Science.gov

Sample records for hcmv ie1 exon4

  1. A fusion protein of HCMV IE1 exon4 and IE2 exon5 stimulates potent cellular immunity in an MVA vaccine vector

    SciTech Connect

    Wang, Z.; Zhou, W.; Srivastava, T.; La Rosa, C.; Mandarino, A.; Forman, S.J.; Zaia, J.A.; Britt, W.J.; Diamond, D.J.

    2008-08-01

    A therapeutic CMV vaccine incorporating an antigenic repertoire capable of eliciting a cellular immune response has yet to be successfully implemented for patients who already have acquired an infection. To address this problem, we have developed a vaccine candidate derived from modified vaccinia Ankara (MVA) that expresses three immunodominant antigens (pp65, IE1, IE2) from CMV. The novelty of this vaccine is the fusion of two adjacent exons from the immediate-early region of CMV, their successful expression in MVA, and robust immunogenicity in both primary and memory response models. Evaluation of the immunogenicity of the viral vaccine in mouse models shows that it can stimulate primary immunity against all three antigens in both the CD4{sup +} and CD8{sup +} T cell subsets. Evaluation of human PBMC from healthy CMV-positive donors or patients within 6 months of receiving hematopoietic cell transplant shows robust stimulation of existing CMV-specific CD4{sup +} and CD8{sup +} T cell subsets.

  2. Modulation of Homology-Directed Repair in T98G Glioblastoma Cells Due to Interactions between Wildtype p53, Rad51 and HCMV IE1-72

    PubMed Central

    Kulkarni, Amit S.; Fortunato, Elizabeth A.

    2014-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous pathogen capable of causing life threatening consequences in neonates and immune-compromised individuals. HCMV inflicts site-specific double strand breaks (DSBs) in the cellular genome. DNA damage infliction raises the corollary question of virus modulation of DNA repair. We recently reported HDR was stimulated in wt human foreskin fibroblasts (HFFs) during fully permissive infection or expression of the HCMV protein IE1-72 (IE72). These studies have been extended into semi-permissive T98G glioblastoma cells. T98Gs encode a mutant p53, which may contribute to their high baseline rate of HDR. We fully expected HCMV infection to increase HDR in T98Gs, similar to its effects in HFFs. Surprisingly in T98Gs HCMV infection, or sole expression of IE72, decreased HDR by two-fold. Transient expression of wt p53 in T98Gs also reduced HDR by two-fold. Dual transient expression of wt p53 and IE72 restored high baseline HDR levels. GST pulldown experiments revealed that both IE72 and wt p53 bound the important HDR protein, Rad51. We conclude that the expression of certain HCMV proteins can modulate HDR in an infected cell, dependent upon p53 status. We propose a model of the protein interactions explaining this behavior. PMID:24576846

  3. Human cytomegalovirus IE1 protein alters the higher-order chromatin structure by targeting the acidic patch of the nucleosome

    PubMed Central

    Fang, Qianglin; Chen, Ping; Wang, Mingzhu; Fang, Junnan; Yang, Na; Li, Guohong; Xu, Rui-Ming

    2016-01-01

    Human cytomegalovirus (hCMV) immediate early 1 (IE1) protein associates with condensed chromatin of the host cell during mitosis. We have determined the structure of the chromatin-tethering domain (CTD) of IE1 bound to the nucleosome core particle, and discovered that the specific interaction between IE1-CTD and the H2A-H2B acidic patch impairs the compaction of higher-order chromatin structure. Our results suggest that IE1 loosens up the folding of host chromatin during hCMV infections. DOI: http://dx.doi.org/10.7554/eLife.11911.001 PMID:26812545

  4. Characterization of Recombinant Human Cytomegaloviruses Encoding IE1 Mutants L174P and 1-382 Reveals that Viral Targeting of PML Bodies Perturbs both Intrinsic and Innate Immune Responses

    PubMed Central

    Scherer, Myriam; Otto, Victoria; Stump, Joachim D.; Klingl, Stefan; Müller, Regina; Reuter, Nina; Muller, Yves A.; Sticht, Heinrich

    2015-01-01

    ABSTRACT PML is the organizer of cellular structures termed nuclear domain 10 (ND10) or PML-nuclear bodies (PML-NBs) that act as key mediators of intrinsic immunity against human cytomegalovirus (HCMV) and other viruses. The antiviral function of ND10 is antagonized by viral regulatory proteins such as the immediate early protein IE1 of HCMV. IE1 interacts with PML through its globular core domain (IE1CORE) and induces ND10 disruption in order to initiate lytic HCMV infection. Here, we investigate the consequences of a point mutation (L174P) in IE1CORE, which was shown to abrogate the interaction with PML, for lytic HCMV infection. We found that a recombinant HCMV encoding IE1-L174P displays a severe growth defect similar to that of an IE1 deletion virus. Bioinformatic modeling based on the crystal structure of IE1CORE suggested that insertion of proline into the highly alpha-helical domain severely affects its structural integrity. Consistently, L174P mutation abrogates the functionality of IE1CORE and results in degradation of the IE1 protein during infection. In addition, our data provide evidence that IE1CORE as expressed by a recombinant HCMV encoding IE1 1-382 not only is required to antagonize PML-mediated intrinsic immunity but also affects a recently described function of PML in innate immune signaling. We demonstrate a coregulatory role of PML in type I and type II interferon-induced gene expression and provide evidence that upregulation of interferon-induced genes is inhibited by IE1CORE. In conclusion, our data suggest that targeting PML by viral regulatory proteins represents a strategy to antagonize both intrinsic and innate immune mechanisms. IMPORTANCE PML nuclear bodies (PML-NBs), which represent nuclear multiprotein complexes consisting of PML and additional proteins, represent important cellular structures that mediate intrinsic resistance against many viruses, including human cytomegalovirus (HCMV). During HCMV infection, the major immediate

  5. Crystal Structure of Cytomegalovirus IE1 Protein Reveals Targeting of TRIM Family Member PML via Coiled-Coil Interactions

    PubMed Central

    Sevvana, Madhumati; Otto, Victoria; Schilling, Eva-Maria; Stump, Joachim D.; Müller, Regina; Reuter, Nina; Sticht, Heinrich; Muller, Yves A.; Stamminger, Thomas

    2014-01-01

    PML nuclear bodies (PML-NBs) are enigmatic structures of the cell nucleus that act as key mediators of intrinsic immunity against viral pathogens. PML itself is a member of the E3-ligase TRIM family of proteins that regulates a variety of innate immune signaling pathways. Consequently, viruses have evolved effector proteins to modify PML-NBs; however, little is known concerning structure-function relationships of viral antagonists. The herpesvirus human cytomegalovirus (HCMV) expresses the abundant immediate-early protein IE1 that colocalizes with PML-NBs and induces their dispersal, which correlates with the antagonization of NB-mediated intrinsic immunity. Here, we delineate the molecular basis for this antagonization by presenting the first crystal structure for the evolutionary conserved primate cytomegalovirus IE1 proteins. We show that IE1 consists of a globular core (IE1CORE) flanked by intrinsically disordered regions. The 2.3 Å crystal structure of IE1CORE displays an all α-helical, femur-shaped fold, which lacks overall fold similarity with known protein structures, but shares secondary structure features recently observed in the coiled-coil domain of TRIM proteins. Yeast two-hybrid and coimmunoprecipitation experiments demonstrate that IE1CORE binds efficiently to the TRIM family member PML, and is able to induce PML deSUMOylation. Intriguingly, this results in the release of NB-associated proteins into the nucleoplasm, but not of PML itself. Importantly, we show that PML deSUMOylation by IE1CORE is sufficient to antagonize PML-NB-instituted intrinsic immunity. Moreover, co-immunoprecipitation experiments demonstrate that IE1CORE binds via the coiled-coil domain to PML and also interacts with TRIM5α We propose that IE1CORE sequesters PML and possibly other TRIM family members via structural mimicry using an extended binding surface formed by the coiled-coil region. This mode of interaction might render the antagonizing activity less susceptible to

  6. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  7. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  8. Functional and structural characterisation of AgMNPV ie1.

    PubMed

    Bilen, Marcos Fabián; Pilloff, Marcela Gabriela; Belaich, Mariano Nicolás; Da Ros, Vanina Gabriela; Rodrigues, Julio Carlyle; Ribeiro, Bergmann Morais; Romanowski, Víctor; Lozano, Mario Enrique; Ghiringhelli, Pablo Daniel

    2007-12-01

    We have located and cloned the Anticarsia gemmatalis multicapsid nucleopolyhedrovirus isolate 2D (AgMNPV-2D) genomic DNA fragment containing the immediate early 1 ORF and its flanking regions. Computer assisted analysis of the complete ie1 locus nucleotide sequence information was used to locate regulatory signals in the upstream region and conserved nucleotide and amino acid sequences. Comparative studies led to the identification of several characteristic protein motifs and to the conclusion that AgMNPV-2D is more closely related to Choristoneura fumiferana defective NPV than to other Group I nucleopolyhedrovirus. We have also shown that the AgMNPV IE1 protein was able to transactivate an early Autographa californica MNPV promoter and its own promoter in transient expression assays. In order to investigate the biological functionality of the ie1 promoter, the ie1 upstream activating region (UAR) was molecularly dissected and cloned upstream of the E. coli lacZ ORF. The results obtained, after transfection of UFL-AG-286 insect cells, leading us to find that the -492 and -357 versions contains sequence motifs important for the level of the lacZ reporter gene expression. PMID:17682932

  9. Design of translactam HCMV protease inhibitors as potent antivirals.

    PubMed

    Borthwick, Alan D

    2005-07-01

    Human cytomegalovirus (HCMV) is an important pathogen for which there is a significant unmet medical need. New HCMV antivirals, active against novel molecular targets, are undoubtedly needed as the currently available drugs ganciclovir, cidofovir, and foscarnet, which are all viral DNA inhibitors, suffer from limited effectiveness, mainly due to the development of drug resistance, poor bioavailability, and toxicity. One of the newer molecular targets that has been exploited in the search for better drug candidates is HCMV protease. Our deltaAla HCMV protease (wild type variant with the internal cleavage site deleted) was cloned and expressed in E. coli. This viral enzyme was used to develop HCMV protease assays to evaluate potential inhibitors. The chirally pure (SRS)-alpha-methyl pyrrolidine-5,5-trans-lactam template was synthesized, which together with the natural substrate requirements of HCMV protease and detailed SAR, was used to design potent and selective mechanism based inhibitors of HCMV protease. The mechanism of action of these inhibitors of HCMV protease was investigated by ESI/MS, and the X-ray crystal structure of the HCMV protease was used to refine our selective viral enzyme inhibitors to obtain plasma stable antivirals. A novel ELISA antiviral assay was developed which, together with a cytotoxicity assay, enabled us to discover anti-HCMV drug candidates equivalent in potency to ganciclovir that had good pharmacokinetics in the dog and good brain and ocular penetration in the guinea pig.

  10. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  11. Multivariate data validation for investigating primary HCMV infection in pregnancy.

    PubMed

    Barberini, Luigi; Noto, Antonio; Saba, Luca; Palmas, Francesco; Fanos, Vassilios; Dessì, Angelica; Zavattoni, Maurizio; Fattuoni, Claudia; Mussap, Michele

    2016-12-01

    We reported data concerning the Gas Chromatography-Mass Spectrometry (GC-MS) based metabolomic analysis of amniotic fluid (AF) samples obtained from pregnant women infected with Human Cytomegalovirus (HCMV). These data support the publication "Primary HCMV Infection in Pregnancy from Classic Data towards Metabolomics: an Exploratory analysis" (C. Fattuoni, F. Palmas, A. Noto, L. Barberini, M. Mussap, et al., 2016) [2]. GC-MS and Multivariate analysis allow to recognize the molecular phenotype of HCMV infected fetuses (transmitters) and that of HCMV non-infected fetuses (non-transmitters); moreover, GC-MS and multivariate analysis allow to distinguish and to compare the molecular phenotype of these two groups with a control group consisting of AF samples obtained in HCMV non-infected pregnant women. The obtained data discriminate controls from transmitters as well as from non-transmitters; no statistically significant difference was found between transmitters and non-transmitters. PMID:27656676

  12. Use of an N-terminal half truncated IE1 as an antagonist of IE1, an essential regulatory protein in baculovirus.

    PubMed

    Yamada, Yoji; Matsuyama, Takahiro; Quan, Guo-Xing; Kanda, Toshio; Tamura, Toshiki; Sahara, Ken; Asano, Shin-ichiro; Bando, Hisanori

    2002-12-01

    An immediate-early gene product of baculovirus, IE1, is essential for viral gene expression and for viral DNA replication. It has been demonstrated for Autographa californica nuclear polyhedrosis virus (AcNPV) that the C-terminal region of IE1 is required for dimerization. And the acidic N-terminal region of IE1 has been identified as the activation domain. We constructed an N-terminal 267 amino acid (a.a.) truncated mutant of Bombyx mori nuclear polyhedrosis virus (BmNPV) IE1, which was defective as a transactivator of a viral early gene (p35) promoter. We then examined possible IE1 antagonistic functions of this defective IE1, IE1TN, in BmNPV-infected cells. A transient expression experiment demonstrated that IE1TN strongly repressed the activation of the hr5-dependent p35 promoter derived from BmNPV infection. In addition, DpnI assay elucidated an inhibitory effect of IE1TN on the hr5-dependent replication of plasmid in BmN cells induced by NPV infection. A marked reduction in the production of virus was observed when the BmN cells were infected with BmNPV after transfection with IE1TN-expression plasmids. These results suggested that IE1TN could act as an IE1 antagonist in silkworm cells infected with BmNPV. We then analyzed the ability of IE1TN to inhibit the multiplication of BmNPV using transgenic silkworms. The BmNPV-resistance of the transgenic silkworms was very weak, suggesting insufficient expression of the transgene product, IE1TN. PMID:12457979

  13. Immediate-Early (IE) gene regulation of cytomegalovirus: IE1- and pp71-mediated viral strategies against cellular defenses.

    PubMed

    Torres, Lilith; Tang, Qiyi

    2014-12-01

    Three crucial hurdles hinder studies on human cytomegalovirus (HCMV): strict species specificity, differences between in vivo and in vitro infection, and the complexity of gene regulation. Ever since the sequencing of the whole genome was first accomplished, functional studies on individual genes have been the mainstream in the CMV field. Gene regulation has therefore been elucidated in a more detailed fashion. However, viral gene regulation is largely controlled by both cellular and viral components. In other words, viral gene expression is determined by the virus-host interaction. Generally, cells respond to viral infection in a defensive pattern; at the same time, viruses try to counteract the cellular defense or else hide in the host (latency). Viruses evolve effective strategies against cellular defense in order to achieve replicative success. Whether or not they are successful, cellular defenses remain in the whole viral replication cycle: entry, immediate-early (IE) gene expression, early gene expression, DNA replication, late gene expression, and viral egress. Many viral strategies against cellular defense, and which occur in the immediate-early time of viral infection, have been documented. In this review, we will summarize the documented biological functions of IE1 and pp71 proteins, especially with regard to how they counteract cellular intrinsic defenses.

  14. Transactivation of a human cytomegalovirus early promoter by gene products from the immediate-early gene IE2 and augmentation by IE1: mutational analysis of the viral proteins.

    PubMed Central

    Malone, C L; Vesole, D H; Stinski, M F

    1990-01-01

    Expression from a human cytomegalovirus early promoter (E1.7) has been shown to be activated in trans by the IE2 gene products (C.-P. Chang, C. L. Malone, and M. F. Stinski, J. Virol. 63:281-290, 1989). Using wild-type and mutant viral proteins, we have defined the protein regions required for transactivation of the E1.7 promoter in IE2 and for augmentation of transactivation in the IE1 protein. Two regions of the IE2 proteins were found to be essential for transactivation. One near the amino terminus is within 52 amino acids encoded by exon 3. The second comprises the carboxyl-terminal 85 amino acids encoded by exon 5. The IE2 protein encoded by an mRNA which lacks the intron within exon 5 and the IE2 protein encoded by exon 5 had no activity for transactivation of the E1.7 promoter. Although the IE1 gene product alone had no effect on this early viral promoter, maximal early promoter activity was detected when both IE1 and IE2 gene products were present. The IE1 protein positively regulated its enhancer-containing promoter-regulatory region. The IE1 protein alone increased the steady-state level of IE2 mRNA; therefore, IE1 and IE2 are synergistic for expression from the E1.7 promoter. Like the IE2 proteins, the IE1 protein requires for activity 52 amino acids encoded by exon 3. IE1 also requires amino acids encoded by exon 4. Since the IE1 and IE2 proteins have 85 amino acids in common at the amino-terminal end encoded by exons 2 and 3, the difference between these specific transactivators resides in their carboxyl-terminal amino acids encoded by exons 4 and 5, respectively. Images PMID:2157038

  15. Identification of a tyrosinase (TYR) exon 4 deletion in albino ferrets (Mustela putorius furo).

    PubMed

    Blaszczyk, W M; Distler, C; Dekomien, G; Arning, L; Hoffmann, K-P; Epplen, J T

    2007-08-01

    Albinism is due to a lack of pigmentation in hair, skin and eye, and has been shown to occur in several animal species. Mutations of the tyrosinase (TYR) gene account for albinism in domestic cats, rabbits, cattle, mice and rats. In this study, we demonstrate that a TYR mutation accounts for albinism in the ferret (Mustela putorius furo). The coding sequence of the five exons of TYR was determined in genomic DNA from wild-type pigmented 'sable' coloured and albino ferrets. It was not possible to amplify TYR exon 4 in albino ferrets originating from different breeds. The deletion of exon 4 in albino ferrets was confirmed by Southern blot hybridization of genomic DNA from albino and pigmented ferrets. This is the first report of a deletion of a TYR exon in a non-human mammal. PMID:17655555

  16. Alternative splicing of Wilms tumor suppressor 1 (Wt1) exon 4 results in protein isoforms with different functions.

    PubMed

    Schnerwitzki, Danny; Perner, Birgit; Hoppe, Beate; Pietsch, Stefan; Mehringer, Rebecca; Hänel, Frank; Englert, Christoph

    2014-09-01

    The Wilms tumor suppressor gene Wt1 encodes a zinc finger transcription factor that is essential for development of multiple organs including kidneys, gonads, spleen and heart. In mammals Wt1 comprises 10 exons with two characteristic splicing events: inclusion or skipping of exon 5 and alternative usage of two splice donor sites between exons 9 and 10. Most fish including zebrafish and medaka possess two wt1 paralogs, wt1a and wt1b, both lacking exon 5. Here we have characterized wt1 in guppy, platyfish and the short-lived African killifish Nothobranchius furzeri. All fish except zebrafish show alternative splicing of exon 4 of wt1a but not of wt1b with the wt1a(-exon 4) isoform being the predominant splice variant. With regard to function, Wt1a(+exon 4) showed less dimerization but stimulated transcription more effectively than the Wt1a(-exon 4) isoform. A specific knockdown of wt1a exon 4 in zebrafish was associated with anomalies in kidney development demonstrating a physiological function for Wt1a exon 4. Interestingly, alternative splicing of exon 4 seems to be an early evolutionary event as it is observed in the single wt1 gene of the sturgeon, a species that has not gone through teleost-specific genome duplication. PMID:25014653

  17. [Genetic characteristics on exon 4 of prolactin gene in 12 water buffalo populations].

    PubMed

    Yuan, Feng; Miao, Yong-Wang; Li, Da-Lin; Tang, Shou-Kun; Xv, Zheng; Huo, Jin-Long; Qi, Hong

    2010-12-01

    The prolactin exerts obvious adjustment and control function for mammary gland development, lactation and milk protein gene expression in water buffalo. In this study the sequence features and polymorphisms of the exon 4 in prolactin gene were examined in 385 individuals which came from 12 river and swamp type buffalo populations using DNA direct sequencing and PCR-SSCP methods. The results showed that the sequence of exon 4 in prolactin gene was consists of 180 nucleotides, the fragment had high conservative character in different species. The e4. 109 C>T substitution was detected in nine swamp buffalo populations, and it was a silent mutation and was not associated with the traits of milk yield in buffalo. The PBA gene was the predominant gene in seven swamp type buffalo populations, while PBB gene was the dominant gene in Dehong and Fuzhong populations. The frequencies of PBA in swamp type buffalo was 0.400 -0.917 and the average value was 0.629+/-0.049. The polymorphism wasn't found in river buffalo, all the samples from river buffalo were holding nucleotides e4.109 C. The results indicate that there is distinct genetic differentiation between swamp and river type buffalo.

  18. Clinical factors influencing phenotype of HCMV-specific CD8+ T cells and HCMV-induced interferon-gamma production after allogeneic stem cells transplantation.

    PubMed

    Gayoso, Inmaculada; Cantisán, Sara; Cerrato, Carolina; Sánchez-García, Joaquín; Martin, Carmen; Solana, Rafael; Torres-Gomez, Antonio; Torre-Cisneros, Julian

    2013-01-01

    Human cytomegalovirus (HCMV) infection causes significant morbidity and mortality after hematopoietic stem cell transplantation (HSCT). In this work, we characterized the phenotype and interferon-gamma (INF-γ) production of HCMV-specific T cells using QuantiFERON-HCMV assay in 26 patients 6 months after HSCT. We analysed whether these two parameters were associated with clinical variables. Our results showed that the patients receiving stem cells from donors ≥40 years old were 12 times more likely to have HCMV-specific CD8+ T cells with "differentiated phenotype" (CD45RA+CCR7+ ≤6.7% and CD28+ ≤30%) than patients grafted from donors <40 years old (OR = 12; P = 0.014). In addition, a detectable IFN-γ production in response to HCMV peptides (cutoff 0.2 IU/mL IFN-γ; "reactive" QuantiFERON-HCMV test) was statistically associated with HCMV replication after transplantation (OR = 11; P = 0.026), recipients ≥40 versus <40 years old (OR = 11; P = 0.026), and the use of peripheral blood versus bone marrow as stem cell source (OR = 17.5; P = 0.024). In conclusion, donor age is the only factor significantly associated with the presence of the "differentiated phenotype" in HCMV-specific CD8+ T cells, whereas HCMV replication after transplantation, recipient age, and stem cell source are the factors associated with the production of IFN-γ in response to HCMV epitopes.

  19. Expression of the IE1 transactivator of Autographa californica nuclear polyhedrosis virus during viral infection.

    PubMed

    Choi, J; Guarino, L A

    1995-05-10

    The immediate-early IE1 protein of Autographa californica nuclear polyhedrosis virus (AcMNPV) is an important regulator of viral gene transcription. To provide a tool for further analysis of the expression and function of IE1, a polyclonal antiserum was raised against IE1 expressed in bacteria. Immunoblot analysis of infected cell lysates was used to monitor the accumulation of IE1 throughout the viral life cycle. When extracts were prepared in the presence of phosphatase inhibitors, only one protein band was detected on SDS-polyacrylamide gels. However, in the absence of phosphatase inhibitors, at least four distinct electrophoretic species were detected. Mobility shift assays were conducted using an enhancer DNA probe and whole cell extracts prepared at different times postinfection. Results indicated that the enhancer-binding activity of IE1 increased from 4 to 72 hr postinfection. DNA-protein complexes formed with infected cell extracts migrated more slowly than those formed with transfected cell extracts. This effect was more pronounced with extracts prepared in the presence of phosphatase inhibitors. Supershift experiments with IE1 antiserum confirmed that IE1 was a component of DNA-protein complexes in both transfected and infected cell extracts. A titration experiment was done to determine the minimal amounts of IE1 required for activation of the 39k promoter in the presence and absence of a cis-linked enhancer element. These analyses indicated that the intracellular levels of IE1 are not sufficient for enhancer-independent activation of the 39k promoter during the early phase of viral infection. Quantitative immunoblots revealed that the amount of IE1 in budded virus was less than 0.68 mole per mole of viral DNA, suggesting that IE1 is not a structural protein of AcNPV.

  20. Baculoviruses deficient in ie1 gene function abrogate viral gene expression in transduced mammalian cells

    SciTech Connect

    Efrose, Rodica; Swevers, Luc; Iatrou, Kostas

    2010-10-25

    One of the newest niches for baculoviruses-based technologies is their use as vectors for mammalian cell transduction and gene therapy applications. However, an outstanding safety issue related to such use is the residual expression of viral genes in infected mammalian cells. Here we show that infectious baculoviruses lacking the major transcriptional regulator, IE1, can be produced in insect host cells stably transformed with IE1 expression constructs lacking targets of homologous recombination that could promote the generation of wt-like revertants. Such ie1-deficient baculoviruses are unable to direct viral gene transcription to any appreciable degree and do not replicate in normal insect host cells. Most importantly, the residual viral gene expression, which occurs in mammalian cells infected with wt baculoviruses is reduced 10 to 100 fold in cells infected with ie1-deficient baculoviruses. Thus, ie1-deficient baculoviruses offer enhanced safety features to baculovirus-based vector systems destined for use in gene therapy applications.

  1. Human cytomegalovirus latency-associated protein LUNA is expressed during HCMV infections in vivo.

    PubMed

    Bego, Mariana G; Keyes, Lisa R; Maciejewski, Jarek; St Jeor, Stephen C

    2011-10-01

    Human cytomegalovirus (HCMV) latency is poorly understood. We previously described a novel HCMV latency-associated transcript, UL81-82ast, coding for a protein designated LUNA (latency unique natural antigen). The aim of this study was to confirm the presence of LUNA in HCMV-seropositive donors. Standard co-immunoprecipitation and ELISA assays were used to detect antibodies against the LUNA protein in the sera of HCMV-seropositive donors. Specific antibodies against LUNA were detected in all HCMV-seropositive donors but in none of the seronegative donors. These data confirm that LUNA is expressed during in vivo infections and is capable of eliciting an immune response.

  2. Titration of human cytomegalovirus (HCMV) DNA in urine by combined use of PCR and microplate hybridization in a renal transplant patient with HCMV pneumonitis.

    PubMed

    Meigata, K; Hondo, R; Fujima, A; Shinkai-Shibata, M; Itoh, S; Kikuchi, K; Ando, Y; Ichikawa, N; Nomura, Y; Watanabe, K; Degawa, H; Beck, Y; Tomikawa, S; Nagao, T; Uchida, H

    1996-06-01

    We titrated human cytomegalovirus (HCMV) DNA in urine specimens obtained from 14 healthy individuals and a renal transplant patient with HCMV pneumonitis by modifying the method for titration of varicella-zoster virus DNA previously described (1,2). Of 14 HCMV seropositive healthy individuals, 13 had HCMV DNA under the detection limit of 10(2.0) copies/ml, whereas one person had 10(2.0) copies/ml. The viral DNA in urine samples was at a low level in healthy individuals with latent infection. In a case with HCMV pneumonitis after renal transplantation, the amount of HCMV DNA in urine gradually increased from the level under 10(2.0) copies/ml and reached a peak of 10(4.7) copies/ml one month prior to the manifestation of pneumonitis. It, thereafter, decreased with the course of clinical remission, and finally settled at under 10(2.0) copies/ml. Serial titrations of HCMV DNA in urine specimens proved to be useful in identifying recipients at risk of developing active HCMV infection after renal transplantation and as a guide for treatment of patients.

  3. Further genotype-phenotype correlation emerging from two families with PLP1 exon 4 skipping.

    PubMed

    Biancheri, Roberta; Grossi, Serena; Regis, Stefano; Rossi, Andrea; Corsolini, Fabio; Rossi, Daniela Paola; Cavalli, Pietro; Severino, Mariasavina; Filocamo, Mirella

    2014-03-01

    Proteolipid protein 1 (PLP1) gene-related disorders due to mutations in the PLP1 include a wide spectrum of X-linked disorders ranging from severe connatal Pelizaeus-Merzbacher disease (PMD) to spastic paraplegia 2 (SPG2). Duplications, deletions or point mutations in coding and noncoding regions of the PLP1 gene may occur. We report the clinical, neuroradiologic and molecular findings in six patients from two unrelated families. The affected males showed severe mental retardation, spastic tetraparesis, inability of walking and pes cavus at onset in early infancy. Brain magnetic resonance imaging (MRI) showed hypomyelination and brain atrophy. Nystagmus was never observed. The affected females showed adult-onset progressive spastic paraparesis leading to wheel-chair dependency and subtle white matter changes on brain MRI. Molecular studies in the two families identified two different intronic mutations, the novel c.622+2T>C and the known c.622+1G>A, leading to the skipping of PLP1-exon 4. The clinical presentation of the affected males did not consistently fit in any of the PLP1-related disorder subtypes (i.e., connatal or classic PMD, SPG2 and 'PLP1 null syndrome'), and in addition, the carrier females were symptomatic despite the severe clinical picture of their respective probands. This study provides new insight into the genotype-phenotype correlations of patients with PLP1 splice-site mutations. PMID:23711321

  4. Clinical Factors Influencing Phenotype of HCMV-Specific CD8+ T Cells and HCMV-Induced Interferon-Gamma Production after Allogeneic Stem Cells Transplantation

    PubMed Central

    Cantisán, Sara; Cerrato, Carolina; Sánchez-García, Joaquín; Martin, Carmen; Solana, Rafael; Torres-Gomez, Antonio; Torre-Cisneros, Julian

    2013-01-01

    Human cytomegalovirus (HCMV) infection causes significant morbidity and mortality after hematopoietic stem cell transplantation (HSCT). In this work, we characterized the phenotype and interferon-gamma (INF-γ) production of HCMV-specific T cells using QuantiFERON-HCMV assay in 26 patients 6 months after HSCT. We analysed whether these two parameters were associated with clinical variables. Our results showed that the patients receiving stem cells from donors ≥40 years old were 12 times more likely to have HCMV-specific CD8+ T cells with “differentiated phenotype” (CD45RA+CCR7+ ≤6.7% and CD28+ ≤30%) than patients grafted from donors <40 years old (OR = 12; P = 0.014). In addition, a detectable IFN-γ production in response to HCMV peptides (cutoff 0.2 IU/mL IFN-γ; “reactive” QuantiFERON-HCMV test) was statistically associated with HCMV replication after transplantation (OR = 11; P = 0.026), recipients ≥40 versus <40 years old (OR = 11; P = 0.026), and the use of peripheral blood versus bone marrow as stem cell source (OR = 17.5; P = 0.024). In conclusion, donor age is the only factor significantly associated with the presence of the “differentiated phenotype” in HCMV-specific CD8+ T cells, whereas HCMV replication after transplantation, recipient age, and stem cell source are the factors associated with the production of IFN-γ in response to HCMV epitopes. PMID:23424600

  5. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2010-01-01 2010-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section 300.60 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT OF...

  6. HCMV infection of humanized mice after transplantation of G-CSF-mobilized peripheral blood stem cells from HCMV-seropositive donors.

    PubMed

    Hakki, Morgan; Goldman, Devorah C; Streblow, Daniel N; Hamlin, Kimberly L; Krekylwich, Craig N; Fleming, William H; Nelson, Jay A

    2014-01-01

    Human cytomegalovirus (HCMV) infection, including primary infection resulting from transmission from a seropositive donor to a seronegative recipient (D(+)/R(-)), remains a significant problem in the setting of peripheral blood stem cell transplantation (PBSCT). The lack of a suitable animal model for studying HCMV transmission after PBSCT is a major barrier to understanding this process and, consequently, developing novel interventions to prevent HCMV infection. Our previous work demonstrated that human CD34(+) progenitor cell-engrafted NOD-scid IL2Rγc(null) (NSG) mice support latent HCMV infection after direct inoculation and reactivation after treatment with granulocyte colony-stimulating factor. To more accurately recapitulate HCMV infection in the D(+)/R(-) PBSCT setting, granulocyte colony-stimulating factor-mobilized peripheral blood stem cells from seropositive donors were used to engraft NSG mice. All recipient mice demonstrated evidence of HCMV infection in liver, spleen, and bone marrow. These findings validate the NSG mouse model for studying HCMV transmission during PBSCT.

  7. Multiple early transcripts and splicing of the Autographa californica nuclear polyhedrosis virus IE-1 gene.

    PubMed Central

    Chisholm, G E; Henner, D J

    1988-01-01

    The immediate-early IE-1 gene of Autographa californica nuclear polyhedrosis virus was cloned, and its nucleotide sequence was determined. Sequence analysis indicated that this gene would encode a protein of 582 amino acids with a predicted molecular weight of 66,822. Analysis of IE-1 gene expression during baculovirus infection identified two transcripts. One, 1.9 kilobases (kb), was expressed at constant steady-state levels throughout infection, whereas the other, 2.1 kb, was expressed only early in infection. Analysis of IE-1 cDNA clones demonstrated that the 2.1-kb transcript contained the entire 1.9-kb transcript (exon 1) plus an additional 5' end (exon 0). Genomic Southern analysis placed the exon 0 sequences on the EcoRI B fragment, 4 kilobase pairs upstream of exon 1. Sequencing of the upstream region identified an open reading frame whose 5' end was identical to the exon 0 sequences in the cDNAs. Examination of the genomic DNA sequences around the exon-exon junction revealed sequences similar to published consensus splice acceptor and donor sequences. This is the first example of splicing of any viral transcript during baculovirus infection. Images PMID:3043024

  8. On the association of human beta 2 microglobulin with cell culture-grown human cytomegalovirus (HCMV).

    PubMed

    Yamashita, Y; Shimokata, K; Nishiyama, Y

    1992-09-01

    We studied the production of human beta 2 microglobulin (beta 2m) in mock-infected or human cytomegalovirus (HCMV) infected human embryonic lung fibroblasts (HEL) and the association of human beta 2m with HCMV virions. Titration of beta 2m by two-step sandwich enzyme immunoassay revealed that HEL released considerable amounts of human beta 2m into the culture medium and that the production of beta 2m was significantly enhanced by HCMV infection. The concentration of human beta 2m in the culture medium of HCMV-infected HEL reached 500 to 600 ng/ml, which corresponded to 7- to 12-fold of levels found in healthy adult urine. Immunoprecipitation assays showed that HEL-grown HCMV bound a significant amount of endogenous beta 2m, but the viruses were efficiently neutralized by either human hyperimmune anti-HCMV globulin or anti-HCMV monoclonal antibody even when treated with a large amount of human beta 2m or with dialysed urine. Thus it seems unlikely that the binding of beta 2m by HCMV is involved in masking the viral antigenic site necessary for neutralization.

  9. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  10. Identification of the uncommon allele HLA-A*7403 in a Caucasian renal transplant cadaveric donor: extension of the exon 4 sequence.

    PubMed

    Canossi, A; Del Beato, T; Piazza, A; Liberatore, G; Ozzella, G; Tessitore, A; Adorno, D

    2007-06-01

    This report describes the unknown exon 4 sequence of the rare A*7403 allele, identified in a Caucasian renal transplant cadaveric donor from Italy. This sequence is identical to that of the only known A*7401 exon 4, and this result allowed us to confirm the hypothesis of the generation of A*7403 allele from the ancestor A*7402 by point mutation in exon 2.

  11. Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

    PubMed

    Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

    2004-01-01

    The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

  12. Identification of two independent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein.

    PubMed

    Slack, J M; Blissard, G W

    1997-12-01

    The Autographa californica multicapsid nuclear polyhedrosis virus immediate-early protein, IE1, is a 582-amino-acid phosphoprotein that regulates the transcription of early viral genes. Deletion of N-terminal regions of IE1 in previous studies (G. R. Kovacs, J. Choi, L. A. Guarino, and M. D. Summers, J. Virol. 66:7429-7437, 1992) resulted in the loss of transcriptional activation, suggesting that this region may contain an acidic activation domain. To identify independently functional transcriptional activation domains, we developed a heterologous system in which potential regulatory domains were fused with a modified Escherichia coli Lac repressor protein that contains a nuclear localization signal (NLacR). Transcriptional activation by the resulting NLacR-IE1 chimeras was measured with a basal baculovirus early promoter containing optimized Lac repressor binding sites (lac operators). Chimeras containing IE1 peptides dramatically activated transcription of the basal promoter only when lac operator sequences were present. In addition, transcriptional activation by NLacR-IE1 chimeras was allosterically regulated by the lactose analog, isopropyl-beta-D-thiogalactopyranoside (IPTG). For a more detailed analysis of IE1 regulatory domains, the M1 to T266 N-terminal portion of IE1 was subdivided (on the basis of average amino acid charge) into five smaller regions which were fused in various combinations to NLacR. Regions M1 to N125 and A168 to G222 were identified as independent transcriptional activation domains. Some NLacR-IE1 chimeras exhibited retarded migration in sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels. As with wild-type IE1, this aberrant gel mobility was associated with phosphorylation. Mapping studies with the NLacR-IE1 chimeras indicate that the M1 to A168 region of IE1 is necessary for this phosphorylation-associated effect.

  13. Altered Striatal Synaptic Function and Abnormal Behaviour in Shank3 Exon4-9 Deletion Mouse Model of Autism.

    PubMed

    Jaramillo, Thomas C; Speed, Haley E; Xuan, Zhong; Reimers, Jeremy M; Liu, Shunan; Powell, Craig M

    2016-03-01

    Shank3 is a multi-domain, synaptic scaffolding protein that organizes proteins in the postsynaptic density of excitatory synapses. Clinical studies suggest that ∼ 0.5% of autism spectrum disorder (ASD) cases may involve SHANK3 mutation/deletion. Patients with SHANK3 mutations exhibit deficits in cognition along with delayed/impaired speech/language and repetitive and obsessive/compulsive-like (OCD-like) behaviors. To examine how mutation/deletion of SHANK3 might alter brain function leading to ASD, we have independently created mice with deletion of Shank3 exons 4-9, a region implicated in ASD patients. We find that homozygous deletion of exons 4-9 (Shank3(e4-9) KO) results in loss of the two highest molecular weight isoforms of Shank3 and a significant reduction in other isoforms. Behaviorally, both Shank3(e4-9) heterozygous (HET) and Shank3(e4-9) KO mice display increased repetitive grooming, deficits in novel and spatial object recognition learning and memory, and abnormal ultrasonic vocalizations. Shank3(e4-9) KO mice also display abnormal social interaction when paired with one another. Analysis of synaptosome fractions from striata of Shank3(e4-9) KO mice reveals decreased Homer1b/c, GluA2, and GluA3 expression. Both Shank3(e4-9) HET and KO demonstrated a significant reduction in NMDA/AMPA ratio at excitatory synapses onto striatal medium spiny neurons. Furthermore, Shank3(e4-9) KO mice displayed reduced hippocampal LTP despite normal baseline synaptic transmission. Collectively these behavioral, biochemical and physiological changes suggest Shank3 isoforms have region-specific roles in regulation of AMPAR subunit localization and NMDAR function in the Shank3(e4-9) mutant mouse model of autism. PMID:26559786

  14. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  15. Transactivation, dimerization, and DNA-binding activity of white spot syndrome virus immediate-early protein IE1.

    PubMed

    Liu, Wang-Jing; Chang, Yun-Shiang; Wang, Hao-Ching; Leu, Jiann-Horng; Kou, Guang-Hsiung; Lo, Chu-Fang

    2008-11-01

    Immediate-early proteins from many viruses function as transcriptional regulators and exhibit transactivation activity, DNA binding activity, and dimerization. In this study, we investigated these characteristics in white spot syndrome virus (WSSV) immediate-early protein 1 (IE1) and attempted to map the corresponding functional domains. Transactivation was investigated by transiently expressing a protein consisting of the DNA binding domain of the yeast transactivator GAL4 fused to full-length IE1. This GAL4-IE1 fusion protein successfully activated the Autographa californica multicapsid nucleopolyhedrovirus p35 basal promoter when five copies of the GAL4 DNA binding site were inserted upstream of the TATA box. A deletion series of GAL4-IE1 fusion proteins suggested that the transactivation domain of WSSV IE1 was carried within its first 80 amino acids. A point mutation assay further showed that all 12 of the acidic residues in this highly acidic domain were important for IE1's transactivation activity. DNA binding activity was confirmed by an electrophoresis mobility shift assay using a probe with (32)P-labeled random oligonucleotides. The DNA binding region of WSSV IE1 was located in its C-terminal end (amino acids 81 to 224), but mutation of a putative zinc finger motif in this C-terminal region suggested that this motif was not directly involved in the DNA binding activity. A homotypic interaction between IE1 molecules was demonstrated by glutathione S-transferase pull-down assay and a coimmunoprecipitation analysis. A glutaraldehyde cross-linking experiment and gel filtration analysis showed that this self-interaction led to the formation of stable IE1 dimers. PMID:18768963

  16. Structure of HCMV glycoprotein B in the postfusion conformation bound to a neutralizing human antibody

    PubMed Central

    Chandramouli, Sumana; Ciferri, Claudio; Nikitin, Pavel A.; Caló, Stefano; Gerrein, Rachel; Balabanis, Kara; Monroe, James; Hebner, Christy; Lilja, Anders E.; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) poses a significant threat to immunocompromised individuals and neonates infected in utero. Glycoprotein B (gB), the herpesvirus fusion protein, is a target for neutralizing antibodies and a vaccine candidate due to its indispensable role in infection. Here we show the crystal structure of the HCMV gB ectodomain bound to the Fab fragment of 1G2, a neutralizing human monoclonal antibody isolated from a seropositive subject. The gB/1G2 interaction is dominated by aromatic residues in the 1G2 heavy chain CDR3 protruding into a hydrophobic cleft in the gB antigenic domain 5 (AD-5). Structural analysis and comparison with HSV gB suggest the location of additional neutralizing antibody binding sites on HCMV gB. Finally, immunoprecipitation experiments reveal that 1G2 can bind to HCMV virion gB suggesting that its epitope is exposed and accessible on the virus surface. Our data will support the development of vaccines and therapeutic antibodies against HCMV infection. PMID:26365435

  17. 11 CFR 300.62 - Non-Federal elections (2 U.S.C. 441i(e)(1)(B)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... elections (2 U.S.C. 441i(e)(1)(B)). A person described in 11 CFR 300.60 may solicit, receive, direct... 11 Federal Elections 1 2010-01-01 2010-01-01 false Non-Federal elections (2 U.S.C. 441i(e)(1)(B)). 300.62 Section 300.62 Federal Elections FEDERAL ELECTION COMMISSION BIPARTISAN CAMPAIGN REFORM ACT...

  18. 11 CFR 300.61 - Federal elections (2 U.S.C. 441i(e)(1)(A)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... elections (2 U.S.C. 441i(e)(1)(A)). No person described in 11 CFR 300.60 shall solicit, receive, direct... any Federal election activity as defined in 11 CFR 100.24, unless the amounts consist of Federal funds... 11 Federal Elections 1 2010-01-01 2010-01-01 false Federal elections (2 U.S.C. 441i(e)(1)(A))....

  19. HCMV Displays a Unique Transcriptome of Immunomodulatory Genes in Primary Monocyte-Derived Cell Types

    PubMed Central

    Van Damme, Ellen; Thys, Kim; Tuefferd, Marianne; Van Hove, Carl; Aerssens, Jeroen; Van Loock, Marnix

    2016-01-01

    Human cytomegalovirus (HCMV) is a betaherpesvirus which rarely presents problems in healthy individuals, yet may result in severe morbidity in immunocompromised patients and in immune-naïve neonates. HCMV has a large 235 kb genome with a coding capacity of at least 165 open reading frames (ORFs). This large genome allows complex gene regulation resulting in different sets of transcripts during lytic and latent infection. While latent virus mainly resides within monocytes and CD34+ progenitor cells, reactivation to lytic infection is driven by differentiation towards terminally differentiated myeloid dendritic cells and macrophages. Consequently, it has been suggested that macrophages and dendritic cells contribute to viral spread in vivo. Thus far only limited knowledge is available on the expression of HCMV genes in terminally differentiated myeloid primary cells and whether or not the virus exhibits a different set of lytic genes in primary cells compared with lytic infection in NHDF fibroblasts. To address these questions, we used Illumina next generation sequencing to determine the HCMV transcriptome in macrophages and dendritic cells during lytic infection and compared it to the transcriptome in NHDF fibroblasts. Here, we demonstrate unique expression profiles in macrophages and dendritic cells which significantly differ from the transcriptome in fibroblasts mainly by modulating the expression of viral transcripts involved in immune modulation, cell tropism and viral spread. In a head to head comparison between macrophages and dendritic cells, we observed that factors involved in viral spread and virion composition are differentially regulated suggesting that the plasticity of the virion facilitates the infection of surrounding cells. Taken together, this study provides the full transcript expression analysis of lytic HCMV genes in monocyte-derived type 1 and type 2 macrophages as well as in monocyte-derived dendritic cells. Thereby underlining the potential

  20. Resistance of transgenic silkworm to BmNPV could be improved by silencing ie-1 and lef-1 genes.

    PubMed

    Zhang, P; Wang, J; Lu, Y; Hu, Y; Xue, R; Cao, G; Gong, C

    2014-01-01

    RNA interference (RNAi)-mediated viral inhibition has been used in several organisms for improving viral resistance. In the present study, we reported the use of transgenic RNAi in preventing Bombyx mori nucleopolyhedrovirus (BmNPV) multiplication in the transgenic silkworm B. mori. We targeted the BmNPV immediate-early-1 (ie-1) and late expression factor-1 (lef-1) genes in the transiently transfected BmN cells, in the stable transformed BmN cell line and in the transgenic silkworms. We generated four piggyBac-based vectors containing short double-stranded ie-1 RNA (sdsie-1), short double-stranded lef-1 RNA (sdslef-1), long double-stranded ie-1 RNA (ldsie-1) and both sdsie-1 and sdslef-1 (sds-ie1-lef1) expression cassettes. Strong viral repression was observed in the transiently transfected cells and in the stable transformed BmN cells transfected with sds-ie-1, sdslef-1, ldsie-1 or sds-ie-lef. The decrease of ie-1 mRNA level in the sds-ie1-lef1 transiently transfected cells was most obvious among the cells transfected with different vectors. The inhibitory effect of viral multiplication was decreased in a viral dose-dependent manner; the infection ratio of transfected cells for sds-ie-1, sdslef-1, ldsie-1 and sds-ie-lef decreased by 18.83%, 13.73%, 6.93% and 30.63%, respectively, compared with control cells 5 days after infection. We generated transgenic silkworms using transgenic vector piggyantiIE-lef1-neo with sds-ie1-lef1 expression cassette; the fourth instar larvae of transgenic silkworms of generation G5 exhibited stronger resistance to BmNPV, the mortalities for the transgenic silkworms and control silkworms were 60% and 100%, respectively, at 11 days after inoculation with BmNPV (10(6) occlusion bodies per ml). These results suggest that double-stranded RNA expression of essential genes of BmNPV is a feasible method for breeding silkworms with a high antiviral capacity. PMID:24173242

  1. N-terminal determinants of human cytomegalovirus IE1 protein in nuclear targeting and disrupting PML-associated subnuclear structures

    SciTech Connect

    Lee, Hye-Ra; Huh, Yong Ho; Kim, Young-Eui; Lee, Karim; Kim, Sunyoung; Ahn, Jin-Hyun . E-mail: jahn@med.skku.ac.kr

    2007-05-04

    The 72-kDa IE1 protein of human cytomegalovirus disrupts PML-associated subnuclear structures (PODs) by inducing PML desumoylation. This process correlates with the functions of IE1 in transcriptional regulation and efficient viral replication. Here, we defined the N-terminal regions of IE1 required for nuclear targeting and POD-disrupting activity. Although the 24 N-terminal amino acids encoded by exon 2, which were previously shown to be essential for nuclear targeting, did not appear to contain typical basic nuclear localization signals, these residues were able to efficiently convey the GFP protein into the nucleus, suggesting a role in promoting nuclear translocation. In assays using a series of N-terminal truncation IE1 mutants, which were forced to enter the nucleus, exon 2 was completely dispensable for POD disruption. However, the predicted two {alpha}-helix regions in exon 3 were identified as important structural determinants for protein stability and for the correlating activities in POD disruption and PML desumoylation.

  2. The Downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 Axis and by Human Cytomegalovirus (HCMV) Associated Factors Allows the Activation of the HCMV Major IE Promoter and the Transition to Productive Infection

    PubMed Central

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A.; Doxaki, Christina; Kampranis, Sotirios C.; Kottakis, Filippos; Tsichlis, Philip N.

    2014-01-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program. PMID:24830456

  3. The downregulation of GFI1 by the EZH2-NDY1/KDM2B-JARID2 axis and by human cytomegalovirus (HCMV) associated factors allows the activation of the HCMV major IE promoter and the transition to productive infection.

    PubMed

    Sourvinos, George; Morou, Antigoni; Sanidas, Ioannis; Codruta, Ignea; Ezell, Scott A; Doxaki, Christina; Kampranis, Sotirios C; Kottakis, Filippos; Tsichlis, Philip N

    2014-05-01

    Earlier studies had suggested that epigenetic mechanisms play an important role in the control of human cytomegalovirus (HCMV) infection. Here we show that productive HCMV infection is indeed under the control of histone H3K27 trimethylation. The histone H3K27 methyltransferase EZH2, and its regulators JARID2 and NDY1/KDM2B repress GFI1, a transcriptional repressor of the major immediate-early promoter (MIEP) of HCMV. Knocking down EZH2, NDY1/KDM2B or JARID2 relieves the repression and results in the upregulation of GFI1. During infection, the incoming HCMV rapidly downregulates the GFI1 mRNA and protein in both wild-type cells and in cells in which EZH2, NDY1/KDM2B or JARID2 were knocked down. However, since the pre-infection levels of GFI1 in the latter cells are significantly higher, the virus fails to downregulate it to levels permissive for MIEP activation and viral infection. Following the EZH2-NDY1/KDM2B-JARID2-independent downregulation of GFI1 in the early stages of infection, the virus also initiates an EZH2-NDY1/ΚDM2Β-JARID2-dependent program that represses GFI1 throughout the infection cycle. The EZH2 knockdown also delays histone H3K27 trimethylation in the immediate early region of HCMV, which is accompanied by a drop in H3K4 trimethylation that may contribute to the shEZH2-mediated repression of the major immediate early HCMV promoter. These data show that HCMV uses multiple mechanisms to allow the activation of the HCMV MIEP and to prevent cellular mechanisms from blocking the HCMV replication program.

  4. A novel frameshift mutation in exon 4 causing a deficiency of high-molecular-weight kininogen in a patient with splenic infarction.

    PubMed

    Fukushima, Noriyasu; Itamura, Hidekazu; Wada, Hideo; Ikejiri, Makoto; Igarashi, Yuko; Masaki, Hiroya; Sano, Masayuki; Komiyama, Yutaka; Ichinohe, Tatsuo; Kimura, Shinya

    2014-01-01

    High-molecular-weight kininogen (HMWK) deficiency is a very rare hereditary disorder. We herein report a case of HMWK deficiency with splenic infarction. The HMWK activity of the proband was markedly decreased (0.9%). Direct sequencing of his HMWK gene showed a homozygous "TC" insertion at c523-524 in exon 4. This insertion led to an amino acid substitution, Ser175Ser, resulting in a frameshift mutation and a premature stop codon in amino acid 183. Furthermore, the HMWK activity was also reduced in the patient's three children, who exhibited the heterozygous "TC" insertion at c523-524 in exon 4. This is the first report of this gene alteration in a patient with HMWK deficiency.

  5. Microsomal epoxide hydrolase (EPHX1), slow (exon 3, 113His) and fast (exon 4, 139Arg) alleles confer susceptibility to squamous cell esophageal cancer

    SciTech Connect

    Jain, Meenu; Tilak, Anup Raj; Upadhyay, Rohit; Kumar, Ashwani; Mittal, Balraj

    2008-07-15

    Genetic polymorphisms in xenobiotic metabolizing enzymes may alter risk of various cancers. Present case-control study evaluated the influence of EPHX1 genetic variations on squamous cell esophageal cancer (ESCC) susceptibility in 107 patients and 320 controls. EPHX1 polymorphic alleles were genotyped by direct sequencing (exon 3, Tyr113His) or PCR-RFLP (exon 4, His139Arg). Patients with exon 3 genotypes (Tyr113His, His113His) and 113His allele were at risk of ESCC (OR{sub Tyr113His} 2.0, 95% CI = 1.2-3.4, p = 0.007; OR{sub His113His} 2.3 95% CI = 1.0-5.2, p = 0.03 and OR{sub His} 1.5, 95% CI = 1.0-2.1, p = 0.01). In contrast, individuals with exon 4, 139Arg allele were at low risk of cancer (OR 0.34, 95% CI = 0.20-0.56, p = 0.001). However, none of haplotype combinations of exon 3 (Tyr113His) and exon 4 (His139Arg) polymorphisms showed modulation of risk for ESCC. Sub-grouping of patients based on anatomical location of tumor predicted that patients with exon 3, His113His and Tyr113His genotypes were at higher risk for developing ESCC tumor at upper and middle third locations (OR 4.4, 95% CI = 1.0-18.5, p = 0.04; OR 2.5, 95% CI = 1.3-5.0, p = 0.005 respectively). The frequency of exon 4, His139Arg genotype was significantly lower in ESCC patients with lower third tumor location as compared to controls (14.8% vs. 36.3%, p = 0.02). In case-only study, gene-environment interaction of EPHX1 genotypes with tobacco, alcohol and occupational exposures did not appear to modulate the cancer susceptibility. In conclusion, exon 3, Tyr113His genotype was associated with higher risk of ESCC particularly at upper and middle-third anatomical locations of tumor. However, His139Arg genotype of exon 4, exhibited low risk for ESCC as well as its clinical characteristics.

  6. The increased sensitivity of human cytomegalovirus (HCMV) PCR quantitation in whole blood affects reproductive rate (Ro) measurement.

    PubMed

    Gurtler, Volker; Mayall, Barrie C; Wang, Jenny; Ghaly-Derias, Shahbano

    2014-02-01

    In order to determine the effect of the increase in sensitivity of HCMV detection in whole blood compared to plasma on reproductive rate (Ro) measurement, an optimized human cytomegalovirus (HCMV) quantitative PCR assay was developed. The results presented in this study are summarized by the following three methodological improvements: (i) at values below the limit of quantitation (LOQ) of 60copies/ml, determination of HCMV load was more sensitive with whole blood than plasma, (ii) for the determination of viral load, whole blood was more sensitive than plasma below 1000copies/ml but little difference was observed above 1000copies/ml and (iii) the measurement of "Reproductive Rate" can be affected by imprecise measurement of HCMV viral load in either plasma or whole blood compartments depending on whether samples were taken from patients on antiviral treatment or from patients where HCMV load was rising. Taken together this study provides methodological improvements suggesting that below HCMV viral load levels of 1000copies/ml (1640IU/ml) both plasma and whole blood should be tested.

  7. Inhibition of cyclophilin A suppresses H2O2-enhanced replication of HCMV through the p38 MAPK signaling pathway.

    PubMed

    Xiao, Jun; Song, Xin; Deng, Jiang; Lv, Liping; Ma, Ping; Gao, Bo; Zhou, Xipeng; Zhang, Yanyu; Xu, Jinbo

    2016-09-01

    Human cytomegalovirus (HCMV) infection can be accelerated by intracellular and extracellular hydrogen peroxide (H2O2) stimulation, mediated by the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. However, it remains unknown whether host gene expression is involved in H2O2-upregulated HCMV replication. Here, we show that the expression of the host gene, cyclophilin A (CyPA), could be facilitated by treatment with H2O2 in a dose-dependent manner. Experiments with CyPA-specific siRNA, or with cyclosporine A, an inhibitor of CyPA, confirmed that H2O2-mediated upregulation of HCMV replication is specifically mediated by upregulation of CyPA expression. Furthermore, depletion or inhibition of CyPA reduced H2O2-induced p38 activation, consistent with that of H2O2-upregulated HCMV lytic replication. These results show that H2O2 is capable of activating ROS-CyPA-p38 MAPK interactions to enhance HCMV replication. PMID:27642560

  8. Inhibition of cyclophilin A suppresses H2O2-enhanced replication of HCMV through the p38 MAPK signaling pathway.

    PubMed

    Xiao, Jun; Song, Xin; Deng, Jiang; Lv, Liping; Ma, Ping; Gao, Bo; Zhou, Xipeng; Zhang, Yanyu; Xu, Jinbo

    2016-09-01

    Human cytomegalovirus (HCMV) infection can be accelerated by intracellular and extracellular hydrogen peroxide (H2O2) stimulation, mediated by the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. However, it remains unknown whether host gene expression is involved in H2O2-upregulated HCMV replication. Here, we show that the expression of the host gene, cyclophilin A (CyPA), could be facilitated by treatment with H2O2 in a dose-dependent manner. Experiments with CyPA-specific siRNA, or with cyclosporine A, an inhibitor of CyPA, confirmed that H2O2-mediated upregulation of HCMV replication is specifically mediated by upregulation of CyPA expression. Furthermore, depletion or inhibition of CyPA reduced H2O2-induced p38 activation, consistent with that of H2O2-upregulated HCMV lytic replication. These results show that H2O2 is capable of activating ROS-CyPA-p38 MAPK interactions to enhance HCMV replication.

  9. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

    SciTech Connect

    Sharma, Sapna; Wisner, Todd W.; Johnson, David C.; Heldwein, Ekaterina E.

    2013-01-20

    Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

  10. Modeling the human MTM1 p.R69C mutation in murine Mtm1 results in exon 4 skipping and a less severe myotubular myopathy phenotype

    PubMed Central

    Pierson, Christopher R.; Dulin-Smith, Ashley N.; Durban, Ashley N.; Marshall, Morgan L.; Marshall, Jordan T.; Snyder, Andrew D.; Naiyer, Nada; Gladman, Jordan T.; Chandler, Dawn S.; Lawlor, Michael W.; Buj-Bello, Anna; Dowling, James J.; Beggs, Alan H.

    2012-01-01

    X-linked myotubular myopathy (MTM) is a severe neuromuscular disease of infancy caused by mutations of MTM1, which encodes the phosphoinositide lipid phosphatase, myotubularin. The Mtm1 knockout (KO) mouse has a severe phenotype and its short lifespan (8 weeks) makes it a challenge to use as a model in the testing of certain preclinical therapeutics. Many MTM patients succumb early in life, but some have a more favorable prognosis. We used human genotype–phenotype correlation data to develop a myotubularin-deficient mouse model with a less severe phenotype than is seen in Mtm1 KO mice. We modeled the human c.205C>T point mutation in Mtm1 exon 4, which is predicted to introduce the p.R69C missense change in myotubularin. Hemizygous male Mtm1 p.R69C mice develop early muscle atrophy prior to the onset of weakness at 2 months. The median survival period is 66 weeks. Histopathology shows small myofibers with centrally placed nuclei. Myotubularin protein is undetectably low because the introduced c.205C>T base change induced exon 4 skipping in most mRNAs, leading to premature termination of myotubularin translation. Some full-length Mtm1 mRNA bearing the mutation is present, which provides enough myotubularin activity to account for the relatively mild phenotype, as Mtm1 KO and Mtm1 p.R69C mice have similar muscle phosphatidylinositol 3-phosphate levels. These data explain the basis for phenotypic variability among human patients with MTM1 p.R69C mutations and establish the Mtm1 p.R69C mouse as a valuable model for the disease, as its less severe phenotype will expand the scope of testable preclinical therapies. PMID:22068590

  11. HCMV protein LUNA is required for viral reactivation from latently infected primary CD14⁺ cells.

    PubMed

    Keyes, Lisa R; Hargett, Danna; Soland, Melisa; Bego, Mariana G; Rossetto, Cyprian C; Almeida-Porada, Graca; St Jeor, Stephen

    2012-01-01

    Human cytomegalovirus (HCMV) is a member of the Herpesviridae family that infects individuals throughout the world. Following an initial lytic stage, HCMV can persist in the individual for life in a non-active (or latent) form. During latency, the virus resides within cells of the myeloid lineage. The mechanisms controlling HCMV latency are not completely understood. A latency associated transcript, UL81-82ast, encoding the protein LUNA (Latency Unique Natural Antigen) was identified from latently infected donors in vivo. To address the role of the UL81-82ast protein product LUNA, in the context of the viral genome, we developed a recombinant HCMV bacterial artificial chromosome (BAC) that does not express LUNA. This construct, LUNA knockout FIX virus (FIX-ΔLUNA), was used to evaluate LUNA's role in HCMV latency. The FIX-ΔLUNA virus was able to lytically infect Human Fibroblast (HF) cells, showing that LUNA is not required to establish a lytic infection. Interestingly, we observed significantly higher viral copy numbers in HF cells infected with FIX-ΔLUNA when compared to FIX-WT virus. Furthermore, FIX-WT and FIX-ΔLUNA genomic DNA and transcription of UL81-82ast persisted over time in primary monocytes. In contrast, the levels of UL138 transcript expression in FIX-ΔLUNA infected HF and CD14⁺ cells was 100 and 1000 fold lower (respectively) when compared to the levels observed for FIX-WT infection. Moreover, FIX-ΔLUNA virus failed to reactivate from infected CD14⁺ cells following differentiation. This lack of viral reactivation was accompanied by a lack of lytic gene expression, increase in viral copy numbers, and lack of the production of infectious units following differentiation of the cells. Our study suggests that the LUNA protein is involved in regulating HCMV reactivation, and that in the absence of LUNA, HCMV may not be able to enter a proper latent state and therefore cannot be rescued from the established persistent infection in CD14⁺ cells.

  12. HCMV pUS28 initiates pro-migratory signaling via activation of Pyk2 kinase

    SciTech Connect

    Vomaske, Jennifer; Varnum, Susan M.; Melnychuk, Ryan; Smith, Patricia; Pasa-Tolic, Ljiljana; Shutthanandan, Janani I.; Streblow, Daniel N.

    2010-12-10

    The HCMV-encoded chemokine receptor US28 mediates smooth muscle cell (SMC) and macrophage motility and this activity has been implicated in the acceleration of vascular disease. US28 induced SMC migration involves the activation of the protein tyrosine kinases (PTKs) Src and Focal adhesion kinase as well as the small GTPase RhoA. In the current study, we examined the involvement of the PTK Pyk2 in US28-induced cellular motility. Expression of a Pyk2 lacking the autophosphorylation site (Tyr-402) blocks US28-mediated SMC migration in response to RANTES, while the kinase-inactive mutant failed to elicit the same negative effect on migration. US28 stimulation with RANTES results in ligand-dependent and calcium-dependent phosphorylation of Pyk2 Tyr-402 and induced the formation of an active Pyk2 kinase complex containing several novel Pyk2 binding proteins. Interestingly, expression of the autophosphorylation site mutant Pyk2 F402Y did not abrogate the formation of an active Pyk2 kinase complex, but instead prevented US28-mediated activation of RhoA. These findings represent the first demonstration that US28 signals through Pyk2 and that this PTK participates in US28-mediated cellular motility via activation of RhoA. Additionally, US28 activated RhoA via Pyk2 in the U373 glioblastoma cells. Interestingly, the Pyk2 kinase complex in U373 contained several proteins known to participate in glioma tumorigenesis. These results provide a potential mechanistic link between HCMV-US28 and glioblastoma cell activation and motility.

  13. Congenital HCMV infection: a collaborative and comparative study of virus detection in amniotic fluid by culture and by PCR.

    PubMed

    Gouarin, S; Palmer, P; Cointe, D; Rogez, S; Vabret, A; Rozenberg, F; Denis, F; Freymuth, F; Lebon, P; Grangeot-Keros, L

    2001-04-01

    Cytomegalovirus (HCMV) infection is the leading cause of congenital virus infection in developed countries, affecting an estimated 1% of births. This antenatal infection can cause serious sequelae. Strategies for prevention and treatment must, therefore, be agreed upon, entailing a preliminary performance assessment of antenatal virus diagnosis techniques. Between 1992 and 1999, HCMV serology status was established for 19456 pregnant women in four French hospitals. Seronegative patients (55.4%) were given serology screening, and antenatal diagnosis was given to 152 women who had shown seroconversion during their pregnancies (1.4%). The detection of HCMV transmission from mother to fetus was finally established in 95 cases, using polymerase chain reaction (PCR) and viral culture methods for detecting HCMV in the amniotic fluid. These results were compared with viral culture of children's urine after birth, enabling us to distinguish between children really infected in utero (30%) and non-infected children (70%). The results of the virus culture and those of PCR were identical in 94 of the 95 cases, with one discrepancy (culture-/PCR+). The two diagnosis techniques had identical sensitivity (72%), with culture proving slightly more specific than PCR (98.4% as opposed to 96.9%). Positive prediction values for culture and for PCR were, respectively, 95.6 and 91.3%. Antenatal virus diagnosis on amniotic fluid was negative with both techniques in 8 out of 29 cases of children born with HCMV infection (VPN=89%). Over half of these wrongly negative results can be explained by amniocentesis carried out too early in the pregnancy or too early with respect to the mother's primary infection.

  14. Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones specifically activated by IE1 peptides in vitro.

    PubMed Central

    Davignon, J L; Castanié, P; Yorke, J A; Gautier, N; Clément, D; Davrinche, C

    1996-01-01

    The control of latent cytomegalovirus (CMV) infections by the immune system is poorly understood. We have previously shown that CD4+ T cells specific for the human CMV major regulatory protein IE1 are frequent in latently infected healthy blood donors. In order to learn about the possible role of these cells, we have developed IE1-specific CD4+ T-cell clones and, in this study, analyzed their epitope specificity and function in vitro. We measured their cytokine production when stimulated with specific IE1 peptides or whole recombinant IE1 protein. Their cytokine profiles, as deduced from gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), and interleukin-4 (IL-4) and IL-6 production, were of the Th0- and Th1-like phenotypes. Supernatants from IE1-specific clones producing IFN-gamma and TNF-alpha were shown to inhibit CMV replication in U373 MG cells. This effect was due, as found by using cytokine-specific neutralizing antibodies, mostly to IFN-gamma, which was secreted at higher levels than TNF-alpha. To better assess the anti-CMV activity of cytokines, recombinant IFN-gamma and TNF-alpha were used and shown to have a synergistic effect on the inhibition of CMV replication and protein expression. Thus, IE1-specific CD4+ T cells display in vitro anti-CMV activity through cytokine secretion and may play a role in the control of in vivo latent infections. PMID:8642638

  15. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell.

  16. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  17. Autoreactivity of primary human immunoglobulins ancestral to hypermutated human antibodies that neutralize HCMV.

    PubMed

    McLean, Gary R; Cho, Chin-wen; Schrader, John W

    2006-05-01

    The human antibody response to the AD-2S1 epitope of glycoprotein B (gB) of human cytomegalovirus (HCMV) is dominated by a family of closely related somatically mutated antibodies. These antibodies neutralize viral infectivity and the genes encoding them are derived from two commonly used germ-line variable (V) region genes, IGHV3-30 and IGKV3-11. Recombination of these V genes with the appropriate junctional diversity generates genes that encode primary immunoglobulins that bind to AD-2S1. To further understand the initial primary immunoglobulin response to AD-2S1 we synthesized the germ-line-based ancestor of one such family of antibodies and showed that it bound gB at the AD-2S1 epitope. Here we show that the germ-line ancestor of a second family of antibodies likewise binds to gB. We further show that one of the ancestral primary immunoglobulins, but not the other, also recognized autoantigens. In contrast, the hypermutated derivatives did not demonstrate autoreactivity and minor structural changes in the primary immunoglobulin were sufficient to generate or abolish autoreactivity or to change specificity. Thus, our demonstration that the ancestor of a highly mutated, non-autoreactive antiviral IgG antibody binds nuclear and cell-surface autoantigens indicates for the first time that self-reactivity is not necessarily a barrier to development into a follicular B lymphocyte that undergoes antigen-initiated affinity maturation.

  18. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Donnarumma, Danilo; Nikitin, Pavel A.; Cianfrocco, Michael A.; Gerrein, Rachel; Feire, Adam L.; Barnett, Susan W.; Lilja, Anders E.; Rappuoli, Rino; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and the leading viral cause of birth defects after congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are key targets of the human humoral response against HCMV and are required for HCMV entry into fibroblasts and endothelial/epithelial cells, respectively. We expressed and characterized soluble forms of gH/gL, gH/gL/gO, and Pentamer. Mass spectrometry and mutagenesis analysis revealed that gL-Cys144 forms disulfide bonds with gO-Cys351 in gH/gL/gO and with UL128-Cys162 in the Pentamer. Notably, Pentamer harboring the UL128-Cys162Ser/gL-Cys144Ser mutations had impaired syncytia formation and reduced interference of HCMV entry into epithelial cells. Electron microscopy analysis showed that HCMV gH/gL resembles HSV gH/gL and that gO and UL128/UL130/UL131A bind to the same site at the gH/gL N terminus. These data are consistent with gH/gL/gO and Pentamer forming mutually exclusive cell entry complexes and reveal the overall location of gH/gL-, gH/gL/gO-, and Pentamer-specific neutralizing antibody binding sites. Our results provide, to our knowledge, the first structural view of gH/gL/gO and Pentamer supporting the development of vaccines and antibody therapeutics against HCMV. PMID:25624487

  19. First Dominique Dormont international conference on "Host-pathogen interactions in chronic infections – viral and host determinants of HCV, HCMV, and HIV infections"

    PubMed Central

    Menu, Elisabeth; Müller-Trutwin, Mickaela C; Pancino, Gianfranco; Saez-Cirion, Asier; Bain, Christine; Inchauspé, Geneviève; Gras, Gabriel S; Mabondzo, Aloïse M; Samri, Assia; Boutboul, Françoise; Grand, Roger Le

    2005-01-01

    The first Dominique Dormont International Conference on "Viral and host determinantsof HCV, HCMV, and HIV infections "was held in Paris, Val-de-Grâce, on December 3–4, 2004. The following is a summary of the scientific sessions of this meeting (). PMID:15813969

  20. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology.

    PubMed

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-11-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  1. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology

    PubMed Central

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-01-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498 HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  2. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A.; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  3. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies.

    PubMed

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C; Carfi, Andrea

    2015-10-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  4. EBV, HCMV, HHV6, and HHV7 Screening in Bone Marrow Samples from Children with Acute Lymphoblastic Leukemia

    PubMed Central

    Morales-Sánchez, A.; Pompa-Mera, E. N.; Fajardo-Gutiérrez, A.; Alvarez-Rodríguez, F. J.; Bekker-Méndez, V. C.; Flores-Chapa, J. de Diego; Flores-Lujano, J.; Jiménez-Hernández, E.; Peñaloza-González, J. G.; Rodríguez-Zepeda, M. C.; Torres-Nava, J. R.; Velázquez-Aviña, M. M.; Amador-Sánchez, R.; Alvarado-Ibarra, M.; Reyes-Zepeda, N.; Espinosa-Elizondo, R. M.; Pérez-Saldivar, M. L.; Núñez-Enríquez, J. C.; Mejía-Aranguré, J. M.; Fuentes-Pananá, E. M.

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  5. Signal peptide cleavage of a type I membrane protein, HCMV US11, is dependent on its membrane anchor

    PubMed Central

    Rehm, Armin; Stern, Patrick; Ploegh, Hidde L.; Tortorella, Domenico

    2001-01-01

    The human cytomegalovirus (HCMV) US11 polypeptide is a type I membrane glycoprotein that targets major histocompatibility complex (MHC) class I molecules for destruction in a proteasome-dependent manner. Although the US11 signal sequence appears to be a classical N-terminal signal peptide in terms of its sequence and cleavage site, a fraction of newly synthesized US11 molecules retain the signal peptide after the N-linked glycan has been attached and translation of the US11 polypeptide has been completed. Delayed cleavage of the US11 signal peptide is determined by the first four residues, the so-called n-region of the signal peptide. Its replacement with the four N-terminal residues of the H-2Kb signal sequence eliminates delayed cleavage. Surprisingly, a second region that affects the rate and extent of signal peptide cleavage is the transmembrane region close to the C-terminus of US11. Deletion of the transmembrane region of US11 (US11-180) significantly delays processing, a delay overcome by replacement with the H-2Kb signal sequence. Thus, elements at a considerable distance from the signal sequence affect its cleavage. PMID:11285222

  6. EBV, HCMV, HHV6, and HHV7 screening in bone marrow samples from children with acute lymphoblastic leukemia.

    PubMed

    Morales-Sánchez, A; Pompa-Mera, E N; Fajardo-Gutiérrez, A; Alvarez-Rodríguez, F J; Bekker-Méndez, V C; Flores-Chapa, J de Diego; Flores-Lujano, J; Jiménez-Hernández, E; Peñaloza-González, J G; Rodríguez-Zepeda, M C; Torres-Nava, J R; Velázquez-Aviña, M M; Amador-Sánchez, R; Alvarado-Ibarra, M; Reyes-Zepeda, N; Espinosa-Elizondo, R M; Pérez-Saldivar, M L; Núñez-Enríquez, J C; Mejía-Aranguré, J M; Fuentes-Pananá, E M

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  7. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  8. Is CMV a target in pediatric glioblastoma? Expression of CMV proteins, pp65 and IE1-72 and CMV nucleic acids in a cohort of pediatric glioblastoma patients.

    PubMed

    Wakefield, Amanda; Pignata, Antonella; Ghazi, Alexia; Ashoori, Aidin; Hegde, Meenakshi; Landi, Daniel; Gray, Tara; Scheurer, Michael E; Chintagumpala, Murali; Adesina, Adekunle; Gottschalk, Stephen; Hicks, John; Powell, Suzanne Z; Ahmed, Nabil

    2015-11-01

    While the 5-year overall survival is better in pediatric than in adult patients diagnosed with glioblastoma (GBM), outcomes in children remain very poor. Understanding the mechanisms of tumorigenesis and tumor propagation can identify therapeutic targets to improve these outcomes. Human cytomegalovirus (CMV) proteins and nucleic acids are present in the majority of adult GBM. Indeed, CMV is emerging as a potential glioma-associated target for anti-CMV agents and cellular therapeutics. Furthermore, CMV appears to contribute to GBM's malignant phenotype, although its role in tumorigenesis is less certain. In this cohort of 25 serially diagnosed pediatric GBMs, the largest described cohort to date, we used immunohistochemical staining and in situ hybridization to show the presence of CMV antigens pp65 and IE1-72 as well as CMV nucleic acids, respectively. Our cohort indicated either CMV antigen pp65 or IE1-72 was present in approximately 67 % of pediatric GBM samples. The majority of samples stained positive for either CMV antigen showing a cytoplasmic pattern in 25-50 % of cells within the sample at a moderate intensity, while a few samples showed nuclear staining and higher grade/intensity. Of 16 samples where in situ hybridization was performed, 13 (81 %) showed specific staining using a CMV genome specific probe cocktail. ISH positive samples showed high concordance with being pp65 or IE1-72 positive. These findings, paired with the association of CMV expression with poor prognosis and overall survival, indicate the need to further investigate how these antigens are promoting tumor growth and preventing cell death. Also, the expression of these antigens in a majority of tumor tissues should be considered for immunotherapeutic targets in cases of pediatric GBM. PMID:26341370

  9. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  10. Co-expression of four baculovirus proteins, IE1, LEF3, P143, and PP31, elicits a cellular chromatin-containing reticulate structure in the nuclei of uninfected cells

    SciTech Connect

    Nagamine, Toshihiro; Abe, Atsushi; Suzuki, Takehiro; Dohmae, Naoshi; Matsumoto, Shogo

    2011-08-15

    Baculovirus DNA replication, transcription, and nucleocapsid assembly occur within a subnuclear structure called the virogenic stroma (VS) that consists of two subcompartments. Specific components of the VS sub-compartments have not been identified except for PP31, a DNA-binding protein that localizes specifically to the electron-dense region of VS. Here, we investigate the dynamic structure of VS using a GFP-tagged PP31 molecule (GFP-PP31). GFP-PP31 localizes to the VS throughout the course of infection. At later times post-infection, a PP31 reticulum distributed within VS was also apparent, indicating that VS sub-compartments compose a reticulate structure. Transient expression of PP31 with the viral proteins, IE1, LEF3, and P143, in uninfected cells resulted in the formation of a reticulate structure containing cellular chromatin and the spatial arrangements of the four proteins within the induced reticulum were the same as those within VS reticulum, suggesting that the two reticula are formed by a similar mechanism.

  11. Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

    SciTech Connect

    Das, Subhendu; Pellett, Philip E. . E-mail: pelletp@ccf.org

    2007-05-10

    The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress.

  12. Structure of the HCMV UL16-MICB complex elucidates select binding of a viral immunoevasin to diverse NKG2D ligands.

    PubMed

    Müller, Steffen; Zocher, Georg; Steinle, Alexander; Stehle, Thilo

    2010-01-01

    The activating immunoreceptor NKG2D promotes elimination of infected or malignant cells by cytotoxic lymphocytes through engagement of stress-induced MHC class I-related ligands. The human cytomegalovirus (HCMV)-encoded immunoevasin UL16 subverts NKG2D-mediated immune responses by retaining a select group of diverse NKG2D ligands inside the cell. We report here the crystal structure of UL16 in complex with the NKG2D ligand MICB at 1.8 A resolution, revealing the molecular basis for the promiscuous, but highly selective, binding of UL16 to unrelated NKG2D ligands. The immunoglobulin-like UL16 protein utilizes a three-stranded beta-sheet to engage the alpha-helical surface of the MHC class I-like MICB platform domain. Intriguingly, residues at the center of this beta-sheet mimic a central binding motif employed by the structurally unrelated C-type lectin-like NKG2D to facilitate engagement of diverse NKG2D ligands. Using surface plasmon resonance, we find that UL16 binds MICB, ULBP1, and ULBP2 with similar affinities that lie in the nanomolar range (12-66 nM). The ability of UL16 to bind its ligands depends critically on the presence of a glutamine (MICB) or closely related glutamate (ULBP1 and ULBP2) at position 169. An arginine residue at this position however, as found for example in MICA or ULBP3, would cause steric clashes with UL16 residues. The inability of UL16 to bind MICA and ULBP3 can therefore be attributed to single substitutions at key NKG2D ligand locations. This indicates that selective pressure exerted by viral immunoevasins such as UL16 contributed to the diversification of NKG2D ligands.

  13. Structure of the HCMV UL16-MICB complex elucidates select binding of a viral immunoevasin to diverse NKG2D ligands.

    PubMed

    Müller, Steffen; Zocher, Georg; Steinle, Alexander; Stehle, Thilo

    2010-01-01

    The activating immunoreceptor NKG2D promotes elimination of infected or malignant cells by cytotoxic lymphocytes through engagement of stress-induced MHC class I-related ligands. The human cytomegalovirus (HCMV)-encoded immunoevasin UL16 subverts NKG2D-mediated immune responses by retaining a select group of diverse NKG2D ligands inside the cell. We report here the crystal structure of UL16 in complex with the NKG2D ligand MICB at 1.8 A resolution, revealing the molecular basis for the promiscuous, but highly selective, binding of UL16 to unrelated NKG2D ligands. The immunoglobulin-like UL16 protein utilizes a three-stranded beta-sheet to engage the alpha-helical surface of the MHC class I-like MICB platform domain. Intriguingly, residues at the center of this beta-sheet mimic a central binding motif employed by the structurally unrelated C-type lectin-like NKG2D to facilitate engagement of diverse NKG2D ligands. Using surface plasmon resonance, we find that UL16 binds MICB, ULBP1, and ULBP2 with similar affinities that lie in the nanomolar range (12-66 nM). The ability of UL16 to bind its ligands depends critically on the presence of a glutamine (MICB) or closely related glutamate (ULBP1 and ULBP2) at position 169. An arginine residue at this position however, as found for example in MICA or ULBP3, would cause steric clashes with UL16 residues. The inability of UL16 to bind MICA and ULBP3 can therefore be attributed to single substitutions at key NKG2D ligand locations. This indicates that selective pressure exerted by viral immunoevasins such as UL16 contributed to the diversification of NKG2D ligands. PMID:20090832

  14. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients. The specific scFv1 and scFv3 with lower neutralizing effects can be used for diagnostic purposes. PMID:27217918

  15. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  16. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  17. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    SciTech Connect

    Rudwaleit, M.; Bowness, P.; Wordsworth, P.

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  18. The human cytotoxic T-lymphocyte (CTL) response to cytomegalovirus is dominated by structural protein pp65: frequency, specificity, and T-cell receptor usage of pp65-specific CTL.

    PubMed Central

    Wills, M R; Carmichael, A J; Mynard, K; Jin, X; Weekes, M P; Plachter, B; Sissons, J G

    1996-01-01

    Cytotoxic T lymphocytes (CTL) appear to play an important role in the control of human cytomegalovirus (HCMV) in the normal virus carrier: previous studies have identified peripheral blood CD8+ CTL specific for the HCMV major immediate-early gene product (IE1) and more recently, by bulk culture and cloning techniques, have identified CTL specific for a structural gene product, the lower matrix protein pp65. In order to determine the relative contributions of CTL which recognize the HCMV proteins IE1, pp65, and glycoprotein B (gB) to the total HCMV-specific CTL response, we have used a limiting-dilution analysis system to quantify HCMV-specific CTL precursors with different specificities, allowing the antigenic specificity of multiple short-term CTL clones to be assessed, in a group of six healthy seropositive donors. All donors showed high frequencies of HCMV-specific major histocompatibility complex-restricted CTL precursors. There was a very high frequency of CTL specific for pp65 (lower matrix protein); IE1-specific CTL were also detectable at lower frequencies in three of five donors, while CTL directed to gB were undetectable. A pp65 gene deletion mutant of HCMV was then used to estimate the contribution of pp65-specific CTL to the total HCMV-specific CTL response; this showed that between 70 and 90% of all CTL recognizing HCMV-infected cells were pp65 specific. Analysis of the peptide specificity of pp65-specific CTL showed that some donors have a highly focused response recognizing a single peptide; the T-cell receptor Vbeta gene usage in these two donors was shown to be remarkably restricted, with over half of the responding CD8+ T cells utilizing a single Vbeta gene rearrangement. Other subjects recognized multiple pp65 peptides: nine new pp65 CTL peptide epitopes were defined, and for five of these the HLA-presenting allele has been identified. All four of the HLA A2 donors tested in this study recognized the same peptide. This apparent domination of the

  19. 11 CFR 300.52 - Fundraising by Federal candidates and Federal officeholders (2 U.S.C. 441i(e)(1)&(4)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... (iii) Generic campaign activity as defined in 11 CFR 100.25. (d) Prohibited solicitations. A Federal... activity: (1) Voter registration activity, as described in 11 CFR 100.24(a)(2), during the period that... election in which one or more Federal candidates appear on the ballot (see 11 CFR 100.24(a)(1)),...

  20. 11 CFR 300.65 - Exceptions for certain tax-exempt organizations (2 U.S.C. 441i(e)(1) and (4)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...(a)(3); or (iii) Generic campaign activity as defined in 11 CFR 100.25. (d) Prohibited solicitations... Federal election activity: (1) Voter registration activity, as described in 11 CFR 100.24(a)(2), during... connection with an election in which one or more Federal candidates appear on the ballot (see 11 CFR...

  1. Differential relocation and stability of PML-body components during productive human cytomegalovirus infection: detailed characterization by live-cell imaging.

    PubMed

    Dimitropoulou, Panagiota; Caswell, Richard; McSharry, Brian P; Greaves, Richard F; Spandidos, Demetrios A; Wilkinson, Gavin W G; Sourvinos, George

    2010-10-01

    In controlling the switch from latency to lytic infection, the immediate early (IE) genes lie at the core of herpesvirus pathogenesis. To image the 72kDa human cytomegalovirus (HCMV) major IE protein (IE1-72K), a recombinant virus encoding IE1 fused with EGFP was constructed. Using this construct, the IE1-EGFP fusion was detected at ND10 (PML-bodies) within 2h post infection (p.i.) and the complete disruption of ND10 imaged through to 6h p.i. HCMV genomes and IE2-86K protein could be detected adjacent to the slowly degrading IE1-72K/ND10 foci. IE1-72K associates with metaphase chromatin, recruiting both PML and STAT2. hDaxx, STAT1 and IE2-86K did not re-locate to metaphase chromatin; the fate of hDaxx is particularly important as this protein contributes to an intrinsic barrier to HCMV infection. While IE1-72K participates in a complex with chromatin, PML, STAT2 and Sp100, IE1-72K releases hDaxx from ND10 yet does not appear to remain associated with it.

  2. Positive Role of Promyelocytic Leukemia Protein in Type I Interferon Response and Its Regulation by Human Cytomegalovirus

    PubMed Central

    Kim, Young-Eui; Ahn, Jin-Hyun

    2015-01-01

    Promyelocytic leukemia protein (PML), a major component of PML nuclear bodies (also known as nuclear domain 10), is involved in diverse cellular processes such as cell proliferation, apoptosis, gene regulation, and DNA damage response. PML also acts as a restriction factor that suppresses incoming viral genomes, therefore playing an important role in intrinsic defense. Here, we show that PML positively regulates type I interferon response by promoting transcription of interferon-stimulated genes (ISGs) and that this regulation by PML is counteracted by human cytomegalovirus (HCMV) IE1 protein. Small hairpin RNA-mediated PML knockdown in human fibroblasts reduced ISG induction by treatment of interferon-β or infection with UV-inactivated HCMV. PML was required for accumulation of activated STAT1 and STAT2, interacted with them and HDAC1 and HDAC2, and was associated with ISG promoters after HCMV infection. During HCMV infection, viral IE1 protein interacted with PML, STAT1, STAT2, and HDACs. Analysis of IE1 mutant viruses revealed that, in addition to the STAT2-binding domain, the PML-binding domain of IE1 was necessary for suppression of interferon-β-mediated ISG transcription, and that IE1 inhibited ISG transcription by sequestering interferon-stimulated gene factor 3 (ISGF3) in a manner requiring its binding of PML and STAT2, but not of HDACs. In conclusion, our results demonstrate that PML participates in type I interferon-induced ISG expression by regulating ISGF3, and that this regulation by PML is counteracted by HCMV IE1, highlighting a widely shared viral strategy targeting PML to evade intrinsic and innate defense mechanisms. PMID:25812002

  3. The murine cytomegalovirus (MCMV) homolog of the HCMV phosphotransferase (UL97(pk)) gene.

    PubMed

    Rawlinson, W D; Zeng, F; Farrell, H E; Cunningham, A L; Scalzo, A A; Booth, T W; Scott, G M

    1997-07-01

    The murine cytomegalovirus (MCMV) M97 gene is homologous with both eukaryotic protein kinases and the phosphotransferases of herpesviruses. The gene conserves the domain structure of protein kinases and of the human cytomegalovirus UL97 (phosphotransferase) gene. An M97 transcript of 2.5 kb is present predominantly at late times, and much smaller quantities of the transcript are detected at early times postinfection. Comparison of the DNA sequences of the complete M97 genes from 12 ganciclovir-sensitive and aciclovir-sensitive strains of MCMV showed that the sensitive isolates strongly conserve the sequence of the catalytic domains, but have only moderate conservation of the sequence of the amino-terminal (regulatory) region. MCMV provides a useful model for studying the in vivo function of the phosphotransferase genes of the betatherpesviruses and has potential for use in studies of antiviral resistance. PMID:9217058

  4. Immune evasion proteins gpUS2 and gpUS11 of human cytomegalovirus incompletely protect infected cells from CD8 T cell recognition.

    PubMed

    Besold, K; Wills, M; Plachter, B

    2009-08-15

    Human cytomegalovirus (HCMV) encodes four glycoproteins, termed gpUS2, gpUS3, gpUS6 and gpUS11 that interfere with MHC class I biosynthesis and antigen presentation. Despite gpUS2-11 expression, however, HCMV infection is efficiently controlled by cytolytic CD8 T lymphocytes (CTL). To address the role of gpUS2 and gpUS11 in antigen presentation during viral infection, HCMV mutants were generated that expressed either gpUS2 or gpUS11 alone without coexpression of the three other proteins. Fibroblasts infected with these viruses showed reduced HLA-A2 and HLA-B7 surface expression. Surprisingly, however, CTL directed against the tegument protein pp65 and the regulatory IE1 protein still recognized and lysed mutant virus infected fibroblasts. Yet, suppression of IE1 derived peptide presentation by gpUS2 or gpUS11 was far more pronounced. The results show that gpUS2 and gpUS11 alone only incompletely protect HCMV infected fibroblasts from CTL recognition and underline the importance of studying infected cells to elucidate HCMV immune evasion.

  5. RT-qPCR-based microneutralization assay for human cytomegalovirus using fibroblasts and epithelial cells.

    PubMed

    Wang, Xiao; Peden, Keith; Murata, Haruhiko

    2015-12-16

    Human cytomegalovirus (HCMV) is a leading cause of congenital infection that can result in serious disabilities in affected children. To facilitate HCMV vaccine development, a microscale neutralization assay based on reverse transcription quantitative PCR (RT-qPCR) was developed to quantify HCMV-neutralizing antibodies. Our approach relies on the generation of crude lysates from virus-infected cells that are amenable to direct analysis by RT-qPCR, thereby circumventing rate-limiting procedures associated with sample RNA extraction and purification. By serial passaging of the laboratory HCMV strain AD169 in epithelial cells (ARPE-19), a revertant virus with restored epithelial cell tropism, designated AD169(wt131), was obtained. AD169 and AD169(wt131) were evaluated in both epithelial cells (ARPE-19) and fibroblasts (MRC-5) by one-step RT-qPCR targeting the immediate-early gene IE1 transcript of HCMV. Expression kinetics indicated that RT-qPCR assessment could be conducted as early as 6h post-infection. Human serum samples (n=30) from healthy donors were tested for HCMV-specific IgG using a commercially available ELISA and for HCMV-neutralizing activity using our RT-qPCR-based neutralization assay. In agreement with the ELISA results, higher neutralizing activity was observed in the HCMV IgG seropositive group when compared with the HCMV IgG seronegative group. In addition, HCMV IgG seropositive human sera exhibited higher neutralizing titers using epithelial cells compared with using fibroblasts (geometric mean titers of 344 and 8 in ARPE-19 cells and MRC-5 cells, respectively). Our assay was robust to variation in input virus dose. In addition, a simple lysis buffer containing a non-ionic detergent was successfully demonstrated to be a less costly alternative to commercial reagents for cell-lysate preparation. Thus, our rapid HCMV neutralization assay may be a straightforward and flexible high-throughput tool for measuring antibody responses induced by vaccination

  6. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  7. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  8. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian

    2014-01-01

    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  9. Human Cytomegalovirus pUL29/28 and pUL38 Repression of p53-Regulated p21CIP1 and Caspase 1 Promoters during Infection

    PubMed Central

    Savaryn, John P.; Reitsma, Justin M.; Bigley, Tarin M.; Halligan, Brian D.; Qian, Zhikang; Yu, Dong

    2013-01-01

    During infection by human cytomegalovirus (HCMV), the tumor suppressor protein p53, which promotes efficient viral gene expression, is stabilized. However, the expression of numerous p53-responsive cellular genes is not upregulated. The molecular mechanism used to manipulate the transcriptional activity of p53 during infection remains unclear. The HCMV proteins IE1, IE2, pUL44, and pUL84 likely contribute to the regulation of p53. In this study, we used a discovery-based approach to identify the protein targets of the HCMV protein pUL29/28 during infection. Previous studies have demonstrated that pUL29/28 regulates viral gene expression by interacting with the chromatin remodeling complex NuRD. Here, we observed that pUL29/28 also associates with p53, an additional deacetylase complex, and several HCMV proteins, including pUL38. We confirmed the interaction between p53 and pUL29/28 in both the presence and absence of infection. HCMV pUL29/28 with pUL38 altered the activity of the 53-regulatable p21CIP1 promoter. During infection, pUL29/28 and pUL38 contributed to the inhibition of p21CIP1 as well as caspase 1 expression. The expression of several other p53-regulating genes was not altered. Infection using a UL29-deficient virus resulted in increased p53 binding and histone H3 acetylation at the responsive promoters. Furthermore, expression of pUL29/28 and its interacting partner pUL38 contributed to an increase in the steady-state protein levels of p53. This study identified two additional HCMV proteins, pUL29/28 and pUL38, which participate in the complex regulation of p53 transcriptional activity during infection. PMID:23236067

  10. Novel real-time monitoring system for human cytomegalovirus-infected cells in vitro that uses a green fluorescent protein-PML-expressing cell line.

    PubMed

    Ueno, T; Eizuru, Y; Katano, H; Kurata, T; Sata, T; Irie, S; Ogawa-Goto, K

    2006-08-01

    Promyelocytic leukemia (PML) bodies are discrete nuclear foci that are intimately associated with many DNA viruses. In human cytomegalovirus (HCMV) infection, the IE1 (for "immediate-early 1") protein has a marked effect on PML bodies via de-SUMOylation of PML protein. Here, we report a novel real-time monitoring system for HCMV-infected cells using a newly established cell line (SE/15) that stably expresses green fluorescent protein (GFP)-PML protein. In SE/15 cells, HCMV infection causes specific and efficient dispersion of GFP-PML bodies in an IE1-dependent manner, allowing the infected cells to be monitored by fluorescence microscopy without immunostaining. Since a specific change in the detergent solubility of GFP-PML occurs upon infection, the infected cells can be quantified by GFP fluorescence measurement after extraction. With this assay, the inhibitory effects of heparin and neutralizing antibodies were determined in small-scale cultures, indicating its usefulness for screening inhibitory reagents for laboratory virus strains. Furthermore, we established a sensitive imaging assay by counting the number of nuclei containing dispersed GFP-PML, which is applicable for titration of slow-growing clinical isolates. In all strains tested, the virus titers estimated by the GFP-PML imaging assay were well correlated with the plaque-forming cell numbers determined in human embryonic lung cells. Coculture of SE/15 cells and HCMV-infected fibroblasts permitted a rapid and reliable method for estimating the 50% inhibitory concentration values of drugs for clinical isolates in susceptibility testing. Taken together, these results demonstrate the development of a rapid, sensitive, quantitative, and specific detection system for HCMV-infected cells involving a simple procedure that can be used for titration of low-titer clinical isolates.

  11. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  12. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators

    PubMed Central

    Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-01-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  13. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators.

    PubMed

    Kim, Ye Ji; Kim, Eui Tae; Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-08-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  14. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang

    2016-01-01

    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  15. Multiple phosphorylation sites at the C-terminus regulate nuclear import of HCMV DNA polymerase processivity factor ppUL44

    SciTech Connect

    Alvisi, Gualtiero; Marin, Oriano; Pari, Gregory; Mancini, Manuela; Avanzi, Simone; Loregian, Arianna; Jans, David A.; Ripalti, Alessandro

    2011-09-01

    The processivity factor of human cytomegalovirus DNA polymerase, phosphoprotein ppUL44, is essential for viral replication. During viral infection ppUL44 is phosphorylated by the viral kinase pUL97, but neither the target residues on ppUL44 nor the effect of phosphorylation on ppUL44's activity are known. We report here that ppUL44 is phosphorylated when transiently expressed in mammalian cells and coimmunoprecipitates with cellular kinases. Of three potential phosphorylation sites (S413, S415, S418) located upstream of ppUL44's nuclear localization signal (NLS) and one (T427) within the NLS itself, protein kinase CK2 (CK2) specifically phosphorylates S413, to trigger a cascade of phosphorylation of S418 and S415 by CK1 and CK2, respectively. Negative charge at the CK2/CK1 target serine residues facilitates optimal nuclear accumulation of ppUL44, whereas negative charge on T427, a potential cyclin-dependent 1 phosphorylation site, strongly decreases nuclear accumulation. Thus, nuclear transport of ppUL44 is finely tuned during viral infection through complex phosphorylation events.

  16. Impact of recombinant DNA technology and protein engineering on structure-based drug design: case studies of HIV-1 and HCMV proteases.

    PubMed

    Kan, Chen-Chen

    2002-03-01

    Structure-based drug design is an organized, multidisciplinary endeavor undertaken by scientists from many different scientific fields. The success of structure-based drug design was only made possible by advances in structure biology that provides the three-dimensional structure of the drug design target with which small molecular chemical ligands interact. Visualization of the conformation and interactions of a small molecule ligand bound to the protein target in the co-crystal structure of the protein:ligand complex enables the design of new chemical compounds with improved binding affinity and specificity. With the advances in molecular biology, lab automation, and computational science, genomic data have now become available for the human genome, as well as various other organisms. The pharmaceutical industry is currently putting forth tremendous effort in the area of functional genomics and structural genomics in attempts to decipher functions and structures of protein encoded by genes, with the ultimate goal of identifying novel targets for drug discovery and development. This chapter discusses the significant impact made by recombinant DNA technology and protein engineering on structural biology and, more specifically, on structure-based drug design.

  17. Role of myeloid human cytomegalovirus infection in children's idiopathic thrombocytopenic purpura.

    PubMed

    Ding, Yan; Zhao, Lei; Mei, Hong; Zhang, Shu-Ling; Huang, Zhi-Hua

    2007-01-01

    This project explores the specificity of myeloid human cytomegalovirus (HCMV) infection in pathogenesis of idiopathic thrombocytopenic purpura (ITP). Eighty-one subjects with ITP were observed. HCMV early antigen and related myeloid cells in bone marrow, and platelet, HCMV IgM, and IgG in blood were tested. The results presented potent evidence that myeloid HCMV infection is a specific factor in children's ITP: patients of ITP with myeloid HCMV infection had a tendency for exacerbation, refractoriness, and chronic advance. However, HCMV did not affect the quantity of megakaryocyte, which showed the complicated relationships between HCMV and ITP.

  18. Reconstitution of Human Cytomegalovirus-Specific CD4+ T Cells is Critical for Control of Virus Reactivation in Hematopoietic Stem Cell Transplant Recipients but Does Not Prevent Organ Infection.

    PubMed

    Gabanti, Elisa; Lilleri, Daniele; Ripamonti, Francesco; Bruno, Francesca; Zelini, Paola; Furione, Milena; Colombo, Anna A; Alessandrino, Emilio P; Gerna, Giuseppe

    2015-12-01

    The relative contribution of human cytomegalovirus (HMCV)-specific CD4(+) and CD8(+) T cells to the control of HCMV infection in hematopoietic stem cell transplant (HSCT) recipients is still controversial. HCMV reactivation and HCMV-specific CD4(+) and CD8(+) T cell reconstitution were monitored for 1 year in 63 HCMV-seropositive patients receiving HSCT. HCMV reactivation was detected in all but 2 patients. In 20 of 63 (31.7%) patients (group 1) HCMV infection resolved spontaneously, whereas 32 of 63 (50.8%) patients (group 2) controlled the infection after a single short-course of pre-emptive therapy and the remaining 9 (14.3%) patients (group 3) suffered from relapsing episodes of HCMV infection, requiring multiple courses of antiviral therapy. The kinetics and magnitude of HCMV-specific CD8(+) T cell reconstitution were comparable among the 3 groups, but HCMV-specific CD4(+) T cells were lower in number in patients requiring antiviral treatment. HCMV-seronegative donors, as well as unrelated donors (receiving antithymocyte globulin) and acute graft-versus-host disease (GVHD) were associated with both delayed HCMV-specific CD4(+) T cell reconstitution and severity of infection. Conversely, these risk factors had no impact on HCMV-specific CD8(+) T cells. Eight patients with previous GVHD suffered from HCMV gastrointestinal disease, although in the presence of HCMV-specific CD4(+) and CD8(+) systemic immunity and undetectable HCMV DNA in blood. Reconstitution of systemic HCMV-specific CD4(+) T cell immunity is required for control of HCMV reactivation in adult HSCT recipients, but it may not be sufficient to prevent late-onset organ localization in patients with GVHD. HCMV-specific CD8(+) T cells contribute to control of HCMV infection, but only after HCMV-specific CD4(+) T cell reconstitution.

  19. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape.

    PubMed

    Landolfo, Santo; De Andrea, Marco; Dell'Oste, Valentina; Gugliesi, Francesca

    2016-08-12

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed "restriction factors" (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell's intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  20. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape

    PubMed Central

    Landolfo, Santo; De Andrea, Marco; Dell’Oste, Valentina; Gugliesi, Francesca

    2016-01-01

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed “restriction factors” (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell’s intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  1. Discordant humoral and cellular immune responses to Cytomegalovirus (CMV) in glioblastoma patients whose tumors are positive for CMV

    PubMed Central

    Rahbar, Afsar; Peredo, Inti; Solberg, Nina Wolmer; Taher, Chato; Dzabic, Mensur; Xu, Xinling; Skarman, Petra; Fornara, Olesja; Tammik, Charlotte; Yaiw, Koon; Wilhelmi, Vanessa; Assinger, Alice; Stragliotto, Giuseppe; Söderberg-Naucler, Cecilia

    2015-01-01

    Background. Glioblastoma (GBM) is the most common malignant brain tumor in adults and is nearly always fatal. Emerging evidence suggests that human Cytomegalovirus (HCMV) is present in 90–100% of GBMs and that add-on antiviral treatment for HCMV show promise to improve survival. Methods. In a randomized, placebo-controlled trial of valganciclovir in 42 GBM patients, blood samples were collected for analyses of HCMV DNA, RNA, reactivity against HCMV peptides, IgG, and IgM at baseline and at 3, 12, and 24 weeks of treatment. Results. All 42 tumors were positive for HCMV protein. All patients examined had at least one blood sample positive for HCMV DNA, 63% were HCMV RNA positive, and 21% were IgM positive. However, 29% of GBM patients were IgG negative for HCMV. Five of these samples were positive in an enzyme-linked immunosorbent assay (ELISA) that used antigens derived from a clinical isolate. Blood T cells from 11 of 13 (85%) HCMV IgG-negative GBM patients reacted against HCMV peptides. Valganciclovir did not affect IgG titers, DNA, or RNA levels of the HCMV immediate early (HCMV IE) gene in blood. Conclusion. In GBM patients, HCMV activity is higher than in healthy controls and serology is a poor test to define previous or active HCMV infection in these patients. PMID:25949880

  2. NKG2C+CD57+ Natural Killer Cell Expansion Parallels Cytomegalovirus-Specific CD8+ T Cell Evolution towards Senescence

    PubMed Central

    Heath, John; Newhook, Nicholas; Comeau, Emilie; Gallant, Maureen; Fudge, Neva

    2016-01-01

    Objective. Measuring NKG2C+CD57+ natural killer (NK) cell expansion to investigate NK responses against human cytomegalovirus (HCMV) and assessing relationships with adaptive immunity against HCMV. Methods. Expansion of NKG2C+CD57+ NK was measured in peripheral blood mononuclear cells (PBMC) from groups distinguished by HCMV and human immunodeficiency virus (HIV) infection status. Anti-HCMV antibody levels against HCMV-infected MRC-5 cell lysate were assessed by ELISA and HCMV-specific CD8+ T cell responses characterized by intracellular flow cytometry following PBMC stimulation with immunodominant HCMV peptides. Results. Median NK, antibody, and CD8+ T cell responses against HCMV were significantly greater in the HCMV/HIV coinfected group than the group infected with CMV alone. The fraction of CMV-specific CD8+ T cells expressing CD28 correlated inversely with NKG2C+CD57+ NK expansion in HIV infection. Conclusion. Our data reveal no significant direct relationships between NK and adaptive immunity against HCMV. However, stronger NK and adaptive immune responses against HCMV and an inverse correlation between NKG2C+CD57+ NK expansion and proliferative reserve of HCMV-specific CD8+ T cells, as signified by CD28 expression, indicate parallel evolution of NK and T cell responses against HCMV in HIV infection. Similar aspects of chronic HCMV infection may drive both NK and CD8+ T cell memory inflation. PMID:27314055

  3. Pathogenesis of experimental rhesus cytomegalovirus infection.

    PubMed

    Lockridge, K M; Sequar, G; Zhou, S S; Yue, Y; Mandell, C P; Barry, P A

    1999-11-01

    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v. ), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  4. Stimulation of the Replication of ICP0-Null Mutant Herpes Simplex Virus 1 and pp71-Deficient Human Cytomegalovirus by Epstein-Barr Virus Tegument Protein BNRF1

    PubMed Central

    Lu, Yongxu; Orr, Anne

    2016-01-01

    ABSTRACT It is now well established that several cellular proteins that are components of promyelocytic leukemia nuclear bodies (PML NBs, also known as ND10) have restrictive effects on herpesvirus infections that are countered by viral proteins that are either present in the virion particle or are expressed during the earliest stages of infection. For example, herpes simplex virus 1 (HSV-1) immediate early (IE) protein ICP0 overcomes the restrictive effects of PML-NB components PML, Sp100, hDaxx, and ATRX while human cytomegalovirus (HCMV) IE protein IE1 targets PML and Sp100, and its tegument protein pp71 targets hDaxx and ATRX. The functions of these viral regulatory proteins are in part interchangeable; thus, both IE1 and pp71 stimulate the replication of ICP0-null mutant HSV-1, while ICP0 increases plaque formation by pp71-deficient HCMV. Here, we extend these studies by examining proteins that are expressed by Epstein-Barr virus (EBV). We report that EBV tegument protein BNRF1, discovered by other investigators to target the hDaxx/ATRX complex, increases the replication of both ICP0-null mutant HSV-1 and pp71-deficient HCMV. In addition, EBV protein EBNA-LP, which targets Sp100, also augments ICP0-null mutant HSV-1 replication. The combination of these two EBV regulatory proteins had a greater effect than each one individually. These findings reinforce the concept that disruption of the functions of PML-NB proteins is important for efficient herpesvirus infections. IMPORTANCE Whether a herpesvirus initiates a lytic infection in a host cell or establishes quiescence or latency is influenced by events that occur soon after the viral genome has entered the host cell nucleus. Certain cellular proteins respond in a restrictive manner to the invading pathogen's DNA, while viral functions are expressed that counteract the cell-mediated repression. One aspect of cellular restriction of herpesvirus infections is mediated by components of nuclear structures known as

  5. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  6. 76 FR 69743 - The Development and Evaluation of Human Cytomegalovirus Vaccines; Public Workshop

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-09

    ... disabilities. Patients undergoing stem cell or solid-organ transplants are at particularly high risk for severe...' perspectives, (4) target populations for a HCMV vaccine, (5) design of clinical trials to study HCMV...

  7. High frequency of Human Cytomegalovirus DNA in the Liver of Infants with Extrahepatic Neonatal Cholestasis

    PubMed Central

    De Tommaso, Adriana MA; Andrade, Paula D; Costa, Sandra CB; Escanhoela, Cecília AF; Hessel, Gabriel

    2005-01-01

    Background Biliary atresia (BA) is the most severe hepatic disorder in newborns and its etiopathogenesis remains unknown. Viral involvement has been proposed, including the human cytomegalovirus (HCMV). The aims of the study were to use the polymerase chain reaction (PCR) to screen the liver tissue of infants with extrahepatic cholestasis for HCMV and to correlate the results with serological antibodies against HCMV and histological findings. Methods A retrospective study in a tertiary care setting included 35 patients (31 BA, 1 BA associated with a choledochal cyst, 2 congenital stenosis of the distal common bile duct and 1 hepatic cyst). HCMV serology was determined by ELISA. Liver and porta hepatis were examined histologically. Liver samples from infants and a control group were screened for HCMV DNA. Results Twelve patients had HCMV negative serology, 9 were positive for IgG antibodies and 14 were positive for IgG and IgM. Nine liver and seven porta hepatis samples were positive for HCMV DNA but none of the control group were positive (general frequency of positivity was 34.3% – 12/35). There was no correlation between HCMV positivity by PCR and the histological findings. The accuracy of serology for detecting HCMV antibodies was low. Conclusion These results indicate an elevated frequency of HCMV in pediatric patients with extrahepatic neonatal cholestasis. They also show the low accuracy of serological tests for detecting active HCMV infection and the lack of correlation between HCMV positivity by PCR and the histopathological changes. PMID:16321152

  8. Characterization of membrane antigens on human cytomegalovirus-infected fibroblasts recognized by human antibodies

    SciTech Connect

    van der Voort, L.H.M.; de Leij, L.F.M.H.; The T.H.

    1989-03-01

    The antigens on the surface of human cytomegalovirus (HCMV)-infected fibroblasts which are recognized by human HCMV antibody-positive sera were characterized. Three HCMV-induced polypeptides, with apparent molecular masses of 53 to 63, 94, and 94 to 120 kilodaltons, were precipitated from /sup 125/I-surface-labeled cell extracts with different sera obtained from healthy individuals. Renal transplant recipients who were suffering from active HCMV infections recognized the same set of antigens. By the use of monoclonal antibodies, these antigens were identified as polypeptides belonging to the gcI and gcIII families of HCMV glycoproteins.

  9. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  10. Association of Human Immunoglobulin G1 Heavy Chain Variants With Neutralization Capacity and Antibody-Dependent Cellular Cytotoxicity Against Human Cytomegalovirus.

    PubMed

    Vietzen, Hannes; Görzer, Irene; Puchhammer-Stöckl, Elisabeth

    2016-10-15

    Human cytomegalovirus (HCMV) infection is limited by HCMV-specific antibody functions. Here the association between the genetic marker (GM) 3/17 variants in the immunoglobulin G1 (IgG1) heavy chain constant region, virus neutralization, and natural killer (NK)-cell activation was investigated. In 100 HCMV-seropositive individuals, the GM3/17 polymorphism, serum 50% HCMV antibody neutralization titer (NT50), and in vitro HCMV-specific antibody NK-cell activation were assessed. The HCMV NT50 was higher in heterozygous GM3/17 persons than in GM3/3 persons (P = .0276). Furthermore, individuals expressing GM3/17 exhibited significantly higher NK-cell activation than persons carrying GM3/3 (P < .0001) or GM17/17 (P = .0095). Thus, persons expressing GM3/17 have potentially a selective advantage in HCMV defense.

  11. Thrombin induces Sp1-mediated antiviral effects in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Prösch, Susanna; Kotchetkov, Ruslan; Cinatl, Jaroslav; Koch, Frank; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-11-01

    Human cytomegalovirus (HCMV) retinitis causing retinal detachment and destruction of the blood-retina barrier is closely related to retinal hemorrhage/coagulation. However, the effects of procoagulants on HCMV (re)activation in retinal cells have not been investigated yet. Therefore, we studied whether thrombin modulates the expression of HCMV immediate early (IE) and late (L) genes in cultured human retinal pigment epithelial cells (RPE). Thrombin specifically stimulated the protease-activated receptor-1 (PAR-1) on RPE and, surprisingly, inhibited basal and 12,0-tetradecanoylphorbol 13-acetate-stimulated HCMV IE gene expression in infected RPE. On the other hand, HCMV strongly induced Sp1 DNA binding activity, which was prevented by thrombin/PAR1-mediated Sp1 hyperphosphorylation. Our data suggest that thrombin/PAR-1 may inhibit Sp1-dependent HCMV replication, which might be an important regulatory mechanism for HCMV persistence and replication in RPE.

  12. Two Novel Human Cytomegalovirus NK Cell Evasion Functions Target MICA for Lysosomal Degradation

    PubMed Central

    Fielding, Ceri A.; Aicheler, Rebecca; Stanton, Richard J.; Wang, Eddie C. Y.; Han, Song; Seirafian, Sepehr; Davies, James; McSharry, Brian P.; Weekes, Michael P.; Antrobus, P. Robin; Prod'homme, Virginie; Blanchet, Fabien P.; Sugrue, Daniel; Cuff, Simone; Roberts, Dawn; Davison, Andrew J.; Lehner, Paul J.; Wilkinson, Gavin W. G.; Tomasec, Peter

    2014-01-01

    NKG2D plays a major role in controlling immune responses through the regulation of natural killer (NK) cells, αβ and γδ T-cell function. This activating receptor recognizes eight distinct ligands (the MHC Class I polypeptide-related sequences (MIC) A andB, and UL16-binding proteins (ULBP)1–6) induced by cellular stress to promote recognition cells perturbed by malignant transformation or microbial infection. Studies into human cytomegalovirus (HCMV) have aided both the identification and characterization of NKG2D ligands (NKG2DLs). HCMV immediate early (IE) gene up regulates NKGDLs, and we now describe the differential activation of ULBP2 and MICA/B by IE1 and IE2 respectively. Despite activation by IE functions, HCMV effectively suppressed cell surface expression of NKGDLs through both the early and late phases of infection. The immune evasion functions UL16, UL142, and microRNA(miR)-UL112 are known to target NKG2DLs. While infection with a UL16 deletion mutant caused the expected increase in MICB and ULBP2 cell surface expression, deletion of UL142 did not have a similar impact on its target, MICA. We therefore performed a systematic screen of the viral genome to search of addition functions that targeted MICA. US18 and US20 were identified as novel NK cell evasion functions capable of acting independently to promote MICA degradation by lysosomal degradation. The most dramatic effect on MICA expression was achieved when US18 and US20 acted in concert. US18 and US20 are the first members of the US12 gene family to have been assigned a function. The US12 family has 10 members encoded sequentially through US12–US21; a genetic arrangement, which is suggestive of an ‘accordion’ expansion of an ancestral gene in response to a selective pressure. This expansion must have be an ancient event as the whole family is conserved across simian cytomegaloviruses from old world monkeys. The evolutionary benefit bestowed by the combinatorial effect of US18 and US20 on

  13. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  14. Human cytomegalovirus function inhibits replication of herpes simplex virus

    SciTech Connect

    Cockley, K.D.; Shiraki, K.; Rapp, F.

    1988-01-01

    Human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of herpes simplex virus type 1 (HSV-1). A delay in HSV replication of 15 h as well as a consistent, almost 3 log inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 h after superinfection were observed compared with controls infected with HSV alone. Treatment of HCMV-infected HEL cells with cycloheximide (100 ..mu..g/ml) for 3 or 24 h was demonstrated effective in blocking HCMV protein synthesis, as shown by immunoprecipitation with HCMV antibody-positive polyvalent serum. Cycloheximide treatment of HCMV-infected HEL cells and removal of the cycloheximide block before superinfection inhibited HSV-1 replication more efficiently than non-drug-treated superinfected controls. HCMV DNA-negative temperature-sensitive mutants restricted HSV as efficiently as wild-type HCMV suggesting that immediate-early and/or early events which occur before viral DNA synthesis are sufficient for inhibition of HSV. Inhibition of HSV-1 in HCMV-infected HEL cells was unaffected by elevated temperature (40.5/sup 0/C). However, prior UV irradiation of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HSV-2 replication was similarly inhibited in HCMV-infected HEL cells. Superinfection of HCMV-infected HEL cells with HSV-1 labeled with (/sup 3/H)thymidine provided evidence that the labeled virus could penetrate to the nucleus of cells after superinfection. Evidence for penetration of superinfecting HSV into HCMV-infected cells was also provided by blot hybridization of HSV DNA synthesized in cells infected with HSV alone versus superinfected cell cultures at 0 and 48 h after superinfection.

  15. Monoclonal antibody E-13 (M-810) to human cytomegalovirus recognizes an epitope encoded by exon 2 of the major immediate early gene.

    PubMed

    Mazeron, M C; Jahn, G; Plachter, B

    1992-10-01

    Monoclonal antibody (MAb) E-13 to human cytomegalovirus is used widely for diagnostic and fundamental studies, and has been shown to be directed against an immediate early (IE) protein(s). To determine which viral antigen is detected by MAb E-13, four subfragments from the open reading frame encoded by exons 2, 3 or 4 of IE-1 were cloned in the bacterial expression vector pROS. The resulting fusion proteins contained amino acids 77 to 491 encoded by mainly exon 4, amino acids 25 to 78 encoded by exon 3, amino acids 1 to 85 encoded by exons 2 and 3, and amino acids 1 to 24 encoded by exon 2. The reactivity of MAb E-13 with the fusion proteins was assayed by Western blotting. MAb E-13 was shown to react exclusively with proteins encoded by exon 2 and therefore recognizes IE proteins which contain the N-terminal amino acid sequence encoded by exon 2, namely the major 72K IE protein, the 82K to 86K IE-2 protein and the 52K to 55K IE-2 protein. MAb E-13 can be used to detect both IE-1- and IE-2-encoded proteins, which share the polypeptide encoded by exon 2. PMID:1383398

  16. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  17. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  18. Essential role of protein kinase R antagonism by TRS1 in human cytomegalovirus replication.

    PubMed

    Braggin, Jacquelyn E; Child, Stephanie J; Geballe, Adam P

    2016-02-01

    Human cytomegalovirus (HCMV) lacking TRS1 and IRS1 (HCMV[ΔI/ΔT]) cannot replicate in cell culture. Although both proteins can block the protein kinase R (PKR) pathway, they have multiple other activities and binding partners. It remains unknown which functions are essential for HCMV replication. To investigate this issue, we first identified a TRS1 mutant that is unable to bind to PKR. Like HCMV[ΔI/ΔT], a recombinant HCMV containing this mutant (HCMV[TRS1-Mut 1]) did not replicate in wild-type cells. However, HCMV[ΔI/ΔT] did replicate in cells in which PKR expression was reduced by RNA interference. Moreover, HCMV[ΔI/ΔT] and HCMV[TRS1-Mut 1] replicated to similar levels as virus containing wild-type TRS1 in cell lines in which PKR expression was knocked out by CRISPR/Cas9-mediated genome editing. These results demonstrate that the sole essential function of TRS1 is to antagonize PKR and that its other activities do not substantially enhance HCMV replication, at least in cultured human fibroblasts.

  19. Human cytomegalovirus miR-UL36-5p inhibits apoptosis via downregulation of adenine nucleotide translocator 3 in cultured cells.

    PubMed

    Guo, Xin; Huang, Yujing; Qi, Ying; Liu, Zhongyang; Ma, Yanping; Shao, Yaozhong; Jiang, Shujuan; Sun, Zhengrong; Ruan, Qiang

    2015-10-01

    Human cytomegalovirus (HCMV) encodes at least 26 microRNAs (miRNA). These miRNAs are utilized by HCMV to regulate its own genes as well as the genes of the host cell during infection. It has been reported that a cellular gene, solute carrier family 25, member 6 (SLC25A6), which is also designated adenine nucleotide translocator 3 (ANT3), was identified as a candidate target of hcmv-miR-UL36-5p by hybrid PCR. In this study, ANT3 was further demonstrated to be a direct target of hcmv-miR-UL36-5p by luciferase reporter assays. The expression level of ANT3 protein was confirmed, by western blotting, to be directly downregulated by overexpression of hcmv-miR-UL36-5p in HEK293 cells, U373 cells and HELF cells. Moreover, HCMV-infected cells showed a decrease in the ANT3 protein level. Using ANT3-specific small interfering RNA (siRNA) and an inhibitor for hcmv-miR-UL36-5p, it was shown that inhibition of apoptosis by hcmv-miR-UL36-5p in these cells specifically occurred via inhibition of ANT3 expression. These results imply that hcmv-miR-UL36-5 may play the same role during actual HCMV infection in order to establish a balance between the host cell and the virus.

  20. Age-Dependent Association between Low Frequency of CD27/CD28 Expression on pp65 CD8+ T Cells and Cytomegalovirus Replication after Transplantation▿

    PubMed Central

    Cantisán, Sara; Torre-Cisneros, Julián; Lara, Rosario; Rodríguez-Benot, Alberto; Santos, Francisco; Gutiérrez-Aroca, Juan; Gayoso, Inmaculada; González-Padilla, Marcelino; Casal, Manuel; Rivero, Antonio; Solana, Rafael

    2009-01-01

    In this cross-sectional study of 42 solid organ transplant recipients, the association of human cytomegalovirus (HCMV) replication and age with the phenotype of the HCMV-specific CD8+ T cells was analyzed by using the CMV pp65 HLA-A*0201 pentamer. A correlation between the proportion of CD28− HCMV-specific CD8+ T cells and age was observed in patients without HCMV replication (r = 0.50; P = 0.02) but not in patients with HCMV replication (r = −0.05; P = 0.83), a finding which differs from that observed for total CD8+ T cells. Within the group of patients younger than 50 years of age, patients with HCVM replication after transplantation had higher percentages of CD28− HCMV-specific CD8+ T cells (85.6 compared with 58.7% for patients without HCMV replication; P = 0.004) and CD27− HCMV-specific CD8+ T cells (90.7 compared with 68.8% for patients without HCMV replication; P = 0.03). However, in patients older than age 50 years, a high frequency of these two subpopulations was observed in patients both with and without previous HCMV replication (for CD28− HCMV-specific CD8+ T cells, 84.4 and 80.9%, respectively [P = 0.39]; for CD27− HCMV-specific CD8+ T cells 86.6 and 81.5%, respectively [P = 0.16]). In conclusion, the present study shows that in the group of recipients younger than age 50 years, HCMV replication after transplantation is associated with a high percentage of CD27− and CD28− HCMV-specific CD8+ T cells. These results suggest that the increased percentage of CD27− or CD28− HCMV-specific subsets can be considered a biomarker of HCMV replication in solid organ transplant recipients younger than age 50 years but not in older patients. Further studies are necessary to define the significance of these changes in HCMV-associated clinical complications posttransplantation. PMID:19656991

  1. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential

    SciTech Connect

    Smirnov, Sergey V.; Harbacheuski, Ryhor; Lewis-Antes, Anita; Zhu Hua; Rameshwar, Pranela; Kotenko, Sergei V. . E-mail: kotenkse@umdnj.edu

    2007-03-30

    Mesenchymal stem cells (MSCs) in bone marrow (BM) regulate the differentiation and proliferation of adjacent hematopoietic precursor cells and contribute to the regeneration of mesenchymal tissues, including bone, cartilage, fat and connective tissue. BM is an important site for the pathogenesis of human cytomegalovirus (HCMV) where the virus establishes latency in hematopoietic progenitors and can transmit after reactivation to neighboring cells. Here we demonstrate that BM-MSCs are permissive to productive HCMV infection, and that HCMV alters the function of MSCs: (i) by changing the repertoire of cell surface molecules in BM-MSCs, HCMV modifies the pattern of interaction between BM-MSCs and hematopoietic cells; (ii) HCMV infection of BM-MSCs undergoing adipogenic or osteogenic differentiation impaired the process of differentiation. Our results suggest that by altering BM-MSC biology, HCMV may contribute to the development of various diseases.

  2. Synergistic effects by combination of ganciclovir and tricin on human cytomegalovirus replication in vitro.

    PubMed

    Yamada, Rie; Suda, Hideki; Sadanari, Hidetaka; Matsubara, Keiko; Tuchida, Yuuzo; Murayama, Tsugiya

    2016-01-01

    It has been demonstrated as the first report that combination treatment with ganciclovir (GCV) and tricin (4',5,7-trihydroxy-3',5' -dimethoxyflavone), a derivative of Sasa albo-marginata, after human cytomegalovirus (HCMV) infection has synergistic effects on both infectious virus production and HCMV DNA synthesis in the human embryonic fibroblast cell line MRC-5. In this paper, we examined the anti-HCMV effects of GCV plus various concentrations of tricin, and tricin plus various concentrations of GCV in MRC-5 cells. We found that expression of the HCMV UL54 gene was significantly inhibited by combination of GCV with tricin when compared with GCV mono-treatment. These results suggest that tricin is a novel compound for combination therapy with GCV against HCMV replication. In addition, reduced-dose combination therapy may provide a direction for treatment in patients with HCMV infection while reducing drug toxicity.

  3. ChREBP, a glucose-responsive transcriptional factor, enhances glucose metabolism to support biosynthesis in human cytomegalovirus-infected cells.

    PubMed

    Yu, Yongjun; Maguire, Tobi G; Alwine, James C

    2014-02-01

    Carbohydrate-response element binding protein (ChREBP) plays a key role in regulating glucose metabolism and de novo lipogenesis in metabolic tissues and cancer cells. Here we report that ChREBP is also a critical regulator of the metabolic alterations induced during human cytomegalovirus (HCMV) infection. The expression of both ChREBP-α and ChREBP-β is robustly induced in HCMV-infected human fibroblasts; this induction is required for efficient HCMV infection. Depletion of ChREBP in HCMV-infected cells results in reduction of HCMV-induced glucose transporter 4 and glucose transporter 2 expression, leading to inhibition of glucose uptake, lactate production, nucleotide biosynthesis, and NADPH generation. We previously reported that HCMV infection induces lipogenesis through the activation of sterol regulatory element binding protein 1, which is mediated by the induction of PKR-like endoplasmic reticulum kinase. Data from the present study show that HCMV-induced lipogenesis is also controlled by the induction of ChREBP, in a second mechanism involved in the regulation of HCMV-induced de novo lipogenesis. These results suggest that ChREBP plays a key role in reprogramming glucose and lipid metabolism in HCMV infection.

  4. Human cytomegalovirus inhibits erythropoietin production.

    PubMed

    Butler, Lynn M; Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia

    2014-08-01

    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients.

  5. Sequestration of human cytomegalovirus by human renal and mammary epithelial cells

    SciTech Connect

    Twite, Nicolas; Andrei, Graciela; Kummert, Caroline; Donner, Catherine; Perez-Morga, David; De Vos, Rita; Snoeck, Robert; Marchant, Arnaud

    2014-07-15

    Urine and breast milk represent the main routes of human cytomegalovirus (HCMV) transmission but the contribution of renal and mammary epithelial cells to viral excretion remains unclear. We observed that kidney and mammary epithelial cells were permissive to HCMV infection and expressed immediate early, early and late antigens within 72 h of infection. During the first 24 h after infection, high titers of infectious virus were measured associated to the cells and in culture supernatants, independently of de novo synthesis of virus progeny. This phenomenon was not observed in HCMV-infected fibroblasts and suggested the sequestration and the release of HCMV by epithelial cells. This hypothesis was supported by confocal and electron microscopy analyses. The sequestration and progressive release of HCMV by kidney and mammary epithelial cells may play an important role in the excretion of the virus in urine and breast milk and may thereby contribute to HCMV transmission. - Highlights: • Primary renal and mammary epithelial cells are permissive to HCMV infection. • HCMV is sequestered by epithelial cells and this phenomenon does not require viral replication. • HCMV sequestration by epithelial cells is reduced by antibodies and IFN-γ.

  6. Detailed polymorphism study on cytomegalovirus DNA polymerase gene to reveal the most suitable genomic targets for quantitative Real-time PCR.

    PubMed

    Bilenoğlu, Onur; Altındiş, Mustafa; Öz, Ersoy; Yücel-Öz, Yeliz; İrigül-Sönmez, Öykü; Ünal, Can Bora

    2015-01-01

    The human cytomegalovirus (HCMV) is an important human pathogen primarily affecting immunocompromised patients, like transplant recipients or HIV- infected individuals. Early diagnosis of cytomegalovirus (CMV) infection in high-risk patients is essential in order to start preemptive treatments. pol (UL54) gene encoding for HCMV viral DNA polymerase is a well-defined target for HCMV detection in clinical samples and identifying most highly conserved regions for primer design remains crucial. Though real-time polymerase chain reaction (qPCR) is a rapid and sensitive method for HCMV detection, failure to detect some HCMV strains due to primer and target mismatches have led the researchers to explore more sensitive and reliable methods. Hence, to understand the broader diversity of the pol mutations in HCMV and to specify the most suitable region for primer-probe design to be used in qPCR assay, we studied both nucleotide and amino acid heterogeneities in 60 HCMV positive samples that were collected to represent national mutational prevalence of pol gene of HCMV in Turkey. The test was designed with a new set of primers- probe for HCMV detection and quantification based on the sequencing data which revealed the most conserved region on the pol gene. Statistical probit analysis was applied on qPCR studies which revealed a 95% detection limit of 100 copies/mL. In addition, linearity, reproducibility, and precision of the new test were assessed for diagnostic purposes. PMID:26295291

  7. Human cytomegalovirus-induced NKG2C(hi) CD57(hi) natural killer cells are effectors dependent on humoral antiviral immunity.

    PubMed

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold; Mertens, Thomas

    2013-07-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2C(hi) CD57(hi) NK cells gated on CD3(neg) CD56(dim) cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2C(hi) CD57(hi) NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2C(hi) CD57(hi) NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2C(hi) CD57(hi) NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy.

  8. Pyrrolidine-5,5-trans-lactams as novel mechanism-based inhibitors of human cytomegalovirus protease. Part 3: potency and plasma stability.

    PubMed

    Borthwick, Alan D; Exall, Anne M; Haley, Terry M; Jackson, Deborah L; Mason, Andrew M; Weingarten, Gordon G

    2002-07-01

    Mechanism-based inhibitors of HCMV protease, which are stable to human plasma (> or = 20 h) and have single-figure potency in the microM range against HCMV protease, have been developed based on the dansylproline alpha-methyl pyrrolidine-5,5-trans-lactam nucleus.

  9. Detection of human cytomegalovirus in different histopathological types of glioma in Iraqi patients.

    PubMed

    Shamran, Haidar A; Kadhim, Haider S; Hussain, Aws R; Kareem, Abdulameer; Taub, Dennis D; Price, Robert L; Nagarkatti, Mitzi; Nagarkatti, Prakash S; Singh, Udai P

    2015-01-01

    Human Cytomegalovirus (HCMV) is an endemic herpes virus that reemerges in cancer patients enhancing oncogenic potential. HCMV infection is associated with certain types of cancer morbidity such as glioblastomas. HCMV, like all other herpes viruses, has the ability to remain latent within the body of the host and can contribute in chronic inflammation. To determine the role of HCMV in glioma pathogenesis, paraffin-embedded blocks from glioma patients (n = 50) and from benign meningioma patients (n = 30) were obtained and evaluated by immunohistochemistry and polymerase chain reaction for the evidence of HCMV antigen expression and the presence of viral DNA. We detected HCMV antigen and DNA for IEI-72, pp65, and late antigen in 33/36, 28/36, and 26/36 in glioblastoma multiforme patients whereas 12/14, 10/14, and 9/14 in anaplastic astrocytoma patients, respectively. Furthermore, 84% of glioma patients were positive for immunoglobulin G (IgG) compared to 72.5% among control samples (P = 0.04). These data indicate the presence of the HCMV virus in a high percentage of glioma samples demonstrating distinct histopathological grades and support previous reports showing the presence of HCMV infection in glioma tissue. These studies demonstrate that detection of low-levels of latent viral infections may play an active role in glioma development and pathogenesis. PMID:25710012

  10. Initiation of human cytomegalovirus infection requires initial interaction with cell surface heparan sulfate.

    PubMed

    Compton, T; Nowlin, D M; Cooper, N R

    1993-04-01

    In this report, we demonstrate that the initial event in human cytomegalovirus (HCMV) infection is attachment to extracellular heparan sulfate. Further, this interaction is important for initiation of infection in fibroblast cells. Using microbinding assays to specifically monitor virus attachment as well as plaque titration assays to measure infectivity, we found that heparin competition as well as enzymatic digestion of cells with heparinase blocked virus attachment, initiation of immediate-early gene expression and infectivity. Other major glycosaminoglycans were found not to be involved in HCMV attachment and infectivity. In addition, HCMV was unable to attach to mutant derivatives of Chinese hamster ovary cells deficient in synthesis of heparan sulfate proteoglycans. Basic fibroblast growth factor, which requires initial interaction with extracellular heparin prior to binding to its high affinity receptor, also inhibited HCMV attachment to cells. Time-course experiments revealed that the initial HCMV binding was sensitive to heparin competition (10 micrograms/ml) or 0.75 M salt washes. The initial heparin-dissociable binding converted rapidly to high affinity (heparin resistant) HCMV attachment. These data suggest that sequential receptor interactions may mediate HCMV adsorption to cells. Heparin affinity chromatography revealed that multiple HCMV envelope glycoproteins, including gB, are capable of binding to heparin.

  11. Human Cytomegalovirus-Encoded pUL7 Is a Novel CEACAM1-Like Molecule Responsible for Promotion of Angiogenesis

    PubMed Central

    MacManiman, Jason D.; Meuser, Andrew; Botto, Sara; Smith, Patricia P.; Liu, Fenyong; Jarvis, Michael A.; Caposio, Patrizia

    2014-01-01

    ABSTRACT Persistent human cytomegalovirus (HCMV) infection has been linked to several diseases, including atherosclerosis, transplant vascular sclerosis (TVS), restenosis, and glioblastoma. We have previously shown that factors secreted from HCMV-infected cells induce angiogenesis and that this process is due, at least in part, to increased secretion of interleukin-6 (IL-6). In order to identify the HCMV gene(s) responsible for angiogenesis promotion, we constructed a large panel of replication-competent HCMV recombinants. One HCMV recombinant deleted for UL1 to UL10 was unable to induce secretion of factors necessary for angiogenesis. Fine mapping using additional HCMV recombinants identified UL7 as a viral gene required for production of angiogenic factors from HCMV-infected cells. Transient expression of pUL7 induced phosphorylation of STAT3 and ERK1/2 MAP kinases and production of proangiogenic factors, including IL-6. Addition of recombinant pUL7 to cells was sufficient for angiogenesis and was again associated with increased IL-6 expression. Analysis of the UL7 structure revealed a conserved domain similar to the immunoglobulin superfamily domain and related to the N-terminal V-like domain of carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1). Our report therefore identifies UL7 as a novel HCMV-encoded molecule that is both structurally and functionally related to cellular CEACAM1, a proangiogenic factor highly expressed during vasculogenesis. PMID:25352622

  12. A Role for 3-O-Sulfated Heparan Sulfate in Promoting Human Cytomegalovirus Infection in Human Iris Cells

    PubMed Central

    Baldwin, John; Maus, Erika; Zanotti, Brian; Volin, Michael V.; Tandon, Ritesh; Shukla, Deepak

    2015-01-01

    Human cytomegalovirus (HCMV) has emerged as a clinically opportunistic pathogen that targets multiple types of ocular cells and tissues, including the iris region of the uveal tract during anterior uveitis. In this report, we used primary cultures of human iris stroma (HIS) cells derived from human eye donors to investigate HCMV entry. The following lines of evidence suggested the role of 3-O-sulfated heparan sulfate (3-OS HS) during HCMV-mediated entry and cell-to-cell fusion in HIS cells. First, 3-O-sulfotransferase-3 (3-OST-3) expression in HIS cells promoted HCMV internalization, while pretreatment of HIS cells with heparinase enzyme or with anti-3-OS HS (G2) peptide significantly reduced the HCMV-mediated formation of plaques/foci. Second, coculture of the HCMV-infected HIS cells with CHO-K1 cells expressing 3-OS HS significantly enhanced cell fusion. Finally, a similar trend of enhanced fusion was observed with cells expressing HCMV glycoproteins (gB, gO, and gH-gL) cocultured with 3-OS HS cells. Taken together, these results highlight the role of 3-OS HS during HCMV plaque formation and cell-to-cell fusion and identify a novel target for future therapeutic interventions. PMID:25717110

  13. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase--A Potential Strategy for Suppression of the Wnt Pathway.

    PubMed

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit

    2015-12-29

    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS' activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes.

  14. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  15. Human cytomegalovirus microRNA miR-US25-1-5p inhibits viral replication by targeting multiple cellular genes during infection.

    PubMed

    Jiang, Shujuan; Qi, Ying; He, Rong; Huang, Yujing; Liu, Zhongyang; Ma, Yanping; Guo, Xin; Shao, Yaozhong; Sun, Zhengrong; Ruan, Qiang

    2015-10-01

    MicroRNAs (miRNAs) play important roles in regulating various cellular processes in plants, animals, and viruses. This mechanism is also utilized by human cytomegalovirus (HCMV) in the process of infection and pathogenesis. The HCMV-encoded miRNA, hcmv-miR-US25-1-5p, was highly expressed during lytic and latent infections, and was found to inhibit viral replication. Identification of functional target genes of this microRNA is important in that it will enable a better understanding of the function of hcmv-miR-US25-1-5p during HCMV infection. In the present study, 35 putative cellular transcript targets of hcmv-miR-US25-1-5p were identified. Down-regulation of the targets YWHAE, UBB, NPM1, and HSP90AA1 by hcmv-miR-US25-1-5p was validated by luciferase reporter assay and Western blot analysis. In addition, we showed that hcmv-miR-US25-1-5p could inhibit viral replication by interacting with these targets, the existence of which may impact virus replication directly or indirectly.

  16. Perivascular Stromal Cells as a Potential Reservoir of Human Cytomegalovirus

    PubMed Central

    Soland, M. A.; Keyes, L. R.; Bayne, R.; Moon, J.; Porada, C. D.; St. Jeor, S.; Almeida-Porada, G.

    2014-01-01

    Human cytomegalovirus (HCMV) infection is an important cause of morbidity and mortality among both solid organ and hematopoietic stem cell transplant recipients. Identification of cells throughout the body that can potentially serve as a viral reservoir is essential to dissect mechanisms of cell tropism and latency and to develop novel therapies. Here, we tested and compared the permissivity of liver-, brain-, lung (LNG)- and bone marrow (BM)-derived perivascular mesenchymal stromal cells (MSC) to HCMV infection and their ability to propagate and produce infectious virus. Perivascular MSC isolated from the different organs have in common the expression of CD146 and Stro-1. While all these cells were permissive to HCMV infection, the highest rate of HCMV infection was seen with LNG-MSC, as determined by viral copy number and production of viral particles by these cells. In addition, we showed that, although the supernatants from each of the HCMV-infected cultures contained infectious virus, the viral copy number and the quantity and timing of virus production varied among the various organ-specific MSC. Furthermore, using quantitative polymerase chain reaction, we were able to detect HCMV DNA in BM-MSC isolated from 7 out of 19 healthy, HCMV-seropositive adults, suggesting that BM-derived perivascular stromal cells may constitute an unrecognized natural HCMV reservoir. PMID:24592822

  17. Human Cytomegalovirus Persistence

    PubMed Central

    Goodrum, Felicia; Caviness, Katie; Zagallo, Patricia

    2012-01-01

    Summary Viral persistence is the rule following infection with all herpesviruses. The β-herpesvirus, human cytomegalovirus (HCMV), persists through chronic and latent states of infection. Both the chronic and latent states of infection contribute to HCMV persistence and to the high HCMV seroprevalence worldwide. The chronic infection is poorly defined molecularly, but clinically manifests as low-level virus shedding over extended periods of time and often in the absence of symptoms. Latency requires long-term maintenance of viral genomes in a reversibly quiescent state in the immunocompetent host. In this review, we focus on recent advances in the biology of HCMV persistence, particularly with respect to the latent mode of persistence. Latently infected individuals harbor HCMV genomes in hematopoietic cells and maintain large subsets of HCMV-specific T-cells. In the last few years, impressive advances have been made in understanding virus-host interactions important to HCMV infection, many of which will profoundly impact latency and persistence. We discuss these advances and their known or potential impact on viral latency. As herpesviruses are met with similar challenges in achieving latency and often employ conserved strategies to persist, we discuss current and future directions of HCMV persistence in the context of the greater body of knowledge regarding α-and γ-herpesviruses persistence. PMID:22329758

  18. Human cytomegalovirus encoded microRNAs: hitting targets.

    PubMed

    Ng, Kiat Rui; Li, Jordan Y Z; Gleadle, Jonathan M

    2015-01-01

    Human cytomegalovirus (HCMV) infection is of particular concern in immunodeficient individuals notably transplant recipients, leading to increased morbidity and mortality. HCMV is predicted to encode multiple microRNAs (miRNAs) and several have been characterized in vitro. Furthermore, these miRNAs have been shown to target human and viral mRNAs. Pathways involved in human cellular targets have key roles in vesicle trafficking, immune evasion and cell cycle control. This demonstration of viral miRNA targets provides novel insights into viral pathogenesis. This review details the evidence for the existence of HCMV-encoded miRNA and their targets. HCMV miRNA in blood and other tissues is a potential diagnostic tool and blocking the effects of specific HCMV-encoded miRNA with sequence specific antagomirs is a potential new therapy.

  19. Cytomegalovirus alpha-chemokine genotypes are associated with clinical manifestations in children with congenital or postnatal infections.

    PubMed

    Paradowska, Edyta; Jabłońska, Agnieszka; Płóciennikowska, Agnieszka; Studzińska, Mirosława; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Dzierżanowska-Fangrat, Katarzyna; Kasztelewicz, Beata; Woźniakowska-Gęsicka, Teresa; Leśnikowski, Zbigniew J

    2014-08-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital infections. The aim of our study was to determine the prevalence of genotypes based on the highly polymorphic UL146 and UL147 HCMV genes and the relationship between the genotype and symptoms or viral load. We analyzed samples from 121 infants with symptomatic HCMV infection, including 32 congenitally infected newborns. The G7 and G5 genotypes were predominant in postnatal infection, whereas the G1 genotype was prevalent in congenital infection. Central nervous system (CNS) damage and hepatomegaly were detected more frequently among children infected with the G1 genotype than in those infected by other genotypes. An association between the viral genotype and viruria level was found. There was a strong correlation between HCMV genotypes determined through the UL146 and UL147 sequences (ĸ=0.794). In conclusion, we found that certain vCXCL genotypes are associated with clinical sequelae following HCMV infection.

  20. Cytomegalovirus Restructures Lipid Rafts via a US28/CDC42-Mediated Pathway, Enhancing Cholesterol Efflux from Host Cells.

    PubMed

    Low, Hann; Mukhamedova, Nigora; Cui, Huanhuan L; McSharry, Brian P; Avdic, Selmir; Hoang, Anh; Ditiatkovski, Michael; Liu, Yingying; Fu, Ying; Meikle, Peter J; Blomberg, Martin; Polyzos, Konstantinos A; Miller, William E; Religa, Piotr; Bukrinsky, Michael; Soderberg-Naucler, Cecilia; Slobedman, Barry; Sviridov, Dmitri

    2016-06-28

    Cytomegalovirus (HCMV) contains cholesterol, but how HCMV interacts with host cholesterol metabolism is unknown. We found that, in human fibroblasts, HCMV infection increased the efflux of cellular cholesterol, despite reducing the abundance of ABCA1. Mechanistically, viral protein US28 was acting through CDC42, rearranging actin microfilaments, causing association of actin with lipid rafts, and leading to a dramatic change in the abundance and/or structure of lipid rafts. These changes displaced ABCA1 from the cell surface but created new binding sites for apolipoprotein A-I, resulting in enhanced cholesterol efflux. The changes also reduced the inflammatory response in macrophages. HCMV infection modified the host lipidome profile and expression of several genes and microRNAs involved in cholesterol metabolism. In mice, murine CMV infection elevated plasma triglycerides but did not affect the level and functionality of high-density lipoprotein. Thus, HCMV, through its protein US28, reorganizes lipid rafts and disturbs cell cholesterol metabolism.

  1. Immunoglobulin genes influence the magnitude of humoral immunity to cytomegalovirus glycoprotein B.

    PubMed

    Pandey, Janardan P; Kistner-Griffin, Emily; Radwan, Faisal F; Kaur, Navtej; Namboodiri, Aryan M; Black, Laurel; Butler, Mary Ann; Carreón, Tania; Ruder, Avima M

    2014-12-01

    Human cytomegalovirus (HCMV) is a risk factor for many human diseases, but among exposed individuals, not everyone is equally likely to develop HCMV-spurred diseases, implying the presence of host genetic factors that might modulate immunity to this virus. Here, we show that antibody responsiveness to HCMV glycoprotein B (gB) is significantly associated with particular immunoglobulin GM (γ marker) genotypes. Anti-HCMV gB antibody levels were highest in GM 17/17 homozygotes, intermediate in GM 3/17 heterozygotes, and lowest in GM 3/3 homozygotes (28.2, 19.0, and 8.1 µg/mL, respectively; P=.014). These findings provide mechanistic insights in the etiopathogenesis of HCMV-spurred diseases.

  2. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.

    2015-01-01

    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  3. Human cytomegalovirus gene expression in long-term infected glioma stem cells.

    PubMed

    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana

    2014-01-01

    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  4. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  5. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  6. Detection of Low Frequency Multi-Drug Resistance and Novel Putative Maribavir Resistance in Immunocompromised Pediatric Patients with Cytomegalovirus

    PubMed Central

    Houldcroft, Charlotte J.; Bryant, Josephine M.; Depledge, Daniel P.; Margetts, Ben K.; Simmonds, Jacob; Nicolaou, Stephanos; Tutill, Helena J.; Williams, Rachel; Worth, Austen J. J.; Marks, Stephen D.; Veys, Paul; Whittaker, Elizabeth; Breuer, Judith

    2016-01-01

    Human cytomegalovirus (HCMV) is a significant pathogen in immunocompromised individuals, with the potential to cause fatal pneumonitis and colitis, as well as increasing the risk of organ rejection in transplant patients. With the advent of new anti-HCMV drugs there is therefore considerable interest in using virus sequence data to monitor emerging resistance to antiviral drugs in HCMV viraemia and disease, including the identification of putative new mutations. We used target-enrichment to deep sequence HCMV DNA from 11 immunosuppressed pediatric patients receiving single or combination anti-HCMV treatment, serially sampled over 1–27 weeks. Changes in consensus sequence and resistance mutations were analyzed for three ORFs targeted by anti-HCMV drugs and the frequencies of drug resistance mutations monitored. Targeted-enriched sequencing of clinical material detected mutations occurring at frequencies of 2%. Seven patients showed no evidence of drug resistance mutations. Four patients developed drug resistance mutations a mean of 16 weeks after starting treatment. In two patients, multiple resistance mutations accumulated at frequencies of 20% or less, including putative maribavir and ganciclovir resistance mutations P522Q (UL54) and C480F (UL97). In one patient, resistance was detected 14 days earlier than by PCR. Phylogenetic analysis suggested recombination or superinfection in one patient. Deep sequencing of HCMV enriched from clinical samples excluded resistance in 7 of 11 subjects and identified resistance mutations earlier than conventional PCR-based resistance testing in 2 patients. Detection of multiple low level resistance mutations was associated with poor outcome.

  7. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  8. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.

    PubMed

    Lee, Junsub; Kim, Sunyoung

    2016-05-01

    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  9. Effect of baicalein on the expression of VIP in extravillous cytotrophoblasts infected with human cytomegalovirus in vitro.

    PubMed

    Qiao, Yuan; Fang, Jian-guo; Xiao, Juan; Liu, Tao; Liu, Jing; Zhang, Yan-li; Chen, Su-hua

    2013-06-01

    This paper aimed to study the ability of baicalein to block human cytomegalovirus (HCMV) infection in extravillous cytotrophoblasts (EVT) and its effect on the vasoactive intestinal peptide (VIP) expression in HCMV-infected EVT in vitro. A human trophoblast cell line (HPT-8) was chosen in this study. HCMV with 100 TCID50 was added into culture medium to infect HPT-8 cells, and then HCMV pp65 antigen was assayed by immunofluorescence staining. The infection status was determined by virus titration. Real-time quantitative polymerase chain reaction (qRT-PCR) was used to detect virus DNA load in the infected cells. The expression of VIP mRNA and protein in the infected cells was measured by qRT-PCR, immunocytochemistry and Western blotting. Concentration of VIP secreted in supernatants was determined by ELISA. Red-stained HCMV pp65 antigens were found in infected HPT-8 cells 48 h after infection. HCMV replicated in large quantity in infected HPT-8 cells 4 days after infection, reaching a peak at day 6 post-infection. After treatment with baicalein, virus DNA load in infected HPT-8 cells was decreased (P<0.05), and the levels of VIP mRNA and protein, and the concentration were raised to the normal (P>0.05). Our study suggested that baicalein exerts a positive effect on the VIP expression in HCMV-infected EVT at maternal-fetal interface.

  10. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease. PMID:27699182

  11. Study of Soluble HLA-G in Congenital Human Cytomegalovirus Infection

    PubMed Central

    Gabrielli, Liliana; Bortolotti, Daria; Gentili, Valentina; Piccirilli, Giulia; Chiereghin, Angela; Pavia, Claudia; Bolzani, Silvia; Guerra, Brunella; Simonazzi, Giuliana; Cervi, Francesca; Capretti, Maria Grazia; Luca, Dario Di; Landini, Maria Paola; Lazzarotto, Tiziana

    2016-01-01

    Human leukocyte antigen-G (HLA-G) is a nonclassical HLA class I antigen that is expressed during pregnancy contributing to maternal-fetal tolerance. HLA-G can be expressed as membrane-bound and soluble forms. HLA-G expression increases strongly during viral infections such as congenital human cytomegalovirus (HCMV) infections, with functional consequences in immunoregulation. In this work we investigated the expression of soluble (s)HLA-G and beta-2 microglobulin (component of HLA) molecules in correlation with the risk of transmission and severity of congenital HCMV infection. We analyzed 182 blood samples from 130 pregnant women and 52 nonpregnant women and 56 amniotic fluid samples from women experiencing primary HCMV infection. The median levels of sHLA-G in maternal serum of women with primary HCMV infection were higher in comparison with nonprimary and uninfected pregnant women (p < 0.001). AF from HCMV symptomatic fetuses presented higher sHLA-G levels in comparison with infected asymptomatic fetuses (p < 0.001), presence of HLA-G free-heavy chain, and a concentration gradient from amniotic fluid to maternal blood. No significant statistical difference of beta-2 microglobulin median levels was observed between all different groups. Our results suggest the determination of sHLA-G molecules in both maternal blood and amniotic fluid as a promising biomarker of diagnosis of maternal HCMV primary infection and fetal HCMV disease.

  12. Control of human cytomegalovirus gene expression by differential histone modifications during lytic and latent infection of a monocytic cell line.

    PubMed

    Ioudinkova, Elena; Arcangeletti, Maria Cristina; Rynditch, Alla; De Conto, Flora; Motta, Federica; Covan, Silvia; Pinardi, Federica; Razin, Sergey V; Chezzi, Carlo

    2006-12-15

    Non-differentiated THP-1 cells can be infected by human cytomegalovirus (HCMV) Towne strain, which persists in these cells in a non-active (latent) form without undergoing a productive cycle. The same cells become permissive for HCMV lytic infection after induction of cell differentiation by treatment with 12-O-tetradecanoylphorbol-13-acetate. We used this cellular model to study the possible role of histone modifications in the control of HCMV latency. Using chromatin immunoprecipitation with antibodies against histone H3 acetylated or dimethylated in position K9, we demonstrated that in lytically infected cells the HCMV enhancer was associated with heavy acetylated but not dimethylated H3. In the case of latent infection, the HCMV enhancer was associated with neither acetylated nor dimethylated H3. HCMV genes encoding DNA polymerase (early), pp65 (early-late) and pp150 (late) proteins were associated preferentially with acetylated H3 in lytically infected cells and with dimethylated H3 in latently infected cells. These data strongly suggest that K9 methylation of H3 is involved in HCMV gene repression, while association of the above genes with acetylated histones is likely to be necessary for active transcription. It can be postulated that the same histone modifications are used to mark active and repressed genes in both cellular and viral chromatin. PMID:16989963

  13. Human cytomegalovirus inhibition by cardiac glycosides: evidence for involvement of the HERG gene.

    PubMed

    Kapoor, Arun; Cai, Hongyi; Forman, Michael; He, Ran; Shamay, Meir; Arav-Boger, Ravit

    2012-09-01

    Infection with human cytomegalovirus (HCMV) continues to be a major threat for pregnant women and the immunocompromised population. Although several anti-HCMV therapies are available, the development of new anti-HCMV agents is highly desired. There is growing interest in identifying compounds that might inhibit HCMV by modulating the cellular milieu. Interest in cardiac glycosides (CG), used in patients with congestive heart failure, has increased because of their established anticancer and their suggested antiviral activities. We report that the several CG--digoxin, digitoxin, and ouabain--are potent inhibitors of HCMV at nM concentrations. HCMV inhibition occurred prior to DNA replication, but following binding to its cellular receptors. The levels of immediate early, early, and late viral proteins and cellular NF-κB were significantly reduced in CG-treated cells. The activity of CG in infected cells correlated with the expression of the potassium channel gene, hERG. CMV infection upregulated hERG, whereas CG significantly downregulated its expression. Infection with mouse CMV upregulated mouse ERG (mERG), but treatment with CG did not inhibit virus replication or mERG transcription. These findings suggest that CG may inhibit HCMV by modulating human cellular targets associated with hERG and that these compounds should be studied for their antiviral activities. PMID:22777050

  14. Human Cytomegalovirus Antigens in Malignant Gliomas as Targets for Adoptive Cellular Therapy

    PubMed Central

    Landi, Daniel; Hegde, Meenakshi; Ahmed, Nabil

    2014-01-01

    Malignant gliomas are the most common primary brain tumor in adults, with over 12,000 new cases diagnosed in the United States each year. Over the last decade, investigators have reliably identified human cytomegalovirus (HCMV) proteins, nucleic acids, and virions in most high-grade gliomas, including glioblastoma (GBM). This discovery is significant because HCMV gene products can be targeted by immune-based therapies. In this review, we describe the current level of understanding regarding the presence and role in pathogenesis of HCMV in GBM. We describe our success detecting and expanding HCMV-specific cytotoxic T lymphocytes to kill GBM cells and explain how these cells can be used as a platform for enhanced cellular therapies. We discuss alternative approaches that capitalize on HCMV infection to treat patients with HCMV-positive tumors. Adoptive cellular therapy for HCMV-positive GBM has been tried in a small number of patients with some benefit, but we reason why, to date, these approaches generally fail to generate long-term remission or cure. We conjecture how cellular therapy for GBM can be improved and describe the barriers that must be overcome to cure these patients. PMID:25505736

  15. Degradation of host ubiquitin E3 ligase Itch by human cytomegalovirus UL42.

    PubMed

    Koshizuka, Tetsuo; Tanaka, Keiichiro; Suzutani, Tatsuo

    2016-01-01

    Human cytomegalovirus (HCMV) UL42 is classified as a CMV-specific but function-unknown gene. According to its amino acid sequence, UL42 has a C-terminal hydrophobic domain predicted to be a transmembrane domain and two PPxY (PY) motifs in its N terminus, but no N-terminal signal peptide. These features resemble those of herpes simplex virus (HSV) UL56 and varicella-zoster virus ORF0. HCMV UL42 interacts with Itch, a member of the Nedd4 family of ubiquitin E3 ligases, through its PY motifs as observed in HSV UL56. HCMV UL42 was partially colocalized with the trans-Golgi network and cytoplasmic vesicles in transfected fibroblasts. Itch was colocalized with HCMV UL42 and accumulated in a fine-speckled pattern in the cytoplasm. UL42 induced the ubiquitination and degradation of Itch in HCMV-infected fibroblasts, and was partially colocalized with p62, a ubiquitin-binding protein, and CD63, a marker of lysosome and multivesicular bodies. The electrophoretic pattern of Itch was altered by infection with HCMV and the amount of Itch was increased by the deletion of UL42. Our findings suggest that the regulatory function of the Nedd4 E3 ligase family and the structural features of HCMV UL42 are conserved characteristics in herpesviruses. PMID:26555021

  16. IL-6 in human cytomegalovirus secretome promotes angiogenesis and survival of endothelial cells through the stimulation of survivin

    PubMed Central

    Botto, Sara; Streblow, Daniel N.; DeFilippis, Victor; White, Laura; Kreklywich, Craig N.; Smith, Patricia P.

    2011-01-01

    Human cytomegalovirus (HCMV) is linked to the acceleration of vascular diseases such as atherosclerosis and transplant vasculopathy. One of the hallmarks of these diseases is angiogenesis (AG) and neovessel formation. Endothelial cells (ECs) are an integral part of AG and are sites of HCMV persistence. AG requires multiple synchronous processes that include EC proliferation, migration, and vessel stabilization. Virus-free supernatant (secretome) from HCMV-infected ECs induces AG. To identify factor(s) involved in this process, we performed a human cytokine array. Several cytokines were significantly induced in the HCMV secretomes including interleukin-6 (IL-6), granulocyte macrophage colony-stimulating factor, and IL-8/CXCL8. Using in vitro AG assays, neutralization of IL-6 significantly reduced neovessel formation. Addition of the HCMV secretome to preformed vessels extended neovessel survival, but this effect was blocked by neutralization of IL-6. In these cells, IL-6 prevented apoptosis by blocking caspase-3 and -7 activation through the induction of survivin. Neutralization of IL-6 receptor on ECs abolished the ability of HCMV secretome to increase survivin expression and activated effector caspases. Moreover, survivin shRNA expression induced rapid regression of tubule capillary networks in ECs stimulated with HCMV secretome and activated effector caspases. These observations may explain how CMV accelerates vascular disease despite limited infection in tissues. PMID:20930069

  17. Novel Human Cytomegalovirus Viral Chemokines, vCXCL-1s, Display Functional Selectivity for Neutrophil Signaling and Function.

    PubMed

    Heo, Jinho; Dogra, Pranay; Masi, Tom J; Pitt, Elisabeth A; de Kruijf, Petra; Smit, Martine J; Sparer, Tim E

    2015-07-01

    Human CMV (HCMV) uses members of the hematopoietic system including neutrophils for dissemination throughout the body. HCMV encodes a viral chemokine, vCXCL-1, that is postulated to attract neutrophils for dissemination within the host. The gene encoding vCXCL-1, UL146, is one of the most variable genes in the HCMV genome. Why HCMV has evolved this hypervariability and how this affects the virus' dissemination and pathogenesis is unknown. Because the vCXCL-1 hypervariability maps to important binding and activation domains, we hypothesized that vCXCL-1s differentially activate neutrophils, which could contribute to HCMV dissemination, pathogenesis, or both. To test whether these viral chemokines affect neutrophil function, we generated vCXCL-1 proteins from 11 different clades from clinical isolates from infants infected congenitally with HCMV. All vCXCL-1s were able to induce calcium flux at a concentration of 100 nM and integrin expression on human peripheral blood neutrophils, despite differences in affinity for the CXCR1 and CXCR2 receptors. In fact, their affinity for CXCR1 or CXCR2 did not correlate directly with chemotaxis, G protein-dependent and independent (β-arrestin-2) activation, or secondary chemokine (CCL22) expression. Our data suggest that vCXCL-1 polymorphisms affect the binding affinity, receptor usage, and differential peripheral blood neutrophil activation that could contribute to HCMV dissemination and pathogenesis.

  18. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  19. Semi-quantitative detection of cytomegalovirus DNA from native serum and plasma by nested PCR: influence of DNA extraction procedures.

    PubMed

    Hamprecht, K; Mikeler, E; Jahn, G

    1997-12-01

    The diagnostic implications of different procedures of DNA extraction were examined for the detection of HCMV DNA from sera and plasma of immunosuppressed patients. The detection limit of HCMV plasmid DNA from cell free seronegative plasma and serum by limiting dilution nested PCR decreased in the following sequence: phenol/chloroform > NaI-single tube method > proteinase K digestion equal to amplification of native sera and plasma. Nested PCR from native sera and plasma performed well and surpassed the proteinase K method in sensitivity for detection of serum DNAemia. Semi-quantitative determination of HCMV DNA titer present in native sera of immunosuppressed patients did not seem to be correlated to HCMV disease. When compared to the persistence of leukoDNAemia, the viral DNA titer in native plasma could only be observed in the acute phase of HCMV infection, an important phenomenon for diagnostic purposes. Correlation of serum DNAemia to virus culture revealed low positive and high negative predictive values. Predictive values of nested PCR from native sera for HCMV infection were not lower than those following organic DNA extraction. Despite its low correlation to viremia and virus isolation from any site, nested PCR from organic DNA extracts of serum or plasma is the most sensitive diagnostic tool of an ongoing HCMV infection. Additionally, semi-quantitative end point dilution nested PCR from native serum or plasma promises to be a rapid and easy tool for the monitoring of antiviral therapy.

  20. Identification of binary interactions between human cytomegalovirus virion proteins.

    PubMed

    Phillips, Stacia L; Bresnahan, Wade A

    2011-01-01

    Human cytomegalovirus (HCMV) virions are composed of a DNA-containing nucleocapsid surrounded by a tegument layer and host-derived lipid envelope studded with virally encoded glycoproteins. These complex virions are estimated to be composed of more than 50 viral proteins. Assembly of HCMV virions is poorly understood, especially with respect to acquisition of the tegument; however, it is thought to involve the stepwise addition of virion components through protein-protein interactions. We sought to identify interactions among HCMV virion proteins using yeast two-hybrid analysis. Using 33 known capsid and tegument proteins, we tested 1,089 pairwise combinations for binary interaction in the two-hybrid assay. We identified 24 interactions among HCMV virion proteins, including 13 novel interactions among tegument proteins and one novel interaction between capsid proteins. Several of these novel interactions were confirmed by coimmunoprecipitation of protein complexes from transfected cells. In addition, we demonstrate three of these interactions in the context of HCMV infection. This study reveals several new protein-protein interactions among HCMV tegument proteins, some of which are likely important for HCMV replication and pathogenesis. PMID:20962080

  1. Role of human cytomegalovirus in the proliferation and invasion of extravillous cytotrophoblasts isolated from early placentae

    PubMed Central

    Liu, Tao; Zheng, Xiaofei; Li, Qin; Chen, Juanjuan; Yin, Zongzhi; Xiao, Juan; Zhang, Dandan; Li, Wei; Qiao, Yuan; Chen, Suhua

    2015-01-01

    Aim: We investigated the role of human cytomegalovirus (HCMV) and its mechanism in extravillous cytotrophoblast (EVT) proliferation and invasion in vitro. Methods: Differential enzymatic digestion combined with gradient centrifugation, was used to isolate primary EVT from human chorionic villi collected from early placentae of healthy pregnant women. HCMV infection was determined by immunofluorescence staining of HCMVpp65 antigen expression. An MTT assay was used to examine the role of HCMV in the proliferation of EVT. Quantitative real-time polymerase chain reaction (qRT-PCR), immunocytochemical staining and Western blots were carried out in a control group (EVT) and a virus group (EVT+HCMV) to examine the expression of major genes and protein in TGF-β/Smad signaling pathways in EVT 48 h after inoculation with HCMV. An in vitro cell invasion assay was performed to analyze the influence of HCMV on EVT invasion. Results: HCMV significantly inhibited the proliferation of EVT 48 h after viral infection (P < 0.05). The expression of TGF-β1, Smad1, Smad2, Smad3, Smad4, and Smad5 genes was significantly increased (P < 0.05), but that of TGF-β2, TGF-β3, TGFβRI, TGFβRII, Smad7, MMP2, and MMP9 was significantly decreased in the virus group 48 h after HCMV infection (P < 0.05). Smad7, MMP-2 and MMP-9 protein levels were significantly decreased and the TGF-β1 protein level was significantly increased in infected EVT (all P < 0.05). Conclusions: HCMV may act on multiple steps of the TGF-β/Smad signaling pathway to impede EVT proliferation and invasion. PMID:26770317

  2. Sequencing-based typing reveals new insight in HLA-DPA1 polymorphism.

    PubMed

    Rozemuller, E H; Bouwens, A G; van Oort, E; Versluis, L F; Marsh, S G; Bodmer, J G; Tilanus, M G

    1995-01-01

    An HLA-DPA1 sequencing-based typing (SBT) system has been developed to identify DPA1 alleles. Up to now eight DPA1 alleles have been defined. Six can be discriminated based upon exon 2 polymorphism. The three subtypes of DPA1*01: DPA1*0101, DPA1*0102 and DPA1*0103, have identical exon 2 sequences but show differences in exon 4. Exon 4 sequences were known for only the three DPA1*01 subtypes and for DPA1*0201. We now present additional sequence information for exon 4 and the unknown segments at the 3' end of exon 2. Additionally with the use of this sequencing technique it is also possible to identify previously unidentified polymorphism. We have studied the exon 2 and exon 4 polymorphism of DPA1 in 40 samples which include all known DPA1 alleles. A new allele, DPA1*01 new, was identified which differs by one nucleotide in exon 2 from DPA1*0103, resulting in an aspartic acid at codon 28. The DPA1*01 subtypes DPA1*0101 and DPA1*0102 could not be confirmed in samples which previously were used to define these subtypes, and consequently they do not exist. The exon 4 sequence of DPA1*0201 is corrected based on sequence data of DAUDI, the cell line in which DPA1*0202 was originally defined. The exon 4 regions of the remaining four alleles were resolved: the exon 4 regions of the alleles DPA1*02021 and DPA1*02022 were found to be identical to the--corrected--DPA1*0201 whereas the exon 4 region of DPA1*0301 differs by one nucleotide compared to DPA1*0103. The DPA1*0401 exon 4 region differs by one nucleotide compared to the corrected DPA1*0201.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  4. Inactivation of the Human Cytomegalovirus US20 Gene Hampers Productive Viral Replication in Endothelial Cells

    PubMed Central

    Cavaletto, Noemi; Luganini, Anna

    2015-01-01

    ABSTRACT The human cytomegalovirus (HCMV) US12 gene family includes a group of 10 contiguous genes (US12 to US21) encoding predicted seven-transmembrane-domain (7TMD) proteins that are nonessential for replication within cultured fibroblasts. Nevertheless, inactivation of some US12 family members affects virus replication in other cell types; e.g., deletion of US16 or US18 abrogates virus growth in endothelial and epithelial cells or in human gingival tissue, respectively, suggesting a role for some US12 proteins in HCMV cell tropism. Here, we provide evidence that another member, US20, impacts the ability of a clinical strain of HCMV to replicate in endothelial cells. Through the use of recombinant HCMV encoding tagged versions of the US20 protein, we investigated the expression pattern, localization, and topology of the US20-encoded protein (pUS20). We show that pUS20 is expressed as a partially glycosylated 7TMD protein which accumulates late in infection in endoplasmic reticulum-derived peripheral structures localized outside the cytoplasmic virus assembly compartment (cVAC). US20-deficient mutants generated in the TR clinical strain of HCMV exhibited major growth defects in different types of endothelial cells, whereas they replicated normally in fibroblasts and epithelial cells. While the attachment and entry phases in endothelial cells were not significantly affected by the absence of US20 protein, US20-null viruses failed to replicate viral DNA and express representative E and L mRNAs and proteins. Taken together, these results indicate that US20 sustains the HCMV replication cycle at a stage subsequent to entry but prior to E gene expression and viral DNA synthesis in endothelial cells. IMPORTANCE Human cytomegalovirus (HCMV) is a major pathogen in newborns and immunocompromised individuals. A hallmark of HCMV pathogenesis is its ability to productively replicate in an exceptionally broad range of target cells, including endothelial cells, which represent

  5. Infection with an H2 recombinant herpes simplex virus vector results in expression of MHC class I antigens on the surfaces of human neuroblastoma cells in vitro and mouse sensory neurons in vivo.

    PubMed

    Abendroth, A; Simmons, A; Efstathiou, S; Pereira, R A

    2000-10-01

    The majority of neurons in herpes simplex virus (HSV)-infected murine sensory ganglia are transiently induced to express MHC-I antigens at the cell surface, whereas only a minority are themselves productively infected. The aim of the current work was to determine whether MHC-I antigens can be expressed on the surfaces of infected neurons in addition to their uninfected neighbours. To address this aim a recombinant HSV type 1 strain, S-130, was used to deliver a mouse H2K(d) gene, under control of the HCMV IE-1 promoter/enhancer, into human neuroblastoma cells in vitro and mouse primary sensory neurons in vivo. S-130 expressed H2K(d) antigens on the surfaces of IMR-32 cells, a human neuroblastoma cell line that expresses very low levels of MHC-I constitutively. In K562 cells, which do not express MHC-I constitutively, H2K(d) and beta(2)-microglobulin (beta(2)m) were shown to be co-expressed at the cell surface following S-130 infection. This observation was taken as evidence that class I heavy chain (alphaC) molecules encoded by the expression cassette in the HSV genome were transported to the cell surface as stable complexes with beta(2)m. Significantly, after introduction of S-130 into flank skin, H2K(d) antigens were detected on the surfaces of primary sensory neurons in ganglia innervating the inoculation site. Our data show that HSV-infected murine primary sensory neurons and human neuroblastoma cells are capable of expressing cell-surface MHC-I molecules encoded by a transgene. From this, we infer that up-regulation of alphaC expression is, in principle, sufficient to overcome potential impediments to neuronal cell surface expression of MHC-I complexes.

  6. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  7. Detection of human cytomegalovirus DNA in paraffin sections of human brain by polymerase chain reaction and the occurrence of false negative results.

    PubMed Central

    Gass, P; Kiessling, M; Schäfer, P; Mester, C; Schmitt, H P; Kühn, J E

    1993-01-01

    Paraffin-embedded necropsy material from 6 patients with human cytomegalovirus encephalitis (HCMVE) corroborated by immunocytochemistry and 11 control cases were examined for the presence of human cytomegalovirus (HCMV) DNA by a nested polymerase chain reaction (nPCR). A characteristic 183 base pair (bp) fragment of the HCMV genome could readily be amplified in 4 cases of HCMVE. In 2 cases of HCMVE, viral DNA could be demonstrated only sporadically by PCR, due most likely to inefficient DNA extraction or DNA degradation. All control cases remained negative. The nPCR provides a specific method for detecting HCMV DNA in routinely processed biopsy and necropsy material and may be used in archival tissues for the diagnosis of infection. Fixation of samples and DNA extraction are, however, crucial steps and require careful control if PCR is used for detection of HCMV, to avoid false negative results. Images PMID:8382271

  8. Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

    PubMed Central

    Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

    2011-01-01

    Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

  9. Human Cytomegalovirus Vaccine Based on the Envelope gH/gL Pentamer Complex

    PubMed Central

    Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A.; Diamond, Don J.

    2014-01-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  10. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.

    PubMed

    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J

    2014-11-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  11. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.

    PubMed

    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J

    2014-11-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  12. Roles of phosphatidylinositol 3-kinase and NF-kappaB in human cytomegalovirus-mediated monocyte diapedesis and adhesion: strategy for viral persistence.

    PubMed

    Smith, M Shane; Bivins-Smith, Elizabeth R; Tilley, A Michael; Bentz, Gretchen L; Chan, Gary; Minard, Jessica; Yurochko, Andrew D

    2007-07-01

    Infected peripheral blood monocytes are proposed to play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to tissues, a critical step in the establishment of HCMV persistence and the development of HCMV-associated diseases. We recently provided evidence for a unique strategy involved in viral dissemination: HCMV infection of primary human monocytes promotes their transendothelial migration and differentiation into proinflammatory macrophages permissive for the replication of the original input virus. To decipher the mechanism of hematogenous spread, we focused on the viral dysregulation of early cellular processes involved in transendothelial migration. Here, we present evidence that both phosphatidylinositol 3-kinase [PI(3)K] and NF-kappaB activities were crucial for the HCMV induction of monocyte motility and firm adhesion to endothelial cells. We found that the beta(1) integrins, the beta(2) integrins, intracellular adhesion molecule 1 (ICAM-1), and ICAM-3 were upregulated following HCMV infection and that they played a key role in the firm adhesion of infected monocytes to the endothelium. The viral regulation of adhesion molecule expression is complex, with PI(3)K and NF-kappaB affecting the expression of each adhesion molecule at different stages of the expression cascade. Our data demonstrate key roles for PI(3)K and NF-kappaB signaling in the HCMV-induced cellular changes in monocytes and identify the biological rationale for the activation of these pathways in infected monocytes, which together suggest a mechanism for how HCMV promotes viral spread to and persistence within host organs.

  13. Significant Association of Multiple Human Cytomegalovirus Genomic Loci with Glioblastoma Multiforme Samples

    PubMed Central

    Ranganathan, Padhma; Clark, Paul A.; Kuo, John S.; Salamat, M. Shahriar

    2012-01-01

    Viruses are appreciated as etiological agents of certain human tumors, but the number of different cancer types induced or exacerbated by viral infections is unknown. Glioblastoma multiforme (GBM)/astrocytoma grade IV is a malignant and lethal brain cancer of unknown origin. Over the past decade, several studies have searched for the presence of a prominent herpesvirus, human cytomegalovirus (HCMV), in GBM samples. While some have detected HCMV DNA, RNA, and proteins in GBM tissues, others have not. Therefore, any purported association of HCMV with GBM remains controversial. In most of the previous studies, only one or a select few viral targets were analyzed. Thus, it remains unclear the extent to which the entire viral genome was present when detected. Here we report the results of a survey of GBM specimens for as many as 20 different regions of the HCMV genome. Our findings indicate that multiple HCMV loci are statistically more likely to be found in GBM samples than in other brain tumors or epileptic brain specimens and that the viral genome was more often detected in frozen samples than in paraffin-embedded archival tissue samples. Finally, our experimental results indicate that cellular genomes substantially outnumber viral genomes in HCMV-positive GBM specimens, likely indicating that only a minority of the cells found in such samples harbor viral DNA. These data argue for the association of HCMV with GBM, defining the virus as oncoaccessory. Furthermore, they imply that, were HCMV to enhance the growth or survival of a tumor (i.e., if it is oncomodulatory), it would likely do so through mechanisms distinct from classic tumor viruses that express transforming viral oncoproteins in the overwhelming majority of tumor cells. PMID:22090104

  14. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.

    2015-01-01

    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  15. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins.

  16. Comparison of nested PCR for detection of DNA in plasma with pp65 leukocytic antigenemia procedure for diagnosis of human cytomegalovirus infection.

    PubMed Central

    Freymuth, F; Gennetay, E; Petitjean, J; Eugene, G; Hurault de Ligny, B; Ryckelynck, J P; Legoff, C; Hazera, P; Bazin, C

    1994-01-01

    A nested PCR was used for the detection of human cytomegalovirus (HCMV) DNA in plasma. The presence of HCMV DNA and its correlation to pp65 leukocytic antigenemia were investigated with 299 blood samples from 45 organ transplant recipients and 63 AIDS patients. Of the 53 samples positive by nested PCR, 52 (98%) were also positive for leukocytic antigenemia and 23 had high levels of antigenemia (> 50 positive cells per 2 x 10(5) leukocytes). Of the 246 samples negative in PCR, only 3 (1.2%) had highly positive antigenemia. For 15 patients having a high antigenemia level in the course of their disease, consecutive blood samples were studied and also assessed for viremia in culture. The extent to which HCMV DNA, detected by PCR, was present in plasma correlated with increased levels of HCMV leukocytic antigenemia for six of the eight AIDS patients and for all the organ transplant recipients. Positivity for HCMV DNA in PCR and for viremia in cell culture was usually restricted to the highest antigenemia levels. From a total of 69 blood samples, PCR and culture gave positive results, respectively, for 17 of 32 samples (53%) and 14 of 32 samples (43%) from transplant recipients and for 15 of 37 samples (40%) and 9 of 37 samples (24%) from AIDS patients. Our findings have shown a strong correlation between high levels of leukocytic antigenemia and HCMV DNA in plasma. The detection of HCMV DNA in plasma by this nested PCR can prove HCMV dissemination in blood, but it lacks the rapidity and simplicity of the leukocytic pp65 antigenemia procedure. PMID:8077418

  17. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  18. The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

    PubMed

    Winkler, Laura L; Kalejta, Robert F

    2014-10-01

    Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during

  19. Detection of human cytomegalovirus and epstein-barr virus in coronary atherosclerotic tissue.

    PubMed

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-07-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

  20. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.

    PubMed

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-04-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  1. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.

    PubMed

    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M

    2016-07-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  2. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner

    PubMed Central

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  3. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  4. RhoB is a component of the human cytomegalovirus assembly complex and is required for efficient viral production

    PubMed Central

    Goulidaki, Nektaria; Alarifi, Saud; Alkahtani, Saad H; Al-Qahtani, Ahmed; Spandidos, Demetrios A; Stournaras, Christos; Sourvinos, George

    2015-01-01

    Human Cytomegalovirus (HCMV), an ubiquitous β-herpesvirus, is a significant pathogen that causes medically severe diseases in immunocompromised individuals and in congenitally infected neonates. RhoB belongs to the family of Rho GTPases, which regulates diverse cellular processes. Rho proteins are implicated in the entry and egress from the host cell of mainly α- and γ-herpesviruses, whereas β-herpesviruses are the least studied in this regard. Here, we studied the role of RhoB GTPase during HCMV lytic infection. Microscopy analysis, both in fixed and live infected cells showed that RhoB was translocated to the assembly complex/compartment (AC) of HCMV, a cytoplasmic zone in infected cells where many viral structural proteins are known to accumulate and assembly of new virions takes place. Furthermore, RhoB was localized at the AC even when the expression of the late HCMV AC proteins was inhibited. At the very late stages of infection, cellular projections were formed containing RhoB and HCMV virions, potentially contributing to the successful viral spread. Interestingly, the knockdown of RhoB in HCMV-infected cells resulted in a significant reduction of the virus titer and could also affect the accumulation of AC viral proteins at this subcellular compartment. RhoB knockdown also affected actin fibers' structure. Actin reorganization was observed at late stages of infection originating from the viral AC and surrounding the cellular projections, implying a potential interplay between RhoB and actin during HCMV assembly and egress. In conclusion, our results demonstrate for the first time that RhoB is a constituent of the viral AC and is required for HCMV productive infection. PMID:26114383

  5. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  6. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

    PubMed Central

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-01-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  7. Cytomegalovirus-mediated activation of pyrimidine biosynthesis drives UDP–sugar synthesis to support viral protein glycosylation

    PubMed Central

    DeVito, Stefanie Renee; Ortiz-Riaño, Emilio; Martínez-Sobrido, Luis; Munger, Joshua

    2014-01-01

    Human cytomegalovirus (HCMV) induces numerous changes to the host metabolic network that are critical for high-titer viral replication. We find that HCMV infection substantially induces de novo pyrimidine biosynthetic flux. This activation is important for HCMV replication because inhibition of pyrimidine biosynthetic enzymes substantially decreases the production of infectious virus, which can be rescued through medium supplementation with pyrimidine biosynthetic intermediates. Metabolomic analysis revealed that pyrimidine biosynthetic inhibition considerably reduces the levels of various UDP–sugar metabolites in HCMV-infected, but not mock-infected, cells. Further, UDP–sugar biosynthesis, which provides the sugar substrates required for glycosylation reactions, was found to be induced during HCMV infection. Pyrimidine biosynthetic inhibition also attenuated the glycosylation of the envelope glycoprotein B (gB). Both glycosylation of gB and viral growth were restored by medium supplementation with either UDP–sugar metabolites or pyrimidine precursors. These results indicate that HCMV drives de novo-synthesized pyrimidines to UDP–sugar biosynthesis to support virion protein glycosylation. The importance of this link between pyrimidine biosynthesis and UDP–sugars appears to be partially shared among diverse virus families, because UDP–sugar metabolites rescued the growth attenuation associated with pyrimidine biosynthetic inhibition during influenza A and vesicular stomatitis virus infection, but not murine hepatitis virus infection. In total, our results indicate that viruses can specifically modulate pyrimidine metabolic flux to provide the glycosyl subunits required for protein glycosylation and production of high titers of infectious progeny. PMID:25472841

  8. Molecular profiling of cytomegalovirus-induced human CD8+ T cell differentiation

    PubMed Central

    Hertoghs, Kirsten M.L.; Moerland, Perry D.; van Stijn, Amber; Remmerswaal, Ester B.M.; Yong, Sila L.; van de Berg, Pablo J.E.J.; van Ham, S. Marieke; Baas, Frank; ten Berge, Ineke J.M.; van Lier, René A.W.

    2010-01-01

    CD8+ T cells play a critical role in the immune response to viral pathogens. Persistent human cytomegalovirus (HCMV) infection results in a strong increase in the number of virus-specific, quiescent effector-type CD8+ T cells with constitutive cytolytic activity, but the molecular pathways involved in the induction and maintenance of these cells are unknown. We show here that HCMV infection induced acute and lasting changes in the transcriptomes of virus-reactive T cells collected from HCMV-seropositive patients at distinct stages of infection. Enhanced cell cycle and metabolic activity was restricted to the acute phase of the response, but at all stages, HCMV-specific CD8+ T cells expressed the Th1-associated transcription factors T-bet (TBX21) and eomesodermin (EOMES), in parallel with continuous expression of IFNG mRNA and IFN-γ–regulated genes. The cytolytic proteins granzyme B and perforin as well as the fractalkine-binding chemokine receptor CX3CR1 were found in virus-reactive cells throughout the response. During HCMV latency, virus-specific CD8+ T cells lacked the typical features of exhausted cells found in other chronic infections. Persistent effector cell traits together with the permanent changes in chemokine receptor usage of virus-specific, nonexhausted, long-lived CD8+ T cells may be crucial to maintain lifelong protection from HCMV reactivation. PMID:20921622

  9. Human cytomegalovirus increases modified low density lipoprotein uptake and scavenger receptor mRNA expression in vascular smooth muscle cells.

    PubMed Central

    Zhou, Y F; Guetta, E; Yu, Z X; Finkel, T; Epstein, S E

    1996-01-01

    Evidence suggests a possible role for human cytomegalovirus (HCMV) in the development of arteriosclerosis. One of the earliest events in plaque formation is the accumulation of lipid-laden foam cells, derived from macrophages and smooth muscle cells (SMCs). The lipid accumulation that occurs depends upon the uptake of oxidized LDL (Ox-LDL), a process in which the scavenger receptor (SR) has been postulated to play an important role. We therefore examined the effects of HCMV on this process. We demonstrate that HCMV infection of human SMCs increases modified LDL uptake and stimulates class A SR gene (SR-A) mRNA expression. In addition, infection of rat SMCs with HCMV, which causes immediate early gene expression (IE72/IE84), but no early or late HCMV gene products and no cytopathic effects, also increases SMC uptake of Ox-LDL and acetylated LDL, with either effect blocked by an excess of either cold Ox-LDL or acetylated-LDL, and by fucoidin, an SR competitor. Cotransfection of an IE72, but not an IE84, expression plasmid and a plasmid containing a Class A SR promoter/reporter gene construct enhances SR promoter activity. Since increased Ox-LDL uptake is believed to play an important role in arteriosclerosis, these results provide a link between HCMV infection and arteriosclerotic plaque formation. PMID:8903333

  10. Human Cytomegalovirus Up-Regulates Endothelin Receptor Type B: Implication for Vasculopathies?

    PubMed Central

    Yaiw, Koon-Chu; Mohammad, Abdul-Aleem; Costa, Helena; Taher, Chato; Badrnya, Sigrun; Assinger, Alice; Wilhelmi, Vanessa; Ananthaseshan, Sharan; Estekizadeh, Atosa; Davoudi, Belghis; Ovchinnikova, Olga; Shlyakhto, Eugene; Rafnsson, Arnar; Khan, Zahidul; Butler, Lynn; Rahbar, Afsar; Pernow, John; Söderberg-Nauclér, Cecilia

    2015-01-01

    Background. Both endothelin receptor type B ([ETBR], a G protein-coupled receptor that mediates the vascular effects of the potent vasoconstrictor endothelin-1) and human cytomegalovirus ([HCMV], a ubiquitous herpesvirus) have been implicated in the pathogenesis of cardiovascular disease (CVD). The effects of HCMV infection on ETBR expression are unknown. We hypothesized that HCMV may contribute to the pathogenesis of CVD via ETBR modulation. Methods. Human CMV effects on ETBR were studied in vitro in endothelial cells (ECs) and smooth muscle cells (SMCs) and ex vivo in human carotid plaque tissue specimens. Expression of ETBR and viral immediate-early were quantified using quantitative polymerase chain reaction. Functional consequences after ETBR blockade in ECs were examined by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide proliferation, wound healing, tube formation, and flow adhesion assays. Results. Human CMV is capable of upregulating both ETBR mRNA and protein expression in ECs and SMCs. The ETBR was also abundantly expressed in ECs, foam cells, and SMCs, and, more importantly, in HCMV-positive cells in human carotid plaques. Endothelin receptor type B blockade led to decreased proliferation and reduced tumor necrosis factor α-mediated leukocyte recruitment in both uninfected and HCMV-infected ECs. Direct HCMV infection was antimigratory and antiangiogenic in ECs. Conclusions. Human CMV may contribute to CVD via ETBR induction. PMID:26719843

  11. Ribonucleotide reductase inhibitors hydroxyurea, didox, and trimidox inhibit human cytomegalovirus replication in vitro and synergize with ganciclovir

    PubMed Central

    Bhave, Sukhada; Elford, Howard; McVoy, Michael A.

    2013-01-01

    Ganciclovir (GCV) is a deoxyguanosine analog that is effective in inhibiting human cytomegalovirus (HCMV) replication. In infected cells GCV is converted to GCV-triphosphate which competes with dGTP for incorporation into the growing DNA strand by the viral DNA polymerase. Incorporated GCV promotes chain termination as it is an inefficient substrate for elongation. Because viral DNA synthesis also relies on cellular ribonucleotide reductase (RR) to synthesize deoxynucleotides, RR inhibitors are predicted to inhibit HCMV replication. Moreover, as dGTP competes with GCV-triphosphate for incorporation, RR inhibitors may also synergize with GCV by reducing intracellular dGTP levels and there by promoting increased GCV-triphosphate utilization by DNA polymerase. To investigate potential of RR inhibitors as anti-HCMV agents both alone and in combination with GCV, HCMV-inhibitory activities of three RR inhibitors, hydroxyurea, didox, and trimidox, were determined. In both spread inhibition and yield reduction assays RR inhibitors had modest anti-HCMV activity with 50% inhibitory concentrations ranging from 36 ± 1.7 to 221 ± 52 µM. However, all three showed significant synergy with GCV at concentrations below their 50% inhibitory and 50% toxic concentrations. These results suggest that combining GCV with relatively low doses of RR inhibitors could significantly potentiate the anti-HCMV activity of GCV in vivo and could improve clinical response to therapy. PMID:23933116

  12. A collaborative study to establish the 1st WHO International Standard for human cytomegalovirus for nucleic acid amplification technology.

    PubMed

    Fryer, Jacqueline F; Heath, Alan B; Minor, Philip D

    2016-07-01

    Variability in the performance of nucleic acid amplification technology (NAT)-based assays presents a significant problem in the diagnosis and management of human cytomegalovirus (HCMV) infections. Here we describe a collaborative study to evaluate the suitability of candidate reference materials to harmonize HCMV viral load measurements in a wide range of NAT assays. Candidate materials comprised lyophilized Merlin virus, liquid Merlin virus, liquid AD169 virus, and purified HCMV Merlin DNA cloned into a bacterial artificial chromosome. Variability in the laboratory mean HCMV concentrations determined for virus samples across the different assays was 2 log10. Variability for the purified DNA sample was higher (>3 log10). The agreement between laboratories was markedly improved when the potencies of the liquid virus samples were expressed relative to the lyophilized virus candidate. In contrast, the agreement between laboratories for the purified DNA sample was not improved. Results indicated the suitability of the lyophilized Merlin virus preparation as the 1st WHO International Standard for HCMV for NAT. It was established in October 2010, with an assigned potency of 5 × 10(6) International Units (IU) (NIBSC code 09/162). It is intended to be used to calibrate secondary references, used in HCMV NAT assays, in IU. PMID:27179913

  13. Controversies in the natural history of congenital human cytomegalovirus infection: the paradox of infection and disease in offspring of women with immunity prior to pregnancy.

    PubMed

    Britt, William

    2015-06-01

    Human cytomegalovirus (HCMV) is the most common virus infection in the developing fetus. A fraction of infants infected in utero develop significant life-threatening and organ-threatening disease with over 90% of infected infants exhibiting no clinical evidence of infection in the newborn period. However, about 10% of all infected infants will develop long-term sequelae. Early studies stressed the importance of primary maternal HCMV infection during pregnancy as a critical determinant of intrauterine transmission and outcome. This concept serves as the foundation for the development of prophylactic vaccines and biologics such as HCMV immune globulins. More recently, studies in maternal populations with high HCMV seroprevalence have challenged the concept of protective maternal immunity. Findings from multiple studies suggest that preexisting maternal HCMV immunity provides at best, partial protection from disease in the infected offspring and similarly may have limited impact on intrauterine transmission. This brief review will provide some considerations about the apparent paradox of maternal HCMV immunity and congenital infection.

  14. A Proteomics Analysis of Human Cytomegalovirus Particles

    SciTech Connect

    Streblow, Daniel N.; Varnum, Susan M.; Smith, Richard D.; Nelson, Jay

    2006-01-01

    While the sequence of the AD169 HCMV genome has been known for several years, the viral and cellular proteins that compose the infectious HCMV virion and entry-competent, non-replicating viral particles such as Dense Bodies (DBs) and Non-Infectious Enveloped Particles (NIEPs) are unknown. To approach this problem we have utilized a gel-free 2-D capillary liquid chromatography (LC)-MS/MS and Fourier transform ion cyclotron resonance (FTICR) mass spectrometry to identify and determine the relative abundance of viral and cellular proteins in purified HCMV AD169 particles. !is study has identified and quantitated the proteins that compose both HCMV virions and DBs. While a number of previously identified proteins were detected by this method the number of viral proteins that compose the HCMV virion was doubled in this study suggesting that over a third of the viral open reading frames are part of an infectious virion. !is chapter will discuss the implications of our findings in relation to what was previously known about HCMV and MCMV virion composition.

  15. Human cytomegalovirus replicates in gamma-irradiated fibroblasts

    SciTech Connect

    Shanley, J.D.

    1986-12-01

    Because of the unique interdependence of human cytomegalovirus (HCMV) and the physiological state of the host cell, we evaluated the ability of human foreskin fibroblasts (HFF), exposed to gamma radiation, to support HCMV growth. Irradiation of HFF with 2,500 rADS prevented cellular proliferation and suppressed cellular DNA, but not RNA or protein synthesis. Treatment of HFF cells with 2,500 rADS 6 or 48 hours prior to infection did not alter the time course or virus yield during HCMV replication. Virus plaquing efficiency in irradiated cells was comparable to that of nonirradiated cells. As judged by thymidine incorporation and BUdR inhibition of virus replication, HCMV infection induced both thymidine kinase activity and host cell DNA synthesis in irradiated cells. In addition, virus could be recovered from HFF exposed to radiation 0-2 days after infection with HCMV. These studies indicate that the damage to cells by gamma irradiation does not alter the capacity of host cells to support HCMV replication.

  16. The decoy Fcγ receptor encoded by the cytomegalovirus UL119-UL118 gene has differential affinity to IgG proteins expressing different GM allotypes.

    PubMed

    Pandey, Janardan P; Namboodiri, Aryan M; Radwan, Faisal F; Nietert, Paul J

    2015-08-01

    Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that has been implicated in many diseases. However, there is significant divergence between HCMV seroprevalence and the prevalence of HCMV-associated diseases, implying the presence of host genetic factors that might modulate immunity to this virus. HCMV deploys many sophisticated strategies to evade host immunosurveillance. One strategy involves encoding for proteins that have functional properties of the Fcγ receptor (FcγR). The aim of the present investigation was to determine whether the UL119-UL118-encoded recombinant FcγR ectodomain binds differentially to genetically disparate IgG1 proteins. Results show that mean absorbance values for binding of HCMV UL119-UL118-encoded Fcγ receptor to the immunoglobulin GM (γ marker) 1,17-expressing IgG1 were significantly higher than to the IgG1 expressing the allelic GM 3 allotype (0.225 vs. 0.151; p=0.039). These findings suggest possible mechanisms underlying the maintenance of immunoglobulin GM gene polymorphism and its putative role in the etiology of HCMV-associated diseases.

  17. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  18. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    PubMed Central

    Krömmelbein, Natascha; Wiebusch, Lüder; Schiedner, Gudrun; Büscher, Nicole; Sauer, Caroline; Florin, Luise; Sehn, Elisabeth; Wolfrum, Uwe; Plachter, Bodo

    2016-01-01

    The human cytomegalovirus (HCMV) replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP) is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production. PMID:26848680

  19. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects.

    PubMed

    Sylwester, Andrew W; Mitchell, Bridget L; Edgar, John B; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R; Grabstein, Kenneth H; Hosken, Nancy A; Kern, Florian; Nelson, Jay A; Picker, Louis J

    2005-09-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4(+) and/or CD8(+) T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average approximately 10% of both the CD4(+) and CD8(+) memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8(+) T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  20. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects

    PubMed Central

    Sylwester, Andrew W.; Mitchell, Bridget L.; Edgar, John B.; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R.; Grabstein, Kenneth H.; Hosken, Nancy A.; Kern, Florian; Nelson, Jay A.; Picker, Louis J.

    2005-01-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4+ and/or CD8+ T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average ∼10% of both the CD4+ and CD8+ memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8+ T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  1. Human Cytomegalovirus pTRS1 and pIRS1 Antagonize Protein Kinase R To Facilitate Virus Replication

    PubMed Central

    Ziehr, Benjamin; Vincent, Heather A.

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) counteracts host defenses that otherwise act to limit viral protein synthesis. One such defense is the antiviral kinase protein kinase R (PKR), which inactivates the eukaryotic initiation factor 2 (eIF2) translation initiation factor upon binding to viral double-stranded RNAs. Previously, the viral TRS1 and IRS1 proteins were found to antagonize the antiviral kinase PKR outside the context of HCMV infection, and the expression of either pTRS1 or pIRS1 was shown to be necessary for HCMV replication. In this study, we found that expression of either pTRS1 or pIRS1 is necessary to prevent PKR activation during HCMV infection and that antagonism of PKR is critical for efficient viral replication. Consistent with a previous study, we observed decreased overall levels of protein synthesis, reduced viral protein expression, and diminished virus replication in the absence of both pTRS1 and pIRS1. In addition, both PKR and eIF2α were phosphorylated during infection when pTRS1 and pIRS1 were absent. We also found that expression of pTRS1 was both necessary and sufficient to prevent stress granule formation in response to eIF2α phosphorylation. Depletion of PKR prevented eIF2α phosphorylation, rescued HCMV replication and protein synthesis, and reversed the accumulation of stress granules in infected cells. Infection with an HCMV mutant lacking the pTRS1 PKR binding domain resulted in PKR activation, suggesting that pTRS1 inhibits PKR through a direct interaction. Together our results show that antagonism of PKR by HCMV pTRS1 and pIRS1 is critical for viral protein expression and efficient HCMV replication. IMPORTANCE To successfully replicate, viruses must counteract host defenses that limit viral protein synthesis. We have identified inhibition of the antiviral kinase PKR by the viral proteins TRS1 and IRS1 and shown that this is a critical step in HCMV replication. Our results suggest that inhibiting pTRS1 and pIRS1 function or

  2. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus

    PubMed Central

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q.; Xu, Xin; Dulcey, Andrés E.; Marugan, Juan J.; Ferrer, Marc; Arav-Boger, Ravit

    2016-01-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50−40±1.72 nM, CC50−8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected

  3. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.

    2016-01-01

    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  4. Identification of a Neutralizing Epitope within Antigenic Domain 5 of Glycoprotein B of Human Cytomegalovirus

    PubMed Central

    Wiegers, Anna-Katharina; Sticht, Heinrich; Winkler, Thomas H.; Britt, William J.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is an important, ubiquitous pathogen that causes severe clinical disease in immunocompromised individuals, such as organ transplant recipients and infants infected in utero. The envelope glycoprotein B (gB) of HCMV is a major antigen for the induction of virus-neutralizing antibodies. We have begun to define target structures within gB that are recognized by virus-neutralizing antibodies. Antigenic domain 5 (AD-5) of gB has been identified as an important target for neutralizing antibodies in studies using human monoclonal antibodies (MAbs). Anti-AD-5 MAbs share a target site on gB, despite originating from different, healthy, HCMV-infected donors. Mutational analysis of AD-5 identified tyrosine 280 in combination with other surface-exposed residues (the YNND epitope) as critical for antibody binding. The YNND epitope is strictly conserved among different HCMV strains. Recombinant viruses carrying YNND mutations in AD-5 were resistant to virus-neutralizing MAbs. Competition enzyme-linked immunosorbent assays (ELISAs) with human HCMV-convalescent-phase sera from unselected donors confirmed the conserved antibody response for the YNND epitope in HCMV-infected individuals and, because a significant fraction of the gB AD-5 response was directed against the YNND epitope, further argued that this epitope is a major target of anti-AD-5 antibody responses. In addition, affinity-purified polyclonal anti-AD-5 antibodies prepared from individual sera showed reactivity to AD-5 and neutralization activity toward gB mutant viruses that were similar to those of AD-5-specific MAbs. Taken together, our data indicate that the YNND epitope represents an important target for anti-gB antibody responses as well as for anti-AD-5 virus-neutralizing antibodies. IMPORTANCE HCMV is a major global health concern, and a vaccine to prevent HCMV disease is a widely recognized medical need. Glycoprotein B of HCMV is an important target for neutralizing

  5. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus.

    PubMed

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q; Xu, Xin; Dulcey, Andrés E; Marugan, Juan J; Ferrer, Marc; Arav-Boger, Ravit

    2016-06-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50-40±1.72 nM, CC50-8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected RPS14

  6. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  7. Is human cytomegalovirus infection associated with essential hypertension? A meta-analysis of 11,878 participants.

    PubMed

    Wang, Zuoguang; Peng, Xiaoyun; Li, Mei; Jin, Fei; Zhang, Bei; Wang, Hao; Wei, Yongxiang

    2016-05-01

    Human cytomegalovirus (HCMV) has been reported to be highly expressed in essential hypertension (EH), and it has been proposed that HCMV infection may contribute to EH development. However, different studies showed opposite results. The present meta-analysis was performed to investigate the association between HCMV infection and the risk of EH. All relevant literature from 1980 to 2015 was extracted from six electronic databases. Odds ratios (OR) and 95% confidence intervals (CI) were used to assess the strength of the association of HCMV infection and risk of EH. Sensitivity analysis and examination for bias were conducted to evaluate cumulative evidence of the association. The random-effect model using the Mantel-Haenszel method was used to give the individual effect-size estimates. Of the 11,878 participants included in this study, there were 3,864 EH patients and 8,014 control subjects. Meta-analysis of nine studies performed in a random-effect model found that EH patients had a higher risk of HCMV infection than normal control subjects (OR = 1.47, 95%CI: 1.13-1.90, P = 0.004; heterogeneity: I(2)  = 66%, P = 0.002). Sensitivity analysis and bias examination showed the overall quality and consistency of the studies to be acceptable. For subgroup analysis, studies of Chinese populations were selected for further analysis. There was a significant association between HCMV infection and EH among Chinese patients (OR = 2.18, 95%CI:1.43-3.31, P = 0.0003) but not among other ethnic groups (OR = 1.11, 95%CI:0.95-1.31, P = 0.19). These findings provide quantitative support for the association between HCMV infection and high risk of EH in individuals of Chinese ethnicity.

  8. Human cytomegalovirus infection inhibits tumor necrosis factor alpha (TNF-alpha) signaling by targeting the 55-kilodalton TNF-alpha receptor.

    PubMed

    Baillie, J; Sahlender, D A; Sinclair, J H

    2003-06-01

    Infection with human cytomegalovirus (HCMV) results in complex interactions between viral and cellular factors which perturb many cellular functions. HCMV is known to target the cell cycle, cellular transcription, and immunoregulation, and it is believed that this optimizes the cellular environment for viral DNA replication during productive infection or during carriage in the latently infected host. Here, we show that HCMV infection also prevents external signaling to the cell by disrupting the function of TNFRI, the 55-kDa receptor for tumor necrosis factor alpha (TNF-alpha), one of the receptors for a potent cytokine involved in eliciting a wide spectrum of cellular responses, including antiviral responses. HCMV infection of fully permissive differentiated monocytic cell lines and U373 cells resulted in a reduction in cell surface expression of TNFRI. The reduction appeared to be due to relocalization of TNFRI from the cell surface and was reflected in the elimination of TNF-alpha-induced Jun kinase activity. Analysis of specific phases of infection suggested that viral early gene products were responsible for this relocalization. However, a mutant HCMV in which all viral gene products known to be involved in down-regulation of major histocompatibility complex (MHC) class I were deleted still resulted in relocalization of TNFRI. Consequently, TNFRI relocalization by HCMV appears to be mediated by a novel viral early function not involved in down-regulation of cell surface MHC class I expression. We suggest that upon infection, HCMV isolates the cell from host-mediated signals, forcing the cell to respond only to virus-specific signals which optimize the cell for virus production and effect proviral responses from bystander cells.

  9. Nonnucleoside Pyrrolopyrimidines with a Unique Mechanism of Action against Human Cytomegalovirus

    PubMed Central

    Jacobson, Jennie G.; Renau, Thomas E.; Nassiri, M. Reza; Sweier, Dominica G.; Breitenbach, Julie M.; Townsend, Leroy B.; Drach, John C.

    1999-01-01

    Based upon a prior study which evaluated a series of nonnucleoside pyrrolo[2,3-d]pyrimidines as inhibitors of human cytomegalovirus (HCMV), we have selected three active analogs for detailed study. In an HCMV plaque-reduction assay, compounds 828, 951, and 1028 had 50% inhibitory concentrations (IC50s) of 0.4 to 1.0 μM. Similar results were obtained when 828 and 951 were examined by HCMV enzyme-linked immunosorbent assay (IC50s = 1.9 and 0.4 μM, respectively) and when 828 was tested in a viral DNA-DNA hybridization assay (IC50 = 1.3 μM). In yield-reduction assays with a low multiplicity of infection (MOI), all three compounds caused multiple log10 reductions in virus titer, and the activities of these compounds were comparable to the activity of ganciclovir (GCV; IC90 = 0.2 μM). In contrast to the reduction of viral titers by GCV, the reduction of viral titers by 828, 951, and 1028 decreased with increasing MOI. Cytotoxicity in human foreskin fibroblasts and KB cells ranged from 32 to >100 μM. In addition, 828 (the only compound tested) was less toxic against human bone marrow progenitor cells than GCV. Time-of-addition and time-of-removal studies established that the three pyrrolopyrimidines inhibited HCMV replication before GCV had an effect on viral DNA synthesis but after viral adsorption. Compound 828 was equally effective against GCV-sensitive and GCV-resistant HCMV clinical isolates. Combination studies with 828 and GCV showed that the effects of the two compounds on HCMV were additive but not synergistic. Taken together, the data indicate that these pyrrolopyrimidines target a viral protein that is required in an MOI-dependent manner and that is expressed early in the HCMV replication cycle. PMID:10428908

  10. Detection of Low Frequency Multi-Drug Resistance and Novel Putative Maribavir Resistance in Immunocompromised Pediatric Patients with Cytomegalovirus.

    PubMed

    Houldcroft, Charlotte J; Bryant, Josephine M; Depledge, Daniel P; Margetts, Ben K; Simmonds, Jacob; Nicolaou, Stephanos; Tutill, Helena J; Williams, Rachel; Worth, Austen J J; Marks, Stephen D; Veys, Paul; Whittaker, Elizabeth; Breuer, Judith

    2016-01-01

    Human cytomegalovirus (HCMV) is a significant pathogen in immunocompromised individuals, with the potential to cause fatal pneumonitis and colitis, as well as increasing the risk of organ rejection in transplant patients. With the advent of new anti-HCMV drugs there is therefore considerable interest in using virus sequence data to monitor emerging resistance to antiviral drugs in HCMV viraemia and disease, including the identification of putative new mutations. We used target-enrichment to deep sequence HCMV DNA from 11 immunosuppressed pediatric patients receiving single or combination anti-HCMV treatment, serially sampled over 1-27 weeks. Changes in consensus sequence and resistance mutations were analyzed for three ORFs targeted by anti-HCMV drugs and the frequencies of drug resistance mutations monitored. Targeted-enriched sequencing of clinical material detected mutations occurring at frequencies of 2%. Seven patients showed no evidence of drug resistance mutations. Four patients developed drug resistance mutations a mean of 16 weeks after starting treatment. In two patients, multiple resistance mutations accumulated at frequencies of 20% or less, including putative maribavir and ganciclovir resistance mutations P522Q (UL54) and C480F (UL97). In one patient, resistance was detected 14 days earlier than by PCR. Phylogenetic analysis suggested recombination or superinfection in one patient. Deep sequencing of HCMV enriched from clinical samples excluded resistance in 7 of 11 subjects and identified resistance mutations earlier than conventional PCR-based resistance testing in 2 patients. Detection of multiple low level resistance mutations was associated with poor outcome. PMID:27667983

  11. NKp46 and DNAM-1 NK-cell receptors drive the response to human cytomegalovirus-infected myeloid dendritic cells overcoming viral immune evasion strategies.

    PubMed

    Magri, Giuliana; Muntasell, Aura; Romo, Neus; Sáez-Borderías, Andrea; Pende, Daniela; Geraghty, Daniel E; Hengel, Hartmut; Angulo, Ana; Moretta, Alessandro; López-Botet, Miguel

    2011-01-20

    Information on natural killer (NK)-cell receptor-ligand interactions involved in the response to human cytomegalovirus (HCMV) is limited and essentially based on the study of infected fibroblasts. Experimental conditions were set up to characterize the NK response to HCMV-infected myeloid dendritic cells (DCs). Monocyte-derived DCs (moDCs) infected by the TB40/E HCMV strain down-regulated the expression of human leukocyte antigen class I molecules and specifically activated autologous NK-cell populations. NKG2D ligands appeared virtually undetectable in infected moDCs, reflecting the efficiency of immune evasion mechanisms, and explained the lack of antagonistic effects of NKG2D-specific monoclonal antibody. By contrast, DNAM-1 and DNAM-1 ligands (DNAM-1L)-specific monoclonal antibodies inhibited the NK response at 48 hours after infection, although the impact of HCMV-dependent down-regulation of DNAM-1L in infected moDCs was perceived at later stages. moDCs constitutively expressed ligands for NKp46 and NKp30 natural cytotoxicity receptors, which were partially reduced on HCMV infection; yet, only NKp46 appeared involved in the NK response. In contrast to previous reports in fibroblasts, human leukocyte antigen-E expression was not preserved in HCMV-infected moDCs, which triggered CD94/NKG2A(+) NK-cell activation. The results provide an insight on key receptor-ligand interactions involved in the NK-cell response against HCMV-infected moDCs, stressing the importance of the dynamics of viral immune evasion mechanisms.

  12. Generation of potent neutralizing human monoclonal antibodies against cytomegalovirus infection from immune B cells

    PubMed Central

    Funaro, Ada; Gribaudo, Giorgio; Luganini, Anna; Ortolan, Erika; Lo Buono, Nicola; Vicenzi, Elisa; Cassetta, Luca; Landolfo, Santo; Buick, Richard; Falciola, Luca; Murphy, Marianne; Garotta, Gianni; Malavasi, Fabio

    2008-01-01

    Background Human monoclonal antibodies (mAbs) generated as a result of the immune response are likely to be the most effective therapeutic antibodies, particularly in the case of infectious diseases against which the immune response is protective. Human cytomegalovirus (HCMV) is an ubiquitous opportunistic virus that is the most serious pathogenic agent in transplant patients. The available therapeutic armamentarium (e.g. HCMV hyperimmune globulins or antivirals) is associated with severe side effects and the emergence of drug-resistant strains; therefore, neutralizing human mAb may be a decisive alternative in the prevention of primary and re-activated HCMV infections in these patients. Results The purpose of this study was to generate neutralizing mAb against HCMV from the immunological repertoire of immune donors. To this aim, we designed an efficient technology relying on two discrete and sequential steps: first, human B-lymphocytes are stimulated with TLR9-agonists and IL-2; second, after both additives are removed, the cells are infected with EBV. Using this strategy we obtained 29 clones secreting IgG neutralizing the HCMV infectivity; four among these were further characterized. All of the mAbs neutralize the infection in different combinations of HCMV strains and target cells, with a potency ~20 fold higher than that of the HCMV hyperimmune globulins, currently used in transplant recipients. Recombinant human monoclonal IgG1 suitable as a prophylactic or therapeutic tool in clinical applications has been generated. Conclusion The technology described has proven to be more reproducible, efficient and rapid than previously reported techniques, and can be adopted at low overall costs by any cell biology laboratory for the development of fully human mAbs for immunotherapeutic uses. PMID:19014469

  13. Detection of Low Frequency Multi-Drug Resistance and Novel Putative Maribavir Resistance in Immunocompromised Pediatric Patients with Cytomegalovirus

    PubMed Central

    Houldcroft, Charlotte J.; Bryant, Josephine M.; Depledge, Daniel P.; Margetts, Ben K.; Simmonds, Jacob; Nicolaou, Stephanos; Tutill, Helena J.; Williams, Rachel; Worth, Austen J. J.; Marks, Stephen D.; Veys, Paul; Whittaker, Elizabeth; Breuer, Judith

    2016-01-01

    Human cytomegalovirus (HCMV) is a significant pathogen in immunocompromised individuals, with the potential to cause fatal pneumonitis and colitis, as well as increasing the risk of organ rejection in transplant patients. With the advent of new anti-HCMV drugs there is therefore considerable interest in using virus sequence data to monitor emerging resistance to antiviral drugs in HCMV viraemia and disease, including the identification of putative new mutations. We used target-enrichment to deep sequence HCMV DNA from 11 immunosuppressed pediatric patients receiving single or combination anti-HCMV treatment, serially sampled over 1–27 weeks. Changes in consensus sequence and resistance mutations were analyzed for three ORFs targeted by anti-HCMV drugs and the frequencies of drug resistance mutations monitored. Targeted-enriched sequencing of clinical material detected mutations occurring at frequencies of 2%. Seven patients showed no evidence of drug resistance mutations. Four patients developed drug resistance mutations a mean of 16 weeks after starting treatment. In two patients, multiple resistance mutations accumulated at frequencies of 20% or less, including putative maribavir and ganciclovir resistance mutations P522Q (UL54) and C480F (UL97). In one patient, resistance was detected 14 days earlier than by PCR. Phylogenetic analysis suggested recombination or superinfection in one patient. Deep sequencing of HCMV enriched from clinical samples excluded resistance in 7 of 11 subjects and identified resistance mutations earlier than conventional PCR-based resistance testing in 2 patients. Detection of multiple low level resistance mutations was associated with poor outcome. PMID:27667983

  14. Cytomegalovirus infection does not impact on survival or time to first treatment in patients with chronic lymphocytic leukemia

    PubMed Central

    Damery, Sarah; Hudson, Christopher; Maurer, Matthew J.; Cerhan, James R.; Pachnio, Annette; Begum, Jusnara; Slager, Susan L.; Fegan, Christopher; Man, Stephen; Pepper, Christopher; Shanafelt, Tait D.; Pratt, Guy; Moss, Paul A. H.

    2016-01-01

    Human cytomegalovirus (HCMV) is a widely prevalent herpes virus which establishes a state of chronic infection. The establishment of CMV‐specific immunity controls viral reactivation and leads to the accumulation of very large numbers of virus‐specific T cells which come to dominate the immune repertoire. There is concern that this may reduce the immune response to heterologous infections and HCMV infection has been associated with reduced survival in elderly people. Patients with chronic lymphocytic leukemia (B‐CLL) suffer from a state of immune suppression but have a paradoxical increase in the magnitude of the CMV‐specific T cell and humoral immune response. As such, there is now considerable interest in how CMV infection impacts on the clinical outcome of patients with B‐CLL. Utilizing a large prospective cohort of patients with B‐CLL (n = 347) we evaluated the relationship between HCMV seropositivity and patient outcome. HCMV seropositive patients had significantly worse overall survival than HCMV negative patients in univariate analysis (HR = 2.28, 95% CI: 1.34–3.88; P = 0.002). However, CMV seropositive patients were 4 years older than seronegative donors and this survival difference was lost in multivariate modeling adjusted for age and other validated prognostic markers (P = 0.34). No significant difference was found in multivariate modeling between HCMV positive and negative patients in relation to the time to first treatment (HR = 1.12, 95% CI: 0.68–1.84; P = 0.65). These findings in a second independent cohort of 236 B‐CLL patients were validated. In conclusion no evidence that HCMV impacts on the clinical outcome of patients with B‐CLL was found. Am. J. Hematol. 91:776–781, 2016. © 2016 Wiley Periodicals, Inc. PMID:27124884

  15. Genetic polymorphisms of the human cytomegalovirus UL144 gene in colorectal cancer and its association with clinical outcome.

    PubMed

    Chen, Hsin-Pai; Jiang, Jeng-Kai; Chan, Chia-Hao; Teo, Wan-Huai; Yang, Chih-Yung; Chen, Yen-Chung; Chou, Teh-Ying; Lin, Chi-Hung; Chan, Yu-Jiun

    2015-12-01

    Human cytomegalovirus (HCMV) has been increasingly detected in colorectal cancer (CRC), and genetic polymorphisms in HCMV affect its pathogenesis. This study aimed to investigate HCMV genetic polymorphisms in CRC and its correlation with the clinical outcomes. We performed PCR and sequencing of a viral immunomodulatory gene, UL144, in clinical isolates and CRC specimens. The nucleotide and amino acid sequences were aligned, and a phylogenetic tree was constructed. The clinical, pathological and survival data were compared among tumours with different UL144 genotypes. HCMV was detected in 49 (47.8 %) of the tumour specimens. Genotype A predominated in 43 samples (22/43; 51.2 %) with successful sequencing, followed by genotype B (13/43; 30.2 %) and genotype C (8/43; 18.6 %). The genotypic distribution was similar to that of the clinical isolates and those reported in other Asian populations. The amino acid sequence of genotype B was the most conserved. For stage II and III CRC patients with HCMV-positive tumours, disease-free survival (DFS) varied among the three major genotypes (P50.0046). The presence of genotype B virus in the tumours was associated with a shorter DFS and independently predicted tumour recurrence in a multivariate Cox proportional hazards model (hazard ratio, 5.79; 95 % confidence interval, 1.30–25.81; P50.021). By reverse transcription PCR, tumour samples with genotype B viruses had the highest rate of UL144 expression. Our results suggest that genetic polymorphisms of HCMV UL144 are associated with clinical outcome in CRC and that HCMV may play an immunomodulatory role in the tumour microenvironment of CRC. PMID:26450180

  16. Synoviolin inhibitor LS-102 reduces endoplasmic reticulum stress-induced collagen secretion in an in vitro model of stress-related interstitial pneumonia.

    PubMed

    Nakajima, Fukami; Aratani, Satoko; Fujita, Hidetoshi; Yagishita, Naoko; Ichinose, Shizuko; Makita, Koshi; Setoguchi, Yasuhiro; Nakajima, Toshihiro

    2015-01-01

    The deletion mutation of exon 4 in surfactant protein C (SP-C), a lung surfactant protein, has been identified in parent-child cases of familial interstitial pneumonia. It has been shown that this mutation induces endoplasmic reticulum (ER) stress. Synoviolin is an E3 ubiquitin ligase that is localized to the ER and is an important factor in the degradation of ER-related proteins. It has been demonstrated that synoviolin is involved in liver fibrosis. In the present study, we investigated the involvement of synoviolin in the pathogenesis of interstitial pneumonia caused by the exon 4 deletion in the SP-C gene. We transfected wild-type and exon 4-deleted SP-C genes into A549 human lung adenocarcinoma cells and measured the secretion of collagen, which is a representative extracellular matrix protein involved in fibrosis. Secreted collagen levels were increased in the culture medium in SP-C mutants compared to the wild-type cells. Furthermore, the transcription of mRNAs coding for factors associated with fibrosis was increased. Subsequently, to assess the involvement of synoviolin, we constructed plasmids with a luciferase gene under the control of the synoviolin promoter. The A549 cells were transfected with the construct along with the exon 4-deleted SP-C plasmid for use in the luciferase assay. We found a 1.6-fold increase in luciferase activity in the cells carrying exon 4 deleted SP-C, as well as an increase in intrinsic synoviolin expression at the mRNA and protein levels. Collagen secretion was decreased by the addition of LS-102, a synoviolin inhibitor, to the A549 culture medium following transfection with wild-type and exon 4-deleted SP-C. These results demonstrate that synoviolin is involved in the onset of interstitial pneumonia induced by exon 4-deleted SP-C, which suggests that synoviolin inhibitors may be used in the treatment of the disease.

  17. Human Cytomegalovirus US28 Is Important for Latent Infection of Hematopoietic Progenitor Cells

    PubMed Central

    Humby, Monica S.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) resides latently in hematopoietic progenitor cells (HPCs). During latency, only a subset of HCMV genes is transcribed, including one of the four virus-encoded G protein-coupled receptors (GPCRs), US28. Although US28 is a multifunctional lytic protein, its function during latency has remained undefined. We generated a panel of US28 recombinant viruses in the bacterial artificial chromosome (BAC)-derived clinical HCMV strain TB40/E-mCherry. We deleted the entire US28 open reading frame (ORF), deleted all four of the viral GPCR ORFs, or deleted three of the HCMV GPCRs but not the US28 wild-type protein. Using these recombinant viruses, we assessed the requirement for US28 during latency in the Kasumi-3 in vitro latency model system and in primary ex vivo-cultured CD34+ HPCs. Our data suggest that US28 is required for latency as infection with viruses lacking the US28 ORF alone or in combination with the remaining HCMV-encoded GPCR results in transcription from the major immediate early promoter, the production of extracellular virions, and the production of infectious virus capable of infecting naive fibroblasts. The other HCMV GPCRs are not required for this phenotype as a virus expressing only US28 but not the remaining virus-encoded GPCRs is phenotypically similar to that of wild-type latent infection. Finally, we found that US28 copurifies with mature virions and is expressed in HPCs upon virus entry although its expression at the time of infection does not complement the US28 deletion latency phenotype. This work suggests that US28 protein functions to promote a latent state within hematopoietic progenitor cells. IMPORTANCE Human cytomegalovirus (HCMV) is a widespread pathogen that, once acquired, remains with its host for life. HCMV remains latent, or quiescent, in cells of the hematopoietic compartment and upon immune challenge can reactivate to cause disease. HCMV-encoded US28 is one of several genes expressed during

  18. Improved detection of mutated human cytomegalovirus UL97 by pyrosequencing.

    PubMed

    Schindele, Birgit; Apelt, Luise; Hofmann, Jörg; Nitsche, Andreas; Michel, Detlef; Voigt, Sebastian; Mertens, Thomas; Ehlers, Bernhard

    2010-12-01

    Ganciclovir (GCV) resistance frequently occurs upon prolonged treatment of ongoing active human cytomegalovirus (HCMV) infection in individuals with immature or compromised immune functions (e.g., recipients of solid-organ and hematopoietic stem cell transplants). Using pyrosequencing (PSQ), we established fast and sensitive detection of GCV resistance-associated mutations occurring in the HCMV open reading frame UL97. These mutations have been repeatedly associated with clinical treatment failure. We designed four PSQ assays and evaluated them by analyzing mixtures of plasmids or bacterial artificial chromosome-derived viruses containing UL97 wild-type and mutant sequences. A minimum level of 6% mutant sequence variants could be detected in these mixtures. In order to further evaluate the novel PSQ assays, we tested clinical specimens from patients with active HCMV infections. The results were compared with those obtained by conventional dideoxy chain terminator sequencing. As the PSQ method was more sensitive in detecting minor HCMV mutant fractions in a wild-type population, it is suggested that pyrosequencing is a useful tool for the early detection of emerging GCV-resistant HCMV in GCV-treated patients.

  19. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  20. A Method for Quantifying Mechanical Properties of Tissue following Viral Infection

    PubMed Central

    Lam, Vy; Bigley, Tarin; Terhune, Scott S.; Wakatsuki, Tetsuro

    2012-01-01

    Viral infection and replication involves the reorganization of the actin network within the host cell. Actin plays a central role in the mechanical properties of cells. We have demonstrated a method to quantify changes in mechanical properties of fabricated model three-dimensional (3D) connective tissue following viral infection. Using this method, we have characterized the impact of infection by the human herpesvirus, cytomegalovirus (HCMV). HCMV is a member of the herpesvirus family and infects a variety of cell types including fibroblasts. In the body, fibroblasts are necessary for maintaining connective tissue and function by creating mechanical force. Using this 3D connective tissue model, we observed that infection disrupted the cell’s ability to generate force and reduced the cumulative contractile force of the tissue. The addition of HCMV viral particles in the absence of both viral gene expression and DNA replication was sufficient to disrupt tissue function. We observed that alterations of the mechanical properties are, in part, due to a disruption of the underlying complex actin microfilament network established by the embedded fibroblasts. Finally, we were able to prevent HCMV-mediated disruption of tissue function by the addition of human immune globulin against HCMV. This study demonstrates a method to quantify the impact of viral infection on mechanical properties which are not evident using conventional cell culture systems. PMID:22870300

  1. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.

    PubMed

    Wu, Shu-En; Miller, William E

    2015-09-01

    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage. PMID:25965798

  2. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.

    PubMed

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  3. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  4. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  5. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-12-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  6. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  7. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  8. A permanently growing human endothelial cell line supports productive infection with human cytomegalovirus under conditional cell growth arrest.

    PubMed

    Lieber, Diana; Hochdorfer, Daniel; Stoehr, Dagmar; Schubert, Axel; Lotfi, Ramin; May, Tobias; Wirth, Dagmar; Sinzger, Christian

    2015-09-01

    Infection of vascular endothelial cells (ECs) is assumed to contribute to dissemination of human cytomegalovirus (HCMV). Investigation of virus-host interactions in ECs such as human umbilical vein endothelial cells (HUVECs) is limited due to the low maximal passage numbers of these primary cells. We tested a conditionally immortalized EC line (HEC-LTT) and a permanent cell line (EA.hy926) for their susceptibility to HCMV infection. Both cell lines resembled HUVECs in that they allowed for entry and immediate early protein expression of highly endotheliotropic HCMV strains but not of poorly endotheliotropic strains, rendering them suitable for analysis of the viral entry mechanism in ECs. The late phase of viral replication and release, however, was supported by growth-controlled HEC-LTT cells but not by EA.hy926 cells. HEC-LTT cells support both the early and late phase of viral replication and release infectious progeny virus at titers comparable to primary HUVECs; thus, the HEC-LTT cell line is a cell culture model representing the full viral replicative cycle of HCMV in ECs. The implementation of permanent HEC-LTT and EA.hy926 cell lines in HCMV research will facilitate long-term approaches that are not feasible in primary HUVECs.

  9. Human cytomegalovirus induces a distinct innate immune response in the maternal-fetal interface.

    PubMed

    Weisblum, Yiska; Panet, Amos; Zakay-Rones, Zichria; Vitenshtein, Alon; Haimov-Kochman, Ronit; Goldman-Wohl, Debra; Oiknine-Djian, Esther; Yamin, Rachel; Meir, Karen; Amsalem, Hagai; Imbar, Tal; Mandelboim, Ofer; Yagel, Simcha; Wolf, Dana G

    2015-11-01

    The initial interplay between human cytomegalovirus (HCMV) and innate tissue response in the human maternal-fetal interface, though crucial for determining the outcome of congenital HCMV infection, has remained unknown. We studied the innate response to HCMV within the milieu of the human decidua, the maternal aspect of the maternal-fetal interface, maintained ex vivo as an integral tissue. HCMV infection triggered a rapid and robust decidual-tissue innate immune response predominated by interferon (IFN)γ and IP-10 induction, dysregulating the decidual cytokine/chemokine environment in a distinctive fashion. The decidual-tissue response was already elicited during viral-tissue contact, and was not affected by neutralizing HCMV antibodies. Of note, IFNγ induction, reflecting immune-cell activation, was distinctive to the maternal decidua, and was not observed in concomitantly-infected placental (fetal) villi. Our studies in a clinically-relevant surrogate human model, provide a novel insight into the first-line decidual tissue response which could affect the outcome of congenital infection.

  10. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.

    PubMed

    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E

    1993-07-01

    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  11. In vitro selection of novel RNA ligands that bind human cytomegalovirus and block viral infection.

    PubMed Central

    Wang, J; Jiang, H; Liu, F

    2000-01-01

    Ribonuclease-resistant RNA molecules that bind to infectious human cytomegalovirus (HCMV) were isolated in vitro from a pool of randomized sequences after 16 cycles of selection and amplification. The two ligands (L13 and L19) characterized exhibited high HCMV-binding affinity in vitro and effectively inhibited viral infection in tissue culture. Their antiviral activity was also specific as they only reacted with two different strains of HCMV but not with the related herpes simplex virus 1 and human cells. These two ligands appeared to function as antivirals by blocking viral entry. Ultraviolet (UV) crosslinking studies suggested that L13 and L19 bind to HCMV essential glycoproteins B and H, respectively. Thus, RNA ligands that bind to different surface antigens of HCMV can be simultaneously isolated by the selection procedure. Our study demonstrates the feasibility of using these RNA ligands as a research tool to identify viral proteins required for infectivity and as an antiviral agent to block viral infection. PMID:10786848

  12. Identification of the major capsid protein gene of human cytomegalovirus.

    PubMed Central

    Chee, M; Rudolph, S A; Plachter, B; Barrell, B; Jahn, G

    1989-01-01

    The coding region for the major capsid protein (MCP) of human cytomegalovirus (HCMV) was identified by comparing the protein sequence with the respective sequences of herpes simplex virus (HSV), Epstein-Barr virus, and varicella-zoster virus. The predicted length of the HCMV MCP was 1,370 amino acids. Comparison of the MCP sequences of the different human herpesviruses showed a homology of 25% to the MCP of HSV type 1, a homology of 29% to the MCP of Epstein-Barr virus, and a homology of 23% to the MCP of varicella-zoster virus. A subfragment of the HSV type 1 KpnI i fragment encoding the MCP VP5 cross-hybridized with the HCMV HindIII U fragment containing part of the MCP gene. Northern (RNA) blot analyses with subclones out of the coding region for the HCMV MCP detected one large transcript of about 8 kilobases. A portion of the open reading frame was expressed in Escherichia coli plasmid pBD2 IC2OH as a beta-galactosidase fusion protein and was used to generate polyclonal antibodies in New Zealand White rabbits. The obtained antisera reacted in Western immunoblots with the MCP of purified HCMV virions. A monoclonal antibody against the human MCP and a monospecific rabbit antiserum against strain Colburn of simian cytomegalovirus detected the fusion protein as well as the MCP of purified virions in immunoblots. Images PMID:2536837

  13. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.

    PubMed

    Wu, Shu-En; Miller, William E

    2015-09-01

    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage.

  14. Thrombin stimulates IL-6 and IL-8 expression in cytomegalovirus-infected human retinal pigment epithelial cells.

    PubMed

    Scholz, Martin; Vogel, Jens-Uwe; Höver, Gerold; Kotchetkov, Ruslan; Cinatl, Jaroslav; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2004-02-01

    Recently, we reported that thrombin specifically stimulates protease-activated receptor-1 (PAR-1) signaling in RPE entailing inhibition of Sp1 dependent HCMV replication. We now studied whether thrombin modulates the expression of the proinflammatory cytokine/chemokines IL-6 and IL-8 in mock- and cytomegalovirus-infected human retinal pigment epithelial cells (RPE). Our data show that thrombin/PAR-1 stimulates IL-6 and IL-8 gene transcription and protein secretion in both mock- and HCMV-infected RPE. Thrombin/PAR-1-mediated signaling stimulated PKC and NF-kappaB-dependent IL-6 and IL-8 gene expression via phosphoinositide 3-kinase and further downstream via p42/44 and p38 MAPKs. Thus, thrombin/PAR-1-mediated IL-6/IL-8 gene expression is uncoupled from Sp1 inhibition and may support proinflammatory pathomechanisms probably involved in hemorrhage/HCMV retinitis progression.

  15. Use of diploid human fibroblasts as a model system to culture, grow, and study human cytomegalovirus infection.

    PubMed

    Fortunato, Elizabeth A

    2014-01-01

    Primary human diploid fibroblasts are used routinely to study host/pathogen interactions of human cytomegalovirus (HCMV). Fibroblasts' ease of culture and tremendous permissiveness for infection allow the study of all facets of infection, an abbreviated list of which includes ligand/receptor interactions, activation of cell signaling responses, and dysregulation of the cell cycle and DNA repair processes. Another advantage to fibroblasts' permissiveness for HCMV is the capability to grow high titer stocks of virus in them. This chapter will discuss the production of viral stocks of HCMV in primary human fibroblasts, commencing with culturing and infection of cells and continuing through harvest, titration (determining the infectious capacity of a particular virus preparation), and storage of viral stocks for use in downstream experiments.

  16. Human cytomegalovirus: bacterial artificial chromosome (BAC) cloning and genetic manipulation.

    PubMed

    Paredes, Anne M; Yu, Dong

    2012-02-01

    The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  17. The tiers and dimensions of evasion of the type I interferon response by human cytomegalovirus.

    PubMed

    Amsler, Lisi; Verweij, Marieke C; DeFilippis, Victor R

    2013-12-13

    Human cytomegalovirus (HCMV) is a member of the β-herpesvirus family that invariably occupies hosts for life despite a consistent multi-pronged antiviral immune response that targets the infection. This persistence is enabled by the large viral genome that encodes factors conferring a wide assortment of sophisticated, often redundant phenotypes that disable or otherwise manipulate impactful immune effector processes. The type I interferon system represents a first line of host defense against infecting viruses. The physiological reactions induced by secreted interferon act to effectively block replication of a broad spectrum of virus types, including HCMV. As such, the virus must exhibit counteractive mechanisms to these responses that involve their inhibition, tolerance, or re-purposing. The goal of this review is to describe the impact of the type I interferon system on HCMV replication and to showcase the number and diversity of strategies employed by the virus that allow infection of hosts in the presence of interferon-dependent activity.

  18. Detection of human cytomegalovirus by slot-blot hybridization assay employing oligo-primed /sup 32/P-labelled probe

    SciTech Connect

    Agha, S.A.; Coleman, J.C.; Selwyn, S.; Mahmound, L.A.; Abd-Elaal, A.M.; Archard, L.C.

    1988-12-01

    A /sup 32/P-labelled Hind III-0 DNA fragment (nine Kilobases; Kb) from human cytomegalovirus AD-169 (HCMV) was used in slot-blot hybridization assay for the detection of HCMV in clinical samples. The results obtained with DNA hybridization assay (DNA HA) were compared with virus isolation using conventional tube cell culture (CTC) and centrifugation vial culture (CVC), immunofluorescence (IF), and complement fixation test (CFT). Of 15 CTC-positive samples, 13 were positive with DNA HA (sensitivity 86.7%). Also, 14 additional samples were DNA HA-positive but CTC-negative. CVC and/or IF confirmed the diagnosis in nine of 14; the remaining five samples were from three patients who showed fourfold rising antibody titre by CFT. Although DNA HA using /sup 32/P-labelled probes is relatively cumbersome and expensive, it is a valuable test for quantitation of viral shedding in patients with HCMV infections who may benefit from antiviral therapy.

  19. Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

    PubMed Central

    Paredes, Anne M.; Yu, Dong

    2011-01-01

    Our understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. PMID:22307551

  20. Sensitive non-isotopic DNA hybridisation assay or immediate-early antigen detection for rapid identification of human cytomegalovirus in urine.

    PubMed

    Kimpton, C P; Morris, D J; Corbitt, G

    1991-04-01

    A sensitive non-radioactive DNA hybridisation assay employing digoxigenin-labelled probes was compared with immediate-early antigen detection and conventional virus isolation for the identification of human cytomegalovirus (HCMV) in 249 urine samples. Of 44 specimens yielding HCMV by virus isolation, more were positive by DNA hybridisation (32; 73%) than by immediate-early antigen detection (25; 52%) (P = 0.05). The specificity of the hybridisation assay in 45 apparently falsely positive specimens was supported by detection of HCMV DNA in 40 of these specimens using the polymerase chain reaction. Many urine specimens may thus contain large amounts of non-viable virus or free viral DNA. Evaluation of various protocols for the extraction and denaturation of virus DNA prior to hybridisation showed that proteinase K digestion with phenol/chloroform extraction was the most sensitive and reliable procedure. We conclude that the non-radioactive DNA hybridisation assay described is a potentially valuable routine diagnostic test.

  1. In vitro antiviral efficacy of the ganciclovir complexed with beta-cyclodextrin on human cytomegalovirus clinical strains.

    PubMed

    Nicolazzi, Céline; Venard, Véronique; Le Faou, Alain; Finance, Chantal

    2002-05-01

    The toxicity of the compounds currently used in the treatment of human cytomegalovirus (HCMV) infections in immunocompromised hosts may force the treatment to be discontinued. The aim of this study was to improve the antiviral activity of ganciclovir (GCV), one the most widely used drug, by complexing it with beta-cyclodextrin. Cyclodextrins (cds) have the property to form inclusion complexes with a great number of molecules and to enhance bioavailability and biological properties of these molecules. In this study, we investigated the in vitro antiviral activity of complexed GCV against several strains of HCMV: AD169, a reference strain, RCL-1, a laboratory mutant resistant to GCV, and four clinical isolates. The complexed GCV was more effective than free GCV against all HCMV strains tested. Cds as carriers for antiviral drugs would represent a useful adjunct to classical treatment procedures. They may make it possible to administer lower doses, thus reducing the toxic side effects of the drugs. PMID:12062397

  2. PTBP1 and PTBP2 impaired autoregulation of SRSF3 in cancer cells.

    PubMed

    Guo, Jihua; Jia, Jun; Jia, Rong

    2015-01-01

    Splicing factors are key players in the regulation of alternative splicing of pre-mRNAs. Overexpression of splicing factors, including SRSF3, has been strongly linked with oncogenesis. However, the mechanisms behind their overexpression remain largely unclear. Autoregulation is a common mechanism to maintain relative stable expression levels of splicing factors in cells. SRSF3 regulates its own expression by enhancing the inclusion of an alternative exon 4 with an in-frame stop codon. We found that the inclusion of SRSF3 exon 4 is impaired in oral squamous cell carcinoma (OSCC) cells. PTBP1 and PTBP2 bind to an exonic splicing suppressor in exon 4 and inhibit its inclusion, which results in overexpression of full length functional SRSF3. Overexpression of SRSF3, in turn, promotes PTBP2 expression. Our results suggest a novel mechanism for the overexpression of oncogenic splicing factor via impairing autoregulation in cancer cells. PMID:26416554

  3. Detection of human cytomegalovirus and Epstein-Barr Virus in symptomatic and asymptomatic apical periodontitis lesions by real-time PCR

    PubMed Central

    Ozbek, Selcuk M.; Yavuz, Muhammed S.

    2013-01-01

    Objectives: Recent studies have investigated the occurrence of human cytomegalovirus and Epstein-Barr Virus in samples from apical periodontitis lesions and a role in the pathogenesis of this disease has been suggested. Because genotype distribution and seroprevalence of EBV and HCMV differ among populations, it is important to determine the presence of these viruses in endodontic periapical lesions of different populations. The aims of this study were to determine the presence of HCMV and EBV DNAs in samples from Turkish patients with symptomatic and asymptomatic apical periodontitis lesions using real-time polymerase chain reaction method and to evaluate their presence in both symptomatic and asymptomatic apical periodontitis lesions. Study Design: Periapical samples were collected from 12 asymptomatic and 16 symptomatic periapical lesions in conjunction with apicectomy. HCMV and EBV DNAs were identified in the samples by real-time PCR. The chi-squared test with Yates’s correction or the Fisher’s exact test was used to analyse the significance of differences. Results: HCMV DNA was detected in 10 of the 16 (62.5%) symptomatic and in five of the 12 (41.7 %) asymptomatic periapical study lesions. The EBV DNA was identified in seven of the 16 (43.7 %) symptomatic and three of the 12 (25 %) asymptomatic periapical lesions. The difference in occurrence of HCMV and EBV DNA between symptomatic and asymptomatic periapical lesions was not statistically significant. (All comparisons have p > 0.05). Conclusions: Our findings suggest that HCMV and EBV is a frequent inhabitant of both symptomatic and asymptomatic apical periodontitis lesions of endodontic origin in Turkish population. Key words:Human cytomegalovirus, Epstein-Barr Virus, apical periodontitis, Polymerase chain reaction method. PMID:23722135

  4. Quantitative analysis of human herpesvirus-6 and human cytomegalovirus in blood and saliva from patients with acute leukemia.

    PubMed

    Nefzi, Faten; Ben Salem, Nabil Abid; Khelif, Abderrahim; Feki, Salma; Aouni, Mahjoub; Gautheret-Dejean, Agnès

    2015-03-01

    Human herpesvirus-6 (HHV-6) and human cytomegalovirus (HCMV) DNAs were quantified by real-time PCR assays in blood and saliva obtained from 50 patients with acute leukemia at the time of diagnosis (50 of each matrix), aplasia (65 of each matrix), remission (55 of each matrix), and relapse (20 of each matrix) to evaluate which biological matrix was more suitable to identify a viral reactivation, search for a possible link between HHV-6 and HCMV reactivations, and evaluate the relations between viral loads and count of different leukocyte types in blood. The median HHV-6 loads were 136; 219; 226, and 75 copies/million cells in blood at diagnosis, aplasia, remission and relapse, respectively. The HCMV loads were 193 and 317 copies/million cells in blood at diagnosis and remission. In the saliva samples, the HHV-6 loads were 22,165; 15,238; 30,214, and 17,454 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HCMV loads were 8,991; 1,461; 2,980, and 4,283 copies/million cells at diagnosis, aplasia, remission, and relapse, respectively. The HHV-6 load in the blood was correlated to the counts of polymorphonuclear leukocytes (R(2)  = 0.5; P < 0.0001) and lymphocytes (R(2)  = 0.4; P = 0.001) and was not correlated to the monocyte counts (R(2)  = 0.07; P = 0.7). Saliva appears to be a more sensitive biological matrix than whole blood in the detection of HHV-6 or HCMV reactivations. The HHV-6 and HCMV reactivations were linked only in saliva.

  5. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron

    2016-01-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  6. Dendritic cells in cytomegalovirus infection: viral evasion and host countermeasures.

    PubMed

    Rölle, Alexander; Olweus, Johanna

    2009-05-01

    Human cytomegalovirus (HCMV) is a beta-herpesvirus that infects the majority of the population during early childhood and thereafter establishes life-long latency. Primary infection as well as spontaneous reactivation usually remains asymptomatic in healthy hosts but can, in the context of systemic immunosuppression, result in substantial morbidity and mortality. HCMV counteracts the host immune response by interfering with the recognition of infected cells. A growing body of literature has also suggested that the virus evades the immune system by paralyzing the initiators of antiviral immune responses--the dendritic cells (DCs). In the current review, we discuss the effects of CMV (HCMV and murine CMV) on various DC subsets and the ensuing innate and adaptive immune responses. The impact of HCMV on DCs has mainly been investigated using monocyte-derived DCs, which are rendered functionally impaired by infection. In mouse models, DCs are targets of viral evasion as well, but the complex cross-talk between DCs and natural killer cells has, however, demonstrated an instrumental role for DCs in the control and clearance of viral infection. Fewer studies address the role of peripheral blood DC subsets, plasmacytoid DCs and CD11c+ myeloid DCs in the response against HCMV. These DCs, rather than being paralyzed by HCMV, are largely resistant to infection, mount a vigorous first-line defense and induce T-cell responses to the virus. This possibly provides a partial explanation for an intriguing conundrum: the highly efficient control of viral infection and reactivation in immunocompetent hosts in spite of multi-layered viral evasion mechanisms.

  7. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane

    2016-01-01

    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  8. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  9. Detection of Human Cytomegalovirus and Epstein-Barr Virus in Coronary Atherosclerotic Tissue

    PubMed Central

    Imbronito, Ana Vitória; Marcelino, Silvia Linardi; Grande, Sabrina Rosa; Nunes, Fabio Daumas; Romito, Giuseppe Alexandre

    2010-01-01

    Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples. PMID:24031529

  10. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.

    2016-01-01

    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  11. Human cytomegalovirus maturational proteinase: expression in Escherichia coli, purification, and enzymatic characterization by using peptide substrate mimics of natural cleavage sites.

    PubMed Central

    Burck, P J; Berg, D H; Luk, T P; Sassmannshausen, L M; Wakulchik, M; Smith, D P; Hsiung, H M; Becker, G W; Gibson, W; Villarreal, E C

    1994-01-01

    The proteolytic processing of the human cytomegalovirus (HCMV) assembly protein, resulting in truncation of its C terminus, is an essential step in virion maturation. The proteinase responsible for this cleavage is the amino-terminal half of the protein encoded by the UL80a open reading fame. We have obtained high expression levels of this 256-amino-acid HCMV proteinase, assemblin, in Escherichia coli. In addition to the 28-kDa proteinase, a 15-kDa protein comprising the first 143 amino acids and a 13-kDa protein comprising the last 113 amino acids of the 28-kDa HCMV proteinase were present. Both the 28-kDa proteinase and the 15-kDa protein were purified by a two-step chromatographic procedure utilizing anion exchange in urea and dithiothreitol and size exclusion in NaSCN and dithiothreitol. Activation of the purified 28-kDa proteinase required denaturation in urea as well as complete reduction of all five cysteine residues in the molecule. Removal of the urea by dialysis with retention of the reducing agent yielded an active proteinase. Addition of glycerol to 50% enhanced the activity. The HCMV proteinase cleaved the peptides RGVVNASSRLAK and SYVKASVSPE, which are mimics of the maturational (M)- and release (R)-site sequences, respectively, in the UL80a-encoded protein. The cleavage site in the peptides was at the same Ala-Ser scissile bond as observed in the UL80a protein. The Km value for the cleavage of RGVVNASSRLAK (M-site mimic) by the proteinase was similar to that for SYVKASVSPE (R-site mimic), but the turnover (kcat) of the M-site peptide mimic substrate by the proteinase was six to eight times faster. The peptide homologs of the herpes simplex virus type 1 M- and R-site sequences in the UL26-encoded protein were also cleaved by the HCMV proteinase, although at rates slower than those for the HCMV substrates. The HCMV proteinase was inhibited by Zn2+ and by alkylating agents, but only at very high inhibitor concentrations. The purified 15-kDa protein

  12. Mutation of glutamine to arginine at position 548 of IE2 86 in human cytomegalovirus leads to decreased expression of IE2 40, IE2 60, UL83, and UL84 and increased transcription of US8-9 and US29-32.

    PubMed

    Burgdorf, Sarah W; Clark, Charles L; Burgdorf, James R; Spector, Deborah H

    2011-11-01

    The IE2 86 protein of human cytomegalovirus (HCMV) is essential for productive infection. The mutation of glutamine to arginine at position 548 of IE2 86 causes the virus to grow both slowly and to very low titers, making it difficult to study this mutant via infection. In this study, Q548R IE2 86 HCMV was produced on the complementing cell line 86F/40HA, which allowed faster and higher-titer production of mutant virus. The main defects observed in this mutant were greatly decreased expression of IE2 40, IE2 60, UL83, and UL84. Genome replication and the induction of cell cycle arrest were found to proceed at or near wild-type levels, and there was no defect in transitioning to early or late protein expression. Q548R IE2 86 was still able to interact with UL84. Furthermore, Q548R IE2 40 maintained the ability to enhance UL84 expression in a cotransfection assay. Microarray analysis of Q548R IE2 HCMV revealed that the US8, US9, and US29-32 transcripts were all significantly upregulated. These results further confirm the importance of IE2 in UL83 and UL84 expression as well as pointing to several previously unknown regions of the HCMV genome that may be regulated by IE2.

  13. Herpesviruses in Abscesses and Cellulitis of Endodontic Origin

    PubMed Central

    Chen, Vicky; Chen, Yanwen; Li, Hong; Kent, Karla; Baumgartner, J. Craig; Machida, Curtis A.

    2009-01-01

    Acute apical abscesses and cellulitis are severe endodontic diseases caused by opportunistic bacteria with possible co-infection with latent herpesviruses. The objectives of this study are to identify herpesviruses, including human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), herpes simplex virus-1 (HSV-1) and Varicella zoster virus (VZV), in patients (n=31) presenting with acute apical abscesses and cellulitis of endodontic origin. Primary and nested polymerase chain reaction (PCR) was conducted using virus-specific primers and DNA isolated from cell-free abscess fluid. From patients exhibiting concurrent spontaneous pain (n=28), nine abscesses contained HCMV, two abscesses contained EBV, one abscess contained HSV-1, and no abscesses contained VZV. Control PCR using genomic or recombinant templates demonstrated detection limits to a single genomic copy of HCMV, 100 genomic copies for EBV, and 1-10 copies for HSV-1, with no cross-amplification between herpesviral DNA targets. Nested PCR was required for detection of herpesviral DNA in the abscess specimens, indicating that these viruses were present in low copy number. Filtration of abscess specimens and virus transfer experiments using human fibroblastic MRC-5 cells confirmed the presence of HCMV particles in several abscess specimens. We conclude that herpesviruses are present, but not required for development of acute apical abscesses and cellulitis of endodontic origin. PMID:19166769

  14. Design and synthesis of pyrrolidine-5,5'-trans-lactams (5-oxo-hexahydropyrrolo[3,2-b]pyrroles) as novel mechanism-based inhibitors of human cytomegalovirus protease. 4. Antiviral activity and plasma stability.

    PubMed

    Borthwick, Alan D; Davies, Dave E; Ertl, Peter F; Exall, Anne M; Haley, Terry M; Hart, Graham J; Jackson, Deborah L; Parry, Nigel R; Patikis, Angela; Trivedi, Naimisha; Weingarten, Gordon G; Woolven, James M

    2003-10-01

    A series of chiral, (S)-proline-alpha-methylpyrrolidine-5,5-trans-lactam serine protease inhibitors has been developed as antivirals of human cytomegalovirus (HCMV). The SAR of the functionality on the proline nitrogen has shown that derivatives of para-substituted phenyl ureas > para-substituted phenyl sulfonamides > para-substituted phenyl carboxamide for activity against HCMV deltaAla protease, producing para-substituted phenyl ureas with single figure nM potency (K(i)) against the viral enzyme. The SAR of the functionality on the lactam nitrogen has defined the steric and electronic requirements for high human plasma stability while retaining good activity against HCMV protease. The combination of high potency against HCMV deltaAla protease and high human plasma stability has produced compounds with significant in vitro antiviral activity against human cytomegalovirus with the 6-hydroxymethyl benzothiazole derivative 72 being equivalent in potency to ganciclovir. The parent benzothiazole 56 had good pharmacokinetics in dogs with 29% bioavailability and good brain and ocular penetration in guinea pigs.

  15. Design and synthesis of pyrrolidine-5,5-trans-lactams (5-oxohexahydropyrrolo[3,2-b]pyrroles) as novel mechanism-based inhibitors of human cytomegalovirus protease. 2. Potency and chirality.

    PubMed

    Borthwick, Alan D; Crame, Andrew J; Ertl, Peter F; Exall, Anne M; Haley, Terry M; Hart, Graham J; Mason, Andrew M; Pennell, Andrew M K; Singh, Onkar M P; Weingarten, Gordon G; Woolven, James M

    2002-01-01

    The stereospecific synthesis of a series of alpha-methylpyrrolidine-5,5-trans-lactam inhibitors of human cytomegalovirus (HCMV) protease is described. Examination of the SAR in this series has defined the size and chirality of the alpha-substituent, optimized the acyl substituent on the lactam nitrogen, and defined the steric constraint of this functionality. The SAR of the functionality on the pyrrolidine nitrogen of the trans-lactam has been investigated, and this has led to the discovery of potent serine protease inhibitors that are highly selective for the viral enzyme over the mammalian enzymes elastase, thrombin, and acetylcholine esterase. The mechanism of action of our lead compounds has been established by mass spectrometry, and enzymatic degradation of HCMV deltaAla protease acylated with these inhibitors showed that Ser 132 is the active site nucleophile. The crystal structure of HCMV protease was obtained and used to model the conformationally restricted, chiral (S)-proline-alpha-methyl-5,5-trans-lactams into the active site groove of the enzyme, enabling us to direct and rationalize the SAR in this series. The activity against HCMV deltaAla protease is the greatest with inhibitors based on the dansyl-(S)-proline alpha-methyl-5,5-trans-lactam template, which have low nanomolar activity against the viral enzyme.

  16. Quantitative Temporal Viromics: An Approach to Investigate Host-Pathogen Interaction

    PubMed Central

    Weekes, Michael P.; Tomasec, Peter; Huttlin, Edward L.; Fielding, Ceri A.; Nusinow, David; Stanton, Richard J.; Wang, Eddie C.Y.; Aicheler, Rebecca; Murrell, Isa; Wilkinson, Gavin W.G.; Lehner, Paul J.; Gygi, Steven P.

    2014-01-01

    Summary A systematic quantitative analysis of temporal changes in host and viral proteins throughout the course of a productive infection could provide dynamic insights into virus-host interaction. We developed a proteomic technique called “quantitative temporal viromics” (QTV), which employs multiplexed tandem-mass-tag-based mass spectrometry. Human cytomegalovirus (HCMV) is not only an important pathogen but a paradigm of viral immune evasion. QTV detailed how HCMV orchestrates the expression of >8,000 cellular proteins, including 1,200 cell-surface proteins to manipulate signaling pathways and counterintrinsic, innate, and adaptive immune defenses. QTV predicted natural killer and T cell ligands, as well as 29 viral proteins present at the cell surface, potential therapeutic targets. Temporal profiles of >80% of HCMV canonical genes and 14 noncanonical HCMV open reading frames were defined. QTV is a powerful method that can yield important insights into viral infection and is applicable to any virus with a robust in vitro model. PaperClip PMID:24906157

  17. Human cytomegalovirus and Epstein–Barr virus inhibit oral bacteria-induced macrophage activation and phagocytosis

    PubMed Central

    Lin, Y.-L.; Li, M.

    2016-01-01

    Introduction Periodontal disease is an inflammatory condition caused by periodontal microorganisms. Viruses such as human cytomegalovirus (HCMV) and Epstein–Barr virus (EBV) are associated with certain types of periodontal disease, but their roles in promoting the disease are unclear. Because both viruses infect human macrophages, cells which play key roles in the clearance of pathogenic bacteria, it is likely that the viruses alter the functional capacity of macrophages by inhibiting their defense mechanisms against invading pathogens. Methods Macrophages preinfected with HCMV or EBV were evaluated following stimulation by selected oral bacteria. Bacteria-induced macrophage activation was assayed by measuring the levels of tumor necrosis factor-α (TNF-α) produced in the media, and phagocytic activity was analysed by a phagocytosis assay with fluorescein isothiocyanate-labeled bacteria. The virus-infected macrophages were also subjected to semi-quantitative polymerase chain reaction to measure the expression of toll-like receptor 9, which is involved in the activation of phagocytosis-related pathways. Results Both HCMV and EBV significantly diminished the TNF-α production typically induced by oral bacteria, inhibited the phagocytic activity of macrophages, and downregulated the expression of toll-like receptor 9. Conclusion Infection by HCMV or EBV inhibits the functional ability of macrophages to respond to bacterial challenge, thereby suggesting their pathogenic role in the development of periodontal disease. PMID:19416455

  18. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades

    PubMed Central

    Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; dos Santos, Claudia Januário; Carlan Silva, Maria Cristina

    2016-01-01

    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties. PMID:27458810

  19. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins

    PubMed Central

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-01-01

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%–99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy. PMID:26114473

  20. Human cytomegalovirus tegument protein pUL83 inhibits IFI16-mediated DNA sensing for immune evasion.

    PubMed

    Li, Tuo; Chen, Jin; Cristea, Ileana M

    2013-11-13

    Nuclear sensing of viral DNA has emerged as an essential step in innate immune responses against herpesviruses. Here, we provide mechanistic insight into host recognition of human cytomegalovirus (HCMV) and subsequent immune evasion by this prominent DNA virus. We establish that the interferon-inducible protein IFI16 acts as a nuclear DNA sensor following HCMV infection, binding viral DNA and triggering expression of antiviral cytokines via the STING-TBK1-IRF3 signaling pathway. The HCMV tegument protein pUL83 inhibits this response by interacting with the IFI16 pyrin domain, blocking its oligomerization upon DNA sensing and subsequent immune signals. pUL83 disrupts IFI16 by concerted action of its N- and C-terminal domains, in which an evolutionarily conserved N-terminal pyrin association domain (PAD) binds IFI16. Additionally, phosphorylation of the N-terminal domain modulates pUL83-mediated inhibition of pyrin aggregation. Collectively, our data elucidate the interplay between host DNA sensing and HCMV immune evasion, providing targets for restoring antiviral immunity.

  1. Expression of the Human Cytomegalovirus UL97 Gene in a Chimeric Guinea Pig Cytomegalovirus (GPCMV) Results in Viable Virus with Increased Susceptibility to Ganciclovir and Maribavir

    PubMed Central

    McGregor, Alistair; Choi, K. Yeon; Cui, Xiaohong; McVoy, Michael A.; Schleiss, Mark R.

    2009-01-01

    In lieu of a licensed vaccine, antivirals are being considered as an intervention to prevent congenital human cytomegalovirus (HCMV) infection. Ideally, antiviral therapies should undergo pre-clinical evaluation in an animal model prior to human use. Guinea pig cytomegalovirus (GPCMV) is the only small animal model for congenital CMV. However, GPCMV is not susceptible to the most commonly used HCMV antiviral, ganciclovir (GCV), rendering in vivo study of this agent problematic in the guinea pig model. Human cytomegalovirus (HCMV) susceptibility to GCV is linked to the UL97 gene. We hypothesized that GPCMV susceptibility to GCV could be improved by inserting the HCMV (Towne) UL97 gene into the GPCMV genome in place of the homolog, GP97. A chimeric GPCMV (GPCMV::UL97) expressed UL97 protein, and replicated efficiently in cell culture, with kinetics similar to wild-type GPCMV. In contrast, deletion of GP97 resulted in a virus (GPCMVdGP97) that grew poorly in culture. GPCMV::UL97 had substantially improved susceptibility to the inhibitory effects of GCV in comparison to wild-type GPCMV. Additionally, GPCMV::UL97 exhibited improved susceptibility to another antiviral undergoing clinical trials, maribavir (MBV; benzimidazole riboside 1263W94), which also acts through UL97. PMID:18325607

  2. The UL97 protein kinase of human cytomegalovirus and homologues in other herpesviruses: impact on virus and host.

    PubMed

    Michel, Detlef; Mertens, Thomas

    2004-03-11

    The human herpesviruses, herpes simplex virus 1 (HSV-1), HSV-2, varicella zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpesvirus 6A (HHV-6A), HHV-6B, HHV-7 and HHV-8, establish persistent infections with possible recurrence during immunosuppression. HCMV replication is inhibited by the nucleoside analogue ganciclovir (GCV), the compound of choice for the treatment of HCMV diseases and preemptive treatment of infections. The viral UL97 protein (pUL97) which shares homologies with protein kinases and bacterial phosphotransferases is able to monophosphorylate GCV. Homologues of pUL97 are found in HSV (UL13), VZV (ORF47), EBV (BGLF4), HHV-6 (U69), HHV-8 (ORF36) as well as in murine CMV (M97) or rat CMV (R97). Several indolocarbazoles have been reported to be specific inhibitors of pUL97. The protein is important for efficient replication of the virus. Autophosphorylation of pUL97 was observed using different experimental systems. Most recently, it has been shown that pUL97 interacts with the DNA polymerase processivity factor pUL44. Indolocarbazole protein kinase inhibitors are promising lead compounds for the development of more specific inhibitors of HCMV. PMID:15023359

  3. Rapid Genetic Engineering of Human Cytomegalovirus by Using a Lambda Phage Linear Recombination System: Demonstration that pp28 (UL99) Is Essential for Production of Infectious Virus

    PubMed Central

    Britt, William J.; Jarvis, Michael; Seo, Jun-Young; Drummond, Derek; Nelson, Jay

    2004-01-01

    A highly efficient lambda phage recombination system previously utilized for studies of bacterial artificial chromosome (BAC)-maintained mouse chromosomal DNA was adapted for the study of the role of human cytomegalovirus (HCMV)-encoded pp28 (UL99) in virus replication. Incorporating a two-step mutagenesis strategy with blue/white selection in Escherichia coli containing a HCMV AD169 BAC, we have shown that we can rapidly introduce point mutations into the HCMV BAC using linear PCR fragments. All manipulations were carried out in bacteria, which greatly accelerated the introduction and analysis of mutations in the viral genome. Our results indicated that HCMV pp28 was essential for the production of infectious virus and that introduction of a single base change that resulted in loss of the myristylation site on pp28 was also associated with the lack of production of infectious virus. Although the block in the viral morphogenesis cannot be determined from these studies, the latter finding suggested that authentic intracellular localization of pp28, not only the expression of the protein, is required for virus assembly. PMID:14671136

  4. Analysis of human cytomegalovirus using the polymerase chain reaction.

    PubMed

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  5. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  6. The pathogenesis of human cytomegalovirus.

    PubMed

    Griffiths, Paul; Baraniak, Ilona; Reeves, Matt

    2015-01-01

    Human cytomegalovirus (HCMV) is a recognized cause of disease in the fetus, the allograft recipient and AIDS patients. More recently, it has been recognized as a pathogen for those admitted to intensive care units, for the elderly and for the general population. The epidemiology and molecular and cellular pathology of this virus are summarized to provide an overarching model of pathogenesis, able to account for these varying clinical presentations. In brief, HCMV has the potential to spread in the bloodstream to all organs, but only produces overt disease if the viral load increases to high levels. This is normally prevented by a robust immune response, so that the infected individual usually remains asymptomatic. However, this benefit comes at the cost of committing more and more immunological resources to controlling HCMV with time, so that the overall function of the immune system is impaired. Fortunately, recent progress in developing novel antiviral drugs and vaccines suggests the possibility that the diverse effects of HCMV may soon become controllable at the individual and population level, respectively.

  7. The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication.

    PubMed

    Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J

    2016-02-01

    Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics.

  8. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins.

    PubMed

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-06-24

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%-99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy.

  9. Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci

    SciTech Connect

    Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En

    2009-09-30

    The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.

  10. Human Cytomegalovirus Secretome Contains Factors That Induce Angiogenesis and Wound Healing

    SciTech Connect

    Dumortier, Jerome; Streblow, Daniel N.; Moses, Ashlee V.; Jacobs, Jon M.; Kreklywich, Craig N.; Camp, David G.; Smith, Richard D.; Orloff, Susan L.; Nelson, Jay

    2008-07-01

    Human cytomegalovirus (HCMV) is implicated in the acceleration of a number of vascular diseases including transplant vascular sclerosis (TVS), the lesion associated with chronic rejection (CR) of solid organ transplants. Although the virus persists in the allograft throughout the course of disease, few cells are directly infected by CMV. This observation is in contrast to the global effects that CMV has on the acceleration of TVS/CR, suggesting that CMV infection indirectly promotes the vascular disease process. Recent transcriptome analysis of CMV-infected heart allografts indicates that the virus induces cytokines and growth factors associated with angiogenesis (AG) and wound healing (WH), suggesting that CMV may accelerate TVS/CR through the induction and secretion of AG/WH factors from infected cells. We analyzed virus-free supernatants from HCMV-infected cells (HCMV secretomes) for growth factors, by mass spectrometry and immunoassays, and found that the HCMV secretome contains over 1,000 cellular proteins, many of which are involved in AG/WH. Importantly, functional assays demonstrated that CMV but not herpes simplex virus secretomes not only induce AG/WH but also promote neovessel stabilization and endothelial cell survival for 2 weeks. These findings suggest that CMV acceleration of TVS occurs through virus-induced growth factors and cytokines in the CMV secretome.

  11. Agouti sequence polymorphisms in coyotes, wolves and dogs suggest hybridization.

    PubMed

    Schmutz, Sheila M; Berryere, Thomas G; Barta, Jodi L; Reddick, Kimberley D; Schmutz, Josef K

    2007-01-01

    Domestic dogs have been shown to have multiple alleles of the Agouti Signal Peptide (ASIP) in exon 4 and we wished to determine the level of polymorphism in the common wild canids of Canada, wolves and coyotes, in comparison. All Canadian coyotes and most wolves have banded hairs. The ASIP coding sequence of the wolf did not vary from the domestic dog but one variant was detected in exon 4 of coyotes that did not alter the arginine at this position. Two other differences were found in the sequence flanking exon 4 of coyotes compared with the 45 dogs and 1 wolf. The coyotes also demonstrated a relatively common polymorphism in the 3' UTR sequence that could be used for population studies. One of the ASIP alleles (R96C) in domestic dogs causes a solid black coat color in homozygotes. Although some wolves are melanistic, this phenotype does not appear to be caused by this same mutation. However, one wolf, potentially a dog-wolf hybrid or descendant thereof, was heterozygous for this allele. Likewise 2 coyotes, potentially dog-coyote or wolf-coyote hybrid descendants, were heterozygous for the several polymorphisms in and flanking exon 4. We could conclude that these were coyote-dog hybrids because both were heterozygous for 2 mutations causing fawn coat color in dogs.

  12. Sequence analysis of the novel HLA-Cw*08 variant allele, Cw*0820, in a Chinese Han individual.

    PubMed

    Deng, Z-H; Xu, Y-P; Wang, D-M

    2009-09-01

    A novel human leukocyte antigen (HLA) allele, HLA-Cw*0820, was identified in a Chinese Han individual. It differs from the closest allele Cw*080101 by single nucleotide change at genomic nucleotide (nt) 1615 G>A (coding sequence nt 652 G>A, codon 194 GTC>ATC) in exon 4, which results in an amino acid change Val194Ile.

  13. Genomic full-length sequence of HLA-Cw*0103 and *0108, identified by cloning and sequencing.

    PubMed

    Xu, Y-P; Yang, B-C; Gao, S-Q; Deng, Z-H; Xie, Z

    2010-02-01

    Genomic full-length sequences of human leukocyte antigen (HLA)-Cw*0103 and *0108 were identified by cloning and sequencing from two Chinese donors. All introns, exons 4-8, 5'-promoter, and 3'-UTR were found to be identical between these two alleles.

  14. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  15. Human Cytomegalovirus Resistance to Deoxyribosylindole Nucleosides Maps to a Transversion Mutation in the Terminase Subunit-Encoding Gene UL89

    PubMed Central

    Phan, Quang; Hall, Ellie D.; Breitenbach, Julie M.; Borysko, Katherine Z.; Kamil, Jeremy P.; Townsend, Leroy B.; Drach, John C.

    2014-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  16. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  17. Human cytomegalovirus resistance to deoxyribosylindole nucleosides maps to a transversion mutation in the terminase subunit-encoding gene UL89.

    PubMed

    Gentry, Brian G; Phan, Quang; Hall, Ellie D; Breitenbach, Julie M; Borysko, Katherine Z; Kamil, Jeremy P; Townsend, Leroy B; Drach, John C

    2015-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  18. Human Cytomegalovirus Exploits Interferon-Induced Transmembrane Proteins To Facilitate Morphogenesis of the Virion Assembly Compartment

    PubMed Central

    Xie, Maorong; Xuan, Baoqin; Shan, Jiaoyu; Pan, Deng; Sun, Yamei; Shan, Zhao; Zhang, Jinping; Yu, Dong

    2014-01-01

    ABSTRACT Recently, interferon-induced transmembrane proteins (IFITMs) have been identified to be key effector molecules in the host type I interferon defense system. The invasion of host cells by a large range of RNA viruses is inhibited by IFITMs during the entry step. However, the roles of IFITMs in DNA virus infections have not been studied in detail. In this study, we report that human cytomegalovirus (HCMV), a large human DNA virus, exploits IFITMs to facilitate the formation of the virion assembly compartment (vAC) during infection of human fibroblasts. We found that IFITMs were expressed constitutively in human embryonic lung fibroblasts (MRC5 cells). HCMV infection inhibited IFITM protein accumulation in the later stages of infection. Overexpression of an IFITM protein in MRC5 cells slightly enhanced HCMV production and knockdown of IFITMs by RNA interference reduced the virus titer by about 100-fold on day 8 postinfection, according to the findings of a virus yield assay at a low multiplicity of infection. Virus gene expression and DNA synthesis were not affected, but the typical round structure of the vAC was not formed after the suppression of IFITMs, thereby resulting in defective virion assembly and the production of less infectious virion particles. Interestingly, the replication of herpes simplex virus, a human herpesvirus that is closely related to HCMV, was not affected by the suppression of IFITMs in MRC5 cells. These results indicate that IFITMs are involved in a specific pathway required for HCMV replication. IMPORTANCE HCMV is known to repurpose the interferon-stimulated genes (ISGs) viperin and tetherin to facilitate its replication. Our results expand the range of ISGs that can be exploited by HCMV for its replication. This is also the first report of a proviral function of IFITMs in DNA virus replication. In addition, whereas previous studies showed that IFITMs modulate virus entry, which is a very early stage in the virus life cycle, we

  19. Complex Interplay of the UL136 Isoforms Balances Cytomegalovirus Replication and Latency

    PubMed Central

    Caviness, Katie; Bughio, Farah; Crawford, Lindsey B.; Streblow, Daniel N.; Nelson, Jay A.; Caposio, Patrizia

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV), a betaherpesvirus, persists indefinitely in the human host through poorly understood mechanisms. The UL136 gene is carried within a genetic locus important to HCMV latency termed the UL133/8 locus, which also carries UL133, UL135, and UL138. Previously, we demonstrated that UL136 is expressed as five protein isoforms ranging from 33-kDa to 19-kDa, arising from alternative transcription and, likely, translation initiation mechanisms. We previously showed that the UL136 isoforms are largely dispensable for virus infection in fibroblasts, a model for productive virus replication. In our current work, UL136 has emerged as a complex regulator of HCMV infection in multiple contexts of infection relevant to HCMV persistence: in an endothelial cell (EC) model of chronic infection, in a CD34+ hematopoietic progenitor cell (HPC) model of latency, and in an in vivo NOD-scid IL2Rγcnull humanized (huNSG) mouse model for latency. The 33- and 26-kDa isoforms promote replication, while the 23- and 19-kDa isoforms suppress replication in ECs, in CD34+ HPCs, and in huNSG mice. The role of the 25-kDa isoform is context dependent and influences the activity of the other isoforms. These isoforms localize throughout the secretory pathway, and loss of the 33- and 26-kDa UL136 isoforms results in virus maturation defects in ECs. This work reveals an intriguing functional interplay between protein isoforms that impacts virus replication, latency, and dissemination, contributing to the overall role of the UL133/8 locus in HCMV infection. PMID:26933055

  20. Modulatory effect of rRNA synthesis and ppUL83 nucleolar compartmentalization on human cytomegalovirus gene expression in vitro.

    PubMed

    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; De Conto, Flora; Gatti, Rita; Orlandini, Guido; Ferraglia, Francesca; Motta, Federica; Covan, Silvia; Razin, Sergey V; Dettori, Giuseppe; Chezzi, Carlo

    2009-10-01

    The nucleolus is a nuclear domain involved in the biogenesis of ribosomes, as well as in many other important cellular regulatory activities, such as cell cycle control and mRNA processing. Many viruses, including herpesviruses, are known to exploit the nucleolar compartment during their replication cycle. In a previous study, we demonstrated the preferential targeting and accumulation of the human cytomegalovirus (HCMV) UL83 phosphoprotein (pp65) to the nucleolar compartment and, in particular, to the nucleolar matrix of lytically infected fibroblasts; such targeting was already evident at very early times after infection. Here we have investigated the possible effects of rRNA synthesis inhibition upon the development of HCMV lytic infection, by using either actinomycin D or cisplatin at low concentrations, that are known to selectively inhibit RNA polymerase I activity, whilst leaving RNA polymerase II function unaffected. Following the inhibition of rRNA synthesis by either of the agents used, we observed a significant redistribution of nucleolar proteins within the nucleoplasm and a simultaneous depletion of viral pp65 from the nucleolus; this effect was highly evident in both unextracted cells and in nuclear matrices in situ. Of particular interest, even a brief suppression of rRNA synthesis resulted in a very strong inhibition of the progression of HCMV infection, as was concluded from the absence of accumulation of HCMV major immediate-early proteins within the nucleus of infected cells. These data suggest that a functional relationship might exist between rRNA synthesis, pp65 localization to the nucleolar matrix and the normal development of HCMV lytic infection. PMID:19585527

  1. Cell-cycle-dependent localization of human cytomegalovirus UL83 phosphoprotein in the nucleolus and modulation of viral gene expression in human embryo fibroblasts in vitro.

    PubMed

    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Covan, Silvia; Germini, Diego; Razin, Sergey; Dettori, Giuseppe; Chezzi, Carlo

    2011-01-01

    The nucleolus is a multifunctional nuclear compartment widely known to be involved in several cellular processes, including mRNA maturation and shuttling to cytoplasmic sites, control of the cell cycle, cell proliferation, and apoptosis; thus, it is logical that many viruses, including herpesvirus, target the nucleolus in order to exploit at least one of the above-mentioned functions. Recent studies from our group demonstrated the early accumulation of the incoming ppUL83 (pp65), the major tegument protein of human cytomegalovirus (HCMV), in the nucleolus. The obtained results also suggested that a functional relationship might exist between the nucleolar localization of pp65, rRNA synthesis, and the development of the lytic program of viral gene expression. Here we present new data which support the hypothesis of a potentially relevant role of HCMV pp65 and its nucleolar localization for the control of the cell cycle by HCMV (arrest of cell proliferation in G1-G1/S), and for the promotion of viral infection. We demonstrated that, although the incoming pp65 amount in the infected cells appears to be constant irrespective of the cell-cycle phase, its nucleolar accumulation is prominent in G1 and G1/S, but very poor in S or G2/M. This correlates with the observation that only cells in G1 and G1/S support an efficient development of the HCMV lytic cycle. We propose that HCMV pp65 might be involved in regulatory/signaling pathways related to nucleolar functions, such as the cell-cycle control. Co-immunoprecipitation experiments have permitted to identify nucleolin as one of the nucleolar partners of pp65. PMID:21053310

  2. Genomic Sequencing and Characterization of Cynomolgus Macaque Cytomegalovirus▿

    PubMed Central

    Marsh, Angie K.; Willer, David O.; Ambagala, Aruna P. N.; Dzamba, Misko; Chan, Jacqueline K.; Pilon, Richard; Fournier, Jocelyn; Sandstrom, Paul; Brudno, Michael; MacDonald, Kelly S.

    2011-01-01

    Cytomegalovirus (CMV) infection is the most common opportunistic infection in immunosuppressed individuals, such as transplant recipients or people living with HIV/AIDS, and congenital CMV is the leading viral cause of developmental disabilities in infants. Due to the highly species-specific nature of CMV, animal models that closely recapitulate human CMV (HCMV) are of growing importance for vaccine development. Here we present the genomic sequence of a novel nonhuman primate CMV from cynomolgus macaques (Macaca fascicularis; CyCMV). CyCMV (Ottawa strain) was isolated from the urine of a healthy, captive-bred, 4-year-old cynomolgus macaque of Philippine origin, and the viral genome was sequenced using next-generation Illumina sequencing to an average of 516-fold coverage. The CyCMV genome is 218,041 bp in length, with 49.5% G+C content and 84% protein-coding density. We have identified 262 putative open reading frames (ORFs) with an average coding length of 789 bp. The genomic organization of CyCMV is largely colinear with that of rhesus macaque CMV (RhCMV). Of the 262 CyCMV ORFs, 137 are homologous to HCMV genes, 243 are homologous to RhCMV 68.1, and 200 are homologous to RhCMV 180.92. CyCMV encodes four ORFs that are not present in RhCMV strain 68.1 or 180.92 but have homologies with HCMV (UL30, UL74A, UL126, and UL146). Similar to HCMV, CyCMV does not produce the RhCMV-specific viral homologue of cyclooxygenase-2. This newly characterized CMV may provide a novel model in which to study CMV biology and HCMV vaccine development. PMID:21994460

  3. Human cytomegalovirus transcriptome activity differs during replication in human fibroblast, epithelial and astrocyte cell lines

    PubMed Central

    Towler, James C.; Ebrahimi, Bahram; Lane, Brian; Davison, Andrew J.

    2012-01-01

    Broad cell tropism contributes to the pathogenesis of human cytomegalovirus (HCMV), but the extent to which cell type influences HCMV gene expression is unclear. A bespoke HCMV DNA microarray was used to monitor the transcriptome activity of the low passage Merlin strain of HCMV at 12, 24, 48 and 72 h post-infection, during a single round of replication in human fetal foreskin fibroblast cells (HFFF-2s), human retinal pigmented epithelial cells (RPE-1s) and human astrocytoma cells (U373MGs). In order to correlate transcriptome activity with concurrent biological responses, viral cytopathic effect, growth kinetics and genomic loads were examined in the three cell types. The temporal expression pattern of viral genes was broadly similar in HFFF-2s and RPE-1s, but dramatically different in U373MGs. Of the 165 known HCMV protein-coding genes, 41 and 48 were differentially regulated in RPE-1s and U373MGs, respectively, compared with HFFF-2s, and 22 of these were differentially regulated in both RPE-1s and U373MGs. In RPE-1s, all differentially regulated genes were downregulated, but, in U373MGs, some were down- and others upregulated. Differentially regulated genes were identified among the immediate-early, early, early late and true-late viral gene classes. Grouping of downregulated genes according to function at landmark stages of the replication cycle led to the identification of potential bottleneck stages (genome replication, virion assembly, and virion maturation and release) that may account for cell type-dependent viral growth kinetics. The possibility that cell type-specific differences in expressed cellular factors are responsible for modulation of viral gene expression is discussed. PMID:22258857

  4. Human cytomegalovirus inhibits apoptosis by proteasome-mediated degradation of Bax at endoplasmic reticulum-mitochondrion contacts.

    PubMed

    Zhang, Aiping; Hildreth, Richard L; Colberg-Poley, Anamaris M

    2013-05-01

    Human cytomegalovirus (HCMV) encodes the UL37 exon 1 protein (pUL37x1), which is the potent viral mitochondrion-localized inhibitor of apoptosis (vMIA), to increase survival of infected cells. HCMV vMIA traffics from the endoplasmic reticulum (ER) to ER subdomains, which are physically linked to mitochondria known as mitochondrion-associated membranes (MAM), and to mitochondria. The antiapoptotic function of vMIA is thought to primarily result from its ability to inhibit Bax-mediated permeabilization of the outer mitochondrial membrane (OMM). Here, we establish that vMIA retargets Bax to the MAM as well as to the OMM from immediate early through late times of infection. However, MAM localization of Bax results in its increased ubiquitination and proteasome-mediated degradation. Surprisingly, HCMV infection does not increase OMM-associated degradation (OMMAD) of Bax, even though the ER and mitochondria are physically connected at the MAM. It was recently found that lipid rafts at the plasma membrane can connect extrinsic and intrinsic apoptotic pathways and can serve as sites of apoptosome assembly. In transfected permissive human fibroblasts, vMIA mediates, through its cholesterol affinity, association of Bax and apoptosome components with MAM lipid rafts. While Bax association with MAM lipid rafts was detected in HCMV-infected cells, association of apoptosome components was not. These results establish that Bax recruitment to the MAM and its MAM-associated degradation (MAMAD) are a newly described antiapoptotic mechanism used by HCMV infection to increase cell survival for its growth.

  5. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism.

    PubMed

    Li, Gang; Nguyen, Christopher C; Ryckman, Brent J; Britt, William J; Kamil, Jeremy P

    2015-04-01

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes.

  6. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism

    PubMed Central

    Li, Gang; Nguyen, Christopher C.; Ryckman, Brent J.; Britt, William J.; Kamil, Jeremy P.

    2015-01-01

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes. PMID:25831500

  7. Murine cytomegalovirus resistant to antivirals has genetic correlates with human cytomegalovirus.

    PubMed

    Scott, G M; Ng, H-L; Morton, C J; Parker, M W; Rawlinson, W D

    2005-08-01

    Human cytomegalovirus (HCMV) resistance to antivirals is a significant clinical problem. Murine cytomegalovirus (MCMV) infection of mice is a well-described animal model for in vivo studies of CMV pathogenesis, although the mechanisms of MCMV antiviral susceptibility need elucidation. Mutants resistant to nucleoside analogues aciclovir, adefovir, cidofovir, ganciclovir, penciclovir and valaciclovir, and the pyrophosphate analogue foscarnet were generated by in vitro passage of MCMV (Smith) in increasing concentrations of antiviral. All MCMV antiviral resistant mutants contained DNA polymerase mutations identical or similar to HCMV DNA polymerase mutations known to confer antiviral resistance. Mapping of the mutations onto an MCMV DNA polymerase three-dimensional model generated using the Thermococcus gorgonarius Tgo polymerase crystal structure showed that the DNA polymerase mutations potentially confer resistance through changes in regions surrounding a catalytic aspartate triad. The ganciclovir-, penciclovir- and valaciclovir-resistant isolates also contained mutations within MCMV M97 identical or similar to recognized GCV-resistant mutations of HCMV UL97 protein kinase, and demonstrated cross-resistance to antivirals of the same class. This strongly suggests that MCMV M97 has a similar role to HCMV UL97 in the phosphorylation of nucleoside analogue antivirals. All MCMV mutants demonstrated replication-impaired phenotypes, with the lowest titre and plaque size observed for isolates containing mutations in both DNA polymerase and M97. These findings indicate DNA polymerase and protein kinase regions of potential importance for antiviral susceptibility and replication. The similarities between MCMV and HCMV mutations that arise under antiviral selective pressure increase the utility of MCMV as a model for in vivo studies of CMV antiviral resistance. PMID:16033961

  8. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  9. Soluble Human Cytomegalovirus gH/gL/pUL128-131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes.

    PubMed

    Loughney, John W; Rustandi, Richard R; Wang, Dai; Troutman, Matthew C; Dick, Lawrence W; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C; Price, Colleen E; Hoang, Van M; Culp, Timothy D; DePhillips, Pete A; Fu, Tong-Ming; Ha, Sha

    2015-06-26

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128-131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128-131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128-131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0-6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4-8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128-131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process.

  10. Antibody-driven design of a human cytomegalovirus gHgLpUL128L subunit vaccine that selectively elicits potent neutralizing antibodies.

    PubMed

    Kabanova, Anna; Perez, Laurent; Lilleri, Daniele; Marcandalli, Jessica; Agatic, Gloria; Becattini, Simone; Preite, Silvia; Fuschillo, Dario; Percivalle, Elena; Sallusto, Federica; Gerna, Giuseppe; Corti, Davide; Lanzavecchia, Antonio

    2014-12-16

    The use of neutralizing antibodies to identify the most effective antigen has been proposed as a strategy to design vaccines capable of eliciting protective B-cell immunity. In this study, we analyzed the human antibody response to cytomegalovirus (human cytomegalovirus, HCMV) infection and found that antibodies to glycoprotein (g)B, a surface glycoprotein that has been developed as a HCMV vaccine, were primarily nonneutralizing. In contrast, most of the antibodies to the complex formed by gH, gL, protein (p)UL128, pUL130, and pUL131 (the gHgLpUL128L pentamer) neutralized HCMV infection with high potency. Based on this analysis, we developed a single polycistronic vector encoding the five pentamer genes separated by "self-cleaving" 2A peptides to generate a stably transfected CHO cell line constitutively secreting high levels of recombinant pentamer that displayed the functional antigenic sites targeted by human neutralizing antibodies. Immunization of mice with the pentamer formulated with different adjuvants elicited HCMV neutralizing antibody titers that persisted to high levels over time and that were a hundred- to thousand-fold higher than those found in individuals that recovered from primary HCMV infection. Sera from mice immunized with the pentamer vaccine neutralized infection of both epithelial cells and fibroblasts and prevented cell-to-cell spread and viral dissemination from endothelial cells to leukocytes. Neutralizing monoclonal antibodies from immunized mice showed the same potency as human antibodies and targeted the same as well as additional sites on the pentamer. These results illustrate with a relevant example a general and practical approach of analytic vaccinology for the development of subunit vaccines against complex pathogens.

  11. Poor survival in glioblastoma patients is associated with early signs of immunosenescence in the CD4 T-cell compartment after surgery

    PubMed Central

    Fornara, Olesja; Odeberg, Jenny; Wolmer Solberg, Nina; Tammik, Charlotte; Skarman, Petra; Peredo, Inti; Stragliotto, Giuseppe; Rahbar, Afsar; Söderberg-Nauclér, Cecilia

    2015-01-01

    Patients with glioblastoma multiforme (GBM) are immunosuppressed and have a broad range of immunological defects in both innate and adaptive immune responses. GBMs are frequently infected with human cytomegalovirus (HCMV), a virus capable of causing immunosuppression. In 42 HCMV-positive GBM patients in a clinical trial (VIGAS), we investigated T-cell phenotypes in the blood and assessed their relation to survival. Blood was collected before and 3, 12, and 24 weeks after surgery, and the frequency of T-cell subsets was compared with that in 26 age-matched healthy controls. GBM patients had lower levels of CD3 cells than the controls, but had significantly higher levels of CD4+CD28− T cells before and 3 and 12 weeks after surgery and increased levels of CD4+CD57+ and CD4+CD57+CD28+ T cells at all-time points. These T-cell subsets were associated with both immunosenescence and HCMV infection. GBM patients also had higher levels of γδ T cells at all-times after surgery and lower levels of CD4+CD25+ cells before and 3 weeks after surgery than healthy controls. Overall survival was significantly shorter in patients with higher levels of CD4+CD28− T cells (p = 0.025), CD4+CD57+ T (p = 0.025) cells, and CD4+CD28−CD57+CD28− T cells (p < 0.0004) at 3 weeks after surgery. Our findings indicate that signs of immunosenescence in the CD4+ compartment are associated with poor prognosis in patients with HCMV-positive GBMs and may reflect the HCMV activity in their tumors. PMID:26405601

  12. A targeted spatial-temporal proteomics approach implicates multiple cellular trafficking pathways in human cytomegalovirus virion maturation.

    PubMed

    Moorman, Nathaniel J; Sharon-Friling, Ronit; Shenk, Thomas; Cristea, Ileana M

    2010-05-01

    The assembly of infectious virus particles is a complex event. For human cytomegalovirus (HCMV) this process requires the coordinated expression and localization of at least 60 viral proteins that comprise the infectious virion. To gain insight into the mechanisms controlling this process, we identified protein binding partners for two viral proteins, pUL99 (also termed pp28) and pUL32 (pp150), which are essential for HCMV virion assembly. We utilized HCMV strains expressing pUL99 or pUL32 carboxyl-terminal green fluorescent protein fusion proteins from their native location in the HCMV genome. Based on the presence of ubiquitin in the pUL99 immunoisolation, we discovered that this viral protein colocalizes with components of the cellular endosomal sorting complex required for transport (ESCRT) pathway during the initial stages of virion assembly. We identified the nucleocapsid and a large number of tegument proteins as pUL32 binding partners, suggesting that events controlling trafficking of this viral protein in the cytoplasm regulate nucleocapsid/tegument maturation. The finding that pUL32, but not pUL99, associates with clathrin led to the discovery that the two viral proteins traffic via distinct pathways during the early stages of virion assembly. Additional investigation revealed that the majority of the major viral glycoprotein gB initially resides in a third compartment. Analysis of the trafficking of these three viral proteins throughout a time course of virion assembly allowed us to visualize their merger into a single large cytoplasmic structure during the late stages of viral assembly. We propose a model of HCMV virion maturation in which multiple components of the virion traffic independently of one another before merging.

  13. Human cytomegalovirus infection leads to elevated levels of transplant arteriosclerosis in a humanized mouse aortic xenograft model.

    PubMed

    Abele-Ohl, S; Leis, M; Wollin, M; Mahmoudian, S; Hoffmann, J; Müller, R; Heim, C; Spriewald, B M; Weyand, M; Stamminger, T; Ensminger, S M

    2012-07-01

    Recent findings emphasized an important role of human cytomegalovirus (HCMV) infection in the development of transplant arteriosclerosis. Therefore, the aim of this study was to develop a human peripheral blood lymphocyte (hu-PBL)/Rag-2(-/-) γc(-/-) mouse-xenograft-model to investigate both immunological as well as viral effector mechanisms in the progression of transplant arteriosclerosis. For this, sidebranches from the internal mammary artery were recovered during coronary artery bypass graft surgery, tissue-typed and infected with HCMV. Then, size-matched sidebranches were implanted into the infrarenal aorta of Rag-2(-/-) γc(-/-) mice. The animals were reconstituted with human peripheral blood mononuclear cells (PBMCs) 7 days after transplantation. HCMV-infection was confirmed by Taqman-PCR and immunofluorescence analyses. Arterial grafts were analyzed by histology on day 40 after transplantation. PBMC-reconstituted Rag-2(-/-) γc(-/-) animals showed splenic chimerism levels ranging from 1-16% human cells. After reconstitution, Rag-2(-/-) γc(-/-) mice developed human leukocyte infiltrates in their grafts and vascular lesions that were significantly elevated after infection. Cellular infiltration revealed significantly increased ICAM-1 and PDGF-R-β expression after HCMV-infection of the graft. Arterial grafts from unreconstituted Rag-2(-/-) γc(-/-) recipients showed no vascular lesions. These data demonstrate a causative relationship between HCMV-infection as an isolated risk factor and the development of transplant-arteriosclerosis in a humanized mouse arterial-transplant-model possibly by elevated ICAM-1 and PDGF-R-β expression.

  14. Novel Method Based on Real-Time Cell Analysis for Drug Susceptibility Testing of Herpes Simplex Virus and Human Cytomegalovirus.

    PubMed

    Piret, Jocelyne; Goyette, Nathalie; Boivin, Guy

    2016-08-01

    The plaque reduction assay (PRA) is the gold standard phenotypic method to determine herpes simplex virus (HSV) and human cytomegalovirus (HCMV) susceptibilities to antiviral drugs. However, this assay is subjective and labor intensive. Here, we describe a novel antiviral phenotypic method based on real-time cell analysis (RTCA) that measures electronic impedance over time. The effective drug concentrations that reduced by 50% (EC50s) the cytopathic effects induced by HSV-1 and HCMV were evaluated by both methods. The EC50s of acyclovir and foscarnet against a reference wild-type (WT) HSV-1 strain in Vero cells were, respectively, 0.5 μM and 32.6 μM by PRA and 0.8 μM and 93.6 μM by RTCA. The EC50 ratios for acyclovir against several HSV-1 thymidine kinase (TK) mutants were 101.8×, 73.4×, 28.8×, and 35.4× (PRA) and 18.0×, 52.0×, 5.5×, and 87.8× (RTCA) compared to those for the WT. The EC50 ratios for acyclovir and foscarnet against the HSV-1 TK/DNA polymerase mutant were 182.8× and 9.7× (PRA) and >125.0× and 10.8× (RTCA) compared to the WT. The EC50s of ganciclovir and foscarnet against WT HCMV strain AD169 in fibroblasts were, respectively, 1.6 μM and 27.8 μM by PRA and 5.0 μM and 111.4 μM by RTCA. The EC50 ratios of ganciclovir against the HCMV UL97 mutant were 3.8× (PRA) and 8.2× (RTCA) compared to those for the WT. The EC50 ratios of ganciclovir and foscarnet against the HCMV UL97/DNA polymerase mutant were 17.1× and 12.1× (PRA) and 14.7× and 4.6× (RTCA) compared to those for the WT. RTCA allows objective drug susceptibility testing of HSV and HCMV and could permit high-throughput screening of new antivirals. PMID:27252463

  15. TAOK3 Phosphorylates the Methylenecyclopropane Nucleoside MBX 2168 to its Monophosphate

    PubMed Central

    Komazin-Meredith, Gloria; Cardinale, Steven C.; Comeau, Katelyn; Magalhaes, Kevin J.; Hartline, Caroll B.; Williams, John D.; Opperman, Timothy J.; Prichard, Mark N.; Bowlin, Terry L.

    2015-01-01

    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  16. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  17. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  18. Phenotypic characterization of two naturally occurring human Cytomegalovirus sequence polymorphisms located in a distinct region of ORF UL56 known to be involved in in vitro resistance to letermovir.

    PubMed

    Goldner, Thomas; Zimmermann, Holger; Lischka, Peter

    2015-04-01

    Letermovir is a new drug in Phase 3 clinical development for the prevention of human Cytomegalovirus (HCMV) infections in hematopoietic-stem-cell transplant recipients (HSCT). In contrast to marketed anti-HCMV drugs which all target the viral DNA polymerase, letermovir's novel mode of action targets the UL56 subunit of the viral terminase complex. Consistently letermovir resistance has mapped in vitro to a distinct region within ORF UL56 (amino acid 230-370). Here we used marker transfer to demonstrate that two naturally occurring UL56 sequence variants within this region, located directly adjacent to sites known to mediate letermovir resistance in vitro (D242G and A327V) represent normal interstrain polymorphisms unrelated to drug-resistance.

  19. CEACAM1-Mediated Inhibition of Virus Production.

    PubMed

    Vitenshtein, Alon; Weisblum, Yiska; Hauka, Sebastian; Halenius, Anne; Oiknine-Djian, Esther; Tsukerman, Pinchas; Bauman, Yoav; Bar-On, Yotam; Stern-Ginossar, Noam; Enk, Jonatan; Ortenberg, Rona; Tai, Julie; Markel, Gal; Blumberg, Richard S; Hengel, Hartmut; Jonjic, Stipan; Wolf, Dana G; Adler, Heiko; Kammerer, Robert; Mandelboim, Ofer

    2016-06-14

    Cells in our body can induce hundreds of antiviral genes following virus sensing, many of which remain largely uncharacterized. CEACAM1 has been previously shown to be induced by various innate systems; however, the reason for such tight integration to innate sensing systems was not apparent. Here, we show that CEACAM1 is induced following detection of HCMV and influenza viruses by their respective DNA and RNA innate sensors, IFI16 and RIG-I. This induction is mediated by IRF3, which bound to an ISRE element present in the human, but not mouse, CEACAM1 promoter. Furthermore, we demonstrate that, upon induction, CEACAM1 suppresses both HCMV and influenza viruses in an SHP2-dependent process and achieves this broad antiviral efficacy by suppressing mTOR-mediated protein biosynthesis. Finally, we show that CEACAM1 also inhibits viral spread in ex vivo human decidua organ culture. PMID:27264178

  20. Polyhydroxylated steroids from the bamboo coral Isis hippuris.

    PubMed

    Chen, Wei-Hua; Wang, Shang-Kwei; Duh, Chang-Yih

    2011-01-01

    In previous studies on the secondary metabolites of the Taiwanese octocoral Isis hippuris, specimens have always been collected at Green Island. In the course of our studies on bioactive compounds from marine organisms, the acetone-solubles of the Taiwanese octocoral I. hippuris collected at Orchid Island have led to the isolation of five new polyoxygenated steroids: hipposterone M-O (1-3), hipposterol G (4) and hippuristeroketal A (5). The structures of these compounds were determined on the basis of their spectroscopic and physical data. The anti-HCMV (human cytomegalovirus) activity of 1-5 and their cytotoxicity against selected cell lines were evaluated. Compound 2 exhibited inhibitory activity against HCMV, with an EC(50) value of 6.0 μg/mL.

  1. TAOK3 phosphorylates the methylenecyclopropane nucleoside MBX 2168 to its monophosphate.

    PubMed

    Komazin-Meredith, Gloria; Cardinale, Steven C; Comeau, Katelyn; Magalhaes, Kevin J; Hartline, Caroll B; Williams, John D; Opperman, Timothy J; Prichard, Mark N; Bowlin, Terry L

    2015-07-01

    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  2. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens.

  3. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  4. Linkage of a new mutation in the proteolipid protein (PLP) gene to Pelizaeus-Merzbacher disease (PMD) in a large Finnish kindred.

    PubMed Central

    Pratt, V M; Kiefer, J R; Lähdetie, J; Schleutker, J; Hodes, M E; Dlouhy, S R

    1993-01-01

    The purpose of this study was to confirm linkage of the proteolipid protein gene (PLP) and Pelizaeus-Merzbacher disease (PMD). A T-->A transversion in nucleotide pair 35 of exon 4 of PLP was found in a large Finnish kindred with PMD. This mutation results in the substitution Val165-->Glu165. We used a combination of single-strand conformational polymorphism and PCR primer extension to determine the presence or absence of the point mutation in family members. A lod score of 2.6 (theta = 0) was found for linkage of the gene and the disease. We examined 101 unrelated X chromosomes and found none with the transversion. This is the second report of linkage of PMD to a missense mutation in PLP. These findings support the hypothesis that PMD in this family is a result of the missense mutation present in exon 4 of PLP. Images Figure 2 Figure 3 Figure 4 PMID:7684886

  5. Alteration of Conserved Alternative Splicing in AMELX Causes Enamel Defects

    PubMed Central

    Cho, E.S.; Kim, K.-J.; Lee, K.-E.; Lee, E.-J.; Yun, C.Y.; Lee, M.-J.; Shin, T.J.; Hyun, H.-K.; Kim, Y.-J.; Lee, S.-H.; Jung, H.-S.; Lee, Z.H.; Kim, J.-W.

    2014-01-01

    Tooth enamel is the most highly mineralized tissue in vertebrates. Enamel crystal formation and elongation should be well controlled to achieve an exceptional hardness and a compact microstructure. Enamel matrix calcification occurs with several matrix proteins, such as amelogenin, enamelin, and ameloblastin. Among them, amelogenin is the most abundant enamel matrix protein, and multiple isoforms resulting from extensive but well-conserved alternative splicing and postsecretional processing have been identified. In this report, we recruited a family with a unique enamel defect and identified a silent mutation in exon 4 of the AMELX gene. We show that the mutation caused the inclusion of exon 4, which is almost always skipped, in the mRNA transcript. We further show, by generating and characterizing a transgenic animal model, that the alteration of the ratio and quantity of the developmentally conserved alternative splicing repertoire of AMELX caused defects in enamel matrix mineralization. PMID:25117480

  6. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu

    2014-01-01

    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  7. Palmitoylation Strengthens Cholesterol-dependent Multimerization and Fusion Activity of Human Cytomegalovirus Glycoprotein B (gB).

    PubMed

    Patrone, Marco; Coroadinha, Ana Sofia; Teixeira, Ana P; Alves, Paula M

    2016-02-26

    Herpesviruses are a large order of animal enveloped viruses displaying a virion fusion mechanism of unusual complexity. Their multipartite machinery has a conserved core made of the gH/gL ancillary complexes and the homo-trimeric fusion protein glycoprotein B (gB). Despite its essential role in starting the viral infection, gB interaction with membrane lipids is still poorly understood. Here, evidence is provided demonstrating that human cytomegalovirus (HCMV) gB depends on the S-palmitoylation of its endodomain for an efficient interaction with cholesterol-rich membrane patches. We found that, unique among herpesviral gB proteins, the HCMV fusion factor has a Cys residue in the C-terminal region that is palmitoylated and mediates methyl-β-cyclodextrin-sensitive self-association of purified gB. A cholesterol-dependent virus-like particle trap assay, based on co-expression of the HIV Gag protein, confirmed that this post-translational modification is functional in the context of cellular membranes. Mutation of the palmitoylated Cys residue to Ala or inhibition of protein palmitoylation decreased HCMV gB export via Gag particles. Moreover, purified gBC777A showed an increased kinetic sensitivity in a cholesterol depletion test, demonstrating that palmitoyl-gB limits outward cholesterol diffusion. Finally, gB palmitoylation was required for full fusogenic activity in human epithelial cells. Altogether, these results uncover the palmitoylation of HCMV gB and its role in gB multimerization and activity.

  8. Cytomegalovirus pUL50 is the multi-interacting determinant of the core nuclear egress complex (NEC) that recruits cellular accessory NEC components.

    PubMed

    Sonntag, Eric; Hamilton, Stuart T; Bahsi, Hanife; Wagner, Sabrina; Jonjic, Stipan; Rawlinson, William D; Marschall, Manfred; Milbradt, Jens

    2016-07-01

    Nuclear egress of herpesvirus capsids through the nuclear envelope is mediated by the multimeric nuclear egress complex (NEC). The human cytomegalovirus (HCMV) core NEC is defined by an interaction between the membrane-anchored pUL50 and its nuclear co-factor pUL53, tightly associated through heterodimeric corecruitment to the nuclear envelope. Cellular proteins, such as p32/gC1qR, emerin and protein kinase C (PKC), are recruited by direct interaction with pUL50 for the multimeric extension of the NEC. As a functionally important event, the recruitment of both viral and cellular protein kinases leads to site-specific lamin phosphorylation and nuclear lamina disassembly. In this study, interaction domains within pUL50 for its binding partners were defined by co-immunoprecipitation. The interaction domain for pUL53 is located within the pUL50 N-terminus (residues 10-169), interaction domains for p32/gC1qR (100-358) and PKC (100-280) overlap in the central part of pUL50, and the interaction domain for emerin is located in the C-terminus (265-397). Moreover, expression and formation of core NEC proteins at the nuclear rim were consistently detected in cells permissive for productive HCMV replication, including two trophoblast-cell lines. Importantly, regular nuclear-rim formation of the core NEC was blocked by inhibition of cyclin-dependent kinase (CDK) activity. In relation to the recently published crystal structure of the HCMV core NEC, our findings result in a refined view of NEC assembly. In particular, we suggest that CDKs may play an important regulatory role in NEC formation during HCMV replication.

  9. Characterization of a Novel Golgi Apparatus-Localized Latency Determinant Encoded by Human Cytomegalovirus▿

    PubMed Central

    Petrucelli, Alex; Rak, Michael; Grainger, Lora; Goodrum, Felicia

    2009-01-01

    Human cytomegalovirus (HCMV) exists indefinitely in infected individuals by a yet poorly characterized latent infection in hematopoietic cells. We previously demonstrated a requirement for the putative UL138 open reading frame (ORF) in promoting a latent infection in CD34+ hematopoietic progenitor cells (HPCs) infected in vitro. In our present study, we have identified two coterminal transcripts of 2.7 and 3.6 kb and a 21-kilodalton (kDa) protein (pUL138) that are derived from the UL138 locus with early-late gene kinetics during productive infection. The UL138 transcripts and protein are detected in both fibroblasts and HPCs. A recombinant virus, FIX-UL138STOP, that synthesizes the UL138 transcripts but not the protein exhibited a partial loss-of-latency phenotype in HPCs, similar to the phenotype observed for the UL138-null recombinant virus. This finding suggests that the UL138 protein is required for latency, but it does not exclude the possibility that the UL138 transcripts or other ORFs also contribute to latency. The mechanisms by which pUL138 contributes to latency remain unknown. While the 86- and 72-kDa immediate-early proteins were not detected in HPCs infected with HCMV in vitro, pUL138 did not function directly to suppress expression from the major immediate-early promoter in reporter assays. Interestingly, pUL138 localizes to the Golgi apparatus in infected cells but is not incorporated into virus particles. The localization of pUL138 to the Golgi apparatus suggests that pUL138 contributes to HCMV latency by a novel mechanism. pUL138 is the first HCMV protein demonstrated to promote an infection with the hallmarks of latency in CD34+ HPCs. PMID:19297488

  10. A Novel CDK7 Inhibitor of the Pyrazolotriazine Class Exerts Broad-Spectrum Antiviral Activity at Nanomolar Concentrations

    PubMed Central

    Hutterer, Corina; Eickhoff, Jan; Milbradt, Jens; Korn, Klaus; Zeitträger, Isabel; Bahsi, Hanife; Wagner, Sabrina; Zischinsky, Gunther; Wolf, Alexander; Degenhart, Carsten; Unger, Anke; Baumann, Matthias; Klebl, Bert

    2015-01-01

    Protein kinases represent central and multifunctional regulators of a balanced virus-host interaction. Cyclin-dependent protein kinase 7 (CDK7) plays crucial regulatory roles in cell cycle and transcription, both connected with the replication of many viruses. Previously, we developed a CDK7 inhibitor, LDC4297, that inhibits CDK7 in vitro in the nano-picomolar range. Novel data from a kinome-wide evaluation (>330 kinases profiled in vitro) demonstrate a kinase selectivity. Importantly, we provide first evidence for the antiviral potential of the CDK7 inhibitor LDC4297, i.e., in exerting a block of the replication of human cytomegalovirus (HCMV) in primary human fibroblasts at nanomolar concentrations (50% effective concentration, 24.5 ± 1.3 nM). As a unique feature compared to approved antiherpesviral drugs, inhibition occurred already at the immediate-early level of HCMV gene expression. The mode of antiviral action was considered multifaceted since CDK7-regulated cellular factors that are supportive of HCMV replication were substantially affected by the inhibitors. An effect of LDC4297 was identified in the interference with HCMV-driven inactivation of retinoblastoma protein (Rb), a regulatory step generally considered a hallmark of herpesviral replication. In line with this finding, a broad inhibitory activity of the drug could be demonstrated against a selection of human and animal herpesviruses and adenoviruses, whereas other viruses only showed intermediate drug sensitivity. Summarized, the CDK7 inhibitor LDC4297 is a promising candidate for further antiviral drug development, possibly offering new options for a comprehensive approach to antiviral therapy. PMID:25624324

  11. Human cytomegalovirus IE72 protein interacts with the transcriptional repressor hDaxx to regulate LUNA gene expression during lytic infection.

    PubMed

    Reeves, Matthew; Woodhall, David; Compton, Teresa; Sinclair, John

    2010-07-01

    A putative latency-associated transcript (LUNA) complementary to the human cytomegalovirus (HCMV) UL81-82 region previously identified in seropositive donors' monocytes is also expressed during lytic infection. Thus, the LUNA promoter is active during both lytic and latent infection. Consequently, the mechanisms regulating this promoter may provide further insight into factors that determine whether the outcome of HCMV infection is latent or lytic. By transfection, the LUNA promoter exhibited low but reproducible activity. Substantial activation by virus infection suggested that a viral factor was important for LUNA expression during lytic infection. IE72, a known transactivator of viral promoters, activated the LUNA promoter in cotransfection assays. Furthermore, coinfection with wild-type HCMV but not an IE72 deletion virus (CR208) also activated the LUNA promoter. Finally, diminished LUNA gene expression in CR208 virus-infected cells supported a role for IE72 in LUNA gene expression. The initial regulation of herpesvirus immediate-early gene expression is associated with proteins found at cellular nuclear domain 10 (ND10) bodies, such as PML, hDaxx, and ATRX. hDaxx transfection repressed LUNA promoter activity. Furthermore, we observed binding of hDaxx to the LUNA promoter, which was abrogated by IE72 gene expression via direct interaction. Finally, we show that small interfering RNA (siRNA) knockdown of the hDaxx interaction partner ATRX rescued LUNA gene expression in CR208-infected cells. Overall, these data show that hDaxx/ATRX-mediated repression of LUNA during lytic infection absolutely requires IE72 gene expression. It also suggests that the targeting of cellular factors by IE72 is important throughout the different phases of HCMV gene expression during productive infection.

  12. Differential cellular localization of Epstein-Barr virus and human cytomegalovirus in the colonic mucosa of patients with active or quiescent inflammatory bowel disease.

    PubMed

    Ciccocioppo, Rachele; Racca, Francesca; Scudeller, Luigia; Piralla, Antonio; Formagnana, Pietro; Pozzi, Lodovica; Betti, Elena; Vanoli, Alessandro; Riboni, Roberta; Kruzliak, Peter; Baldanti, Fausto; Corazza, Gino Roberto

    2016-02-01

    The role of human cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) in the exacerbation of inflammatory bowel disease (IBD) is still uncertain. We prospectively investigated the presence of EBV and HCMV infection in both epithelial and immune cells of colonic mucosa of IBD patients, both refractory and responders to standard therapies, in comparison with patients suffering from irritable bowel syndrome who were considered as controls, by using quantitative real-time polymerase chain reaction, immunohistochemistry and in situ hybridization, in an attempt to assess viral localization, DNA load, life cycle phase and possible correlation with disease activity indexes. We obtained clear evidence of the presence of high DNA loads of both viruses in either enterocytes or immune cells of refractory IBD patients, whereas we observed low levels in the responder group and an absence of detectable copies in all cell populations of controls. Remarkably, the values of EBV and HCMV DNA in inflamed mucosa were invariably higher than in non-inflamed areas in both IBD groups, and the EBV DNA loads in the cell populations of diseased mucosa of refractory IBD patients positively correlated with the severity of mucosal damage and clinical indexes of activity. Moreover, EBV infection resulted the most prevalent either alone or in combination with HCMV, while immunohistochemistry and in situ hybridization did not allow us to distinguish between the different phases of viral life cycle. Finally, as regards treatment, these novel findings could pave the way for the use of new antiviral molecules in the treatment of this condition. PMID:26659090

  13. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

    PubMed Central

    McGregor, Alistair

    2016-01-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  14. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    PubMed

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

  15. Cyclin A Degradation by Primate Cytomegalovirus Protein pUL21a Counters Its Innate Restriction of Virus Replication

    PubMed Central

    Yu, Dong

    2013-01-01

    Cyclin A is critical for cellular DNA synthesis and S phase progression of the cell cycle. Human cytomegalovirus (HCMV) can reduce cyclin A levels and block cellular DNA synthesis, and cyclin A overexpression can repress HCMV replication. This interaction has only been previously observed in HCMV as murine CMV does not downregulate cyclin A, and the responsible viral factor has not been identified. We previously reported that the HCMV protein pUL21a disrupted the anaphase-promoting complex (APC), but a point mutant abrogating this activity did not phenocopy a UL21a-deficient virus, suggesting that pUL21a has an additional function. Here we identified a conserved arginine-x-leucine (RxL) cyclin-binding domain within pUL21a, which allowed pUL21a to interact with cyclin A and target it for proteasome degradation. Homologous pUL21a proteins from both chimpanzee and rhesus CMVs also contained the RxL domain and similarly degraded cyclin A, indicating that this function is conserved in primate CMVs. The RxL point mutation disabled the virus' ability to block cellular DNA synthesis and resulted in a growth defect similar to pUL21a-deficient virus. Importantly, knockdown of cyclin A rescued growth of UL21a-deficient virus. Together, these data show that during evolution, the pUL21a family proteins of primate CMVs have acquired a cyclin-binding domain that targets cyclin A for degradation, thus neutralizing its restriction on virus replication. Finally, the combined proteasome-dependent degradation of pUL21a and its cellular targets suggests that pUL21a may act as a novel suicide protein, targeting its protein cargos for destruction. PMID:24385906

  16. Cytomegalovirus pUL50 is the multi-interacting determinant of the core nuclear egress complex (NEC) that recruits cellular accessory NEC components.

    PubMed

    Sonntag, Eric; Hamilton, Stuart T; Bahsi, Hanife; Wagner, Sabrina; Jonjic, Stipan; Rawlinson, William D; Marschall, Manfred; Milbradt, Jens

    2016-07-01

    Nuclear egress of herpesvirus capsids through the nuclear envelope is mediated by the multimeric nuclear egress complex (NEC). The human cytomegalovirus (HCMV) core NEC is defined by an interaction between the membrane-anchored pUL50 and its nuclear co-factor pUL53, tightly associated through heterodimeric corecruitment to the nuclear envelope. Cellular proteins, such as p32/gC1qR, emerin and protein kinase C (PKC), are recruited by direct interaction with pUL50 for the multimeric extension of the NEC. As a functionally important event, the recruitment of both viral and cellular protein kinases leads to site-specific lamin phosphorylation and nuclear lamina disassembly. In this study, interaction domains within pUL50 for its binding partners were defined by co-immunoprecipitation. The interaction domain for pUL53 is located within the pUL50 N-terminus (residues 10-169), interaction domains for p32/gC1qR (100-358) and PKC (100-280) overlap in the central part of pUL50, and the interaction domain for emerin is located in the C-terminus (265-397). Moreover, expression and formation of core NEC proteins at the nuclear rim were consistently detected in cells permissive for productive HCMV replication, including two trophoblast-cell lines. Importantly, regular nuclear-rim formation of the core NEC was blocked by inhibition of cyclin-dependent kinase (CDK) activity. In relation to the recently published crystal structure of the HCMV core NEC, our findings result in a refined view of NEC assembly. In particular, we suggest that CDKs may play an important regulatory role in NEC formation during HCMV replication. PMID:27145986

  17. Novel IRF6 mutations in families with Van Der Woude syndrome and popliteal pterygium syndrome from sub-Saharan Africa.

    PubMed

    Butali, Azeez; Mossey, Peter A; Adeyemo, Wasiu L; Eshete, Mekonen A; Gaines, LauRen A; Even, Dee; Braimah, Ramat O; Aregbesola, Babatunde S; Rigdon, Jennifer V; Emeka, Christian I; James, Olutayo; Ogunlewe, Mobolanle O; Ladeinde, Akinola L; Abate, Fikre; Hailu, Taye; Mohammed, Ibrahim; Gravem, Paul E; Deribew, Milliard; Gesses, Mulualem; Adeyemo, Adebowale A; Murray, Jeffrey C

    2014-05-01

    Orofacial clefts (OFC) are complex genetic traits that are often classified as syndromic or nonsyndromic clefts. Currently, there are over 500 types of syndromic clefts in the Online Mendelian Inheritance in Man (OMIM) database, of which Van der Woude syndrome (VWS) is one of the most common (accounting for 2% of all OFC). Popliteal pterygium syndrome (PPS) is considered to be a more severe form of VWS. Mutations in the IRF6 gene have been reported worldwide to cause VWS and PPS. Here, we report studies of families with VWS and PPS in sub-Saharan Africa. We screened the DNA of eight families with VWS and one family with PPS from Nigeria and Ethiopia by Sanger sequencing of the most commonly affected exons in IRF6 (exons 3, 4, 7, and 9). For the VWS families, we found a novel nonsense variant in exon 4 (p.Lys66X), a novel splice-site variant in exon 4 (p.Pro126Pro), a novel missense variant in exon 4 (p.Phe230Leu), a previously reported splice-site variant in exon 7 that changes the acceptor splice site, and a known missense variant in exon 7 (p.Leu251Pro). A previously known missense variant was found in exon 4 (p.Arg84His) in the PPS family. All the mutations segregate in the families. Our data confirm the presence of IRF6-related VWS and PPS in sub-Saharan Africa and highlights the importance of screening for novel mutations in known genes when studying diverse global populations. This is important for counseling and prenatal diagnosis for high-risk families. PMID:24936515

  18. A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

    PubMed

    Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

    2012-08-01

    A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

  19. Determinants of the variability of aflatoxin-albumin adduct levels in Ghanaians.

    PubMed

    Dash, B; Afriyie-Gyawu, E; Huebner, H J; Porter, W; Wang, J S; Jolly, P E; Phillips, T D

    2007-01-01

    Hepatocellular carcinoma (HCC) is a multifactorial disease with various host and environmental factors involved in its etiology. Of these, aflatoxin exposure has been established as an important risk factor in the development of HCC; the presence of aflatoxin-albumin (AA) adducts in the blood serves as a valuable biomarker of human exposure. In this study, the relationship between a variety of different HCC host factors and the incidence of AA adduct levels was examined in a Ghanaian population at high risk for HCC. These factors included age, gender, hepatitis virus B (HVB) and hepatitis C virus (HCV) status, and genetic polymorphisms in both microsomal epoxide hydrolase (mEH) and glutathione S-transferases (GSTs). Blood samples were analyzed for AA adducts and HBV and HCV status. GSTM1 and GSTT1 deletion polymorphisms and mEH exon 3 and exon 4 single-nucleotide polymorphisms (SNPs) were determined from urine samples. In univariate analysis, age, HBV and HVC status, and GSTT1 and mEH exon 3 genotypes were not associated with AA adduct levels. However, mean adduct levels were significantly higher in both females and individuals typed heterozygous for mEH exon 4 (vs. wild types). Stratification analysis also showed that gender along with mEH exon 4 genotype and HBV status had a significant effect on adduct levels. Both females typed HBsAg+ and males with mEH exon 4 heterozygote genotypes showed significantly higher adduct levels as compared to the HBsAg- and wild types, respectively. Understanding the relationships between these host factors and the variability in aflatoxin-adduct levels may help in identifying susceptible populations in developing countries and for targeting specific public health interventions for the prevention of aflatoxicoses in populations with HCC and chronic liver diseases. PMID:17162498

  20. The spectrum of Notch3 mutations in 28 Italian CADASIL families

    PubMed Central

    Dotti, M; Federico, A; Mazzei, R; Bianchi, S; Scali, O; Conforti, F; Sprovieri, T; Guidetti, D; Aguglia, U; Consoli, D; Pantoni, L; Sarti, C; Inzitari, D; Quattrone, A

    2005-01-01

    Objective: To report Notch3 mutation analysis in 28 unrelated Italian CADASIL families from central and south Italy. Results: The highest rate of mutations was found in exon 11 (21%) and only 18% of mutations were in exon 4. This may be related to the peculiar distribution of Notch3 mutations in the regions of origin of the families. Conclusions: The results suggest that limited scanning of exons 3 and 4 is inadvisable in CADASIL cases of Italian origin. PMID:15834039

  1. Identification of a Novel C-Terminal Truncated WT1 Isoform with Antagonistic Effects against Major WT1 Isoforms

    PubMed Central

    Tatsumi, Naoya; Hojo, Nozomi; Sakamoto, Hiroyuki; Inaba, Rena; Moriguchi, Nahoko; Matsuno, Keiko; Fukuda, Mari; Matsumura, Akihide; Hayashi, Seiji; Morimoto, Soyoko; Nakata, Jun; Fujiki, Fumihiro; Nishida, Sumiyuki; Nakajima, Hiroko; Tsuboi, Akihiro; Oka, Yoshihiro; Hosen, Naoki; Sugiyama, Haruo; Oji, Yusuke

    2015-01-01

    The Wilms’ tumor gene WT1 consists of 10 exons and encodes a zinc finger transcription factor. There are four major WT1 isoforms resulting from alternative splicing at two sites, exon 5 (17AA) and exon 9 (KTS). All major WT1 isoforms are overexpressed in leukemia and solid tumors and play oncogenic roles such as inhibition of apoptosis, and promotion of cell proliferation, migration and invasion. In the present study, a novel alternatively spliced WT1 isoform that had an extended exon 4 (designated as exon 4a) with an additional 153 bp (designated as 4a sequence) at the 3’ end was identified and designated as an Ex4a(+)WT1 isoform. The insertion of exon 4a resulted in the introduction of premature translational stop codons in the reading frame in exon 4a and production of C-terminal truncated WT1 proteins lacking zinc finger DNA-binding domain. Overexpression of the truncated Ex4a(+)WT1 isoform inhibited the major WT1-mediated transcriptional activation of anti-apoptotic Bcl-xL gene promoter and induced mitochondrial damage and apoptosis. Conversely, suppression of the Ex4a(+)WT1 isoform by Ex4a-specific siRNA attenuated apoptosis. These results indicated that the Ex4a(+)WT1 isoform exerted dominant negative effects on anti-apoptotic function of major WT1 isoforms. Ex4a(+)WT1 isoform was endogenously expressed as a minor isoform in myeloid leukemia and solid tumor cells and increased regardless of decrease in major WT1 isoforms during apoptosis, suggesting the dominant negative effects on anti-apoptotic function of major WT1 isoforms. These results indicated that Ex4a(+)WT1 isoform had an important physiological function that regulated oncogenic function of major WT1 isoforms. PMID:26090994

  2. Functional Characterization of the spf/ash Splicing Variation in OTC Deficiency of Mice and Man

    PubMed Central

    Viecelli, Hiu Man; Rüfenacht, Veronique; Pérez, Belén; Ugarte, Magdalena; Häberle, Johannes; Thöny, Beat; Desviat, Lourdes Ruiz

    2015-01-01

    The spf/ash mouse model of ornithine transcarbamylase (OTC) deficiency, a severe urea cycle disorder, is caused by a mutation (c.386G>A; p.R129H) in the last nucleotide of exon 4 of the Otc gene, affecting the 5’ splice site and resulting in partial use of a cryptic splice site 48 bp into the adjacent intron. The equivalent nucleotide change and predicted amino acid change is found in OTC deficient patients. Here we have used liver tissue and minigene assays to dissect the transcriptional profile resulting from the “spf/ash” mutation in mice and man. For the mutant mouse, we confirmed liver transcripts corresponding to partial intron 4 retention by the use of the c.386+48 cryptic site and to normally spliced transcripts, with exon 4 always containing the c.386G>A (p.R129H) variant. In contrast, the OTC patient exhibited exon 4 skipping or c.386G>A (p.R129H)-variant exon 4 retention by using the natural or a cryptic splice site at nucleotide position c.386+4. The corresponding OTC tissue enzyme activities were between 3-6% of normal control in mouse and human liver. The use of the cryptic splice sites was reproduced in minigenes carrying murine or human mutant sequences. Some normally spliced transcripts could be detected in minigenes in both cases. Antisense oligonucleotides designed to block the murine cryptic +48 site were used in minigenes in an attempt to redirect splicing to the natural site. The results highlight the relevance of in depth investigations of the molecular mechanisms of splicing mutations and potential therapeutic approaches. Notably, they emphasize the fact that findings in animal models may not be applicable for human patients due to the different genomic context of the mutations. PMID:25853564

  3. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-08-05

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection.

  4. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  5. A First-in-Human Study To Assess the Safety and Pharmacokinetics of Monoclonal Antibodies against Human Cytomegalovirus in Healthy Volunteers.

    PubMed

    Dole, Kiran; Segal, Florencia Pereyra; Feire, Adam; Magnusson, Baldur; Rondon, Juan C; Vemula, Janardhana; Yu, Jing; Pang, Yinuo; Pertel, Peter

    2016-05-01

    Human cytomegalovirus (HCMV) can cause significant disease in immunocompromised patients and treatment options are limited by toxicities. CSJ148 is a combination of two anti-HCMV human monoclonal antibodies (LJP538 and LJP539) that bind to and inhibit the function of viral HCMV glycoprotein B (gB) and the pentameric complex, consisting of glycoproteins gH, gL, UL128, UL130, and UL131. Here, we evaluated the safety, tolerability, and pharmacokinetics of a single intravenous dose of LJP538 or LJP539 or their combination in healthy volunteers. Adverse events and laboratory abnormalities occurred sporadically with similar incidence between antibody and placebo groups and without any apparent relationship to dose. No subject who received antibody developed a hypersensitivity, infusion-related reaction or anti-drug antibodies. After intravenous administration, both LJP538 and LJP539 demonstrated typical human IgG1 pharmacokinetic properties, with slow clearances, limited volumes of distribution, and long terminal half-lives. The pharmacokinetic parameters were linear and dose proportional for both antibodies across the 50-fold range of doses evaluated in the study. There was no apparent impact on pharmacokinetics when the antibodies were administered alone or in combination. CSJ148 and the individual monoclonal antibodies were safe and well tolerated, with pharmacokinetics as expected for human immunoglobulin.

  6. Infections of neonatal and adult mice with murine CMV HaNa1 strain upon oronasal inoculation: New insights in the pathogenesis of natural primary CMV infections.

    PubMed

    Xiang, Jun; Zhang, Shunchuan; Nauwynck, Hans

    2016-01-01

    In healthy individuals, naturally acquired infections of human cytomegalovirus (HCMV) are generally asymptomatic. Animal models mimicking the natural primary HCMV infections in infants and adults are scarce. Here, neonatal and adult BALB/c mice were inoculated oronasally with a Belgian isolate HaNa1 of murine cytomegalovirus (MCMV). None of the mice showed clinical symptoms. In neonatal mice, a typical systemic infection occurred. In adult mice, viral replication was restricted to the nasal mucosa and submandibular glands. Infectious virus was not detected in trachea, oral mucosa, pharynx, esophagus, small intestines of both neonatal and adult mice at all time points. Nose was demonstrated to be the entry site. Double immunofluorescence staining showed that in nose infected cells were olfactory neurons and sustentacular cells in olfactory epithelium and were macrophages and dendritic cells in nasopharynx-associated lymphoid tissues (NALT). Neonatal and adult mice developed similar antibody response pattern, though former magnitude was lower. In summary, we have established intranasal (without anesthesia) infections of neonatal and adult mice with murine CMV HaNa1 strain, which mimic the range and extent of virus replication during natural primary HCMV infections in healthy infants and adults. These findings might bring new insights in the pathogenesis of natural primary CMV infections. PMID:26474525

  7. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    PubMed

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  8. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6.

    PubMed

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  9. Cleavage maps for human cytomegalovirus DNA strain AD169 for restriction endonucleases EcoRI, BglII, and HindIII.

    PubMed Central

    Spector, D H; Hock, L; Tamashiro, J C

    1982-01-01

    We have used cloned EcoRI fragments of the human CMV (HCMV) genome, strain AD169, to prepare restriction endonuclease maps of the DNA. Individual 32P-labeled cloned fragments were hybridized to Southern blots of HCMV DNA cleaved to completion with the restriction endonucleases BglII and HindIII and cleaved partially with EcoRI. By determining which EcoRI fragments hybridized to the same band on a Southern blot, we were able to establish linkage groups. This information coupled with the data derived from digestion of the cloned fragments with the enzymes BglII and HindIII (Tamashiro et al., J. Virol. 42:547-557, 1982) provided the basis for the construction of detailed maps for the enzymes EcoRI, BglII, and HindIII. We also identified the EcoRI fragments derived from the termini of this genome and mapped them with respect to the BglII and HindIII terminal fragments. From our mapping data, we conclude that the genome of HCMV is approximately 240 kilobases in length and is divided into long (198 kilobases) and short (42 kilobases) regions. Both regions consist of a unique sequence bounded by inverted repeats (11 to 12 kilobases for the long region and 2 to 3 kilobases for the short region). Furthermore, the long and short regions can invert relative to each other. Images PMID:6283173

  10. Contribution of the Major ND10 Proteins PML, hDaxx and Sp100 to the Regulation of Human Cytomegalovirus Latency and Lytic Replication in the Monocytic Cell Line THP-1

    PubMed Central

    Wagenknecht, Nadine; Reuter, Nina; Scherer, Myriam; Reichel, Anna; Müller, Regina; Stamminger, Thomas

    2015-01-01

    Promyelocytic leukemia nuclear bodies, also termed nuclear domain 10 (ND10), have emerged as nuclear protein accumulations mediating an intrinsic cellular defense against viral infections via chromatin-based mechanisms, however, their contribution to the control of herpesviral latency is still controversial. In this study, we utilized the monocytic cell line THP-1 as an in vitro latency model for human cytomegalovirus infection (HCMV). Characterization of THP-1 cells by immunofluorescence and Western blot analysis confirmed the expression of all major ND10 components. THP-1 cells with a stable, individual knockdown of PML, hDaxx or Sp100 were generated. Importantly, depletion of the major ND10 proteins did not prevent the terminal cellular differentiation of THP-1 monocytes. After construction of a recombinant, endotheliotropic human cytomegalovirus expressing IE2-EYFP, we investigated whether the depletion of ND10 proteins affects the onset of viral IE gene expression. While after infection of differentiated, THP-1-derived macrophages as well as during differentiation-induced reactivation from latency an increase in the number of IE-expressing cells was readily detectable in the absence of the major ND10 proteins, no effect was observed in non-differentiated monocytes. We conclude that PML, hDaxx and Sp100 primarily act as cellular restriction factors during lytic HCMV replication and during the dynamic process of reactivation but do not serve as key determinants for the establishment of HCMV latency. PMID:26057166

  11. Stimulation of B lymphocytes by cmvIL-10 but not LAcmvIL-10

    SciTech Connect

    Spencer, Juliet V. Cadaoas, Jaclyn; Castillo, Patricia R.; Saini, Vandana; Slobedman, Barry

    2008-04-25

    Human cytomegalovirus (HCMV) is a widespread pathogen that establishes lifelong latent infection facilitated by numerous mechanisms for modulating the host immune system. The UL111A region of the HCMV genome encodes a homolog of human cellular IL-10 (hIL-10). The viral cytokine, cmvIL-10, exhibits many of the immunosuppressive properties of hIL-10. However, hIL-10 is also known to have stimulatory effects on B lymphocytes. We found that cmvIL-10 has the ability to enhance B cell proliferation, despite having only 27% sequence identity to hIL-10. Treatment with cmvIL-10 stimulated autocrine production of hIL-10 by B lymphocytes and led to activation of the latent transcription factor Stat3. In contrast, LAcmvIL-10, a truncated protein resulting from an alternatively spliced transcript in latently infected cells, did not stimulate B cell proliferation, Stat3 activation, or hIL-10 production. These results provide insights into the biological activity of the full-length and latency-associated viral cytokines and suggest different roles for each in HCMV infection.

  12. Generation of a Gaussia luciferase-expressing endotheliotropic cytomegalovirus for screening approaches and mutant analyses.

    PubMed

    Falk, Jessica J; Laib Sampaio, Kerstin; Stegmann, Cora; Lieber, Diana; Kropff, Barbara; Mach, Michael; Sinzger, Christian

    2016-09-01

    For many questions in human cytomegalovirus (HCMV) research, assays are desired that allow robust and fast quantification of infection efficiencies under high-throughput conditions. The secreted Gaussia luciferase has been demonstrated as a suitable reporter in the context of a fibroblast-adapted HCMV strain, which however is greatly restricted in the number of cell types to which it can be applied. We inserted the Gaussia luciferase expression cassette into the BAC-cloned virus strain TB40-BAC4, which displays the natural broad cell tropism of HCMV and hence allows application to screening approaches in a variety of cell types including fibroblasts, epithelial, and endothelial cells. Here, we applied the reporter virus TB40-BAC4-IE-GLuc to identify mouse hybridoma clones that preferentially neutralize infection of endothelial cells. In addition, as the Gaussia luciferase is secreted into culture supernatants from infected cells it allows kinetic analyses in living cultures. This can speed up and facilitate phenotypic characterization of BAC-cloned mutants. For example, we analyzed a UL74 stop-mutant of TB40-BAC4-IE-GLuc immediately after reconstitution in transfected cultures and found the increase of luciferase delayed and reduced as compared to wild type. Phenotypic monitoring directly in transfected cultures can minimize the risk of compensating mutations that might occur with extended passaging. PMID:27326666

  13. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  14. Role of the human cytomegalovirus major immediate-early promoter's 19-base-pair-repeat cyclic AMP-response element in acutely infected cells.

    PubMed

    Keller, M J; Wheeler, D G; Cooper, E; Meier, J L

    2003-06-01

    Prior studies have suggested a role of the five copies of the 19-bp-repeat cyclic AMP (cAMP)-response element (CRE) in major immediate-early (MIE) promoter activation, the rate-limiting step in human cytomegalovirus (HCMV) replication. We used two different HCMV genome modification strategies to test this hypothesis in acutely infected cells. We report the following: (i) the CREs do not govern basal levels of MIE promoter activity at a high or low multiplicity of infection (MOI) in human foreskin fibroblast (HFF)- or NTera2-derived neuronal cells; (ii) serum and virion components markedly increase MIE promoter-dependent transcription at a low multiplicity of infection (MOI), but this increase is not mediated by the CREs; (iii) forskolin stimulation of the cAMP signaling pathway induces a two- to threefold increase in MIE RNA levels in a CRE-specific manner at a low MOI in both HFF- and NTera2-derived neuronal cells; and (iv) the CREs do not regulate basal levels of HCMV DNA replication at a high or low MOI in HFF. Their presence does impart a forskolin-induced increase in viral DNA replication at a low MOI but only when basal levels of MIE promoter activity are experimentally diminished. In conclusion, the 19-bp-repeat CREs add to the robust MIE promoter activity that occurs in the acutely infected stimulated cells, although the CREs' greater role may be in other settings.

  15. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70

    PubMed Central

    Zhang, Liang; Guo, Gangqiang; Sun, Xiangwei; Chen, Jing; Ye, Lulu; Ye, Sisi; Mao, Chenchen; Xu, Jianfeng; Zhang, Lifang; Jiang, Lubin; Shen, Xian; Xue, Xiangyang

    2016-01-01

    It has been hypothesized that human cytomegalovirus (HCMV) could act as a tumor promoter and play an “oncomodulatory” role in the neoplastic process of several human malignancies. However, we demonstrate for the first time that UL138, a HCMV latency-associated gene, could act as a tumor inhibitor in gastric cancer (GC). The expression of UL138 is down-regulated in HCMV positive gastric adenocarcinoma tissues, especially in poorly or none differentiated tumors. Overexpression of UL138 in several human GC cell lines inhibits cell viability and induces apoptosis, in association with the reduction of an anti-apoptotic Bcl-2 protein and the induction of cleaved caspase-3 and caspase-9. Moreover, protein array analysis reveals that UL138 interacts with a chaperone protein, heat shock protein 70 (HSP70). This interaction is confirmed by immunoprecipitation and immunostaining in situ in GC cell lines. In addition, this UL138-mediated cancer cell death could efficiently lead to suppression of human tumor growth in a xenograft animal model of GC. In conclusion, these results uncover a previously unknown role of the cytomegalovirus protein UL138 in inducing GC cells apoptosis, which might imply a general mechanism that viral proteins inhibit cancer growth in interactions with both chaperones and apoptosis-related proteins. Our findings might provide a potential target for new therapeutic strategies of GC treatment. PMID:26735338

  16. Coordinated expansion of both memory T cells and NK cells in response to CMV infection in humans.

    PubMed

    Bayard, Charles; Lepetitcorps, Hélène; Roux, Antoine; Larsen, Martin; Fastenackels, Solène; Salle, Virginie; Vieillard, Vincent; Marchant, Arnaud; Stern, Marc; Boddaert, Jacques; Bajolle, Fanny; Appay, Victor; Sauce, Delphine

    2016-05-01

    NK cells are key players in the fight against persistent viruses. Human cytomegalovirus (HCMV) infection is associated with the presence of a population of CD16(+) CD56(dim) NKG2C(+) NK cells in both acutely and latently infected individuals. Here, we studied the nature of these terminally differentiated NK cells in different human populations infected with HCMV: healthy donors stratified by age, thymectomized individuals, pregnant women suffering from primary CMV infection, and lung transplant patients. Both CD16(+) CD56(dim) NK- and CD8 T-cell phenotypes as well as functional capacities were determined and stratified according to age and/or CMV event. Similarly to T-cell responsiveness, we observe an accumulation over time of NKG2C(+) NK cells, which preferentially expressed CD57. This accumulation is particularly prominent in elderly and amplified further by CMV infection. Latent HCMV infection (without replication) is sufficient for NKG2C(+) CD57(+) NK cells to persist in healthy individuals but is not necessarily required in old age. Collectively, the present work supports the emerging concept that CMV shapes both innate and adaptive immunity in humans.

  17. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus.

  18. Viperin Regulates Cellular Lipid Metabolism during Human Cytomegalovirus Infection

    PubMed Central

    Seo, Jun-Young; Cresswell, Peter

    2013-01-01

    Human cytomegalovirus (HCMV) has been shown to induce increased lipogenesis in infected cells, and this is believed to be required for proper virion envelopment. We show here that this increase is a consequence of the virus-induced redistribution of the host protein viperin to mitochondria and its capacity to interact with and block the function of the mitochondrial trifunctional protein (TFP), the enzyme that mediates fatty acid-β-oxidation. The resulting decrease in cellular ATP levels activates the enzyme AMP-activated protein kinase (AMPK), which induces expression of the glucose transporter GLUT4, resulting in increased glucose import and translocation to the nucleus of the glucose-regulated transcription factor ChREBP. This induces increased transcription of genes encoding lipogenic enzymes, increased lipid synthesis and lipid droplet accumulation, and generation of the viral envelope. Viperin-dependent lipogenesis is required for optimal production of infectious virus. We show that all of these metabolic outcomes can be replicated by direct targeting of viperin to mitochondria in the absence of HCMV infection, and that the motif responsible for Fe-S cluster binding by viperin is essential. The data indicate that viperin is the major effector underlying the ability of HCMV to regulate cellular lipid metabolism. PMID:23935494

  19. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  20. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins.

    PubMed

    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R; Brune, Wolfram; Geballe, Adam P; Beau, Isabelle; Esclatine, Audrey

    2016-01-01

    Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus. PMID:26654401

  1. Accurate identification of paraprotein antigen targets by epitope reconstruction

    PubMed Central

    Sompuram, Seshi R.; Bastas, Gerassimos; Vani, Kodela

    2008-01-01

    We describe the first successful clinical application of a new discovery technology, epitope-mediated antigen prediction (E-MAP), to the investigation of multiple myeloma. Until now, there has been no reliable, systematic method to identify the cognate antigens of paraproteins. E-MAP is a variation of previous efforts to reconstruct the epitopes of paraproteins, with the significant difference that it provides enough epitope sequence data so as to enable successful protein database searches. We first reconstruct the paraprotein's epitope by analyzing the peptides that strongly bind. Then, we compile the data and interrogate the nonredundant protein database, searching for a close match. As a clinical proof-of-concept, we apply this technology to uncovering the protein targets of para-proteins in multiple myeloma (MM). E-MAP analysis of 2 MM paraproteins identified human cytomegalovirus (HCMV) as a target in both. E-MAP sequence analysis determined that one para-protein binds to the AD-2S1 epitope of HCMV glycoprotein B. The other binds to the amino terminus of the HCMV UL-48 gene product. We confirmed these predictions using immunoassays and immunoblot analyses. E-MAP represents a new investigative tool for analyzing the role of chronic antigenic stimulation in B-lymphoproliferative disorders. PMID:17878398

  2. NAB2-STAT6 Gene Fusion in Meningeal Hemangiopericytoma and Solitary Fibrous Tumor.

    PubMed

    Fritchie, Karen J; Jin, Long; Rubin, Brian P; Burger, Peter C; Jenkins, Sarah M; Barthelmeß, Sarah; Moskalev, Evgeny A; Haller, Florian; Oliveira, Andre M; Giannini, Caterina

    2016-03-01

    Meningeal solitary fibrous tumor (SFT) and hemangiopericytoma (HPC) are considered to be distinct entities in the WHO Classification of CNS Tumours (2007). They harbor NAB2-STAT6 fusions similar to their soft tissue counterparts, supporting the view that they are part of a tumor continuum. We examined 30 meningeal-based tumors originally diagnosed as either SFT or HPC. These showed a spectrum of morphologic features and were diagnosed as SFTs, malignant SFTs, HPCs, or tumors with "intermediate" features. All of the tumors showed nuclear expression of STAT6. SFTs consistently expressed diffuse CD34, while HPCs and intermediate tumors had heterogeneous staining. NAB2-STAT6 fusions were identified in 20 cases, including 7 with exon 4-exon 3, 9 with exon 6-exon 17, and 4 with exon 6-exon 18 fusions. NAB2 exon 4-STAT6 exon 3 fusion correlated with classic SFT morphology and older age and showed a trend toward less mitotic activity; there was also a trend toward more aggressive behavior in tumors lacking NAB2 exon 4-STAT6 exon 3. Thus, despite their clinical and morphologic differences, meningeal-based SFTs, HPCs, and tumors with intermediate features, similar to their soft tissue counterparts, form a histopathologic spectrum unified by STAT6 immunoexpression and NAB2-STAT6 fusion.

  3. NAB2-STAT6 Gene Fusion in Meningeal Hemangiopericytoma and Solitary Fibrous Tumor.

    PubMed

    Fritchie, Karen J; Jin, Long; Rubin, Brian P; Burger, Peter C; Jenkins, Sarah M; Barthelmeß, Sarah; Moskalev, Evgeny A; Haller, Florian; Oliveira, Andre M; Giannini, Caterina

    2016-03-01

    Meningeal solitary fibrous tumor (SFT) and hemangiopericytoma (HPC) are considered to be distinct entities in the WHO Classification of CNS Tumours (2007). They harbor NAB2-STAT6 fusions similar to their soft tissue counterparts, supporting the view that they are part of a tumor continuum. We examined 30 meningeal-based tumors originally diagnosed as either SFT or HPC. These showed a spectrum of morphologic features and were diagnosed as SFTs, malignant SFTs, HPCs, or tumors with "intermediate" features. All of the tumors showed nuclear expression of STAT6. SFTs consistently expressed diffuse CD34, while HPCs and intermediate tumors had heterogeneous staining. NAB2-STAT6 fusions were identified in 20 cases, including 7 with exon 4-exon 3, 9 with exon 6-exon 17, and 4 with exon 6-exon 18 fusions. NAB2 exon 4-STAT6 exon 3 fusion correlated with classic SFT morphology and older age and showed a trend toward less mitotic activity; there was also a trend toward more aggressive behavior in tumors lacking NAB2 exon 4-STAT6 exon 3. Thus, despite their clinical and morphologic differences, meningeal-based SFTs, HPCs, and tumors with intermediate features, similar to their soft tissue counterparts, form a histopathologic spectrum unified by STAT6 immunoexpression and NAB2-STAT6 fusion. PMID:26883114

  4. Detection of TMPRSS2-ERG translocations in human prostate cancer by expression profiling using GeneChip Human Exon 1.0 ST arrays.

    PubMed

    Jhavar, Sameer; Reid, Alison; Clark, Jeremy; Kote-Jarai, Zsofia; Christmas, Timothy; Thompson, Alan; Woodhouse, Christopher; Ogden, Christopher; Fisher, Cyril; Corbishley, Cathy; De-Bono, Johann; Eeles, Rosalind; Brewer, Daniel; Cooper, Colin

    2008-01-01

    Translocation of TMPRSS2 to the ERG gene, found in a high proportion of human prostate cancer, results in overexpression of the 3'-ERG sequences joined to the 5'-TMPRSS2 promoter. The studies presented here were designed to test the ability of expression analysis on GeneChip Human Exon 1.0 ST arrays to detect 5'-TMPRSS2-ERG-3' hybrid transcripts encoded by this translocation. Monitoring the relative expression of each ERG exon revealed altered transcription of the ERG gene in 15 of a series of 27 prostate cancer samples. In all cases, exons 4 to 11 exhibited enhanced expression compared with exons 2 and 3. This pattern of expression indicated that the most abundant hybrid transcripts involve fusions to ERG exon 4, and RT-PCR analyses confirmed the joining of TMPRSS2 exon 1 to ERG exon 4 in all 15 cases. The exon expression patterns also indicated that TMPRSS2-ERG fusion transcripts commonly contain deletion of ERG exon 8. Analysis of gene-level data from the arrays allowed the identification of genes whose expression levels significantly correlated with the presence of the translocation. These studies demonstrate that expression analyses using exon arrays represent a valuable approach for detecting ETS gene translocation in prostate cancer, in parallel with analyses of gene expression profiles.

  5. Studies on the Contribution of Human Cytomegalovirus UL21a and UL97 to Viral Growth and Inactivation of the Anaphase-Promoting Complex/Cyclosome (APC/C) E3 Ubiquitin Ligase Reveal a Unique Cellular Mechanism for Downmodulation of the APC/C Subunits APC1, APC4, and APC5

    PubMed Central

    Clark, Elizabeth

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) deregulates the cell cycle by several means, including inactivation of the anaphase-promoting complex/cyclosome (APC/C) E3 ubiquitin ligase. Viral proteins UL97 and UL21a, respectively, affect the APC/C by phosphorylation of APC/C coactivator Cdh1 and by inducing the degradation of subunits APC4 and APC5, which along with APC1 form the APC/C platform subcomplex. The aim of this study was to further characterize the mechanism of APC/C inactivation and define the relative contributions of UL21a and UL97 to APC/C substrate accumulation and to viral growth. We show that in uninfected cells, UL21a but not UL97 can disrupt APC/C function, leading to the accumulation of substrates. We find that UL21a is necessary and sufficient to induce the degradation of APC1, in addition to the previously reported APC4 and APC5. We also demonstrate that there is a previously unreported cellular mechanism for a specific decrease in the levels of all three platform subunits, APC1, APC4, and APC5, upon the depletion of any one of these subunits or of subunit APC8. Finally, we show that at a low multiplicity of infection, either UL97 or UL21a can partially complement a growth-defective mutant virus lacking both UL21a and UL97, with significantly greater benefit afforded by the expression of both proteins. This double mutant also can be partially rescued by inactivation of the APC/C using small interfering RNAs against specific subunits. These results further our understanding of HCMV's interaction with the cell cycle machinery and reveal a new cellular pattern of APC/C subunit downmodulation. IMPORTANCE HCMV lytic infection subverts the host cell cycle machinery in multiple ways. A major effect is inactivation of the APC/C, which plays a central role in the control of cell cycle progression. This study provides further insight into the mechanism of inactivation. We discovered that the APC1 subunit, which along with APC4 and APC5 form the platform

  6. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus.

    PubMed

    Coleman, Stewart; Hornig, Julia; Maddux, Sarah; Choi, K Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  7. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus

    PubMed Central

    Maddux, Sarah; Choi, K. Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  8. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions

    PubMed Central

    Vanarsdall, Adam L.; Howard, Paul W.; Wisner, Todd W.; Johnson, David C.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16–50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB. PMID:27082872

  9. A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

    USGS Publications Warehouse

    Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

    1997-01-01

    The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

  10. Genetic Stability of Bacterial Artificial Chromosome-Derived Human Cytomegalovirus during Culture In Vitro

    PubMed Central

    Murrell, Isa; Wilkie, Gavin S.; Davison, Andrew J.; Statkute, Evelina; Fielding, Ceri A.; Tomasec, Peter; Wilkinson, Gavin W. G.

    2016-01-01

    ABSTRACT Clinical human cytomegalovirus (HCMV) strains invariably mutate when propagated in vitro. Mutations in gene RL13 are selected in all cell types, whereas in fibroblasts mutants in the UL128 locus (UL128L; genes UL128, UL130, and UL131A) are also selected. In addition, sporadic mutations are selected elsewhere in the genome in all cell types. We sought to investigate conditions under which HCMV can be propagated without incurring genetic defects. Bacterial artificial chromosomes (BACs) provide a stable, genetically defined source of viral genome. Viruses were generated from BACs containing the genomes of strains TR, TB40, FIX, and Merlin, as well as from Merlin-BAC recombinants containing variant nucleotides in UL128L from TB40-BAC4 or FIX-BAC. Propagation of viruses derived from TR-BAC, TB40-BAC4, and FIX-BAC in either fibroblast or epithelial cells was associated with the generation of defects around the prokaryotic vector, which is retained in the unique short (US) region of viruses. This was not observed for Merlin-BAC, from which the vector is excised in derived viruses; however, propagation in epithelial cells was consistently associated with mutations in the unique long b′ (UL/b′) region, all impacting on gene UL141. Viruses derived from Merlin-BAC in fibroblasts had mutations in UL128L, but mutations occurred less frequently with recombinants containing UL128L nucleotides from TB40-BAC4 or FIX-BAC. Viruses derived from a Merlin-BAC derivative in which RL13 and UL128L were either mutated or repressed were remarkably stable in fibroblasts. Thus, HCMV containing a wild-type gene complement can be generated in vitro by deriving virus from a self-excising BAC in fibroblasts and repressing RL13 and UL128L. IMPORTANCE Researchers should aim to study viruses that accurately represent the causative agents of disease. This is problematic for HCMV because clinical strains mutate rapidly when propagated in vitro, becoming less cell associated, altered in

  11. A Human Cytomegalovirus gO-Null Mutant Fails To Incorporate gH/gL into the Virion Envelope and Is Unable To Enter Fibroblasts and Epithelial and Endothelial Cells▿

    PubMed Central

    Wille, Paul T.; Knoche, Amber J.; Nelson, Jay A.; Jarvis, Michael A.; Johnson, David C.

    2010-01-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRΔgO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRΔgO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRΔgO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRΔgO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRΔgO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of gH/gL complexes into the HCMV

  12. A human cytomegalovirus gO-null mutant fails to incorporate gH/gL into the virion envelope and is unable to enter fibroblasts and epithelial and endothelial cells.

    PubMed

    Wille, Paul T; Knoche, Amber J; Nelson, Jay A; Jarvis, Michael A; Johnson, David C

    2010-03-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRDeltagO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRDeltagO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRDeltagO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRDeltagO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRDeltagO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of g

  13. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie

    2014-01-01

    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  14. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.

    PubMed

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities.

  15. Interactions between Proteins Encoded within the Human Cytomegalovirus UL133-UL138 Locus

    PubMed Central

    Petrucelli, Alex; Umashankar, Mahadevaiah; Zagallo, Patricia; Rak, Michael

    2012-01-01

    We previously described a novel genetic locus within the ULb′ region of the human cytomegalovirus (HCMV) genome that, while dispensable for replication in fibroblasts, suppresses replication in hematopoietic progenitors and augments replication in endothelial cells. This locus, referred to as the UL133-UL138 locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. In this work, we have mapped the interactions among these proteins. An analysis of all pairwise interactions during transient expression revealed a robust interaction between pUL133 and pUL138. Potential interactions between pUL136 and both pUL133 and pUL138 were also revealed. In addition, each of the UL133-UL138 locus proteins self-associated, suggesting a potential to form higher-order homomeric complexes. As both pUL133 and pUL138 function in promoting viral latency in CD34+ hematopoietic progenitor cells (HPCs) infected in vitro, we further focused on this interaction. pUL133 and pUL138 are the predominant complex detected when all proteins are expressed together and require no other proteins in the locus for their association. During infection, the interaction between pUL133 and pUL138 or pUL136 can be detected. A recombinant virus that fails to express both pUL133 and pUL138 exhibited a latency phenotype similar to that of viruses that fail to express either pUL133 or pUL138, indicating that these proteins function cooperatively in latency and do not have independent functions that additively contribute to HCMV latency. These studies identify protein interactions among proteins encoded by the UL133-UL138 locus and demonstrate an important interaction impacting the outcome of HCMV infection. PMID:22674978

  16. CMV-Specific CD8 T Cell Differentiation and Localization: Implications for Adoptive Therapies

    PubMed Central

    Smith, Corinne J.; Quinn, Michael; Snyder, Christopher M.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that causes chronic infection and, thus, is one of the most common infectious complications of immune suppression. Adoptive transfer of HCMV-specific T cells has emerged as an effective method to reduce the risk for HCMV infection and/or reactivation by restoring immunity in transplant recipients. However, the CMV-specific CD8+ T cell response is comprised of a heterogenous mixture of subsets with distinct functions and localization, and it is not clear if current adoptive immunotherapy protocols can reconstitute the full spectrum of CD8+ T cell immunity. The aim of this review is to briefly summarize the role of these T cell subsets in CMV immunity and to describe how current adoptive immunotherapy practices might affect their reconstitution in patients. The bulk of the CMV-specific CD8+ T cell population is made up of terminally differentiated effector T cells with immediate effector function and a short life span. Self-renewing memory T cells within the CMV-specific population retain the capacity to expand and differentiate upon challenge and are important for the long-term persistence of the CD8+ T cell response. Finally, mucosal organs, which are frequent sites of CMV reactivation, are primarily inhabited by tissue-resident memory T cells, which do not recirculate. Future work on adoptive transfer strategies may need to focus on striking a balance between the formation of these subsets to ensure the development of long lasting and protective immune responses that can access the organs affected by CMV disease. PMID:27695453

  17. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins

    PubMed Central

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  18. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.

    PubMed

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  19. Mechanism of tumor remission by cytomegalovirus in a murine lymphoma model: evidence for involvement of virally induced cellular interleukin-15.

    PubMed

    Erlach, Katja C; Reddehase, Matthias J; Podlech, Jürgen

    2015-06-01

    A murine model of B and T cell lymphomas in recipients after hematoablative conditioning for hematopoietic cell transplantation (HCT) has previously revealed a tumor-repressive, metastasis-inhibiting function of murine cytomegalovirus (mCMV). More recently, this prediction from the experimental model was put on trial in several clinical studies that indeed gave evidence for a lower incidence of tumor relapse associated with early reactivation of latent human cytomegalovirus (hCMV) after allogeneic HCT in patients treated against different types of hematopoietic malignancies, including lymphoma and acute as well as chronic leukemias. Due to the limitations inherent to clinical studies, the tumor-repressive role of hCMV remained observational with no approach to clarify mechanisms. Although the tumor-repressive mechanisms of mCMV and hCMV may differ and depend on the type of tumor, experimental approaches in the murine model might give valuable hints for concepts to follow in clinical research. We have previously shown for the liver-adapted A20-derived B cell lymphoma E12E that mCMV does not infect the lymphoma cells for causing cell death by viral cytopathogenicity but triggers tumor-selective apoptosis at a tissue site of tumor metastasis distant from a local site of infection. This finding suggested involvement of a cytokine that triggers apoptosis, directly or indirectly. Here we used a series of differential high-density microarray analyses to identify cellular genes whose expression is specifically upregulated at the site of virus entry only by viruses capable of triggering lymphoma cell apoptosis. This strategy identified interleukin-15 (IL-15) as most promising candidate, eventually confirmed by lymphoma repression with recombinant IL-15. PMID:25805565

  20. The protease and the assembly protein of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8).

    PubMed Central

    Unal, A; Pray, T R; Lagunoff, M; Pennington, M W; Ganem, D; Craik, C S

    1997-01-01

    A genomic clone encoding the protease (Pr) and the assembly protein (AP) of Kaposi's sarcoma-associated herpesvirus (KSHV) (also called human herpesvirus 8) has been isolated and sequenced. As with other herpesviruses, the Pr and AP coding regions are present within a single long open reading frame. The mature KSHV Pr and AP polypeptides are predicted to contain 230 and 283 residues, respectively. The amino acid sequence of KSHV Pr has 56% identity with that of herpesvirus salmiri, the most similar virus by phylogenetic comparison. Pr is expressed in infected human cells as a late viral gene product, as suggested by RNA analysis of KSHV-infected BCBL-1 cells. Expression of the Pr domain in Escherichia coli yields an enzymatically active species, as determined by cleavage of synthetic peptide substrates, while an active-site mutant of this same domain yields minimal proteolytic activity. Sequence comparisons with human cytomegalovirus (HCMV) Pr permitted the identification of the catalytic residues, Ser114, His46, and His134, based on the known structure of the HCMV enzyme. The amino acid sequences of the release site of KSHV Pr (Tyr-Leu-Lys-Ala*Ser-Leu-Ile-Pro) and the maturation site (Arg-Leu-Glu-Ala*Ser-Ser-Arg-Ser) show that the extended substrate binding pocket differs from that of other members of the family. The conservation of amino acids known to be involved in the dimer interface region of HCMV Pr suggests that KSHV Pr assembles in a similar fashion. These features of the viral protease provide opportunities to develop specific inhibitors of its enzymatic activity. PMID:9261433

  1. Structure of Human Cytomegalovirus UL141 Binding to TRAIL-R2 Reveals Novel, Non-canonical Death Receptor Interactions

    PubMed Central

    Nemčovičová, Ivana; Benedict, Chris A.; Zajonc, Dirk M.

    2013-01-01

    The TRAIL (TNF-related apoptosis inducing ligand) death receptors (DRs) of the tumor necrosis factor receptor superfamily (TNFRSF) can promote apoptosis and regulate antiviral immunity by maintaining immune homeostasis during infection. In turn, human cytomegalovirus (HCMV) expresses immunomodulatory proteins that down-regulate cell surface expression of TNFRSF members as well as poliovirus receptor-related proteins in an effort to inhibit host immune effector pathways that would lead to viral clearance. The UL141 glycoprotein of human cytomegalovirus inhibits host defenses by blocking cell surface expression of TRAIL DRs (by retention in ER) and poliovirus receptor CD155, a nectin-like Ig-fold molecule. Here we show that the immunomodulatory function of HCMV UL141 is associated with its ability to bind diverse proteins, while utilizing at least two distinct binding sites to selectively engage TRAIL DRs or CD155. Binding studies revealed high affinity interaction of UL141 with both TRAIL-R2 and CD155 and low affinity binding to TRAIL-R1. We determined the crystal structure of UL141 bound to TRAIL-R2 at 2.1 Å resolution, which revealed that UL141 forms a homodimer that engages two TRAIL-R2 monomers 90° apart to form a heterotetrameric complex. Our structural and biochemical data reveal that UL141 utilizes its Ig-domain to facilitate non-canonical death receptor interactions while UL141 partially mimics the binding site of TRAIL on TRAIL-R2, which we found to be distinct from that of CD155. Moreover, UL141 also binds to an additional surface patch on TRAIL-R2 that is distinct from the TRAIL binding site. Therefore, the breadth of UL141-mediated effects indicates that HCMV has evolved sophisticated strategies to evade the immune system by modulating multiple effector pathways. PMID:23555243

  2. Phosphorylation of Golgi Peripheral Membrane Protein Grasp65 Is an Integral Step in the Formation of the Human Cytomegalovirus Cytoplasmic Assembly Compartment

    PubMed Central

    Rebmann, G. Michael; Grabski, Robert; Sanchez, Veronica

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the largest member of the Herpesviridae and represents a significant cause of disease. During virus replication, HCMV alters cellular functions to facilitate its replication, including significant reorganization of the secretory and endocytic pathways of the infected cell. A defining morphologic change of the infected cell is the formation of a membranous structure in the cytoplasm that is designated the virion assembly compartment (AC), which consists of virion structural proteins surrounded by cellular membranes. The loss of normal Golgi compartment morphology and its relocalization from a juxtanuclear ribbonlike structure to a series of concentric rings on the periphery of the AC represents a readily recognized reorganization of cellular membranes in the HCMV-infected cell. Although trafficking of viral proteins to this compartment is required for the assembly of infectious virions, the functional significance of the reorganization of intracellular membranes like the Golgi membranes into the AC in the assembly of infectious virus remains understudied. In this study, we determined that Golgi membrane ribbon fragmentation increased during the early cytoplasmic phase of virion assembly and that Golgi membrane fragmentation in infected cells was dependent on the phosphorylation of an integral cis-Golgi protein, Grasp65. Inhibition of Golgi membrane fragmentation and of its reorganization into the AC resulted in decreased production of infectious particles and alteration of the incorporation of an essential protein into the envelope of the mature virion. These results demonstrated the complexity of the virus-host cell interactions required for efficient assembly of this large DNA virus. PMID:27703074

  3. A Role for Nuclear F-Actin Induction in Human Cytomegalovirus Nuclear Egress

    PubMed Central

    Wilkie, Adrian R.; Lawler, Jessica L.

    2016-01-01

    ABSTRACT Herpesviruses, which include important pathogens, remodel the host cell nucleus to facilitate infection. This remodeling includes the formation of structures called replication compartments (RCs) in which herpesviruses replicate their DNA. During infection with the betaherpesvirus, human cytomegalovirus (HCMV), viral DNA synthesis occurs at the periphery of RCs within the nuclear interior, after which assembled capsids must reach the inner nuclear membrane (INM) for translocation to the cytoplasm (nuclear egress). The processes that facilitate movement of HCMV capsids to the INM during nuclear egress are unknown. Although an actin-based mechanism of alphaherpesvirus capsid trafficking to the INM has been proposed, it is controversial. Here, using a fluorescently-tagged, nucleus-localized actin-binding peptide, we show that HCMV, but not herpes simplex virus 1, strongly induced nuclear actin filaments (F-actin) in human fibroblasts. Based on studies using UV inactivation and inhibitors, this induction depended on viral gene expression. Interestingly, by 24 h postinfection, nuclear F-actin formed thicker structures that appeared by super-resolution microscopy to be bundles of filaments. Later in infection, nuclear F-actin primarily localized along the RC periphery and between the RC periphery and the nuclear rim. Importantly, a drug that depolymerized nuclear F-actin caused defects in production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization near the nuclear rim, without decreasing capsid accumulation in the nucleus. Thus, our results suggest that for at least one herpesvirus, nuclear F-actin promotes capsid movement to the nuclear periphery and nuclear egress. We discuss our results in terms of competing models for these processes. PMID:27555312

  4. Reevaluation of the Coding Potential and Proteomic Analysis of the BAC Derived Rhesus Cytomegalovirus Strain 68-1

    SciTech Connect

    Malouli, Daniel; Nakayasu, Ernesto S.; Viswanathan, Kasinath; Camp, David G.; Chang, W. L.; Barry, Peter A.; Smith, Richard D.; Fruh, Klaus

    2012-09-01

    Cytomegaloviruses are highly host restricted resulting in co-speciation with their hosts. As a natural pathogen of rhesus macaques (RM), Rhesus Cytomegalovirus (RhCMV) has therefore emerged as a highly relevant experimental model for pathogenesis and vaccine development due to its close evolutionary relationship to human CMV (HCMV). To date, most in vivo experiments performed with RhCMV employed strain 68-1 cloned as bacterial artificial chromosome (BAC). However, the complete genome sequence of the 68-1 BAC has not been determined. Furthermore, the gene content of the RhCMV genome is unknown and previous open reading frame (ORF) predictions relied solely on uninterrupted ORFs with an arbitrary cutoff of 300bp. To obtain a more precise picture of the actual proteins encoded by the most commonly used molecular clone of RhCMV we re-evaluated the RhCMV 68-1 BAC-genome by whole genome shotgun sequencing and determined the protein content of the resulting RhCMV virions by proteomics. By additionally comparing the RhCMV genome to that of several closely related Old World Monkey (OWM) CMVs we were able to filter out many unlikely ORFs and obtain a simplified map of the RhCMV genome. This comparative genomics analysis eliminated many genes previously characterized as RhCMV-specific while consolidating a high conservation of ORFs among OWM-CMVs and between RhCMV and HCMV. Moreover, virion proteomics independently validated the revised ORF predictions since only proteins encoded by predicted ORFs could be detected. Taken together these data suggest a much higher conservation of genome and virion structure between CMVs of humans, apes and OWMs than previously assumed. Remarkably, BAC-derived RhCMV is able to establish and maintain persistent infection despite the lack of multiple genes homologous to HCMV genes involved in tissue tropism.

  5. Construction of a genomic library of the human cytomegalovirus genome and analysis of late transcription of its inverted internal repeat region

    SciTech Connect

    Silva, K.F.S.T.

    1989-01-01

    The investigations described in this dissertation were designed to determine the transcriptionally active DNA sequences of IIR region and to identify the viral mRNA transcribed from the transcriptionally most active DNA sequences of that region during late phase of HCMV Towne infection. Preliminary transcriptional studies which included the hybridization of a southern blot of XbaI digested entire HCMV genome to {sup 32}P-labelled late phase infected cell A{sup +} RNA, indicated that late viral transcripts homologous to XbaI Q fragment of IIR region were very highly abundant while XbaI Q fragment showed a very low transcriptional activity. To facilitate further analysis of late transcription of IIR region, the entire DNA sequences of IIR region were molecularly cloned as U, S, and H BamHI fragments in pACYC-184 plasmid vector. In addition, to be used in future studies on other regions of the genome, except for y and c{prime} smaller fragments the entire 240 kb HCMV genome was cloned as BamHI fragments in the same vector. Furthermore, the U, S, and H BamHI fragments were mapped with six other restriction enzymes in order to use that mapping data in subsequent transcriptional analysis of the IIR region. Further localization of transcriptionally active DNA sequences within IIR region was achieved by hybridization of southern blots of restricted U, S, and H BamHI fragments with 3{prime} {sup 32}P-labelled infected cell late A{sup +} RNA. The 1.5 kb EcooRI subfragments of S BamHI fragment and the adjoining 0.72 kb XhoI subfragment of H BamHI fragment revealed the highest level of transcription, although the remainder of the S fragment was also transcribed at a substantial level. The U fragment and the remainder of the H fragment was transcribed at a very low level.

  6. Resistance of human cytomegalovirus to cyclopropavir maps to a base pair deletion in the open reading frame of UL97.

    PubMed

    Gentry, Brian G; Vollmer, Laura E; Hall, Ellie D; Borysko, Katherine Z; Zemlicka, Jiri; Kamil, Jeremy P; Drach, John C

    2013-09-01

    Human cytomegalovirus (HCMV) is a widespread pathogen in the human population, affecting many immunologically immature and immunocompromised patients, and can result in severe complications, such as interstitial pneumonia and mental retardation. Current chemotherapies for the treatment of HCMV infections include ganciclovir (GCV), foscarnet, and cidofovir. However, the high incidences of adverse effects (neutropenia and nephrotoxicity) limit the use of these drugs. Cyclopropavir (CPV), a guanosine nucleoside analog, is 10-fold more active against HCMV than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively). We hypothesize that the mechanism of action of CPV is similar to that of GCV: phosphorylation to a monophosphate by viral pUL97 protein kinase with further phosphorylation to a triphosphate by endogenous kinases, resulting in inhibition of viral DNA synthesis. To test this hypothesis, we isolated a CPV-resistant virus, sequenced its genome, and discovered that bp 498 of UL97 was deleted. This mutation caused a frameshift in UL97 resulting in a truncated protein that lacks a kinase domain. To determine if this base pair deletion was responsible for drug resistance, the mutation was engineered into the wild-type viral genome, which was then exposed to increasing concentrations of CPV. The results demonstrate that the engineered virus was approximately 72-fold more resistant to CPV (EC50 = 25.8 ± 3.1 μM) than the wild-type virus (EC50 = 0.36 ± 0.11 μM). We conclude, therefore, that this mutation is sufficient for drug resistance and that pUL97 is involved in the mechanism of action of CPV.

  7. Human cytomegalovirus neutralizing antibody-resistant phenotype is associated with reduced expression of glycoprotein H.

    PubMed Central

    Li, L; Coelingh, K L; Britt, W J

    1995-01-01

    We have characterized a neutralizing antibody-resistant mutant human cytomegalovirus (HCMV) obtained from a patient treated with a human monoclonal antiglycoprotein H (gH; unique long region 75) antibody. This virus exhibited resistance to several different neutralizing anti-gH murine monoclonal antibodies (MAbs), as well as to a polyvalent anti-gH serum. The resistant phenotype was unstable and could be maintained only by passage of plaque-purified virus under neutralizing MAb selection. In the absence of a MAb, the resistant phenotype reverted to a neutralizing antibody-sensitive phenotype within one passage. The predicted amino acid sequences of gH from the MAb-resistant and -susceptible parent viruses were identical. Biochemical analysis of the MAb-resistant and -susceptible parent viruses revealed a marked decrease of gH expression in the envelope of the MAb-resistant virus. Furthermore, propagation of the virus in various MAb concentrations resulted in the production of extracellular virions with various levels of resistance to the neutralizing activity of the MAb. These results suggest a mechanism for the generation of neutralizing antibody-resistant viruses which could evade host-derived antiviral antibody responses. In addition, our findings indicate that the stoichiometry of gH in the envelope of infectious HCMV virions is not rigidly fixed and therefore offer a simple explanation for production of phenotypic variants of HCMV through an assembly process in which the content of gH in the envelope of progeny virions varies randomly. PMID:7666509

  8. Enhanced neutrophil activity is associated with shorter time to tumor progression in glioblastoma patients

    PubMed Central

    Rahbar, Afsar; Cederarv, Madeleine; Wolmer-Solberg, Nina; Tammik, Charlotte; Stragliotto, Giuseppe; Peredo, Inti; Fornara, Olesja; Xu, Xinling; Dzabic, Mensur; Taher, Chato; Skarman, Petra; Söderberg-Nauclér, Cecilia

    2016-01-01

    ABSTRACT Glioblastoma multiforme (GBM) is a highly malignant tumor with a poor outcome that is often positive for human cytomegalovirus (HCMV). GBM patients often have excessive numbers of neutrophils and macrophages near and within the tumor. Here, we characterized the cytokine patterns in the blood of GBM patients with and without Valganciclovir treatment. Furthermore, we determined whether neutrophil activation is related to HCMV status and patient outcome. Blood samples for analyses of cytokines and growth factors were collected from 42 GBM patients at the time of diagnosis (n = 42) and at weeks 12 and 24 after surgery. Blood neutrophils of 28 GBM patients were examined for CD11b expression. The levels of pro- and anti-inflammatory cytokines and chemokines—including interleukin (IL)-1β, IL-2, IL-6, IL-8, IL-10, IL-12p70, IL-17A, transforming growth factor (TGF)-β1, interferon-γ, interferon-α, tumor necrosis factor α, and monocyte chemoattractant protein (MCP)-1were analyzed with a bead-based flow cytometry assay. During the first six months after surgery, neutrophil activity was increased in 12 patients and was unchanged or decreased in 16. Patients with increased neutrophil activity had enhanced IL-12p70, high grade HCMV and a shorter time to tumor progression (TTP) than patients without or decreased neutrophil activity (median TTP; 5.4 vs. 12 months, 95% confidence interval; 1.6–10 vs. 0.1–0.6, hazard ratio = 3 vs. 0.4, p = 0.004). The levels of IL-12p70 were significantly decreased in Valganciclovir treated patients (n = 22, T 12W vs. T 24W, p = 0.03). In conclusion, our findings suggest that neutrophil activation is an early sign of tumor progression in GBM patients. PMID:27057448

  9. CMV-Specific CD8 T Cell Differentiation and Localization: Implications for Adoptive Therapies

    PubMed Central

    Smith, Corinne J.; Quinn, Michael; Snyder, Christopher M.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that causes chronic infection and, thus, is one of the most common infectious complications of immune suppression. Adoptive transfer of HCMV-specific T cells has emerged as an effective method to reduce the risk for HCMV infection and/or reactivation by restoring immunity in transplant recipients. However, the CMV-specific CD8+ T cell response is comprised of a heterogenous mixture of subsets with distinct functions and localization, and it is not clear if current adoptive immunotherapy protocols can reconstitute the full spectrum of CD8+ T cell immunity. The aim of this review is to briefly summarize the role of these T cell subsets in CMV immunity and to describe how current adoptive immunotherapy practices might affect their reconstitution in patients. The bulk of the CMV-specific CD8+ T cell population is made up of terminally differentiated effector T cells with immediate effector function and a short life span. Self-renewing memory T cells within the CMV-specific population retain the capacity to expand and differentiate upon challenge and are important for the long-term persistence of the CD8+ T cell response. Finally, mucosal organs, which are frequent sites of CMV reactivation, are primarily inhabited by tissue-resident memory T cells, which do not recirculate. Future work on adoptive transfer strategies may need to focus on striking a balance between the formation of these subsets to ensure the development of long lasting and protective immune responses that can access the organs affected by CMV disease.

  10. The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in africans with the Rh D-negative blood group phenotype.

    PubMed

    Singleton, B K; Green, C A; Avent, N D; Martin, P G; Smart, E; Daka, A; Narter-Olaga, E G; Hawthorne, L M; Daniels, G

    2000-01-01

    Antigens of the Rh blood group system are encoded by 2 homologous genes, RHD and RHCE, that produce 2 red cell membrane proteins. The D-negative phenotype is considered to result, almost invariably, from homozygosity for a complete deletion of RHD. The basis of all PCR tests for predicting fetal D phenotype from DNA obtained from amniocytes or maternal plasma is detection of the presence of RHD. These tests are used in order to ascertain the risk of hemolytic disease of the newborn. We have identified an RHD pseudogene (RHD psi) in Rh D-negative Africans. RHDpsi contains a 37 base pair (bp) insert in exon 4, which may introduce a stop codon at position 210. The insert is a sequence duplication across the boundary of intron 3 and exon 4. RHDpsi contains another stop codon in exon 6. The frequency of RHDpsi in black South Africans is approximately 0.0714. Of 82 D-negative black Africans, 66% had RHDpsi, 15% had the RHD-CE-D hybrid gene associated with the VS+ V- phenotype, and only 18% completely lacked RHD. RHDpsi is present in about 24% of D-negative African Americans and 17% of D-negative South Africans of mixed race. No RHD transcript could be detected in D-negative individuals with RHDpsi, probably as a result of nonsense-mediated mRNA decay. Existing PCR-based methods for predicting D phenotype from DNA are not suitable for testing Africans or any population containing a substantial proportion of people with African ethnicity. Consequently, we have developed a new test that detects the 37 bp insert in exon 4 of RHDpsi. (Blood. 2000; 95:12-18)

  11. Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing

    SciTech Connect

    Akeson, A.L.; Wiginton, D.A.; States, C.J.; Perme, C.M.; Dusing, M.R.; Hutton, J.J.

    1987-08-01

    Adenosine deaminase deficiency is one cause of the genetic disease severe combined immunodeficiency. To identify mutations responsible for ADA deficiency, the authors synthesized cDNAs to ADA mRNAs from two cell lines, GM2756 and GM2825A, derived from ADA-deficient immunodeficient patients. Sequence analysis of GM2756 cDNA clones revealed a different point mutation in each allele that causes amino acid changes of alanine to valine and arginine to histidine. One allele of GM2825A also has a point mutation that causes an alanine to valine substitution. The other allele of GM2825A was found to produce an mRNA in which exon 4 had been spliced out but had no other detrimental mutations. S1 nuclease mapping of GM2825A mRNA showed equal abundance of the full-length ADA mRNA and the ADA mRNA that was missing exon 4. Several of the ADA cDNA clones extended 5' of the major initiation start site, indicating multiple start sites for ADA transcription. The point mutations in GM2756 and GM2825A and the absence of exon 4 in GM2825A appear to be directly responsible for the ADA deficiency. Comparison of a number of normal and mutant ADA cDNA sequences showed a number of changes in the third base of codons. These change do not affect the amino acid sequence. Analyses of ADA cDNAs from different cell lines detected aberrant RNA species that either included intron 7 or excluded exon 7. Their presence is a result of aberrant splicing of pre-mRNAs and is not related to mutations that cause ADA deficiency.

  12. Diagnosis of children’s attention deficit hyperactivity disorder (ADHD) and its association with cytomegalovirus infection with ADHD: a historical review

    PubMed Central

    Zhou, Rui; Xia, Qun; Shen, Huaiyun; Yang, Xiaoyun; Zhang, Yongli; Xu, Jiali

    2015-01-01

    As the most common mental disorder identified in children and teenagers, attention deficit hyperactivity disorder (ADHD) affects millions of children and their families, making it a critical health issue worldwide. This article reviewed the historical opinions about the diagnosis of ADHD and defined different subtypes of this disorder. It also summarized the current diagnostic criteria and available medications. After re-visiting the etiology of ADHD in the sense of both genetic and environment factors, it was further hypothesized that viral infection might be involved in ADHD pathogenesis. Human cytomegalovirus (HCMV) infection may be associated with ADHD, although both clinical observations and animal studies need to be performed for validation. PMID:26550354

  13. Sinugyrosanolide A, an unprecedented C-4 norcembranoid, from the Formosan soft coral Sinularia gyrosa.

    PubMed

    Cheng, Shi-Yie; Shih, Neng-Lang; Chuang, Cheng-Ta; Chiou, Shu-Fen; Yang, Chia-Ning; Wang, Shang-Kwei; Duh, Chang-Yih

    2014-03-15

    Chemical investigations on the acetone extract of the Formosan soft coral Sinularia gyrosa have obtained a novel C-4 norcembranoid possessing an unprecedented tricyclo[9.3.0.0(3,8)]tetradecane skeleton, namely sinugyrosanolide A. The NMR spectroscopic data of the novel norcembranoid were completely assigned by using a combination of 2D NMR experiments including (1)H-(1)H COSY, HSQC, HMBC, and NOESY. The cytotoxicities, anti-HCMV (human cytomegalovirus) endonuclease activities and antibacterial activities were evaluated in vitro. It showed moderate cytotoxicity against P-388 (mouse lymphocytic leukemia) cancer cell line with an EC50 of 11.8μM. PMID:24529868

  14. Latent infection of myeloid progenitors by human cytomegalovirus protects cells from FAS-mediated apoptosis through the cellular IL-10/PEA-15 pathway

    PubMed Central

    Lau, Jonathan C. H.; Sinclair, John

    2015-01-01

    Latent infection of primary CD34+ progenitor cells by human cytomegalovirus (HCMV) results in their increased survival in the face of pro-apoptotic signals. For instance, we have shown previously that primary myeloid cells are refractory to FAS-mediated killing and that cellular IL-10 (cIL-10) is an important survival factor for this effect. However, how cIL-10 mediates this protection is unclear. Here, we have shown that cIL-10 signalling leading to upregulation of the cellular factor PEA-15 mediates latency-associated protection of CD34+ progenitor cells from the extrinsic death pathway. PMID:25957098

  15. Extensive germinal mosaicism in a family with X linked myotubular myopathy simulates genetic heterogeneity.

    PubMed Central

    Vincent, M C; Guiraud-Chaumeil, C; Laporte, J; Manouvrier-Hanu, S; Mandel, J L

    1998-01-01

    A family with two male cousins affected with myotubular myopathy (MTM) was referred to us for genetic counselling. Linkage analysis appeared to exclude the Xq28 region. As a gene for X linked MTM was recently identified in Xq28, we screened the obligatory carrier mothers for mutation. We found a 4 bp deletion in exon 4 of the MTM1 gene, which originated from the grandfather of the affected children and which was transmitted to three daughters. This illustrates the importance of mutation detection to avoid pitfalls in linkage analysis that may be caused by such cases of germinal mosaicism. Images PMID:9541111

  16. An ARMS-based technique for sex determination of red panda (Ailurus fulgens).

    PubMed

    Li, Yuzhi; Xu, Xiao; Zhang, Liang; Zhang, Zhihe; Shen, Fujun; Zhang, Wenping; Yue, Bisong

    2011-03-01

    Molecular sexing is a key component in the investigation of wild populations. In this study, we developed a fast, accurate and reliable amplification refractory mutation system (ARMS) technique for sex determination of red panda based on the exon 4 of the ZFX/ZFY gene. The amplicons were distinguished simply by agarose gel electrophoresis, exhibiting one fragment in females (X: 300 bp) and two in males (X: 300 bp, Y: 166 bp). Robustness of this ARMS system was confirmed by testing both 43 captive red pandas using DNA samples with known-sex and 10 wild red pandas using faecal DNA samples with unknown sex.

  17. Unusual case presentations associated with the CD45 C77G polymorphism.

    PubMed

    Tchilian, E Z; Gil, J; Navarro, M L; Fernandez-Cruz, E; Chapel, H; Misbah, S; Ferry, B; Renz, H; Schwinzer, R; Beverley, P C L

    2006-12-01

    CD45, the leucocyte common antigen, is a haematopoietic cell specific tyrosine phosphatase. Human polymorphic CD45 variants are associated with autoimmune and infectious diseases and alter the phenotype and function of lymphocytes, establishing CD45 as an important regulator of immune function. Here we report four patients with diverse diseases with unusual clinical features. All four have the C77G polymorphism of CD45 exon 4, which alters the splicing and CD45RA/CD45R0 phenotype of lymphocytes. We suggest that C77G may be a contributing factor in these unusual cases. PMID:17100764

  18. Application of denaturing gradient gel electrophoresis to detect DNA sequence differences encoding apolipoprotein E isoforms

    SciTech Connect

    Parker, S.; Angelico, M.C.; Laffel, L.; Krolewski, A.S. Harvard Medical School, Boston, MA )

    1993-04-01

    Apolipoprotein E (apoE) plays an important role in plasma lipid metabolism. Three common isoforms of this protein have been identified by the isoelectric focusing method. In this report the authors describe a new method for distinguishing these isoforms. Their method employs PCR amplification of the DNA sequence of exon 4 in the apoE gene followed by denaturing gradient gel electrophoresis (DGGE) to distinguish its different melting characteristics. Identification of the ApoE isoforms through DNA melting behavior rather than protein charge differences eliminates the problems associated with isoelectric focusing and facilitates screening for additional mutations at the apoE locus. 12 refs., 2 figs.

  19. Mutations of the p53 gene in human functional adrenal neoplasms

    SciTech Connect

    Shiu-Ru Lin; Yau-Jiunn Lee; Juei-Hsiung Tsai

    1994-02-01

    To clarify gene alterations in functional human adrenal tumors, the authors performed molecular analysis for p53 abnormalities in 23 cases with adrenal neoplasms. The immunohistochemical study with anti-p53 monoclonal antibody pAb1801 demonstrated that 10 of 23 (43.5%) cases overexpressed p53 protein in the tumor cells. Using a polymerase chain reaction-single strand conformation polymorphism study, 5 of 6 (83.3%) pheochromocytoma tissues (1 malignant and 5 benign) and 11 of 15 (73.3%) adrenocortical adenomas (2 with Cushing`s syndrome and 13 with primary aldosteronism, all benign) showed an apparent electrophoretic mobility shift between the tumor and its paired adjacent normal adrenal tissue. Such differences were detected in exon 4 (12 cases), exon 5 (2 cases), and exon 7 (3 cases). The types of these mutations in exon 4 were a substitution from threonine (ACC) to isoleucine (ATC) at codon 102 in 5 cases, from glutamine (CAG) to histidine (CAC) at codon 104 in 1 case, from glycine (GGG) to alanine (CGG) at codon 117 in 1 case, from glutamate (GAG) to glutamine (CAG) at codon 68 in 1 case, and single base changes resulting in a premature stop codon at codon 100 in 2 cases. A 2-basepair deletion at codon 175 in exon 5 resulting in a frame shift was identified in 1 case. A single point mutation was identified, resulting in the substitution of glutamine (CAG) for arginine (CGG) at codon 248 of exon 7 in 1 case. A single basepair deletion at codon 249 resulted in a frame shift in 2 cases. There was 1 case with malignant pheochromocytoma that combined a single point mutation in exon 4 and a single base deletion in exon 7. Only 2 of 23 cases showed a loss of a normal allele encoding in the p53 gene. Northern blot analysis with 1.8-kilobase p53 cDNA revealed that p53 mRNA was overexpressed in 6 cases. The results indicate that high frequencies of p53 gene mutation, especially in exon 4, exist in functional adrenal tumors. 39 refs., 6 figs., 4 tabs.

  20. Unusual case presentations associated with the CD45 C77G polymorphism

    PubMed Central

    Tchilian, E Z; Gil, J; Navarro, M L; Fernandez-Cruz, E; Chapel, H; Misbah, S; Ferry, B; Renz, H; Schwinzer, R; Beverley, P C L

    2006-01-01

    CD45, the leucocyte common antigen, is a haematopoietic cell specific tyrosine phosphatase. Human polymorphic CD45 variants are associated with autoimmune and infectious diseases and alter the phenotype and function of lymphocytes, establishing CD45 as an important regulator of immune function. Here we report four patients with diverse diseases with unusual clinical features. All four have the C77G polymorphism of CD45 exon 4, which alters the splicing and CD45RA/CD45R0 phenotype of lymphocytes. We suggest that C77G may be a contributing factor in these unusual cases. PMID:17100764

  1. Fibrodysplasia ossificans progressiva: three Indian patients with mutation in the ACVR1 gene.

    PubMed

    Shukla, Anju; Taywade, Onjal; Stephen, Joshi; Gupta, Divya; Phadke, Shubha R

    2014-06-01

    Fibrodysplasia ossificans progressiva (FOP) is a rare genetic disorder characterized by ectopic bone formation involving the connective tissues leading to severe skeletal manifestations. The genetic defect in this disorder has not been characterized in Indian patients till date. The authors report three cases of FOP along with the molecular defects identified in them. Exon 4 of the ACVR1 gene was amplified and analysed by sequencing. All three cases revealed common heterozygous mutation i.e., c.617(G>A). Identification of this mutation would lead to decrease in misdiagnosis and subsequent iatrogenic harm caused to these children by unnecessary surgical procedures. Also, mutation detection would provide an opportunity for prenatal diagnosis.

  2. t(9;11)(p22;p15) with NUP98-LEDGF fusion gene in pediatric acute myeloid leukemia.

    PubMed

    Morerio, Cristina; Acquila, Maura; Rosanda, Cristina; Rapella, Annamaria; Tassano, Elisa; Micalizzi, Concetta; Panarello, Claudio

    2005-04-01

    The rare t(9;11)(p22;p15) translocation is associated with adult acute myeloid leukemia (AML) with immature forms. We report a novel fusion of the NUP98 and LEDGF genes in a pediatric AML with intermediate characteristics between M2-M3 French-American-British (FAB) subtypes exhibiting the same chromosomal rearrangement. Fluorescence in situ hybridization (FISH) and reverse transcriptase-PCR (RT-PCR) studies identified the chimeric transcript product of in-frame fusion of NUP98 exon 8 to LEDGF exon 4.

  3. Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35

    SciTech Connect

    Salsman, Jayme; Wang Xueqi; Frappier, Lori

    2011-06-05

    The human cytomegalovirus (HCMV) UL35 gene encodes two proteins, UL35 and UL35a. Expression of UL35 in transfected cells results in the formation of UL35 nuclear bodies that associate with promyelocytic leukemia (PML) protein. PML forms the basis for PML nuclear bodies that are important for suppressing viral lytic gene expression. Given the important relationship between PML and viral infection, we have further investigated the association of UL35 with PML bodies. We demonstrate that UL35 bodies form independently of PML and subsequently recruit PML, Sp100 and Daxx. In contrast, UL35a did not form bodies; however, it could bind UL35 and inhibit the formation of UL35 bodies. The HCMV tegument protein pp71 promoted the formation of UL35 bodies and the cytoplasmic localization of UL35a. Similarly, UL35a shifted pp71 to the cytoplasm. These results indicate that the interplay between UL35, UL35a and pp71 affects their subcellular localization and likely their functions throughout infection.

  4. New efficient artemisinin derived agents against human leukemia cells, human cytomegalovirus and Plasmodium falciparum: 2nd generation 1,2,4-trioxane-ferrocene hybrids.

    PubMed

    Reiter, Christoph; Fröhlich, Tony; Zeino, Maen; Marschall, Manfred; Bahsi, Hanife; Leidenberger, Maria; Friedrich, Oliver; Kappes, Barbara; Hampel, Frank; Efferth, Thomas; Tsogoeva, Svetlana B

    2015-06-01

    In our ongoing search for highly active hybrid molecules exceeding their parent compounds in anticancer, antimalaria as well as antiviral activity and being an alternative to the standard drugs, we present the synthesis and biological investigations of 2nd generation 1,2,4-trioxane-ferrocene hybrids. In vitro tests against the CCRF-CEM leukemia cell line revealed di-1,2,4-trioxane-ferrocene hybrid 7 as the most active compound (IC50 of 0.01 μM). Regarding the activity against the multidrug resistant subline CEM/ADR5000, 1,2,4-trioxane-ferrocene hybrid 5 showed a remarkable activity (IC50 of 0.53 μM). Contrary to the antimalaria activity of hybrids 4-8 against Plasmodium falciparum 3D7 strain with slightly higher IC50 values (between 7.2 and 30.2 nM) than that of their parent compound DHA, hybrids 5-7 possessed very promising activity (IC50 values lower than 0.5 μM) against human cytomegalovirus (HCMV). The application of 1,2,4-trioxane-ferrocene hybrids against HCMV is unprecedented and demonstrated here for the first time.

  5. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts.

    PubMed

    Williamson, Chad D; Wong, Daniel S; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M

    2015-09-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondrial network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients.

  6. Hsp90 inhibitor 17-DMAG decreases expression of conserved herpesvirus protein kinases and reduces virus production in Epstein-Barr virus-infected cells.

    PubMed

    Sun, Xiaoping; Bristol, Jillian A; Iwahori, Satoko; Hagemeier, Stacy R; Meng, Qiao; Barlow, Elizabeth A; Fingeroth, Joyce D; Tarakanova, Vera L; Kalejta, Robert F; Kenney, Shannon C

    2013-09-01

    All eight human herpesviruses have a conserved herpesvirus protein kinase (CHPK) that is important for the lytic phase of the viral life cycle. In this study, we show that heat shock protein 90 (Hsp90) interacts directly with each of the eight CHPKs, and we demonstrate that an Hsp90 inhibitor drug, 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG), decreases expression of all eight CHPKs in transfected HeLa cells. 17-DMAG also decreases expression the of the endogenous Epstein-Barr virus protein kinase (EBV PK, encoded by the BGLF4 gene) in lytically infected EBV-positive cells and inhibits phosphorylation of several different known EBV PK target proteins. Furthermore, 17-DMAG treatment abrogates expression of the human cytomegalovirus (HCMV) kinase UL97 in HCMV-infected human fibroblasts. Importantly, 17-DMAG treatment decreased the EBV titer approximately 100-fold in lytically infected AGS-Akata cells without causing significant cellular toxicity during the same time frame. Increased EBV PK expression in 17-DMAG-treated AGS-Akata cells did not restore EBV titers, suggesting that 17-DMAG simultaneously targets multiple viral and/or cellular proteins required for efficient viral replication. These results suggest that Hsp90 inhibitors, including 17-DMAG, may be a promising group of drugs that could have profound antiviral effects on herpesviruses. PMID:23843639

  7. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  8. On the relative roles of background selection and genetic hitchhiking in shaping human cytomegalovirus genetic diversity.

    PubMed

    Renzette, Nicholas; Kowalik, Timothy F; Jensen, Jeffrey D

    2016-01-01

    A central focus of population genetics has been examining the contribution of selective and neutral processes in shaping patterns of intraspecies diversity. In terms of selection specifically, surveys of higher organisms have shown considerable variation in the relative contributions of background selection and genetic hitchhiking in shaping the distribution of polymorphisms, although these analyses have rarely been extended to bacteria and viruses. Here, we study the evolution of a ubiquitous, viral pathogen, human cytomegalovirus (HCMV), by analysing the relationship among intraspecies diversity, interspecies divergence and rates of recombination. We show that there is a strong correlation between diversity and divergence, consistent with expectations of neutral evolution. However, after correcting for divergence, there remains a significant correlation between intraspecies diversity and recombination rates, with additional analyses suggesting that this correlation is largely due to the effects of background selection. In addition, a small number of loci, centred on long noncoding RNAs, also show evidence of selective sweeps. These data suggest that HCMV evolution is dominated by neutral mechanisms as well as background selection, expanding our understanding of linked selection to a novel class of organisms. PMID:26211679

  9. Intracellular expression of engineered RNase P ribozymes effectively blocks gene expression and replication of human cytomegalovirus.

    PubMed

    Kim, Kihoon; Umamoto, Sean; Trang, Phong; Hai, Rong; Liu, Fenyong

    2004-03-01

    A ribozyme (M1GS RNA) constructed from the catalytic RNA subunit of RNase P from Escherichia coli was used to target the overlapping region of two human cytomegalovirus (HCMV) mRNAs, which encode for the viral essential protease (PR) and capsid assembly proteins (AP), respectively. The results show a reduction of >80% in the expression levels of PR and AP and an inhibition of approximately 2000-fold of viral growth in cells that stably expressed the ribozyme. In comparison, <10% reduction in the expression of the targets and viral growth was found in cells that either did not express the ribozyme or produced a "disabled" ribozyme carrying mutations that abolished its catalytic activity. Examination of replication of the virus in the ribozyme-expressing cells indicates that packaging of the viral genomic DNA into capsids is blocked, and suggests that the antiviral effects are because the ribozyme specifically inhibits the AP and PR expression and, consequently, abolishes viral capsid formation and growth. Our results show that RNase P ribozymes are highly effective in blocking HCMV growth by targeting the PR and AP mRNAs and demonstrate the feasibility to use these ribozymes in gene therapy for antiviral applications.

  10. Isolation of Endoplasmic Reticulum, Mitochondria, and Mitochondria-Associated Membrane and Detergent Resistant Membrane Fractions from Transfected Cells and from Human Cytomegalovirus-Infected Primary Fibroblasts

    PubMed Central

    Williamson, Chad D.; Wong, Daniel S.; Bozidis, Petros; Zhang, Aiping; Colberg-Poley, Anamaris M.

    2015-01-01

    Increasingly mechanistic virology studies require dependable and sensitive methods for isolating purified organelles containing functional cellular sub-domains. The mitochondrial network is, in part, closely apposed to the endoplasmic reticulum (ER). The mitochondria-associated membrane (MAM) fraction provides direct physical contact between the ER and mitochondria. Characterization of the dual localization and trafficking of human cytomegalovirus (HCMV) UL37 proteins required establishing protocols in which the ER and mitochondria could be reliably separated. Because of its documented role in lipid and ceramide transfer from the ER to mitochondria, a method to purify MAM from infected cells was also developed. Two robust procedures were developed to efficiently isolate mitochondria, ER, and MAM fractions while providing substantial protein yields from HCMV-infected primary fibroblasts and from transfected HeLa cells. Furthermore, this unit includes protocols for isolation of detergent resistant membranes from subcellular fractions as well as techniques that allow visualization of the mitochondria network disruption that occurs in permissively infected cells by their optimal resolution in Percoll gradients. PMID:26331984

  11. Structure of a herpesvirus nuclear egress complex subunit reveals an interaction groove that is essential for viral replication.

    PubMed

    Leigh, Kendra E; Sharma, Mayuri; Mansueto, My Sam; Boeszoermenyi, Andras; Filman, David J; Hogle, James M; Wagner, Gerhard; Coen, Donald M; Arthanari, Haribabu

    2015-07-21

    Herpesviruses require a nuclear egress complex (NEC) for efficient transit of nucleocapsids from the nucleus to the cytoplasm. The NEC orchestrates multiple steps during herpesvirus nuclear egress, including disruption of nuclear lamina and particle budding through the inner nuclear membrane. In the important human pathogen human cytomegalovirus (HCMV), this complex consists of nuclear membrane protein UL50, and nucleoplasmic protein UL53, which is recruited to the nuclear membrane through its interaction with UL50. Here, we present an NMR-determined solution-state structure of the murine CMV homolog of UL50 (M50; residues 1-168) with a strikingly intricate protein fold that is matched by no other known protein folds in its entirety. Using NMR methods, we mapped the interaction of M50 with a highly conserved UL53-derived peptide, corresponding to a segment that is required for heterodimerization. The UL53 peptide binding site mapped onto an M50 surface groove, which harbors a large cavity. Point mutations of UL50 residues corresponding to surface residues in the characterized M50 heterodimerization interface substantially decreased UL50-UL53 binding in vitro, eliminated UL50-UL53 colocalization, prevented disruption of nuclear lamina, and halted productive virus replication in HCMV-infected cells. Our results provide detailed structural information on a key protein-protein interaction involved in nuclear egress and suggest that NEC subunit interactions can be an attractive drug target.

  12. A cyclooxygenase-2 homologue encoded by rhesus cytomegalovirus is a determinant for endothelial cell tropism.

    PubMed

    Rue, Cary A; Jarvis, Michael A; Knoche, Amber J; Meyers, Heather L; DeFilippis, Victor R; Hansen, Scott G; Wagner, Markus; Früh, Klaus; Anders, David G; Wong, Scott W; Barry, Peter A; Nelson, Jay A

    2004-11-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  13. A Cyclooxygenase-2 Homologue Encoded by Rhesus Cytomegalovirus Is a Determinant for Endothelial Cell Tropism

    PubMed Central

    Rue, Cary A.; Jarvis, Michael A.; Knoche, Amber J.; Meyers, Heather L.; DeFilippis, Victor R.; Hansen, Scott G.; Wagner, Markus; Früh, Klaus; Anders, David G.; Wong, Scott W.; Barry, Peter A.; Nelson, Jay A.

    2004-01-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  14. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection.

  15. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus

    PubMed Central

    Sturgill, Elizabeth R.; Malouli, Daniel; Hansen, Scott G.; Burwitz, Benjamin J.; Schneider, Christine L.; Womack, Jennie L.; Verweij, Marieke C.; Ventura, Abigail B.; Bhusari, Amruta; Jeffries, Krystal M.; Legasse, Alfred W.; Axthelm, Michael K.; Hudson, Amy W.; Sacha, Jonah B.; Picker, Louis J.; Früh, Klaus

    2016-01-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  16. Structural changes in human cytomegalovirus cytoplasmic assembly sites in the absence of UL97 kinase activity

    SciTech Connect

    Azzeh, Maysa; Honigman, Alik; Taraboulos, Albert; Rouvinski, Alexander; Wolf, Dana G. . E-mail: wolfd@md.huji.ac.il

    2006-10-10

    Studies of human cytomegalovirus (HCMV) UL97 kinase deletion mutant ({delta}UL97) indicated a multi-step role for this kinase in early and late phases of the viral life cycle, namely, in DNA replication, capsid maturation and nuclear egress. Here, we addressed its possible involvement in cytoplasmic steps of HCMV assembly. Using the {delta}UL97 and the UL97 kinase inhibitor NGIC-I, we demonstrate that the absence of UL97 kinase activity results in a modified subcellular distribution of the viral structural protein assembly sites, from compact structures impacting upon the nucleus to diffuse perinuclear structures punctuated by large vacuoles. Infection by either wild type or {delta}UL97 viruses induced a profound reorganization of wheat germ agglutinin (WGA)-positive Golgi-related structures. Importantly, the viral-induced Golgi remodeling along with the reorganization of the nuclear architecture was substantially altered in the absence of UL97 kinase activity. These findings suggest that UL97 kinase activity might contribute to organization of the viral cytoplasmic assembly sites.

  17. Murine CMV-Induced Hearing Loss Is Associated with Inner Ear Inflammation and Loss of Spiral Ganglia Neurons

    PubMed Central

    Golemac, Mijo; Pugel, Ester Pernjak; Jonjic, Stipan; Britt, William J.

    2015-01-01

    Congenital human cytomegalovirus (HCMV) occurs in 0.5–1% of live births and approximately 10% of infected infants develop hearing loss. The mechanism(s) of hearing loss remain unknown. We developed a murine model of CMV induced hearing loss in which murine cytomegalovirus (MCMV) infection of newborn mice leads to hematogenous spread of virus to the inner ear, induction of inflammatory responses, and hearing loss. Characteristics of the hearing loss described in infants with congenital HCMV infection were observed including, delayed onset, progressive hearing loss, and unilateral hearing loss in this model and, these characteristics were viral inoculum dependent. Viral antigens were present in the inner ear as were CD3+ mononuclear cells in the spiral ganglion and stria vascularis. Spiral ganglion neuron density was decreased after infection, thus providing a mechanism for hearing loss. The lack of significant inner ear histopathology and persistence of inflammation in cochlea of mice with hearing loss raised the possibility that inflammation was a major component of the mechanism(s) of hearing loss in MCMV infected mice. PMID:25875183

  18. Malignant transformation of guinea pig cells after exposure to ultraviolet-irradiated guinea pig cytomegalovirus

    SciTech Connect

    Isom, H.C.; Mummaw, J.; Kreider, J.W.

    1983-04-30

    Guinea pig cells were malignantly transformed in vitro by ultraviolet (uv)-irradiated guinea pig cytomegalovirus (GPCMV). When guinea pig hepatocyte monolayers were infected with uv-irradiated GPCMV, three continuous epithelioid cell lines which grew in soft agarose were established. Two independently derived GPCMV-transformed liver cells and a cell line derived from a soft agarose clone of one of these lines induced invasive tumors when inoculated subcutaneously or intraperitoneally into nude mice. The tumors were sarcomas possibly derived from hepatic stroma or sinusoid. Transformed cell lines were also established after infection of guinea pig hepatocyte monolayers with human cytomegalovirus (HCMV) or simian virus 40 (SV40). These cell lines also formed colonies in soft agarose and induced sarcomas in nude mice. It is concluded that (i) GPCMV can malignantly transform guinea pig cells; (ii) cloning of GPCMV-transformed cells in soft agarose produced cells that induced tumors with a shorter latency period but with no alteration in growth rate or final tumor size; and (iii) the tumors produced by GPCMV-and HCMV-transformed guinea pig cells were more similar to each other in growth rate than to those induced by SV40-transformed guinea pig cells.

  19. Analytic Vaccinology: Antibody-Driven Design of a Human Cytomegalovirus Subunit Vaccine.

    PubMed

    Kabanova, Anna; Lilleri, Daniele

    2016-01-01

    Identification of the most relevant protective antigens has represented a considerable obstacle for the development of subunit vaccines against viral infections, including human cytomegalovirus (HCMV) infection. This chapter describes the method of analytic vaccinology, centered on the clonal analysis of human B cell response to HCMV, which represents an essential tool for assessing the impact of individual viral antigens in the antiviral antibody response. By providing key information on the immunogenicity and protective properties of the antibodies elicited by viral proteins, the analytic vaccinology method guides the selection of the most appropriate vaccine candidates. Here we discuss methodologies for the generation of human monoclonal antibodies from B cells of immune donors, antibody screening in in vitro assays of antigen binding and virus neutralization, and strategies of animal immunization useful for the preclinical evaluation of selected viral antigens. The approach of analytic vaccinology could be universally applied to the characterization of B-cell immune response against any virus of interest and ultimately used for vaccine development.

  20. Viral etiology of aseptic meningitis among children in southern Iran.

    PubMed

    Hosseininasab, Ali; Alborzi, Abdolvahab; Ziyaeyan, Mazyar; Jamalidoust, Marzieh; Moeini, Mahsa; Pouladfar, Gholamreza; Abbasian, Amin; Kadivar, Mohamad Rahim

    2011-05-01

    Aseptic meningitis refers to a clinical syndrome of meningeal inflammation in which bacteria cannot be identified in the cerebrospinal fluid (CSF). The viral etiology and the epidemiological, clinical, and laboratory characteristics of aseptic meningitis among children aged 2 months to 15 years in Shiraz, southern Iran were determined. From May 2007 to April 2008, 65 patients were admitted to the hospital with aseptic meningitis. Seven viruses, non-polio human enteroviruses, mumps virus, herpes simplex virus (HSV), varicella-zoster virus (VZV), human cytomegalovirus (HCMV), human herpes virus type 6 (HHV-6), and Epstein-Barr virus (EBV) were investigated by polymerase chain reaction (PCR) method. Viruses were detected in 30 (46.2%) patients in whom non-polio human enterovirus and mumps virus were detected in 13 (43.3%) and 11 (36.7%), respectively. The remaining 6 (20%) of the cases were caused by HSV, VZV, HCMV, and HHV-6. Haemophilus influenzae and non-polio human enterovirus were detected in one patient simultaneously. Viral meningitis was found to be more frequent during spring and summer. The majority (66.6%) of the patients were treated in the hospital for 10 days and had received antibiotics in the case of bacterial meningitis. Rapid diagnosis of viral meningitis using PCR testing of CSF can help shorten hospitalization, and avoid the unnecessary use of antibiotics.

  1. Broad-spectrum antiviral activity of chebulagic acid and punicalagin against viruses that use glycosaminoglycans for entry

    PubMed Central

    2013-01-01

    Background We previously identified two hydrolyzable tannins, chebulagic acid (CHLA) and punicalagin (PUG) that blocked herpes simplex virus type 1 (HSV-1) entry and spread. These compounds inhibited viral glycoprotein interactions with cell surface glycosaminoglycans (GAGs). Based on this property, we evaluated their antiviral efficacy against several different viruses known to employ GAGs for host cell entry. Results Extensive analysis of the tannins’ mechanism of action was performed on a panel of viruses during the attachment and entry steps of infection. Virus-specific binding assays and the analysis of viral spread during treatment with these compounds were also conducted. CHLA and PUG were effective in abrogating infection by human cytomegalovirus (HCMV), hepatitis C virus (HCV), dengue virus (DENV), measles virus (MV), and respiratory syncytial virus (RSV), at μM concentrations and in dose-dependent manners without significant cytotoxicity. Moreover, the natural compounds inhibited viral attachment, penetration, and spread, to different degrees for each virus. Specifically, the tannins blocked all these steps of infection for HCMV, HCV, and MV, but had little effect on the post-fusion spread of DENV and RSV, which could suggest intriguing differences in the roles of GAG-interactions for these viruses. Conclusions CHLA and PUG may be of value as broad-spectrum antivirals for limiting emerging/recurring viruses known to engage host cell GAGs for entry. Further studies testing the efficacy of these tannins in vivo against certain viruses are justified. PMID:23924316

  2. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53.

    PubMed

    Kuan, Man I; O'Dowd, John M; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J; Fortunato, Elizabeth A

    2016-10-01

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm.

  3. The Interaction between Cyclin B1 and Cytomegalovirus Protein Kinase pUL97 is Determined by an Active Kinase Domain.

    PubMed

    Steingruber, Mirjam; Socher, Eileen; Hutterer, Corina; Webel, Rike; Bergbrede, Tim; Lenac, Tihana; Sticht, Heinrich; Marschall, Manfred

    2015-08-11

    Replication of human cytomegalovirus (HCMV) is characterized by a tight virus-host cell interaction. Cyclin-dependent protein kinases (CDKs) are functionally integrated into viral gene expression and protein modification. The HCMV-encoded protein kinase pUL97 acts as a CDK ortholog showing structural and functional similarities. Recently, we reported an interaction between pUL97 kinase with a subset of host cyclins, in particular with cyclin T1. Here, we describe an interaction of pUL97 at an even higher affinity with cyclin B1. As a striking feature, the interaction between pUL97 and cyclin B1 proved to be strictly dependent on pUL97 activity, as interaction could be abrogated by treatment with pUL97 inhibitors or by inserting mutations into the conserved kinase domain or the nonconserved C-terminus of pUL97, both producing loss of activity. Thus, we postulate that the mechanism of pUL97-cyclin B1 interaction is determined by an active pUL97 kinase domain.

  4. Effect of Genetic Diversity in Swine Leukocyte Antigen-DRA Gene on Piglet Diarrhea.

    PubMed

    Huang, Xiaoyu; Yang, Qiaoli; Yuan, Junhu; Liu, Lixia; Sun, Wenyang; Jiang, Yingdi; Zhao, Shengguo; Zhang, Shengwei; Huang, Wangzhou; Gun, Shuangbao

    2016-07-15

    The swine leukocyte antigens (SLAs) are the multigene families related to immune responses. Little is known about the effect of the DRA gene on diarrheal disease. This study reported the genetic diversity of the DRA gene in exons 1, 3 and 4 in 290 Chinese Yantai black pigs. No variation was identified in exon 3. In exon 1, three genotypes and two alleles were identified, generated by two single nucleotide polymorphisms (SNPs). In exon 4, there were eight genotypes and five alleles containing seven SNPs were detected with four SNPs being novel SNPs. The low polymorphism found in swine DRA is consistent with the concept that the DRA gene is highly conserved among all mammalian species. Statistical analyses indicated that the genotypes of exon 1 were not significantly associated with piglet diarrhea (p > 0.05); however, genotypes C₄C₄ (1.80 ± 0.33) and A₄E₄ (1.66 ± 0.25) of exon 4 were significantly susceptible to diarrhea (p < 0.01). These indicate that the particular genotypes of the DRA gene are susceptible to diarrheal disease, which provides valuable information for disease-resistance breeding in swine.

  5. Massive expansions of Dscam splicing diversity via staggered homologous recombination during arthropod evolution.

    PubMed

    Lee, Christopher; Kim, Namshin; Roy, Meenakshi; Graveley, Brenton R

    2010-01-01

    The arthropod Down syndrome cell adhesion molecule (Dscam) gene can generate tens of thousands of protein isoforms via combinatorial splicing of numerous alternative exons encoding immunoglobulin variable domains organized into three clusters referred to as the exon 4, 6, and 9 clusters. Dscam protein diversity is important for nervous system development and immune functions. We have performed extensive phylogenetic analyses of Dscam from 20 arthropods (each containing between 46 and 96 alternative exons) to reconstruct the detailed history of exon duplication and loss events that built this remarkable system over 450 million years of evolution. Whereas the structure of the exon 4 cluster is ancient, the exon 6 and 9 clusters have undergone massive, independent expansions in each insect lineage. An analysis of nearly 2000 duplicated exons enabled detailed reconstruction of the timing, location, and boundaries of these duplication events. These data clearly show that new Dscam exons have arisen continuously throughout arthropod evolution and that this process is still occurring in the exon 6 and 9 clusters. Recently duplicated regions display boundaries corresponding to a single exon and the adjacent intron. The boundaries, homology, location, clustering, and relative frequencies of these duplication events strongly suggest that staggered homologous recombination is the major mechanism by which new Dscam exons evolve. These data provide a remarkably detailed picture of how complex gene structure evolves and reveal the molecular mechanism behind this process.

  6. An Activin Receptor IA/Activin-Like Kinase-2 (R206H) Mutation in Fibrodysplasia Ossificans Progressiva.

    PubMed

    Herrera-Esparza, Rafael; Pacheco-Tovar, Deyanira; Bollain-Y-Goytia, Juan José; Torres Del Muro, Felipe; Ramírez-Sandoval, Roxana; Pacheco-Tovar, María Guadalupe; Castañeda-Ureña, María; Avalos-Díaz, Esperanza

    2013-01-01

    Fibrodysplasia ossificans progressiva (FOP) is an exceptionally rare genetic disease that is characterised by congenital malformations of the great toes and progressive heterotopic ossification (HO) in specific anatomical areas. This disease is caused by a mutation in activin receptor IA/activin-like kinase-2 (ACVR1/ALK2). A Mexican family with one member affected by FOP was studied. The patient is a 19-year-old female who first presented with symptoms of FOP at 8 years old; she developed spontaneous and painful swelling of the right scapular area accompanied by functional limitation of movement. Mutation analysis was performed in which genomic DNA as PCR amplified using primers flanking exons 4 and 6, and PCR products were digested with Cac8I and HphI restriction enzymes. The most informative results were obtained with the exon 4 flanking primers and the Cac8I restriction enzyme, which generated a 253 bp product that carries the ACVR1 617G>A mutation, which causes an amino acid substitution of histidine for arginine at position 206 of the glycine-serine (GS) domain, and its mutation results in the dysregulation of bone morphogenetic protein (BMP) signalling that causes FOP. PMID:23653868

  7. Mucopolysaccharidosis IVA: Four new exonic mutations in patients with N-acetylgalactosamine-6-sulfate sulfatase deficiency

    SciTech Connect

    Tomatsu, Shunji; Fukuda, Seiji; Yamagishi, Atsushi

    1996-05-01

    We report four new mutations in Japanese patients with mucopolysaccharidosis IVA (MPSIVA) who were heterozygous for a common double gene deletion. A nonsense mutation of CAG to TAG at codon 148 in exon 4 was identified, resulting in a change of Q to a stop codon and three missense mutations: V (GTC) to A (GCC) at codon 138 in exon 4, P (CCC) to S (TCC) at codon 151 in exon 5, and P (CCC) to L (CTC) at codon 151 in exon 5. Introduction of these mutations into the normal GALNS cDNA and transient expression in cultured fibroblasts resulted in a significant decrease in the enzyme activity. V138A and Q148X mutations result in changes of restriction site, which were analyzed by restriction-enzyme assay. P151S and P151L mutations that did not alter the restriction site were detected by direct sequencing or allele specific oligohybridization. Detection of the double gene deletion was initially done using Southern blots and was confirmed by PCR. Haplotypes were determined using seven polymorphisms to the GALNS locus in families with the double gene deletion. Haplotype analysis showed that the common double gene deletion occurred on a single haplotype, except for some variation in a VNTR-like polymorphism. This finding is consistent with a common founder for all individuals with this mutation. 48 refs., 5 figs., 1 tab.

  8. Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system.

    PubMed

    Nakada, Satoko; Minato, Hiroshi; Nojima, Takayuki

    2016-07-01

    Investigations on the NAB2-STAT6 fusion gene in solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) have increased since its discovery in 2013. Although several SFTs reported without NAB2-STAT6 fusion gene analysis, we reviewed 546 SFTs/HPCs with NAB2-STAT6 fusion gene analysis in this study and investigated differences between the gene variants. In total, 452 cases tested positive for the NAB2-STAT6 fusion gene, with more than 40 variants being detected. The most frequent of these were NAB2 exon 6-STAT6 exon 16/17/18 and NAB2 exon 4-STAT6 exon 2/3, with the former occurring most frequently in SFTs in meninges, soft tissues, and head and neck; the latter predominated in SFTs in the pleura and lung. There was no difference between the histology of SFTs and fusion gene variants. A follow-up analysis of SFTs showed that 51 of 202 cases had a recurrence, with 18 of 53 meningeal SFTs having a local recurrence and/or metastasis within 0-19 years. In meninges and soft tissue, SFTs with the NAB2 exon 6-STAT6 exon 16/17/18 tended to recur more frequently than SFTs with the NAB2 exon 4-STAT6 exon 2/3. Clinicopathological data, including yearly follow-ups, are required for meningeal SFTs/HPCs to define the correlation of variants of NAB2-STAT6 fusion gene.

  9. A novel IRF6 nonsense mutation (Y67X) in a German family with Van der Woude syndrome.

    PubMed

    Brosch, Sibylle; Baur, Manuela; Blin, Nikolaus; Reinert, Siegmar; Pfister, Markus

    2007-07-01

    Van der Woude syndrome (VWS) is the most common type of syndromic orofacial cleft, which accounts for approximately 2% of all cleft lip and palate cases. It is characterised by variable association of lower lip pits, cleft lip and cleft palate, and hypodontia. VWS arises as the result of mutations in the gene encoding interferon regulatory factor 6 (IRF6). The disorder is transmitted in an autosomal dominant manner, with high penetrance and variable expressivity. Very recently, mutations of the IRF6 gene in exons 2-9 have been found in VWS patients, suggesting that this gene plays an important role in orofacial development. We report a novel mutation of the IRF6 gene in a German family. Five out of the 12 persons affected were able to be investigated. The mutation produced a stop codon within exon 4 of the IRF6 gene. All 5 patients were heterozygous for a base substitution c.201C>A changing the tyrosine codon at amino acid position 67 into a stop codon (p.Y67X) in exon 4. The premature stop codon was responsible for a truncated protein lacking parts of the DNA- binding domain and the complete Smad-interferon regulatory factor-binding domain probably essential for interactions with the Smad transcription factors. PMID:17549393

  10. De novo mutation causes steroid 21-hydroxylase deficiency in one family of HLA-identical affected and unaffected siblings

    SciTech Connect

    Tajima, Toshihiro Hokkaido Univ., Sapporo ); Fujieda, K. ); Fujii-Kuriyama, Yoshiaki )

    1993-07-01

    Over 90% of congenital adrenal hyperplasia (CAH) results from 21-hydroxylase deficiency. Because the CYP21B gene is located within the HLA complex and is very tightly linked to HLA markers, HLA typing is widely used for prenatal diagnosis and identifying heterozygous family members. In the course of a study on identification of heterozygous family members with HLA typing, the authors recognized an unusual family case in which three siblings share the same HLA haplotype, and only one of them had the simple virilizing form; her two siblings did not have any endocrinological abnormalities. They investigated the mode of genetic transmission by using polymerase chain reaction and single stranded conformation polymorphism. The present study revealed that the proband was a compound heterozygote with the intron 2 mutation that causes aberrant RNA splicing and the missense mutation of exon 4, while the other siblings and the father had only one allele of a missense mutation in exon 4; the mother is a normal homozygote. This result together with DNA fingerprint analysis strongly suggest that the intron 2 mutation occurred de novo in the maternally inherited gene of the proband. This seems to be the first case of a de novo mutation of the CYP21B gene that causes CAH. 19 refs., 5 figs., 1 tab.

  11. A specific isoform of poly(ADP-ribose) glycohydrolase is targeted to the mitochondrial matrix by a N-terminal mitochondrial targeting sequence

    SciTech Connect

    Whatcott, Clifford J.; Meyer-Ficca, Mirella L.; Meyer, Ralph G.; Jacobson, Myron K.

    2009-12-10

    Poly(ADP-ribose) polymerases (PARPs) convert NAD to polymers of ADP-ribose that are converted to free ADP-ribose by poly(ADP-ribose) glycohydrolase (PARG). The activation of the nuclear enzyme PARP-1 following genotoxic stress has been linked to release of apoptosis inducing factor from the mitochondria, but the mechanisms by which signals are transmitted between nuclear and mitochondrial compartments are not well understood. The study reported here has examined the relationship between PARG and mitochondria in HeLa cells. Endogenous PARG associated with the mitochondrial fraction migrated in the range of 60 kDa. Transient transfection of cells with PARG expression constructs with amino acids encoded by exon 4 at the N-terminus was targeted to the mitochondria as demonstrated by subcellular fractionation and immunofluorescence microscopy of whole cells. Deletion and missense mutants allowed identification of a canonical N-terminal mitochondrial targeting sequence consisting of the first 16 amino acids encoded by PARG exon 4. Sub-mitochondrial localization experiments indicate that this mitochondrial PARG isoform is targeted to the mitochondrial matrix. The identification of a PARG isoform as a component of the mitochondrial matrix raises several interesting possibilities concerning mechanisms of nuclear-mitochondrial cross talk involved in regulation of cell death pathways.

  12. Cdk5rap2 regulates centrosome function and chromosome segregation in neuronal progenitors.

    PubMed

    Lizarraga, Sofia B; Margossian, Steven P; Harris, Marian H; Campagna, Dean R; Han, An-Ping; Blevins, Sherika; Mudbhary, Raksha; Barker, Jane E; Walsh, Christopher A; Fleming, Mark D

    2010-06-01

    Microcephaly affects approximately 1% of the population and is associated with mental retardation, motor defects and, in some cases, seizures. We analyzed the mechanisms underlying brain size determination in a mouse model of human microcephaly. The Hertwig's anemia (an) mutant shows peripheral blood cytopenias, spontaneous aneuploidy and a predisposition to hematopoietic tumors. We found that the an mutation is a genomic inversion of exon 4 of Cdk5rap2, resulting in an in-frame deletion of exon 4 from the mRNA. The finding that CDK5RAP2 human mutations cause microcephaly prompted further analysis of Cdk5rap2(an/an) mice and we demonstrated that these mice exhibit microcephaly comparable to that of the human disease, resulting from striking neurogenic defects that include proliferative and survival defects in neuronal progenitors. Cdk5rap2(an/an) neuronal precursors exit the cell cycle prematurely and many undergo apoptosis. These defects are associated with impaired mitotic progression coupled with abnormal mitotic spindle pole number and mitotic orientation. Our findings suggest that the reduction in brain size observed in humans with mutations in CDK5RAP2 is associated with impaired centrosomal function and with changes in mitotic spindle orientation during progenitor proliferation. PMID:20460369

  13. Mutational analysis of the biglycan gene excludes it as a candidate for x-linked dominant chondrodysplasia punctata, dyskeratosis congenita, and incontinentia pigmenti

    SciTech Connect

    Das, S.; Metzenberg, A.; Gitschier, J. ); Pai, G.S. )

    1994-05-01

    Biglycan is a small proteoglycan expressed mainly in cells of connective tissue, including chondrocytes, ostocytes, epithelial cells, and endothelial cells. The biglycan cDNA is 1,685 bp long. The biglycan gene was amplified in six segments by using nested PCR. Primers were synthesized to amplify exons 2-8 of the biglycan gene. Exon 1 was not amplified, as it consists entirely of 5[prime] untranslated sequence. Each exon was separately amplified, except for exons 5-7, which, because of their small size, were amplified in two segments and were subjected to SSCP analysis. Results indicate the presence of two different haplotypes for exon 2 and three different haplotypes for exon 4. Further SSCP analysis of control samples from nine females and one male confirmed that the exon 2 and exon 4 haplotypes consist of polymorphisms, rather than of mutations that specifically affect this patient population. Our results support recently described work that proposes that the biglycan gene may not be involved in X-linked dominant chondrodysplasia punctata. The absence of mutations in the biglycan gene in X-linked dominant chondrodysplasia punctata, dyskeratosis congenita, and incontinentia pigmenti suggest it is highly unlikely that mutations in this gene are responsible for any of these disorders.

  14. Effect of Genetic Diversity in Swine Leukocyte Antigen-DRA Gene on Piglet Diarrhea.

    PubMed

    Huang, Xiaoyu; Yang, Qiaoli; Yuan, Junhu; Liu, Lixia; Sun, Wenyang; Jiang, Yingdi; Zhao, Shengguo; Zhang, Shengwei; Huang, Wangzhou; Gun, Shuangbao

    2016-01-01

    The swine leukocyte antigens (SLAs) are the multigene families related to immune responses. Little is known about the effect of the DRA gene on diarrheal disease. This study reported the genetic diversity of the DRA gene in exons 1, 3 and 4 in 290 Chinese Yantai black pigs. No variation was identified in exon 3. In exon 1, three genotypes and two alleles were identified, generated by two single nucleotide polymorphisms (SNPs). In exon 4, there were eight genotypes and five alleles containing seven SNPs were detected with four SNPs being novel SNPs. The low polymorphism found in swine DRA is consistent with the concept that the DRA gene is highly conserved among all mammalian species. Statistical analyses indicated that the genotypes of exon 1 were not significantly associated with piglet diarrhea (p > 0.05); however, genotypes C₄C₄ (1.80 ± 0.33) and A₄E₄ (1.66 ± 0.25) of exon 4 were significantly susceptible to diarrhea (p < 0.01). These indicate that the particular genotypes of the DRA gene are susceptible to diarrheal disease, which provides valuable information for disease-resistance breeding in swine. PMID:27429004

  15. Transcription variants of SLA-7, a swine non classical MHC class I gene.

    PubMed

    Hu, Rui; Lemonnier, Gaëtan; Bourneuf, Emmanuelle; Vincent-Naulleau, Silvia; Rogel-Gaillard, Claire

    2011-06-03

    In pig, very little information is available on the non classical class I (Ib) genes of the Major Histocompatibility Complex (MHC) i.e. SLA-6, -7 and -8. Our aim was to focus on the transcription pattern of the SLA-7 gene. RT-PCR experiments were carried out with SLA-7 specific primers targeting either the full coding sequence (CDS) from exon 1 to the 3 prime untranslated region (3UTR) or a partial CDS from exon 4 to the 3UTR. We show that the SLA-7 gene expresses a full length transcript not yet identified that refines annotation of the gene with eight exons instead of seven as initially described from the existing RefSeq RNA. These two RNAs encode molecules that differ in cytoplasmic tail length. In this study, another SLA-7 transcript variant was characterized, which encodes a protein with a shorter alpha 3 domain, as a consequence of a splicing site within exon 4. Surprisingly, a cryptic non canonical GA-AG splicing site is used to generate this transcript variant. An additional SLA-7 variant was also identified in the 3UTR with a splicing site occurring 31 nucleotides downstream to the stop codon. In conclusion, the pig SLA-7 MHC class Ib gene presents a complex transcription pattern with two transcripts encoding various molecules and transcripts that do not alter the CDS and may be subject to post-transcriptional regulation.

  16. Naturally- and experimentally-designed restorations of the Parkin gene deficit in autosomal recessive juvenile parkinsonism

    SciTech Connect

    Asai, Hirohide; Hirano, Makito; Kiriyama, Takao; Ikeda, Masanori; Ueno, Satoshi

    2010-01-01

    Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cycle proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.

  17. Insertion of long interspersed element-1 in the Mitf gene is associated with altered neurobehavior of the black-eyed white Mitf(mi-bw) mouse.

    PubMed

    Takeda, Kazuhisa; Hozumi, Hiroki; Nakai, Kunihiko; Yoshizawa, Miki; Satoh, Hiroshi; Yamamoto, Hiroaki; Shibahara, Shigeki

    2014-02-01

    Microphthalmia-associated transcription factor (Mitf) is required for the differentiation of melanoblasts of the neural crest origin. The mouse homozygous for the black-eyed white (Mitf(mi-bw) ) allele is characterized by white-coat color and deafness with black eye, due to the loss of melanoblasts during embryonic development. The Mitf(mi-bw) allele carries an insertion of long interspersed element-1 (L1) in intron 3 of the Mitf gene, which may cause the deficiency of melanocyte-specific Mitf-M. Here, we show that the L1 insertion results in the generation of alternatively spliced Mitf-M mRNA species, such as Mitf-M mRNA lacking exon 3, exon 4 or both exons 3 and 4, each of which encodes Mitf-M protein with an internal deletion. Transient expression assays showed the loss of or reduction in function of each aberrant Mitf-M protein and the dominant negative effect of Mitf-M lacking exon 4 that encodes an activation domain. Thus, the L1 insertion may decrease the expression level of functional Mitf-M. Importantly, Mitf-M mRNA is expressed in the wild-type mouse brain, with the highest expression level in the hypothalamus. Likewise, aberrant Mitf-M mRNAs are expressed in the bw mouse brain. The bw mice show the altered neurobehavior under a stressful environment, suggesting the role of Mitf-M in sensory perception.

  18. Association of Human Papilloma Virus 16 Infection and p53 Polymorphism among Tobacco using Oral Leukoplakia Patients: A Clinicopathologic and Genotypic Study

    PubMed Central

    Sikka, Seema; Sikka, Pranav

    2014-01-01

    Background: Human papillomavirus (HPV) and p53 alterations are speculated to play a role in carcinogenesis. This study was carried out to find out the association of HPV and p53 with precancerous lesions of the oral cavity such as leukoplakia: The objective of this study was to find the association among human papilloma virus (HPV) 16 infections and p53 polymorphism in tobacco using the oral leukoplakia patients. Methods: A total of 91 oral leukoplakia patients and 100 controls were randomly selected from the out-patient department of a tertiary care dental hospital of North-east India. Blood samples were drawn incisional biopsy was performed from the lesion proper and the tissue was processed for histopathological grading. Cytological smears were taken from the lesional site of leukoplakia patients and buccal mucosa of controls. The rate of HPV infection and p53 polymorphism was detected with the help of polymerase chain reaction, gel electrophoresis and deoxyribonucleic acid sequencing. Results: The rate of HPV 16 infection was found significantly high in the oral leukoplakia patients. No particular p53 genotype at exon 4 of codon 72 was found to be associated with oral leukoplakia, but “C” allele (proline) at exon 4 of codon 72 was significantly raised in these patients. Conclusions: Oral leukoplakia, a well-known pre-cancerous lesion, has been shown to be associated with tobacco, but certain other factors like HPV infection and p53 polymorphism may play an important role in its development. PMID:24829730

  19. Role of interleukin-15 receptor alpha polymorphisms in normal weight obese syndrome.

    PubMed

    Di Renzo, L; Gloria-Bottini, F; Saccucci, P; Bigioni, M; Abenavoli, L; Gasbarrini, G; De Lorenzo, A

    2009-01-01

    Previous published studies have identified a class of women, Normal Weight Obese women (NWO) with normal BMI and high fat content. An important role of Interleukin-15 (IL-15) has been documented in facilitating muscle proliferation and promoting fat depletion. Indeed the presence of three types of IL-15 receptor subunits in fat tissue suggests a direct effect on adipose tissue. We studied three single nucleotide polymorphisms (SNP) of IL-15R-alpha receptor gene and investigated their relationship with NWO phenotype. We considered two classes of women according to their BMI and percent fat mass (percent FAT), class 1: including 72 overweight-obese women (high BMI-high fat mass) and class 2: including 36 NWO (normal BMI, high fat mass). Three sites of Interleukin-15 receptor subunit á gene were examined, located respectively in exon4, exon5 intron-exon border and exon7. Genotyping of the identified polymorphisms was performed by restriction fragment length polymorphism. Haplotype frequency estimation was performed by using the Mendel-University of Chicago program. Odds ratio analyses were calculated by EPISTAT program. Highly significant differences were observed for exon 7- exon5 intron-exon border and exon 4-exon 7 haplotype distribution between class 1 and class 2 women. These results strongly support the hypothesis that genetic variability of the IL-15 receptor has an important role in body fat composition. Our data underscore previous findings that suggest a potential role of IL-15 cytokine in NWO syndrome.

  20. Molecular Characterization of TP53 Gene in Human Populations Exposed to Low-Dose Ionizing Radiation

    PubMed Central

    Brasil-Costa, Igor; Alencar, Dayse O.; Raiol-Moraes, Milene; Pessoa, Igor A.; Brito, Alexandre W. M.; Jati, Schneyder R.; Santos, Sidney E. B.; Burbano, Rommel M. R.; Ribeiro-dos-Santos, Ândrea K. C.

    2013-01-01

    Ionizing radiation, such as that emitted by uranium, may cause mutations and consequently lead to neoplasia in human cells. The TP53 gene acts to maintain genomic integrity and constitutes an important biomarker of susceptibility. The present study investigated the main alterations observed in exons 4, 5, 6, 7, and 8 of the TP53 gene and adjacent introns in Amazonian populations exposed to radioactivity. Samples were collected from 163 individuals. Occurrence of the following alterations was observed: (i) a missense exchange in exon 4 (Arg72Pro); (ii) 2 synonymous exchanges, 1 in exon 5 (His179His), and another in exon 6 (Arg213Arg); (iii) 4 intronic exchanges, 3 in intron 7 (C → T at position 13.436; C → T at position 13.491; T → G at position 13.511) and 1 in intron 8 (T → G at position 13.958). Alteration of codon 72 was found to be an important risk factor for cancer development (P = 0.024; OR = 6.48; CI: 1.29–32.64) when adjusted for age and smoking. Thus, TP53 gene may be an important biomarker for carcinogenesis susceptibility in human populations exposed to ionizing radiation. PMID:23586029

  1. Applications of the human p53 knock-in (Hupki) mouse model for human carcinogen testing.

    PubMed

    Besaratinia, Ahmad; Pfeifer, Gerd P

    2010-08-01

    Tumor-driving mutations in the TP53 gene occur frequently in human cancers. These inactivating mutations arise predominantly from a single-point mutation in the DNA-binding domain of this tumor suppressor gene (i.e., exons 4-9). The human p53 knock-in (Hupki) mouse model was constructed using gene-targeting technology to create a mouse strain that harbors human wild-type TP53 DNA sequences in both copies of the mouse TP53 gene. Replacement of exons 4-9 of the endogenous mouse TP53 alleles in the Hupki mouse with the homologous normal human TP53 gene sequences has offered a humanized replica of the TP53 gene in a murine genetic environment. The Hupki mouse model system has proven to be an invaluable research tool for studying the underlying mechanisms of human TP53 mutagenesis. The utility of the Hupki mouse model system for exploring carcinogen-induced TP53 mutagenesis has been demonstrated in both in vivo animal experiments and in vitro cell culture experiments. Here, we highlight applications of the Hupki mouse model system for investigating mutagenesis induced by a variety of environmental carcinogens, including sunlight ultraviolet radiation, benzo[a]pyrene (a tobacco smoke-derived carcinogen), 3-nitrobenzanthrone (an urban air pollutant), aristolochic acid (a component of Chinese herbal medicine), and aflatoxin B1 (a food contaminant). We summarize the salient findings of the respective studies and discuss their relevance to human cancer etiology.

  2. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4) Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    PubMed

    Brenig, Bertram; Schütz, Ekkehard; Hardt, Michael; Scheuermann, Petra; Freick, Markus

    2015-01-01

    Aristaless-like homeobox 4 (ALX4) gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA) and 289 White Galloway (WGA) cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed. PMID:26076463

  3. Molecular characterization of interferon regulatory factor 1 in Bubalus bubalis.

    PubMed

    Stafuzza, N B; Borges, M M; Amaral-Trusty, M E J

    2015-01-01

    Interferon regulatory factor 1 (IRF1) is functionally diverse in the regulation of immune response and is considered to be an important candidate gene for studying disease susceptibility in mammals. In this paper, we characterized the whole sequence of the IRF1 gene in river buffalo (Bubalus bubalis) and compared genomic and the amino acid sequences between different species. The buffalo IRF1 gene was 7099 bp long and organized into 10 exons and nine introns. Its molecular structure showed exactly the same number of exons (10) and introns (nine) in bovids, mice, horses, humans, and chickens. However, rats did not have exon 5, but had the largest exon 4, which suggests that exon 5 was incorporated into exon 4. The coding and the amino acid sequences of the gene showed that identity varied from 73 to 99% at the coding sequence level and from 61 to 100% at the amino acid level when compared with other mammals and chickens. Comparative analysis of the gene sequence between two different buffalo breeds, Murrah and Mediterranean, revealed six potential SNPs that are primarily located in the 5' and 3'UTRs. PMID:26400319

  4. Functional consequences of EpCam mutation in mice and men.

    PubMed

    Mueller, James L; McGeough, Matthew D; Peña, Carla A; Sivagnanam, Mamata

    2014-02-15

    Congenital tufting enteropathy (CTE) is a severe diarrheal disease of infancy characterized by villous changes and epithelial tufts. We previously identified mutations in epithelial cell adhesion molecule (EpCAM) as the cause of CTE. We developed an in vivo mouse model of CTE based on EpCAM mutations found in patients with the aim to further elucidate the in vivo role of EpCAM and allow for a direct comparison to human CTE. Using Cre-LoxP recombination technology, we generated a construct lacking exon 4 in Epcam. Epcam(Δ4/Δ4) mice and CTE patient intestinal tissue integrity was analyzed by histology using both light immunohistochemistry and electron microscopy. Epcam(Δ4/Δ4) mice demonstrate neonatal lethality and growth retardation with pathological features, including epithelial tufts, enterocyte crowding, altered desmosomes, and intercellular gaps, similar to human CTE patients. Mutant EpCAM protein is present at low levels and is mislocalized in the intestine of Epcam(Δ4/Δ4) mice and CTE patients. Deletion of exon 4 was found to decrease expression of both EpCAM and claudin-7 causing a loss of colocalization, functionally disrupting the EpCAM/claudin-7 complex, a finding for the first time confirmed in CTE patients. Furthermore, compared with unaffected mice, mutation of Epcam leads to enhanced permeability and intestinal cell migration, uncovering underlying disease mechanisms.

  5. Characterization of a de novo 43-bp deletion of the Gs[alpha] gene (GNAS1) in Albright hereditary osteodystrophy

    SciTech Connect

    Luttikhuis, M.E.M.O.; Trembath, R.C. ); Wilson, L.C. Institute of Child Health, London ); Leonard, J.V. )

    1994-05-15

    Albright hereditary osteodystrophy (AHO) is an autosomal dominant disorder characterized by short stature, obesity, mental retardation, subcutaneous calcification, and brachy-metaphalangia. Two distinct forms of AHO exist; pseudohypoparathyroidism type I (PHPI) and pseudopseudohypoparathyrodism (PPHP). The classification is dependent upon the presence or absence, respectively, of resistance to parathyroid and other hormones that bind to Gs-protein-coupled membrane receptors stimulating adenylyl cyclase. Gs is a heterotrimeric protein comprising [alpha], [beta], and [gamma]-subunits encoded by separate genes. Genomic DNA was isolated from peripheral leukocytes from 13 unrelated AHO patients. Exon 4 and flanking intronic sequence of GNAS1 were PCR amplified. A single PCR product corresponding to the expected 159-bp fragment was identified in 12 affected individuals with either PHPIa or PPHP. In patient 10285 an additional smaller fragment was detected but was not present in either of the unaffected parents. These two fragments were isolated from a 2% agarose gel. Direct sequencing of the smaller fragment revealed a 43-bp deletion comprising at least 35 hp of the 3[prime] end of exon 4 and the donor splice site of intron 4 and extending into the following intro. The 43-bp deletion would lead to a premature stop codon, 62 codons downstream of the deletion. The de novo mutation reported here is the largest deletion in the Gs[alpha] gene described so far for AHO patients.

  6. Binding of a candidate splice regulator to a calcitonin-specific splice enhancer regulates calcitonin/CGRP pre-mRNA splicing.

    PubMed

    Coleman, Timothy P; Tran, Quincy; Roesser, James R

    2003-01-27

    The calcitonin/calcitonin gene-related peptide (CGRP) pre-mRNA is alternatively processed in a tissue-specific manner leading to the production of calcitonin mRNA in thyroid C cells and CGRP mRNA in neurons. A candidate calcitonin/CGRP splice regulator (CSR) isolated from rat brain was shown to inhibit calcitonin-specific splicing in vitro. CSR specifically binds to two regions in the calcitonin-specific exon 4 RNA previously demonstrated to function as a bipartate exonic splice enhancer (ESE). The two regions, A and B element, are necessary for inclusion of exon 4 into calcitonin mRNA. A novel RNA footprinting method based on the UV cross-linking assay was used to define the site of interaction between CSR and B element RNA. Base changes at the CSR binding site prevented CSR binding to B element RNA and CSR was unable to inhibit in vitro splicing of pre-mRNAs containing the mutated CSR binding site. When expressed in cells that normally produce predominantly CGRP mRNA, a calcitonin/CGRP gene containing the mutated CSR binding site expressed predominantly calcitonin mRNA. These observations demonstrate that CSR binding to the calcitonin-specific ESE regulates calcitonin/CGRP pre-mRNA splicing.

  7. Effect of Genetic Diversity in Swine Leukocyte Antigen-DRA Gene on Piglet Diarrhea

    PubMed Central

    Huang, Xiaoyu; Yang, Qiaoli; Yuan, Junhu; Liu, Lixia; Sun, Wenyang; Jiang, Yingdi; Zhao, Shengguo; Zhang, Shengwei; Huang, Wangzhou; Gun, Shuangbao

    2016-01-01

    The swine leukocyte antigens (SLAs) are the multigene families related to immune responses. Little is known about the effect of the DRA gene on diarrheal disease. This study reported the genetic diversity of the DRA gene in exons 1, 3 and 4 in 290 Chinese Yantai black pigs. No variation was identified in exon 3. In exon 1, three genotypes and two alleles were identified, generated by two single nucleotide polymorphisms (SNPs). In exon 4, there were eight genotypes and five alleles containing seven SNPs were detected with four SNPs being novel SNPs. The low polymorphism found in swine DRA is consistent with the concept that the DRA gene is highly conserved among all mammalian species. Statistical analyses indicated that the genotypes of exon 1 were not significantly associated with piglet diarrhea (p > 0.05); however, genotypes C4C4 (1.80 ± 0.33) and A4E4 (1.66 ± 0.25) of exon 4 were significantly susceptible to diarrhea (p < 0.01). These indicate that the particular genotypes of the DRA gene are susceptible to diarrheal disease, which provides valuable information for disease-resistance breeding in swine. PMID:27429004

  8. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4) Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle

    PubMed Central

    Brenig, Bertram; Schütz, Ekkehard; Hardt, Michael; Scheuermann, Petra; Freick, Markus

    2015-01-01

    Aristaless-like homeobox 4 (ALX4) gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA) and 289 White Galloway (WGA) cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed. PMID:26076463

  9. Novel IRF6 mutations in Japanese patients with Van der Woude syndrome: two missense mutations (R45Q and P396S) and a 17-kb deletion.

    PubMed

    Kayano, Shuji; Kure, Shigeo; Suzuki, Yoichi; Kanno, Kiyoshi; Aoki, Yoko; Kondo, Shinji; Schutte, Brian C; Murray, Jeffrey C; Yamada, Atsushi; Matsubara, Yoichi

    2003-01-01

    Three Japanese families with Van der Woude syndrome (VWS) were screened for mutations in the interferon regulatory factor 6 gene (IRF6) by sequencing its entire coding region. Two novel missense mutations, R45Q in exon 3 and P396S in exon 9, were identified in families 1 and 2, respectively. In family 3, no causative base change was found by the sequencing analysis, but a deletion involving exons 4-9 was suggested by multiplex PCR analysis. To confirm the deletion and to determine its 5'- and 3'-boundaries, we amplified a DNA fragment containing a heterozygous polymorphic site in exon 2 by using a 5'-upstream forward PCR primer and eight different reverse primers located 3'-downstream of exon 2. The amplified product was subjected to nested PCR to generate a DNA fragment containing the polymorphic site. When a reverse primer located within the deletion was used for the first PCR amplification, only the nondeletion allele was detected after the second PCR. Repeated analyses with eight different reverse primers allowed us to map the boundaries of the deletion, and subsequently a heterozygous 17,162-bp deletion involving exons 4-9 was identified. Since IRF6 mutations in a significant portion of VWS patients remain undetected by conventional sequencing analysis, it may be important to search for a large deletion in those patients. Our simple methods to identify deletions and to determine the boundaries of a deletion would facilitate the identification of such patients.

  10. Nucleotide sequence and temporal expression of a baculovirus regulatory gene.

    PubMed

    Guarino, L A; Summers, M D

    1987-07-01

    The nucleotide sequence of a trans-activating regulatory gene (IE-1) of the baculovirus Autographa californica nuclear polyhedrosis virus has been determined. This gene encodes a protein of 581 amino acids with a predicted molecular weight of 66,856. A DNA fragment containing the entire coding sequence of IE-1 was inserted downstream of an RNA promoter. Subsequent cell-free transcription and translation directed the synthesis of a single peptide with an apparent molecular weight of 70,000. Quantitative S1 nuclease analysis indicated that IE-1 was maximally synthesized during a 1-h virus adsorption period and that steady-state levels of IE-1 message were maintained during the first 24 h of infection. Northern blot hybridization indicated that several late transcripts which overlap the IE-1 gene were transcribed from both strands. The precise locations of the 5' and 3' ends of these overlapping transcripts were mapped using S1 nuclease. The overlapping transcripts were grouped in two transcriptional units. One unit was composed of IE-1 and overlapping gamma transcripts which initiated upstream of IE-1 and terminated downstream of IE-1. The other unit, transcribed from the opposite strand, consisted of gamma transcripts with coterminal 5' ends and extended 3' ends. The shorter, more abundant transcripts in this unit overlapped 30 to 40 bases of IE-1 at the 3' end, while the longer transcripts overlapped the entire IE-1 gene. Transcription of several early A. californica nuclear polyhedrosis virus genes, in addition to 39K, was shown to be trans-activated by IE-1, indicating that IE-1 may have a central role in the regulation of beta-gene expression. PMID:16789264

  11. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    SciTech Connect

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  12. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.

    PubMed Central

    Lang, D; Gebert, S; Arlt, H; Stamminger, T

    1995-01-01

    The 86-kDa IE2 protein (IE86) of human cytomegalovirus (HCMV) has been described as a promiscuous transactivator of viral, as well as cellular, gene expression. Investigation of the mechanism used by IE86 to activate gene expression from the early UL112/113 promoter of HCMV revealed the existence of three binding sites for IE86 located between nucleotides -290 and -120 relative to the transcriptional start site (H. Arlt, D. Lang, S. Gebert, and T. Stamminger, J. Virol. 68:4117-4125, 1994). As shown previously, deletion of these target sites resulted in a reduction of IE86-mediated transactivation by approximately 70%. The remaining promoter, however, could still be stimulated about 40-fold, indicating the presence of an additional responsive element within these sequences. Here, we provide evidence that a binding site for the cellular transcription factor CREB can also act as a target for IE86 transactivation. By DNase I protection analysis, a binding sequence for CREB could be detected between nucleotides -78 and -56 within the respective promoter region. After in vitro mutagenesis of this CREB-binding site within the context of the entire UL112/113 promoter, a marked reduction in transactivation levels was evident. Moreover, when individual CREB-binding sites were positioned upstream of a minimal, TATA box-containing UL112/113 promoter, they were able to confer strong IE86 responsiveness, whereas a mutated sequence did not exert any effect. In far Western blot and pull-down experiments, a direct interaction of IE86 with the cellular transcription factor CREB could be observed. The in vivo relevance of this in vitro interaction was confirmed by using various GAL4 fusion proteins in the presence or absence of IE86 which revealed a strong activation only in the presence of both a GAL4-CREB fusion and IE86. This shows that at least one specific member of the ATF/CREB family of transcription factors is involved in mediating transactivation by the HCMV IE86 protein

  13. A “Coiled-Coil” Motif Is Important for Oligomerization and DNA Binding Properties of Human Cytomegalovirus Protein UL77

    PubMed Central

    Dittmer, Alexandra; Lapp, Sara; Bogner, Elke

    2011-01-01

    Human cytomegalovirus (HCMV) UL77 gene encodes the essential protein UL77, its function is characterized in the present study. Immunoprecipitation identified monomeric and oligomeric pUL77 in HCMV infected cells. Immunostaining of purified virions and subviral fractions showed that pUL77 is a structural protein associated with capsids. In silico analysis revealed the presence of a coiled-coil motif (CCM) at the N-terminus of pUL77. Chemical cross-linking of either wild-type pUL77 or CCM deletion mutant (pUL77ΔCCM) implicated that CCM is critical for oligomerization of pUL77. Furthermore, co-immunoprecipitations of infected and transfected cells demonstrated that pUL77 interacts with the capsid-associated DNA packaging motor components, pUL56 and pUL104, as well as the major capsid protein. The ability of pUL77 to bind dsDNA was shown by an in vitro assay. Binding to certain DNA was further confirmed by an assay using biotinylated 36-, 250-, 500-, 1000-meric dsDNA and 966-meric HCMV-specific dsDNA designed for this study. The binding efficiency (BE) was determined by image processing program defining values above 1.0 as positive. While the BE of the pUL56 binding to the 36-mer bio-pac1 containing a packaging signal was 10.0±0.63, the one for pUL77 was only 0.2±0.03. In contrast to this observation the BE of pUL77 binding to bio-500 bp or bio-1000 bp was 2.2±0.41 and 4.9±0.71, respectively. By using pUL77ΔCCM it was demonstrated that this protein could not bind to dsDNA. These data indicated that pUL77 (i) could form homodimers, (ii) CCM of pUL77 is crucial for oligomerization and (iii) could bind to dsDNA in a sequence independent manner. PMID:21998635

  14. Simian cytomegalovirus encodes five rapidly evolving chemokine receptor homologues.

    PubMed

    Sahagun-Ruiz, Alfredo; Sierra-Honigmann, Ana Maria; Krause, Philip; Murphy, Philip M

    2004-01-01

    Many herpesviruses, poxviruses and retroviruses encode proteins related to chemokines and chemokine receptors. The first one discovered, US28 of human cytomegalovirus (HCMV), is a 7-transmembrane domain G protein-coupled chemokine receptor able to activate diverse cellular responses, including cell migration and gene expression. A related ORF named US27 is adjacent to US28, but no functions have been defined yet. Recently ORFs 3-7, a cluster of five concatenated ORFs with highest homology to US28 and mammalian chemokine receptors, were sequenced from a prototype "stealth virus", an African green monkey simian CMV (SCMV)-related entity with unusual fungal, bacterial and mammalian gene homologues. Stealth viruses have not yet been independently replicated in tissue culture, and therefore their biological significance remains unclear. ORF3, ORF4, ORF5 and ORF6 are complete ORFs whereas the sequence of ORF7 is incomplete. In the present study, we identified five corresponding ORFs in the genome of a clinical isolate of bonafide simian CMV (SCMV), strain 9610. We found substantial differences between the SCMV and "stealth virus" ORFs, especially for ORF5 where there are 31% non-identities at the amino acid level. Four conserved genes unrelated to chemokines (64K/CAP, DNBI, UL32, and IE2) in SCMV and HCMV had on average 52% identity at the deduced amino acid level, whereas the corresponding values for the SCMV ORFs versus US28 ranged from 21% to 30%, suggesting rapid gene diversification in this cluster. Consistent with this, the amino acid identity for any pairwise comparison among the SCMV ORFs is only 21-52%. The chemokine receptor homologues are estimated to comprise approximately 2-3% of the SCMV genome. HCMV US27 and US28 homologues have also been identified in the chimpanzee CMV genome, whereas mouse and rat CMV lack chemokine receptor homologues. This genomic analysis indicates that SCMV has an unusually high concentration of US28-related chemokine receptor

  15. Infection of a Single Cell Line with Distinct Strains of Human Cytomegalovirus Can Result in Large Variations in Virion Production and Facilitate Efficient Screening of Virus Protein Function

    PubMed Central

    Zavala, Anamaria G.; O'Dowd, John M.

    2015-01-01

    ABSTRACT Previously, we reported that the absence of the ataxia telangiectasia mutated (ATM) kinase, a critical DNA damage response (DDR) signaling component for double-strand breaks, caused no change in HCMV Towne virion production. Later, others reported decreased AD169 viral titers in the absence of ATM. To address this discrepancy, human foreskin fibroblasts (HFF) and three ATM− lines (GM02530, GM05823, and GM03395) were infected with both Towne and AD169. Two additional ATM− lines (GM02052 and GM03487) were infected with Towne. Remarkably, both previous studies' results were confirmed. However, the increased number of cell lines and infections with both lab-adapted strains confirmed that ATM was not necessary to produce wild-type-level titers in fibroblasts. Instead, interactions between individual virus strains and the cellular microenvironment of the individual ATM− line determined efficiency of virion production. Surprisingly, these two commonly used lab-adapted strains produced drastically different titers in one ATM− cell line, GM05823. The differences in titer suggested a rapid method for identifying genes involved in differential virion production. In silico comparison of the Towne and AD169 genomes determined a list of 28 probable candidates responsible for the difference. Using serial iterations of an experiment involving virion entry and input genome nuclear trafficking with a panel of related strains, we reduced this list to four (UL129, UL145, UL147, and UL148). As a proof of principle, reintroduction of UL148 largely rescued genome trafficking. Therefore, use of a battery of related strains offers an efficient method to narrow lists of candidate genes affecting various virus life cycle checkpoints. IMPORTANCE Human cytomegalovirus (HCMV) infection of multiple cell lines lacking ataxia telangiectasia mutated (ATM) protein produced wild-type levels of infectious virus. Interactions between virus strains and the microenvironment of individual

  16. Structure and transcription of an immediate-early region in the human herpesvirus 6 genome.

    PubMed Central

    Schiewe, U; Neipel, F; Schreiner, D; Fleckenstein, B

    1994-01-01

    The unique segment of the human herpesvirus 6 (HHV-6) genome is essentially collinear to the unique long DNA segment of another betaherpesvirus, the human cytomegalovirus (HCMV). However, the HHV-6 genomic section that is analogous in position to the major immediate-early (IE) locus of HCMV does not exhibit recognizable sequence homologies. The respective HHV-6 region of 5.5 kbp is flanked on one side by 25 to 28 incomplete tandem repeats of 105 to 110 bp that contain, with one exception, a single KpnI restriction site (KpnI repeats). About 250 reiterations of the sequence motif CACATA are located on the other end. We identified two open reading frames of 375 and 2,595 nucleotides, respectively, on one strand. Strand-specific Northern blot analyses with RNA harvested from HHV-6 (strain U1102)-infected HSB-2 cells or cord blood lymphocytes revealed two transcripts of about 3.5 and 4.7 kb in the corresponding orientation. Sequence analyses of the respective cDNA clones and primer extension experiments were used to map the mRNAs. The two transcripts are coterminal and multiply spliced and code for the same putative 104.6-kDa protein, but they are initiated from different promoters. Characterization of smaller cDNA clones and Northern blotting with other strand-specific probes showed that singly spliced mRNAs of 1.0 and 1.5 kb are transcribed from the opposite strand; they could code for a 17.2-kDa polypeptide. Blocking experiments with cycloheximide led to the conclusion that only the 3.5-kb mRNA is synthesized in the absence of protein biosynthesis upon infection with cell-free virus. This identifies a single IE gene of HHV-6 at the genomic position corresponding to the major IE region of HCMV, although the coding content and transcriptional regulation are quite different for these two herpesvirus IE regions. Images PMID:8151768

  17. Human Cytomegalovirus UL97 Kinase and Nonkinase Functions Mediate Viral Cytoplasmic Secondary Envelopment ▿

    PubMed Central

    Goldberg, Miri D.; Honigman, Alik; Weinstein, Jacob; Chou, Sunwen; Taraboulos, Albert; Rouvinski, Alexander; Shinder, Vera; Wolf, Dana G.

    2011-01-01

    Previous studies have revealed critical roles for the human cytomegalovirus (HCMV) UL97 kinase in viral nuclear maturation events. We have shown recently that UL97 affects the morphology of the viral cytoplasmic assembly compartment (AC) (M. Azzeh, A. Honigman, A. Taraboulos, A. Rouvinski, and D. G. Wolf, Virology 354:69-79, 2006). Here, we employed a comprehensive ultrastructural analysis to dissect the impact of UL97 on cytoplasmic steps of HCMV assembly. Using UL97 deletion (ΔUL97) and kinase-null (K355M) mutants, as well as the UL97 kinase inhibitor NGIC-I, we demonstrated that the loss of UL97 kinase activity resulted in a unique combination of cytoplasmic features: (i) the formation of pp65-rich aberrant cytoplasmic tegument aggregates, (ii) distorted intracytoplasmic membranes, which replaced the normal architecture of the AC, and (iv) a paucity of cytoplasmic tegumented capsids and dense bodies (DBs). We further showed that these abnormal assembly intermediates did not result from impaired nuclear capsid maturation and egress per se by using 2-bromo-5,6-dichloro-1-(β-d-ribofuranosyl) benzimidizole (BDCRB) to induce the artificial inhibition of nuclear maturation and the nucleocytoplasmic translocation of capsids. The specific abrogation of UL97 kinase activity under low-multiplicity-of-infection conditions resulted in the improved release of extracellular virus compared to that of ΔUL97, despite similar rates of viral DNA accumulation and similar effects on nuclear capsid maturation and egress. The only ultrastructural correlate of the growth difference was a higher number of cytoplasmic DBs, tegumented capsids, and clustered viral particles observed upon the specific abrogation of UL97 kinase activity compared to that of ΔUL97. These combined findings reveal a novel role for UL97 in HCMV cytoplasmic secondary envelopment steps, with a further distinction of kinase-mediated function in the formation of the virus-induced AC and a nonkinase function

  18. Membrane Perturbation-Associated Ca2+ Signaling and Incoming Genome Sensing Are Required for the Host Response to Low-Level Enveloped Virus Particle Entry

    PubMed Central

    Hare, David N.; Collins, Susan E.; Mukherjee, Subhendu; Gale, Michael; Janssen, Luke J.

    2015-01-01

    ABSTRACT The type I interferon (IFN) response is an important aspect of innate antiviral defense, and the transcription factor IRF3 plays an important role in its induction. Membrane perturbation during fusion, a necessary step for enveloped virus particle entry, appears sufficient to induce transcription of a subset of IFN-stimulated genes (ISGs) in an IRF3-dependent, IFN-independent fashion. IRF3 is emerging as a central node in host cell stress responses, although it remains unclear how different forms of stress activate IRF3. Here, we investigated the minimum number of Sendai virus (SeV) and human cytomegalovirus (HCMV) particles required to activate IRF3 and trigger an antiviral response. We found that Ca2+ signaling associated with membrane perturbation and recognition of incoming viral genomes by cytosolic nucleic acid receptors are required to activate IRF3 in response to fewer than 13 particles of SeV and 84 particles of HCMV per cell. Moreover, it appears that Ca2+ signaling is important for activation of STING and IRF3 following HCMV particle entry, suggesting that Ca2+ signaling sensitizes cells to recognize genomes within incoming virus particles. To our knowledge, this is the first evidence that cytosolic nucleic acid sensors recognize genomes within incoming virus particles prior to virus replication. These studies highlight the exquisite sensitivity of the cellular response to low-level stimuli and suggest that virus particle entry is sensed as a stress signal. IMPORTANCE The mechanism by which replicating viruses trigger IRF3 activation and type I IFN induction through the generation and accumulation of viral pathogen-associated molecular patterns has been well characterized. However, the mechanism by which enveloped virus particle entry mediates a stress response, leading to IRF3 activation and the IFN-independent response, remained elusive. Here, we find that Ca2+ signaling associated with membrane perturbation appears to sensitize cells to

  19. Mouse cytomegalovirus immediate-early protein 1 binds with host cell repressors to relieve suppressive effects on viral transcription and replication during lytic infection.

    PubMed

    Tang, Qiyi; Maul, Gerd G

    2003-01-01

    Herpesviruses start their transcriptional cascade at nuclear domain 10 (ND10). The deposition of virus genomes at these nuclear sites occurs due to the binding of the interferon-inducible repressor protein promyelocytic leukemia protein (PML) and/or Daxx to a viral DNA-protein complex. However, the presence of repressive proteins at the nuclear site of virus transcription has remained unexplained. We investigated the mouse cytomegalovirus (MCMV) immediate-early 1 protein (IE1), which is necessary for productive infection at low multiplicities of infection and therefore likely to be involved in overcoming cellular repression. Temporal analysis of IE1 distribution revealed its initial segregation into ND10 by binding to PML and/or Daxx and IE1-dependent recruitment of the transcriptional repressor histone deacetylase-2 (HDAC-2) to this site. However, these protein aggregates are dissociated in cells producing sufficient IE1 through titration of PML, Daxx, and HDAC-2. Importantly, binding of IE1 to HDAC-2 decreased deacetylation activity. Moreover, inhibition of HDAC by trichostatin-A resulted in an increase in viral protein synthesis, an increase in cells starting the formation of prereplication compartments, and an increase in the total infectious viruses produced. Thus, IE1, like trichostatin-A, reverses the repressive effect of HDAC evident in the presence of acetylated histones in the immediate-early promoter region. Since HDAC also binds to the promoter region of IE1, as determined by the chromatin immunoprecipitation assay, these combined results suggest that IE1 inhibits or reverses HDAC-mediated repression of the infecting viral genomes, possibly by a process akin to activation of heterochromatin. We propose that even permissive cells can repress transcription of infecting viral genomes through repressors, including HDAC, Daxx, and PML, and the segregation of IE1 to ND10 that would inactivate those repressors. The virus can counter this repression by

  20. Human Cytomegalovirus-Encoded Human Interleukin-10 (IL-10) Homolog Amplifies Its Immunomodulatory Potential by Upregulating Human IL-10 in Monocytes

    PubMed Central

    Avdic, Selmir; McSharry, Brian P.; Steain, Megan; Poole, Emma; Sinclair, John; Abendroth, Allison

    2016-01-01

    ABSTRACT The human cytomegalovirus (HCMV) gene UL111A encodes cytomegalovirus-encoded human interleukin-10 (cmvIL-10), a homolog of the potent immunomodulatory cytokine human interleukin 10 (hIL-10). This viral homolog exhibits a range of immunomodulatory functions, including suppression of proinflammatory cytokine production and dendritic cell (DC) maturation, as well as inhibition of major histocompatibility complex (MHC) class I and class II. Here, we present data showing that cmvIL-10 upregulates hIL-10, and we identify CD14+ monocytes and monocyte-derived macrophages and DCs as major sources of hIL-10 secretion in response to cmvIL-10. Monocyte activation was not a prerequisite for cmvIL-10-mediated upregulation of hIL-10, which was dose dependent and controlled at the transcriptional level. Furthermore, cmvIL-10 upregulated expression of tumor progression locus 2 (TPL2), which is a regulator of the positive hIL-10 feedback loop, whereas expression of a negative regulator of the hIL-10 feedback loop, dual-specificity phosphatase 1 (DUSP1), remained unchanged. Engagement of the hIL-10 receptor (hIL-10R) by cmvIL-10 led to upregulation of heme oxygenase 1 (HO-1), an enzyme linked with suppression of inflammatory responses, and this upregulation was required for cmvIL-10-mediated upregulation of hIL-10. We also demonstrate an important role for both phosphatidylinositol 3-kinase (PI3K) and STAT3 in the upregulation of HO-1 and hIL-10 by cmvIL-10. In addition to upregulating hIL-10, cmvIL-10 could exert a direct immunomodulatory function, as demonstrated by its capacity to upregulate expression of cell surface CD163 when hIL-10 was neutralized. This study identifies a mechanistic basis for cmvIL-10 function, including the capacity of this viral cytokine to potentially amplify its immunosuppressive impact by upregulating hIL-10 expression. IMPORTANCE Human cytomegalovirus (HCMV) is a large, double-stranded DNA virus that causes significant human disease

  1. Xenotransplantation and porcine cytomegalovirus.

    PubMed

    Denner, Joachim

    2015-01-01

    Porcine microorganisms may be transmitted to the human recipient when xenotransplantation with pig cells, tissues, and organs will be performed. Most of such microorganisms can be eliminated from the donor pig by specified or designated pathogen-free production of the animals. As human cytomegalovirus causes severe transplant rejection in allotransplantation, considerable concern is warranted on the potential pathogenicity of porcine cytomegalovirus (PCMV) in the setting of xenotransplantation. On the other hand, despite having a similar name, PCMV is different from HCMV. The impact of PCMV infection on pigs is known; however, the influence of PCMV on the human transplant recipient is unclear. However, first transplantations of pig organs infected with PCMV into non-human primates were associated with a significant reduction of the survival time of the transplants. Sensitive detection methods and strategies for elimination of PCMV from donor herds are required.

  2. Epstein-Barr virus infection induces bone resorption in apical periodontitis via increased production of reactive oxygen species.

    PubMed

    Jakovljevic, Aleksandar; Andric, Miroslav; Miletic, Maja; Beljic-Ivanovic, Katarina; Knezevic, Aleksandra; Mojsilovic, Slavko; Milasin, Jelena

    2016-09-01

    Chronic inflammatory processes in periapical tissues caused by etiological agents of endodontic origin lead to apical periodontitis. Apart from bacteria, two herpesviruses, Epstein-Barr virus (EBV) and Human cytomegalovirus (HCMV) are recognized as putative pathogens in apical periodontitis. Although previous reports suggest the involvement of EBV in the pathogenesis of apical periodontitis, its exact role in periapical bone resorption has not yet been fully elucidated. We hypothesize that EBV infection in apical periodontitis is capable of inducing periapical bone resorption via stimulation of reactive oxygen species (ROS) overproduction. Increased levels of ROS induce expression of receptor activator of nuclear factor kappa B (NF-κB) ligand (RANKL). RANKL binding to receptor activator of nuclear factor κB (RANK) present on the surface of preosteoclasts induces their maturation and activation which consequently leads to bone resorption. The potential benefit of antiviral and antioxidant-based therapies in periapical bone resorption treatment remains to be assessed. PMID:27515196

  3. New advances in CMV and immunosenescence.

    PubMed

    Sansoni, Paolo; Vescovini, Rosanna; Fagnoni, Francesco F; Akbar, Arne; Arens, Ramon; Chiu, Yen-Ling; Cičin-Šain, Luka; Dechanet-Merville, Julie; Derhovanessian, Evelyna; Ferrando-Martinez, Sara; Franceschi, Claudio; Frasca, Daniela; Fulöp, Tamas; Furman, David; Gkrania-Klotsas, Effrossyni; Goodrum, Felicia; Grubeck-Loebenstein, Beatrix; Hurme, Mikko; Kern, Florian; Lilleri, Daniele; López-Botet, Miguel; Maier, Andrea B; Marandu, Thomas; Marchant, Arnaud; Matheï, Catharina; Moss, Paul; Muntasell, Aura; Remmerswaal, Ester B M; Riddell, Natalie E; Rothe, Kathrin; Sauce, Delphine; Shin, Eui-Cheol; Simanek, Amanda M; Smithey, Megan J; Söderberg-Nauclér, Cecilia; Solana, Rafael; Thomas, Paul G; van Lier, Rene; Pawelec, Graham; Nikolich-Zugich, Janko

    2014-07-01

    Immunosenescence, defined as the age-associated dysregulation and dysfunction of the immune system, is characterized by impaired protective immunity and decreased efficacy of vaccines. An increasing number of immunological, clinical and epidemiological studies suggest that persistent Cytomegalovirus (CMV) infection is associated with accelerated aging of the immune system and with several age-related diseases. However, current evidence on whether and how human CMV (HCMV) infection is implicated in immunosenescence and in age-related diseases remains incomplete and many aspects of CMV involvement in immune aging remain controversial. The attendees of the 4th International Workshop on "CMV & Immunosenescence", held in Parma, Italy, 25-27th March, 2013, presented and discussed data related to these open questions, which are reported in this commentary.

  4. Discovery of Potent, Orally Bioavailable Inhibitors of Human Cytomegalovirus.

    PubMed

    Fader, Lee; Brault, Martine; Desjardins, Jessica; Dansereau, Nathalie; Lamorte, Louie; Tremblay, Sonia; Bilodeau, François; Bordeleau, Josée; Duplessis, Martin; Gorys, Vida; Gillard, James; Gleason, James L; James, Clint; Joly, Marc-André; Kuhn, Cyrille; Llinas-Brunet, Montse; Luo, Laibin; Morency, Louis; Morin, Sébastien; Parisien, Mathieu; Poirier, Maude; Thibeault, Carl; Trinh, Thao; Sturino, Claudio; Srivastava, Sanjay; Yoakim, Christiane; Franti, Michael

    2016-05-12

    A high-throughput screen based on a viral replication assay was used to identify inhibitors of the human cytomegalovirus. Using this approach, hit compound 1 was identified as a 4 μM inhibitor of HCMV that was specific and selective over other herpes viruses. Time of addition studies indicated compound 1 exerted its antiviral effect early in the viral life cycle. Mechanism of action studies also revealed that this series inhibited infection of MRC-5 and ARPE19 cells by free virus and via direct cell-to-cell spread from infected to uninfected cells. Preliminary structure-activity relationships demonstrated that the potency of compound 1 could be improved to a low nanomolar level, but metabolic stability was a key optimization parameter for this series. A strategy focused on minimizing metabolic hydrolysis of the N1-amide led to an alternative scaffold in this series with improved metabolic stability and good pharmacokinetic parameters in rat. PMID:27190604

  5. Rapid diagnosis and quantification of herpes simplex virus with a green fluorescent protein reporter system.

    PubMed

    Kung, S H; Wang, Y C; Lin, C H; Kuo, R L; Liu, W T

    2000-11-01

    A genetically modified cell line (Vero-ICP10-EGFP) was constructed for detection of herpes simplex virus (HSV) by a simple, rapid and direct method. The cell line was developed by stable transfection of Vero cell with a plasmid encoding the green fluorescent protein (GFP) driven by the promoter of the HSV-2 ICP10 gene. As early as 6 h after infection with HSV, fluorescence-emitting cells can be observed under a fluorescence microscope. A single infected cell emitting fluorescence can be observed with soft agar overlay by inverted fluorescence microscopy. No induction of detectable fluorescence was seen following infections with human cytomegalovirus (HCMV), varicella zoster virus (VZV), coxsackievirus A16 and enterovirus 71. Analysis by flow cytometry also demonstrated that intensity of the triggered fluorescence is proportional to the titer of HSV inoculated. Taken together, this novel GFP reporter system could become a useful means for rapid detection and quantification of HSV in clinical specimens.

  6. Ribosome profiling reveals pervasive translation outside of annotated protein-coding genes.

    PubMed

    Ingolia, Nicholas T; Brar, Gloria A; Stern-Ginossar, Noam; Harris, Michael S; Talhouarne, Gaëlle J S; Jackson, Sarah E; Wills, Mark R; Weissman, Jonathan S

    2014-09-11

    Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5' UTRs and long noncoding RNAs (lncRNAs). Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs). Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV) infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences. PMID:25159147

  7. Fluorescence lifetime biosensing with DNA microarrays and a CMOS-SPAD imager

    PubMed Central

    Giraud, Gerard; Schulze, Holger; Li, Day-Uei; Bachmann, Till T.; Crain, Jason; Tyndall, David; Richardson, Justin; Walker, Richard; Stoppa, David; Charbon, Edoardo; Henderson, Robert; Arlt, Jochen

    2010-01-01

    Fluorescence lifetime of dye molecules is a sensitive reporter on local microenvironment which is generally independent of fluorophores concentration and can be used as a means of discrimination between molecules with spectrally overlapping emission. It is therefore a potentially powerful multiplexed detection modality in biosensing but requires extremely low light level operation typical of biological analyte concentrations, long data acquisition periods and on-chip processing capability to realize these advantages. We report here fluorescence lifetime data obtained using a CMOS-SPAD imager in conjunction with DNA microarrays and TIRF excitation geometry. This enables acquisition of single photon arrival time histograms for a 320 pixel FLIM map within less than 26 seconds exposure time. From this, we resolve distinct lifetime signatures corresponding to dye-labelled HCV and quantum-dot-labelled HCMV nucleic acid targets at concentrations as low as 10 nM. PMID:21258550

  8. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates

    PubMed Central

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-01-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  9. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates.

    PubMed

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-05-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  10. The human cytomegalovirus UL133-138 gene locus attenuates the lytic viral cycle in fibroblasts.

    PubMed

    Dutta, Nirmal; Lashmit, Philip; Yuan, Jinxiang; Meier, Jeffery; Stinski, Mark F

    2015-01-01

    The genomes of HCMV clinical strains (e.g. FIX, TR, PH, etc) contain a 15 kb region that encodes 20 putative ORFs. The region, termed ULb', is lost after serial passage of virus in human foreskin fibroblast (HFF) cell culture. Compared to clinical strains, laboratory strains replicate faster and to higher titers of infectious virus. We made recombinant viruses with 22, 14, or 7 ORFs deleted from the ULb' region using FIX and TR as model clinical strains. We also introduced a stop codon into single ORFs between UL133 and UL138 to prevent protein expression. All deletions within ULb' and all stop codon mutants within the UL133 to UL138 region increased to varying degrees, viral major immediate early RNA and protein, DNA, and cell-free infectious virus compared to the wild type viruses. The wild type viral proteins slowed down the viral replication process along with cell-free infectious virus release from human fibroblast cells.

  11. Molecular diagnostics for myelin proteolipid protein gene mutations in Pelizaeus-Merzbacher disease.

    PubMed Central

    Doll, R; Natowicz, M R; Schiffmann, R; Smith, F I

    1992-01-01

    Pelizaeus-Merzbacher disease (PMD) is a clinically heterogeneous, slowly progressive leukodystrophy. The recent detection of mutations in the myelin proteolipid protein (PLP) gene in several PMD patients offers the opportunity both to design DNA-based tests that would be useful in diagnosing a proportion of PMD cases and, in particular, to evaluate the diagnostic utility of single-strand conformation polymorphism (SSCP) analysis for this disease. A combination of SSCP analysis and direct sequencing of PCR-amplified DNA was used to screen for PLP mutations in 24 patients affected with leukodystrophies of unknown etiology. Two heretofore undescribed mutations in the PLP gene were identified, Asp202His in exon 4 and Gly73Arg in exon 3. The ease and efficiency of SSCP analysis in detecting new mutations support the utilization of this technique in screening for PLP mutations in patients with unexplained leukodystrophies. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:1376966

  12. Paroxysmal exercise-induced dyskinesia, writer's cramp, migraine with aura and absence epilepsy in twin brothers with a novel SLC2A1 missense mutation.

    PubMed

    Urbizu, Aintzane; Cuenca-León, Ester; Raspall-Chaure, Miquel; Gratacòs, Margarida; Conill, Joan; Redecillas, Susana; Roig-Quilis, Manuel; Macaya, Alfons

    2010-08-15

    We report two monochorionic twins that progressively developed, between ages 5 and 10, a combination of episodic neurological disorders including paroxysmal exercise-induced dyskinesia, migraine without or with aura, absence seizures and writer's cramp. CSF/serum glucose ratio was moderately decreased in both patients. Mutational analysis of SLC2A1 gene identified a de novo heterozygous missense mutation in exon 4. This novel mutation has been previously showed to disrupt glucose transport in vitro. Both patients showed immediate and near-complete response to ketogenic diet. This clinical observation suggests that a high index of suspicion for GLUT1 deficiency syndrome is warranted in evaluating patients with multiple neurological paroxysmal events.

  13. A novel homozygous SLC19A2 mutation in a Portuguese patient with diabetes mellitus and thiamine-responsive megaloblastic anaemia.

    PubMed

    Tahir, Sophia; Leijssen, Lieve Gj; Sherif, Maha; Pereira, Carla; Morais, Anabela; Hussain, Khalid

    2015-01-01

    Thiamine-responsive megaloblastic anaemia (TRMA) is a rare syndrome where patients present with early onset diabetes mellitus, megaloblastic anaemia and sensorineural deafness. This report describes a new case of TRMA syndrome in a female patient of Portuguese descent, born to unrelated parents. The patient was found to have a novel homozygous change R397X in exon 4 of the SLC19A2 gene, leading to a premature stop codon. The patient's diabetes and anaemia showed a good response to daily thiamine doses, reducing the daily insulin dose requirement. The report further indicates that TRMA is not only limited to consanguineous or ethnically isolated families, and should be considered as a differential diagnosis for patients presenting with suggestive clinical symptoms. PMID:25878670

  14. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  15. [Vertebral and multiple organ malformations in a black and white German Holstein calf].

    PubMed

    Buck, Bettina Constanze; Ulrich, Reiner; Wöhlke, Anne; Kuiper, Heidi; Baumgärtner, Wolfgang; Distl, Ottmar

    2010-01-01

    A male black and white German Holstein calf showed a congenital, high-graded scoliosis and rotation of the thoracal spinal cord associated with shortening and fusion of multiple vertebral bodies and abnormal bending of the processus spinosus. Furthermore reduced birth weight, partial hypoplasia of the lung, excessive liver segmentation, doubled gall bladder, rectal atresia, horseshoe kidney, and uterine atresia were found. Due to the exclusion of a point mutation in exon 4 of the solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3 (SLC35A3) gene, complex vertebral malformation (CVM) was ruled out. Conclusively, it is hypothetized that the presented case resembles a new brachyspina syndrome with a still unresolved genetic etiology.

  16. Case report: first successful application of preimplantation genetic diagnosis for hereditary angiooedema.

    PubMed

    Bautista-Llácer, Rosa; Alberola, Trinitat M; Vendrell, Xavier; Fernández, Esther; Pérez-Alonso, Manuel

    2010-11-01

    Hereditary angiooedema is an autosomal dominant disease caused by mutations in the SERPING1 gene. It is characterized by oedemas in different parts of the body, being particularly dangerous when swelling involves the upper airway. Preimplantation genetic diagnosis (PGD) was performed in a couple where the woman carries a deletion of 2.9Kb that includes exon 4 of the SERPING1 gene. Four polymorphic short tandem repeat markers were tested in order to establish the disease-bearing haplotype and three of them were fully informative. Amplification efficiency at the preclinical work up ranged from 71% to 100% for each locus and allele drop out rates were between 0% and 20% for the polymorphic markers. The couple underwent PGD using fluorescent multiplex heminested polymerase chain reaction. Six embryos were biopsied and five of them were diagnosed as healthy. Two embryos were transferred and a singleton pregnancy was achieved, resulting in the birth of a healthy boy.

  17. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M

    1994-01-01

    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  18. FH Tulsa-1 and -2: Two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male

    SciTech Connect

    Blackett, P.R.; Altmiller, D.H.; Jelley, D.; Wilson, D.P.

    1995-11-20

    A two-year-old African American boy presented with cutaneous xanthomata and extreme hypercholesterolemia. Subsequent studies revealed that the LDL-cholesterol was 1,001 mg/dl and apoB 507 mg/dl. LDL-receptor activity was almost undetectable, which is compatible with the finding of two newly described defective alleles on exon 4 of the LDL-receptor gene coding for part of the ligand-binding domain. One allele contained a 21 base-pair insertion from codon 200 to 207 whereas the other had a point mutation at codon 207. The rarity of genes for FH reported in individuals of African ancestry is discussed. 16 refs., 2 figs., 2 tabs.

  19. Clinical variability of the cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy phenotype in two siblings of a large family showing the same mutation

    PubMed Central

    Vyshka, Gentian; Kruja, Jera

    2013-01-01

    A 44-year-old Albanian male was consulted and diagnosed with dementia. His magnetic resonance imaging suggested diffuse white matter changes. The suspicion of cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) was raised, and a genetic analysis confirmed such a suspicion through uncovering a pathogenic mutation at the level of exon 4 (c.475C>T) of chromosome 19. The patient came from a large family of 13 children, all of whom underwent clinical, genetic, and imaging examination. The pathogenic mutation was found present only in his eldest sister (50 years old), and she presented also very suggestive signs of CADASIL in her respective imaging study, but without any clinically significant counterpart. All other siblings were free from clinical and radiological signs of the disorder. Our opinion was that we were dealing w