression rate in the general population. Among 49,488 individuals from the Copenhagen General Population Study, 63 (0.1%) tested positive for the JAK2V617F mutation in the time period 2003–2008. Of these, 48 were available for re-examination in 2012. Level of JAK2V617F mutation burden was associated with myeloproliferative neoplasm progression rate, consistent with a biological continuum of increasing JAK2V617F mutation burden across increasing severity of myeloproliferative neoplasm from no disease (n=8 at re-examination) through essential thrombocythemia (n=20) and polycythemia vera (n=13) to primary myelofibrosis (n=7). Among those diagnosed with a myeloproliferative neoplasm only at re-examination in 2012, in the preceding years JAK2V617F mutation burden increased by 0.55% per year, erythrocyte volume fraction increased by 1.19% per year, and erythrocyte mean corpuscular volume increased by 1.25% per year, while there was no change in platelet count or erythropoietin levels. Furthermore, we established a JAK2V617F mutation burden cut-off point of 2% indicative of disease versus no disease; however, individuals with a mutation burden below 2% may suffer from a latent form of myeloproliferative disease revealed by a slightly larger spleen and/or slightly higher lactic acid dehydrogenase concentration compared to controls. Of all 63 JAK2V617F positive individuals, 48 were eventually diagnosed with a myeloproliferative neoplasm. PMID:24907356

Impact on disease-free survival of adjuvant erlotinib or gefitinib in patients with resected lung adenocarcinomas that harbor epidermal growth factor receptor (EGFR) mutations

PubMed Central

Janjigian, Yelena Y.; Park, Bernard J.; Zakowski, Maureen F.; Ladanyi, Marc; Pao, William; D’Angelo, Sandra P.; Kris, Mark G.; Shen, Ronglai; Zheng, Junting; Azzoli, Christopher G.

2013-01-01

Background Patients with stage IV lung adenocarcinoma and EGFR mutation derive clinical benefit from treatment with EGFR tyrosine kinase inhibitors (TKI). Whether treatment with TKI improves outcomes in patients with resected lung adenocarcinoma and EGFR mutation is unknown. Methods Data were analyzed from a surgical database of patients with resected lung adenocarcinoma harboring EGFR exon 19 or 21 mutations. In a multivariate analysis, we evaluated the impact of treatment with adjuvant TKI. Results The cohort consists of 167 patients with completely resected stage I–III lung adenocarcinoma. 93 patients (56%) had exon 19 del, 74 patients (44%) had exon 21 mutations, 56 patients (33%) received perioperative TKI. In a multivariate analysis controlling for sex, stage, type of surgery and adjuvant platinum chemotherapy, the 2-year DFS was 89% for patients treated with adjuvant TKI compared with 72% in control group (hazard ratio [HR] = 0.53; 95% confidence interval [CI] 0.28 to 1.03; p = 0.06). The 2-year OS was 96% with adjuvant EGFR TKI and 90% in the group that did not receive TKI (HR 0.62; 95% CI 0.26 to 1.51; p = 0.296). Conclusions Compared to patients who did not receive adjuvant TKI, we observed a trend toward improvement in disease free survival among individuals with resected stages I–III lung adenocarcinomas harboring mutations in EGFR exons 19 or 21 who received these agents as adjuvant therapy. Based on these data, 320 patients are needed for a randomized trial to prospectively validate this DFS benefit. PMID:21150674

An Analysis of the Sensitivity of Proteogenomic Mapping of Somatic Mutations and Novel Splicing Events in Cancer.

PubMed

Ruggles, Kelly V; Tang, Zuojian; Wang, Xuya; Grover, Himanshu; Askenazi, Manor; Teubl, Jennifer; Cao, Song; McLellan, Michael D; Clauser, Karl R; Tabb, David L; Mertins, Philipp; Slebos, Robbert; Erdmann-Gilmore, Petra; Li, Shunqiang; Gunawardena, Harsha P; Xie, Ling; Liu, Tao; Zhou, Jian-Ying; Sun, Shisheng; Hoadley, Katherine A; Perou, Charles M; Chen, Xian; Davies, Sherri R; Maher, Christopher A; Kinsinger, Christopher R; Rodland, Karen D; Zhang, Hui; Zhang, Zhen; Ding, Li; Townsend, R Reid; Rodriguez, Henry; Chan, Daniel; Smith, Richard D; Liebler, Daniel C; Carr, Steven A; Payne, Samuel; Ellis, Matthew J; Fenyő, David

2016-03-01

Improvements in mass spectrometry (MS)-based peptide sequencing provide a new opportunity to determine whether polymorphisms, mutations, and splice variants identified in cancer cells are translated. Herein, we apply a proteogenomic data integration tool (QUILTS) to illustrate protein variant discovery using whole genome, whole transcriptome, and global proteome datasets generated from a pair of luminal and basal-like breast-cancer-patient-derived xenografts (PDX). The sensitivity of proteogenomic analysis for singe nucleotide variant (SNV) expression and novel splice junction (NSJ) detection was probed using multiple MS/MS sample process replicates defined here as an independent tandem MS experiment using identical sample material. Despite analysis of over 30 sample process replicates, only about 10% of SNVs (somatic and germline) detected by both DNA and RNA sequencing were observed as peptides. An even smaller proportion of peptides corresponding to NSJ observed by RNA sequencing were detected (<0.1%). Peptides mapping to DNA-detected SNVs without a detectable mRNA transcript were also observed, suggesting that transcriptome coverage was incomplete (∼80%). In contrast to germline variants, somatic variants were less likely to be detected at the peptide level in the basal-like tumor than in the luminal tumor, raising the possibility of differential translation or protein degradation effects. In conclusion, this large-scale proteogenomic integration allowed us to determine the degree to which mutations are translated and identify gaps in sequence coverage, thereby benchmarking current technology and progress toward whole cancer proteome and transcriptome analysis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Retrospective study of adjuvant icotinib in postoperative lung cancer patients harboring epidermal growth factor receptor mutations

PubMed Central

Yao, Shuyang; Zhi, Xiuyi; Wang, Ruotian; Qian, Kun; Hu, Mu

2016-01-01

Background Epidermal growth factor receptor (EGFR) mutations occur in about 50% of Asian patients with non‐small cell lung cancer (NSCLC). Patients with advanced NSCLC and EGFR mutations derive clinical benefit from treatment with EGFR‐tyrosine kinase inhibitors (TKIs). This study assessed the efficacy and safety of adjuvant icotinib without chemotherapy in EGFR‐mutated NSCLC patients undergoing resection of stage IB–IIIA. Methods Our retrospective study enrolled 20 patients treated with icotinib as adjuvant therapy. Survival factors were evaluated by univariate and Cox regression analysis. Results The median follow‐up time was 30 months (range 24–41). At the data cut‐off, five patients (25%) had recurrence or metastasis and one patient had died of the disease. The two‐year disease‐free survival (DFS) rate was 85%. No recurrence occurred in the high‐risk stage IB subgroup during the follow‐up period. In univariate analysis, the micropapillary pattern had a statistically significant effect on DFS (P = 0.040). Multivariate logistic regression analysis showed that there was no independent predictor. Drug related adverse events (AEs) occurred in nine patients (45.0%). The most common AEs were skin‐related events and diarrhea, but were relatively mild. No grade 3 AEs or occurrences of intolerable toxicity were observed. Conclusions Icotinib as adjuvant therapy is effective in patients harboring EGFR mutations after complete resection, with an acceptable AE profile. Further trials with larger sample sizes might confirm the efficiency of adjuvant TKI in selected patients. PMID:27766784

Analysis of genotoxic activity of ketamine and rocuronium bromide using the somatic mutation and recombination test in Drosophila melanogaster.

PubMed

Koksal, Pakize Muge; Gürbüzel, Mehmet

2015-03-01

The present study evaluated the mutagenic and recombinogenic effects of two commonly used anesthetic agents, ketamine and rocuronium bromide, in medicine using the wing somatic mutation and recombination test (SMART) in Drosophila. The standard (ST) cross and the high-bioactivation (HB) cross with high sensitivity to procarcinogens and promutagens were used. The SMART test is based on the loss of heterozygosity, which occurs via various mechanisms, such as chromosome loss and deletion, half-translocation, mitotic recombination, mutation, and non-disjunction. Genetic alterations occurring in the somatic cells of the wing's imaginal discs result in mutant clones in the wing blade. Three-day-old trans-heterozygous larvae with two recessive markers, multiple wing hairs (mwh) and flare (flr(3)), were treated with ketamine and rocuronium bromide. Analysis of the ST cross indicated that ketamine exhibited genotoxicity activity and that this activity was particularly dependent on homologous mitotic recombination at concentrations of 250 μg/ml and above. Rocuronium bromide did not exert mutagenic and/or recombinogenic effects. In the HB cross, ketamine at a concentration of 1000 μg/ml and rocuronium bromide at all concentrations, with the exception of 250 μg/ml (inconclusive), exerted genotoxic effects, which could also be associated with the increase in mitotic recombination. Copyright © 2015 Elsevier B.V. All rights reserved.

The determination of complete human mitochondrial DNA sequences in single cells: implications for the study of somatic mitochondrial DNA point mutations

PubMed Central

Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.

2001-01-01

Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889

Subjects harboring presenilin familial Alzheimer’s disease mutations exhibit diverse white matter biochemistry alterations

PubMed Central

Roher, Alex E; Maarouf, Chera L; Malek-Ahmadi, Michael; Wilson, Jeffrey; Kokjohn, Tyler A; Daugs, Ian D; Whiteside, Charisse M; Kalback, Walter M; Macias, MiMi P; Jacobson, Sandra A; Sabbagh, Marwan N; Ghetti, Bernardino; Beach, Thomas G

2013-01-01

Alzheimer’s disease (AD) dementia impacts all facets of higher order cognitive function and is characterized by the presence of distinctive pathological lesions in the gray matter (GM). The profound alterations in GM structure and function have fostered the view that AD impacts are primarily a consequence of GM damage. However, the white matter (WM) represents about 50% of the cerebrum and this area of the brain is substantially atrophied and profoundly abnormal in both sporadic AD (SAD) and familial AD (FAD). We examined the WM biochemistry by ELISA and Western blot analyses of key proteins in 10 FAD cases harboring mutations in the presenilin genes PSEN1 and PSEN2 as well as in 4 non-demented control (NDC) individuals and 4 subjects with SAD. The molecules examined were direct substrates of PSEN1 such as Notch-1 and amyloid precursor protein (APP). In addition, apolipoproteins, axonal transport molecules, cytoskeletal and structural proteins, neurotrophic factors and synaptic proteins were examined. PSEN-FAD subjects had, on average, higher amounts of WM amyloid-beta (Aβ) peptides compared to SAD, which may play a role in the devastating dysfunction of the brain. However, the PSEN-FAD mutations we examined did not produce uniform increases in the relative proportions of Aβ42 and exhibited substantial variability in total Aβ levels. These observations suggest that neurodegeneration and dementia do not depend solely on enhanced Aβ42 levels. Our data revealed additional complexities in PSEN-FAD individuals. Some direct substrates of γ-secretase, such as Notch, N-cadherin, Erb-B4 and APP, deviated substantially from the NDC group baseline for some, but not all, mutation types. Proteins that were not direct γ-secretase substrates, but play key structural and functional roles in the WM, likewise exhibited varied concentrations in the distinct PSEN mutation backgrounds. Detailing the diverse biochemical pathology spectrum of PSEN mutations may offer valuable

Mitochondrial-Associated Cell Death Mechanisms Are Reset to an Embryonic-Like State in Aged Donor-Derived iPS Cells Harboring Chromosomal Aberrations

PubMed Central

Prigione, Alessandro; Hossini, Amir M.; Lichtner, Björn; Serin, Akdes; Fauler, Beatrix; Megges, Matthias; Lurz, Rudi; Lehrach, Hans; Zouboulis, Christos C.

2011-01-01

Somatic cells reprogrammed into induced pluripotent stem cells (iPSCs) acquire features of human embryonic stem cells (hESCs) and thus represent a promising source for cellular therapy of debilitating diseases, such as age-related disorders. However, reprogrammed cell lines have been found to harbor various genomic alterations. In addition, we recently discovered that the mitochondrial DNA of human fibroblasts also undergoes random mutational events upon reprogramming. Aged somatic cells might possess high susceptibility to nuclear and mitochondrial genome instability. Hence, concerns over the oncogenic potential of reprogrammed cells due to the lack of genomic integrity may hinder the applicability of iPSC-based therapies for age-associated conditions. Here, we investigated whether aged reprogrammed cells harboring chromosomal abnormalities show resistance to apoptotic cell death or mitochondrial-associated oxidative stress, both hallmarks of cancer transformation. Four iPSC lines were generated from dermal fibroblasts derived from an 84-year-old woman, representing the oldest human donor so far reprogrammed to pluripotency. Despite the presence of karyotype aberrations, all aged-iPSCs were able to differentiate into neurons, re-establish telomerase activity, and reconfigure mitochondrial ultra-structure and functionality to a hESC-like state. Importantly, aged-iPSCs exhibited high sensitivity to drug-induced apoptosis and low levels of oxidative stress and DNA damage, in a similar fashion as iPSCs derived from young donors and hESCs. Thus, the occurrence of chromosomal abnormalities within aged reprogrammed cells might not be sufficient to over-ride the cellular surveillance machinery and induce malignant transformation through the alteration of mitochondrial-associated cell death. Taken together, we unveiled that cellular reprogramming is capable of reversing aging-related features in somatic cells from a very old subject, despite the presence of genomic

A targeted mutational landscape of angioimmunoblastic T-cell lymphoma

PubMed Central

Odejide, Oreofe; Weigert, Oliver; Lane, Andrew A.; Toscano, Dan; Lunning, Matthew A.; Kopp, Nadja; Kim, Sunhee; van Bodegom, Diederik; Bolla, Sudha; Schatz, Jonathan H.; Teruya-Feldstein, Julie; Hochberg, Ephraim; Louissaint, Abner; Dorfman, David; Stevenson, Kristen; Rodig, Scott J.; Piccaluga, Pier Paolo; Jacobsen, Eric; Pileri, Stefano A.; Harris, Nancy L.; Ferrero, Simone; Inghirami, Giorgio; Horwitz, Steven M.

2014-01-01

The genetics of angioimmunoblastic T-cell lymphoma (AITL) are very poorly understood. We defined the mutational landscape of AITL across 219 genes in 85 cases from the United States and Europe. We identified ≥2 mutations in 34 genes, nearly all of which were not previously implicated in AITL. These included loss-of-function mutations in TP53 (n = 4), ETV6 (n = 3), CCND3 (n = 2), and EP300 (n = 5), as well as gain-of-function mutations in JAK2 (n = 2) and STAT3 (n = 4). TET2 was mutated in 65 (76%) AITLs, including 43 that harbored 2 or 3 TET2 mutations. DNMT3A mutations occurred in 28 (33%) AITLs; 100% of these also harbored TET2 mutations (P < .0001). Seventeen AITLs harbored IDH2 R172 substitutions, including 15 with TET2 mutations. In summary, AITL is characterized by high frequencies of overlapping mutations in epigenetic modifiers and targetable mutations in a subset of cases. PMID:24345752

Mutational Signatures in Cancer (MuSiCa): a web application to implement mutational signatures analysis in cancer samples.

PubMed

Díaz-Gay, Marcos; Vila-Casadesús, Maria; Franch-Expósito, Sebastià; Hernández-Illán, Eva; Lozano, Juan José; Castellví-Bel, Sergi

2018-06-14

Mutational signatures have been proved as a valuable pattern in somatic genomics, mainly regarding cancer, with a potential application as a biomarker in clinical practice. Up to now, several bioinformatic packages to address this topic have been developed in different languages/platforms. MutationalPatterns has arisen as the most efficient tool for the comparison with the signatures currently reported in the Catalogue of Somatic Mutations in Cancer (COSMIC) database. However, the analysis of mutational signatures is nowadays restricted to a small community of bioinformatic experts. In this work we present Mutational Signatures in Cancer (MuSiCa), a new web tool based on MutationalPatterns and built using the Shiny framework in R language. By means of a simple interface suited to non-specialized researchers, it provides a comprehensive analysis of the somatic mutational status of the supplied cancer samples. It permits characterizing the profile and burden of mutations, as well as quantifying COSMIC-reported mutational signatures. It also allows classifying samples according to the above signature contributions. MuSiCa is a helpful web application to characterize mutational signatures in cancer samples. It is accessible online at http://bioinfo.ciberehd.org/GPtoCRC/en/tools.html and source code is freely available at https://github.com/marcos-diazg/musica .

Widening the Heterogeneity of Leigh Syndrome: Clinical, Biochemical, and Neuroradiologic Features in a Patient Harboring a NDUFA10 Mutation.

PubMed

Minoia, Francesca; Bertamino, Marta; Picco, Paolo; Severino, Mariasavina; Rossi, Andrea; Fiorillo, Chiara; Minetti, Carlo; Nesti, Claudia; Santorelli, Filippo Maria; Di Rocco, Maja

2017-01-01

Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder, characterized by a wide clinical and genetic heterogeneity, and is the most frequent disorder of mitochondrial energy production in children. Beside its great variability in clinical, biochemical, and genetic features, LS is pathologically uniformly characterized by multifocal bilateral and symmetric spongiform degeneration of the basal ganglia, brainstem, thalamus, cerebellum, spinal cord, and optic nerves. Isolated complex I deficiency is the most common defect identified in Leigh syndrome. In 2011, the first child with a mutation of NDUFA10 gene, coding for an accessory subunits of complex I, was described. Here, we present an additional description of a child with Leigh syndrome harboring a homozygous mutation in NDUFA10, providing insights in clinical, biochemical, and neuroradiologic features for future earlier recognition.

Somatic clonal evolution: A selection-centric perspective.

PubMed

Scott, Jacob; Marusyk, Andriy

2017-04-01

It is generally accepted that the initiation and progression of cancers is the result of somatic clonal evolution. Despite many peculiarities, evolution within populations of somatic cells should obey the same Darwinian principles as evolution within natural populations, i.e. variability of heritable phenotypes provides the substrate for context-specific selection forces leading to increased population frequencies of phenotypes, which are better adapted to their environment. Yet, within cancer biology, the more prevalent way to view evolution is as being entirely driven by the accumulation of "driver" mutations. Context-specific selection forces are either ignored, or viewed as constraints from which tumor cells liberate themselves during the course of malignant progression. In this review, we will argue that explicitly focusing on selection forces acting on the populations of neoplastic cells as the driving force of somatic clonal evolution might provide for a more accurate conceptual framework compared to the mutation-centric driver gene paradigm. Whereas little can be done to counteract the "bad luck" of stochastic occurrences of cancer-related mutations, changes in selective pressures and the phenotypic adaptations they induce can, in principle, be exploited to limit the incidence of cancers and to increase the efficiency of existing and future therapies. This article is part of a Special Issue entitled: Evolutionary principles - heterogeneity in cancer?, edited by Dr. Robert A. Gatenby. Copyright © 2017 Elsevier B.V. All rights reserved.

Somatic and germline mosaicism for a mutation of the PHEX gene can lead to genetic transmission of X-linked hypophosphatemic rickets that mimics an autosomal dominant trait.

PubMed

Goji, Katsumi; Ozaki, Kayo; Sadewa, Ahmad H; Nishio, Hisahide; Matsuo, Masafumi

2006-02-01

Familial hypophosphatemic rickets is usually transmitted as an X-linked dominant disorder (XLH), although autosomal dominant forms have also been observed. Genetic studies of these disorders have identified mutations in PHEX and FGF23 as the causes of X-linked dominant disorder and autosomal dominant forms, respectively. The objective of the study was to describe the molecular genetic findings in a family affected by hypophosphatemic rickets with presumed autosomal dominant inheritance. We studied a family in which the father and the elder of his two daughters, but not the second daughter, were affected by hypophosphatemic rickets. The pedigree interpretation of the family suggested that genetic transmission of the disorder occurred as an autosomal dominant trait. Direct nucleotide sequencing of FGF23 and PHEX revealed that the elder daughter was heterozygous for an R567X mutation in PHEX, rather than FGF23, suggesting that the genetic transmission occurred as an X-linked dominant trait. Unexpectedly, the father was heterozygous for this mutation. Single-nucleotide primer extension and denaturing HPLC analysis of the father using DNA from single hair roots revealed that he was a somatic mosaic for the mutation. Haplotype analysis confirmed that the father transmitted the genotypes for 18 markers on the X chromosome equally to his two daughters. The fact that the father transmitted the mutation to only one of his two daughters indicated that he was a germline mosaic for the mutation. Somatic and germline mosaicism for an X-linked dominant mutation in PHEX may mimic autosomal dominant inheritance.

Acquired resistance mechanisms to tyrosine kinase inhibitors in lung cancer with activating epidermal growth factor receptor mutation--diversity, ductility, and destiny.

PubMed

Suda, Kenichi; Mizuuchi, Hiroshi; Maehara, Yoshihiko; Mitsudomi, Tetsuya

2012-12-01

Lung cancers that harbor somatic activating mutations in the gene for the epidermal growth factor receptor (EGFR) depend on mutant EGFR for their proliferation and survival; therefore, lung cancer patients with EGFR mutations often dramatically respond to orally available EGFR tyrosine kinase inhibitors (TKIs). However, emergence of acquired resistance is virtually inevitable, thus limiting improvement in patient outcomes. To elucidate and overcome this acquired resistance, multidisciplinary basic and clinical investigational approaches have been applied, using in vitro cell line models or samples obtained from lung cancer patients treated with EGFR-TKIs. These efforts have revealed several acquired resistance mechanisms and candidates, including EGFR secondary mutations (T790M and other rare mutations), MET amplification, PTEN downregulation, CRKL amplification, high-level HGF expression, FAS-NFκB pathway activation, epithelial-mesenchymal transition, and conversion to small cell lung cancer. Interestingly, cancer cells harbor potential destiny and ductility together in acquiring resistance to EGFR-TKIs, as shown in in vitro acquired resistance models. Molecular mechanisms of "reversible EGFR-TKI tolerance" that occur in early phase EGFR-TKI exposure have been identified in cell line models. Furthermore, others have reported molecular markers that can predict response to EGFR-TKIs in clinical settings. Deeper understanding of acquired resistance mechanisms to EGFR-TKIs, followed by the development of molecular target drugs that can overcome the resistance, might turn this fatal disease into a chronic disorder.

A Novel KCNJ5-insT149 Somatic Mutation Close to, but Outside, the Selectivity Filter Causes Resistant Hypertension by Loss of Selectivity for Potassium

PubMed Central

Kuppusamy, Maniselvan; Caroccia, Brasilina; Stindl, Julia; Bandulik, Sascha; Lenzini, Livia; Gioco, Francesca; Fishman, Veniamin; Zanotti, Giuseppe; Gomez-Sanchez, Celso; Bader, Michael; Warth, Richard

2014-01-01

Context: Understanding the function of the KCNJ5 potassium channel through characterization of naturally occurring novel mutations is key for dissecting the mechanism(s) of autonomous aldosterone secretion in primary aldosteronism. Objective: We sought for such novel KCNJ5 channel mutations in a large database of patients with aldosterone-producing adenomas (APAs). Methods: We discovered a novel somatic c.446insAAC insertion, resulting in the mutant protein KCNJ5-insT149, in a patient with severe drug-resistant hypertension among 195 consecutive patients with a conclusive diagnosis of APA, 24.6% of whom showed somatic KCNJ5 mutations. By site-directed mutagenesis, we created the mutated cDNA that was transfected, along with KCNJ3 cDNA, in mammalian cells. We also localized CYP11B2 in the excised adrenal gland with immunohistochemistry and immunofluorescence using an antibody specific to human CYP11B2. Whole-cell patch clamp recordings, CYP11B2 mRNA, aldosterone measurement, and molecular modeling were performed to characterize the novel KCNJ5-insT149 mutation. Results: Compared with wild-type and mock-transfected adrenocortical cells, HAC15 cells expressing the mutant KCNJ5 showed increased CYP11B2 expression and aldosterone secretion. Mammalian cells expressing the mutated KCNJ5-insT149 channel exhibited a strong Na+ inward current and, in parallel, a substantial rise in intracellular Ca2+, caused by activation of voltage-gated Ca2+ channels and reduced Ca2+ elimination by Na+/Ca2+ exchangers, as well as an increased production of aldosterone. Conclusions: This novel mutation shows pathological Na+ permeability, membrane depolarization, raised cytosolic Ca2+, and increased aldosterone synthesis. Hence, a novel KCNJ5 channelopathy located after the pore α-helix preceding the selectivity filter causes constitutive secretion of aldosterone with ensuing resistant hypertension in a patient with a small APA. PMID:25057880

Recurrent hotspot mutations in HRAS Q61 and PI3K-AKT pathway genes as drivers of breast adenomyoepitheliomas.

PubMed

Geyer, Felipe C; Li, Anqi; Papanastasiou, Anastasios D; Smith, Alison; Selenica, Pier; Burke, Kathleen A; Edelweiss, Marcia; Wen, Huei-Chi; Piscuoglio, Salvatore; Schultheis, Anne M; Martelotto, Luciano G; Pareja, Fresia; Kumar, Rahul; Brandes, Alissa; Fan, Dan; Basili, Thais; Da Cruz Paula, Arnaud; Lozada, John R; Blecua, Pedro; Muenst, Simone; Jungbluth, Achim A; Foschini, Maria P; Wen, Hannah Y; Brogi, Edi; Palazzo, Juan; Rubin, Brian P; Ng, Charlotte K Y; Norton, Larry; Varga, Zsuzsanna; Ellis, Ian O; Rakha, Emad A; Chandarlapaty, Sarat; Weigelt, Britta; Reis-Filho, Jorge S

2018-05-08

Adenomyoepithelioma of the breast is a rare tumor characterized by epithelial-myoepithelial differentiation, whose genetic underpinning is largely unknown. Here we show through whole-exome and targeted massively parallel sequencing analysis that whilst estrogen receptor (ER)-positive adenomyoepitheliomas display PIK3CA or AKT1 activating mutations, ER-negative adenomyoepitheliomas harbor highly recurrent codon Q61 HRAS hotspot mutations, which co-occur with PIK3CA or PIK3R1 mutations. In two- and three-dimensional cell culture models, forced expression of HRAS Q61R in non-malignant ER-negative breast epithelial cells with or without a PIK3CA H1047R somatic knock-in results in transformation and the acquisition of the cardinal features of adenomyoepitheliomas, including the expression of myoepithelial markers, a reduction in E-cadherin expression, and an increase in AKT signaling. Our results demonstrate that adenomyoepitheliomas are genetically heterogeneous, and qualify mutations in HRAS, a gene whose mutations are vanishingly rare in common-type breast cancers, as likely drivers of ER-negative adenomyoepitheliomas.

Efficient Generation of Gene-Modified Pigs Harboring Precise Orthologous Human Mutation via CRISPR/Cas9-Induced Homology-Directed Repair in Zygotes.

PubMed

Zhou, Xiaoyang; Wang, Lulu; Du, Yinan; Xie, Fei; Li, Liang; Liu, Yu; Liu, Chuanhong; Wang, Shiqiang; Zhang, Shibing; Huang, Xingxu; Wang, Yong; Wei, Hong

2016-01-01

Precise genetic mutation of model animals is highly valuable for functional investigation of human mutations. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced homology-directed repair (HDR) is usually used for precise genetic mutation, being limited by the relatively low efficiency compared with that of non-homologous end joining (NHEJ). Although inhibition of NHEJ was shown to enhance HDR-derived mutation, in this work, without inhibition of NHEJ, we first generated gene-modified pigs harboring precise orthologous human mutation (Sox10 c.A325>T) via CRISPR/Cas9-induced HDR in zygotes using single-strand oligo DNA (ssODN) as template with an efficiency as high as 80%, indicating that pig zygotes exhibited high activities of HDR relative to NHEJ and were highly amendable to genetic mutation via CIRSPR/Cas9-induced HDR. Besides, we found a higher concentration of ssODN remarkably reduced HDR-derived mutation in pig zygotes, suggesting a possible balance for optimal HDR-derived mutation in zygotes between the excessive accessibility to HDR templates and the activities of HDR relative to NHEJ which appeared to be negatively correlated to ssODN concentration. In addition, the HDR-derived mutation, as well as those from NHEJ, extensively integrated into various tissues including gonad of founder pig without detected off-targeting, suggesting CRISPR/Cas9-induced HDR in zygotes is a reliable approach for precise genetic mutation in pigs. © 2015 WILEY PERIODICALS, INC.

Somatic HRPT2 Mutation (Arg234X) of Parathyroid Carcinoma Associated with Slipped Capital Femoral Epiphysis: A First Case Report.

PubMed

Niramitmahapanya, Sathit; Deerochanawong, Chaicharn; Sarinnapakorn, Veerasak; Sunthornthepvarakul, Thongkum; Pingsuthiwong, Sarinee; Athipan, Pornake; Sangsuda, Yuthana

2016-02-01

A 14-year-old boy was admitted to the orthopedic clinic of Rajavithi Hospital complaining of pain in the left hip. A year earlier, pain had developed in his left joint and had gradually increased in intensity in both hips. A month before he was referred, radiographs obtained at another hospital showed bilateral slipped capital femoral epiphysis (SCFE). The patient's biochemical laboratory data showed hypercalcemia, hypophosphatemia, and a high level of intact parathyroid hormone (iPTH) compatible with primary hyperparathyroidism. HRPT2 gene analysis found heterozygosity for c. 700 C > T mutation (Arg234X) of HRPT2 gene at exon 7. This is the first report in the literature about somatic mutation of the HRPT2 gene of parathyroid carcinoma associated with slipped capital femoral epiphysis.

Rapid intracranial response to osimertinib, without radiotherapy, in nonsmall cell lung cancer patients harboring the EGFR T790M mutation: Two Case Reports.

PubMed

Koba, Taro; Kijima, Takashi; Takimoto, Takayuki; Hirata, Haruhiko; Naito, Yujiro; Hamaguchi, Masanari; Otsuka, Tomoyuki; Kuroyama, Muneyoshi; Nagatomo, Izumi; Takeda, Yoshito; Kida, Hiroshi; Kumanogoh, Atsushi

2017-02-01

Most of nonsmall cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR) activating mutations eventually acquire resistance to the first EGFR-tyrosine kinase inhibitors (TKIs) therapy after varying periods of treatment. Of note, approximately one-third of those patients develop brain metastases, which deteriorate their quality of life and survival. The effect of systemic chemotherapy on brain metastases after acquisition of EGFR-TKI resistance is limited, and thus far, whole-brain radiation therapy, which may cause the harmful effect on neurocognitive functions, has been the only established therapeutic option for especially symptomatic brain metastases. Osimertinib is a third-generation oral, potent, and irreversible EGFR-TKI. It can bind to EGFRs with high affinity even when the EGFR T790M mutation exists in addition to the sensitizing mutations. Its clinical efficacy for NSCLC patients harboring the T790M mutation has already been shown; however, the evidence of osimertinib on brain metastases has not been documented well, especially in terms of the appropriate timing for treatment and its response evaluation. We experienced 2 NSCLC patients with the EGFR T790M mutation; a 67-year-old woman with symptomatic multiple brain metastases administered osimertinib as seventh-line chemotherapy, and a 76-year old man with an asymptomatic single brain metastasis administered osimertinib as fifth-line chemotherapy. These patients showed great response to osimertinib within 2 weeks without radiation therapy. These are the first reports to reveal the rapid response of the brain metastases to osimertinib within 2 weeks. These cases suggest the possibility that preemptive administration of osimertinib may help patients to postpone or avoid radiation exposures. In addition, rapid reassessment of the effect of osimertinib on brain metastases could prevent patients from being too late to receive essential radiotherapy.

Retrospective study of adjuvant icotinib in postoperative lung cancer patients harboring epidermal growth factor receptor mutations.

PubMed

Yao, Shuyang; Zhi, Xiuyi; Wang, Ruotian; Qian, Kun; Hu, Mu; Zhang, Yi

2016-09-01

Epidermal growth factor receptor (EGFR) mutations occur in about 50% of Asian patients with non-small cell lung cancer (NSCLC). Patients with advanced NSCLC and EGFR mutations derive clinical benefit from treatment with EGFR-tyrosine kinase inhibitors (TKIs). This study assessed the efficacy and safety of adjuvant icotinib without chemotherapy in EGFR-mutated NSCLC patients undergoing resection of stage IB-IIIA. Our retrospective study enrolled 20 patients treated with icotinib as adjuvant therapy. Survival factors were evaluated by univariate and Cox regression analysis. The median follow-up time was 30 months (range 24-41). At the data cut-off, five patients (25%) had recurrence or metastasis and one patient had died of the disease. The two-year disease-free survival (DFS) rate was 85%. No recurrence occurred in the high-risk stage IB subgroup during the follow-up period. In univariate analysis, the micropapillary pattern had a statistically significant effect on DFS ( P = 0.040). Multivariate logistic regression analysis showed that there was no independent predictor. Drug related adverse events (AEs) occurred in nine patients (45.0%). The most common AEs were skin-related events and diarrhea, but were relatively mild. No grade 3 AEs or occurrences of intolerable toxicity were observed. Icotinib as adjuvant therapy is effective in patients harboring EGFR mutations after complete resection, with an acceptable AE profile. Further trials with larger sample sizes might confirm the efficiency of adjuvant TKI in selected patients. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Telomere length and somatic mutations in correlation with response to immunosuppressive treatment in aplastic anaemia.

PubMed

Park, Hee S; Park, Si N; Im, Kyongok; Kim, Sung-Min; Kim, Jung-Ah; Hwang, Sang M; Lee, Dong S

2017-08-01

We investigated the frequencies of cytogenetic aberrations and somatic mutations of prognostic relevance in 393 patients with aplastic anaemia (AA). Clonality was determined by G-banding/fluorescence in situ hybridization (FISH) (n = 245), and targeted capture sequencing was performed for 88 haematopoiesis-related genes (n = 70). The telomere length (TL) of bone marrow nucleated cells was measured at the single cell level by FISH (n = 135). Eighteen (4·6%) patients showed disease progression, and monosomy 7 (50·0%) was the most predominant cytogenetic evolution at disease transformation. One third of patients (32·9%) presented at least 1 mutation; the most frequently mutated genes were NOTCH1, NF1, SCRIB, BCOR and DNMT3A. The patient group with clonal changes (30·7%) showed an adverse response to immunosuppressive treatment (IST), compared to the non-clonal group, but this finding did not show statistical significance. The TL of AA patients was significantly shorter than normal control and patients with clonal changes showed significantly shorter TLs. Patients with TL>5·9 showed a higher response rate to IST (P = 0·048). In conclusion, the patients with clonal changes or TL attrition showed a poor response to IST. Shorter TL can be used not only as a biomarker, but also as a predictive marker for treatment response to IST. © 2017 John Wiley & Sons Ltd.

Somatic cell mutations at the glycophorin A locus in erythrocytes of atomic bomb survivors: Implications for radiation carcinogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kyoizumi, Seishi; Akiyama, Mitoshi; Tanabe, Kazumi

To clarify the relationship between somatic cell mutations and radiation exposure, the frequency of hemizygous mutant erythrocytes at the glycophorin A (GPA) locus was measured by flow cytometry for 1,226 heterozygous atomic bomb (A-bomb) survivors in HIroshima and Nagasaki. For statistical analysis, both GPA mutant frequency and radiation dose were log-transformed to normalize skewed distributions of these variables. The GPA mutant frequency increased slightly but significantly with age at testing and with the number of cigarettes smoked. Also, mutant frequency was significantly higher in males than in females even with adjustment for smoking and was higher to Hiroshima than inmore » Nagasaki. These characteristics of background GPA mutant frequency are qualitatively similar to those of background solid cancer incidence or mortality obtained from previous epidemiological studies of survivors. An analysis of the mutant frequency dose response using a descriptive model showed that the doubling dose is about 1.20 Sv [95% confidence interval (CI): 0.95-1.56], whereas the minimum dose for detecting a significant increase in mutant frequency is about 0.24 Sv (95% CI: 0.041-0.51). No significant effects of sex, city or age at the time of exposure on the dose response were detected. Interestingly, the doubling dose of the GPA mutant frequency was similar to that of solid cancer incidence in A-bomb survivors. This observation is in line with the hypothesis that radiation-induced somatic cell mutations are the major cause of excess cancer risk after radiation. 49 refs., 6 figs., 2 tabs.« less

Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

PubMed

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

2013-10-15

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

PubMed Central

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

2013-01-01

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

Mutational Profiling of Non-Small-Cell Lung Cancer Resistant to Osimertinib Using Next-Generation Sequencing in Chinese Patients.

PubMed

Nie, Keke; Jiang, Haiping; Zhang, Chunling; Geng, Chuanxin; Xu, Xiajuan; Zhang, Ling; Zhang, Hao; Zhang, Zhongfa; Lan, Ketao; Ji, Youxin

2018-01-01

To identify the somatic mutated genes for optimal targets of non-small-cell lung cancer after resistance to osimertinib treatment. Study patients all had advanced lung adenocarcinoma and acquired resistance to osimertinib as a second- or third-line treatment. These patients had harboring EGFR T790M mutation before osimertinib treatment, which was confirmed by Amplification Refractory Mutation System (ARMS) PCR or Next-Generation Sequencing (NGS). After resistance to osimertinib treatment, tumor tissue was collected by core needle biopsy. DNA was extracted from 15 × 5 um sliced section of formalin-fixed paraffin-embedded (FFPE) material and NGS was done. The genetic changes were analyzed. A total of 9 Chinese patients were studied, 5 females and 4 males, age 51-89 years. After progression with osimertinib treatment, core needle biopsy was performed and next-generation sequencing was performed. Nine patients had harboring 62 point mutations, 2 altered gene copies, 2 amplifications, and 1 EML4-ALK gene fusion. No MET or HER2 amplification was found in this cohort study. Nine patients still maintained initial EGFR 19 del or L858R activating mutations, while 7 of them kept EGFR T790M mutations. Among the 7 patients, 5 had secondary EGFR C797S and/or C797G mutations, which all happened in the same allele with T790M mutation. All patients were treated with targets therapies, chemotherapy, or best supportive care (BSC) in accordance with NGS genetic results and patients' performance status; 7 of them are still alive and 2 of them died of disease progression at last follow-up. EGFR C797S/G mutation and the same one presented on the same allele with EGFR T790M mutation were the most common mutation feature and played a key role in resistance to osimertinib in Chinese patients with NSCLC. Tumor cells losing T790M mutation and maintaining EGFR activating mutation might benefit from first-generation EGFR-TKI treatment.

Melorheostosis: Exome sequencing of an associated dermatosis implicates postzygotic mosaicism of mutated KRAS.

PubMed

Whyte, Michael P; Griffith, Malachi; Trani, Lee; Mumm, Steven; Gottesman, Gary S; McAlister, William H; Krysiak, Kilannin; Lesurf, Robert; Skidmore, Zachary L; Campbell, Katie M; Rosman, Ilana S; Bayliss, Susan; Bijanki, Vinieth N; Nenninger, Angela; Van Tine, Brian A; Griffith, Obi L; Mardis, Elaine R

2017-08-01

Melorheostosis (MEL) is the rare sporadic dysostosis characterized by monostotic or polyostotic osteosclerosis and hyperostosis often distributed in a sclerotomal pattern. The prevailing hypothesis for MEL invokes postzygotic mosaicism. Sometimes scleroderma-like skin changes, considered a representation of the pathogenetic process of MEL, overlie the bony changes, and sometimes MEL becomes malignant. Osteopoikilosis (OPK) is the autosomal dominant skeletal dysplasia that features symmetrically distributed punctate osteosclerosis due to heterozygous loss-of-function mutation within LEMD3. Rarely, radiographic findings of MEL occur in OPK. However, germline mutation of LEMD3 does not explain sporadic MEL. To explore if mosaicism underlies MEL, we studied a boy with polyostotic MEL and characteristic overlying scleroderma-like skin, a few bony lesions consistent with OPK, and a large epidermal nevus known to usually harbor a HRAS, FGFR3, or PIK3CA gene mutation. Exome sequencing was performed to ~100× average read depth for his two dermatoses, two areas of normal skin, and peripheral blood leukocytes. As expected for non-malignant tissues, the patient's mutation burden in his normal skin and leukocytes was low. He, his mother, and his maternal grandfather carried a heterozygous, germline, in-frame, 24-base-pair deletion in LEMD3. Radiographs of the patient and his mother revealed bony foci consistent with OPK, but she showed no MEL. For the patient, somatic variant analysis, using four algorithms to compare all 20 possible pairwise combinations of his five DNA samples, identified only one high-confidence mutation, heterozygous KRAS Q61H (NM_033360.3:c.183A>C, NP_203524.1:p.Gln61His), in both his dermatoses but absent in his normal skin and blood. Thus, sparing our patient biopsy of his MEL bone, we identified a heterozygous somatic KRAS mutation in his scleroderma-like dermatosis considered a surrogate for MEL. This implicates postzygotic mosaicism of mutated KRAS

Global Characterization of Protein Altering Mutations in Prostate Cancer

DTIC Science & Technology

2011-08-01

prevalence of candidate cancer genes observed here in prostate cancer. (3) Perform integrative analyses of somatic mutation with gene expression and copy...analyses of somatic mutation with gene expression and copy number change data collected on the same samples. Body This is a “synergy” project between...However, to perform initial verification/validation studies, we have evaluated the mutation calls for several genes discovered initially by the

New Insight Into the Biology, Risk Stratification, and Targeted Treatment of Myelodysplastic Syndromes.

PubMed

Haider, Mintallah; Duncavage, Eric J; Afaneh, Khalid F; Bejar, Rafael; List, Alan F

2017-01-01

In myelodysplastic syndromes (MDS), somatic mutations occur in five major categories: RNA splicing, DNA methylation, activated cell signaling, myeloid transcription factors, and chromatin modifiers. Although many MDS cases harbor more than one somatic mutation, in general, there is mutual exclusivity of mutated genes within a class. In addition to the prognostic significance of individual somatic mutations, more somatic mutations in MDS have been associated with poor prognosis. Prognostic assessment remains a critical component of the personalization of care for patient with MDS because treatment is highly risk adapted. Multiple methods for risk stratification are available with the revised International Prognostic Scoring System (IPSS-R), currently considered the gold standard. Increasing access to myeloid gene panels and greater evidence for the diagnostic and predictive value of somatic mutations will soon make sequencing part of the standard evaluation of patients with MDS. In the absence of formal guidelines for their prognostic use, well-validated mutations can still refine estimates of risk made with the IPSS-R. Not only are somatic gene mutations advantageous in understanding the biology of MDS and prognosis, they also offer potential as biomarkers and targets for the treatment of patients with MDS. Examples include deletion 5q, spliceosome complex gene mutations, and TP53 mutations.

Deep sequencing detects very-low-grade somatic mosaicism in the unaffected mother of siblings with nemaline myopathy.

PubMed

Miyatake, Satoko; Koshimizu, Eriko; Hayashi, Yukiko K; Miya, Kazushi; Shiina, Masaaki; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Saitsu, Hirotomo; Ogata, Kazuhiro; Nishino, Ichizo; Matsumoto, Naomichi

2014-07-01

When an expected mutation in a particular disease-causing gene is not identified in a suspected carrier, it is usually assumed to be due to germline mosaicism. We report here very-low-grade somatic mosaicism in ACTA1 in an unaffected mother of two siblings affected with a neonatal form of nemaline myopathy. The mosaicism was detected by deep resequencing using a next-generation sequencer. We identified a novel heterozygous mutation in ACTA1, c.448A>G (p.Thr150Ala), in the affected siblings. Three-dimensional structural modeling suggested that this mutation may affect polymerization and/or actin's interactions with other proteins. In this family, we expected autosomal dominant inheritance with either parent demonstrating germline or somatic mosaicism. Sanger sequencing identified no mutation. However, further deep resequencing of this mutation on a next-generation sequencer identified very-low-grade somatic mosaicism in the mother: 0.4%, 1.1%, and 8.3% in the saliva, blood leukocytes, and nails, respectively. Our study demonstrates the possibility of very-low-grade somatic mosaicism in suspected carriers, rather than germline mosaicism. Copyright © 2014 Elsevier B.V. All rights reserved.

AG-221, a First-in-Class Therapy Targeting Acute Myeloid Leukemia Harboring Oncogenic IDH2 Mutations.

PubMed

Yen, Katharine; Travins, Jeremy; Wang, Fang; David, Muriel D; Artin, Erin; Straley, Kimberly; Padyana, Anil; Gross, Stefan; DeLaBarre, Byron; Tobin, Erica; Chen, Yue; Nagaraja, Raj; Choe, Sung; Jin, Lei; Konteatis, Zenon; Cianchetta, Giovanni; Saunders, Jeffrey O; Salituro, Francesco G; Quivoron, Cyril; Opolon, Paule; Bawa, Olivia; Saada, Véronique; Paci, Angelo; Broutin, Sophie; Bernard, Olivier A; de Botton, Stéphane; Marteyn, Benoît S; Pilichowska, Monika; Xu, YingXia; Fang, Cheng; Jiang, Fan; Wei, Wentao; Jin, Shengfang; Silverman, Lee; Liu, Wei; Yang, Hua; Dang, Lenny; Dorsch, Marion; Penard-Lacronique, Virginie; Biller, Scott A; Su, Shin-San Michael

2017-05-01

Somatic gain-of-function mutations in isocitrate dehydrogenases ( IDH ) 1 and 2 are found in multiple hematologic and solid tumors, leading to accumulation of the oncometabolite ( R )-2-hydroxyglutarate (2HG). 2HG competitively inhibits α-ketoglutarate-dependent dioxygenases, including histone demethylases and methylcytosine dioxygenases of the TET family, causing epigenetic dysregulation and a block in cellular differentiation. In vitro studies have provided proof of concept for mutant IDH inhibition as a therapeutic approach. We report the discovery and characterization of AG-221, an orally available, selective, potent inhibitor of the mutant IDH2 enzyme. AG-221 suppressed 2HG production and induced cellular differentiation in primary human IDH2 mutation-positive acute myeloid leukemia (AML) cells ex vivo and in xenograft mouse models. AG-221 also provided a statistically significant survival benefit in an aggressive IDH2 R140Q -mutant AML xenograft mouse model. These findings supported initiation of the ongoing clinical trials of AG-221 in patients with IDH2 mutation-positive advanced hematologic malignancies. Significance: Mutations in IDH1/2 are identified in approximately 20% of patients with AML and contribute to leukemia via a block in hematopoietic cell differentiation. We have shown that the targeted inhibitor AG-221 suppresses the mutant IDH2 enzyme in multiple preclinical models and induces differentiation of malignant blasts, supporting its clinical development. Cancer Discov; 7(5); 478-93. ©2017 AACR. See related commentary by Thomas and Majeti, p. 459 See related article by Shih et al., p. 494 This article is highlighted in the In This Issue feature, p. 443 . ©2017 American Association for Cancer Research.

Antitumor effects and molecular mechanisms of ponatinib on endometrial cancer cells harboring activating FGFR2 mutations

PubMed Central

Kim, Do-Hee; Kwak, Yeonui; Kim, Nam Doo; Sim, Taebo

2016-01-01

ABSTRACT Aberrant mutational activation of FGFR2 is associated with endometrial cancers (ECs). AP24534 (ponatinib) currently undergoing clinical trials has been known to be an orally available multi-targeted tyrosine kinase inhibitor. Our biochemical kinase assay showed that AP24534 is potent against wild-type FGFR1-4 and 5 mutant FGFRs (V561M-FGFR1, N549H-FGFR2, K650E-FGFR3, G697C-FGFR3, N535K-FGFR4) and possesses the strongest kinase-inhibitory activity on N549H-FGFR2 (IC50 of 0.5 nM) among all FGFRs tested. We therefore investigated the effects of AP24534 on endometrial cancer cells harboring activating FGFR2 mutations and explored the underlying molecular mechanisms. AP24534 significantly inhibited the proliferation of endometrial cancer cells bearing activating FGFR2 mutations (N549K, K310R/N549K, S252W) and mainly induced G1/S cell cycle arrest leading to apoptosis. AP24534 also diminished the kinase activity of immunoprecipitated FGFR2 derived from MFE-296 and MFE-280 cells and reduced the phosphorylation of FGFR2 and FRS2 on MFE-296 and AN3CA cells. AP24534 caused substantial reductions in ERK phosphorylation, PLCγ signaling and STAT5 signal transduction on ECs bearing FGFR2 activating mutations. Akt signaling pathway was also deactivated by AP24534. AP24534 causes the chemotherapeutic effect through mainly the blockade of ERK, PLCγ and STAT5 signal transduction on ECs. Moreover, AP24534 inhibited migration and invasion of endometrial cancer cells with FGFR2 mutations. In addition, AP24534 significantly blocked anchorage-independent growth of endometrial cancer cells. We, for the first time, report the molecular mechanisms by which AP24534 exerts antitumor effects on ECs with FGFR2 activating mutations, which would provide mechanistic insight into ongoing clinical investigations of AP24534 for ECs. PMID:26574622

Somatic mutations in PIK3CA and activation of AKT in intraductal tubulopapillary neoplasms of the pancreas.

PubMed

Yamaguchi, Hiroshi; Kuboki, Yuko; Hatori, Takashi; Yamamoto, Masakazu; Shiratori, Keiko; Kawamura, Shunji; Kobayashi, Makio; Shimizu, Michio; Ban, Shinichi; Koyama, Isamu; Higashi, Morihiro; Shin, Nobuhiro; Ishida, Kazuyuki; Morikawa, Takanori; Motoi, Fuyuhiko; Unno, Michiaki; Kanno, Atsushi; Satoh, Kennichi; Shimosegawa, Tooru; Orikasa, Hideki; Watanabe, Tomoo; Nishimura, Kazuhiko; Harada, Youji; Furukawa, Toru

2011-12-01

Intraductal tubulopapillary neoplasm (ITPN) is a recently recognized rare variant of intraductal neoplasms of the pancreas. Molecular aberrations underlying the neoplasm remain unknown. We investigated somatic mutations in PIK3CA, PTEN, AKT1, KRAS, and BRAF. We also investigated aberrant expressions of phosphorylated AKT, phosphatase and tensin homolog (PTEN), tumor protein 53 (TP53), SMAD4, and CTNNB1 in 11 cases of ITPNs and compared these data with those of 50 cases of intraductal papillary mucinous neoplasm (IPMN), another distinct variant of pancreatic intraductal neoplasms. Mutations in PIK3CA were found in 3 of 11 ITPNs but not in IPMNs (P = 0.005; Fisher exact test). In contrast, mutations in KRAS were found in none of the ITPNs but were found in 26 of the 50 IPMNs (P = 0.001; Fisher exact test). PIK3CA mutations were associated with strong expression of phosphorylated AKT (P < 0.001; the Mann-Whitney U test). Moreover, the expression of phosphorylated AKT was apparent in most ITPNs but only in a few IPMNs (P < 0.001; the Mann-Whitney U test). Aberrant expressions of TP53, SMAD4, and CTNNB1 were not statistically different between these neoplasms. Mutations in PIK3CA and the expression of phosphorylated AKT were not associated with age, sex, tissue invasion, and patients' prognosis in ITPNs. These results indicate that activation of the phosphatidylinositol 3-kinase pathway may play a crucial role in ITPNs but not in IPMNs. In contrast, the mutation in KRAS seems to play a major role in IPMNs but not in ITPNs. The activated phosphatidylinositol 3-kinase pathway may be a potential target for molecular diagnosis and therapy of ITPNs.

Functional Analysis of Somatic Mutations in Lung Cancer

DTIC Science & Technology

2015-10-01

antibody cetuximab [11]. Finally, we have developed novel single cell sequencing approaches to uncover EGFR mutational variants in glioblastoma and their...assessed which mutations are epistatic to EGFR or capable of initiating xenograft tumor formation in vivo. Using eVIP, we identified 69% of mutations...analyzed as impactful whereas 31% appear functionally neutral. A subset of the impactful mutations induce xenograft tumor formation in mice and/or

PTT analysis of polyps from FAP patients reveals a great majority of APC truncating mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luijt, R.B. van der; Khan, P.M.; Tops, C.M.J.

The adenomatous polyposis coli (APC) gene plays an important role in colorectal carcinogenesis. Germline APC mutations are associated with familial adenomatous polyposis (FAP), an autosomal dominantly inherited predisposition to colorectal cancer, characterized by the development of numerous adenomatous polyps in the large intestine. In order to investigate whether somatic inactivation of the remaining APC allele is necessary for adenoma formation, we collected multiple adenomatous polyps from individual FAP patients and investigated the presence of somatic mutations in the APC gene. The analysis of somatic APC mutations in these tumor samples was performed using a rapid and sensitive assay, called themore » protein truncation test (PTT). Chain-terminating somatic APC mutations were detected in the great majority of the tumor samples investigated. As expected, these mutations were mainly located in the mutation cluster region (MCR) in exon 15. Our results confirm that somatic mutation of the second APC allele is required for adenoma formation in FAP. Interestingly, in the polyps investigated in our study, the second APC allele is somatically inactivated through point mutation leading to a stop codon rather than by loss of heterozygosity. The observation that somatic second hits in APC are required for tumor development in FAP is in apparent accordance with the Knudson hypothesis for classical tumor suppressor genes. However, it is yet unknown whether chain-terminating APC mutations lead to a truncated protein exerting a dominant-negative effect or whether these mutations result in a null allele. Further investigation of this important issue will hopefully provide a better understanding of the mechanism of action of the mutated APC alleles in colorectal carcinogenesis.« less

Persistent induction of somatic reversions of the pink-eyed unstable mutation in F1 mice born to fathers irradiated at the spermatozoa stage.

PubMed

Shiraishi, Kazunori; Shimura, Tsutomu; Taga, Masataka; Uematsu, Norio; Gondo, Yoichi; Ohtaki, Megu; Kominami, Ryo; Niwa, Ohtsura

2002-06-01

Untargeted mutation and delayed mutation are features of radiation-induced genomic instability and have been studied extensively in tissue culture cells. The mouse pink-eyed unstable (p(un)) mutation is due to an intragenic duplication of the pink-eyed dilution locus and frequently reverts back to the wild type in germ cells as well as in somatic cells. The reversion event can be detected in the retinal pigment epithelium as a cluster of pigmented cells (eye spot). We have investigated the reversion p(um) in F1 mice born to irradiated males. Spermatogonia-stage irradiation did not affect the frequency of the reversion in F1 mice. However, 6 Gy irradiation at the spermatozoa stage resulted in an approximately twofold increase in the number of eye spots in the retinal pigment epithelium of F1 mice. Somatic reversion occurred for the paternally derived p(un) alleles. In addition, the reversion also occurred for the maternally derived, unirradiated p(un) alleles at a frequency equal to that for the paternally derived allele. Detailed analyses of the number of pigmented cells per eye spot indicated that the frequency of reversion was persistently elevated during the proliferation cycle of the cells in the retinal pigment epithelium when the male parents were irradiated at the spermatozoa stage. The present study demonstrates the presence of a long-lasting memory of DNA damage and the persistent up-regulation of recombinogenic activity in the retinal pigment epithelium of the developing fetus.

The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

PubMed

Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

2018-05-01

In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

Emergence of MPLW515 mutation in a patient with CALR deletion: Evidence of secondary acquisition of MPL mutation in the CALR clone.

PubMed

Partouche, Nicolas; Conejero, Carole; Barathon, Quentin; Moroch, Julien; Tulliez, Michel; Cordonnier, Catherine; Giraudier, Stephane

2018-02-01

Myeloproliferative neoplasms are characterized by transduction pathway recognized as mutually exclusive molecular abnormalities such as BCR-ABL translocation, JAK2V617F or JAK2 exon 12 mutations, MPL w515, and CALR mutations. However, in some rare cases, associations of such mutations are found in 1 patient. This can be related to 2 pathologies (at least 2 different clones harboring 2 mutations) or associated mutations in 1 clone. We describe here such an association of CALR and MPL mutations in a patient harboring the second mutation in a subclone during the phenotypic evolution of the myeloproliferative neoplasms. Copyright © 2017 John Wiley & Sons, Ltd.

Case Report: Osimertinib achieved remarkable and sustained disease control in an advanced non-small-cell lung cancer harboring EGFR H773L/V774M mutation complex.

PubMed

Yang, Minglei; Tong, Xiaoling; Xu, Xiang; Zheng, Enkuo; Ni, Junjun; Li, Junfang; Yan, Junrong; Shao, Yang W; Zhao, Guofang

2018-07-01

Missense mutations in EGFR exon 20 are rare in non-small-cell lung cancer (NSCLC), and mostly insensitive to the first generation tyrosine kinase inhibitors (TKIs) of EGFR. However, their responses to the third generation TKI are unclear. Here, we reported a patient with advanced NSCLC harboring a rare EGFR H773L/V774M mutation complex. Although he was irresponsive to the first generation TKI gefitinib, he demonstrated sustained disease control to osimertinib, suggesting that this complex is an activating mutation of EGFR and can be suppressed by osimertinib. The follow-up genetic profiling revealed multiple acquired new mutations that might be related to his resistance to osimertinib. This finding would provide valuable experience for future treatment of the same mutations. Copyright © 2018 Elsevier B.V. All rights reserved.

A novel splicing site IRP1 somatic mutation in a patient with pheochromocytoma and JAK2V617F positive polycythemia vera: a case report.

PubMed

Pang, Ying; Gupta, Garima; Yang, Chunzhang; Wang, Herui; Huynh, Thanh-Truc; Abdullaev, Ziedulla; Pack, Svetlana D; Percy, Melanie J; Lappin, Terence R J; Zhuang, Zhengping; Pacak, Karel

2018-03-13

The role of the hypoxia signaling pathway in the pathogenesis of pheochromocytoma/paraganglioma (PPGL)-polycythemia syndrome has been elucidated. Novel somatic mutations in hypoxia-inducible factor type 2A (HIF2A) and germline mutations in prolyl hydroxylase type 1 and type 2 (PHD1 and PHD2) have been identified to cause upregulation of the hypoxia signaling pathway and its target genes including erythropoietin (EPO) and its receptor (EPOR). However, in a minority of patients presenting with this syndrome, the genetics and molecular pathogenesis remain unexplained. The aim of the present study was to uncover novel genetic causes of PPGL-polycythemia syndrome. A female presented with a history of JAK2 V617F positive PV, diagnosed in 2007, and right adrenal pheochromocytoma diagnosed and resected in 2011. Her polycythemia symptoms and hematocrit levels continued to worsen from 2007 to 2011, with an increased frequency of phlebotomies. Postoperatively, until early 2013, her hematocrit levels remained normalized. Following this, the hematocrit levels ranged between 46.4 and 48.9% [35-45%]. Tumor tissue from the patient was further tested for mutations in genes related to upregulation of the hypoxia signaling pathway including iron regulatory protein 1 (IRP1), which is a known regulator of HIF-2α mRNA translation. Functional studies were performed to investigate the consequences of these mutations, especially their effect on the HIF signaling pathway and EPO. Indel mutations (c.267-1_267delGGinsTA) were discovered at the exon 3 splicing site of IRP1. Minigene construct and splicing site analysis showed that the mutation led to a new splicing site and a frameshift mutation of IRP1, which caused a truncated protein. Fluorescence in situ hybridization analysis demonstrated heterozygous IRP1 deletions in tumor cells. Immunohistochemistry results confirmed the truncated IRP1 and overexpressed HIF-2α, EPO and EPOR in tumor cells. This is the first report which provides

Global Characterization of Protein Altering Mutations in Prostate Cancer

DTIC Science & Technology

2011-08-01

integrative analyses of somatic mutation with gene expression and copy number change data collected on the same samples. To date, we have performed...implications for resistance to cancer therapeutics. We have also identified a subset of genes that appear to be recurrently mutated in our discovery set, and...integrative analyses of somatic mutation with gene expression and copy number change data collected on the same samples. Body This is a “synergy” project

Somatic mosaicism due to monoallelic reversion of a mutation in T cells of an ADA-SCID patient and the effects of enzyme replacement therapy on the revertant phenotype

PubMed Central

Moncada-Vélez, Marcela; Vélez-Ortega, Alejandra C.; Orrego, Julio C.; Santisteban, Inés; Jagadeesh, Jayashree; Olivares, Margarita; Olaya, Natalia; Hershfield, Michael S.; Candotti, Fabio; Franco, Jose L.

2011-01-01

Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B-NK- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in PBL, as a result of somatic mosaicism due to monoallelic reversion of the causative mutation in the ADA gene. Our patient was not eligible for hematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore enzyme replacement therapy (ERT) with bovine PEG-ADA was initiated. The follow up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, with sustained expansion of TCRγδ+ T cells. This was accompanied by disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient’s clinical condition improved marginally, he later developed a germinal cell tumor and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. PMID:21671975

The landscape of cancer genes and mutational processes in breast cancer

PubMed Central

Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; Loo, Peter Van; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; OSBREAC; Lee, Ming Ta Michael; Shen, Chen-Yang; Tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van ’t Veer, Laura; Foekens, John; Desmedt, Christine; Sotiriou, Christos; Tutt, Andrew; Caldas, Carlos; Reis-Filho, Jorge S.; Aparicio, Samuel A. J. R.; Salomon, Anne Vincent; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Campbell, Peter J.; Futreal, P. Andrew; Stratton, Michael R.

2012-01-01

All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis1, and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast cancer have not yet been comprehensively explored. Here we examine the genomes of 100 tumours for somatic copy number changes and mutations in the coding exons of protein-coding genes. The number of somatic mutations varied markedly between individual tumours. We found strong correlations between mutation number, age at which cancer was diagnosed and cancer histological grade, and observed multiple mutational signatures, including one present in about ten per cent of tumours characterized by numerous mutations of cytosine at TpC dinucleotides. Driver mutations were identified in several new cancer genes including AKT2, ARID1B, CASP8, CDKN1B, MAP3K1, MAP3K13, NCOR1, SMARCD1 and TBX3. Among the 100 tumours, we found driver mutations in at least 40 cancer genes and 73 different combinations of mutated cancer genes. The results highlight the substantial genetic diversity underlying this common disease. PMID:22722201

Characterization of conservative somatic instability of the CAG repeat region in Huntington`s disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schaefer, F.V.; Calikoglu, A.S.; Whetsell, L.H.

1994-09-01

Instability and enlargement of a CAG repeat region at the beginning of the huntingtin gene (IT-15) has been linked with Huntington`s disease. The CAG repeat size shows a highly significant correlation with age-of-onset of clinicial features in individuals with 40 or more repeats who have Huntington disease. The clinical status of nonsymptomatic individuals with 30 to 39 CAG repeats is considered ambiguous. In order to define more carefully the nature of the HD expansion instability, we examined patients in our HD population using a discriminating fluorescence-based PCR approach. The degree of somatic mutation increases with both earlier age of onsetmore » and the size of the inherited allele. A single prominent band one repeat larger than the index peak was typical in individuals with 40-41 CAG repeats. Three to four larger bands are typically discerned in individuals with 50 or more repeats. In an extreme example, an individual with approximately 95 repeats had at least 8 prominent bands. Plotting the degree of somatic mutation relative to the size of the HD allele shows somatic mutation activity increases with size. By this approach 40-60% of the alleles in a 40-41 CAG repeat HD loci is represented in the primary allele. In contrast, the primary allele represents a relatively minor proportion of the total alleles for expansions greater than 50 CAG repeats (10-20%). The limited range of somatic mutation suggest that the instability is restricted to very early stages of embryogenesis before tissue development diverges or that persistent somatic instability occurs at a slow rate. Therefore, the properties of somatic instability in Huntington`s disease have aspects that are both in common but also different from that found in other trinucleotide repeat expanding diseases such as myotonic muscular dystrophy and fragile X syndrome.« less

Spectrum of mutations in RARS-T patients includes TET2 and ASXL1 mutations.

PubMed

Szpurka, Hadrian; Jankowska, Anna M; Makishima, Hideki; Bodo, Juraj; Bejanyan, Nelli; Hsi, Eric D; Sekeres, Mikkael A; Maciejewski, Jaroslaw P

2010-08-01

While a majority of patients with refractory anemia with ring sideroblasts and thrombocytosis harbor JAK2V617F and rarely MPLW515L, JAK2/MPL-negative cases constitute a diagnostic problem. 23 RARS-T cases were investigated applying immunohistochemical phospho-STAT5, sequencing and SNP-A-based karyotyping. Based on the association of TET2/ASXL1 mutations with MDS/MPN we studied molecular pattern of these genes. Two patients harbored ASXL1 and another 2 TET2 mutations. Phospho-STAT5 activation was present in one mutated TET2 and ASXL1 case. JAK2V617F/MPLW515L mutations were absent in TET2/ASXL1 mutants, indicating that similar clinical phenotype can be produced by various MPN-associated mutations and that additional unifying lesions may be present in RARS-T. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Somatic mutation frequencies in the stamen hairs of Tradescantia grown in soil samples from the Bikini Island.

PubMed

Ichikawa, S; Ishii, C

1991-02-01

Somatic pink mutation frequencies in the stamen hairs of Tradescantia BNL 02 clone grown for 76 days in two soil samples taken from the Bikini Island (where a hydrogen bomb explosion test had been conducted in 1954) were investigated. A significantly high mutation frequency (2.58 +/- 0.17 pink mutant events per 10(3) hairs or 1.34 +/- 0.09 pink mutant events per 10(4) hair-cell divisions) was observed for the plant grown in one of the two Bikini soil samples, as compared to the control plants (1.70 +/- 0.14 or 0.88 +/- 0.07, respectively) grown in the field soil of Saitama University. The soil sample which caused the significant increase in mutation frequency contained 6,880 +/- 330 mBq/g 137Cs, 62.5 +/- 4.4 mBq/g 60Co, and some other nuclides; a 150 microR/hr exposure rate being measured on the surface of the soil sample. The effective cumulative external exposures measured for the inflorescences of the plant grown in this soil sample averaged at most 60.8 mR, being too small to explain the significant elevation in mutation frequency observed. On the other hand, internal exposure due to uptake of radioactive nuclides was estimated to be 125 mrad (1.25 mGy) as an accumulated effective dose, mainly based on a gamma-spectrometrical analysis. However, it seemed highly likely that this value of internal exposure was a considerable underestimate, and the internal exposure was considered to be more significant than the external exposure.

Targeted Exome Sequencing of Krebs Cycle Genes Reveals Candidate Cancer-Predisposing Mutations in Pheochromocytomas and Paragangliomas.

PubMed

Remacha, Laura; Comino-Méndez, Iñaki; Richter, Susan; Contreras, Laura; Currás-Freixes, María; Pita, Guillermo; Letón, Rocío; Galarreta, Antonio; Torres-Pérez, Rafael; Honrado, Emiliano; Jiménez, Scherezade; Maestre, Lorena; Moran, Sebastian; Esteller, Manel; Satrústegui, Jorgina; Eisenhofer, Graeme; Robledo, Mercedes; Cascón, Alberto

2017-10-15

Purpose: Mutations in Krebs cycle genes are frequently found in patients with pheochromocytomas/paragangliomas. Disruption of SDH, FH or MDH2 enzymatic activities lead to accumulation of specific metabolites, which give rise to epigenetic changes in the genome that cause a characteristic hypermethylated phenotype. Tumors showing this phenotype, but no alterations in the known predisposing genes, could harbor mutations in other Krebs cycle genes. Experimental Design: We used downregulation and methylation of RBP1, as a marker of a hypermethylation phenotype, to select eleven pheochromocytomas and paragangliomas for targeted exome sequencing of a panel of Krebs cycle-related genes. Methylation profiling, metabolite assessment and additional analyses were also performed in selected cases. Results: One of the 11 tumors was found to carry a known cancer-predisposing somatic mutation in IDH1 A variant in GOT2 , c.357A>T, found in a patient with multiple tumors, was associated with higher tumor mRNA and protein expression levels, increased GOT2 enzymatic activity in lymphoblastic cells, and altered metabolite ratios both in tumors and in GOT2 knockdown HeLa cells transfected with the variant. Array methylation-based analysis uncovered a somatic epigenetic mutation in SDHC in a patient with multiple pheochromocytomas and a gastrointestinal stromal tumor. Finally, a truncating germline IDH3B mutation was found in a patient with a single paraganglioma showing an altered α-ketoglutarate/isocitrate ratio. Conclusions: This study further attests to the relevance of the Krebs cycle in the development of PCC and PGL, and points to a potential role of other metabolic enzymes involved in metabolite exchange between mitochondria and cytosol. Clin Cancer Res; 23(20); 6315-24. ©2017 AACR . ©2017 American Association for Cancer Research.

MutSpec: a Galaxy toolbox for streamlined analyses of somatic mutation spectra in human and mouse cancer genomes.

PubMed

Ardin, Maude; Cahais, Vincent; Castells, Xavier; Bouaoun, Liacine; Byrnes, Graham; Herceg, Zdenko; Zavadil, Jiri; Olivier, Magali

2016-04-18

The nature of somatic mutations observed in human tumors at single gene or genome-wide levels can reveal information on past carcinogenic exposures and mutational processes contributing to tumor development. While large amounts of sequencing data are being generated, the associated analysis and interpretation of mutation patterns that may reveal clues about the natural history of cancer present complex and challenging tasks that require advanced bioinformatics skills. To make such analyses accessible to a wider community of researchers with no programming expertise, we have developed within the web-based user-friendly platform Galaxy a first-of-its-kind package called MutSpec. MutSpec includes a set of tools that perform variant annotation and use advanced statistics for the identification of mutation signatures present in cancer genomes and for comparing the obtained signatures with those published in the COSMIC database and other sources. MutSpec offers an accessible framework for building reproducible analysis pipelines, integrating existing methods and scripts developed in-house with publicly available R packages. MutSpec may be used to analyse data from whole-exome, whole-genome or targeted sequencing experiments performed on human or mouse genomes. Results are provided in various formats including rich graphical outputs. An example is presented to illustrate the package functionalities, the straightforward workflow analysis and the richness of the statistics and publication-grade graphics produced by the tool. MutSpec offers an easy-to-use graphical interface embedded in the popular Galaxy platform that can be used by researchers with limited programming or bioinformatics expertise to analyse mutation signatures present in cancer genomes. MutSpec can thus effectively assist in the discovery of complex mutational processes resulting from exogenous and endogenous carcinogenic insults.

Somatic mosaicism containing double mutations in PTCH1 revealed by generation of induced pluripotent stem cells from nevoid basal cell carcinoma syndrome.

PubMed

Ikemoto, Yu; Takayama, Yoshinaga; Fujii, Katsunori; Masuda, Mokuri; Kato, Chise; Hatsuse, Hiromi; Fujitani, Kazuko; Nagao, Kazuaki; Kameyama, Kohzoh; Ikehara, Hajime; Toyoda, Masashi; Umezawa, Akihiro; Miyashita, Toshiyuki

2017-08-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder characterised by developmental defects and tumorigenesis, such as medulloblastomas and basal cell carcinomas, caused by mutations of the patched-1 ( PTCH1 ) gene. In this article, we seek to demonstrate a mosaicism containing double mutations in PTCH1 in an individual with NBCCS. A de novo germline mutation of PTCH1 (c.272delG) was detected in a 31-year-old woman with NBCCS. Gene analysis of two out of four induced pluripotent stem cell (iPSC) clones established from the patient unexpectedly revealed an additional mutation, c.274delT. Deep sequencing confirmed a low-prevalence somatic mutation (5.5%-15.6% depending on the tissue) identical to the one found in iPSC clones. This is the first case of mosaicism unequivocally demonstrated in NBCCS. Furthermore, the mosaicism is unique in that the patient carries one normal and two mutant alleles. Because these mutations are located in close proximity, reversion error is likely to be involved in this event rather than a spontaneous mutation. In addition, this study indicates that gene analysis of iPSC clones can contribute to the detection of mosaicism containing a minor population carrying a second mutation. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Analysis of the IgV(H) somatic mutations in splenic marginal zone lymphoma defines a group of unmutated cases with frequent 7q deletion and adverse clinical course.

PubMed

Algara, Patricia; Mateo, Marisol S; Sanchez-Beato, Margarita; Mollejo, Manuela; Navas, Immaculada C; Romero, Lourdes; Solé, Francesc; Salido, Marta; Florensa, Lourdes; Martínez, Pedro; Campo, Elias; Piris, Miguel A

2002-02-15

This study aimed to correlate the frequency of somatic mutations in the IgV(H) gene and the use of specific segments in the V(H) repertoire with the clinical and characteristic features of a series of 35 cases of splenic marginal zone lymphoma (SMZL). The cases were studied by seminested polymerase chain reaction by using primers from the FR1 and J(H) region. The results showed unexpected molecular heterogeneity in this entity, with 49% unmutated cases (less than 2% somatic mutations). The 7q31 deletions and a shorter overall survival were more frequent in this group. Additionally a high percentage (18 of 40 sequences) of SMZL cases showed usage of the V(H)1-2 segment, thereby emphasizing the singularity of this neoplasia, suggesting that this tumor derives from a highly selected B-cell population and encouraging the search for specific antigens that are pathogenically relevant in the genesis or progression of this tumor.

Activating HER2 mutations in HER2 gene amplification negative breast cancer.

PubMed

Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

2013-02-01

Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

A systematic profile of clinical inhibitors responsive to EGFR somatic amino acid mutations in lung cancer: implication for the molecular mechanism of drug resistance and sensitivity.

PubMed

Ai, Xinghao; Sun, Yingjia; Wang, Haidong; Lu, Shun

2014-07-01

Human epidermal growth factor receptor (EGFR) has become a well-established target for the treatment of patients with non-small cell lung cancer (NSCLC). However, a large number of somatic mutations in such protein have been observed to cause drug resistance or sensitivity during pathological progression, limiting the application of reversible EGFR tyrosine kinase inhibitor therapy in NSCLC. In the current work, we describe an integration of in silico analysis and in vitro assay to profile six representative EGFR inhibitors against a panel of 71 observed somatic mutations in EGFR tyrosine kinase domain. In the procedure, the changes in interaction free energy of inhibitors with EGFR upon various mutations were calculated one by one using a rigorous computational scheme, which was preoptimized based on a set of structure-solved, affinity-known samples to improve its performance in characterizing the EGFR-inhibitor system. This method was later demonstrated to be effective in inferring drug response to the classical L858R and G719S mutations that confer constitutive activation for the EGFR kinase. It is found that the Staurosporine, a natural product isolated from the bacterium Streptomyces staurosporeus, exhibits selective inhibitory activity on the T790M and T790M/L858R mutants. This finding was subsequently solidified by in vitro kinase assay experiment; the inhibitory IC50 values of Staurosporine against wild-type, T790M and T790M/L858R mutant EGFR were measured to be 937, 12 and 3 nM, respectively.

Stochastic modeling indicates that aging and somatic evolution in the hematopoetic system are driven by non-cell-autonomous processes.

PubMed

Rozhok, Andrii I; Salstrom, Jennifer L; DeGregori, James

2014-12-01

Age-dependent tissue decline and increased cancer incidence are widely accepted to be rate-limited by the accumulation of somatic mutations over time. Current models of carcinogenesis are dominated by the assumption that oncogenic mutations have defined advantageous fitness effects on recipient stem and progenitor cells, promoting and rate-limiting somatic evolution. However, this assumption is markedly discrepant with evolutionary theory, whereby fitness is a dynamic property of a phenotype imposed upon and widely modulated by environment. We computationally modeled dynamic microenvironment-dependent fitness alterations in hematopoietic stem cells (HSC) within the Sprengel-Liebig system known to govern evolution at the population level. Our model for the first time integrates real data on age-dependent dynamics of HSC division rates, pool size, and accumulation of genetic changes and demonstrates that somatic evolution is not rate-limited by the occurrence of mutations, but instead results from aged microenvironment-driven alterations in the selective/fitness value of previously accumulated genetic changes. Our results are also consistent with evolutionary models of aging and thus oppose both somatic mutation-centric paradigms of carcinogenesis and tissue functional decline. In total, we demonstrate that aging directly promotes HSC fitness decline and somatic evolution via non-cell-autonomous mechanisms.

Monitoring humans for somatic mutation in the endogenous PIG-a gene using red blood cells.

PubMed

Dobrovolsky, Vasily N; Elespuru, Rosalie K; Bigger, C Anita H; Robison, Timothy W; Heflich, Robert H

2011-12-01

The endogenous X-linked PIG-A gene is involved in the synthesis of glycosyl phosphatidyl inositol (GPI) anchors that tether specific protein markers to the exterior of mammalian cell cytoplasmic membranes. Earlier studies in rodent models indicate that Pig-a mutant red blood cells (RBCs) can be induced in animals treated with genotoxic agents, and that flow cytometry can be used to identify rare RBCs deficient in the GPI-anchored protein, CD59, as a marker of Pig-a gene mutation. We investigated if a similar approach could be used for detecting gene mutation in humans. We first determined the frequency of spontaneous CD59-deficient RBCs (presumed PIG-A mutants) in 97 self-identified healthy volunteers. For most subjects, the frequency of CD59-deficient RBCs was low (average of 5.1 ± 4.9 × 10(-6) ; median of 3.8 × 10(-6) and mutant frequency less than 8 × 10(-6) for 75% of subjects), with a statistically significant difference in median mutant frequencies between males and females. PIG-A RBC mutant frequency displayed poor correlation with the age and no correlation with the smoking status of the subjects. Also, two individuals had markedly increased CD59-deficient RBC frequencies of ∼300 × 10(-6) and ∼100 × 10(-6) . We then monitored PIG-A mutation in 10 newly diagnosed cancer patients undergoing chemotherapy with known genotoxic drugs. The frequency of CD59-deficient RBCs in the blood of the patients was measured before the start of chemotherapy and three times over a period of ∼6 months while on/after chemotherapy. Responses were generally weak, most observations being less than the median mutant frequency for both males and females; the greatest response was an approximate three-fold increase in the frequency of CD59-deficient RBCs in one patient treated with a combination of cisplatin and etoposide. These results suggest that the RBC PIG-A assay can be adopted to measuring somatic cell mutation in humans. Further research is necessary to determine

Suppression of Somatic Expansion Delays the Onset of Pathophysiology in a Mouse Model of Huntington’s Disease

PubMed Central

Budworth, Helen; Harris, Faye R.; Williams, Paul; Lee, Do Yup; Holt, Amy; Pahnke, Jens; Szczesny, Bartosz; Acevedo-Torres, Karina; Ayala-Peña, Sylvette; McMurray, Cynthia T.

2015-01-01

Huntington’s Disease (HD) is caused by inheritance of a single disease-length allele harboring an expanded CAG repeat, which continues to expand in somatic tissues with age. The inherited disease allele expresses a toxic protein, and whether further somatic expansion adds to toxicity is unknown. We have created an HD mouse model that resolves the effects of the inherited and somatic expansions. We show here that suppressing somatic expansion substantially delays the onset of disease in littermates that inherit the same disease-length allele. Furthermore, a pharmacological inhibitor, XJB-5-131, inhibits the lengthening of the repeat tracks, and correlates with rescue of motor decline in these animals. The results provide evidence that pharmacological approaches to offset disease progression are possible. PMID:26247199

Suppression of somatic expansion delays the onset of pathophysiology in a mouse model of Huntington’s Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Budworth, Helen; Harris, Faye R.; Williams, Paul

Huntington’s Disease (HD) is caused by inheritance of a single disease-length allele harboring an expanded CAG repeat, which continues to expand in somatic tissues with age. The inherited disease allele expresses a toxic protein, and whether further somatic expansion adds to toxicity is unknown. We have created an HD mouse model that resolves the effects of the inherited and somatic expansions. We show here that suppressing somatic expansion substantially delays the onset of disease in littermates that inherit the same disease-length allele. Furthermore, a pharmacological inhibitor, XJB-5-131, inhibits the lengthening of the repeat tracks, and correlates with rescue of motormore » decline in these animals. The results provide evidence that pharmacological approaches to offset disease progression are possible.« less

Suppression of somatic expansion delays the onset of pathophysiology in a mouse model of Huntington’s Disease

DOE PAGES

Budworth, Helen; Harris, Faye R.; Williams, Paul; ...

2015-08-06

Huntington’s Disease (HD) is caused by inheritance of a single disease-length allele harboring an expanded CAG repeat, which continues to expand in somatic tissues with age. The inherited disease allele expresses a toxic protein, and whether further somatic expansion adds to toxicity is unknown. We have created an HD mouse model that resolves the effects of the inherited and somatic expansions. We show here that suppressing somatic expansion substantially delays the onset of disease in littermates that inherit the same disease-length allele. Furthermore, a pharmacological inhibitor, XJB-5-131, inhibits the lengthening of the repeat tracks, and correlates with rescue of motormore » decline in these animals. The results provide evidence that pharmacological approaches to offset disease progression are possible.« less

The Mutational Landscape of Adenoid Cystic Carcinoma

PubMed Central

Ho, Allen S.; Kannan, Kasthuri; Roy, David M.; Morris, Luc G.T.; Ganly, Ian; Katabi, Nora; Ramaswami, Deepa; Walsh, Logan A.; Eng, Stephanie; Huse, Jason T.; Zhang, Jianan; Dolgalev, Igor; Huberman, Kety; Heguy, Adriana; Viale, Agnes; Drobnjak, Marija; Leversha, Margaret A.; Rice, Christine E.; Singh, Bhuvanesh; Iyer, N. Gopalakrishna; Leemans, C. Rene; Bloemena, Elisabeth; Ferris, Robert L.; Seethala, Raja R.; Gross, Benjamin E.; Liang, Yupu; Sinha, Rileen; Peng, Luke; Raphael, Benjamin J.; Turcan, Sevin; Gong, Yongxing; Schultz, Nikolaus; Kim, Seungwon; Chiosea, Simion; Shah, Jatin P.; Sander, Chris; Lee, William; Chan, Timothy A.

2013-01-01

Adenoid cystic carcinomas (ACCs) are among the most enigmatic of human malignancies. These aggressive salivary cancers frequently recur and metastasize despite definitive treatment, with no known effective chemotherapy regimen. Here, we determined the ACC mutational landscape and report the exome or whole genome sequences of 60 ACC tumor/normal pairs. These analyses revealed a low exonic somatic mutation rate (0.31 non-silent events/megabase) and wide mutational diversity. Interestingly, mutations selectively involved chromatin state regulators, such as SMARCA2, CREBBP, and KDM6A, suggesting aberrant epigenetic regulation in ACC oncogenesis. Mutations in genes central to DNA damage and protein kinase A signaling also implicate these processes. We observed MYB-NFIB translocations and somatic mutations in MYB-associated genes, solidifying these aberrations as critical events. Lastly, we identified recurrent mutations in the FGF/IGF/PI3K pathway that may potentially offer new avenues for therapy (30%). Collectively, our observations establish a molecular foundation for understanding and exploring new treatments for ACC. PMID:23685749

Activating HER2 mutations in HER2 gene amplification negative breast cancer

PubMed Central

Bose, Ron; Kavuri, Shyam M.; Searleman, Adam C.; Shen, Wei; Shen, Dong; Koboldt, Daniel C.; Monsey, John; Goel, Nicholas; Aronson, Adam B.; Li, Shunqiang; Ma, Cynthia X.; Ding, Li; Mardis, Elaine R.; Ellis, Matthew J.

2012-01-01

Data from eight breast cancer genome sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized thirteen HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGFR exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings demonstrate that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. PMID:23220880

Myeloid neoplasms with germline DDX41 mutation.

PubMed

Cheah, Jesse J C; Hahn, Christopher N; Hiwase, Devendra K; Scott, Hamish S; Brown, Anna L

2017-08-01

Recently, DDX41 mutations have been identified both as germline and acquired somatic mutations in families with multiple cases of late-onset myelodysplastic syndrome (MDS) and/or acute myeloid leukemia. The majority of germline mutations are frameshift mutations suggesting loss of function with DDX41 acting as a tumor suppressor, and there is a common somatic missense mutation found in a majority of germline mutated tumors. Clinically, DDX41 mutations lead to development of high-risk MDS at an age similar to that observed in sporadic cohorts, presenting a unique challenge to hematologists in recognizing the familial context. Functionally, DDX41 has been shown to contribute to multiple pathways and processes including mRNA splicing, innate immunity and rRNA processing. Mutations in DDX41 result in aberrations to each of these in ways that could potentially impact on tumorigenesis-initiation, maintenance or progression. This review discusses the various molecular, clinical and biological aspects of myeloid malignancy predisposition due to DDX41 mutation and highlights how each of these suggest potential therapeutic opportunities through the use of pathway-specific inhibitors.

Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi

PubMed Central

Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes AP; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G

2017-01-01

Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n = 61), followed by less frequent mutations in GNA11 (16%, n = 17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T > A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi. PMID:27934878

Activating cysteinyl leukotriene receptor 2 (CYSLTR2) mutations in blue nevi.

PubMed

Möller, Inga; Murali, Rajmohan; Müller, Hansgeorg; Wiesner, Thomas; Jackett, Louise A; Scholz, Simone L; Cosgarea, Ioana; van de Nes, Johannes Ap; Sucker, Antje; Hillen, Uwe; Schilling, Bastian; Paschen, Annette; Kutzner, Heinz; Rütten, Arno; Böckers, Martin; Scolyer, Richard A; Schadendorf, Dirk; Griewank, Klaus G

2017-03-01

Blue nevi are common melanocytic tumors arising in the dermal layer of the skin. Similar to uveal melanomas, blue nevi frequently harbor GNAQ and GNA11 mutations. Recently, recurrent CYSLTR2 and PLCB4 mutations were identified in uveal melanomas not harboring GNAQ or GNA11 mutations. All four genes (GNAQ, GNA11, CYSLTR2, and PLCB4) code for proteins involved in the same signaling pathway, which is activated by mutations in these genes. Given the related functional consequences of these mutations and the known genetic similarities between uveal melanoma and blue nevi, we analyzed a cohort of blue nevi to investigate whether CYSLTR2 and PLCB4 mutations occur in tumors lacking GNAQ or GNA11 mutations (as in uveal melanoma). A targeted next-generation sequencing assay covering known activating mutations in GNAQ, GNA11, CYSLTR2, PLCB4, KIT, NRAS, and BRAF was applied to 103 blue nevi. As previously reported, most blue nevi were found to harbor activating mutations in GNAQ (59%, n=61), followed by less frequent mutations in GNA11 (16%, n=17). Additionally, one BRAF (1%) and three NRAS (3%) mutations were detected. In three tumors (3%) harboring none of the aforementioned gene alterations, CYSLTR2 mutations were identified. All three CYSLTR2 mutations were the same c.386T>A, L129Q mutation previously identified in uveal melanoma that has been shown to lead to increased receptor activation and signaling. In summary, our study identifies CYSLTR2 L129Q alterations as a previously unrecognized activating mutation in blue nevi, occuring in a mutually exclusive fashion with known GNAQ and GNA11 mutations. Similar to GNAQ and GNA11 mutations, CYSLTR2 mutations, when present, are likely defining pathogenetic events in blue nevi.

DNA polymerase η mutational signatures are found in a variety of different types of cancer.

PubMed

Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I

2018-01-01

DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression profile with dysregulated HOX gene expression distinct from MLL-rearranged leukemias.

PubMed

Mullighan, C G; Kennedy, A; Zhou, X; Radtke, I; Phillips, L A; Shurtleff, S A; Downing, J R

2007-09-01

Somatic mutations in nucleophosmin (NPM1) occur in approximately 35% of adult acute myeloid leukemia (AML). To assess the frequency of NPM1 mutations in pediatric AML, we sequenced NPM1 in the diagnostic blasts from 93 pediatric AML patients. Six cases harbored NPM1 mutations, with each case lacking common cytogenetic abnormalities. To explore the phenotype of the AMLs with NPM1 mutations, gene expression profiles were obtained using Affymetrix U133A microarrays. NPM1 mutations were associated with increased expression of multiple homeobox genes including HOXA9, A10, B2, B6 and MEIS1. As dysregulated homeobox gene expression is also a feature of MLL-rearranged leukemia, the gene expression signatures of NPM1-mutated and MLL-rearranged leukemias were compared. Significant differences were identified between these leukemia subtypes including the expression of different HOX genes, with NPM1-mutated AML showing higher levels of expression of HOXB2, B3, B6 and D4. These results confirm recent reports of perturbed HOX expression in NPM1-mutated adult AML, and provide the first evidence that the NPM1-mutated signature is distinct from MLL-rearranged AML. These findings suggest that mutated NPM1 leads to dysregulated HOX expression via a different mechanism than MLL rearrangement.

Somatic mutations and affinity maturation are impaired by excessive numbers of T follicular helper cells and restored by Treg cells or memory T cells.

PubMed

Preite, Silvia; Baumjohann, Dirk; Foglierini, Mathilde; Basso, Camilla; Ronchi, Francesca; Fernandez Rodriguez, Blanca M; Corti, Davide; Lanzavecchia, Antonio; Sallusto, Federica

2015-11-01

We previously reported that Cd3e-deficient mice adoptively transferred with CD4(+) T cells generate high numbers of T follicular helper (Tfh) cells, which go on to induce a strong B-cell and germinal center (GC) reaction. Here, we show that in this system, GC B cells display an altered distribution between the dark and light zones, and express low levels of activation-induced cytidine deaminase. Furthermore, GC B cells from Cd3e(-/-) mice accumulate fewer somatic mutations as compared with GC B cells from wild-type mice, and exhibit impaired affinity maturation and reduced differentiation into long-lived plasma cells. Reconstitution of Cd3e(-/-) mice with regulatory T (Treg) cells restored Tfh-cell numbers, GC B-cell numbers and B-cell distribution within dark and light zones, and the rate of antibody somatic mutations. Tfh-cell numbers and GC B-cell numbers and dynamics were also restored by pre-reconstitution of Cd3e(-/-) mice with Cxcr5(-/-) Treg cells or non-regulatory, memory CD4(+) T cells. Taken together, these findings underline the importance of a quantitatively regulated Tfh-cell response for an efficient and long-lasting serological response. © 2015 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Monoallelic mutation analysis (MAMA) for identifying germline mutations.

PubMed

Papadopoulos, N; Leach, F S; Kinzler, K W; Vogelstein, B

1995-09-01

Dissection of germline mutations in a sensitive and specific manner presents a continuing challenge. In dominantly inherited diseases, mutations occur in only one allele and are often masked by the normal allele. Here we report the development of a sensitive and specific diagnostic strategy based on somatic cell hybridization termed MAMA (monoallelic mutation analysis). We have demonstrated the utility of this strategy in two different hereditary colorectal cancer syndromes, one caused by a defective tumour suppressor gene on chromosome 5 (familial adenomatous polyposis, FAP) and the other caused by a defective mismatch repair gene on chromosome 2 (hereditary non-polyposis colorectal cancer, HNPCC).

Concordance of somatic mutational profile in multiple primary melanomas.

PubMed

Adler, Nikki R; McLean, Catriona A; Wolfe, Rory; Kelly, John W; McArthur, Grant A; Haydon, Andrew; Tra, Thien; Cummings, Nicholas; Mar, Victoria J

2018-03-30

This study aimed to determine the frequency and concordance of BRAF and NRAS mutation in tumours arising in patients with multiple primary melanoma (MPM). Patients with MPM managed at one of three tertiary referral centres in Melbourne, Australia, from 2010 to 2015 were included. Incident and subsequent melanomas underwent mutation testing. Cohen's kappa (κ) coefficient assessed agreement between incident and subsequent primary melanomas for both BRAF and NRAS mutation status (mutant versus wild-type). Mutation testing of at least two primary tumours from 64 patients was conducted. There was poor agreement for both BRAF and NRAS mutation status between incident and subsequent melanomas (κ = 0.10, 95% CI -0.10 to 0.42; κ = 0.06, 95% CI -0.10 to 0.57, respectively). In view of the low concordance in BRAF mutation status between incident and subsequent melanomas, mutational analysis of metastatic tissue, rather than of a primary melanoma, in patients with MPM should be used to guide targeted therapy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Somatic mosaicism caused by monoallelic reversion of a mutation in T cells of a patient with ADA-SCID and the effects of enzyme replacement therapy on the revertant phenotype.

PubMed

Moncada-Vélez, M; Vélez-Ortega, A; Orrego, J; Santisteban, I; Jagadeesh, J; Olivares, M; Olaya, N; Hershfield, M; Candotti, F; Franco, J

2011-11-01

Patients with adenosine deaminase (ADA) deficiency exhibit spontaneous and partial clinical remission associated with somatic reversion of inherited mutations. We report a child with severe combined immunodeficiency (T-B- SCID) due to ADA deficiency diagnosed at the age of 1 month, whose lymphocyte counts including CD4+ and CD8+ T and NK cells began to improve after several months with normalization of ADA activity in Peripheral blood lymphocytes (PBL), as a result of somatic mosaicism caused by monoallelic reversion of the causative mutation in the ADA gene. He was not eligible for haematopoietic stem cell transplantation (HSCT) or gene therapy (GT); therefore he was placed on enzyme replacement therapy (ERT) with bovine PEG-ADA. The follow-up of metabolic and immunologic responses to ERT included gradual improvement in ADA activity in erythrocytes and transient expansion of most lymphocyte subsets, followed by gradual stabilization of CD4+ and CD8+ T (with naïve phenotype) and NK cells, and sustained expansion of TCRγδ+ T cells. This was accompanied by the disappearance of the revertant T cells as shown by DNA sequencing from PBL. Although the patient's clinical condition improved marginally, he later developed a germinal cell tumour and eventually died at the age of 67 months from sepsis. This case adds to our current knowledge of spontaneous reversion of mutations in ADA deficiency and shows that the effects of the ERT may vary among these patients, suggesting that it could depend on the cell and type in which the somatic mosaicism is established upon reversion. © 2011 The Authors. Scandinavian Journal of Immunology © 2011 Blackwell Publishing Ltd.

Resolving rates of mutation in the brain using single-neuron genomics

PubMed Central

Evrony, Gilad D; Lee, Eunjung; Park, Peter J; Walsh, Christopher A

2016-01-01

Whether somatic mutations contribute functional diversity to brain cells is a long-standing question. Single-neuron genomics enables direct measurement of somatic mutation rates in human brain and promises to answer this question. A recent study (Upton et al., 2015) reported high rates of somatic LINE-1 element (L1) retrotransposition in the hippocampus and cerebral cortex that would have major implications for normal brain function, and suggested that these events preferentially impact genes important for neuronal function. We identify aspects of the single-cell sequencing approach, bioinformatic analysis, and validation methods that led to thousands of artifacts being interpreted as somatic mutation events. Our reanalysis supports a mutation frequency of approximately 0.2 events per cell, which is about fifty-fold lower than reported, confirming that L1 elements mobilize in some human neurons but indicating that L1 mosaicism is not ubiquitous. Through consideration of the challenges identified, we provide a foundation and framework for designing single-cell genomics studies. DOI: http://dx.doi.org/10.7554/eLife.12966.001 PMID:26901440

Somatic mosaicism in a case of apparently sporadic Creutzfeldt-Jakob disease carrying a de novo D178N mutation in the PRNP gene.

PubMed

Alzualde, A; Moreno, F; Martínez-Lage, P; Ferrer, I; Gorostidi, A; Otaegui, D; Blázquez, L; Atares, B; Cardoso, S; Martínez de Pancorbo, M; Juste, R; Rodríguez-Martínez, A B; Indakoetxea, B; López de Munain, A

2010-10-05

Transmissible spongiform encephalopathies (TSEs) are a group of rare fatal neurodegenerative disorders. Creutzfeldt-Jakob disease (CJD) represents the most common form of TSE and can be classified into sporadic, genetic, iatrogenic and variant forms. Genetic cases are related to prion protein gene mutations but they only account for 10-20% of cases. Here we report an apparently sporadic CJD case with negative family history carrying a mutation at codon 178 of prion protein gene. This mutation is a de novo mutation as the parents of the case do not show it. Furthermore the presence of three different alleles (wild type 129M-178D and 129V-178D and mutated 129V-178N), confirmed by different methods, indicates that this de novo mutation is a post-zygotic mutation that produces somatic mosaicism. The proportion of mutated cells in peripheral blood cells and in brain tissue was similar and was estimated at approximately 97%, suggesting that the mutation occurred at an early stage of embryogenesis. Neuropathological examination disclosed spongiform change mainly involving the caudate and putamen, and the cerebral cortex, together with proteinase K-resistant PrP globular deposits in the cerebrum and cerebellum. PrP typing was characterized by a lower band of 21 kDa. This is the first case of mosaicism described in prion diseases and illustrates a potential etiology for apparently sporadic neurodegenerative diseases. In light of this case, genetic counseling for inherited and sporadic forms of transmissible encephalopathies should take into account this possibility for genetic screening procedures.

Phylogenetic analysis of metastatic progression in breast cancer using somatic mutations and copy number aberrations

PubMed Central

Brown, David; Smeets, Dominiek; Székely, Borbála; Larsimont, Denis; Szász, A. Marcell; Adnet, Pierre-Yves; Rothé, Françoise; Rouas, Ghizlane; Nagy, Zsófia I.; Faragó, Zsófia; Tőkés, Anna-Mária; Dank, Magdolna; Szentmártoni, Gyöngyvér; Udvarhelyi, Nóra; Zoppoli, Gabriele; Pusztai, Lajos; Piccart, Martine; Kulka, Janina; Lambrechts, Diether; Sotiriou, Christos; Desmedt, Christine

2017-01-01

Several studies using genome-wide molecular techniques have reported various degrees of genetic heterogeneity between primary tumours and their distant metastases. However, it has been difficult to discern patterns of dissemination owing to the limited number of patients and available metastases. Here, we use phylogenetic techniques on data generated using whole-exome sequencing and copy number profiling of primary and multiple-matched metastatic tumours from ten autopsied patients to infer the evolutionary history of breast cancer progression. We observed two modes of disease progression. In some patients, all distant metastases cluster on a branch separate from their primary lesion. Clonal frequency analyses of somatic mutations show that the metastases have a monoclonal origin and descend from a common ‘metastatic precursor’. Alternatively, multiple metastatic lesions are seeded from different clones present within the primary tumour. We further show that a metastasis can be horizontally cross-seeded. These findings provide insights into breast cancer dissemination. PMID:28429735

Germline activating MTOR mutation arising through gonadal mosaicism in two brothers with megalencephaly and neurodevelopmental abnormalities.

PubMed

Mroske, Cameron; Rasmussen, Kristen; Shinde, Deepali N; Huether, Robert; Powis, Zoe; Lu, Hsiao-Mei; Baxter, Ruth M; McPherson, Elizabeth; Tang, Sha

2015-11-05

In humans, Mammalian Target of Rapamycin (MTOR) encodes a 300 kDa serine/ threonine protein kinase that is ubiquitously expressed, particularly at high levels in brain. MTOR functions as an integrator of multiple cellular processes, and in so doing either directly or indirectly regulates the phosphorylation of at least 800 proteins. While somatic MTOR mutations have been recognized in tumors for many years, and more recently in hemimegalencephaly, germline MTOR mutations have rarely been described. We report the successful application of family-trio Diagnostic Exome Sequencing (DES) to identify the underlying molecular etiology in two brothers with multiple neurological and developmental lesions, and for whom previous testing was non-diagnostic. The affected brothers, who were 6 and 23 years of age at the time of DES, presented symptoms including but not limited to mild Autism Spectrum Disorder (ASD), megalencephaly, gross motor skill delay, cryptorchidism and bilateral iris coloboma. Importantly, we determined that each affected brother harbored the MTOR missense alteration p.E1799K (c.5395G>A). This exact variant has been previously identified in multiple independent human somatic cancer samples and has been shown to result in increased MTOR activation. Further, recent independent reports describe two unrelated families in whom p.E1799K co-segregated with megalencephaly and intellectual disability (ID); in both cases, p.E1799K was shown to have originated due to germline mosaicism. In the case of the family reported herein, the absence of p.E1799K in genomic DNA extracted from the blood of either parent suggests that this alteration most likely arose due to gonadal mosaicism. Further, the p.E1799K variant exerts its effect by a gain-of-function (GOF), autosomal dominant mechanism. Herein, we describe the use of DES to uncover an activating MTOR missense alteration of gonadal mosaic origin that is likely to be the causative mutation in two brothers who present

Evidence that human immunoglobulin M rheumatoid factors can Be derived from the natural autoantibody pool and undergo an antigen driven immune response in which somatically mutated rheumatoid factors have lower affinities for immunoglobulin G Fc than their germline counterparts.

PubMed

Carayannopoulos, M O; Potter, K N; Li, Y; Natvig, J B; Capra, J D

2000-04-01

The question of whether immunoglobulin (Ig)M rheumatoid factors (RF) arise as the result of an abnormal expansion of already existing clones producing natural autoantibodies or emerge as new clones that are somatically mutated owing to an antigen driven immune response has never been conclusively answered. In this study, an inhibition ELISA was utilized to measure the affinities of recombinant antibodies using VH segments reverted back to their closest germline counterparts (germline revertants). In all cases, the somatically mutated parental RFs had a decreased affinity for immunoglobulin (Ig)G Fc compared to the germline revertant, indicating that the antibodies in the germline configuration had the higher affinities. This demonstrates that somatic mutation is not a prerequisite to generate disease associated antibodies. The presence of mutations in the parental IgM RFS suggests that these cells had been involved in a germinal centre reaction. As the germinal centre is the conventional site of the acquisition of mutations during an antigen driven response, these data suggest a role for germinal centres in the generation of the antibody diversity in addition to the selection of higher affinity antibodies. Assuming that only antigen selected cells survive deletion, these data support the hypothesis that IgM RFS can be derived from the natural autoantibody repertoire and result from an antigen driven response. Mechanisms controlling the survival of B cells based on the affinity/avidity of the immunoglobulin receptor are shown to be functional in patients with rheumatoid arthritis.

Parkin Somatic Mutations Link Melanoma and Parkinson's Disease.

PubMed

Levin, Lotan; Srour, Shani; Gartner, Jared; Kapitansky, Oxana; Qutob, Nouar; Dror, Shani; Golan, Tamar; Dayan, Roy; Brener, Ronen; Ziv, Tamar; Khaled, Mehdi; Schueler-Furman, Ora; Samuels, Yardena; Levy, Carmit

2016-06-20

Epidemiological studies suggest a direct link between melanoma and Parkinson's disease (PD); however, the underlying molecular basis is unknown. Since mutations in Parkin are the major driver of early-onset PD and Parkin was recently reported to play a role in cancer development, we hypothesized that Parkin links melanoma and PD. By analyzing whole exome/genome sequencing of Parkin from 246 melanoma patients, we identified five non-synonymous mutations, three synonymous mutations, and one splice region variant in Parkin in 3.6% of the samples. In vitro analysis showed that wild-type Parkin plays a tumor suppressive role in melanoma development resulting in cell-cycle arrest, reduction of metabolic activity, and apoptosis. Using a mass spectrometry-based analysis, we identified potential Parkin substrates in melanoma and generated a functional protein association network. The activity of mutated Parkin was assessed by protein structure modeling and examination of Parkin E3 ligase activity. The Parkin-E28K mutation impairs Parkin ubiquitination activity and abolishes its tumor suppressive effect. Taken together, our analysis of genomic sequence and in vitro data indicate that Parkin is a potential link between melanoma and Parkinson's disease. Our findings suggest new approaches for early diagnosis and treatment against both diseases. Copyright © 2016. Published by Elsevier Ltd.

Chromosome microduplication in somatic cells decreases the genetic stability of human reprogrammed somatic cells and results in pluripotent stem cells.

PubMed

Yu, Yang; Chang, Liang; Zhao, Hongcui; Li, Rong; Fan, Yong; Qiao, Jie

2015-05-12

Human pluripotent stem cells, including cloned embryonic and induced pluripotent stem cells, offer a limitless cellular source for regenerative medicine. However, their derivation efficiency is limited, and a large proportion of cells are arrested during reprogramming. In the current study, we explored chromosome microdeletion/duplication in arrested and established reprogrammed cells. Our results show that aneuploidy induced by somatic cell nuclear transfer technology is a key factor in the developmental failure of cloned human embryos and primary colonies from implanted cloned blastocysts and that expression patterns of apoptosis-related genes are dynamically altered. Overall, ~20%-53% of arrested primary colonies in induced plurpotent stem cells displayed aneuploidy, and upregulation of P53 and Bax occurred in all arrested primary colonies. Interestingly, when somatic cells with pre-existing chromosomal mutations were used as donor cells, no cloned blastocysts were obtained, and additional chromosomal mutations were detected in the resulting iPS cells following long-term culture, which was not observed in the two iPS cell lines with normal karyotypes. In conclusion, aneuploidy induced by the reprogramming process restricts the derivation of pluripotent stem cells, and, more importantly, pre-existing chromosomal mutations enhance the risk of genome instability, which limits the clinical utility of these cells.

The topography of mutational processes in breast cancer genomes

DOE PAGES

Morganella, Sandro; Alexandrov, Ludmil B.; Glodzik, Dominik; ...

2016-01-01

Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription,more » DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Lastly, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.« less

The topography of mutational processes in breast cancer genomes.

PubMed

Morganella, Sandro; Alexandrov, Ludmil B; Glodzik, Dominik; Zou, Xueqing; Davies, Helen; Staaf, Johan; Sieuwerts, Anieta M; Brinkman, Arie B; Martin, Sancha; Ramakrishna, Manasa; Butler, Adam; Kim, Hyung-Yong; Borg, Åke; Sotiriou, Christos; Futreal, P Andrew; Campbell, Peter J; Span, Paul N; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E; Thompson, Alastair M; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W M; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Kong, Gu; Thomas, Gilles; Sale, Julian; Rada, Cristina; Stratton, Michael R; Birney, Ewan; Nik-Zainal, Serena

2016-05-02

Somatic mutations in human cancers show unevenness in genomic distribution that correlate with aspects of genome structure and function. These mutations are, however, generated by multiple mutational processes operating through the cellular lineage between the fertilized egg and the cancer cell, each composed of specific DNA damage and repair components and leaving its own characteristic mutational signature on the genome. Using somatic mutation catalogues from 560 breast cancer whole-genome sequences, here we show that each of 12 base substitution, 2 insertion/deletion (indel) and 6 rearrangement mutational signatures present in breast tissue, exhibit distinct relationships with genomic features relating to transcription, DNA replication and chromatin organization. This signature-based approach permits visualization of the genomic distribution of mutational processes associated with APOBEC enzymes, mismatch repair deficiency and homologous recombinational repair deficiency, as well as mutational processes of unknown aetiology. Furthermore, it highlights mechanistic insights including a putative replication-dependent mechanism of APOBEC-related mutagenesis.

Cytomorphological identification of advanced pulmonary adenocarcinoma harboring KRAS mutation in lymph node fine-needle aspiration specimens: Comparative investigation of adenocarcinoma with KRAS and EGFR mutations.

PubMed

Song, Dae Hyun; Lee, Boram; Shin, Yooju; Choi, In Ho; Ha, Sang Yun; Lee, Jae Jun; Hong, Min Eui; Choi, Yoon-La; Han, Joungho; Um, Sang-Won

2015-07-01

Kirsten rat sarcoma 2 viral oncogene homolog (KRAS) mutation in pulmonary adenocarcinoma is clinically important due to its association with resistance to EGFR inhibitors and poor prognosis. To our knowledge, there has not been a comparative study focusing on cytological nuclear features of pulmonary adenocarcinoma harboring KRAS mutation (KRAS-AD). Hence, we compared the cytomorphology of metastatic KRAS-AD and EGFR-positive adenocarcinoma (EGFR-AD) in aspiration specimens from lymph nodes. Forty lymph node aspiration specimens from forty KRAS-AD patients were collected at Samsung Medical Center (Seoul, Korea) from 2009 to 2013. As a control group, 40 EBUS-FNA lymph node specimens from 20 EGFR-AD patients were collected. EGFR-AD specimens were evaluated at Samsung Medical Center (Seoul, Korea) from 2012 to 2013. All 80 specimens were histologically confirmed to metastatic adenocarcinoma. Two pathologists performed a blinded review of all specimens. Compared with EGFR-AD, KRAS-AD exhibited more severe nuclear pleomorphism (P < 0.001), coarse chromatin (P = 0.001), cherry-red nucleoli (P < 0.001) and naked tumor cells (P = 0.002) with necrotic (P < 0.001) and neutrophilic (P = 0.008) background. Our study provides the first demonstration of cytomorphologic differentiation between metastatic KRAS-AD and metastatic EGFR-AD in lymph node aspiration specimens. © 2014 Wiley Periodicals, Inc.

Cells Comprising the Prostate Cancer Microenvironment Lack Recurrent Clonal Somatic Genomic Aberrations

PubMed Central

Bianchi-Frias, Daniella; Basom, Ryan; Delrow, Jeffrey J; Coleman, Ilsa M; Dakhova, Olga; Qu, Xiaoyu; Fang, Min; Franco, Omar E.; Ericson, Nolan G.; Bielas, Jason H.; Hayward, Simon W.; True, Lawrence; Morrissey, Colm; Brown, Lisha; Bhowmick, Neil A.; Rowley, David; Ittmann, Michael; Nelson, Peter S.

2017-01-01

Prostate cancer-associated stroma (CAS) plays an active role in malignant transformation, tumor progression, and metastasis. Molecular analyses of CAS have demonstrated significant changes in gene expression; however, conflicting evidence exists on whether genomic alterations in benign cells comprising the tumor microenvironment (TME) underlie gene expression changes and oncogenic phenotypes. This study evaluates the nuclear and mitochondrial DNA integrity of prostate carcinoma cells, CAS, matched benign epithelium and benign epithelium-associated stroma by whole genome copy number analyses, targeted sequencing of TP53, and fluorescence in situ hybridization. Comparative genomic hybridization (aCGH) of CAS revealed a copy-neutral diploid genome with only rare and small somatic copy number aberrations (SCNAs). In contrast, several expected recurrent SCNAs were evident in the adjacent prostate carcinoma cells, including gains at 3q, 7p, and 8q, and losses at 8p and 10q. No somatic TP53 mutations were observed in CAS. Mitochondrial DNA (mtDNA) extracted from carcinoma cells and stroma identified 23 somatic mtDNA mutations in neoplastic epithelial cells but only one mutation in stroma. Finally, genomic analyses identified no SCNAs, no loss of heterozygosity (LOH) or copy-neutral LOH in cultured cancer-associated fibroblasts (CAFs), which are known to promote prostate cancer progression in vivo. PMID:26753621

Recent advances in the study of somatic mosaicism and diseases other than cancer.

PubMed

Erickson, Robert P

2014-06-01

Somatic mosaicism is well appreciated as a cause of cancer and, possibly, aging. Somatic mosaicism as the cause of other diseases is becoming more appreciated. It is especially important in the causation of deforming diseases (e.g., Proteus syndrome; Sturge-Weber syndrome) which are not inherited because early developmental expression is lethal. It also known to make an important contribution to neurological, dermatological, hematological and other diseases (and probably all diseases but many in which it is harder to detect). There have been exciting recent advances in the detection of somatic mosaicism. In particular, for many diseases of somatic overgrowth in which somatic mosaicism as the sole cause was predicted, the gene somatically mutated has been found. A limited number of pathways seem involved in these disorders, some of which are also implicated in cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

Deep targeted sequencing in pediatric acute lymphoblastic leukemia unveils distinct mutational patterns between genetic subtypes and novel relapse-associated genes.

PubMed

Lindqvist, C Mårten; Lundmark, Anders; Nordlund, Jessica; Freyhult, Eva; Ekman, Diana; Carlsson Almlöf, Jonas; Raine, Amanda; Övernäs, Elin; Abrahamsson, Jonas; Frost, Britt-Marie; Grandér, Dan; Heyman, Mats; Palle, Josefine; Forestier, Erik; Lönnerholm, Gudmar; Berglund, Eva C; Syvänen, Ann-Christine

2016-09-27

To characterize the mutational patterns of acute lymphoblastic leukemia (ALL) we performed deep next generation sequencing of 872 cancer genes in 172 diagnostic and 24 relapse samples from 172 pediatric ALL patients. We found an overall greater mutational burden and more driver mutations in T-cell ALL (T-ALL) patients compared to B-cell precursor ALL (BCP-ALL) patients. In addition, the majority of the mutations in T-ALL had occurred in the original leukemic clone, while most of the mutations in BCP-ALL were subclonal. BCP-ALL patients carrying any of the recurrent translocations ETV6-RUNX1, BCR-ABL or TCF3-PBX1 harbored few mutations in driver genes compared to other BCP-ALL patients. Specifically in BCP-ALL, we identified ATRX as a novel putative driver gene and uncovered an association between somatic mutations in the Notch signaling pathway at ALL diagnosis and increased risk of relapse. Furthermore, we identified EP300, ARID1A and SH2B3 as relapse-associated genes. The genes highlighted in our study were frequently involved in epigenetic regulation, associated with germline susceptibility to ALL, and present in minor subclones at diagnosis that became dominant at relapse. We observed a high degree of clonal heterogeneity and evolution between diagnosis and relapse in both BCP-ALL and T-ALL, which could have implications for the treatment efficiency.

Reduction of spontaneous somatic mutation frequency by a low-dose X irradiation of Drosophila larvae and possible involvement of DNA single-strand damage repair.

PubMed

Koana, Takao; Takahashi, Takashi; Tsujimura, Hidenobu

2012-03-01

The third instar larvae of Drosophila were irradiated with X rays, and the somatic mutation frequency in their wings was measured after their eclosion. In the flies with normal DNA repair and apoptosis functions, 0.2 Gy irradiation at 0.05 Gy/min reduced the frequency of the so-called small spot (mutant cell clone with reduced reproductive activity) compared with that in the sham-irradiated flies. When apoptosis was suppressed using the baculovirus p35 gene, the small spot frequency increased four times in the sham-irradiated control group, but the reduction by the 0.2-Gy irradiation was still evident. In a non-homologous end joining-deficient mutant, the small spot frequency was also reduced by 0.2 Gy radiation. In a mutant deficient in single-strand break repair, no reduction in the small spot frequency by 0.2 Gy radiation was observed, and the small spot frequency increased with the radiation dose. Large spot (mutant cell clone with normal reproductive activity) frequency was not affected by suppression of apoptosis and increased monotonically with radiation dose in wild-type larvae and in mutants for single- or double-strand break repair. It is hypothesized that some of the small spots resulted from single-strand damage and, in wild-type larvae, 0.2 Gy radiation activated the normal single-strand break repair gene, which reduced the background somatic mutation frequency.

Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report.

PubMed

Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

2017-04-01

We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor ( EGFR ) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment.

Dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor T790M mutation: A case report

PubMed Central

Uemura, Takehiro; Oguri, Tetsuya; Okayama, Minami; Furuta, Hiromi; Kanemitsu, Yoshihiro; Takakuwa, Osamu; Ohkubo, Hirotsugu; Takemura, Masaya; Maeno, Ken; Ito, Yutaka; Niimi, Akio

2017-01-01

We herein report a case of dramatic intracranial response to osimertinib in a poor performance status patient with lung adenocarcinoma harboring the epidermal growth factor receptor (EGFR) T790M mutation encoded in exon 20. The patient was a 59-year-old woman with EGFR exon 19 deletion-positive lung adenocarcinoma, who relapsed with multiple brain metastases. Computed tomography-guided biopsy of the left pleural tumor revealed adenocarcinoma harboring an EGFR exon 19 deletion and an EGFR T790M mutation encoded in exon 20. The patient was treated with osimertinib, a third-generation EGFR tyrosine kinase inhibitor. Two days after treatment initiation, the patient displayed profound disturbance of consciousness, possibly due to carcinomatous meningitis, and treatment had to be discontinued due to difficulty in taking osimertinib. However, the patient gradually started to recover consciousness and, after 3 days, she was again able to take osimertinib. One month after the initiation of osimertinib treatment, magnetic resonance imaging revealed an apparent reduction in brain metastases. The patient is currently under continued treatment with osimertinib. At the last follow-up (February, 2017) she exhibited partial response to the treatment. PMID:28413660

Antimutagenicity of amifostine against the anticancer drug fotemustine in the Drosophila somatic mutation and recombination (SMART) test.

PubMed

Aydemir, N; Sevim, N; Celikler, S; Vatan, O; Bilaloglu, R

2009-01-01

Amifostine (WR-2721), a phosphorylated aminothiol pro-drug, is a selective cytoprotective agent in normal tissue against the toxicities associated with chemotherapy and irradiation. Fotemustine is a cancer chemotherapeutic agent that belongs to an extremely active class of alkylating compounds. Amifostine was tested for antimutagenicity against fotemustine in the somatic mutation and recombination test (SMART) in Drosophila melanogaster. Third-instar larvae that were trans-heterozygous for the two genetic markers mwh and flr were treated at different concentrations (2, 4, and 8 microg/ml for fotemustine and, 1, 2, and 4 microg/ml for amifostine) of the test compounds; for the antimutagenicity study, 8 microg/ml fotemustine plus 1 and 2 microg/ml amifostine were tested. Fotemustine showed mutagenic and recombinagenic effects in both genotypes in the wing-spot test. Amifostine significantly reduced the mutagenic and recombinagenic effects of fotemustine.

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

PubMed Central

Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

2016-01-01

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

PubMed

Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

2016-01-21

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

Age-related mutations and chronic myelomonocytic leukemia

PubMed Central

Mason, CC; Khorashad, JS; Tantravahi, SK; Kelley, TW; Zabriskie, MS; Yan, D; Pomicter, AD; Reynolds, KR; Eiring, AM; Kronenberg, Z; Sherman, RL; Tyner, JW; Dalley, BK; Dao, K-H; Yandell, M; Druker, BJ; Gotlib, J; O’Hare, T; Deininger, MW

2016-01-01

Chronic myelomonocytic leukemia (CMML) is a hematologic malignancy nearly confined to the elderly. Previous studies to determine incidence and prognostic significance of somatic mutations in CMML have relied on candidate gene sequencing, although an unbiased mutational search has not been conducted. As many of the genes commonly mutated in CMML were recently associated with age-related clonal hematopoiesis (ARCH) and aged hematopoiesis is characterized by a myelomonocytic differentiation bias, we hypothesized that CMML and aged hematopoiesis may be closely related. We initially established the somatic mutation landscape of CMML by whole exome sequencing followed by gene-targeted validation. Genes mutated in ⩾ 10% of patients were SRSF2, TET2, ASXL1, RUNX1, SETBP1, KRAS, EZH2, CBL and NRAS, as well as the novel CMML genes FAT4, ARIH1, DNAH2 and CSMD1. Most CMML patients (71%) had mutations in ⩾ 2 ARCH genes and 52% had ⩾ 7 mutations overall. Higher mutation burden was associated with shorter survival. Age-adjusted population incidence and reported ARCH mutation rates are consistent with a model in which clinical CMML ensues when a sufficient number of stochastically acquired age-related mutations has accumulated, suggesting that CMML represents the leukemic conversion of the myelomonocytic-lineage-biased aged hematopoietic system. PMID:26648538

Adjuvant Chemotherapy With FOLFOX for Primary Colorectal Cancer Is Associated With Increased Somatic Gene Mutations and Inferior Survival in Patients Undergoing Hepatectomy for Metachronous Liver Metastases

PubMed Central

Andreou, Andreas; Kopetz, Scott; Maru, Dipen M.; Chen, Su S.; Zimmitti, Giuseppe; Brouquet, Antoine; Shindoh, Junichi; Curley, Steven A.; Garrett, Christopher; Overman, Michael J.; Aloia, Thomas A.; Vauthey, Jean-Nicolas

2013-01-01

Objective We hypothesized that metachronous colorectal liver metastases (CLM) have different biology after failure of oxaliplatin (FOLFOX) compared to 5-fluorouracil (5-FU) or no chemotherapy for adjuvant treatment of colorectal cancer (CRC). Background It is unclear whether patients treated with liver resection for metachronous CLM after adjuvant FOLFOX for CRC have worse outcomes than those who received 5-FU or no chemotherapy. Methods We identified 341 patients who underwent hepatectomy for metachronous CLM (disease-free interval ≥12 months, 1993–2010). Mass-spectroscopy genotyping for somatic gene mutations in CLM was performed in a subset of 129 patients. Results Adjuvant treatment for primary CRC was FOLFOX in 77 patients, 5-FU in 169 patients, and no chemotherapy in 95 patients. Node-positive primary was comparable between FOLFOX and 5-FU but lower in the no-chemotherapy group (P < 0.0001). Median metastasis size was smaller in the FOLFOX group (2.5 cm) than in the 5-FU (3.0 cm) or no-chemotherapy (3.5 cm) groups, (P = 0.008) although prehepatectomy chemotherapy utilization, metastases number, and carcinoembryonic antigen levels were similar. Disease-free survival (DFS) and overall survival (OS) rates after hepatectomy were worse in patients treated with adjuvant FOLFOX [DFS at 3 years: 14% vs 38% (5-FU) vs 45% (no-chemo), OS at 3 years: 58% vs 70% (5-FU) vs 84% (no-chemo)]. On multivariate analysis, adjuvant FOLFOX was associated with worse DFS (P < 0.0001) and OS (P < 0.0001). Mutation analysis revealed ≥1 mutations in 57% of patients (27/47) after FOLFOX, 29% (12/41) after 5-FU, and 32% (13/41) after no chemotherapy (P = 0.011). Conclusions Adjuvant FOLFOX for primary CRC is associated with a high rate of somatic mutations in liver metastases and inferior outcomes after hepatectomy for metachronous CLM. PMID:22968062

Adjuvant chemotherapy with FOLFOX for primary colorectal cancer is associated with increased somatic gene mutations and inferior survival in patients undergoing hepatectomy for metachronous liver metastases.

PubMed

Andreou, Andreas; Kopetz, Scott; Maru, Dipen M; Chen, Su S; Zimmitti, Giuseppe; Brouquet, Antoine; Shindoh, Junichi; Curley, Steven A; Garrett, Christopher; Overman, Michael J; Aloia, Thomas A; Vauthey, Jean-Nicolas

2012-10-01

We hypothesized that metachronous colorectal liver metastases (CLM) have different biology after failure of oxaliplatin (FOLFOX) compared to 5-fluorouracil (5-FU) or no chemotherapy for adjuvant treatment of colorectal cancer (CRC). It is unclear whether patients treated with liver resection for metachronous CLM after adjuvant FOLFOX for CRC have worse outcomes than those who received 5-FU or no chemotherapy. We identified 341 patients who underwent hepatectomy for metachronous CLM (disease-free interval ≥12 months, 1993-2010). Mass-spectroscopy genotyping for somatic gene mutations in CLM was performed in a subset of 129 patients. Adjuvant treatment for primary CRC was FOLFOX in 77 patients, 5-FU in 169 patients, and no chemotherapy in 95 patients. Node-positive primary was comparable between FOLFOX and 5-FU but lower in the no-chemotherapy group (P < 0.0001). Median metastasis size was smaller in the FOLFOX group (2.5 cm) than in the 5-FU (3.0 cm) or no-chemotherapy (3.5 cm) groups, (P = 0.008) although prehepatectomy chemotherapy utilization, metastases number, and carcinoembryonic antigen levels were similar. Disease-free survival (DFS) and overall survival (OS) rates after hepatectomy were worse in patients treated with adjuvant FOLFOX [DFS at 3 years: 14% vs 38% (5-FU) vs 45% (no-chemo), OS at 3 years: 58% vs 70% (5-FU) vs 84% (no-chemo)]. On multivariate analysis, adjuvant FOLFOX was associated with worse DFS (P < 0.0001) and OS (P < 0.0001). Mutation analysis revealed ≥1 mutations in 57% of patients (27/47) after FOLFOX, 29% (12/41) after 5-FU, and 32% (13/41) after no chemotherapy (P = 0.011). Adjuvant FOLFOX for primary CRC is associated with a high rate of somatic mutations in liver metastases and inferior outcomes after hepatectomy for metachronous CLM.

Mechanisms of mutations in myeloproliferative neoplasms.

PubMed

Levine, Ross L

2009-12-01

In recent years, a series of studies have provided genetic insight into the pathogenesis of myeloproliferative neoplasms (MPNs). It is now known that JAK2V617F mutations are present in 90% of patients with polycythaemia vera (PV), 60% of patients with essential thrombocytosis (ET) and 50% of patients with myelofibrosis (MF). Despite the high prevalence of JAK2V617F mutations in these three myeloid malignancies, several questions remain. For example, how does one mutation contribute to the pathogenesis of three clinically distinct diseases, and how do some patients develop these diseases in the absence of a JAK2V617F mutation? Single nucleotide polymorphisms at various loci and somatic mutations, such as those in MPLW515L/K, TET2 and in exon 12 of JAK2, may also contribute to the pathogenesis of these MPNs. There are likely additional germline and somatic genetic factors important to the MPN phenotype. Additional studies of large MPN and control cohorts with new techniques will help identify these factors.

Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

PubMed

Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

2015-04-01

Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Intratumoral heterogeneity and TERT promoter mutations in progressive/higher-grade meningiomas

PubMed Central

Juratli, Tareq A.; Thiede, Christian; Koerner, Mara V.A.; Tummala, Shilpa S.; Daubner, Dirk; Shankar, Ganesh M.; Williams, Erik A.; Martinez-Lage, Maria; Soucek, Silke; Robel, Katja; Penson, Tristan; Krause, Mechthild; Appold, Steffen; Meinhardt, Matthias; Pinzer, Thomas; Miller, Julie J.; Krex, Dietmar; Ely, Heather A.; Silverman, Ian M.; Christiansen, Jason; Schackert, Gabriele; Wakimoto, Hiroaki; Kirsch, Matthias; Brastianos, Priscilla K.; Cahill, Daniel P.

2017-01-01

Background Recent studies have reported mutations in the telomerase reverse transcriptase promoter (TERTp) in meningiomas. We sought to determine the frequency, clonality and clinical significance of telomere gene alterations in a cohort of patients with progressive/higher-grade meningiomas. Methods We characterized 64 temporally- and regionally-distinct specimens from 26 WHO grade III meningioma patients. On initial diagnoses, the meningiomas spanned all WHO grades (3 grade I, 13 grade II and 10 grade III). The tumor samples were screened for TERTp and ATRX/DAXX mutations, and TERT rearrangements. Additionally, TERTp was sequenced in a separate cohort of 19 patients with radiation-associated meningiomas. We examined the impact of mutational status on patients’ progression and overall survival. Results Somatic TERTp mutations were detected in six patients (6/26 = 23%). Regional intratumoral heterogeneity in TERTp mutation status was noted. In 4 patients, TERTp mutations were detected in recurrent specimens but not in the available specimens of the first surgery. Additionally, a TERT gene fusion (LPCAT1-TERT) was found in one sample. In contrary, none of the investigated samples harbored an ATRX or DAXX mutation. In the cohort of radiation-induced meningiomas, TERTp mutation was detected in two patients (10.5%). Importantly, we found that patients with emergence of TERTp mutations had a substantially shorter OS than their TERTp wild-type counterparts (2.7 years, 95% CI 0.9 – 4.5 years versus 10.8 years, 95% CI 7.8 -12.8 years, p=0.003). Conclusions In progressive/higher-grade meningiomas,TERTp mutations are associated with poor survival, supporting a model in which selection of this alteration is a harbinger of aggressive tumor development. In addition, we observe spatial intratumoral heterogeneity of TERTp mutation status, consistent with this model of late emergence in tumor evolution. Thus, early detection of TERTp mutations may define patients with more

Prevalence of NRAS, PTEN and AKT1 gene mutations in the central nervous system metastases of non-small cell lung cancer.

PubMed

Nicoś, Marcin; Krawczyk, Paweł; Jarosz, Bożena; Sawicki, Marek; Trojanowski, Tomasz; Milanowski, Janusz

2017-01-01

Somatic mutations in NRAS, PTEN and AKT1 genes are rarely (~1%) reported in primary NSCLC, but their role in carcinogenesis have been proven. Therefore, we assessed the frequency of them in 145 FFPE tissue samples from CNS metastases of NSCLC using the real-time PCR technique. We identified four (two NRAS and single AKT1 and PTEN) mutations in CNS metastases of NSCLC. All mutations were observed in current male smokers (4% out of the male group; 4/100 and 4.25% out of smokers; 4/94). Three mutations have been detected in patients with SqCC (10.3% out of SqCC patients; 3/29), and only one mutation in the NRAS gene-in a patient with adenocarcinoma (1.25% out of AC patients; 1/80). The examined genes were mutually exclusive in terms of molecular background in KRAS; EGFR; DDR2; PIK3CA; HER2 and MEK1 genes that were evaluated in our previous studies. The OS of the patients who harbored NRAS, AKT1 and PTEN mutations was 10.1, 12.1, 7.3 and 4 months, respectively (vs 13.5 months of the studied group). Our results suggest that the presence of NRAS, PTEN and AKT1 gene mutations may have an influence on the occurrence of CNS metastases in patients with SqCC.

Non-hyperfunctioning nodules from multinodular goiters: a minor role in pathogenesis for somatic activating mutations in the TSH-receptor and Gsalpha subunit genes.

PubMed

Derrien, C; Sonnet, E; Gicquel, I; Le Gall, J Y; Poirier, J Y; David, V; Maugendre, D

2001-05-01

Constitutive activation of the cAMP pathway stimulates thyrocyte proliferation. Gain-of-function mutations in Gsalpha protein have already been identified in thyroid nodules which have lost the ability to trap iodine. In contrast, most of the studies failed to detect somatic activating mutations in the thyrotropin receptor (TSH-R) in non-hyperfunctioning thyroid tumors. The aim of this study was to screen for mutations TSH-R exon 10, encoding the whole intracytoplasmic area involved in signal transduction, and Gsalpha exons 8 and 9, containing the two hot-spot codons 201 and 227, in a subset of non-hyperfunctioning nodules from multinodular goiter. Identified by matching ultrasonography and scintiscan, 22 eufunctioning (normal 99Tc uptake) and 15 nonfunctioning (decreased 99Tc uptake) nodules from 27 non-toxic multinodular goiters were isolated. After DNA extraction, TSH-R exon 10 was analyzed by direct sequencing of the PCR products and Gsalpha exons 8 and 9 by Denaturing Gradient Gel Electrophoresis. No mutation of TSH-R or Gsalpha was detected in the 37 nodules analyzed. This absence of mutation, despite the use of two sensitive screening methods associated with the analysis of the TSH-R whole intracytoplasmic area and Gsalpha two hot-spot codons, suggests that TSH-R and Gsalpha play a minor role in the pathogenesis of non-toxic nodules from multinodular goiters.

Recurrent ETNK1 mutations in atypical chronic myeloid leukemia.

PubMed

Gambacorti-Passerini, Carlo B; Donadoni, Carla; Parmiani, Andrea; Pirola, Alessandra; Redaelli, Sara; Signore, Giovanni; Piazza, Vincenzo; Malcovati, Luca; Fontana, Diletta; Spinelli, Roberta; Magistroni, Vera; Gaipa, Giuseppe; Peronaci, Marco; Morotti, Alessandro; Panuzzo, Cristina; Saglio, Giuseppe; Usala, Emilio; Kim, Dong-Wook; Rea, Delphine; Zervakis, Konstantinos; Viniou, Nora; Symeonidis, Argiris; Becker, Heiko; Boultwood, Jacqueline; Campiotti, Leonardo; Carrabba, Matteo; Elli, Elena; Bignell, Graham R; Papaemmanuil, Elli; Campbell, Peter J; Cazzola, Mario; Piazza, Rocco

2015-01-15

Despite the recent identification of recurrent SETBP1 mutations in atypical chronic myeloid leukemia (aCML), a complete description of the somatic lesions responsible for the onset of this disorder is still lacking. To find additional somatic abnormalities in aCML, we performed whole-exome sequencing on 15 aCML cases. In 2 cases (13.3%), we identified somatic missense mutations in the ETNK1 gene. Targeted resequencing on 515 hematological clonal disorders revealed the presence of ETNK1 variants in 6 (8.8%) of 68 aCML and 2 (2.6%) of 77 chronic myelomonocytic leukemia samples. These mutations clustered in a small region of the kinase domain, encoding for H243Y and N244S (1/8 H243Y; 7/8 N244S). They were all heterozygous and present in the dominant clone. The intracellular phosphoethanolamine/phosphocholine ratio was, on average, 5.2-fold lower in ETNK1-mutated samples (P < .05). Similar results were obtained using myeloid TF1 cells transduced with ETNK1 wild type, ETNK1-N244S, and ETNK1-H243Y, where the intracellular phosphoethanolamine/phosphocholine ratio was significantly lower in ETNK1-N244S (0.76 ± 0.07) and ETNK1-H243Y (0.37 ± 0.02) than in ETNK1-WT (1.37 ± 0.32; P = .01 and P = .0008, respectively), suggesting that ETNK1 mutations may inhibit the catalytic activity of the enzyme. In summary, our study shows for the first time the evidence of recurrent somatic ETNK1 mutations in the context of myeloproliferative/myelodysplastic disorders. © 2015 by The American Society of Hematology.

Phenotypic diversity in patients with lipodystrophy associated with LMNA mutations.

PubMed

Mory, Patricia B; Crispim, Felipe; Freire, Maria Beatriz S; Salles, João Eduardo N; Valério, Cynthia M; Godoy-Matos, Amelio F; Dib, Sérgio A; Moisés, Regina S

2012-09-01

Mutations in LMNA have been linked to diverse disorders called laminopathies, which display heterogeneous phenotypes and include diseases affecting muscles, axonal neurons, progeroid syndromes, and lipodystrophies. Among the lipodystrophies, LMNA mutations have been reported most frequently in patients with familial partial lipodystrophy (FPLD) of the Dunnigan variety; however, phenotypic heterogeneity in the pattern of body fat loss has been observed. In this study, we searched for LMNA mutations in patients with various forms of lipodystrophy. We studied 21 unrelated individuals with lipodystrophy. Subjects underwent a complete clinical evaluation and were classified as typical FPLD (n=12), atypical partial lipodystrophy (n=7), or generalized lipodystrophy (n=2). Molecular analysis of LMNA gene, analysis of body fat by dual-energy X-ray absorptiometry, and biochemical measurements were performed. ALL PATIENTS WITH TYPICAL FPLD WERE FOUND TO CARRY LMNA MUTATIONS: seven patients harbored the heterozygous p.R482W (c.1444C>T), two patients harbored the p.R482Q (c.1445G>A), and two individuals harbored the novel heterozygous variant p.N466D (c.1396A>G), all in exon 8. Also, a homozygous p.R584H (c.1751 G>A) mutation in exon 11 was found. Among patients with atypical partial lipodystrophy, two of them were found to have LMNA mutations: a novel heterozygous p.R582C variation (c.1744 C>T) in exon 11 and a heterozygous substitution p.R349W (c.1045C>T) in exon 6. Among patients with generalized lipodystrophy, only one harbored LMNA mutation, a heterozygous p.T10I (c.29C>T) in exon 1. We have identified LMNA mutations in phenotypically diverse lipodystrophies. Also, our study broadens the spectrum of LMNA mutations in lipodystrophy.

Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia

PubMed Central

Puente, Xose S.; Pinyol, Magda; Quesada, Víctor; Conde, Laura; Ordóñez, Gonzalo R.; Villamor, Neus; Escaramis, Georgia; Jares, Pedro; Beà, Sílvia; González-Díaz, Marcos; Bassaganyas, Laia; Baumann, Tycho; Juan, Manel; López-Guerra, Mónica; Colomer, Dolors; Tubío, José M. C.; López, Cristina; Navarro, Alba; Tornador, Cristian; Aymerich, Marta; Rozman, María; Hernández, Jesús M.; Puente, Diana A.; Freije, José M. P.; Velasco, Gloria; Gutiérrez-Fernández, Ana; Costa, Dolors; Carrió, Anna; Guijarro, Sara; Enjuanes, Anna; Hernández, Lluís; Yagüe, Jordi; Nicolás, Pilar; Romeo-Casabona, Carlos M.; Himmelbauer, Heinz; Castillo, Ester; Dohm, Juliane C.; de Sanjosé, Silvia; Piris, Miguel A.; de Alava, Enrique; Miguel, Jesús San; Royo, Romina; Gelpí, Josep L.; Torrents, David; Orozco, Modesto; Pisano, David G.; Valencia, Alfonso; Guigó, Roderic; Bayés, Mónica; Heath, Simon; Gut, Marta; Klatt, Peter; Marshall, John; Raine, Keiran; Stebbings, Lucy A.; Futreal, P. Andrew; Stratton, Michael R.; Campbell, Peter J.; Gut, Ivo; López-Guillermo, Armando; Estivill, Xavier; Montserrat, Emili; López-Otín, Carlos; Campo, Elías

2012-01-01

Chronic lymphocytic leukaemia (CLL), the most frequent leukaemia in adults in Western countries, is a heterogeneous disease with variable clinical presentation and evolution1,2. Two major molecular subtypes can be distinguished, characterized respectively by a high or low number of somatic hypermutations in the variable region of immunoglobulin genes3,4. The molecular changes leading to the pathogenesis of the disease are still poorly understood. Here we performed whole-genome sequencing of four cases of CLL and identified 46 somatic mutations that potentially affect gene function. Further analysis of these mutations in 363 patients with CLL identified four genes that are recurrently mutated: notch 1 (NOTCH1), exportin 1 (XPO1), myeloid differentiation primary response gene 88 (MYD88) and kelch-like 6 (KLHL6). Mutations in MYD88 and KLHL6 are predominant in cases of CLL with mutated immunoglobulin genes, whereas NOTCH1 and XPO1 mutations are mainly detected in patients with unmutated immunoglobulins. The patterns of somatic mutation, supported by functional and clinical analyses, strongly indicate that the recurrent NOTCH1, MYD88 and XPO1 mutations are oncogenic changes that contribute to the clinical evolution of the disease. To our knowledge, this is the first comprehensive analysis of CLL combining whole-genome sequencing with clinical characteristics and clinical outcomes. It highlights the usefulness of this approach for the identification of clinically relevant mutations in cancer. PMID:21642962

Gain-of-function somatic mutations contribute to inflammation and blood vessel damage that lead to Alzheimer dementia: a hypothesis.

PubMed

Marchesi, Vincent T

2016-02-01

Amyloid deposits are a characteristic feature of advanced Alzheimer dementia (AD), but whether they initiate the disease or are a consequence of it remains an unsettled question. To explore an alternative pathogenic mechanism, I propose that the triggering events that begin the pathogenic cascade are not amyloid deposits but damaged blood vessels caused by inflammatory reactions that lead to ischemia, amyloid accumulation, axonal degeneration, synaptic loss, and eventually irreversible neuronal cell death. Inflammation and blood vessel damage are well recognized complications of AD, but what causes them and why the cerebral microvasculature is affected have never been adequately addressed. Because heritable autosomal dominant mutations of NLRP3, APP, TREX1, NOTCH3, and Col4A1 are known to provoke inflammatory reactions and damage the brain in a wide variety of diseases, I propose that one or more low abundant, gain-of-function somatic mutations of the same 5 gene families damage the microvasculature of the brain that leads to dementia. This implies that the pathogenic triggers that lead to AD are derived not from external invaders or amyloid but from oxidative damage of our own genes. © FASEB.

Wide spetcrum mutational analysis of metastatic renal cell cancer: a retrospective next generation sequencing approach

PubMed Central

Fiorentino, Michelangelo; Gruppioni, Elisa; Massari, Francesco; Giunchi, Francesca; Altimari, Annalisa; Ciccarese, Chiara; Bimbatti, Davide; Scarpa, Aldo; Iacovelli, Roberto; Porta, Camillo; Virinder, Sarhadi; Tortora, Giampaolo; Artibani, Walter; Schiavina, Riccardo; Ardizzoni, Andrea; Brunelli, Matteo; Knuutila, Sakari; Martignoni, Guido

2017-01-01

Renal cell cancer (RCC) is characterized by histological and molecular heterogeneity that may account for variable response to targeted therapies. We evaluated retrospectively with a next generation sequencing (NGS) approach using a pre-designed cancer panel the mutation burden of 32 lesions from 22 metastatic RCC patients treated with at least one tyrosine kinase or mTOR inhibitor. We identified mutations in the VHL, PTEN, JAK3, MET, ERBB4, APC, CDKN2A, FGFR3, EGFR, RB1, TP53 genes. Somatic alterations were correlated with response to therapy. Most mutations hit VHL1 (31,8%) followed by PTEN (13,6%), JAK3, FGFR and TP53 (9% each). Eight (36%) patients were wild-type at least for the genes included in the panel. A genotype concordance between primary RCC and its secondary lesion was found in 3/6 cases. Patients were treated with Sorafenib, Sunitinib and Temsirolimus with partial responses in 4 (18,2%) and disease stabilization in 7 (31,8%). Among the 4 partial responders, 1 (25%) was wild-type and 3 (75%) harbored different VHL1 variants. Among the 7 patients with disease stabilization 2 (29%) were wild-type, 2 (29%) PTEN mutated, and single patients (14% each) displayed mutations in VHL1, JAK3 and APC/CDKN2A. Among the 11 non-responders 7 (64%) were wild-type, 2 (18%) were p53 mutated and 2 (18%) VHL1 mutated. No significant associations were found among RCC histotype, mutation variants and response to therapies. In the absence of predictive biomarkers for metastatic RCC treatment, a NGS approach may address single patients to basket clinical trials according to actionable molecular specific alterations. PMID:27741505

Consensus for EGFR mutation testing in non-small cell lung cancer: results from a European workshop.

PubMed

Pirker, Robert; Herth, Felix J F; Kerr, Keith M; Filipits, Martin; Taron, Miquel; Gandara, David; Hirsch, Fred R; Grunenwald, Dominique; Popper, Helmut; Smit, Egbert; Dietel, Manfred; Marchetti, Antonio; Manegold, Christian; Schirmacher, Peter; Thomas, Michael; Rosell, Rafael; Cappuzzo, Federico; Stahel, Rolf

2010-10-01

Activating somatic mutations of the tyrosine kinase domain of epidermal growth factor receptor (EGFR) have recently been characterized in a subset of patients with advanced non-small cell lung cancer (NSCLC). Patients harboring these mutations in their tumors show excellent response to EGFR tyrosine kinase inhibitors (EGFR-TKIs). The EGFR-TKI gefitinib has been approved in Europe for the treatment of adult patients with locally advanced or metastatic NSCLC with activating mutations of the EGFR TK. Because EGFR mutation testing is not yet well established across Europe, biomarker-directed therapy only slowly emerges for the subset of NSCLC patients most likely to benefit: those with EGFR mutations. The "EGFR testing in NSCLC: from biology to clinical practice" International Association for the Study of Lung Cancer-European Thoracic Oncology Platform multidisciplinary workshop aimed at facilitating the implementation of EGFR mutation testing. Recommendations for high-quality EGFR mutation testing were formulated based on the opinion of the workshop expert group. Co-operation and communication flow between the various disciplines was considered to be of most importance. Participants agreed that the decision to request EGFR mutation testing should be made by the treating physician, and results should be available within 7 working days. There was agreement on the importance of appropriate sampling techniques and the necessity for the standardization of tumor specimen handling including fixation. Although there was no consensus on which laboratory test should be preferred for clinical decision making, all stressed the importance of standardization and validation of these tests. The recommendations of the workshop will help implement EGFR mutation testing in Europe and, thereby, optimize the use of EGFR-TKIs in clinical practice.

Mutational signatures associated with tobacco smoking in human cancer

DOE PAGES

Alexandrov, Ludmil B.; Ju, Young Seok; Haase, Kerstin; ...

2016-11-04

Tobacco smoking increases the risk of at least 17 classes of cancer. Here, we analyzed somatic mutations and DNA methylation in 5,243 cancers of types for which tobacco smoking confers an elevated risk. Smoking is associated with increased mutation burdens of multiple distinct mutational signatures, which contribute to different extents in different cancers. One of these signatures, mainly found in cancers derived from tissues directly exposed to tobacco smoke, is attributable to misreplication of DNA damage caused by tobacco carcinogens. Others likely reflect indirect activation of DNA edi ting by APOBEC cytidine deaminases and of an endogenous clock-like mutational process.more » Smoking is associated with limited differences in methylation. The results are consistent with the proposition that smoking increases cancer risk by increasing the somatic mutation load, although direct evidence for this mechanism is lacking in some smoking-related cancer types.« less

Mutational signatures associated with tobacco smoking in human cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexandrov, Ludmil B.; Ju, Young Seok; Haase, Kerstin

Tobacco smoking increases the risk of at least 17 classes of cancer. Here, we analyzed somatic mutations and DNA methylation in 5,243 cancers of types for which tobacco smoking confers an elevated risk. Smoking is associated with increased mutation burdens of multiple distinct mutational signatures, which contribute to different extents in different cancers. One of these signatures, mainly found in cancers derived from tissues directly exposed to tobacco smoke, is attributable to misreplication of DNA damage caused by tobacco carcinogens. Others likely reflect indirect activation of DNA edi ting by APOBEC cytidine deaminases and of an endogenous clock-like mutational process.more » Smoking is associated with limited differences in methylation. The results are consistent with the proposition that smoking increases cancer risk by increasing the somatic mutation load, although direct evidence for this mechanism is lacking in some smoking-related cancer types.« less

Emergence of fatal avian influenza in New England harbor seals

USGS Publications Warehouse

Anthony, S.J.; St. Leger, J. A.; Pugliares, K.; Ip, Hon S.; Chan, J.M.; Carpenter, Z.W.; Navarrete-Macias, I.; Sanchez-Leon, M.; Saliki, J.T.; Pedersen, J.; Karesh, W.; Daszak, P.; Rabadan, R.; Rowles, T.; Lipkin, W.I.

2012-01-01

From September to December 2011, 162 New England harbor seals died in an outbreak of pneumonia. Sequence analysis of postmortem samples revealed the presence of an avian H3N8 influenza A virus, similar to a virus circulating in North American waterfowl since at least 2002 but with mutations that indicate recent adaption to mammalian hosts. These include a D701N mutation in the viral PB2 protein, previously reported in highly pathogenic H5N1 avian influenza viruses infecting people. Lectin staining and agglutination assays indicated the presence of the avian-preferred SAα-2,3 and mammalian SAα-2,6 receptors in seal respiratory tract, and the ability of the virus to agglutinate erythrocytes bearing either the SAα-2,3 or the SAα-2,6 receptor. The emergence of this A/harbor seal/Massachusetts/1/2011 virus may herald the appearance of an H3N8 influenza clade with potential for persistence and cross-species transmission.

Visualization portal for genetic variation (VizGVar): a tool for interactive visualization of SNPs and somatic mutations in exons, genes and protein domains.

PubMed

Solano-Román, Antonio; Alfaro-Arias, Verónica; Cruz-Castillo, Carlos; Orozco-Solano, Allan

2018-03-15

VizGVar was designed to meet the growing need of the research community for improved genomic and proteomic data viewers that benefit from better information visualization. We implemented a new information architecture and applied user centered design principles to provide a new improved way of visualizing genetic information and protein data related to human disease. VizGVar connects the entire database of Ensembl protein motifs, domains, genes and exons with annotated SNPs and somatic variations from PharmGKB and COSMIC. VizGVar precisely represents genetic variations and their respective location by colored curves to designate different types of variations. The structured hierarchy of biological data is reflected in aggregated patterns through different levels, integrating several layers of information at once. VizGVar provides a new interactive, web-based JavaScript visualization of somatic mutations and protein variation, enabling fast and easy discovery of clinically relevant variation patterns. VizGVar is accessible at http://vizport.io/vizgvar; http://vizport.io/vizgvar/doc/. asolano@broadinstitute.org or allan.orozcosolano@ucr.ac.cr.

PIK3CA and KRAS mutations in cell free circulating DNA are useful markers for monitoring ovarian clear cell carcinoma

PubMed Central

Morikawa, Asuka; Hayashi, Tomoatsu; Shimizu, Naomi; Kobayashi, Mana; Taniue, Kenzui; Takahashi, Akiko; Tachibana, Kota; Saito, Misato; Kawabata, Ayako; Iida, Yasushi; Ueda, Kazu; Saito, Motoaki; Yanaihara, Nozomu; Tanabe, Hiroshi; Yamada, Kyosuke; Takano, Hirokuni; Nureki, Osamu; Okamoto, Aikou; Akiyama, Tetsu

2018-01-01

Ovarian clear cell carcinoma (OCCC) exhibits distinct phenotypes, such as resistance to chemotherapy, poor prognosis and an association with endometriosis. Biomarkers and imaging techniques currently in use are not sufficient for reliable diagnosis of this tumor or prediction of therapeutic response. It has recently been reported that analysis of somatic mutations in cell-free circulating DNA (cfDNA) released from tumor tissues can be useful for tumor diagnosis. In the present study, we attempted to detect mutations in PIK3CA and KRAS in cfDNA from OCCC patients using droplet digital PCR (ddPCR). Here we show that we were able to specifically detect PIK3CA-H1047R and KRAS-G12D in cfDNA from OCCC patients and monitor their response to therapy. Furthermore, we found that by cleaving wild-type PIK3CA using the CRISPR/Cas9 system, we were able to improve the sensitivity of the ddPCR method and detect cfDNA harboring PIK3CA-H1047R. Our results suggest that detection of mutations in cfDNA by ddPCR would be useful for the diagnosis of OCCC, and for predicting its recurrence. PMID:29632642

MLH1-deficient Colorectal Carcinoma With Wild-type BRAF and MLH1 Promoter Hypermethylation Harbor KRAS Mutations and Arise From Conventional Adenomas.

PubMed

Farchoukh, Lama; Kuan, Shih-Fan; Dudley, Beth; Brand, Randall; Nikiforova, Marina; Pai, Reetesh K

2016-10-01

can harbor KRAS mutations and arise from precursor polyps resembling conventional tubular/tubulovillous adenomas.

Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

PubMed

Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

2016-10-15

Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Mutations of E3 Ubiquitin Ligase Cbl Family Members Constitute a Novel Common Pathogenic Lesion in Myeloid Malignancies

PubMed Central

Makishima, Hideki; Cazzolli, Heather; Szpurka, Hadrian; Dunbar, Andrew; Tiu, Ramon; Huh, Jungwon; Muramatsu, Hideki; O'Keefe, Christine; Hsi, Eric; Paquette, Ronald L.; Kojima, Seiji; List, Alan F.; Sekeres, Mikkael A.; McDevitt, Michael A.; Maciejewski, Jaroslaw P.

2009-01-01

Purpose Acquired somatic uniparental disomy (UPD) is commonly observed in myelodysplastic syndromes (MDS), myelodysplastic/myeloproliferative neoplasms (MDS/MPN), or secondary acute myelogenous leukemia (sAML) and may point toward genes harboring mutations. Recurrent UPD11q led to identification of homozygous mutations in c-Cbl, an E3 ubiquitin ligase involved in attenuation of proliferative signals transduced by activated receptor tyrosine kinases. We examined the role and frequency of Cbl gene family mutations in MPN and related conditions. Methods We applied high-density SNP-A karyotyping to identify loss of heterozygosity of 11q in 442 patients with MDS, MDS/MPN, MPN, sAML evolved from these conditions, and primary AML. We sequenced c-Cbl, Cbl-b, and Cbl-c in patients with or without corresponding UPD or deletions and correlated mutational status with clinical features and outcomes. Results We identified c-Cbl mutations in 5% and 9% of patients with chronic myelomonocytic leukemia (CMML) and sAML, and also in CML blast crisis and juvenile myelomonocytic leukemia (JMML). Most mutations were homozygous and affected c-Cbl; mutations in Cbl-b were also found in patients with similar clinical features. Patients with Cbl family mutations showed poor prognosis, with a median survival of 5 months. Pathomorphologic features included monocytosis, monocytoid blasts, aberrant expression of phosphoSTAT5, and c-kit overexpression. Serial studies showed acquisition of c-Cbl mutations during malignant evolution. Conclusion Mutations in the Cbl family RING finger domain or linker sequence constitute important pathogenic lesions associated with not only preleukemic CMML, JMML, and other MPN, but also progression to AML, suggesting that impairment of degradation of activated tyrosine kinases constitutes an important cancer mechanism. PMID:19901108

Analysis of EGFR, EML4-ALK, KRAS, and c-MET mutations in Chinese lung adenocarcinoma patients.

PubMed

Xia, Ning; An, Jian; Jiang, Qing-qing; Li, Min; Tan, Jun; Hu, Cheng-ping

2013-10-01

Mutation analysis of cancer driver genes is helpful for determining an optimal treatment strategy. We evaluated mutations in four driver genes, namely epidermal growth factor receptor (EGFR), Kirsten ras oncogene (KRAS), c-MET, and echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK), in Chinese lung adenocarcinoma patients from Hunan Province. We enrolled 110 lung adenocarcinoma patients in a single institution. EGFR and KRAS mutations were examined by direct sequencing, the EML4-ALK fusion gene was analyzed by fluorescence in situ hybridization, and c-MET amplification and c-Met protein expression were detected by quantitative PCR and immunohistochemistry, respectively. EGFR and KRAS mutations were observed in 52.7% (58/110) and 3.6% (4/106) of patients, respectively. c-MET amplification was detected in 5.5% (6/110) of patients. In addition, 30% (33/110) of the cases expressed c-Met protein, including all of the patients harboring c-MET amplification. Ten percent (11/110) of patients harbored the EML4-ALK fusion gene, and the frequency of ALK rearrangement was higher than that of other cohort analyses involving patients from other regions in China. Almost all of these gene mutations were exclusive except that in two female non-smoking patients, who harbored an EGFR mutation and EML4-ALK rearrangement simultaneously. In total, 70% of patients in the study harbored one of the four gene mutations. Most Chinese lung adenocarcinoma patients harbor driver gene mutations, among which ALK rearrangements were more common in Hunan patients than in previously reported populations. Future clinical trials should be conducted to determine the safety and efficacy of drug combination targeting different driver mutations.

MUFFINN: cancer gene discovery via network analysis of somatic mutation data.

PubMed

Cho, Ara; Shim, Jung Eun; Kim, Eiru; Supek, Fran; Lehner, Ben; Lee, Insuk

2016-06-23

A major challenge for distinguishing cancer-causing driver mutations from inconsequential passenger mutations is the long-tail of infrequently mutated genes in cancer genomes. Here, we present and evaluate a method for prioritizing cancer genes accounting not only for mutations in individual genes but also in their neighbors in functional networks, MUFFINN (MUtations For Functional Impact on Network Neighbors). This pathway-centric method shows high sensitivity compared with gene-centric analyses of mutation data. Notably, only a marginal decrease in performance is observed when using 10 % of TCGA patient samples, suggesting the method may potentiate cancer genome projects with small patient populations.

Origin of Somatic Mutations in β-Catenin versus Adenomatous Polyposis Coli in Colon Cancer: Random Mutagenesis in Animal Models versus Nonrandom Mutagenesis in Humans.

PubMed

Yang, Da; Zhang, Min; Gold, Barry

2017-07-17

Wnt signaling is compromised early in the development of human colorectal cancer (CRC) due to truncating nonsense mutations in adenomatous polyposis coli (APC). CRC induced by chemical carcinogens, such as heterocyclic aromatic amines and azoxymethane, in mice also involves dysregulation of Wnt signaling but via activating missense mutations in the β-catenin oncogene despite the fact that genetically modified mice harboring an inactive APC allele efficiently develop CRC. In contrast, activating mutations in β-catenin are rarely observed in human CRC. Dysregulation of the Wnt signaling pathway by the two distinct mechanisms reveals insights into the etiology of human CRC. On the basis of calculations related to DNA adduct levels produced in mouse CRC models using mutagens, and the number of stem cells in the mouse colon, we show that two nonsense mutations required for biallelic disruption of APC are statistically unlikely to produce CRC in experiments using small numbers of mice. We calculate that an activating mutation in one allele near the critical GSK3β phosphorylation site on β-catenin is >10 5 -times more likely to produce CRC by random mutagenesis due to chemicals than inactivating two alleles in APC, yet it does not occur in humans. Therefore, the mutagenesis mechanism in human CRC cannot be random. We explain that nonsense APC mutations predominate in human CRC because of deamination at 5-methylcytosine at CGA and CAG codons, coupled with the number of human colonic stem cells and lifespan. Our analyses, including a comparison of mutation type and age at CRC diagnosis in U.S. and Chinese patients, also indicate that APC mutations in CRC are not due to environmental mutagens that randomly damage DNA.

A systems approach defining constraints of the genome architecture on lineage selection and evolvability during somatic cancer evolution

PubMed Central

Rübben, Albert; Nordhoff, Ole

2013-01-01

Summary Most clinically distinguishable malignant tumors are characterized by specific mutations, specific patterns of chromosomal rearrangements and a predominant mechanism of genetic instability but it remains unsolved whether modifications of cancer genomes can be explained solely by mutations and selection through the cancer microenvironment. It has been suggested that internal dynamics of genomic modifications as opposed to the external evolutionary forces have a significant and complex impact on Darwinian species evolution. A similar situation can be expected for somatic cancer evolution as molecular key mechanisms encountered in species evolution also constitute prevalent mutation mechanisms in human cancers. This assumption is developed into a systems approach of carcinogenesis which focuses on possible inner constraints of the genome architecture on lineage selection during somatic cancer evolution. The proposed systems approach can be considered an analogy to the concept of evolvability in species evolution. The principal hypothesis is that permissive or restrictive effects of the genome architecture on lineage selection during somatic cancer evolution exist and have a measurable impact. The systems approach postulates three classes of lineage selection effects of the genome architecture on somatic cancer evolution: i) effects mediated by changes of fitness of cells of cancer lineage, ii) effects mediated by changes of mutation probabilities and iii) effects mediated by changes of gene designation and physical and functional genome redundancy. Physical genome redundancy is the copy number of identical genetic sequences. Functional genome redundancy of a gene or a regulatory element is defined as the number of different genetic elements, regardless of copy number, coding for the same specific biological function within a cancer cell. Complex interactions of the genome architecture on lineage selection may be expected when modifications of the genome

Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells.

PubMed

Ju, Young Seok; Tubio, Jose M C; Mifsud, William; Fu, Beiyuan; Davies, Helen R; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J; Tan, Benita K T; Aparicio, Samuel; Span, Paul N; Martens, John W M; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Myklebost, Ola; Flanagan, Adrienne M; Foster, Christopher; Neal, David E; Cooper, Colin; Eeles, Rosalind; Bova, Steven G; Lakhani, Sunil R; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L; Purdie, Colin A; Thompson, Alastair M; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J; Stratton, Michael R

2015-06-01

Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. © 2015 Ju et al.; Published by Cold Spring Harbor Laboratory Press.

Somatic Mutations and Ancestry Markers in Hispanic Lung Cancer Patients.

PubMed

Gimbrone, Nicholas T; Sarcar, Bhaswati; Gordian, Edna R; Rivera, Jason I; Lopez, Christian; Yoder, Sean J; Teer, Jamie K; Welsh, Eric A; Chiappori, Alberto A; Schabath, Matthew B; Reuther, Gary W; Dutil, Julie; Garcia, Miosotis; Ventosilla-Villanueva, Ronald; Vera-Valdivia, Luis; Yabar-Berrocal, Alejandro; Motta-Guerrero, Rodrigo; Santiago-Cardona, Pedro G; Muñoz-Antonia, Teresita; Cress, W Douglas

2017-12-01

To address the lack of genomic data from Hispanic/Latino (H/L) patients with lung cancer, the Latino Lung Cancer Registry was established to collect patient data and biospecimens from H/L patients. This retrospective observational study examined lung cancer tumor samples from 163 H/L patients, and tumor-derived DNA was subjected to targeted-exome sequencing (>1000 genes, including EGFR, KRAS, serine/threonine kinase 11 gene [STK11], and tumor protein p53 gene [TP53]) and ancestry analysis. Mutation frequencies in this H/L cohort were compared with those in a similar cohort of non-Hispanic white (NHW) patients and correlated with ancestry, sex, smoking status, and tumor histologic type. Of the adenocarcinomas in the H/L cohort (n = 120), 31% had EGFR mutations, versus 17% in the NHW control group (p < 0.001). KRAS (20% versus 38% [p = 0.002]) and STK11 (8% versus 16% [p = 0.065]) mutations occurred at lower frequency, and mutations in TP53 occurred at similar frequency (46% versus 40% [p = 0.355]) in H/L and NHW patients, respectively. Within the Hispanic cohort, ancestry influenced the rate of TP53 mutations (p = 0.009) and may have influenced the rate of EGFR, KRAS, and STK11 mutations. Driver mutations in H/L patients with lung adenocarcinoma differ in frequency from those in NHW patients associated with their indigenous American ancestry. The spectrum of driver mutations needs to be further assessed in the H/L population. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

PubMed

Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

2018-01-31

The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

Spectrum of oncogenic driver mutations in lung adenocarcinomas from East Asian never smokers.

PubMed

Li, Chenguang; Fang, Rong; Sun, Yihua; Han, Xiangkun; Li, Fei; Gao, Bin; Iafrate, A John; Liu, Xin-Yuan; Pao, William; Chen, Haiquan; Ji, Hongbin

2011-01-01

We previously showed that 90% (47 of 52; 95% CI, 0.79 to 0.96) of lung adenocarcinomas from East Asian never-smokers harbored well-known oncogenic mutations in just four genes: EGFR, HER2, ALK, and KRAS. Here, we sought to extend these findings to more samples and identify driver alterations in tumors negative for these mutations. We have collected and analyzed 202 resected lung adenocarcinomas from never smokers seen at Fudan University Shanghai Cancer Center. Since mutations were mutually exclusive in the first 52 examined, we determined the status of EGFR, KRAS, HER2, ALK, and BRAF in stepwise fashion as previously described. Samples negative for mutations in these 5 genes were subsequently examined for known ROS1 fusions by RT-PCR and direct sequencing. 152 tumors (75.3%) harbored EGFR mutations, 12 (6%) had HER2 mutations, 10 (5%) had ALK fusions all involving EML4 as the 5' partner, 4 (2%) had KRAS mutations, and 2 (1%) harbored ROS1 fusions. No BRAF mutation were detected. The vast majority (176 of 202; 87.1%, 95% CI: 0.82 to 0.91) of lung adenocarcinomas from never smokers harbor mutant kinases sensitive to available TKIs. Interestingly, patients with EGFR mutant patients tend to be older than those without EGFR mutations (58.3 Vs 54.3, P = 0.016) and patient without any known oncogenic driver tend to be diagnosed at a younger age (52.3 Vs 57.9, P = 0.013). Collectively, these data indicate that the majority of never smokers with lung adenocarcinoma could benefit from treatment with a specific tyrosine kinase inhibitor.

Spectrum of Oncogenic Driver Mutations in Lung Adenocarcinomas from East Asian Never Smokers

PubMed Central

Han, Xiangkun; Li, Fei; Gao, Bin; Iafrate, A. John; Liu, Xin-Yuan; Pao, William; Chen, Haiquan; Ji, Hongbin

2011-01-01

Purpose We previously showed that 90% (47 of 52; 95% CI, 0.79 to 0.96) of lung adenocarcinomas from East Asian never-smokers harbored well-known oncogenic mutations in just four genes: EGFR, HER2, ALK, and KRAS. Here, we sought to extend these findings to more samples and identify driver alterations in tumors negative for these mutations. Experimental Design We have collected and analyzed 202 resected lung adenocarcinomas from never smokers seen at Fudan University Shanghai Cancer Center. Since mutations were mutually exclusive in the first 52 examined, we determined the status of EGFR, KRAS, HER2, ALK, and BRAF in stepwise fashion as previously described. Samples negative for mutations in these 5 genes were subsequently examined for known ROS1 fusions by RT-PCR and direct sequencing. Results 152 tumors (75.3%) harbored EGFR mutations, 12 (6%) had HER2 mutations, 10 (5%) had ALK fusions all involving EML4 as the 5′ partner, 4 (2%) had KRAS mutations, and 2 (1%) harbored ROS1 fusions. No BRAF mutation were detected. Conclusion The vast majority (176 of 202; 87.1%, 95% CI: 0.82 to 0.91) of lung adenocarcinomas from never smokers harbor mutant kinases sensitive to available TKIs. Interestingly, patients with EGFR mutant patients tend to be older than those without EGFR mutations (58.3 Vs 54.3, P = 0.016) and patient without any known oncogenic driver tend to be diagnosed at a younger age (52.3 Vs 57.9, P = 0.013). Collectively, these data indicate that the majority of never smokers with lung adenocarcinoma could benefit from treatment with a specific tyrosine kinase inhibitor. PMID:22140546

Acute myeloid leukemia-associated DNMT3A p.Arg882His mutation in a patient with Tatton-Brown-Rahman overgrowth syndrome as a constitutional mutation.

PubMed

Kosaki, Rika; Terashima, Hiroshi; Kubota, Masaya; Kosaki, Kenjiro

2017-01-01

DNA methylation plays a critical role in both embryonic development and tumorigenesis and is mediated through various DNA methyltransferases. Constitutional mutations in the de novo DNA methyltransferase DNMT3A cause a recently identified Tatton-Brown-Rahman overgrowth syndrome (TBRS). Somatically acquired mutations in DNMT3A are causally associated with acute myeloid leukemia (AML), and p.Arg882His represents the most prevalent hotspot. So far, no patients with TBRS have been reported to have subsequently developed AML. Here, we report a live birth and the survival of a female with the TBRS phenotype who had a heterozygous constitutional DNMT3A mutation at the AML somatic mutation hotspot p.Arg882His in her DNA from peripheral blood and buccal tissue. Her characteristic features at birth included hypotonia, narrow palpebral fissures, ventricular septal defect, umbilical hernia, sacral cyst, Chiari type I anomaly. At the age of 6 years, she exhibited overgrowth (> 3 SD) and round face and intellectual disability. This report represents the first documentation of the same variant (DNMT3A p.Arg882His) as both the constitutional mutation associated with TBRS and the somatic mutation hotspot of AML. The observation neither confirms nor denies the notion that mutations responsible for TBRS and those for AML might share the same mode of action. Larger data sets are required to determine whether TBRS patients with constitutional DNMT3A mutations are at an increased risk for AML. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Unique mutational profile associated with a loss of TDG expression in the rectal cancer of a patient with a constitutional PMS2 deficiency.

PubMed

Vasovcak, P; Krepelova, A; Menigatti, M; Puchmajerova, A; Skapa, P; Augustinakova, A; Amann, G; Wernstedt, A; Jiricny, J; Marra, G; Wimmer, K

2012-07-01

Cells with DNA repair defects have increased genomic instability and are more likely to acquire secondary mutations that bring about cellular transformation. We describe the frequency and spectrum of somatic mutations involving several tumor suppressor genes in the rectal carcinoma of a 13-year-old girl harboring biallelic, germline mutations in the DNA mismatch repair gene PMS2. Apart from microsatellite instability, the tumor DNA contained a number of C:G→T:A or G:C→A:T transitions in CpG dinucleotides, which often result through spontaneous deamination of cytosine or 5-methylcytosine. Four DNA glycosylases, UNG2, SMUG1, MBD4 and TDG, are involved in the repair of these deamination events. We identified a heterozygous missense mutation in TDG, which was associated with TDG protein loss in the tumor. The CpGs mutated in this patient's tumor are generally methylated in normal colonic mucosa. Thus, it is highly likely that loss of TDG contributed to the supermutator phenotype and that most of the point mutations were caused by deamination of 5-methylcytosine to thymine, which remained uncorrected owing to the TDG deficiency. This case provides the first in vivo evidence of the key role of TDG in protecting the human genome against the deleterious effects of 5-methylcytosine deamination. Copyright © 2012 Elsevier B.V. All rights reserved.

Unique mutational profile associated with a loss of TDG expression in the rectal cancer of a patient with a constitutional PMS2 deficiency

PubMed Central

Vasovcak, P.; Krepelova, A.; Menigatti, M.; Puchmajerova, A.; Skapa, P.; Augustinakova, A.; Amann, G.; Wernstedt, A.; Jiricny, J.; Marra, G.; Wimmer, K.

2012-01-01

Cells with DNA repair defects have increased genomic instability and are more likely to acquire secondary mutations that bring about cellular transformation. We describe the frequency and spectrum of somatic mutations involving several tumor suppressor genes in the rectal carcinoma of a 13-year-old girl harboring biallelic, germline mutations in the DNA mismatch repair gene PMS2. Apart from microsatellite instability, the tumor DNA contained a number of C:G → T:A or G:C → A:T transitions in CpG dinucleotides, which often result through spontaneous deamination of cytosine or 5-methylcytosine. Four DNA glycosylases, UNG2, SMUG1, MBD4 and TDG, are involved in the repair of these deamination events. We identified a heterozygous missense mutation in TDG, which was associated with TDG protein loss in the tumor. The CpGs mutated in this patient's tumor are generally methylated in normal colonic mucosa. Thus, it is highly likely that loss of TDG contributed to the supermutator phenotype and that most of the point mutations were caused by deamination of 5-methylcytosine to thymine, which remained uncorrected owing to the TDG deficiency. This case provides the first in vivo evidence of the key role of TDG in protecting the human genome against the deleterious effects of 5-methylcytosine deamination. PMID:22608206

Relevance of the immunoglobulin VH somatic mutation status in patients with chronic lymphocytic leukemia treated with fludarabine, cyclophosphamide, and rituximab (FCR) or related chemoimmunotherapy regimens.

PubMed

Lin, Katherine I; Tam, Constantine S; Keating, Michael J; Wierda, William G; O'Brien, Susan; Lerner, Susan; Coombes, Kevin R; Schlette, Ellen; Ferrajoli, Alessandra; Barron, Lynn L; Kipps, Thomas J; Rassenti, Laura; Faderl, Stefan; Kantarjian, Hagop; Abruzzo, Lynne V

2009-04-02

Although immunoglobulin V(H) mutation status (IgV(H) MS) is prognostic in patients with chronic lymphocytic leukemia (CLL) who are treated with alkylating agents or single-agent fludarabine, its significance in the era of chemoimmunotherapy is not known. We determined the IgV(H) somatic mutation status (MS) in 177 patients enrolled in a phase 2 study of fludarabine, cyclophosphamide, and rituximab (FCR) and in 127 patients treated with subsequent chemoimmunotherapy protocols. IgV(H) MS did not impact significantly on the complete remission (CR) rate of patients receiving FCR or related regimens. However, CR duration was significantly shorter in patients with CLL that used unmutated IgV(H) than those whose CLL used mutated IgV(H) (TTP 47% vs 82% at 6 years, P < .001). In a multivariate model considering all baseline characteristics, IgV(H) MS emerged as the only determinant of remission duration (hazard ratio 3.8, P < .001). Our results suggest that postremission interventions should be targeted toward patients with unmutated IgV(H) status.

Pulmonary Neoplasms in Patients with Birt-Hogg-Dubé Syndrome: Histopathological Features and Genetic and Somatic Events.

PubMed

Furuya, Mitsuko; Tanaka, Reiko; Okudela, Koji; Nakamura, Satoko; Yoshioka, Hiromu; Tsuzuki, Toyonori; Shibuya, Ryo; Yatera, Kazuhiro; Shirasaki, Hiroki; Sudo, Yoshiko; Kimura, Naoko; Yamada, Kazuaki; Uematsu, Shugo; Kunimura, Toshiaki; Kato, Ikuma; Nakatani, Yukio

2016-01-01

Birt-Hogg-Dubé syndrome (BHD) is an inherited disorder caused by genetic mutations in the folliculin (FLCN) gene. Individuals with BHD have multiple pulmonary cysts and are at a high risk for developing renal cell carcinomas (RCCs). Currently, little information is available about whether pulmonary cysts are absolutely benign or if the lungs are at an increased risk for developing neoplasms. Herein, we describe 14 pulmonary neoplastic lesions in 7 patients with BHD. All patients were confirmed to have germline FLCN mutations. Neoplasm histologies included adenocarcinoma in situ (n = 2), minimally invasive adenocarcinoma (n = 1), papillary adenocarcinoma (n = 1), micropapillary adenocarcinoma (n = 1), atypical adenomatous hyperplasia (n = 8), and micronodular pneumocyte hyperplasia (MPH)-like lesion (n = 1). Five of the six adenocarcinoma/MPH-like lesions (83.3%) demonstrated a loss of heterozygosity (LOH) of FLCN. All of these lesions lacked mutant alleles and preserved wild-type alleles. Three invasive adenocarcinomas possessed additional somatic events: 2 had a somatic mutation in the epidermal growth factor receptor gene (EGFR) and another had a somatic mutation in KRAS. Immunohistochemical analysis revealed that most of the lesions were immunostained for phospho-mammalian target of rapamycin (p-mTOR) and phospho-S6. Collective data indicated that pulmonary neoplasms of peripheral adenocarcinomatous lineage in BHD patients frequently exhibit LOH of FLCN with mTOR pathway signaling. Additional driver gene mutations were detected only in invasive cases, suggesting that FLCN LOH may be an underlying abnormality that cooperates with major driver gene mutations in the progression of pulmonary adenocarcinomas in BHD patients.