Sample records for heat denatured p53

  1. Modifying the Cold Gelation Properties of Quinoa Protein Isolate: Influence of Heat-Denaturation pH in the Alkaline Range.

    PubMed

    Mäkinen, Outi E; Zannini, Emanuele; Arendt, Elke K

    2015-09-01

    Heat-denaturation of quinoa protein isolate (QPI) at alkali pH and its influence on the physicochemical and cold gelation properties was investigated. Heating QPI at pH 8.5 led to increased surface hydrophobicity and decreases in free and bound sulfhydryl group contents. Heating at pH 10.5 caused a lesser degree of changes in sulfhydryl groups and surface hydrophobicity, and the resulting solutions showed drastically increased solubility. SDS PAGE revealed the presence of large aggregates only in the sample heated at pH 8.5, suggesting that any aggregates present in the sample heated at pH 10.5 were non-covalently bound and disintegrated in the presence of SDS. Reducing conditions partially dissolved the aggregates in the pH 8.5 heated sample indicating the occurrence of disulphide bonding, but caused no major alterations in the separation pattern of the pH 10.5 heated sample. Denaturation pH influenced the cold gelation properties greatly. Solutions heated at pH 8.5 formed a coarse coagulum with maximum G' of 5 Pa. Heat-denaturation at 10.5 enabled the proteins to form a finer and regularly structured gel with a maximum G' of 1140 Pa. Particle size analysis showed that the pH 10.5 heated sample contained a higher level of very small particles (0.1-2 μm), and these readily aggregated into large particles (30-200 μm) when pH was lowered to 5.5. Differences in the nature of aggregates formed during heating may explain the large variation in gelation properties.

  2. Effect of heat, pH, ultrasonication and ethanol on the denaturation of whey protein isolate using a newly developed approach in the analysis of difference-UV spectra.

    PubMed

    Nikolaidis, Athanasios; Andreadis, Marios; Moschakis, Thomas

    2017-10-01

    A newly developed method of analysis of difference-UV spectra was successfully implemented in the study of the effect of heat, pH, ultrasonication and ethanol on the denaturation of whey protein isolate. It was found that whey proteins exhibit their highest stability against heat denaturation at pH 3.75. At very low pH values, i.e. 2.5, they exhibited considerable cold denaturation, while after heating at this pH value, the supplementary heat denaturation rate was lower compared to that at neutral pH. The highest heat denaturation rates were observed at pH values higher than neutral. High power sonication on whey proteins, previously heated at 90°C for 30min, resulted in a rather small reduction of the fraction of the heat denatured protein aggregates. Finally, when ethanol was used as a cosolvent in the concentration range 20-50%, a sharp increase in the degree of denaturation, compared to the native protein solution, was observed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Cooperative Unfolding of Residual Structure in Heat Denatured Proteins by Urea and Guanidinium Chloride.

    PubMed

    Singh, Ritu; Hassan, Md Imtaiyaz; Islam, Asimul; Ahmad, Faizan

    2015-01-01

    The denatured states of proteins have always attracted our attention due to the fact that the denatured state is the only experimentally achievable state of a protein, which can be taken as initial reference state for considering the in vitro folding and defining the native protein stability. It is known that heat and guanidinium chloride (GdmCl) give structurally different states of RNase-A, lysozyme, α-chymotrypsinogen A and α-lactalbumin. On the contrary, differential scanning calorimetric (DSC) and isothermal titration calorimetric measurements, reported in the literature, led to the conclusion that heat denatured and GdmCl denatured states are thermodynamically and structurally identical. In order to resolve this controversy, we have measured changes in the far-UV CD (circular dichroism) of these heat-denatured proteins on the addition of different concentrations of GdmCl. The observed sigmoidal curve of each protein was analyzed for Gibbs free energy change in the absence of the denaturant (ΔG0X→D) associated with the process heat denatured (X) state ↔ GdmCl denatured (D) state. To confirm that this thermodynamic property represents the property of the protein alone and is not a manifestation of salvation effect, we measured urea-induced denaturation curves of these heat denatured proteins under the same experimental condition in which GdmCl-induced denaturation was carried out. In this paper we report that (a) heat denatured proteins contain secondary structure, and GdmCl (or urea) induces a cooperative transition between X and D states, (b) for each protein at a given pH and temperature, thermodynamic cycle connects quantities, ΔG0N→X (native (N) state ↔ X state), ΔG0X→D and ΔG0N→D (N state ↔ D state), and (c) there is not a good enthalpy difference between X and D states, which is the reason for the absence of endothermic peak in DSC scan for the transition, X state ↔ D state.

  4. Cooperative Unfolding of Residual Structure in Heat Denatured Proteins by Urea and Guanidinium Chloride

    PubMed Central

    Singh, Ritu; Hassan, Md. Imtaiyaz; Islam, Asimul; Ahmad, Faizan

    2015-01-01

    The denatured states of proteins have always attracted our attention due to the fact that the denatured state is the only experimentally achievable state of a protein, which can be taken as initial reference state for considering the in vitro folding and defining the native protein stability. It is known that heat and guanidinium chloride (GdmCl) give structurally different states of RNase-A, lysozyme, α-chymotrypsinogen A and α-lactalbumin. On the contrary, differential scanning calorimetric (DSC) and isothermal titration calorimetric measurements, reported in the literature, led to the conclusion that heat denatured and GdmCl denatured states are thermodynamically and structurally identical. In order to resolve this controversy, we have measured changes in the far-UV CD (circular dichroism) of these heat-denatured proteins on the addition of different concentrations of GdmCl. The observed sigmoidal curve of each protein was analyzed for Gibbs free energy change in the absence of the denaturant (ΔG 0 X→D) associated with the process heat denatured (X) state ↔ GdmCl denatured (D) state. To confirm that this thermodynamic property represents the property of the protein alone and is not a manifestation of salvation effect, we measured urea-induced denaturation curves of these heat denatured proteins under the same experimental condition in which GdmCl-induced denaturation was carried out. In this paper we report that (a) heat denatured proteins contain secondary structure, and GdmCl (or urea) induces a cooperative transition between X and D states, (b) for each protein at a given pH and temperature, thermodynamic cycle connects quantities, ΔG 0 N→X (native (N) state ↔ X state), ΔG 0 X→D and ΔG 0 N→D (N state ↔ D state), and (c) there is not a good enthalpy difference between X and D states, which is the reason for the absence of endothermic peak in DSC scan for the transition, X state ↔ D state. PMID:26046628

  5. Plasma protein denaturation with graded heat exposure.

    PubMed

    Vazquez, R; Larson, D F

    2013-11-01

    During cardiopulmonary bypass (CPB), perfusion at tepid temperatures (33-35 °C) is recommended to avoid high temperature cerebral hyperthermia during and after the operation. However, the ideal temperature for uncomplicated adult cardiac surgery is an unsettled question. Typically, the heat exchanger maximum temperature is monitored between 40-42 °C to prevent denaturation of plasma proteins, but studies have not been performed to make these conclusions. Therefore, our hypothesis was to determine the temperature in which blood plasma protein degradation occurs after 2 hours of heat exposure. As a result, blood plasma proteins were exposed to heat in the 37-50 °C range for 2 hours. Plasma protein samples were loaded onto an 8-12% gradient gel for SDS-PAGE and low molecular weight plasma protein degradation was detected with graded heat exposure. Protein degradation was first detected between 43-45 °C of heat exposure. This study supports the practice of monitoring the heat exchanger between 40-42 °C to prevent denaturation of plasma proteins.

  6. Effect of heating strategies on whey protein denaturation--Revisited by liquid chromatography quadrupole time-of-flight mass spectrometry.

    PubMed

    Akkerman, M; Rauh, V M; Christensen, M; Johansen, L B; Hammershøj, M; Larsen, L B

    2016-01-01

    Previous standards in the area of effect of heat treatment processes on milk protein denaturation were based primarily on laboratory-scale analysis and determination of denaturation degrees by, for example, electrophoresis. In this study, whey protein denaturation was revisited by pilot-scale heating strategies and liquid chromatography quadrupole time-of-flight mass spectrometer (LC/MC Q-TOF) analysis. Skim milk was heat treated by the use of 3 heating strategies, namely plate heat exchanger (PHE), tubular heat exchanger (THE), and direct steam injection (DSI), under various heating temperatures (T) and holding times. The effect of heating strategy on the degree of denaturation of β-lactoglobulin and α-lactalbumin was determined using LC/MC Q-TOF of pH 4.5-soluble whey proteins. Furthermore, effect of heating strategy on the rennet-induced coagulation properties was studied by oscillatory rheometry. In addition, rennet-induced coagulation of heat-treated micellar casein concentrate subjected to PHE was studied. For skim milk, the whey protein denaturation increased significantly as T and holding time increased, regardless of heating method. High denaturation degrees were obtained for T >100°C using PHE and THE, whereas DSI resulted in significantly lower denaturation degrees, compared with PHE and THE. Rennet coagulation properties were impaired by increased T and holding time regardless of heating method, although DSI resulted in less impairment compared with PHE and THE. No significant difference was found between THE and PHE for effect on rennet coagulation time, whereas the curd firming rate was significantly larger for THE compared with PHE. Micellar casein concentrate possessed improved rennet coagulation properties compared with skim milk receiving equal heat treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Thermal and chemical denaturation of the BRCT functional module of human 53BP1.

    PubMed

    Thanassoulas, Angelos; Nomikos, Michail; Theodoridou, Maria; Stavros, Philemon; Mastellos, Dimitris; Nounesis, George

    2011-10-01

    BRCTs are protein-docking modules involved in eukaryotic DNA repair. They are characterized by low sequence homology with generally well-conserved structure organization. In a considerable number of proteins, a pair of BRCT structural repeats occurs, connected with inter-BRCT linkers, variable in length, sequence and structure. Linkers may separate and control the relative position of BRCT domains as well as protect and stabilize the hydrophobic inter-BRCT interface region. Their vital role in protein function has been demonstrated by recent findings associating missense mutations in the inter-repeat linker region of the BRCT domain of BRCA1 (BRCA1-BRCT) to hereditary breast/ovarian cancer. The interaction of 53BP1 with the core domain of the p53 tumor suppressor involves the C-terminal BRCT repeat as well as the inert-BRCT linker of the tandem BRCT domain of 53BP1 (53BP1-BRCT). High-accuracy differential scanning calorimetry (DSC) and circular dichroism (CD) have been employed to characterize the heat-induced unfolding of 53BP1-BRCT domain. The calorimetric results provide evidence for unfolding to an intermediate, only partly unfolded state, which, based on the CD results, retains the secondary structural characteristics of the native protein. A direct comparison with the corresponding thermal processes for BRAC1-BRCT and BARD1-BRCT provides evidence that the observed behavior is analogous to BRCA1-BRCT even though the two domains differ substantially in the linker structure. Moreover, chemical denaturation experiments of the untagged 53BP1-BRCT and comparison with BRCA1 and BARD1 BRCTs show that no clear association can be drawn between the structural organization of the inter-BRCT linkers and the overall stability of the BRCT domains. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. 27 CFR 19.386 - Adjusting pH of denatured spirits.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

  9. 27 CFR 19.386 - Adjusting pH of denatured spirits.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

  10. 27 CFR 19.386 - Adjusting pH of denatured spirits.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

  11. 27 CFR 19.386 - Adjusting pH of denatured spirits.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... will counteract or reduce the effect of the denaturants. A proprietor who adjusts the pH of denatured... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Adjusting pH of denatured... of Articles Rules for Denaturing Spirits and Testing Denaturants § 19.386 Adjusting pH of denatured...

  12. The expression and proangiogenic effect of nucleolin during the recovery of heat-denatured HUVECs.

    PubMed

    Liang, Pengfei; Jiang, Bimei; Lv, Chunliu; Huang, Xu; Sun, Li; Zhang, Pihong; Huang, Xiaoyuan

    2013-10-01

    The present study aims to examine the expression patterns and roles of nucleolin during the recovery of heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burn model in Sprague-Dawley rats and the heat denatured cell model (52°C, 35s) were used. The expression of nucleolin was measured using Western blot analysis and real-time PCR. Angiogenesis was assessed using in vitro parameters including endothelial cell proliferation, transwell migration assay, and scratched wound healing. Gene transfection and RNA interference approaches were employed to investigate the roles of nucleolin. Nucleolin mRNA and protein expression showed a time-dependent increase during the recovery of heat-denatured dermis and HUVECs. Heat-denaturation time-dependently promoted cell growth, adhesion, migration, scratched wound healing and formation of tube-like structures in HUVECs. These effects of heat denaturation on endothelial wound healing and formation of tube-like structures were prevented by knockdown of nucleolin, whereas over-expression of nucleolin increased cell growth, migration, and formation of tube-like structures in cultured HUVEC endothelial cells. In addition, we found that the expression of vascular endothelial growth factor (VEGF) increased during the recovery of heat-denatured dermis and HUVECs, and nucleolin up-regulated VEGF in HUVECs. The present study reveals that the expression of nucleolin is up-regulated, and plays a pro-angiogenic role during the recovery of heat-denatured dermis and its mechanism is probably dependent on production of VEGF. We find a novel and important pro-angiogenic role of nucleolin during the recovery of heat-denatured dermis. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Experimental and Modelling Study of the Denaturation of Milk Protein by Heat Treatment

    PubMed Central

    Qian, Fang; Sun, Jiayue; Cao, Di; Tuo, Yanfeng; Jiang, Shujuan; Mu, Guangqing

    2017-01-01

    Heat treatment of milk aims to inhibit the growth of microbes, extend the shelf-life of products and improve the quality of the products. Heat treatment also leads to denaturation of whey protein and the formation of whey protein-casein polymer, which has negative effects on milk product. Hence the milk heat treatment conditions should be controlled in milk processing. In this study, the denaturation degree of whey protein and the combination degree of whey protein and casein when undergoing heat treatment were also determined by using the Native-PAGE and SDS-PAGE analysis. The results showed that the denaturation degree of whey protein and the combination degree of whey protein with casein extended with the increase of the heat-treated temperature and time. The effects of the heat-treated temperature and heat-treated time on the denaturation degree of whey protein and on the combination degree of whey protein and casein were well described using the quadratic regression equation. The analysis strategy used in this study reveals an intuitive and effective measure of the denaturation degree of whey protein, and the changes of milk protein under different heat treatment conditions efficiently and accurately in the dairy industry. It can be of great significance for dairy product proteins following processing treatments applied for dairy product manufacturing. PMID:28316470

  14. Kinetic and thermodynamic parameters for heat denaturation of human recombinant lactoferrin from rice.

    PubMed

    Castillo, Eduardo; Pérez, María Dolores; Franco, Indira; Calvo, Miguel; Sánchez, Lourdes

    2012-06-01

    Heat denaturation of recombinant human lactoferrin (rhLf) from rice with 3 different iron-saturation degrees, holo rhLf (iron-saturated), AsIs rhLf (60% iron saturation), and apo rhLf (iron-depleted), was studied. The 3 forms of rhLf were subjected to heat treatment, and the kinetic and thermodynamic parameters of the denaturation process were determined. Thermal denaturation of rhLf was assessed by measuring the loss of reactivity against specific antibodies. D(t) values (time to reduce 90% of immunoreactivity) decreased with increasing temperature of treatment for apo and holo rhLf, those values being higher for the iron-saturated form, which indicates that iron confers thermal stability to rhLf. However, AsIs rhLf showed a different behaviour with an increase in resistance to heat between 79 °C and 84 °C, so that the kinetic parameters could not be calculated. The heat denaturation process for apo and holo rhLf was best described assuming a reaction order of 1.5. The activation energy of the denaturation process was 648.20 kJ/mol for holo rhLf and 406.94 kJ/mol for apo rhLf, confirming that iron-depleted rhLf is more sensitive to heat treatment than iron-saturated rhLf.

  15. Thermal denaturation of egg protein under nanosecond pulsed laser heating of gold nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meshalkin, Yu P; Lapin, I N; Svetlichnyi, Valery A

    Thermal denaturation of egg protein in the presence of gold nanoparticles via their heating at the plasmon resonance wavelength by the pulsed radiation of the second harmonic of an Nd:YAG laser (532 nm) is investigated. The experimental dependence of the protein denaturation time on the mean laser power is obtained. The heating temperature of the medium with gold nanoparticles is calculated. The numerical estimates of the temperature of the heated medium containing protein and gold nanoparticles (45.3 deg. C at the moment of protein denaturation) are in good agreement with the literature data on its thermal denaturation and with themore » data of pyrometric measurements (42.0 {+-} 1.5 deg. C). The egg protein may be successfully used to investigate the specific features of laser heating of proteins in the presence of metal nanoparticles under their excitation at the plasmon resonance wavelength. (laser methods in biology)« less

  16. [Inactivating Effect of Heat-Denatured Lysozyme on Murine Norovirus in Bread Fillings].

    PubMed

    Takahashi, Michiko; Yasuda, Yuka; Takahashi, Hajime; Takeuchi, Akira; Kuda, Takashi; Kimura, Bon

    2018-01-01

    In this study, we investigated the viability of murine norovirus strain 1 (MNV-1), a surrogate for human norovirus, in bread fillings used for making stuffed buns and pastries. The inactivating effect of heat-denatured lysozyme, which was recently reported to have an antiviral effect, on MNV-1 contaminating the bread fillings was also examined. MNV-1 was inoculated into two types of fillings (chocolate cream, marmalade jam) at 4.5 log PFU/g, and the bread fillings were stored at 4℃ for 5 days. MNV-1 remained viable in the bread fillings during storage. However, addition of 1% heat-denatured lysozyme to the fillings resulted in a decrease of MNV-1 infectivity immediately after inoculation, in both fillings. On the fifth day of storage, MNV-1 infectivity was decreased by 1.2 log PFU/g in chocolate cream and by 0.9 log PFU/g in marmalade jam. Although the mechanism underlying the anti-norovirus effect of heat-denatured lysozyme has not been clarified, our results suggest that heat-denatured lysozyme can be used as an inactivating agent against norovirus in bread fillings.

  17. Joule Heating and Thermal Denaturation of Proteins in Nano-ESI Theta Tips

    NASA Astrophysics Data System (ADS)

    Zhao, Feifei; Matt, Sarah M.; Bu, Jiexun; Rehrauer, Owen G.; Ben-Amotz, Dor; McLuckey, Scott A.

    2017-10-01

    Electro-osmotically induced Joule heating in theta tips and its effect on protein denaturation were investigated. Myoglobin, equine cytochrome c, bovine cytochrome c, and carbonic anhydrase II solutions were subjected to electro-osmosis in a theta tip and all of the proteins were denatured during the process. The extent of protein denaturation was found to increase with the applied square wave voltage and electrolyte concentration. The solution temperature at the end of a theta tip was measured directly by Raman spectroscopy and shown to increase with the square wave voltage, thereby demonstrating the effect of Joule heating through an independent method. The electro-osmosis of a solution comprised of myoglobin, bovine cytochrome c, and ubiquitin demonstrated that the magnitude of Joule heating that causes protein denaturation is positively correlated with protein melting temperature. This allows for a quick determination of a protein's relative thermal stability. This work establishes a fast, novel method for protein conformation manipulation prior to MS analysis and provides a temperature-controllable platform for the study of processes that take place in solution with direct coupling to mass spectrometry. [Figure not available: see fulltext.

  18. Association of denatured whey proteins with casein micelles in heated reconstituted skim milk and its effect on casein micelle size.

    PubMed

    Anema, Skelte G; Li, Yuming

    2003-02-01

    When skim milk at pH 6.55 was heated (75 to 100 degrees C for up to 60 min), the casein micelle size, as monitored by photon correlation spectroscopy, was found to increase during the initial stages of heating and tended to plateau on prolonged heating. At any particular temperature, the casein micelle size increased with longer holding times, and, at any particular holding time, the casein micelle size increased with increasing temperature. The maximum increase in casein micelle size was about 30-35 nm. The changes in casein micelle size were poorly correlated with the level of whey protein denaturation. However, the changes in casein micelle size were highly correlated with the levels of denatured whey proteins that were associated with the casein micelles. The rate of association of the denatured whey proteins with the casein micelles was considerably slower than the rate of denaturation of the whey proteins. Removal of the whey proteins from the skim milk resulted in only small changes in casein micelle size during heating. Re-addition of beta-lactoglobulin to the whey-protein-depleted milk caused the casein micelle size to increase markedly on heat treatment. The changes in casein micelle size induced by the heat treatment of skim milk may be a consequence of the whey proteins associating with the casein micelles. However, these associated whey proteins would need to occlude a large amount of serum to account for the particle size changes. Separate experiments showed that the viscosity changes of heated milk and the estimated volume fraction changes were consistent with the particle size changes observed. Further studies are needed to determine whether the changes in size are due to the specific association of whey proteins with the micelles or whether a low level of aggregation of the casein micelles accompanies this association behaviour. Preliminary studies indicated lower levels of denatured whey proteins associated with the casein micelles and smaller

  19. The expression of miR-125b regulates angiogenesis during the recovery of heat-denatured HUVECs.

    PubMed

    Zhou, Situo; Zhang, Pihong; Liang, Pengfei; Huang, Xiaoyuan

    2015-06-01

    In previous studies we found that miR-125b was down-regulated in denatured dermis of deep partial thickness burn patients. Moreover, miR-125b inhibited tumor-angiogenesis associated with the decrease of ERBB2 and VEGF expression in ovarian cancer cells and breast cancer cells, etc. In this study, we investigated the expression patterns and roles of miR-125b during the recovery of denatured dermis and heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burns in Sprague-Dawley rats and the heat-denatured cells (52°C, 35 s) were used for analysis. Western blot analysis and real-time PCR were applied to evaluate the expression of miR-125b and ERBB2 and VEGF. The ability of angiogenesis in heat-denatured HUVECs was analyzed by scratch wound healing and tube formation assay after pri-miR-125b or anti-miR-125b transfection. miR-125b expression was time-dependent during the recovery of heat-denatured dermis and HUVECs. Moreover, miR-125b regulated ERBB2 mRNA and Protein Expression and regulated angiogenesis association with regulating the expression of VEGF in heat-denatured HUVECs. Taken together our results show that the expression of miR-125b is time-dependent and miR-125b plays a regulatory role of angiogenesis during wound healing after burns. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  20. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    PubMed

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Heat-induced Irreversible Denaturation of the Camelid Single Domain VHH Antibody Is Governed by Chemical Modifications

    PubMed Central

    Akazawa-Ogawa, Yoko; Takashima, Mizuki; Lee, Young-Ho; Ikegami, Takahisa; Goto, Yuji; Uegaki, Koichi; Hagihara, Yoshihisa

    2014-01-01

    The variable domain of camelid heavy chain antibody (VHH) is highly heat-resistant and is therefore ideal for many applications. Although understanding the process of heat-induced irreversible denaturation is essential to improve the efficacy of VHH, its inactivation mechanism remains unclear. Here, we showed that chemical modifications predominantly governed the irreversible denaturation of VHH at high temperatures. After heat treatment, the activity of VHH was dependent only on the incubation time at 90 °C and was insensitive to the number of heating (90 °C)-cooling (20 °C) cycles, indicating a negligible role for folding/unfolding intermediates on permanent denaturation. The residual activity was independent of concentration; therefore, VHH lost its activity in a unimolecular manner, not by aggregation. A VHH mutant lacking Asn, which is susceptible to chemical modifications, had significantly higher heat resistance than did the wild-type protein, indicating the importance of chemical modifications to VHH denaturation. PMID:24739391

  2. Hemoglobin stability: observations on the denaturation of normal and abnormal hemoglobins by oxidant dyes, heat, and alkali

    PubMed Central

    Rieder, Ronald F.

    1970-01-01

    Several unstable mutant hemoglobins have alterations which affect areas of the molecule involved in the attachment of heme to globin. Loss of heme from globin has been demonstrated during the denaturation of some of these unstable mutants. The importance of heme ligands for the stability of hemoglobin was illustrated in the present experiments on the denaturation of several hemoglobins and hemoglobin derivatives by heat, oxidative dyes, and alkali. Heating of normal hemolysates diluted to 4 g of hemoglobin per 100 ml at 50°C for 20 hr in 0.05 M sodium phosphate, pH 7.4, caused precipitation of 23-54% of the hemoglobin. Dialysis against water or dilution of the sample decreased denaturation to 12-20%. Precipitation was decreased to less than 3.5% by the presence of 0.015 M potassium cyanide. Increasing the ionic strength of the medium increased precipitation. Cyanide prevented the formation of inclusion bodies when red cells containing unstable hemoglobin Philly, β35 tyr → phe, were incubated with the redox dye new methylene blue. Conversion to methemoglobin increased the rate of alkali denaturation of hemoglobin but the presence of potassium cyanide returned the denaturation rate to that of ferrohemoglobin. The ability of cyanide to decrease heat precipitation of hemoglobin may depend on a dimeric or tetrameric state of the hemoglobin molecule. Purified β-chains, which exist as tetramers, were stabilized but purified monomeric α-chains were not rendered more heat resistant by the ligand. Stabilization of hemoglobin by cyanide required binding of the ligand to only one heme of an αβ-dimer. Hemoglobin Gun Hill, an unstable molecule with heme groups present only on the α-chains was quite heat stable in the presence of cyanide. The binding of cyanide to the iron atom in methemoglobin is thought to be associated with increased planarity of the heme group and increased stability of the heme-globin complex. The stabilizing effect of cyanide in the above

  3. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    PubMed Central

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  4. Heat-denatured lysozyme could be a novel disinfectant for reducing hepatitis A virus and murine norovirus on berry fruit.

    PubMed

    Takahashi, Michiko; Okakura, Yumiko; Takahashi, Hajime; Imamura, Minami; Takeuchi, Akira; Shidara, Hiroyuki; Kuda, Takashi; Kimura, Bon

    2018-02-02

    Hepatitis A virus (HAV) is well known worldwide as a causative virus of acute hepatitis. In recent years, numerous cases of HAV infection caused by HAV-contaminated berries have occurred around the world. Because berries are often consumed without prior heating, reliable disinfection of the raw fruit is important in order to prevent HAV outbreaks. Previous studies have found that murine norovirus strain 1 (MNV-1) and human norovirus GII.4 were inactivated in heat-denatured lysozyme solution. In this study, we investigated whether or not heat-denatured lysozyme is effective in inactivating HAV and whether it could be an effective disinfectant for berries contaminated with HAV or MNV-1. We examined the inactivating effect of heat-denatured lysozyme on three strains of HAV and found that it reduced the infectivity of all three strains. We then immersed blueberries and mixed berries into solutions of HAV or MNV-1, and disinfected them by soaking them in 1% heat-denatured lysozyme for 1min. Consequently, the infectious HAV and MNV-1 contaminating the berries were decreased by >3.1 log units in all samples. Our results demonstrate that heat-denatured lysozyme effectively inactivates HAV and suggest that heat-denatured lysozyme may be an effective disinfectant for berry fruit, which is a potential source of HAV food poisoning. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Hsp70- and p53-reponses after heat treatment and/or X-irradiation mediate the susceptibility of hematopoietic cells to undergo apoptosis.

    PubMed

    Nijhuis, E H A; Poot, A A; Feijen, J; Vermes, I

    2008-02-01

    The effect of heat treatment in combination with X-irradiation was examined with regard to expression of p53, a tumor suppressor gene product, and Hsp70, a heat-shock protein, in association with the occurrence of programmed cell death (apoptosis). Three hematopoietic cell lines (HSB2, HL60 and Kasumi-1), which differ in p53 status, were exposed to 42.5 degrees C during one hour and/or X-radiation (total dose 8 Gy). After exposure, both mRNA and protein expression levels of Hsp70 and p53 were investigated by real-time PCR (polymerase chain reaction) and Western blotting. Apoptosis was simultaneously analyzed by observation of cell morphology as well as flowcytometric determination of Annexin V binding to phosphatidylserine and propidium iodide exclusion. Both HL60 and HSB2 cell lines with a low p53 status and a quick response to heat treatment with Hsp70 over-expression are less susceptible to heat-induced apoptosis compared to Kasumi-1 cells with wild-type p53 protein and no Hsp70 response. The combination of first applying X-irradiation followed by heat treatment resulted in the most effective induction of apoptosis due to impairment of the Hsp70 response in all three cell lines. These results indicate that the Hsp70 response and p53 status mediate the susceptibility of hematopoietic cells to undergo heat-induced apoptosis. Therefore, these parameters can be used as markers to predict the effectiveness of hyperthermia in cancer treatment.

  6. Reversible and non-reversible thermal denaturation of lysozyme with varying pH at low ionic strength.

    PubMed

    Blumlein, Alice; McManus, Jennifer J

    2013-10-01

    DSC analysis has been used to quantify the reversibility of unfolding following thermal denaturation of lysozyme. Since the temperature at which protein unfolding occurs, Tm, varies with different solution conditions, the effect on the melting temperature and the degree of refolding after thermal denaturation in low ionic strength sodium phosphate buffers (5-1000mM) over a range of pH (5-9) in the presence/absence of disaccharides is examined. This study compares the enthalpies of unfolding during successive heating cycles to quantify reversibility following thermal denaturation. The disaccharides, trehalose and maltose were used to assess if the disaccharide induced increase in Tm is reflected in the reversibility of thermally induced denaturation. There was extensive overlap between the Tm values where non-reversible and reversible thermal denaturation occurred. Indeed, for pH6, at the highest and lowest Tm, no refolding was observed whereas refolding was observed for intermediate values, but with similar Tm values having different proportions of refolded protein. We established a method to measure the degree of reversible unfolding following thermal denaturation and hence indirectly, the degree to which protein is lost to irreversible aggregation, and show that solution conditions which increase melt transition temperatures do not automatically confer an increase in reversibility. This type of analysis may prove useful in assessing the stability of proteins in both the biopharmaceutical and food industries. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. The role of intra-domain disulfide bonds in heat-induced irreversible denaturation of camelid single domain VHH antibodies

    PubMed Central

    Akazawa-Ogawa, Yoko; Uegaki, Koichi; Hagihara, Yoshihisa

    2016-01-01

    Camelid-derived single domain VHH antibodies are highly heat resistant, and the mechanism of heat-induced VHH denaturation predominantly relies on the chemical modification of amino acids. Although chemical modification of disulfide bonds has been recognized as a cause for heat-induced denaturation of many proteins, there have been no mutagenesis studies, in which the number of disulfide bonds was controlled. In this article, we examined a series of mutants of two different VHHs with single, double or no disulfide bonds, and scrutinized the effects of these disulfide bond modifications on VHH denaturation. With the exception of one mutant, the heat resistance of VHHs decreased when the number of disulfide bonds increased. The effect of disulfide bonds on heat denaturation was more striking if the VHH had a second disulfide bond, suggesting that the contribution of disulfide shuffling is significant in proteins with multiple disulfide bonds. Furthermore, our results directly indicate that removal of a disulfide bond can indeed increase the heat resistance of a protein, irrespective of the negative impact on equilibrium thermodynamic stability. PMID:26289739

  8. Reassociation of dissociated caseins upon acidification of heated pH-adjusted skim milk.

    PubMed

    Anema, Skelte G; Li, Yuming

    2015-05-01

    Milk was heated at different pH (pH 6.5-7.1) and temperatures (20-120 °C/10 min). This resulted in different levels of casein and denatured whey proteins to be distributed between the colloidal and serum phases. The milks were subsequently acidified and the distribution of protein between colloidal and serum was monitored at different pH. On acidification to pH 5.4, the serum phase caseins and denatured whey proteins partially reassociated with the caseins, although a complex behaviour was observed at ∼ pH 5.4 where additional casein dissociation occurred in some samples. At pH below 5.4 the caseins and denatured whey proteins rapidly aggregated. No separate aggregation of κ-casein/denatured whey protein complexes or κ-casein depleted micelles was observed. The earlier gelation of milks heated at higher pH was likely to be due to the destabilisation of the entire milk protein system rather than a preferential aggregation of the serum phase proteins. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Yogurt made from milk heated at different pH values.

    PubMed

    Ozcan, Tulay; Horne, David S; Lucey, John A

    2015-10-01

    Milk for yogurt manufacture is subjected to high heat treatment to denature whey proteins. Low milk pH values (≤ 6.5) at heating result in most denatured whey proteins becoming associated with casein micelles, whereas high milk pH values (≥ 7.0) at heating result in the formation of mostly soluble (nonmicellar) denatured whey protein complexes. There are conflicting reports on the relative importance of soluble and casein-bound whey protein aggregates on the properties of acid gels. Prior studies investigating the effect of pH of milk at heating used model gels in which milk was acidified by glucono-δ-lactone; in this study, we prepared yogurt gels using commercial starter cultures. Model acid gels can have very different texture and physical properties from those made by fermentation with starter cultures. In this study, we investigated the effects of different pH values of milk at heating on the rheological, light backscatter, and microstructural properties of yogurt gels. Reconstituted skim milk was adjusted to pH values 6.2, 6.7, and 7.2 and heated at 85°C for 30 min. A portion of the heated milk samples was readjusted back to pH 6.7 after heating. Milks were inoculated with 3% (wt/wt) yogurt starter culture and incubated at 40°C until pH 4.6. Gel formation was monitored using dynamic oscillatory rheology, and parameters measured included the storage modulus (G') and loss tangent (LT) values. Light-backscattering properties, such as the backscatter ratio (R) and the first derivative of light backscatter ratio (R'), were also monitored during fermentation. Fluorescence microscopy was used to observe gel microstructure. The G' values at pH 4.6 were highest in gels made from milk heated at pH 6.7 and lowest in milk heated at pH 6.2, with or without pH adjustment after heating. The G' values at pH 4.6 were lower in samples after adjustment back to pH 6.7 after heating. No maximum in the LT parameter was observed during gelation for yogurts made from milk

  10. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  11. The role of intra-domain disulfide bonds in heat-induced irreversible denaturation of camelid single domain VHH antibodies.

    PubMed

    Akazawa-Ogawa, Yoko; Uegaki, Koichi; Hagihara, Yoshihisa

    2016-01-01

    Camelid-derived single domain VHH antibodies are highly heat resistant, and the mechanism of heat-induced VHH denaturation predominantly relies on the chemical modification of amino acids. Although chemical modification of disulfide bonds has been recognized as a cause for heat-induced denaturation of many proteins, there have been no mutagenesis studies, in which the number of disulfide bonds was controlled. In this article, we examined a series of mutants of two different VHHs with single, double or no disulfide bonds, and scrutinized the effects of these disulfide bond modifications on VHH denaturation. With the exception of one mutant, the heat resistance of VHHs decreased when the number of disulfide bonds increased. The effect of disulfide bonds on heat denaturation was more striking if the VHH had a second disulfide bond, suggesting that the contribution of disulfide shuffling is significant in proteins with multiple disulfide bonds. Furthermore, our results directly indicate that removal of a disulfide bond can indeed increase the heat resistance of a protein, irrespective of the negative impact on equilibrium thermodynamic stability. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  12. 27 CFR 21.92 - Denaturants listed as U.S.P. or N.F.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ....P. or N.F. 21.92 Section 21.92 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... for Denaturants § 21.92 Denaturants listed as U.S.P. or N.F. Denaturing materials and products listed in this part as “U.S.P.” or “N.F.” shall meet the specifications set forth in the current United...

  13. 27 CFR 21.92 - Denaturants listed as U.S.P. or N.F.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ....P. or N.F. 21.92 Section 21.92 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... for Denaturants § 21.92 Denaturants listed as U.S.P. or N.F. Denaturing materials and products listed in this part as “U.S.P.” or “N.F.” shall meet the specifications set forth in the current United...

  14. 27 CFR 21.92 - Denaturants listed as U.S.P. or N.F.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ....P. or N.F. 21.92 Section 21.92 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... for Denaturants § 21.92 Denaturants listed as U.S.P. or N.F. Denaturing materials and products listed in this part as “U.S.P.” or “N.F.” shall meet the specifications set forth in the current United...

  15. 27 CFR 21.92 - Denaturants listed as U.S.P. or N.F.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ....P. or N.F. 21.92 Section 21.92 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... for Denaturants § 21.92 Denaturants listed as U.S.P. or N.F. Denaturing materials and products listed in this part as “U.S.P.” or “N.F.” shall meet the specifications set forth in the current United...

  16. 27 CFR 21.92 - Denaturants listed as U.S.P. or N.F.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ....P. or N.F. 21.92 Section 21.92 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND... for Denaturants § 21.92 Denaturants listed as U.S.P. or N.F. Denaturing materials and products listed in this part as “U.S.P.” or “N.F.” shall meet the specifications set forth in the current United...

  17. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  18. Heat-Denatured Lysozyme Inactivates Murine Norovirus as a Surrogate Human Norovirus.

    PubMed

    Takahashi, Hajime; Nakazawa, Moemi; Ohshima, Chihiro; Sato, Miki; Tsuchiya, Tomoki; Takeuchi, Akira; Kunou, Masaaki; Kuda, Takashi; Kimura, Bon

    2015-07-02

    Human norovirus infects humans through the consumption of contaminated food, contact with the excrement or vomit of an infected person, and through airborne droplets that scatter the virus through the air. Being highly infectious and highly viable in the environment, inactivation of the norovirus requires a highly effective inactivating agent. In this study, we have discovered the thermal denaturing capacity of a lysozyme with known antimicrobial activity against gram-positive bacteria, as well as its inactivating effect on murine norovirus. This study is the first report on the norovirus-inactivating effects of a thermally denatured lysozyme. We observed that lysozymes heat-treated for 40 min at 100 °C caused a 4.5 log reduction in infectivity of norovirus. Transmission electron microscope analysis showed that virus particles exposed to thermally denatured lysozymes were expanded, compared to the virus before exposure. The amino acid sequence of the lysozyme was divided into three sections and the peptides of each artificially synthesised, in order to determine the region responsible for the inactivating effect. These results suggest that thermal denaturation of the lysozyme changes the protein structure, activating the region responsible for imparting an inactivating effect against the virus.

  19. Viability of murine norovirus in salads and dressings and its inactivation using heat-denatured lysozyme.

    PubMed

    Takahashi, Hajime; Tsuchiya, Tomoki; Takahashi, Michiko; Nakazawa, Moemi; Watanabe, Tomoka; Takeuchi, Akira; Kuda, Takashi; Kimura, Bon

    2016-09-16

    In recent years, a number of food poisoning outbreaks due to the contamination of norovirus in ready-to-eat (RTE) foods such as salads have been reported, and this issue is regarded as a global problem. The risk of contamination of fresh vegetables with norovirus has been previously reported, but the survivability of norovirus that contaminates salads remains unknown. In addition, there have been limited reports on the control of norovirus in food products by using inactivating agents. In this study, the viability of norovirus in various types of salads and dressings was examined using murine norovirus strain 1 (MNV-1) as a surrogate for the closely related human norovirus. In addition, the inactivation of MNV-1 in salads was examined using heat-denatured lysozyme, which had been reported to inactivate norovirus. MNV-1 was inoculated in 4 types of salads (coleslaw, thousand island salad, vinaigrette salad, egg salad) and 3 types of dressings (mayonnaise, thousand island dressing, vinaigrette dressing), stored at 4°C for 5days. The results revealed that in the vinaigrette dressing, the infectivity of MNV-1 decreased by 2.6logPFU/mL in 5days, whereas in the other dressings and salads, the infectivity of MNV-1 did not show any significant decrease. Next, 1% heat-denatured lysozyme was added to the 4 types of salads, and subsequently it was found that in 2 types of salads (thousand island salad, vinaigrette salad), the infectivity of MNV-1 decreased by >4.0logPFU/g, whereas in coleslaw salad, a decrease of 3.0logPFU/g was shown. However, in egg salads, the infectivity of MNV-1 did not show such decrease. These results suggest that norovirus can survive for 5days in contaminated salads. Further, these findings also indicated that heat-denatured lysozyme had an inactivating effect on norovirus, even in salads. In the future, heat-denatured lysozyme can be used as a novel norovirus-inactivating agent, although it is essential to investigate the mechanism of inactivating

  20. Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finlay, C.A.; Hinds, P.W.; Tan, T.H.

    1988-02-01

    The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

  1. Cold denaturation of α-synuclein amyloid fibrils.

    PubMed

    Ikenoue, Tatsuya; Lee, Young-Ho; Kardos, József; Saiki, Miyu; Yagi, Hisashi; Kawata, Yasushi; Goto, Yuji

    2014-07-21

    Although amyloid fibrils are associated with numerous pathologies, their conformational stability remains largely unclear. Herein, we probe the thermal stability of various amyloid fibrils. α-Synuclein fibrils cold-denatured to monomers at 0-20 °C and heat-denatured at 60-110 °C. Meanwhile, the fibrils of β2-microglobulin, Alzheimer's Aβ1-40/Aβ1-42 peptides, and insulin exhibited only heat denaturation, although they showed a decrease in stability at low temperature. A comparison of structural parameters with positive enthalpy and heat capacity changes which showed opposite signs to protein folding suggested that the burial of charged residues in fibril cores contributed to the cold denaturation of α-synuclein fibrils. We propose that although cold-denaturation is common to both native proteins and misfolded fibrillar states, the main-chain dominated amyloid structures may explain amyloid-specific cold denaturation arising from the unfavorable burial of charged side-chains in fibril cores. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Structural stability of E. coli transketolase to temperature and pH denaturation.

    PubMed

    Jahromi, Raha R F; Morris, Phattaraporn; Martinez-Torres, Ruben J; Dalby, Paul A

    2011-09-10

    We have previously shown that the denaturation of TK with urea follows a non-aggregating though irreversible denaturation pathway in which the cofactor binding appears to become altered but without dissociating, then followed at higher urea by partial denaturation of the homodimer prior to any further unfolding or dissociation of the two monomers. Urea is not typically present during biocatalysis, whereas access to TK enzymes that retain activity at increased temperature and extreme pH would be useful for operation under conditions that increase substrate and product stability or solubility. To provide further insight into the underlying causes of its deactivation in process conditions, we have characterised the effects of temperature and pH on the structure, stability, aggregation and activity of Escherichia coli transketolase. The activity of TK was initially found to progressively improve after pre-incubation at increasing temperatures. Loss of activity at higher temperature and low pH resulted primarily from protein denaturation and subsequent irreversible aggregation. By contrast, high pH resulted in the formation of a native-like state that was only partially inactive. The apo-TK enzyme structure content also increased at pH 9 to converge on that of the holo-TK. While cofactor dissociation was previously proposed for high pH deactivation, the observed structural changes in apo-TK but not holo-TK indicate a more complex mechanism. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. The C-terminal region of alpha-crystallin: involvement in protection against heat-induced denaturation

    NASA Technical Reports Server (NTRS)

    Takemoto, L.; Emmons, T.; Horwitz, J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Recent studies have demonstrated that the alpha-crystallins can protect other proteins against heat-induced denaturation and aggregation. To determine the possible involvement of the C-terminal region in this activity, the alpha-crystallins were subjected to limited tryptic digestion, and the amount of cleavage from the N-terminal and C-terminal regions of the alpha-A and alpha-B crystallin chains was assessed using antisera specific for these regions. Limited tryptic digestion resulted in cleavage only from the C-terminal region of alpha-A crystallin. This trypsin-treated alpha-A crystallin preparation showed a decreased ability to protect proteins from heat-induced aggregation using an in vitro assay. Together, these results demonstrate that the C-terminal region of alpha-A crystallin is important for its ability to protect against heat-induced aggregation, which is consistent with the hypothesis that post-translational changes that are known to occur at the C-terminal region may have significant effects on the ability of alpha-A crystallin to protect against protein denaturation in vivo.

  4. Denatured states of yeast cytochrome c induced by heat and guanidinium chloride are structurally and thermodynamically different.

    PubMed

    Zaidi, Sobia; Haque, Md Anzarul; Ubaid-Ullah, Shah; Prakash, Amresh; Hassan, Md Imtaiyaz; Islam, Asimul; Batra, Janendra K; Ahmad, Faizan

    2017-05-01

    A sequence alignment of mammalian cytochromes c with yeast iso-1-cytochrome c (y-cyt-c) shows that the yeast protein contains five extra N-terminal residues. We have been interested in understanding the question: What is the role of these five extra N-terminal residues in folding and stability of the protein? To answer this question we have prepared five deletants of y-cyt-c by sequentially removing these extra residues. During our studies on the wild type (WT) protein and its deletants, we observed that the amount of secondary structure in the guanidinium chloride (GdmCl)-induced denatured (D) state of each protein is different from that of the heat-induced denatured (H) state. This finding is confirmed by the observation of an additional cooperative transition curve of optical properties between H and D states on the addition of different concentrations of GdmCl to the already heat denatured WT y-cyt-c and its deletants at pH 6.0 and 68°C. For each protein, analysis of transition curves representing processes, native (N) state ↔ D state, N state ↔ H state, and H state ↔ D state, was done to obtain Gibbs free energy changes associated with all the three processes. This analysis showed that, for each protein, thermodynamic cycle accommodates Gibbs free energies associated with transitions between N and D states, N and H states, and H and D states, the characteristics required for a thermodynamic function. All these experimental observations have been supported by our molecular dynamics simulation studies.

  5. Ovalbumin labeling with p-hydroxymercurybenzoate: The effect of different denaturing agents and the kinetics of reaction.

    PubMed

    Campanella, Beatrice; Onor, Massimo; Biancalana, Lorenzo; D'Ulivo, Alessandro; Bramanti, Emilia

    2015-08-15

    The aim of our study was to investigate how denaturing agents commonly used in protein analysis influence the labeling between a reactive molecule and proteins. For this reason, we investigated the labeling of ovalbumin (OVA) as a globular model protein with p-hydroxymercurybenzoate (pHMB) in its native state (phosphate buffer solution) and in different denaturing conditions (8 molL(-1) urea, 3 molL(-1) guanidinium thiocyanate, 6 molL(-1) guanidinium chloride, 0.2% sodium dodecyl sulfate, and 20% methanol). In addition to chemical denaturation, thermal denaturation was also tested. The protein was pre-column simultaneously denatured and derivatized, and the pHMB-labeled denatured OVA complexes were analyzed by size exclusion chromatography (SEC) coupled online with chemical vapor generation-atomic fluorescence spectrometry (CVG-AFS). The number of -SH groups titrated greatly depends on the protein structure in solution. Indeed, we found that, depending on the adopted denaturing conditions, OVA gave different aggregate species that influence the complexation process. The results were compared with those obtained by a common alternative procedure for the titration of -SH groups that employs monobromobimane (mBBr) as tagging molecule and molecular fluorescence spectroscopy as detection technique. We also investigated the labeling kinetics for denatured OVA and pHMB, finding that the 4 thiolic groups of OVA have a very different reactivity toward mercury labeling, in agreement with previous studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. A stapled p53 helix overcomes HDMX-mediated suppression of p53.

    PubMed

    Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

    2010-11-16

    Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. Pressure-assisted cold denaturation of hen egg white lysozyme: the influence of co-solvents probed by hydrogen exchange nuclear magnetic resonance.

    PubMed

    Vogtt, K; Winter, R

    2005-08-01

    COSY proton nuclear magnetic resonance was used to measure the exchange rates of amide protons of hen egg white lysozyme (HEWL) in the pressure-assisted cold-denatured state and in the heat-denatured state. After dissolving lysozyme in deuterium oxide buffer, labile protons exchange for deuterons in such a way that exposed protons are substituted rapidly, whereas "protected" protons within structured parts of the protein are substituted slowly. The exchange rates k obs were determined for HEWL under heat treatment (80 degrees C) and under high pressure conditions at low temperature (3.75 kbar, -13 degrees C). Moreover, the influence of co-solvents (sorbitol, urea) on the exchange rate was examined under pressure-assisted cold denaturation conditions, and the corresponding protection factors, P, were determined. The exchange kinetics upon heat treatment was found to be a two-step process with initial slow exchange followed by a fast one, showing residual protection in the slow-exchange state and P-factors in the random-coil-like range for the final temperature-denatured state. Addition of sorbitol (500 mM) led to an increase of P-factors for the pressure-assisted cold denatured state, but not for the heat-denatured state. The presence of 2 M urea resulted in a drastic decrease of the P-factors of the pressure-assisted cold denatured state. For both types of co-solvents, the effect they exert appears to be cooperative, i.e., no particular regions within the protein can be identified with significantly diverse changes of P-factors.

  8. Towards a Model of Cold Denaturation of Proteins

    NASA Astrophysics Data System (ADS)

    Sanchez, Isaac

    2010-10-01

    Proteins/enzymes can undergo cold denaturation or cold deactivation. In the active or natured state, a protein exists in a unique folded/ordered state. In the deactivated (denatured) state, a protein unfolds and exists in a disordered expanded state. This protein folding/unfolding or order/disorder transition can be triggered by a temperature change. What seems paradoxical is that the active (ordered) state can be induced by heating, or equivalently, the disordered inactive state can be induced by cooling. This is equivalent to an Ising spin model passing from a disordered array of spins to an ordered array by increasing temperature! Hydrogels and their corresponding polyelectrolyte chains behave similarly, i.e., the swollen disordered state can be induced by cooling while the more ordered collapsed or globular state is induced by heating (an entropically driven phase transition). In a living cell at the physiological temperature of 37 C, activation and deactivation of proteins is triggered by local environmental changes in pH, salinity, etc. The important physics is that the denaturation temperature can be moved up or down relative to 37 C by these stimuli. Moving the transition temperature up can destabilize the active protein while moving it down leads to stabilization. An analytical polymer model will be described that exhibits cold denaturation behavior.

  9. Study of dynamical process of heat denaturation in optically trapped single microorganisms by near-infrared Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Xie, Changan; Li, Yong-qing; Tang, Wei; Newton, Ronald J.

    2003-11-01

    The development of laser traps has made it possible to investigate single cells and record real-time Raman spectra during a heat-denaturation process when the temperature of the surrounding medium is increased. Large changes in the phenylalanine band (1004 cm-1) of near-infrared spectra between living and heat-treated cells were observed in yeast and Escerichia coli and Enterobacter aerogenes bacteria. This change appears to reflect the change in environment of phenylalanine as proteins within the cells unfold as a result of increasing temperatures. As a comparison, we measured Raman spectra of native and heat-denatured solutions of bovine serum albumin proteins, and a similar change in the phenylalanine band of spectra was observed. In addition, we measured Raman spectra of native and heat-treated solutions of pure phenylalanine molecules; no observable difference in vibrational spectra was observed. These findings may make it possible to study conformational changes in proteins within single cells.

  10. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    PubMed

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. THE KINETICS AND THERMODYNAMICS OF REVERSIBLE DENATURATION OF CRYSTALLINE SOYBEAN TRYPSIN INHIBITOR

    PubMed Central

    Kunitz, M.

    1948-01-01

    Crystalline soybean trypsin inhibitor protein undergoes denaturation on heating which is reversed on cooling. In the range of temperature of 35 to 50°C. a solution of the protein consists of a mixture of native and denatured forms in equilibrium with each other. The equilibrium is only slowly established and its final value at any temperature is the same whether a heated, denatured solution of the protein is cooled to the given temperature or whether a fresh solution is raised to that temperature. The kinetics of reversible denaturation of the soybean protein as well as the reversal of denaturation is that of a reversible unimolecular reaction, each process consisting at a given temperature of the same two simultaneous reactions acting in opposite directions. The experimental data on the effect of temperature on the velocity and the equilibrium constants of the opposing reaction were utilized in evaluating the reaction energies and activation energies. The reaction energies for denaturation were found to be as follows:— Change in total heat of reaction ΔH = 57,000 calories per mole Change in entropy of reaction ΔS = 180 calories per degree per mole The heat of activation ΔH 1 ‡ for denaturation = 55,000 The heat of activation ΔH 2 ‡ for the reversal of denaturation = –1900 The entropy ΔS 1 ‡ for denaturation = 95 The entropy ΔS 2 ‡ for reversal of denaturation = –84 PMID:18891149

  12. Salicylic Acid and Ethylene Pathways Are Differentially Activated in Melon Cotyledons by Active or Heat-Denatured Cellulase from Trichoderma longibrachiatum

    PubMed Central

    Martinez, Christelle; Blanc, Frédéric; Le Claire, Emilie; Besnard, Olivier; Nicole, Michel; Baccou, Jean-Claude

    2001-01-01

    Infiltration of cellulase (EC 3.2.1.4) from Trichoderma longibrachiatum into melon (Cucumis melo) cotyledons induced several key defense mechanisms and hypersensitive reaction-like symptoms. An oxidative burst was observed 3 hours after treatment and was followed by activation of ethylene and salicylic acid (SA) signaling pathways leading to marked induction of peroxidase and chitinase activities. The treatment of cotyledons by heat-denatured cellulase also led to some induction of peroxidase and chitinase activities, but the oxidative burst and SA production were not observed. Co-infiltration of aminoethoxyvinil-glycine (an ethylene inhibitor) with the active cellulase did not affect the high increase of peroxidase and chitinase activities. In contrast, co-infiltration of aminoethoxyvinil-glycine with the denatured enzyme blocked peroxidase and chitinase activities. Our data suggest that the SA pathway (induced by the cellulase activity) and ethylene pathway (induced by heat-denatured and active protein) together coordinate the activation of defense mechanisms. We found a partial interaction between both signaling pathways since SA caused an inhibition of the ethylene production and a decrease in peroxidase activity when co-infiltrated with denatured cellulase. Treatments with active or denatured cellulase caused a reduction in powdery mildew (Sphaerotheca fuliginea) disease. PMID:11553761

  13. Highly Anomalous Energetics of Protein Cold Denaturation Linked to Folding-Unfolding Kinetics

    PubMed Central

    Romero-Romero, M. Luisa; Inglés-Prieto, Alvaro; Ibarra-Molero, Beatriz; Sanchez-Ruiz, Jose M.

    2011-01-01

    Despite several careful experimental analyses, it is not yet clear whether protein cold-denaturation is just a “mirror image” of heat denaturation or whether it shows unique structural and energetic features. Here we report that, for a well-characterized small protein, heat denaturation and cold denaturation show dramatically different experimental energetic patterns. Specifically, while heat denaturation is endothermic, the cold transition (studied in the folding direction) occurs with negligible heat effect, in a manner seemingly akin to a gradual, second-order-like transition. We show that this highly anomalous energetics is actually an apparent effect associated to a large folding/unfolding free energy barrier and that it ultimately reflects kinetic stability, a naturally-selected trait in many protein systems. Kinetics thus emerges as an important factor linked to differential features of cold denaturation. We speculate that kinetic stabilization against cold denaturation may play a role in cold adaptation of psychrophilic organisms. Furthermore, we suggest that folding-unfolding kinetics should be taken into account when analyzing in vitro cold-denaturation experiments, in particular those carried out in the absence of destabilizing conditions. PMID:21829584

  14. Canine gastric carcinoma: immunohistochemical expression of cell cycle proteins (p53, p21, and p16) and heat shock proteins (Hsp27 and Hsp70).

    PubMed

    Carrasco, V; Canfrán, S; Rodríguez-Franco, F; Benito, A; Sáinz, A; Rodríguez-Bertos, A

    2011-01-01

    Immunohistochemical staining for cell cycle proteins and heat shock proteins was performed on 17 canine gastric carcinomas. The immunoexpression of p53, p21, p16, Hsp27, and Hsp70 was investigated. A study was conducted to determine the histological type and parameters related to tumor malignancy. Possible associations and trends were assessed between the immunoexpression of each protein and tumor type as well as specific parameters of malignancy. High intratumor frequency of cellular p53 immunostaining was observed (61.96% average), but lower frequencies of p21 and p16 expression were present (34.65% and 10.41%, respectively). The p53 overexpression was associated with tumor infiltration (P = .0258). Expression of p21 was lower in undifferentiated carcinomas, and the loss of expression was associated with histopathological parameters characteristic of a poor prognosis such as lymphatic vessel invasion (P = .0258). The lack of p16 immunoreactivity was related to histopathological characteristics of malignancy such as the presence of evident and multiple nucleoli (P = .0475). In contrast, deep tumor infiltration was observed in those carcinomas with a high p16 index (P = .0475). Hsp70 appeared to be overexpressed in all gastric neoplasms included in this study. This is in contrast to Hsp27, because a group of tumors showed complete lack of Hsp27 immunoexpression, whereas the others displayed extensive Hsp27 immunostaining. The differences in Hsp27 did not correlate with any of the histopathological parameters, but Hsp27 immunoexpression was higher in the undifferentiated carcinoma. No significant differences in the expression of the proteins were found in canine gastric carcinomas according to their histological type. These findings may be useful for establishing a prognosis for canine gastric carcinoma.

  15. INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

    PubMed

    2007-01-01

    Introgen and its wholly owned European subsidiary Gendux AB are developing an adenoviral p53 gene therapy as a treatment for cancer in the US and Europe, respectively. Phase III trials in patients with head and neck cancer are ongoing, and a number of clinical trials in other cancer indications have been completed. INGN 201 is being reviewed by the EMEA for approval in Li-Fraumeni syndrome (LFS) under the provisions of exceptional circumstance; the therapy is available on a compassionate use basis to eligible LFS cancer patients under a protocol authorised by the US FDA. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. The p53 protein is one of the most intricate elements in the apoptotic signalling cascade, and a mutation in the gene encoding it is believed to result in a decreased ability of a cell to apoptose. Thus replacing this gene via adenovirally-mediated p53 gene therapy is hoped to result in increased apoptosis where it is administered.INGN 201 is available for licensing, although Introgen favours retaining partial or full rights to the therapy in the US. Introgen entered into a license agreement with The University of Texas System and MD Anderson Cancer Center in 1994. The technologies licenced include p53 and fus1 (INGN 401). The collaboration has yielded exclusive patent and licensing rights to numerous technologies. Introgen entered into a collaboration with Rhône-Poulenc Rorer Pharmaceuticals (now sanofi-aventis) to develop therapeutics based on p53 inhibition in October 1994. However, in June 2001 this relationship was restructured and Introgen assumed responsibility for the worldwide development of all p53 products including INGN 201, and acquired all marketing and commercialisation rights with respect to those products. Introgen initiated two phase III trials in head and neck cancer (in June 2000 and May 2001) at about 80 sites in the US, Canada and Europe

  16. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  17. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

    PubMed Central

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-01-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  18. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  19. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

    2012-06-29

    elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

  20. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

    PubMed Central

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

  1. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    PubMed

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  2. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  3. Physical interaction between bacterial heat shock protein (Hsp) 90 and Hsp70 chaperones mediates their cooperative action to refold denatured proteins.

    PubMed

    Nakamoto, Hitoshi; Fujita, Kensaku; Ohtaki, Aguru; Watanabe, Satoru; Narumi, Shoichi; Maruyama, Takahiro; Suenaga, Emi; Misono, Tomoko S; Kumar, Penmetcha K R; Goloubinoff, Pierre; Yoshikawa, Hirofumi

    2014-02-28

    In eukaryotes, heat shock protein 90 (Hsp90) is an essential ATP-dependent molecular chaperone that associates with numerous client proteins. HtpG, a prokaryotic homolog of Hsp90, is essential for thermotolerance in cyanobacteria, and in vitro it suppresses the aggregation of denatured proteins efficiently. Understanding how the non-native client proteins bound to HtpG refold is of central importance to comprehend the essential role of HtpG under stress. Here, we demonstrate by yeast two-hybrid method, immunoprecipitation assays, and surface plasmon resonance techniques that HtpG physically interacts with DnaJ2 and DnaK2. DnaJ2, which belongs to the type II J-protein family, bound DnaK2 or HtpG with submicromolar affinity, and HtpG bound DnaK2 with micromolar affinity. Not only DnaJ2 but also HtpG enhanced the ATP hydrolysis by DnaK2. Although assisted by the DnaK2 chaperone system, HtpG enhanced native refolding of urea-denatured lactate dehydrogenase and heat-denatured glucose-6-phosphate dehydrogenase. HtpG did not substitute for DnaJ2 or GrpE in the DnaK2-assisted refolding of the denatured substrates. The heat-denatured malate dehydrogenase that did not refold by the assistance of the DnaK2 chaperone system alone was trapped by HtpG first and then transferred to DnaK2 where it refolded. Dissociation of substrates from HtpG was either ATP-dependent or -independent depending on the substrate, indicating the presence of two mechanisms of cooperative action between the HtpG and the DnaK2 chaperone system.

  4. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.

    PubMed

    Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand

    2017-09-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.

  5. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis

    PubMed Central

    Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli

    2017-01-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745

  6. Role of kappa-casein in the association of denatured whey proteins with casein micelles in heated reconstituted skim milk.

    PubMed

    Anema, Skelte G

    2007-05-02

    Reconstituted skim milk at pH from 6.5 to 7.1 was unheated, preheated (68 degrees C/20 min), or heated at 90 degrees C for 20-30 min. On preheating, the size of the casein micelles decreased by about 5-20 nm, with a greater effect at higher pH. The casein micelle size of the heated milk at pH 6.5 increased by about 30 nm when compared to that of the unheated or preheated milk. As the pH was increased before heating, the particle size gradually decreased so that, at pH 7.1, the size was markedly smaller than that for the unheated milk and slightly smaller than that for the preheated milk. High levels (about 85%) of denatured whey protein associated with the casein micelles at pH 6.5, and this level decreased as the pH increased so that, at pH 7.1, low levels (about 15%) were associated with the micelles. Low levels of alphaS-casein and beta-casein were found in the serum regardless of the heat treatment or the pH of the milk. At pH 6.5, low levels (about 10%) of kappa-casein were also found in the milk serum. In the unheated milk, the level of serum kappa-casein increased slightly with increasing pH; in the heated samples, the level of serum kappa-casein increased markedly and linearly with increasing pH so that, at pH 7.1, about 70% of the kappa-casein was in the serum phase. The results of this study indicate that the pH dependence of the levels of serum phase kappa-casein may be responsible for the change in distribution of the whey proteins between the colloidal and serum phases. This is the first report to demonstrate significant levels of dissociation of kappa-casein from the micelles at pH between 6.5 and 6.7, although this dissociation phenomenon is well known on heating milk at high temperatures at pH above 6.7.

  7. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    PubMed

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a

  8. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

    PubMed Central

    2014-01-01

    Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be

  9. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  10. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

  11. Patterns of Proteins that Associate with p53 or with p53 Binding Sites Present in the Ribosomal Gene Cluster and MDM2 (P2) Promoter

    DTIC Science & Technology

    2000-08-01

    Spodoptera frugiperda (Sf21) cells were infected with a recombinant baculovirus expressing the wild-type human p53. 3-4 and 10-1 cells were grown at 37 ’C in...for further use. Spodoptera fugiperda (Sf21) cells were grown at 27 0C in TC-100 medium (GIBCO), supplemented with 10% of heat inactivated Fetal

  12. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

    1997-01-01

    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  13. Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.

    PubMed

    Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias

    2012-03-01

    To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.

  14. Laboratory Exercise for Studying the Morphology of Heat-Denatured and Amyloid Aggregates of Lysozyme by Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Gokalp, Sumeyra; Horton, William; Jónsdóttir-Lewis, Elfa B.; Foster, Michelle; Török, Marianna

    2018-01-01

    To facilitate learning advanced instrumental techniques, essential tools for visualizing biomaterials, a simple and versatile laboratory exercise demonstrating the use of Atomic Force Microscopy (AFM) in biomedical applications was developed. In this experiment, the morphology of heat-denatured and amyloid-type aggregates formed from a low-cost…

  15. Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

    PubMed

    Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

    1999-06-01

    The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

  16. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Equilibrium unfolding of A. niger RNase: pH dependence of chemical and thermal denaturation.

    PubMed

    Kumar, Gundampati Ravi; Sharma, Anurag; Kumari, Moni; Jagannadham, Medicherla V; Debnath, Mira

    2011-08-01

    Equilibrium unfolding of A. niger RNase with chemical denaturants, for example GuHCl and urea, and thermal unfolding have been studied as a function of pH using fluorescence, far-UV, near-UV, and absorbance spectroscopy. Because of their ability to affect electrostatic interactions, pH and chemical denaturants have a marked effect on the stability, structure, and function of many globular proteins. ANS binding studies have been conducted to enable understanding of the folding mechanism of the protein in the presence of the denaturants. Spectroscopic studies by absorbance, fluorescence, and circular dichroism and use of K2D software revealed that the enzyme has α + β type secondary structure with approximately 29% α-helix, 24% β-sheet, and 47% random coil. Under neutral conditions the enzyme is stable in urea whereas GuHCl-induced equilibrium unfolding was cooperative. A. niger RNase has little ANS binding even under neutral conditions. Multiple intermediates were populated during the pH-induced unfolding of A. niger RNase. Urea and temperature-induced unfolding of A. niger RNase into the molten globule-like state is non-cooperative, in contrast to the cooperativity seen with the native protein, suggesting the presence of two parts/domains, in the molecular structure of A. niger RNase, with different stability that unfolds in steps. Interestingly, the GuHCl-induced unfolding of the A state (molten globule state) of A. niger RNase is unique, because a low concentration of denaturant not only induces structural change but also facilitates transition from one molten globule like state (A(MG1)) into another (I(MG2)).

  18. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  19. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  20. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    PubMed

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  1. The Isoforms of the p53 Protein

    PubMed Central

    Khoury, Marie P.; Bourdon, Jean-Christophe

    2010-01-01

    p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

  2. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  3. Effect of chitosan on the heat stability of whey protein solution as a function of pH.

    PubMed

    Zhao, Zhengtao; Xiao, Qian

    2017-03-01

    Chitosan was reported to interact with proteins through electrostatic interactions. Their interaction was influenced by pH, which was not fully characterized. Further research on the interactions between protein and chitosan at different pH and their influence on the thermal denaturation of proteins is necessary. In this research, the effect of chitosan on the heat stability of whey protein solution at pH 4.0-6.0 was studied. At pH 4.0, a small amount chitosan was able to prevent the heat-induced denaturation and aggregation of whey protein molecules. At higher pH values (5.5 and 6.0), whey proteins complexed with chitosan through electrostatic attraction. The formation of chitosan-whey protein complexes at pH 5.5 improved the heat stability of dispersions and no precipitation could be detected up to 20 days. The dispersion with a medium amount of chitosan (chitosan:whey protein 1:5) produced the most stable particles, which had an average radius of 135 ± 14 nm and a zeta potential value of 36 ± 1 mV. In contrast, at pH 6.0 only the dispersion with a high amount of chitosan (chitosan:whey protein 1:2) showed good shelf stability up to 20 days. It was possible to produce heat-stable whey protein beverages by regulating the interaction between chitosan and whey protein molecules. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  4. Elimination of cannibalistic denaturation by enzyme immobilization or inhibition

    PubMed Central

    Wu, Hua-Lin; Lace, Daniel A.; Bender, Myron L.

    1981-01-01

    The cannibalistic denaturation of α-chymotrypsin (EC 3.4.21.1) around neutral pH can be eliminated by immobilization (insolubilization) of the enzyme or by inhibition by specific reversible inhibitors, but the high-pH denaturation cannot be. The denaturation of the immobilized enzyme at high pH follows first-order kinetics, just as the denaturation of the soluble enzyme does. These results lend credence to the description of the denaturation of chymotrypsin as cannibalistic around neutrality and due to a hydroxide ion reaction at high pH; this interpretation followed from kinetic arguments given in the previous article [Wu, H.-L., Wastell, A. & Bender, M. L. (1981) Proc. Natl. Acad. Sci. USA 78, 4116-4117]. Elimination of denaturation around neutrality by immobilization may be the reason why membrane-bound enzymes are so common in vivo. PMID:16593052

  5. Expressions of p53 and p21 in primary gastric lymphomas.

    PubMed Central

    Go, J. H.; Yang, W. I.

    2001-01-01

    The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

  6. Structure and properties of native and unfolded lysing enzyme from T. harzianum: Chemical and pH denaturation.

    PubMed

    Bey, Houda; Gtari, Wala; Aschi, Adel; Othman, Tahar

    2016-11-01

    The effect of chemical denaturants and pH on the change of the conformation of the protein Lysing Enzyme from Trichoderma Harzianum has been investigated by dynamic light scattering (DLS) and turbidimetry. Chemical denaturants are frequently used to describe the mechanisms of folding and transition states. We have analyzed the pH effect on the properties and particle size of the protein. The compaction factor CI has shown that the protein is weakly disordered. The molecular dynamics simulations confirm, at neutral pH, that the protein has a low net charge and high hydrophobicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  8. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  9. Electrochemically-driven large amplitude pH cycling for acid-base driven DNA denaturation and renaturation.

    PubMed

    Wang, Yong-Chun; Lin, Cong-Bin; Su, Jian-Jia; Ru, Ying-Ming; Wu, Qiao; Chen, Zhao-Bin; Mao, Bing-Wei; Tian, Zhao-Wu

    2011-06-15

    In this paper, we present an electrochemically driven large amplitude pH alteration method based on a serial electrolytic cell involving a hydrogen permeable bifacial working electrode such as Pd thin foil. The method allows solution pH to be changed periodically up to ±4~5 units without additional alteration of concentration and/or composition of the system. Application to the acid-base driven cyclic denaturation and renaturation of 290 bp DNA fragments is successfully demonstrated with in situ real-time UV spectroscopic characterization. Electrophoretic analysis confirms that the denaturation and renaturation processes are reversible without degradation of the DNA. The serial electrolytic cell based electrochemical pH alteration method presented in this work would promote investigations of a wide variety of potential-dependent processes and techniques.

  10. Regulation of autophagy by cytoplasmic p53.

    PubMed

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  11. WDR36 and P53 Gene Variants and Susceptibility to Primary Open-Angle Glaucoma: Analysis of Gene-Gene Interactions

    PubMed Central

    Blanco-Marchite, Cristina; Sánchez-Sánchez, Francisco; López-Garrido, María-Pilar; Iñigez-de-Onzoño, Mercedes; López-Martínez, Francisco; López-Sánchez, Enrique; Alvarez, Lydia; Rodríguez-Calvo, Pedro-Pablo; Méndez-Hernández, Carmen; Fernández-Vega, Luis; García-Sánchez, Julián; Coca-Prados, Miguel; García-Feijoo, Julián

    2011-01-01

    Purpose. To investigate the role of WDR36 and P53 sequence variations in POAG susceptibility. Methods. The authors performed a case-control genetic association study in 268 unrelated Spanish patients (POAG1) and 380 control subjects matched for sex, age, and ethnicity. WDR36 sequence variations were screened by either direct DNA sequencing or denaturing high-performance liquid chromatography. P53 polymorphisms p.R72P and c.97–147ins16bp were analyzed by single-nucleotide polymorphism (SNP) genotyping and PCR, respectively. Positive SNP and haplotype associations were reanalyzed in a second sample of 211 patients and in combined cases (n = 479). Results. The authors identified almost 50 WDR36 sequence variations, of which approximately two-thirds were rare and one-third were polymorphisms. Approximately half the variants were novel. Eight patients (2.9%) carried rare mutations that were not identified in the control group (P = 0.001). Six Tag SNPs were expected to be structured in three common haplotypes. Haplotype H2 was consistently associated with the disease (P = 0.0024 in combined cases). According to a dominant model, genotypes containing allele P of the P53 p.R72P SNP slightly increased glaucoma risk. Glaucoma susceptibility associated with different WDR36 genotypes also increased significantly in combination with the P53 RP risk genotype, indicating the existence of a genetic interaction. For instance, the OR of the H2 diplotype estimated for POAG1 and combined cases rose approximately 1.6 times in the two-locus genotype H2/RP. Conclusions. Rare WDR36 variants and the P53 p.R72P polymorphism behaved as moderate glaucoma risk factors in Spanish patients. The authors provide evidence for a genetic interaction between WDR36 and P53 variants in POAG susceptibility, although this finding must be confirmed in other populations. PMID:21931130

  12. Regulation of autophagy by cytoplasmic p53

    PubMed Central

    Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2009-01-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

  13. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  14. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  15. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2015-01-01

    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  16. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    PubMed Central

    Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

    2015-01-01

    Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy. PMID:26098630

  17. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif.

    PubMed

    Elengoe, Asita; Naser, Mohammed Abu; Hamdan, Salehhuddin

    2015-01-01

    Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD) of heat shock 70 kDa protein (PDB: 1HJO) with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD) simulation. Human DNA binding domain of p53 motif (SCMGGMNR) retrieved from UniProt (UniProtKB: P04637) was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were -0.44 Kcal/mol and -9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  18. Biological effects of electric shock and heat denaturation and oxidation of molecules, membranes, and cellular functions.

    PubMed

    Tsong, T Y; Su, Z D

    1999-10-30

    Direct exposure of cells in suspension to intense electric pulses is known to produce damages to cell membranes and supramolecular organizations of cells, and denaturation of macromolecules, much like injuries and tears seen in electric trauma patients. Thus, the system has been used as a laboratory model for investigating the biochemical basis of electric injury. An intense electric pulse can produce two major effects on cells--one caused by the field, or the electric potential, and the other by current, or the electric energy. The field-induced transmembrane potential can produce electro-conformational changes of ion channels and ion pumps and, when the potential exceeds the dielectric strength of the cell membrane (approximately 500 mV for a pulse width of a few ms), electro-conformational damages and electroporations of membrane proteins and lipid bilayers. These events lead to passage of electric current through the membrane-porated cells and to heating of cell membranes and cytoplasmic contents. The subsequent denaturation of cell membranes and cytoplasmic macromolecules brings about many complex biochemical reactions, including oxidation of proteins and lipids. The combined effects may cripple the cells beyond repair. This communication will focus on the thermal effects of electric shock. After a brief review of the current state of knowledge on thermal denaturation of soluble enzymes and muscle proteins, this paper will describe experiments on the thermal denaturation of cellular components and functions, such as nucleosomes, and the electron transport chain and ATP synthetic enzymes of the mitochondrial inner membranes. Data will show that lipid peroxidation and the subsequent loss of the energy-transducing ability of the cells may occur even at moderate temperatures between 40 degrees C and 45 degrees C. However, lipid peroxidation may be prevented with reducing reagents such as mercaptoethanol, dithiothreitol, and ascorbic acid. Reactivation of denatured

  19. pH-dependent relationship between thermodynamic and kinetic stability in the denaturation of human phosphoglycerate kinase 1.

    PubMed

    Pey, Angel L

    2014-08-01

    Human phosphoglycerate kinase 1 (hPGK1) is a glycolytic enzyme essential for ATP synthesis, and it is implicated in different pathological conditions such as inherited diseases, oncogenesis and activation of drugs for cancer and viral treatments. Particularly, mutations in hPGK1 cause human PGK1 deficiency, a rate metabolic conformational disease. We have recently found that most of these mutations cause protein kinetic destabilization by significant changes in the structure/energetics of the transition state for irreversible denaturation. In this work, we explore the relationships between protein conformation, thermodynamic and kinetic stability in hPGK1 by performing comprehensive analyses in a wide pH range (2.5-8). hPGK1 remains in a native conformation at pH 5-8, but undergoes a conformational transition to a molten globule-like state at acidic pH. Interestingly, hPGK1 kinetic stability remains essentially constant at pH 6-8, but is significantly reduced when pH is decreased from 6 to 5. We found that this decrease in kinetic stability is caused by significant changes in the energetic/structural balance of the denaturation transition state, which diverge from those found for disease-causing mutations. We also show that protein kinetic destabilization by acidic pH is strongly linked to lower thermodynamic stability, while in disease-causing mutations seems to be linked to lower unfolding cooperativity. These results highlight the plasticity of the hPGK1 denaturation mechanism that responds differently to changes in pH and in disease-causing mutations. New insight is presented into the different factors contributing to hPGK1 thermodynamic and kinetic stability and the role of denaturation mechanisms in hPGK1 deficiency. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  20. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    PubMed

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  1. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    PubMed

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  3. p53 mutations promote proteasomal activity.

    PubMed

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  4. Effect of pH on subunit association and heat protection of soybean alpha-galactosidase

    NASA Technical Reports Server (NTRS)

    Porter, J. E.; Sarikaya, A.; Herrmann, K. M.; Ladisch, M. R.; Mitchell, C. A. (Principal Investigator)

    1992-01-01

    Soybeans contain the enzyme alpha-galactosidase, which hydrolyzes alpha-1, 6 linkages in stachyose and raffinose to give sucrose and galactose. We have found that galactose, a competitive product inhibitor of alpha-galactosidase, strongly promotes the heat stability of the tetrameric form of the enzyme at pH 4.0 and at temperatures of up to 70 degrees C for 60 min. Stachyose and raffinose also protect alpha-galactosidase from denaturation at pH 4.0 although to a lesser extent. Glucose and mannose have little effect. At pH 7.0 the enzyme is a monomer, and galactose has no effect on the heat stability of the enzyme. In the absence of heat protection of the enzyme by added sugars, a series deactivation mechanism was found to describe the deactivation data. In comparison, a unimolecular, non-first order deactivation model applies at pH 4.0, where heat protection effects were observed. At a temperature above 60 degrees C, simple deactivation is a suitable model. The results suggest that alpha-galactosidase conformation and heat stability are directly related.

  5. Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

    PubMed Central

    Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

    2017-01-01

    Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

  6. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  7. Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

    PubMed

    Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

    2011-09-27

    Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

  8. Mechanisms that enhance sustainability of p53 pulses.

    PubMed

    Kim, Jae Kyoung; Jackson, Trachette L

    2013-01-01

    The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

  9. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

  10. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    PubMed Central

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  11. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  12. p53-independent p21 induction by MELK inhibition.

    PubMed

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-08-29

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

  13. p53-independent p21 induction by MELK inhibition

    PubMed Central

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-01-01

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

  14. Rigor of cell fate decision by variable p53 pulses and roles of cooperative gene expression by p53

    PubMed Central

    Murakami, Yohei; Takada, Shoji

    2012-01-01

    Upon DNA damage, the cell fate decision between survival and apoptosis is largely regulated by p53-related networks. Recent experiments found a series of discrete p53 pulses in individual cells, which led to the hypothesis that the cell fate decision upon DNA damage is controlled by counting the number of p53 pulses. Under this hypothesis, Sun et al. (2009) modeled the Bax activation switch in the apoptosis signal transduction pathway that can rigorously “count” the number of uniform p53 pulses. Based on experimental evidence, here we use variable p53 pulses with Sun et al.’s model to investigate how the variability in p53 pulses affects the rigor of the cell fate decision by the pulse number. Our calculations showed that the experimentally anticipated variability in the pulse sizes reduces the rigor of the cell fate decision. In addition, we tested the roles of the cooperativity in PUMA expression by p53, finding that lower cooperativity is plausible for more rigorous cell fate decision. This is because the variability in the p53 pulse height is more amplified in PUMA expressions with more cooperative cases. PMID:27857606

  15. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

    PubMed Central

    Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

    2016-01-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  16. Nanometer-Scale Dissection of Chromosomes by Atomic Force Microscopy Combined with Heat-Denaturing Treatment

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Kazumi; Kuwazaki, Seigo; Yamamoto, Kimiko; Shichiri, Motoharu; Yoshino, Tomoyuki; Ohtani, Toshio; Sugiyama, Shigeru

    2006-03-01

    We have developed a method for dissecting chromosome fragments with a size of a few hundred nanometers by atomic force microscopy (AFM). By using this method, we demonstrated reproducible dissections of silkworm chromosomes in the pachytene phase. The dissected fragments were successfully recovered on the cantilever tips, as confirmed by fluorescent microscopy using fluorescent stained chromosomes. To recover dissected chromosome fragments from a larger chromosome, such as the human metaphase chromosome of a somatic cell, heat denaturation was found to be effective. Further improvements in this method may lead to a novel tool for isolating valuable genes and/or investigating local genome structures in the near future.

  17. p53 mutation and expression in lymphoma.

    PubMed Central

    Adamson, D. J.; Thompson, W. D.; Dawson, A. A.; Bennett, B.; Haites, N. E.

    1995-01-01

    Mutation and abnormal expression of p53 was studied in 38 lymphomas [five Hodgkin's disease and 33 non-Hodgkin's lymphoma (NHL)]. CM1 polyclonal antibody was used to detect overexpression of p53. Three missense mutations were characterised in three cases of NHL after screening exons 5-8 of p53 of all the tumours with single-strand conformation polymorphism (SSCP) analysis. Only two out of three tumours with a missense mutation showed abnormal expression of p53 as measured by CM1. Conversely, seven out of nine tumours with positive CM1 staining had no point mutation demonstrated. Overexpression of p53 in the cases of NHL occurred in three out of twenty four low-grade tumours and five out of nine high-grade tumours (Kiel classification). The results suggest that abnormalities of p53 are commoner in high-grade than low-grade NHL, and that positive immunocytochemistry cannot be used to determine which tumours have mutations of p53. Images Figure 1 Figure 2 PMID:7599045

  18. Accumulation of p53 in infectious mononucleosis tissues.

    PubMed

    Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

    2000-11-01

    Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

  19. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  20. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Heterogeneous distribution of P53 immunoreactivity in human lung adenocarcinoma correlates with MDM2 protein expression, rather than with P53 gene mutation.

    PubMed

    Koga, T; Hashimoto, S; Sugio, K; Yoshino, I; Nakagawa, K; Yonemitsu, Y; Sugimachi, K; Sueishi, K

    2001-07-20

    Although the tumor suppressor p53 protein (P53) immunoreactivity and its gene (p53) mutation were reported to be significant prognostic indicators for human lung adenocarcinomas, little is known regarding the relationship between the heterogeneous distribution of P53 and its genetic status in each tumor focus and the clinicopathological significance. To determine how P53 is heterogeneously stabilized in patients, we compared P53 expression to both the p53 allelic mutation in exon 2 approximately 9 by polymerase chain reaction-single strand conformation polymorphism using microdissected DNA fractions, and the immunohistochemical MDM2 expression. Of the 48 positive to P53 in 118 lung adenocarcinomas examined, 10 with heterogeneous P53 expression were closely examined. The higher P53 expression foci in 7 of 10 cases were less differentiated, histologically in respective cases, and were frequently associated with fibrous stroma. Two had genetic mutations in exon 7 of the p53 gene in both the high and low P53 expression foci of cancer tissue indicating no apparent correlation between heterogeneous P53 expression and the occurrence of gene mutation. Immunohistochemical expression of MDM2 was significantly lower in high P53 expression areas (p < 0.05, the mean labeling indices of high and low P53 expression areas being 4.2 +/- 5.4% and 13.6 +/- 12.2%, respectively). In addition, among all the 118 cases examined, MDM2 expression was significantly suppressed in cases of p53 gene mutation, simultaneously with P53 overexpression, as compared with cases without both the p53 mutation and expression (p < 0.001). These findings suggest that the heterogeneous stabilization of P53 in human lung adenocarcinomas could be partly due to suppressed MDM2 expression. The overexpression of non-mutated P53 may afford a protective mechanism in human lung adenocarcinomas. Copyright 2001 Wiley-Liss, Inc.

  2. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  3. Histone deacetylase inhibitors prevent p53-dependent and p53-independent Bax-mediated neuronal apoptosis through two distinct mechanisms.

    PubMed

    Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S

    2009-03-04

    Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.

  4. Negative feedback regulation of wild-type p53 biosynthesis.

    PubMed Central

    Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

    1995-01-01

    When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

  5. TRIM65 negatively regulates p53 through ubiquitination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Ma, Chengyuan; Zhou, Tong

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

  6. Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

    PubMed Central

    Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

    2012-01-01

    Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

  7. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

  8. Thermal, Chemical and pH Induced Denaturation of a Multimeric β-Galactosidase Reveals Multiple Unfolding Pathways

    PubMed Central

    Kishore, Devesh; Kundu, Suman; Kayastha, Arvind M.

    2012-01-01

    Background In this case study, we analysed the properties of unfolded states and pathways leading to complete denaturation of a multimeric chick pea β-galactosidase (CpGAL), as obtained from treatment with guanidium hydrochloride, urea, elevated temperature and extreme pH. Methodology/Principal Findings CpGAL, a heterodimeric protein with native molecular mass of 85 kDa, belongs to α+β class of protein. The conformational stability and thermodynamic parameters of CpGAL unfolding in different states were estimated and interpreted using circular dichroism and fluorescence spectroscopic measurements. The enzyme was found to be structurally and functionally stable in the entire pH range and upto 50°C temperature. Further increase in temperature induces unfolding followed by aggregation. Chemical induced denaturation was found to be cooperative and transitions were irreversible, non-coincidental and sigmoidal. Free energy of protein unfolding (ΔG0) and unfolding constant (Kobs) were also calculated for chemically denatured CpGAL. Significance The protein seems to use different pathways for unfolding in different environments and is a classical example of how the environment dictates the path a protein might take to fold while its amino acid sequence only defines its final three-dimensional conformation. The knowledge accumulated could be of immense biotechnological significance as well. PMID:23185611

  9. Investigation of thermal denaturation of solid oxytocin by terahertz dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Li, Xiangjun; Yang, Xiaojie; Liu, Jianjun; Du, Yong; Hong, Zhi

    2014-07-01

    We investigate the thermal denaturation of solid oxytocin using terahertz time domain spectroscopy(THz-TDS). When the peptide is heated up from 25°C to 107°C and cooled down to 25°C again, an irreversible decrease in its THz absorption coefficient and refractive index is observed. The corresponding frequency-dependent permittivity during heating is fitted by the Debye model with single relaxation time. The relaxation times during temperature rising agree very well with Arrhenius equation with the activation energy of 3.12kJ/(K•mol) as an indicator for its thermal denaturation difficulty.

  10. The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

    PubMed

    Noda, Takeshi

    2011-12-01

    I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.

    PubMed

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D

    2016-10-01

    TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.

  12. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma

    PubMed Central

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie

    2016-01-01

    Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of

  13. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have

  14. Smoking, p53 Mutation, and Lung Cancer

    PubMed Central

    Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

    2014-01-01

    This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

  15. Hyperthermophile Protein Behavior: Partially-Structured Conformations of Pyrococcus furiosus Rubredoxin Monomers Generated through Forced Cold-Denaturation and Refolding

    PubMed Central

    Ahmed, Shubbir; Guptasarma, Purnananda

    2014-01-01

    Some years ago, we showed that thermo-chemically denatured, partially-unfolded forms of Pyrococcus furiosus triosephosphateisomerase (PfuTIM) display cold-denaturation upon cooling, and heat-renaturation upon reheating, in proportion with the extent of initial partial unfolding achieved. This was the first time that cold-denaturation was demonstrated for a hyperthermophile protein, following unlocking of surface salt bridges. Here, we describe the behavior of another hyperthermophile protein, the small, monomeric, 53 residues-long rubredoxin from Pyrococcus furiosus (PfRd), which is one of the most thermostable proteins known to man. Like PfuTIM, PfRd too displays cold-denaturation after initial thermo-chemical perturbation, however, with two differences: (i) PfRd requires considerably higher temperatures as well as higher concentrations of guanidium hydrochloride (Gdm.HCl) than PfuTIM; (ii) PfRd's cold-denaturation behavior during cooling after thermo-chemical perturbation is incompletely reversible, unlike PfuTIM's, which was clearly reversible (from each different conformation generated). Differential cold-denaturation treatments allow PfRd to access multiple partially-unfolded states, each of which is clearly highly kinetically-stable. We refer to these as ‘Trishanku’ unfolding intermediates (or TUIs). Fascinatingly, refolding of TUIs through removal of Gdm.HCl generates multiple partially-refolded, monomeric, kinetically-trapped, non-native ‘Trishanku’ refolding intermediates (or TRIs), which differ from each other and from native PfRd and TUIs, in structural content and susceptibility to proteolysis. We find that the occurrence of cold denaturation and observations of TUI and TRI states is contingent on the oxidation status of iron, with redox agents managing to modulate the molecule's behavior upon gaining access to PfRd's iron atom. Mass spectrometric examination provides no evidence of the formation of disulfide bonds, but other experiments suggest

  16. System-based strategies for p53 recovery.

    PubMed

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

    2018-06-01

    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  17. Photodynamic Action on Native and Denatured Transforming Deoxyribonucleic Acid from Haemophilus influenzae

    PubMed Central

    León, Manuel Ponce-De; Cabrera-Juárez, Emiliano

    1970-01-01

    The photodynamic inactivation of native or denatured transforming deoxyribonucleic acid (DNA) from Haemophilus influenzae is described. The inactivation at the same pH was higher for denatured than native DNA. At acidic pH, the inactivation both for native and denatured DNA was faster than at alkaline pH. The guanine content of photoinactivated native DNA at neutral pH was less than untreated DNA. The inactivation of biological activity was more extensive than the alteration of guanine. The absorption spectrum of photoinactivated native or denatured DNA was only slightly different than the control DNA at the different experimental conditions. PMID:5309576

  18. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  19. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  20. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  1. The nucleolus directly regulates p53 export and degradation.

    PubMed

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  2. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  3. Immunohistochemical analysis of P53 protein in odontogenic cysts

    PubMed Central

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  4. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  5. Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

    PubMed Central

    Meng, X; Carlson, NR; Dong, J; Zhang, Y

    2016-01-01

    The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53

  6. p53 downregulates the Fanconi anaemia DNA repair pathway.

    PubMed

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  7. Involvement of stromal p53 in tumor-stroma interactions

    PubMed Central

    Bar, Jair; Moskovits, Neta; Oren, Moshe

    2009-01-01

    p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

  8. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  9. P53 Suppression of Homologous Recombination and Tumorigenesis

    DTIC Science & Technology

    2013-01-01

    absence or mutation of p53 and the mechanism of p53 control of HR in an in vivo system. p53 is often a targeted therapy and further insight into the...function of p53 in DNA repair pathways can be vital to finding novel points of targeted therapy . Our data will add insight to the important paradigm...cancers. Cisplatin works by the aquation of a chloride ligand that results in the formation of a DNA adduct, usually crosslinking the DNA, which impedes

  10. The Transcription Factor p53 Influences Microglial Activation Phenotype

    PubMed Central

    Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

    2011-01-01

    Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

  11. p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

    PubMed

    Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

    2000-01-01

    Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.

  12. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

    PubMed

    Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

  13. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    PubMed

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  14. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  15. Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

    PubMed Central

    Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

    2016-01-01

    Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

  16. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  17. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    PubMed

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  18. Phosphorylation of p53 modifies sensitivity to ionizing radiation.

    PubMed

    Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

    2011-06-01

    Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

  19. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  20. HIPK2 modulates p53 activity towards pro-apoptotic transcription.

    PubMed

    Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

    2009-10-14

    Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co

  1. Heat capacity changes in RNA folding: application of perturbation theory to hammerhead ribozyme cold denaturation

    PubMed Central

    Mikulecky, Peter J.; Feig, Andrew L.

    2004-01-01

    In proteins, empirical correlations have shown that changes in heat capacity (ΔCP) scale linearly with the hydrophobic surface area buried upon folding. The influence of ΔCP on RNA folding has been widely overlooked and is poorly understood. In addition to considerations of solvent reorganization, electrostatic effects might contribute to ΔCPs of folding in polyanionic species such as RNAs. Here, we employ a perturbation method based on electrostatic theory to probe the hot and cold denaturation behavior of the hammerhead ribozyme. This treatment avoids much of the error associated with imposing two-state folding models on non-two-state systems. Ribozyme stability is perturbed across a matrix of solvent conditions by varying the concentration of NaCl and methanol co-solvent. Temperature-dependent unfolding is then monitored by circular dichroism spectroscopy. The resulting array of unfolding transitions can be used to calculate a ΔCP of folding that accurately predicts the observed cold denaturation temperature. We confirm the accuracy of the calculated ΔCP by using isothermal titration calorimetry, and also demonstrate a methanol-dependence of the ΔCP. We weigh the strengths and limitations of this method for determining ΔCP values. Finally, we discuss the data in light of the physical origins of the ΔCPs for RNA folding and consider their impact on biological function. PMID:15282329

  2. Super p53 for Treatment of Ovarian Cancer

    DTIC Science & Technology

    2016-07-01

    WSLP ( polymer ) has been successfully synthesized, and a subset of adenoviral constructs have been cloned (p53, p53-CC, EGFP control). Major results...therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer -adenovirus hybrid 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18...modified p53, tumor suppressor, high grade serous carcinoma, combination therapy, carboplatin, paclitaxel, polymeric drug delivery, polymer

  3. Calcium Binding and Disulfide Bonds Regulate the Stability of Secretagogin towards Thermal and Urea Denaturation

    PubMed Central

    Weiffert, Tanja; Ní Mhurchú, Niamh; O’Connell, David; Linse, Sara

    2016-01-01

    Secretagogin is a calcium-sensor protein with six EF-hands. It is widely expressed in neurons and neuro-endocrine cells of a broad range of vertebrates including mammals, fishes and amphibia. The protein plays a role in secretion and interacts with several vesicle-associated proteins. In this work, we have studied the contribution of calcium binding and disulfide-bond formation to the stability of the secretagogin structure towards thermal and urea denaturation. SDS-PAGE analysis of secretagogin in reducing and non-reducing conditions identified a tendency of the protein to form dimers in a redox-dependent manner. The denaturation of apo and Calcium-loaded secretagogin was studied by circular dichroism and fluorescence spectroscopy under conditions favoring monomer or dimer or a 1:1 monomer: dimer ratio. This analysis reveals significantly higher stability towards urea denaturation of Calcium-loaded secretagogin compared to the apo protein. The secondary and tertiary structure of the Calcium-loaded form is not completely denatured in the presence of 10 M urea. Reduced and Calcium-loaded secretagogin is found to refold reversibly after heating to 95°C, while both oxidized and reduced apo secretagogin is irreversibly denatured at this temperature. Thus, calcium binding greatly stabilizes the structure of secretagogin towards chemical and heat denaturation. PMID:27812162

  4. Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

    PubMed

    Garner, Elizabeth; Raj, Kenneth

    2008-02-01

    There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

  5. Modeling the Etiology of p53-mutated Cancer Cells*

    PubMed Central

    Perez, Ricardo E.; Shen, Hong; Duan, Lei; Kim, Reuben H.; Kim, Terresa; Park, No-Hee; Maki, Carl G.

    2016-01-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. PMID:27022024

  6. p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

    PubMed

    Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

    2018-03-06

    Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

  7. Uncovering Specific Electrostatic Interactions in the Denatured States of Proteins

    PubMed Central

    Shen, Jana K.

    2010-01-01

    The stability and folding of proteins are modulated by energetically significant interactions in the denatured state that is in equilibrium with the native state. These interactions remain largely invisible to current experimental techniques, however, due to the sparse population and conformational heterogeneity of the denatured-state ensemble under folding conditions. Molecular dynamics simulations using physics-based force fields can in principle offer atomistic details of the denatured state. However, practical applications are plagued with the lack of rigorous means to validate microscopic information and deficiencies in force fields and solvent models. This study presents a method based on coupled titration and molecular dynamics sampling of the denatured state starting from the extended sequence under native conditions. The resulting denatured-state pKas allow for the prediction of experimental observables such as pH- and mutation-induced stability changes. I show the capability and use of the method by investigating the electrostatic interactions in the denatured states of wild-type and K12M mutant of NTL9 protein. This study shows that the major errors in electrostatics can be identified by validating the titration properties of the fragment peptides derived from the sequence of the intact protein. Consistent with experimental evidence, our simulations show a significantly depressed pKa for Asp8 in the denatured state of wild-type, which is due to a nonnative interaction between Asp8 and Lys12. Interestingly, the simulation also shows a nonnative interaction between Asp8 and Glu48 in the denatured state of the mutant. I believe the presented method is general and can be applied to extract and validate microscopic electrostatics of the entire folding energy landscape. PMID:20682271

  8. 27 CFR 21.151 - List of denaturants authorized for denatured spirits.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Denatured Rum (S.D.R.) Acetaldehyde S.D.A. 29. Acetone, U.S.P S.D.A. 23-A, 23-H. Acetaldol C.D.A. 18. Almond... alcohol S.D.A. 39, 39-A, 39-B, 40, 40-A, 40-B, 40-C. Camphor, U.S.P S.D.A. 27, 27-A, 38-B. Caustic soda.... Formaldehyde solution, U.S.P S.D.A. 22, 38-C, 38-D. Gasoline C.D.A. 18, 19; S.D.A. 28-A. Gasoline, unleaded C.D...

  9. 27 CFR 21.151 - List of denaturants authorized for denatured spirits.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... Denatured Rum (S.D.R.) Acetaldehyde S.D.A. 29. Acetone, U.S.P S.D.A. 23-A, 23-H. Acetaldol C.D.A. 18. Almond... alcohol S.D.A. 39, 39-A, 39-B, 40, 40-A, 40-B, 40-C. Camphor, U.S.P S.D.A. 27, 27-A, 38-B. Caustic soda.... Formaldehyde solution, U.S.P S.D.A. 22, 38-C, 38-D. Gasoline C.D.A. 18, 19; S.D.A. 28-A. Gasoline, unleaded C.D...

  10. Protein Denaturation on p-T Axes--Thermodynamics and Analysis.

    PubMed

    Smeller, László

    2015-01-01

    Proteins are essential players in the vast majority of molecular level life processes. Since their structure is in most cases substantial for their correct function, study of their structural changes attracted great interest in the past decades. The three dimensional structure of proteins is influenced by several factors including temperature, pH, presence of chaotropic and cosmotropic agents, or presence of denaturants. Although pressure is an equally important thermodynamic parameter as temperature, pressure studies are considerably less frequent in the literature, probably due to the technical difficulties associated to the pressure studies. Although the first steps in the high-pressure protein study have been done 100 years ago with Bridgman's ground breaking work, the field was silent until the modern spectroscopic techniques allowed the characterization of the protein structural changes, while the protein was under pressure. Recently a number of proteins were studied under pressure, and complete pressure-temperature phase diagrams were determined for several of them. This review summarizes the thermodynamic background of the typical elliptic p-T phase diagram, its limitations and the possible reasons for deviations of the experimental diagrams from the theoretical one. Finally we show some examples of experimentally determined pressure-temperature phase diagrams.

  11. MicroRNAs as Key Effectors in the p53 Network.

    PubMed

    Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

    2017-01-01

    The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

  12. P53 Suppression of Homologous Recombination and Tumorigenesis

    DTIC Science & Technology

    2011-01-01

    huge strides have been made in the numbers of mice breed and relevant cells collected for the purposes of experiments outlined in the aims below. The PI... breeding colony of R172P, R172H, Wild type and p53 null mice in order to have sufficient numbers of animals to perform the in vivo pun assay. Mouse...Strains and Breeding Cohorts Mice heterozygous for the point mutations p53R172P and p53R172H both on a C57BL/6 genetic background were kindly

  13. Immunohistochemical detection of p53 protein in ameloblastoma types.

    PubMed

    el-Sissy, N A

    1999-05-01

    Overexpression of p53 protein in unicystic ameloblastoma (uAB) is denser than in the conventional ameloblastoma (cAB) type, indicating increased wild type p53--suppressing the growth potential of uAB and denoting the early event of neoplastic transformation, probably of a previous odontogenic cyst. Overexpression of p53 in borderline cAB and malignant ameloblastoma (mAB) types might reflect a mutational p53 protein playing an oncogenic role, promoting tumour growth. Overexpression of p53 protein could be a valid screening method for predicting underlying malignant genetic changes in AB types, through increased frequency of immunoreactive cells or increased staining density.

  14. Friend or Foe: MicroRNAs in the p53 network.

    PubMed

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  15. Zn(II)-curc targets p53 in thyroid cancer cells.

    PubMed

    Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

    2015-10-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

  16. A dual role of p53 in the control of autophagy.

    PubMed

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  17. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  18. Expression of C-terminal deleted p53 isoforms in neuroblastoma

    PubMed Central

    Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

    2006-01-01

    The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

  19. On the cold denaturation of globular proteins

    NASA Astrophysics Data System (ADS)

    Ascolese, Eduardo; Graziano, Giuseppe

    2008-12-01

    The recent finding that yeast frataxin shows, at pH 7.0, cold denaturation at 274 K and hot denaturation at 303 K [A. Pastore, S.R. Martin, A. Politou, K.C. Kondapalli, T. Stemmler, P.A. Temussi, J. Am. Chem. Soc. 129 (2007) 5374] calls for a deeper rationalization of the molecular mechanisms stabilizing-destabilizing the native state of globular proteins. It is shown that the statistical thermodynamic model originally developed by Ikegami can reproduce in a more-than-qualitative manner the two conformational transitions of yeast frataxin, providing important clues on their molecular origin.

  20. Combined radiation and p53 gene therapy of malignant glioma cells.

    PubMed

    Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

    1999-01-01

    More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We

  1. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    PubMed Central

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-01-01

    To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

  2. 27 CFR 19.456 - Adding denaturants.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... methods of mixing denaturants and spirits if he deems such denaturation will not hinder effective... Denaturation § 19.456 Adding denaturants. Denaturants and spirits shall be mixed in packages, tanks, or bulk... proprietor shall submit a flow diagram of the intended process or method of adding denaturants. (Sec. 201...

  3. KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

    PubMed Central

    Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

    2017-01-01

    Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

  4. p53 -Dependent and -Independent Nucleolar Stress Responses

    PubMed Central

    Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

    2012-01-01

    The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

  5. On p53 revival using system oriented drug dosage design.

    PubMed

    Haseeb, Muhammad; Azam, Shumaila; Bhatti, A I; Azam, Rizwan; Ullah, Mukhtar; Fazal, Sahar

    2017-02-21

    We propose a new paradigm in the drug design for the revival of the p53 pathway in cancer cells. It is shown that the current strategy of using small molecule based Mdm2 inhibitors is not enough to adequately revive p53 in cancerous cells, especially when it comes to the extracting pulsating behavior of p53. This fact has come to notice when a novel method for the drug dosage design is introduced using system oriented concepts. As a test case, small molecule drug Mdm2 repressor Nutlin 3a is considered. The proposed method determines the dose of Nutlin to revive p53 pathway functionality. For this purpose, PBK dynamics of Nutlin have also been integrated with p53 pathway model. The p53 pathway is the focus of researchers for the last thirty years for its pivotal role as a frontline cancer suppressant protein due to its effect on cell cycle checkpoints and cell apoptosis in response to a DNA strand break. That is the reason for finding p53 being absent in more than 50% of tumor cancers. Various drugs have been proposed to revive p53 in cancer cells. Small molecule based drugs are at the foremost and are the subject of advanced clinical trials. The dosage design of these drugs is an important issue. We use control systems concepts to develop the drug dosage so that the cancer cells can be treated in appropriate time. We investigate by using a computational model how p53 protein responds to drug Nutlin 3a, an agent that interferes with the MDM2-mediated p53 regulation. The proposed integrated model describes in some detail the regulation network of p53 including the negative feedback loop mediated by MDM2 and the positive feedback loop mediated by Mdm2 mRNA as well as the reversible represses of MDM2 caused by Nutlin. The reported PBK dynamics of Nutlin 3a are also incorporated to see the full effect. It has been reported that p53 response to stresses in two ways. Either it has a sustained (constant) p53 response, or there are oscillations in p53 concentration. The

  6. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy

  7. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

  8. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    PubMed Central

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  9. Expression of P53 protein after exposure to ionizing radiation

    NASA Astrophysics Data System (ADS)

    Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

    2001-10-01

    One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

  10. An adaptive molecular timer in p53-meidated cell fate decision

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  11. Thermal denaturation of β-glucosidase B from Paenibacillus polymyxa proceeds through a Lumry-Eyring mechanism.

    PubMed

    Camarillo-Cadena, Menandro; Garza-Ramos, Georgina; Peimbert, Mariana; Pérez-Hernández, Gerardo; Zubillaga, Rafael A

    2011-06-01

    β-glucosidase B (BglB), 1,4-β-D: -glucanohydrolase, is an enzyme with various technological applications for which some thermostable mutants have been obtained. Because BglB denatures irreversibly with heating, the stabilities of these mutants are assessed kinetically. It, therefore, becomes relevant to determine whether the measured rate constants reflect one or several elementary kinetic steps. We have analyzed the kinetics of heat denaturation of BglB from Paenibacillus polymyxa under various conditions by following the loss of secondary structure and enzymatic activity. The denaturation is accompanied by aggregation and an initial reversible step at low temperatures. At T ≥ T ( m ), the process follows a two-state irreversible mechanism for which the kinetics does not depend on the enzyme concentration. This behavior can be explained by a Lumry-Eyring model in which the difference between the rates of the irreversible and the renaturation steps increases with temperature. Accordingly, at high scan rates (≥1 °C min(-1)) or temperatures (T ≥ T ( m )), the measurable activation energy involves only the elementary step of denaturation.

  12. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    PubMed

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  13. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

    PubMed

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-02-11

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

  15. Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

    PubMed Central

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

  16. 40 Years of Research Put p53 in Translation

    PubMed Central

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  17. pH and Heat Resistance of the Major Celery Allergen Api g 1.

    PubMed

    Rib-Schmidt, Carina; Riedl, Philipp; Meisinger, Veronika; Schwaben, Luisa; Schulenborg, Thomas; Reuter, Andreas; Schiller, Dirk; Seutter von Loetzen, Christian; Rösch, Paul

    2018-05-25

    The major celery allergen Api g 1 is a member of the pathogenesis-related 10 class protein family. Here we aimed to investigate the impact of heat and pH on the native protein conformation required for Immunoglobulin E (IgE) recognition. Spectroscopic methods, MS and IgE binding analyses were used to study the effects of pH and thermal treatment on Api g 1.0101. Heat processing results in a loss of the native protein fold via denaturation, oligomerisation and precipitation along with a subsequent reduction of IgE recognition. The induced effects and timescales are strongly pH depended. While Api g 1 refolds partially into an IgE-binding conformation at physiological pH, acidic pH treatment leads to the formation of structurally heat resistant, IgE-reactive oligomers. Thermal processing in the presence of a celery matrix or at pH conditions close to the isoelectric point (pI = 4.63) of Api g 1.0101 results in almost instant precipitation. Our data demonstrate that Api g 1.0101 is not intrinsically susceptible to heat treatment in vitro. However, the pH and the celery matrix strongly influence the stability of Api g 1.0101 and might be the main reasons for the observed temperature lability of this important food allergen. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and

  19. p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.

    PubMed

    Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar

    2017-06-23

    Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  1. Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

    PubMed Central

    Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

    1995-01-01

    We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

  2. The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status.

    PubMed

    Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer

    2011-03-11

    The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21- combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21- carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status.

  3. Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

    PubMed Central

    Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

    2017-01-01

    Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

  4. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  5. 29 CFR 1915.53 - Welding, cutting and heating in way of preservative coatings.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Welding, cutting and heating in way of preservative... SHIPYARD EMPLOYMENT Welding, Cutting and Heating § 1915.53 Welding, cutting and heating in way of... and shipbulding and shall not apply to shipbreaking. (b) Before welding, cutting or heating is...

  6. 29 CFR 1915.53 - Welding, cutting and heating in way of preservative coatings.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 7 2014-07-01 2014-07-01 false Welding, cutting and heating in way of preservative... SHIPYARD EMPLOYMENT Welding, Cutting and Heating § 1915.53 Welding, cutting and heating in way of... and shipbulding and shall not apply to shipbreaking. (b) Before welding, cutting or heating is...

  7. 29 CFR 1915.53 - Welding, cutting and heating in way of preservative coatings.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 7 2012-07-01 2012-07-01 false Welding, cutting and heating in way of preservative... SHIPYARD EMPLOYMENT Welding, Cutting and Heating § 1915.53 Welding, cutting and heating in way of... and shipbulding and shall not apply to shipbreaking. (b) Before welding, cutting or heating is...

  8. 29 CFR 1915.53 - Welding, cutting and heating in way of preservative coatings.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 29 Labor 7 2013-07-01 2013-07-01 false Welding, cutting and heating in way of preservative... SHIPYARD EMPLOYMENT Welding, Cutting and Heating § 1915.53 Welding, cutting and heating in way of... and shipbulding and shall not apply to shipbreaking. (b) Before welding, cutting or heating is...

  9. 29 CFR 1915.53 - Welding, cutting and heating in way of preservative coatings.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 7 2011-07-01 2011-07-01 false Welding, cutting and heating in way of preservative... SHIPYARD EMPLOYMENT Welding, Cutting and Heating § 1915.53 Welding, cutting and heating in way of... and shipbulding and shall not apply to shipbreaking. (b) Before welding, cutting or heating is...

  10. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    PubMed

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  11. p53 as an Effector or Inhibitor of Therapy Response

    PubMed Central

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2016-01-01

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. PMID:26637438

  12. The transcription factor p53: Not a repressor, solely an activator

    PubMed Central

    Fischer, Martin; Steiner, Lydia; Engeland, Kurt

    2014-01-01

    The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

  13. Stimulation of autophagy by the p53 target gene Sestrin2.

    PubMed

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  14. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  15. Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

    PubMed

    Romano, Rose-Anne; Sinha, Satrajit

    2014-04-01

    The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.

    PubMed

    Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori

    2017-12-01

    Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.

  17. Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

    PubMed Central

    Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

    2000-01-01

    p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

  18. Different urea stoichiometries between the dissociation and denaturation of tobacco mosaic virus as probed by hydrostatic pressure.

    PubMed

    Santos, Jose L R; Aparicio, Ricardo; Joekes, Inés; Silva, Jerson L; Bispo, Jose A C; Bonafe, Carlos F S

    2008-05-01

    Viruses are very efficient self-assembly structures, but little is understood about the thermodynamics governing their directed assembly. At higher levels of pressure or when pressure is combined with urea, denaturation occurs. For a better understanding of such processes, we investigated the apparent thermodynamic parameters of dissociation and denaturation by assuming a steady-state condition. These processes can be measured considering the decrease of light scattering of a viral solution due to the dissociation process, and the red shift of the fluorescence emission spectra, that occurs with the denaturation process. We determined the apparent urea stoichiometry considering the equilibrium reaction of TMV dissociation and subunit denaturation, which furnished, respectively, 1.53 and 11.1 mol of urea/mol of TMV subunit. The denaturation and dissociation conditions were arrived in a near reversible pathway, allowing the determination of thermodynamic parameters. Gel filtration HPLC, electron microscopy and circular dichroism confirmed the dissociation and denaturation processes. Based on spectroscopic results from earlier papers, the calculation of the apparent urea stoichiometry of dissociation and denaturation of several other viruses resulted in similar values, suggesting a similar virus-urea interaction among these systems.

  19. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

    PubMed Central

    Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

    2016-01-01

    Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

  20. p53 as an Effector or Inhibitor of Therapy Response.

    PubMed

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2015-12-04

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  1. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region.

  2. Distinct downstream targets manifest p53-dependent pathologies in mice.

    PubMed

    Pant, V; Xiong, S; Chau, G; Tsai, K; Shetty, G; Lozano, G

    2016-11-03

    Mdm2, the principal negative regulator of p53, is critical for survival, a fact clearly demonstrated by the p53-dependent death of germline or conditional mice following deletion of Mdm2. On the other hand, Mdm2 hypomorphic (Mdm2 Puro/Δ7-12 ) or heterozygous (Mdm2 +/- ) mice that express either 30 or 50% of normal Mdm2 levels, respectively, are viable but present distinct phenotypes because of increased p53 activity. Mdm2 levels are also transcriptionally regulated by p53. We evaluated the significance of this reciprocal relationship in a new hypomorphic mouse model inheriting an aberrant Mdm2 allele with insertion of the neomycin cassette and deletion of 184-bp sequence in intron 3. These mice also carry mutations in the Mdm2 P2-promoter and thus express suboptimal levels of Mdm2 entirely encoded from the P1-promoter. Resulting mice exhibit abnormalities in skin pigmentation and reproductive tissue architecture, and are subfertile. Notably, all these phenotypes are rescued on a p53-null background. Furthermore, these phenotypes depend on distinct p53 downstream activities as genetic ablation of the pro-apoptotic gene Puma reverts the reproductive abnormalities but not skin hyperpigmentation, whereas deletion of cell cycle arrest gene p21 does not rescue either phenotype. Moreover, p53-mediated upregulation of Kitl influences skin pigmentation. Altogether, these data emphasize tissue-specific p53 activities that regulate cell fate.

  3. The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

    p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

  4. Therapeutic targeting of the p53 pathway in cancer stem cells

    PubMed Central

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  5. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

    PubMed

    Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

    2015-06-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

  6. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    PubMed Central

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  7. AS-2, a novel inhibitor of p53-dependent apoptosis, prevents apoptotic mitochondrial dysfunction in a transcription-independent manner and protects mice from a lethal dose of ionizing radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing

    2014-08-08

    Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2

  8. p53 as a retrovirus-induced oxidative stress modulator.

    PubMed

    Kim, Soo Jin; Wong, Paul K Y

    2015-01-01

    Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.

  9. CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

    PubMed Central

    Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

    2014-01-01

    The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

  10. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  11. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.

    2016-06-01

    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal ;tumor suppressor; is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  12. Structural origins of pH and ionic strength effects on protein stability. Acid denaturation of sperm whale apomyoglobin.

    PubMed

    Yang, A S; Honig, B

    1994-04-15

    A recently developed approach to calculate the pH dependence of protein stability from three-dimensional structure information is applied to the analysis of acid denaturation of sperm whale apomyoglobin. The finite difference Poisson-Boltzmann method is used to calculate pKa values and these are used to obtain titration curves for the folded protein as well as for compact intermediates. The total electrostatic free energy change involved in apomyoglobin unfolding is then evaluated. Calculations are carried out of the unfolding free energy of the native (N) and the compact intermediate (I) of apomyoglobin relative to the unfolded state (U) over a range of pH at various ionic strengths. The contributions from key ionizable groups to the unfolding process are discussed. For the acid-induced partial unfolding of apomyoglobin near pH 5, the transition from N to I is found to be driven by three histidines that are exposed when the B, C, D and E helices unfold. Similarly, the unfolding of the compact intermediate I consisting of the A, G and H helices is driven primarily by a few carboxylic acids with low pKa values in the compact state. This picture is in contrast to the view which attributes acid denaturation to electrostatic repulsion resulting from the build up of positive charge. In fact, charge-charge interactions in myoglobin are found to be attractive at all pH values where the protein unfolds. pH-dependent changes in these interactions contribute to acid denaturation but other electrostatic effects, such as hydrogen bonding and solvation, are important as well. The effect of increasing ionic strength on unfolding is attributed to the decrease of attractive charge-charge interactions which destabilize the N state relative to I, but stabilize the I state relative to U by reducing the pKa shifts of a few critical carboxylic acids. The I state is found to be more stable than U at neutral pH thus accounting for its presence as an intermediate on the protein folding

  13. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  14. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  15. Mutant p53 expression in fallopian tube epithelium drives cell migration.

    PubMed

    Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

    2015-10-01

    Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates. © 2015 UICC.

  16. Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

    PubMed

    Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

    2013-05-01

    DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy

    DTIC Science & Technology

    1999-07-01

    inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74

  18. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  19. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  20. p53 and metabolism: from mechanism to therapeutics

    PubMed Central

    Simabuco, Fernando M.; Morale, Mirian G.; Pavan, Isadora C.B.; Morelli, Ana P.; Silva, Fernando R.; Tamura, Rodrigo E.

    2018-01-01

    The tumor cell changes itself and its microenvironment to adapt to different situations, including action of drugs and other agents targeting tumor control. Therefore, metabolism plays an important role in the activation of survival mechanisms to keep the cell proliferative potential. The Warburg effect directs the cellular metabolism towards an aerobic glycolytic pathway, despite the fact that it generates less adenosine triphosphate than oxidative phosphorylation; because it creates the building blocks necessary for cell proliferation. The transcription factor p53 is the master tumor suppressor; it binds to more than 4,000 sites in the genome and regulates the expression of more than 500 genes. Among these genes are important regulators of metabolism, affecting glucose, lipids and amino acids metabolism, oxidative phosphorylation, reactive oxygen species (ROS) generation and growth factors signaling. Wild-type and mutant p53 may have opposing effects in the expression of these metabolic genes. Therefore, depending on the p53 status of the cell, drugs that target metabolism may have different outcomes and metabolism may modulate drug resistance. Conversely, induction of p53 expression may regulate differently the tumor cell metabolism, inducing senescence, autophagy and apoptosis, which are dependent on the regulation of the PI3K/AKT/mTOR pathway and/or ROS induction. The interplay between p53 and metabolism is essential in the decision of cell fate and for cancer therapeutics. PMID:29805774

  1. Analysis of Thermally Denatured Depth in Laser Vaporization for Benign Prostatic Hyperplasia using a Simulation of Light Propagation and Heat Transfer (secondary publication)

    PubMed Central

    Takada, Junya; Honda, Norihiro; Hazama, Hisanao; Ioritani, Naomasa

    2016-01-01

    Background and Aims: Laser vaporization of the prostate is expected as a less invasive treatment for benign prostatic hyperplasia (BPH), via the photothermal effect. In order to develop safer and more effective laser vaporization of the prostate, it is essential to set optimal irradiation parameters based on quantitative evaluation of temperature distribution and thermally denatured depth in prostate tissue. Method: A simulation model was therefore devised with light propagation and heat transfer calculation, and the vaporized and thermally denatured depths were estimated by the simulation model. Results: The results of the simulation were compared with those of an ex vivo experiment and clinical trial. Based on the accumulated data, the vaporized depth strongly depended on the distance between the optical fiber and the prostate tissue, and it was suggested that contact laser irradiation could vaporize the prostate tissue most effectively. Additionally, it was suggested by analyzing thermally denatured depth comprehensively that laser irradiation at the distance of 3 mm between the optical fiber and the prostate tissue was useful for hemostasis. Conclusions: This study enabled quantitative and reproducible analysis of laser vaporization for BPH and will play a role in clarification of the safety and efficacy of this treatment. PMID:28765672

  2. Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.

    PubMed

    Barthelery, Nicolas J; Manfredi, James J

    2016-05-01

    The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

    PubMed

    Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

    2017-12-01

    Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  5. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  6. Intracellular accumulation of a mild-denatured monomer of the human PrP fragment 90-231, as possible mechanism of its neurotoxic effects.

    PubMed

    Chiovitti, Katia; Corsaro, Alessandro; Thellung, Stefano; Villa, Valentina; Paludi, Domenico; D'Arrigo, Cristina; Russo, Claudio; Perico, Angelo; Ianieri, Adriana; Di Cola, Domenico; Vergara, Alberto; Aceto, Antonio; Florio, Tullio

    2007-12-01

    Because of high tendency of the prion protein (PrP) to aggregate, the exact PrP isoform responsible for prion diseases as well as the pathological mechanism that it activates remains still controversial. In this study, we show that a pre-fibrillar, monomeric or small oligomeric conformation of the human PrP fragment 90-231 (hPrP90-231), rather than soluble or fibrillar large aggregates, represents the neurotoxic species. In particular, we demonstrate that monomeric mild-denatured hPrP90-231 (incubated for 1 h at 53 degrees C) induces SH-SY5Y neuroblastoma cell death, while, when structured in large aggregates, it is ineffective. Using spectroscopic and cellular techniques we demonstrate that this toxic conformer is characterized by a high exposure of hydrophobic regions that favors the intracellular accumulation of the protein. Inside the cells hPrP90-231 is mainly compartmentalized into the lysosomes where it may trigger pro-apoptotic 'cell death' signals. The PrP toxic conformation, which we have obtained inducing a controlled in vitro conformational change of the protein, might mimic mild-unfolding events occurring in vivo, in the presence of specific mutations, oxidative reactions or proteolysis. Thus, in light of this model, we propose that novel therapeutic strategies, designed to inhibit the interaction of the toxic PrP with the plasmamembrane, could be beneficial to prevent the formation of intracellular neurotoxic aggregates and ultimately the neuronal death.

  7. Targeting p53-MDM2-MDMX Loop for Cancer Therapy

    PubMed Central

    Zhang, Qi; Zeng, Shelya X.

    2015-01-01

    The tumor suppressor p53 plays a central role in anti-tumorigenesis and cancer therapy. It has been described as “the guardian of the genome”, because it is essential for conserving genomic stability by preventing mutation, and its mutation and inactivation are highly related to all human cancers. Two important p53 regulators, MDM2 and MDMX, inactivate p53 by directly inhibiting its transcriptional activity and mediating its ubiquitination in a feedback fashion, as their genes are also the transcriptional targets of p53. On account of the importance of the p53-MDM2- MDMX loop in the initiation and development of wild type p53-containing tumors, intensive studies over the past decade have been aiming to identify small molecules or peptides that could specifically target individual protein molecules of this pathway for developing better anti-cancer therapeutics. In this chapter, we review the approaches for screening and discovering efficient and selective MDM2 inhibitors with emphasis on the most advanced synthetic small molecules that interfere with the p53-MDM2 interaction and are currently on Phase I clinical trials. Other therapeutically useful strategies targeting this loop, which potentially improve the prospects of cancer therapy and prevention, will also be discussed briefly. PMID:25201201

  8. P53 Gene Mutagenesis in Breast Cancer

    DTIC Science & Technology

    2005-03-01

    the wild type T peak. 12 Table 1. Sonic ntations dected by SINtA Individual Cell Sequence Amino Acid Species Conservation 3 ID’ ID Change2 Change... differences in the content of toxic substances in the diet (Biggs et al., 1993; Blaszyk et al., 1996). The development of this p53 mutation load...Changes in the P53 Gene in Single Cells Individual Sequence Amino acid Species conservation ’ ID’ Cell ID change’ change Monkey Mouse Rat Chicken

  9. The impact of p53 on the early stage replication of retrovirus.

    PubMed

    Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

    2017-08-09

    The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of

  10. p53 predictive value for pT1-2 N0 disease at radical cystectomy.

    PubMed

    Shariat, Shahrokh F; Lotan, Yair; Karakiewicz, Pierre I; Ashfaq, Raheela; Isbarn, Hendrik; Fradet, Yves; Bastian, Patrick J; Nielsen, Matthew E; Capitanio, Umberto; Jeldres, Claudio; Montorsi, Francesco; Müller, Stefan C; Karam, Jose A; Heukamp, Lukas C; Netto, George; Lerner, Seth P; Sagalowsky, Arthur I; Cote, Richard J

    2009-09-01

    Approximately 15% to 30% of patients with pT1-2N0M0 urothelial carcinoma of the bladder experience disease progression despite radical cystectomy with curative intent. We determined whether p53 expression would improve the prediction of disease progression after radical cystectomy for pT1-2N0M0 UCB. In a multi-institutional retrospective cohort we identified 324 patients with pT1-2N0M0 urothelial carcinoma of the bladder who underwent radical cystectomy. Analysis focused on a testing cohort of 272 patients and an external validation of 52. Competing risks regression models were used to test the association of variables with cancer specific mortality after accounting for nonbladder cancer caused mortality. In the testing cohort 91 patients (33.5%) had altered p53 expression (p53alt). On multivariate competing risks regression analysis altered p53 achieved independent status for predicting disease recurrence and cancer specific mortality (each p <0.001). Adding p53 increased the accuracy of multivariate competing risks regression models predicting recurrence and cancer specific mortality by 5.7% (62.0% vs 67.7%) and 5.4% (61.6% vs 67.0%), respectively. Alterations in p53 represent a highly promising marker of disease recurrence and cancer specific mortality after radical cystectomy for urothelial carcinoma of the bladder. Analysis confirmed previous findings and showed that considering p53 can result in substantial accuracy gains relative to the use of standard predictors. The value and the level of the current evidence clearly exceed previous proof of the independent predictor status of p53 for predicting recurrence and cancer specific mortality.

  11. Functional Analysis of Interactions Between 53BP1, BRCA1 and p53

    DTIC Science & Technology

    2004-07-01

    deficiency synergize in tumorigenesis. Furthermore, the loss of a single 53BP1 allele enhances the susceptibility to cancer in the absence of p53. 14...specific antibodies against these sites and showed that at least two of them (S25 and S29) are phosphorylated in vivo by ATM, the kinase mutated in cancer ...characterized by chromosomal aberrations, genetic instability and cancer predisposition. +HU 153BP1 Fig. 5: Lack of 53BP1 prevents the efficient accumulation

  12. Thermal denaturation of protein studied by terahertz time-domain spectroscopy

    NASA Astrophysics Data System (ADS)

    Fu, Xiuhua; Li, Xiangjun; Liu, Jianjun; Du, Yong; Hong, Zhi

    2012-12-01

    In this study, the absorption spectra of native or thermal protein were measured in 0.2-1.4THz using terahertz time-domain spectroscopy (THz-TDS) system at room temperature, their absorption spectra and the refractive spectra were obtained. Experimental results indicate that protein both has strong absorption but their characteristics were not distinct in the THz region, and the absorption decreased during thermal denatured state. In order to prove protein had been denatured, we used Differential scanning calorimeter (DSC) measured their denatured temperature, from their DSC heating traces, collagen Td=101℃, Bovine serum albumin Td=97℃. While we also combined the Fourier transform infrared spectrometer (FTIR) to investigate their secondary and tertiary structure before and after denatuation, but the results did not have the distinct changes. We turned the absorption spectra and the refractive spectra to the dielectric spectra, and used the one-stage Debye model simulated the terahertz dielectric spectra of protein before and after denaturation. This research proved that the terahertz spectrum technology is feasible in testing protein that were affected by temperature or other factors which can provide theoretical foundation in the further study about the THz spectrum of protein and peptide temperature stability.

  13. p53 Involvement in the Control of Murine Hair Follicle Regression

    PubMed Central

    Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.

    2001-01-01

    p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365

  14. Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy

    2009-02-01

    Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glandsmore » of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.« less

  15. RELAP5-3D Modeling of Heat Transfer Components (Intermediate Heat Exchanger and Helical-Coil Steam Generator) for NGNP Application

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    N. A. Anderson; P. Sabharwall

    2014-01-01

    The Next Generation Nuclear Plant project is aimed at the research and development of a helium-cooled high-temperature gas reactor that could generate both electricity and process heat for the production of hydrogen. The heat from the high-temperature primary loop must be transferred via an intermediate heat exchanger to a secondary loop. Using RELAP5-3D, a model was developed for two of the heat exchanger options a printed-circuit heat exchanger and a helical-coil steam generator. The RELAP5-3D models were used to simulate an exponential decrease in pressure over a 20 second period. The results of this loss of coolant analysis indicate thatmore » heat is initially transferred from the primary loop to the secondary loop, but after the decrease in pressure in the primary loop the heat is transferred from the secondary loop to the primary loop. A high-temperature gas reactor model should be developed and connected to the heat transfer component to simulate other transients.« less

  16. Adiposity is associated with p53 gene mutations in breast cancer.

    PubMed

    Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G

    2015-10-01

    Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.

  17. Distinct tumor protein p53 mutants in breast cancer subgroups.

    PubMed

    Dumay, Anne; Feugeas, Jean-Paul; Wittmer, Evelyne; Lehmann-Che, Jacqueline; Bertheau, Philippe; Espié, Marc; Plassa, Louis-François; Cottu, Paul; Marty, Michel; André, Fabrice; Sotiriou, Christos; Pusztai, Lajos; de Thé, Hugues

    2013-03-01

    Tumor protein p53 (TP53) is mutated in approximately 30% of breast cancers, but this frequency fluctuates widely between subclasses. We investigated the p53 mutation status in 572 breast tumors, classified into luminal, basal and molecular apocrine subgroups. As expected, the lowest mutation frequency was observed in luminal (26%), and the highest in basal (88%) tumors. Luminal tumors showed significantly higher frequency of substitutions (82 vs. 65%), notably A/T to G/C transitions (31 vs. 15%), whereas molecular apocrine and basal tumors presented much higher frequencies of complex mutations (deletions/insertions) (36 and 33%, respectively, vs. 18%). Accordingly, missense mutations were significantly more frequent in luminal tumors (75 vs. 54%), whereas basal tumors displayed significantly increased rates of TP53 truncations (43 vs. 25%), resulting in loss of function and/or expression. Interestingly, as basal tumors, molecular apocrine tumors presented with a high rate of complex mutations, but paradoxically, these were not associated with increased frequency of p53 truncation. As in luminal tumors, this could reflect a selective pressure for p53 gain of function, possibly through P63/P73 inactivation. Collectively, these observations point not only to different mechanisms of TP53 alterations, but also to different functional consequences in the different breast cancer subtypes. Copyright © 2012 UICC.

  18. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

  19. p53 on the crossroad between regeneration and cancer.

    PubMed

    Charni, Meital; Aloni-Grinstein, Ronit; Molchadsky, Alina; Rotter, Varda

    2017-01-01

    Regeneration and tumorigenesis share common molecular pathways, nevertheless the outcome of regeneration is life, whereas tumorigenesis leads to death. Although the process of regeneration is strictly controlled, malignant transformation is unrestrained. In this review, we discuss the involvement of TP53, the major tumor-suppressor gene, in the regeneration process. We point to the role of p53 as coordinator assuring that regeneration will not shift to carcinogenesis. The fluctuation in p53 activity during the regeneration process permits a tight control. On one hand, its inhibition at the initial stages allows massive proliferation, on the other its induction at advanced steps of regeneration is essential for preservation of robustness and fidelity of the regeneration process. A better understanding of the role of p53 in regulation of regeneration may open new opportunities for implementation of TP53-based therapies, currently available for cancer patients, in regenerative medicine.

  20. Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

    PubMed Central

    Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

    2016-01-01

    Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

  1. [Study on serum p53 protein in cops in Guangzhou city].

    PubMed

    Zhu, Wen-Chang; Chen, Qing; Chu, Xin-Wei; Luo, Chen-Ling; Wu, Min; Wang, Ya-Xian; Chen, Si-Dong

    2003-10-01

    Serum p53 protein overexpression was detected in population exposed to traffic exhaust gas to study the relation between traffic exhaust gas and the increased risk in p53 gene mutation. Serum p53 protein expression was measured by enzyme-linked immunosorbent assay. Relationship between different types of job and serum p53 protein overexpression were studied by pearson Chi-square tests. Results on serum p53 protein overexpression on jobs outside of office (5.74%) were not significantly higher than jobs inside the office. However, it suggested that traffic police men (12.12%) working outside of office, with whose length of service longer than 30 years had a significant overexpression of serum p53 protein than the others (5.36%) whose length of service was less than 30 years (P < 0.05, OR = 2.43, 95% CI: 1.11 - 5.33). Overexpression rate of p53 protein appeared to be 6.89% in the group whose average weekly exposure hours were more than 40 hours, which was significant higher than the group whose exposed hours were less than 40 hours (P < 0.05, OR = 1.71, 95% CI: 1.03 - 2.81). The result suggested that traffic exhaust gas was likely to cause mutation of p53 gene and increasing the incidence of lung cancer.

  2. Selective activation of p53-mediated tumour suppression in high-grade tumours.

    PubMed

    Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

    2010-11-25

    Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

  3. Irreversible denaturation of maltodextrin glucosidase studied by differential scanning calorimetry, circular dichroism, and turbidity measurements.

    PubMed

    Goyal, Megha; Chaudhuri, Tapan K; Kuwajima, Kunihiro

    2014-01-01

    Thermal denaturation of Escherichia coli maltodextrin glucosidase was studied by differential scanning calorimetry, circular dichroism (230 nm), and UV-absorption measurements (340 nm), which were respectively used to monitor heat absorption, conformational unfolding, and the production of solution turbidity. The denaturation was irreversible, and the thermal transition recorded at scan rates of 0.5-1.5 K/min was significantly scan-rate dependent, indicating that the thermal denaturation was kinetically controlled. The absence of a protein-concentration effect on the thermal transition indicated that the denaturation was rate-limited by a mono-molecular process. From the analysis of the calorimetric thermograms, a one-step irreversible model well represented the thermal denaturation of the protein. The calorimetrically observed thermal transitions showed excellent coincidence with the turbidity transitions monitored by UV-absorption as well as with the unfolding transitions monitored by circular dichroism. The thermal denaturation of the protein was thus rate-limited by conformational unfolding, which was followed by a rapid irreversible formation of aggregates that produced the solution turbidity. It is thus important to note that the absence of the protein-concentration effect on the irreversible thermal denaturation does not necessarily means the absence of protein aggregation itself. The turbidity measurements together with differential scanning calorimetry in the irreversible thermal denaturation of the protein provided a very effective approach for understanding the mechanisms of the irreversible denaturation. The Arrhenius-equation parameters obtained from analysis of the thermal denaturation were compared with those of other proteins that have been reported to show the one-step irreversible thermal denaturation. Maltodextrin glucosidase had sufficiently high kinetic stability with a half-life of 68 days at a physiological temperature (37°C).

  4. The p53 breast cancer tissue biomarker in Indian women

    PubMed Central

    Patil, Vinayak W; Tayade, Mukund B; Pingale, Sangeeta A; Dalvi, Shubhangi M; Rajekar, Rajesh B; Deshmukh, Hemkant M; Patil, Shital D; Singhai, Rajeev

    2011-01-01

    Background Combination chemotherapy is highly effective in locally advanced breast cancer. A negative expression of biomarker p53 indicates a higher chance of responding to this regimen. Patients’ p53 status may be used as a biological cancer marker to identify those who would benefit from more aggressive treatments. Aims The role of p53 in modulating apoptosis has suggested that it may affect the efficacy of anticancer agents. p53 alterations in 80 patients with locally advanced breast cancer IIIB undergoing neoadjuvant chemotherapy were prospectively evaluated. Materials and methods Patients received three cycles of paclitaxel (175 mg/m2) and doxorubicin (60 mg/m2) every 21 days. Tumor sections were analyzed before treatment for altered patterns of p53 expression, using immunohistochemistry and DNA sequencing. Results An overall response rate of 83.5% was obtained, including 15.1% complete pathological responses. The regimen was well tolerated with 17.7% grade 2/3 nausea and 12.8% grade 3/4 leukopenia. There was a statistically significant correlation between response and expression of p53. Of 25 patients who obtained a complete clinical response, only two were classified as p53-positive (P = 0.004, χ2). Of 11 patients who obtained a complete pathological remission, one was positive (P = 0.099, χ2). Conclusion Immunohistochemical (IHC) analysis has been shown to be a prognostic factor for patients with breast cancer in India. Paclitaxel is one of the most promising anticancer agents for the therapy of breast cancer, where it has also shown activity in tumors resistant to doxorubicin. PMID:24367177

  5. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  6. P53 protein in proliferation, repair and apoptosis of cells.

    PubMed

    Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

    2014-05-01

    The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

  7. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    PubMed Central

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  8. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  9. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed Central

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar

    2017-01-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941

  10. Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.

    PubMed

    Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae

    2017-08-01

    Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  11. The tumour suppressor CYLD regulates the p53 DNA damage response

    PubMed Central

    Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

    2016-01-01

    The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

  12. Clinical and pathologic relevance of p53 index in canine osseous tumors.

    PubMed

    Loukopoulos, P; Thornton, J R; Robinson, W F

    2003-05-01

    The clinicopathologic value of the immunohistochemical (IHC) expression of p53 protein was evaluated in 167 canine osseous tumors. p53 staining frequency and intensity in tumor cells was expressed as a p53 index. p53 index was significantly higher in osteosarcomas than in other sarcomas, chondrosarcoma, multilobular tumor of bone, and tumors initially misdiagnosed as osteosarcomas as well as in appendicular versus axial and in distal versus proximal osteosarcomas. A strong correlation is demonstrated between the p53 index and a range of clinicopathologic parameters in osteosarcoma, including the tumor site, histologic grade and score, mitotic index, degree of tumor necrosis, and pleomorphism. Chondroblastic osteosarcomas had significantly higher and telangiectatic osteosarcomas significantly lower p53 index than did osteosarcomas belonging to other histopathologic subtypes, a fact that tends to reinforce the perception of these osteosarcomas as distinct clinicopathologic entities. Entire males had higher p53 index than did neutered males. p53 index was higher in Rottweilers than in Great Danes and Terriers, confirming breed susceptibilities to osteosarcoma. p53 index showed no association with age, primary or secondary site status, or the presence of metastases or other tumor types. Biopsy samples had a higher p53 index than did postmortem samples, either because of differences in sample processing or the possibility that p53 overexpression is more evident at the earlier stages of osteosarcoma pathogenesis, presumably represented by the biopsy material. IHC examination for p53 and the derived index has the potential to be used as an additional diagnostic tool and prognostic indicator for osseous tumors.

  13. p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

    PubMed Central

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

  14. p53 is a key regulator for osthole-triggered cancer pathogenesis.

    PubMed

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

  15. Metabolic activation of 2-amino-1-methyl-6-phenylimidazo [4,5-b]pyridine and DNA adduct formation depends on p53: Studies in Trp53(+/+),Trp53(+/-) and Trp53(-/-) mice.

    PubMed

    Krais, Annette M; Speksnijder, Ewoud N; Melis, Joost P M; Singh, Rajinder; Caldwell, Anna; Gamboa da Costa, Gonçalo; Luijten, Mirjam; Phillips, David H; Arlt, Volker M

    2016-02-15

    The expression of the tumor suppressor p53 can influence the bioactivation of, and DNA damage induced by, the environmental carcinogen benzo[a]pyrene, indicating a role for p53 in its cytochrome P450 (CYP)-mediated biotransformation. The carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), which is formed during the cooking of food, is also metabolically activated by CYP enzymes, particularly CYP1A2. We investigated the potential role of p53 in PhIP metabolism in vivo by treating Trp53(+/+), Trp53(+/-) and Trp53(-/-) mice with a single oral dose of 50 mg/kg body weight PhIP. N-(Deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP-C8-dG) levels in DNA, measured by liquid chromatography-tandem mass spectrometry, were significantly lower in liver, colon, forestomach and glandular stomach of Trp53(-/-) mice compared to Trp53(+/+) mice. Lower PhIP-DNA adduct levels in the livers of Trp53(-/-) mice correlated with lower Cyp1a2 enzyme activity (measured by methoxyresorufin-O-demethylase activity) in these animals. Interestingly, PhIP-DNA adduct levels were significantly higher in kidney and bladder of Trp53(-/-) mice compared to Trp53(+/+) mice, which was accompanied by higher sulfotransferase (Sult) 1a1 protein levels and increased Sult1a1 enzyme activity (measured by 2-naphthylsulfate formation from 2-naphthol) in kidneys of these animals. Our study demonstrates a role for p53 in the metabolism of PhIP in vivo, extending previous results on a novel role for p53 in xenobiotic metabolism. Our results also indicate that the impact of p53 on PhIP biotransformation is tissue-dependent and that in addition to Cyp1a enzymes, Sult1a1 can contribute to PhIP-DNA adduct formation. © 2015 The Authors International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.

  16. MicroRNA-125b is a novel negative regulator of p53.

    PubMed

    Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

    2009-04-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

  17. MicroRNA-125b is a novel negative regulator of p53

    PubMed Central

    Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

    2009-01-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

  18. Enhanced radiosensitization of p53 mutant cells by oleamide.

    PubMed

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil

    2006-04-01

    Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  19. Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

    PubMed

    Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

    2017-12-15

    TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

  20. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  1. p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS

    PubMed Central

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

    2008-01-01

    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401

  2. p53 and MDM2 protein expression in actinic cheilitis.

    PubMed

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

    2008-01-01

    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia.

  3. R248Q mutation--Beyond p53-DNA binding.

    PubMed

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  4. High-pressure NMR reveals close similarity between cold and alcohol protein denaturation in ubiquitin.

    PubMed

    Vajpai, Navratna; Nisius, Lydia; Wiktor, Maciej; Grzesiek, Stephan

    2013-01-29

    Proteins denature not only at high, but also at low temperature as well as high pressure. These denatured states are not easily accessible for experiment, because usually heat denaturation causes aggregation, whereas cold or pressure denaturation occurs at temperatures well below the freezing point of water or pressures above 5 kbar, respectively. Here we have obtained atomic details of the pressure-assisted, cold-denatured state of ubiquitin at 2,500 bar and 258 K by high-resolution NMR techniques. Under these conditions, a folded, native-like and a disordered state exist in slow exchange. Secondary chemical shifts show that the disordered state has structural propensities for a native-like N-terminal β-hairpin and α-helix and a nonnative C-terminal α-helix. These propensities are very similar to the previously described alcohol-denatured (A-)state. Similar to the A-state, (15)N relaxation data indicate that the secondary structure elements move as independent segments. The close similarity of pressure-assisted, cold-denatured, and alcohol-denatured states with native and nonnative secondary elements supports a hierarchical mechanism of folding and supports the notion that similar to alcohol, pressure and cold reduce the hydrophobic effect. Indeed, at nondenaturing concentrations of methanol, a complete transition from the native to the A-state can be achieved at ambient temperature by varying the pressure from 1 to 2,500 bar. The methanol-assisted pressure transition is completely reversible and can also be induced in protein G. This method should allow highly detailed studies of protein-folding transitions in a continuous and reversible manner.

  5. The Origins and Evolution of the p53 Family of Genes

    PubMed Central

    Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

    2010-01-01

    A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

  6. Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

    2009-03-01

    We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

  7. The role of p53 in cancer drug resistance and targeted chemotherapy.

    PubMed

    Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas

    2017-01-31

    Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.

  8. Increased Arf/p53 activity in stem cells, aging and cancer.

    PubMed

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  9. Correlated parameter fit of arrhenius model for thermal denaturation of proteins and cells.

    PubMed

    Qin, Zhenpeng; Balasubramanian, Saravana Kumar; Wolkers, Willem F; Pearce, John A; Bischof, John C

    2014-12-01

    Thermal denaturation of proteins is critical to cell injury, food science and other biomaterial processing. For example protein denaturation correlates strongly with cell death by heating, and is increasingly of interest in focal thermal therapies of cancer and other diseases at temperatures which often exceed 50 °C. The Arrhenius model is a simple yet widely used model for both protein denaturation and cell injury. To establish the utility of the Arrhenius model for protein denaturation at 50 °C and above its sensitivities to the kinetic parameters (activation energy E a and frequency factor A) were carefully examined. We propose a simplified correlated parameter fit to the Arrhenius model by treating E a, as an independent fitting parameter and allowing A to follow dependently. The utility of the correlated parameter fit is demonstrated on thermal denaturation of proteins and cells from the literature as a validation, and new experimental measurements in our lab using FTIR spectroscopy to demonstrate broad applicability of this method. Finally, we demonstrate that the end-temperature within which the denaturation is measured is important and changes the kinetics. Specifically, higher E a and A parameters were found at low end-temperature (50 °C) and reduce as end-temperatures increase to 70 °C. This trend is consistent with Arrhenius parameters for cell injury in the literature that are significantly higher for clonogenics (45-50 °C) vs. membrane dye assays (60-70 °C). Future opportunities to monitor cell injury by spectroscopic measurement of protein denaturation are discussed.

  10. Correlated Parameter Fit of Arrhenius Model for Thermal Denaturation of Proteins and Cells

    PubMed Central

    Qin, Zhenpeng; Balasubramanian, Saravana Kumar; Wolkers, Willem F.; Pearce, John A.; Bischof, John C.

    2014-01-01

    Thermal denaturation of proteins is critical to cell injury, food science and other biomaterial processing. For example protein denaturation correlates strongly with cell death by heating, and is increasingly of interest in focal thermal therapies of cancer and other diseases at temperatures which often exceed 50 °C. The Arrhenius model is a simple yet widely used model for both protein denaturation and cell injury. To establish the utility of the Arrhenius model for protein denaturation at 50 °C and above its sensitivities to the kinetic parameters (activation energy Ea and frequency factor A) were carefully examined. We propose a simplified correlated parameter fit to the Arrhenius model by treating Ea, as an independent fitting parameter and allowing A to follow dependently. The utility of the correlated parameter fit is demonstrated on thermal denaturation of proteins and cells from the literature as a validation, and new experimental measurements in our lab using FTIR spectroscopy to demonstrate broad applicability of this method. Finally, we demonstrate that the end-temperature within which the denaturation is measured is important and changes the kinetics. Specifically, higher Ea and A parameters were found at low end-temperature (50°C) and reduce as end-temperatures increase to 70 °C. This trend is consistent with Arrhenius parameters for cell injury in the literature that are significantly higher for clonogenics (45 – 50 °C) vs. membrane dye assays (60 –70 °C). Future opportunities to monitor cell injury by spectroscopic measurement of protein denaturation are discussed. PMID:25205396

  11. Irreversible Denaturation of Maltodextrin Glucosidase Studied by Differential Scanning Calorimetry, Circular Dichroism, and Turbidity Measurements

    PubMed Central

    Goyal, Megha; Chaudhuri, Tapan K.; Kuwajima, Kunihiro

    2014-01-01

    Thermal denaturation of Escherichia coli maltodextrin glucosidase was studied by differential scanning calorimetry, circular dichroism (230 nm), and UV-absorption measurements (340 nm), which were respectively used to monitor heat absorption, conformational unfolding, and the production of solution turbidity. The denaturation was irreversible, and the thermal transition recorded at scan rates of 0.5–1.5 K/min was significantly scan-rate dependent, indicating that the thermal denaturation was kinetically controlled. The absence of a protein-concentration effect on the thermal transition indicated that the denaturation was rate-limited by a mono-molecular process. From the analysis of the calorimetric thermograms, a one-step irreversible model well represented the thermal denaturation of the protein. The calorimetrically observed thermal transitions showed excellent coincidence with the turbidity transitions monitored by UV-absorption as well as with the unfolding transitions monitored by circular dichroism. The thermal denaturation of the protein was thus rate-limited by conformational unfolding, which was followed by a rapid irreversible formation of aggregates that produced the solution turbidity. It is thus important to note that the absence of the protein-concentration effect on the irreversible thermal denaturation does not necessarily means the absence of protein aggregation itself. The turbidity measurements together with differential scanning calorimetry in the irreversible thermal denaturation of the protein provided a very effective approach for understanding the mechanisms of the irreversible denaturation. The Arrhenius-equation parameters obtained from analysis of the thermal denaturation were compared with those of other proteins that have been reported to show the one-step irreversible thermal denaturation. Maltodextrin glucosidase had sufficiently high kinetic stability with a half-life of 68 days at a physiological temperature (37°C). PMID

  12. The Tumor Suppressor Protein p53 and its Physiological Splicing Variant p53as in a Mouse Mammary Cancer Model

    DTIC Science & Technology

    1997-10-01

    and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted

  13. Urea-temperature phase diagrams capture the thermodynamics of denatured state expansion that accompany protein unfolding

    PubMed Central

    Tischer, Alexander; Auton, Matthew

    2013-01-01

    We have analyzed the thermodynamic properties of the von Willebrand factor (VWF) A3 domain using urea-induced unfolding at variable temperature and thermal unfolding at variable urea concentrations to generate a phase diagram that quantitatively describes the equilibrium between native and denatured states. From this analysis, we were able to determine consistent thermodynamic parameters with various spectroscopic and calorimetric methods that define the urea–temperature parameter plane from cold denaturation to heat denaturation. Urea and thermal denaturation are experimentally reversible and independent of the thermal scan rate indicating that all transitions are at equilibrium and the van't Hoff and calorimetric enthalpies obtained from analysis of individual thermal transitions are equivalent demonstrating two-state character. Global analysis of the urea–temperature phase diagram results in a significantly higher enthalpy of unfolding than obtained from analysis of individual thermal transitions and significant cross correlations describing the urea dependence of and that define a complex temperature dependence of the m-value. Circular dichroism (CD) spectroscopy illustrates a large increase in secondary structure content of the urea-denatured state as temperature increases and a loss of secondary structure in the thermally denatured state upon addition of urea. These structural changes in the denatured ensemble make up ∼40% of the total ellipticity change indicating a highly compact thermally denatured state. The difference between the thermodynamic parameters obtained from phase diagram analysis and those obtained from analysis of individual thermal transitions illustrates that phase diagrams capture both contributions to unfolding and denatured state expansion and by comparison are able to decipher these contributions. PMID:23813497

  14. Robustness of the p53 network and biological hackers.

    PubMed

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  15. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    PubMed Central

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  16. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    PubMed

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

  17. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  18. Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

    PubMed

    Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

    2013-01-31

    Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

  19. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  20. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    PubMed

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  1. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  2. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed Central

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  3. The expanding regulatory universe of p53 in gastrointestinal cancer.

    PubMed

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  4. The UbL-UBA Ubiquilin4 protein functions as a tumor suppressor in gastric cancer by p53-dependent and p53-independent regulation of p21.

    PubMed

    Huang, Shengkai; Li, Yan; Yuan, Xinghua; Zhao, Mei; Wang, Jia; Li, You; Li, Yuan; Lin, Hong; Zhang, Qiao; Wang, Wenjie; Li, Dongdong; Dong, Xin; Li, Lanfen; Liu, Min; Huang, Weiyan; Huang, Changzhi

    2018-06-13

    Ubiquilin4 (Ubqln4), a member of the UbL-UBA protein family, serves as an adaptor in the degradation of specific substrates via the proteasomal pathway. However, the biological function of Ubqln4 remains largely unknown, especially in cancer. Here, we reported that Ubqln4 was downregulated in gastric cancer tissues and functioned as a tumor suppressor by inhibiting gastric cancer cell proliferation in vivo and in vitro. Overexpression of Ubqln4-induced cellular senescence and G1-S cell cycle arrest in gastric cancer cells and activated the p53/p21 axis. Moreover, Ubqln4 regulated p21 through both p53-dependent and p53-independent manners. Ubqln4 interacted with RNF114, an E3 ubiquitin ligase of p21, and negatively regulated its expression level, which in turn stabilized p21 by attenuating proteasomal degradation of p21. These effects of Ubqln4 were partly abrogated in gastric cancer cells upon silencing of p21. Our findings not only establish the anti-tumor potential of Ubqln4 in gastric cancer but also reveal a role for Ubqln4 in regulation of the cell cycle and cellular senescence via stabilizing p21.

  5. Super p53 for Treatment of Ovarian Cancer

    DTIC Science & Technology

    2017-09-01

    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  6. Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

    PubMed Central

    Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

    2012-01-01

    Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

  7. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    PubMed

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  8. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less

  9. p53 Is a Host Cell Regulator during Herpes Simplex Encephalitis.

    PubMed

    Maruzuru, Yuhei; Koyanagi, Naoto; Takemura, Naoki; Uematsu, Satoshi; Matsubara, Daisuke; Suzuki, Yutaka; Arii, Jun; Kato, Akihisa; Kawaguchi, Yasushi

    2016-08-01

    p53 is a critical host cell factor in the cellular response to a broad range of stress factors. We recently reported that p53 is required for efficient herpes simplex virus 1 (HSV-1) replication in cell culture. However, a defined role for p53 in HSV-1 replication and pathogenesis in vivo remains elusive. In this study, we examined the effects of p53 on HSV-1 infection in vivo using p53-deficient mice. Following intracranial inoculation, p53 knockout reduced viral replication in the brains of mice and led to significantly reduced rates of mortality due to herpes simplex encephalitis. These results suggest that p53 is an important host cell regulator of HSV-1 replication and pathogenesis in the central nervous system (CNS). HSV-1 causes sporadic cases of encephalitis, which, even with antiviral therapy, can result in severe neurological defects and even death. Many host cell factors involved in the regulation of CNS HSV-1 infection have been investigated using genetically modified mice. However, most of these factors are immunological regulators and act via immunological pathways in order to restrict CNS HSV-1 infection. They therefore provide limited information on intrinsic host cell regulators that may be involved in the facilitation of CNS HSV-1 infection. Here we demonstrate that a host cell protein, p53, which has generally been considered a host cell restriction factor for various viral infections, is required for efficient HSV-1 replication and pathogenesis in the CNS of mice. This is the first report showing that p53 positively regulates viral replication and pathogenesis in vivo and provides insights into its molecular mechanism, which may suggest novel clinical treatment options for herpes simplex encephalitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Detection of p53 mutations in proliferating vascular cells in glioblastoma multiforme.

    PubMed

    Kawasoe, Takuma; Takeshima, Hideo; Yamashita, Shinji; Mizuguchi, Sohei; Fukushima, Tsuyoshi; Yokogami, Kiyotaka; Yamasaki, Kouji

    2015-02-01

    Glioblastoma multiforme (GBM), one of the most aggressive tumors in humans, is highly angiogenic. However, treatment with the angiogenesis inhibitor bevacizumab has not significantly prolonged overall patient survival times. GBM resistance to angiogenesis inhibitors is attributed to multiple interacting mechanisms. Although mesenchymal transition via glioma stem-like cells has attracted attention, it is considered a poor biomarker. There is no simple method for differentiating tumor-derived and reactive vascular cells from normal cells. The authors attempted to detect the mesenchymal transition of tumor cells by means of p53 and isocitrate dehydrogenase 1 (IDH1) immunohistochemistry. Using antibody against p53 and IDH1 R132H, the authors immunohistochemically analyzed GBM tissue from patients who had undergone surgery at the University of Miyazaki Hospital during August 2005-December 2011. They focused on microvascular proliferation with a p53-positive ratio exceeding 50%. They compared TP53 mutations in original tumor tissues and in p53-positive and p53-negative microvascular proliferation cells collected by laser microdissection. Among 61 enrolled GBM patients, the first screening step (immunostaining) identified 46 GBMs as p53 positive, 3 of which manifested areas of prominent p53-positive microvascular proliferation (>50%). Histologically, areas of p53-positive microvascular proliferation tended to be clustered, and they coexisted with areas of p53-negative microvascular proliferation. Both types of microvascular proliferation cells were clearly separated from original tumor cells by glial fibrillary acidic protein, epidermal growth factor receptor, and low-/high-molecular-weight cytokeratin. DNA sequencing analysis disclosed that p53-positive microvascular proliferation cells exhibited TP53 mutations identical to those observed in the original tumor; p53-negative microvascular proliferation cells contained a normal allele. Although immunostaining indicated

  11. CRISPR-Cas9-based target validation for p53-reactivating model compounds

    PubMed Central

    Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

    2015-01-01

    Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

  12. Roles of HAUSP-mediated p53 regulation in central nervous system development.

    PubMed

    Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W

    2011-08-01

    The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.

  13. Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

    PubMed

    Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

    2016-03-01

    Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

  14. 27 CFR 19.455 - Dissolving of denaturants.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Dissolving of denaturants... Denaturation § 19.455 Dissolving of denaturants. Denaturants which are difficult to dissolve in spirits at... may be liquefied or dissolved in a small quantity of spirits or water in advance of their use in the...

  15. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  16. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

    2011-01-01

    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

  17. Urea-temperature phase diagrams capture the thermodynamics of denatured state expansion that accompany protein unfolding.

    PubMed

    Tischer, Alexander; Auton, Matthew

    2013-09-01

    We have analyzed the thermodynamic properties of the von Willebrand factor (VWF) A3 domain using urea-induced unfolding at variable temperature and thermal unfolding at variable urea concentrations to generate a phase diagram that quantitatively describes the equilibrium between native and denatured states. From this analysis, we were able to determine consistent thermodynamic parameters with various spectroscopic and calorimetric methods that define the urea-temperature parameter plane from cold denaturation to heat denaturation. Urea and thermal denaturation are experimentally reversible and independent of the thermal scan rate indicating that all transitions are at equilibrium and the van't Hoff and calorimetric enthalpies obtained from analysis of individual thermal transitions are equivalent demonstrating two-state character. Global analysis of the urea-temperature phase diagram results in a significantly higher enthalpy of unfolding than obtained from analysis of individual thermal transitions and significant cross correlations describing the urea dependence of ΔH0 and ΔCP0 that define a complex temperature dependence of the m-value. Circular dichroism (CD) spectroscopy illustrates a large increase in secondary structure content of the urea-denatured state as temperature increases and a loss of secondary structure in the thermally denatured state upon addition of urea. These structural changes in the denatured ensemble make up ∼40% of the total ellipticity change indicating a highly compact thermally denatured state. The difference between the thermodynamic parameters obtained from phase diagram analysis and those obtained from analysis of individual thermal transitions illustrates that phase diagrams capture both contributions to unfolding and denatured state expansion and by comparison are able to decipher these contributions. © 2013 The Protein Society.

  18. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  19. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutatedmore » (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.« less

  20. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    PubMed Central

    Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M

    2018-01-01

    Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous

  1. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    PubMed

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  2. Nucleophosmin regulates the stability and transcriptional activity of p53.

    PubMed

    Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

    2002-07-01

    Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

  3. Interaction of the Tumor Suppressor p53 with Replication Protein A.

    DTIC Science & Technology

    1996-08-01

    The DNA replication factor RPA physically associates with the tumor suppressor protein p53, an interaction that could be important for the function...binding single-stranded DNA, this mutant of RPA fails to support DNA replication . Therefore the region of RPA which interacts with p53 is essential for...of p53, p21/WAFl/CIPl, inhibits the cell-cycle by associating with cyclin-cdk kinases. It also inhibits DNA replication by interacting with a

  4. Detection of genotoxic and non-genotoxic carcinogens in Xpc(-/-)p53(+/-) mice.

    PubMed

    Melis, Joost P M; Speksnijder, Ewoud N; Kuiper, Raoul V; Salvatori, Daniela C F; Schaap, Mirjam M; Maas, Saskia; Robinson, Joke; Verhoef, Aart; van Benthem, Jan; Luijten, Mirjam; van Steeg, Harry

    2013-01-15

    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

    PubMed Central

    2012-01-01

    Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

  6. Preeclampsia is associated with alterations in the p53-pathway in villous trophoblast.

    PubMed

    Sharp, Andrew N; Heazell, Alexander E P; Baczyk, Dora; Dunk, Caroline E; Lacey, Helen A; Jones, Carolyn J P; Perkins, Jonathan E; Kingdom, John C P; Baker, Philip N; Crocker, Ian P

    2014-01-01

    Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT-α). Equally, Mdm2 was knocked-down with siRNA. Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation.

  7. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

    2013-11-01

    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

  8. Enzyme kinetics above denaturation temperature: a temperature-jump/stopped-flow apparatus.

    PubMed

    Kintses, Bálint; Simon, Zoltán; Gyimesi, Máté; Tóth, Júlia; Jelinek, Balázs; Niedetzky, Csaba; Kovács, Mihály; Málnási-Csizmadia, András

    2006-12-15

    We constructed a "temperature-jump/stopped-flow" apparatus that allows us to study fast enzyme reactions at extremely high temperatures. This apparatus is a redesigned stopped-flow which is capable of mixing the reactants on a submillisecond timescale concomitant with a temperature-jump even as large as 60 degrees C. We show that enzyme reactions that are faster than the denaturation process can be investigated above denaturation temperatures. In addition, the temperature-jump/stopped-flow enables us to investigate at physiological temperature the mechanisms of many human enzymes, which was impossible until now because of their heat instability. Furthermore, this technique is extremely useful in studying the progress of heat-induced protein unfolding. The temperature-jump/stopped-flow method combined with the application of structure-specific fluorescence signals provides novel opportunities to study the stability of certain regions of enzymes and identify the unfolding-initiating regions of proteins. The temperature-jump/stopped-flow technique may become a breakthrough in exploring new features of enzymes and the mechanism of unfolding processes.

  9. UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

    PubMed Central

    Du, Cheng; Wu, Hong; Leng, Roger P.

    2016-01-01

    Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

  10. p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

    PubMed

    Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

    1998-09-01

    The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

  11. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  12. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

    PubMed

    Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

    2010-11-01

    Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

  13. A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM

    EPA Science Inventory

    p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

  14. Preeclampsia Is Associated with Alterations in the p53-Pathway in Villous Trophoblast

    PubMed Central

    Sharp, Andrew N.; Heazell, Alexander E. P.; Baczyk, Dora; Dunk, Caroline E.; Lacey, Helen A.; Jones, Carolyn J. P.; Perkins, Jonathan E.; Kingdom, John C. P.; Baker, Philip N.; Crocker, Ian P.

    2014-01-01

    Background Preeclampsia (PE) is characterized by exaggerated apoptosis of the villous trophoblast of placental villi. Since p53 is a critical regulator of apoptosis we hypothesized that excessive apoptosis in PE is mediated by abnormal expression of proteins participating in the p53 pathway and that modulation of the p53 pathway alters trophoblast apoptosis in vitro. Methods Fresh placental villous tissue was collected from normal pregnancies and pregnancies complicated by PE; Western blotting and real-time PCR were performed on tissue lysate for protein and mRNA expression of p53 and downstream effector proteins, p21, Bax and caspases 3 and 8. To further assess the ability of p53 to modulate apoptosis within trophoblast, BeWo cells and placental villous tissue were exposed to the p53-activator, Nutlin-3, alone or in combination with the p53-inhibitor, Pifithrin-α (PFT- α). Equally, Mdm2 was knocked-down with siRNA. Results Protein expression of p53, p21 and Bax was significantly increased in pregnancies complicated by PE. Conversely, Mdm2 protein levels were significantly depleted in PE; immunohistochemistry showed these changes to be confined to trophoblast. Reduction in the negative feedback of p53 by Mdm2, using siRNA and Nutlin-3, caused an imbalance between p53 and Mdm2 that triggered apoptosis in term villous explants. In the case of Nutlin, this was attenuated by Pifithrin-α. Conclusions These data illustrate the potential for an imbalance in p53 and Mdm2 expression to promote excessive apoptosis in villous trophoblast. The upstream regulation of p53 and Mdm2, with regard to exaggerated apoptosis and autophagy in PE, merits further investigation. PMID:24498154

  15. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. © 2015. Published by The Company of Biologists Ltd.

  16. MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

    PubMed

    Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

    2018-04-17

    The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

  17. Effects of thermally induced denaturation on technological-functional properties of whey protein isolate-based films.

    PubMed

    Schmid, M; Krimmel, B; Grupa, U; Noller, K

    2014-09-01

    This study examined how and to what extent the degree of denaturation affected the technological-functional properties of whey protein isolate (WPI)-based coatings. It was observed that denaturation affected the material properties of WPI-coated films significantly. Surface energy decreased by approximately 20% compared with native coatings. Because the surface energy of a coating should be lower than that of the substrate, this might result in enhanced wettability characteristics between WPI-based solution and substrate surface. Water vapor barrier properties increased by about 35% and oxygen barrier properties increased by approximately 33%. However, significant differences were mainly observed between coatings made of fully native WPI and ones with a degree of denaturation of 25%. Higher degrees of denaturation did not lead to further improvement of material properties. This observation offers cost-saving potential: a major share of denatured whey proteins may be replaced by fully native ones that are not exposed to energy-intensive heat treatment. Furthermore, native WPI solutions can be produced with higher dry matter content without gelatinizing. Hence, less moisture has to be removed through drying, resulting in reduced energy consumption. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Cold denaturation and 2H2O stabilization of a staphylococcal nuclease mutant.

    PubMed Central

    Antonino, L C; Kautz, R A; Nakano, T; Fox, R O; Fink, A L

    1991-01-01

    Cold denaturation is now recognized as a general property of proteins but has been observed only under destabilizing conditions, such as moderate denaturant concentration or low pH. By destabilizing the protein using site-directed mutagenesis, we have observed cold denaturation at pH 7.0 in the absence of denaturants in a mutant of staphylococcal nuclease, which we call NCA S28G for a hybrid protein between staphylococcal nuclease and concanavalin A in which there is the point mutation Ser-28----Gly. The temperature of maximum stability (tmax) as determined by circular dichroism (CD) was 18.1 degrees C, and the midpoints of the thermal unfolding transitions (tm) were 0.6 degrees C and 30.0 degrees C. These values may be compared with the tm of 52.5 degrees C for wild-type staphylococcal nuclease, for which no cold denaturation was observed under these conditions. When the stability of the mutant was examined in 2H2O by NMR, CD, or fluorescence, a substantial increase in the amount of folded protein at the tmax was noted as well as a decrease in tmax, reflecting increased stability. PMID:1652762

  19. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  20. AAVPG: A vigilant vector where transgene expression is induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

  1. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    PubMed

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  2. Inhibition of apoptosis by p26: implications for small heat shock protein function during Artemia development.

    PubMed

    Villeneuve, Tania S; Ma, Xiaocui; Sun, Yu; Oulton, Mindy M; Oliver, Ann E; MacRae, Thomas H

    2006-01-01

    p26, an abundantly expressed small heat shock protein, is thought to establish stress resistance in oviparously developing embryos of the crustacean Artemia franciscana by preventing irreversible protein denaturation, but it might also promote survival by inhibiting apoptosis. To test this possibility, stably transfected mammalian cells producing p26 were generated and their ability to resist apoptosis induction determined. Examination of immunofluorescently stained transfected 293H cells by confocal microscopy demonstrated p26 is diffusely distributed in the cytoplasm with a minor amount of the protein in nuclei. As shown by immunoprobing of Western blots, p26 constituted approximately 0.6% of soluble cell protein. p26 localization and quantity were unchanged during prolonged culture, and the protein had no apparent ill effects on transfected cells. Molecular sieve chromatography in Sepharose 6B revealed p26 oligomers of about 20 monomers, with a second fraction occurring as larger aggregates. A similar pattern was observed in sucrose gradients, but overall oligomer size was smaller. Mammalian cells containing p26 were more thermotolerant than cells transfected with the expression vector only, and as measured by annexin V labeling, Hoescht 33342 nuclear staining and procaspase-3 activation, transfected cells effectively resisted apoptosis induction by heat and staurosporine. The ability to confer thermotolerance and limit heat-induced apoptosis is important because Artemia embryos are frequently exposed to high temperature in their natural habitat. p26 also blocked apoptosis in transfected cells during drying and rehydration, findings with direct relevance to Artemia life history characteristics because desiccation terminates cyst diapause. Thus, in addition to functioning as a molecular chaperone, p26 inhibits apoptosis, an activity shared by other small heat shock proteins and with the potential to play an important role during Artemia embryo development.

  3. Synthesis and evaluation of modified chalcone based p53 stabilizing agents.

    PubMed

    Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdel-Hamid; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

    2017-09-01

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (CAL-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI 50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI 50 of 0.473±0.043µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-h post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Kinetic and thermodynamic parameters for thermal denaturation of ovine milk lactoferrin determined by its loss of immunoreactivity.

    PubMed

    Navarro, F; Harouna, S; Calvo, M; Pérez, M D; Sánchez, L

    2015-07-01

    Lactoferrin is a protein with important biological functions that can be obtained from milk and by-products derived from the dairy industry, such as whey. Although bovine lactoferrin has been extensively studied, ovine lactoferrin is not quite as well known. In the present study, the effect of several heat treatments in 3 different media, over a temperature range from 66 to 75°C, has been studied on lactoferrin isolated from sheep milk. Denaturation of lactoferrin was determined by measuring its immunoreactivity with specific polyclonal antibodies. Kinetic and thermodynamic parameters obtained indicate that lactoferrin denatures by heat more rapidly in whey than in phosphate buffer or milk. The value of activation energy found for the denaturation process of lactoferrin when treated in whey is higher (390kJ/mol) than that obtained in milk (194kJ/mol) or phosphate buffer (179kJ/mol). This indicates that a great amount of energy is necessary to start denaturation of ovine lactoferrin, probably due to the interaction of this protein with other whey proteins. The changes in the hydrophobicity of lactoferrin after heat treatments were determined by fluorescence measurement using acrylamide. The decrease in the hydrophobicity constant was very small for the treatments from 66 to 75°C, up to 20min, which indicates that lactoferrin conformation did not experienced a great change. The results obtained in this study permit the prediction of behavior of ovine lactoferrin under several heat treatments and show that high-temperature, short-time pasteurization (72°C, 15 s) does not cause loss of its immunoreactivity and, consequently, would not affect its conformation and biological activity. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling

  6. The impact of p53 protein core domain structural alteration on ovarian cancer survival.

    PubMed

    Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E

    2003-09-15

    Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.

  7. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    PubMed

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Methionine sulfoxide reductase A regulates cell growth through the p53-p21 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Seung Hee; Kim, Hwa-Young, E-mail: hykim@ynu.ac.kr

    2011-12-09

    Highlights: Black-Right-Pointing-Pointer Down-regulation of MsrA inhibits normal cell proliferation. Black-Right-Pointing-Pointer MsrA deficiency leads to an increase in p21 by enhanced p53 acetylation. Black-Right-Pointing-Pointer Down-regulation of MsrA causes cell cycle arrest at the G{sub 2}/M stage. Black-Right-Pointing-Pointer MsrA is a regulator of cell growth that mediates the p53-p21 pathway. -- Abstract: MsrA is an oxidoreductase that catalyzes the stereospecific reduction of methionine-S-sulfoxide to methionine. Although MsrA is well-characterized as an antioxidant and has been implicated in the aging process and cellular senescence, its roles in cell proliferation are poorly understood. Here, we report a critical role of MsrA in normal cellmore » proliferation and describe the regulation mechanism of cell growth by this protein. Down-regulation of MsrA inhibited cell proliferation, but MsrA overexpression did not promote it. MsrA deficiency led to an increase in p21, a major cyclin-dependent kinase inhibitor, thereby causing cell cycle arrest at the G{sub 2}/M stage. While protein levels of p53 were not altered upon MsrA deficiency, its acetylation level was significantly elevated, which subsequently activated p21 transcription. The data suggest that MsrA is a regulator of cell growth that mediates the p53-p21 pathway.« less

  9. Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

    PubMed

    Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

    2009-06-19

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

  10. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    PubMed Central

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630

  11. The p53-Deficient Mouse as a Breast Cancer Model

    DTIC Science & Technology

    1995-10-01

    M.A. Gryka , F.Z. Bischoff, M.A. Tain- Halachmi, R.T. Bronson, and R.A. Weinberg. 1994. Tumor sky, and S.H. Friend. 1990. Germ line p53 mutations in a...J. Kassel, M.A. Gryka , F.Z. Bischoff, Weaver-Feldhaus, W. Ding, Z. Gholami, P. Soderkvist, L. M.A. Tainsky, and S.H. Friend. 1990. Germ line p53

  12. Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

    PubMed

    Donehower, Lawrence A

    2014-06-01

    Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

  13. In vitro anti-denaturation and anti-hyaluronidase activities of extracts and galactolipids from leaves of Impatiens parviflora DC.

    PubMed

    Grabowska, Karolina; Podolak, Irma; Galanty, Agnieszka; Załuski, Daniel; Makowska-Wąs, Justyna; Sobolewska, Danuta; Janeczko, Zbigniew; Żmudzki, Paweł

    2016-01-01

    The in vitro anti-denaturation and anti-hyaluronidase activities of Impatiens parviflora extracts and isolated galactolipids (MGDG-1, DGDG-1) were investigated. This is the first report on these compounds in I. parviflora. All extracts showed anti-hyaluronidase activity, but only methanolic extract from fresh leaves exhibited significant activity against heat-induced denaturation of BSA in a dose-dependent manner. At 500 μg/mL, the extract and the reference drug showed 79.05% and 99.81% inhibition of protein denaturation, respectively. These results indicate that fresh leaves of I. parviflora may be beneficial in inflammatory conditions, especially those associated with protein denaturation, such as rheumatoid arthritis. The study revealed that only MGDG-1 showed weak activity in anti-denaturation assay but both galactolipids were potent inhibitors of hyaluronidase. MGDG-1 completely inhibited the enzyme activity at the concentration of 127.9 μg/mL. These results indicate the potential of galactolipids in the treatment of diseases associated with the loss of hyaluronic acid.

  14. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    PubMed

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  15. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

    PubMed Central

    Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

    2013-01-01

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

  16. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    PubMed

    Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V

    2013-01-01

    The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  17. Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

    PubMed

    Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

    2009-07-01

    p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

  18. p53 represses autophagy in a cell cycle-dependent fashion.

    PubMed

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  19. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    PubMed

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  20. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  1. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    PubMed Central

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-01-01

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096

  2. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence

    PubMed Central

    Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

    2015-01-01

    Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction. PMID:26578773

  3. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

    PubMed

    Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

    2015-11-17

    Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

  4. The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.

    PubMed

    Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang

    2017-05-01

    This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.

  5. Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor.

    PubMed

    Salama, Asmaa; Kamel, Ahmad

    2011-03-01

    Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p=0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p<0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p=0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p=0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p=0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p=0.004). Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification. Copyright © 2011. Published by Elsevier B.V.

  6. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  7. The UMD-p53 database: new mutations and analysis tools.

    PubMed

    Béroud, Christophe; Soussi, Thierry

    2003-03-01

    The tumor suppressor gene TP53 (p53) is the most extensively studied gene involved in human cancers. More than 1,400 publications have reported mutations of this gene in 150 cancer types for a total of 14,971 mutations. To exploit this huge bulk of data, specific analytic tools were highly warranted. We therefore developed a locus-specific database software called UMD-p53. This database compiles all somatic and germline mutations as well as polymorphisms of the TP53 gene which have been reported in the published literature since 1989, or unpublished data submitted to the database curators. The database is available at www.umd.necker.fr or at http://p53.curie.fr/. In this paper, we describe recent developments of the UMD-p53 database. These developments include new fields and routines. For example, the analysis of putative acceptor or donor splice sites is now automated and gives new insight for the causal role of "silent mutations." Other routines have also been created such as the prescreening module, the UV module, and the cancer distribution module. These new improvements will help users not only for molecular epidemiology and pharmacogenetic studies but also for patient-based studies. To achieve theses purposes we have designed a procedure to check and validate data in order to reach the highest quality data. Copyright 2003 Wiley-Liss, Inc.

  8. WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma.

    PubMed

    Del Mare, Sara; Husanie, Hussam; Iancu, Ortal; Abu-Odeh, Mohammad; Evangelou, Konstantinos; Lovat, Francesca; Volinia, Stefano; Gordon, Jonathan; Amir, Gail; Stein, Janet; Stein, Gary S; Croce, Carlo M; Gorgoulis, Vassilis; Lian, Jane B; Aqeilan, Rami I

    2016-10-15

    Osteosarcoma is a highly metastatic form of bone cancer in adolescents and young adults that is resistant to existing treatments. Development of an effective therapy has been hindered by very limited understanding of the mechanisms of osteosarcomagenesis. Here, we used genetically engineered mice to investigate the effects of deleting the tumor suppressor Wwox selectively in either osteoblast progenitors or mature osteoblasts. Mice with conditional deletion of Wwox in preosteoblasts (Wwox Δosx1 ) displayed a severe inhibition of osteogenesis accompanied by p53 upregulation, effects that were not observed in mice lacking Wwox in mature osteoblasts. Deletion of p53 in Wwox Δosx1 mice rescued the osteogenic defect. In addition, the Wwox;p53 Δosx1 double knockout mice developed poorly differentiated osteosarcomas that resemble human osteosarcoma in histology, location, metastatic behavior, and gene expression. Strikingly, the development of osteosarcomas in these mice was greatly accelerated compared with mice lacking p53 only. In contrast, combined WWOX and p53 inactivation in mature osteoblasts did not accelerate osteosarcomagenesis compared with p53 inactivation alone. These findings provide evidence that a WWOX-p53 network regulates normal bone formation and that disruption of this network in osteoprogenitors results in accelerated osteosarcoma. The Wwox;p53 Δosx1 double knockout establishes a new osteosarcoma model with significant advancement over existing models. Cancer Res; 76(20); 6107-17. ©2016 AACR. ©2016 American Association for Cancer Research.

  9. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    PubMed

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  10. Anti-cancer peptides from ras-p21 and p53 proteins.

    PubMed

    Pincus, Matthew R; Fenelus, Maly; Sarafraz-Yazdi, Ehsan; Adler, Victor; Bowne, Wilbur; Michl, Josef

    2011-01-01

    We have employed computer-based molecular modeling approaches to design peptides from the ras-p21 and p53 proteins that either induce tumor cell reversion to the untransformed phenotype or induce tumor cell necrosis without affecting normal cells. For rasp21, we have computed and superimposed the average low energy structures for the wild-type protein and oncogenic forms of this protein and found that specific domains change conformation in the oncogenic proteins. We have synthesized peptides corresponding to these and found that ras peptides, 35-47 (PNC-7) and 96-110 (PNC-2), block oncogenic ras-p21-induced oocyte maturation but have no effect on insulin-induced oocyte maturation that requires activation of endogenous wild-type ras-p21. These results show signal transduction pathway differences between oncogenic and activated wild-type ras-p21. Both peptides, attached to a membrane-penetrating peptide (membrane residency peptide or MRP), either induce phenotypic reversion to the untransformed phenotype or tumor cell necrosis of several ras-transformed cell lines, but have no effect on the growth of normal cells. Using other computational methods, we have designed two peptides, PNC-27 and 28, containing HDM-2-protein-binding domain sequences from p53 linked on their C-termini to the MRP that induce pore formation in the membranes of a wide range of cancer cells but not any normal cells tested. This is due to the expression of HDM-2 in the cancer cell membrane that does not occur in normal cells. These peptides eradicate a highly malignant tumor in nude mice with no apparent side effects. Both ras and p53 peptides show promise as anti-tumor agents in humans.

  11. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    PubMed

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

  12. p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

    PubMed

    Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

    2001-11-09

    Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

  13. Mitoguazone induces apoptosis via a p53-independent mechanism.

    PubMed

    Davidson, K; Petit, T; Izbicka, E; Koester, S; Von Hoff, D D

    1998-08-01

    Mitoguazone (methylglyoxal bisguanylhydrazone, methyl-GAG or MGBG) is a synthetic polycarbonyl derivative with activity in patients with Hodgkin's and non-Hodgkin's lymphoma, head and neck cancer, prostate cancer, and esophageal cancer. Mitoguazone has also recently been documented to have activity in patients with AIDS-related lymphoma. Among anticancer drugs, mitoguazone has a unique mechanism of action via interference with the polyamine biosynthetic pathway. Polyamines stabilize DNA structure by non-covalent cross-bridging between phosphate groups on opposite strands. In addition, mitoguazone causes uncoupling of oxidative phosphorylation. In this study, the ability of mitoguazone to induce apoptosis by inhibiting the polyamine pathway was assessed in three Burkitt's lymphoma cell lines (Raji, Ramos and Daudi) and one prostate carcinoma cell line (MPC 3). Additional evaluations were performed in two human breast cancer cell lines (MCF7 with wild-type p53 and VM4K with mutated p53) to determine whether the p53 tumor suppressor gene was required for efficient apoptosis induction. The present study demonstrated that mitoguazone induces apoptosis in all the different human cancer cell lines tested in a concentration- and time-dependent way, and triggers a p53-independent programmed cell death in the human breast cancer MCF7 cell line.

  14. Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

    PubMed Central

    Kim, Seok-Hyung; Kowalski, Marie L.; Carson, Robert P.; Bridges, L. Richard; Ess, Kevin C.

    2013-01-01

    SUMMARY Tuberous sclerosis complex (TSC) is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1) kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors. PMID:23580196

  15. 27 CFR 19.459 - Mixing of denatured spirits.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Mixing of denatured spirits. 19.459 Section 19.459 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... of Articles Denaturation § 19.459 Mixing of denatured spirits. (a) Denatured spirits produced under...

  16. Pleurotus ostreatus inhibits proliferation of human breast and colon cancer cells through p53-dependent as well as p53-independent pathway

    PubMed Central

    JEDINAK, ANDREJ; SLIVA, DANIEL

    2009-01-01

    In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765

  17. Progesterone facilitates chromosome instability (aneuploidy) in p53 null normal mammary epithelial cells

    NASA Technical Reports Server (NTRS)

    Goepfert, T. M.; McCarthy, M.; Kittrell, F. S.; Stephens, C.; Ullrich, R. L.; Brinkley, B. R.; Medina, D.

    2000-01-01

    Mammary epithelial cells from p53 null mice have been shown recently to exhibit an increased risk for tumor development. Hormonal stimulation markedly increased tumor development in p53 null mammary cells. Here we demonstrate that mammary tumors arising in p53 null mammary cells are highly aneuploid, with greater than 70% of the tumor cells containing altered chromosome number and a mean chromosome number of 56. Normal mammary cells of p53 null genotype and aged less than 14 wk do not exhibit aneuploidy in primary cell culture. Significantly, the hormone progesterone, but not estrogen, increases the incidence of aneuploidy in morphologically normal p53 null mammary epithelial cells. Such cells exhibited 40% aneuploidy and a mean chromosome number of 54. The increase in aneuploidy measured in p53 null tumor cells or hormonally stimulated normal p53 null cells was not accompanied by centrosome amplification. These results suggest that normal levels of progesterone can facilitate chromosomal instability in the absence of the tumor suppressor gene, p53. The results support the emerging hypothesis based both on human epidemiological and animal model studies that progesterone markedly enhances mammary tumorigenesis.

  18. Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

    PubMed

    Suppiah, Aravind; Greenman, John

    2013-08-07

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

  19. Mechanisms of Breast Carcinogenesis Involving Wild-Type p53

    DTIC Science & Technology

    2001-09-01

    Nelson, C. E., Gryka , M . A., Litwak, G., Gebhardt, M ., level of p53 that was expressed in the cells in both these studies Bressac, B., Ozturk, M ., Baker...14 Publication resulting from this research: 1. Resnick-Silverman, L., S. St Clair, M . Maurer, K...activation by the tumor suppressor protein p53. Genes Dev 12:2102-7. 2. Tang, H. Y., K. Zhao, J. F. Pizzolato, M . Fonarev, J. C. Langer, and J. J

  20. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  1. p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

    PubMed Central

    Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

    1998-01-01

    Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and

  2. Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sang Eun; Min, Yong Ki; Ha, Jae Du

    2007-07-06

    Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less

  3. Direct characterization of hydrophobic hydration during cold and pressure denaturation.

    PubMed

    Das, Payel; Matysiak, Silvina

    2012-05-10

    Cold and pressure denaturation are believed to have their molecular origin in hydrophobic interactions between nonpolar groups and water. However, the direct characterization of the temperature- and pressure-dependent variations of those interactions with atomistic simulations remains challenging. We investigated the role of solvent in the cold and pressure denaturation of a model hydrophobic 32-mer polymer by performing extensive coarse-grained molecular dynamics simulations including explicit solvation. Our simulations showed that the water-excluded folded state of this polymer is marginally stable and can be unfolded by heating or cooling, as well as by applying pressure, similar to globular proteins. We further detected essential population of a hairpin-like configuration prior to the collapse, which is consistently accompanied by a vapor bubble at the elbow of the kink. Increasing pressure suppresses formation of this vapor bubble by reducing water fluctuations in the hydration shell of the polymer, thus promoting unfolding. Further analysis revealed a slight reduction of water tetrahedrality in the polymer hydration shell compared to the bulk. Cold denaturation is driven by an enhanced tetrahedral ordering of hydration shell water than bulk water. At elevated pressures, the strikingly reduced fluctuations combined with the increase in interstitial water molecules in the polymer hydration shell contribute to weakening of hydrophobic interactions, thereby promoting pressure unfolding. These findings provide critical molecular insights into the changes in hydrophobic hydration during cold and pressure unfolding of a hydrophobic polymer, which is strongly related to the cold and pressure denaturation of globular proteins.

  4. The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells.

    PubMed

    Kim, H; You, S; Foster, L K; Farris, J; Foster, D N

    2001-08-23

    The steady-state levels of p53 mRNA were dramatically lower in immortal chicken embryo fibroblast (CEF) cell lines compared to primary CEF cells. In the presence of cycloheximide (CHX), the steady-state levels of p53 mRNA markedly increased in immortal CEF cell lines, similar to levels found in primary cells. The de novo synthetic rates of p53 mRNA were relatively similar in primary and immortal cells grown in the presence or absence of CHX. Destabilization of p53 mRNA was observed in the nuclei of immortal, but not primary, CEF cells. The half-life of p53 mRNA in primary cells was found to be a relatively long 23 h compared to only 3 h in immortal cells. The expression of transfected p53 cDNA was inhibited in immortal cells, but restored upon CHX treatment. The 5'-region of the p53 mRNA was shown to be involved in the rapid p53 mRNA destabilization in immortal cells by expression analysis of 5'- and 3'-deleted p53 cDNAs as well as fusion mRNA constructs of N-terminal p53 and N-terminal deleted LacZ genes. Together, it is suggestive that the downregulation of p53 mRNA in immortal CEF cells occurs through a post-transcriptional destabilizing mechanism.

  5. Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance.

    PubMed

    Walia, Mannu K; Ho, Patricia Mw; Taylor, Scott; Ng, Alvin Jm; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew Cw; Martin, T John; Walkley, Carl R

    2016-04-12

    Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS.

  6. Activation of PTHrP-cAMP-CREB1 signaling following p53 loss is essential for osteosarcoma initiation and maintenance

    PubMed Central

    Walia, Mannu K; Ho, Patricia MW; Taylor, Scott; Ng, Alvin JM; Gupte, Ankita; Chalk, Alistair M; Zannettino, Andrew CW; Martin, T John; Walkley, Carl R

    2016-01-01

    Mutations in the P53 pathway are a hallmark of human cancer. The identification of pathways upon which p53-deficient cells depend could reveal therapeutic targets that may spare normal cells with intact p53. In contrast to P53 point mutations in other cancer, complete loss of P53 is a frequent event in osteosarcoma (OS), the most common cancer of bone. The consequences of p53 loss for osteoblastic cells and OS development are poorly understood. Here we use murine OS models to demonstrate that elevated Pthlh (Pthrp), cAMP levels and signalling via CREB1 are characteristic of both p53-deficient osteoblasts and OS. Normal osteoblasts survive depletion of both PTHrP and CREB1. In contrast, p53-deficient osteoblasts and OS depend upon continuous activation of this pathway and undergo proliferation arrest and apoptosis in the absence of PTHrP or CREB1. Our results identify the PTHrP-cAMP-CREB1 axis as an attractive pathway for therapeutic inhibition in OS. DOI: http://dx.doi.org/10.7554/eLife.13446.001 PMID:27070462

  7. Clinical utility of anti-p53 auto-antibody: Systematic review and focus on colorectal cancer

    PubMed Central

    Suppiah, Aravind; Greenman, John

    2013-01-01

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance. PMID:23922463

  8. Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens

    NASA Astrophysics Data System (ADS)

    Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid

    2016-09-01

    The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.

  9. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    PubMed

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  10. p53 sequence analysis predicts treatment response and outcome of patients with esophageal carcinoma.

    PubMed

    Ribeiro, U; Finkelstein, S D; Safatle-Ribeiro, A V; Landreneau, R J; Clarke, M R; Bakker, A; Swalsky, P A; Gooding, W E; Posner, M C

    1998-07-01

    The ability to predict biologic behavior and treatment responsiveness would be a valuable asset in the multimodality approach to esophageal carcinoma. The authors examined whether alterations of the p53 gene correlate with clinicopathologic parameters, response to preoperative chemotherapy/radiotherapy, and outcome in patients with esophageal carcinoma. METHODS. Histopathologic/genetic analysis of p53 was performed on formalin fixed, paraffin embedded tissues. Tissue sections were stained immunohistochemically for p53 protein followed by topographic genotyping comprised of polymerase chain reaction amplification and direct sequencing of p53 exons 5-8. All patients received induction chemotherapy (5-fluorouracil, cisplatin, and alpha-interferon) and concurrent external beam radiotherapy (4500 centigrays) followed by resection. p53 analysis performed on 42 tumors from patients with potentially resectable esophageal carcinoma revealed 25 of the 42 tumors (59.5%) to be p53 immunopositive; however, only 17 of the 42 tumors (40.5%) were proven to contain p53 point mutational damage in exons 8 (n=5), 5 (n=5), 7 (n=4), and 6 (n=3). Eight cases were weakly immunopositive and had no genotype mutation suggesting hyperexpression of normal wild-type p53. Genotyping also identified two immunonegative cases with deletion-type mutations (exons 5 and 6). Tissue samples collected before and after chemotherapy/radiotherapy exhibited fidelity in p53 mutational genotype in all cases. The presence of a p53 point mutation positively correlated with pTNM stage (P=0.003) and residual disease in the resected specimen (P=0.01). Moreover, survival of patients with p53 mutations was significantly lower than that of patients without mutations (overall survival of 21.6 months vs. 40 months; P=0.0038; and disease free survival of 14.1 months vs. 38 months; P=0.0004). Histopathologic/genetic analysis is a better determinant of p53 mutational damage than immunohistochemistry alone and can be used

  11. Differential Denaturation of Serum Proteome Reveals a Significant Amount of Hidden Information in Complex Mixtures of Proteins

    PubMed Central

    Polci, Maria Letizia; Rossi, Stefania; Cordella, Martina; Carlucci, Giuseppe; Marchetti, Paolo; Antonini-Cappellini, Giancarlo; Facchiano, Antonio; D'Arcangelo, Daniela; Facchiano, Francesco

    2013-01-01

    Recently developed proteomic technologies allow to profile thousands of proteins within a high-throughput approach towards biomarker discovery, although results are not as satisfactory as expected. In the present study we demonstrate that serum proteome denaturation is a key underestimated feature; in fact, a new differential denaturation protocol better discriminates serum proteins according to their electrophoretic mobility as compared to single-denaturation protocols. Sixty nine different denaturation treatments were tested and the 3 most discriminating ones were selected (TRIDENT analysis) and applied to human sera, showing a significant improvement of serum protein discrimination as confirmed by MALDI-TOF/MS and LC-MS/MS identification, depending on the type of denaturation applied. Thereafter sera from mice and patients carrying cutaneous melanoma were analyzed through TRIDENT. Nine and 8 protein bands were found differentially expressed in mice and human melanoma sera, compared to healthy controls (p<0.05); three of them were found, for the first time, significantly modulated: α2macroglobulin (down-regulated in melanoma, p<0.001), Apolipoprotein-E and Apolipoprotein-A1 (both up-regulated in melanoma, p<0.04), both in mice and humans. The modulation was confirmed by immunological methods. Other less abundant proteins (e.g. gelsolin) were found significantly modulated (p<0.05). Conclusions: i) serum proteome contains a large amount of information, still neglected, related to proteins folding; ii) a careful serum denaturation may significantly improve analytical procedures involving complex protein mixtures; iii) serum differential denaturation protocol highlights interesting proteomic differences between cancer and healthy sera. PMID:23533572

  12. mTORC1 and p53

    PubMed Central

    Hasty, Paul; Sharp, Zelton Dave; Curiel, Tyler J.; Campisi, Judith

    2013-01-01

    A balance must be struck between cell growth and stress responses to ensure that cells proliferate without accumulating damaged DNA. This balance means that optimal cell proliferation requires the integration of pro-growth and stress-response pathways. mTOR (mechanistic target of rapamycin) is a pleiotropic kinase found in complex 1 (mTORC1). The mTORC1 pathway governs a response to mitogenic signals with high energy levels to promote protein synthesis and cell growth. In contrast, the p53 DNA damage response pathway is the arbiter of cell proliferation, restraining mTORC1 under conditions of genotoxic stress. Recent studies suggest a complicated integration of these pathways to ensure successful cell growth and proliferation without compromising genome maintenance. Deciphering this integration could be key to understanding the potential clinical usefulness of mTORC1 inhibitors like rapamycin. Here we discuss how these p53-mTORC1 interactions might play a role in the suppression of cancer and perhaps the development of cellular senescence and organismal aging. PMID:23255104

  13. p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.

    PubMed

    Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M

    2009-09-25

    Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.

  14. Regulation of p53 Stability and Apoptosis by a ROR Agonist

    PubMed Central

    Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.

    2012-01-01

    Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368

  15. Regulation of p53 stability and apoptosis by a ROR agonist.

    PubMed

    Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

    2012-01-01

    Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

  16. Regulation of p53 Target Gene Expression by Peptidylarginine Deiminase 4 ▿ †

    PubMed Central

    Li, Pingxin; Yao, Hongjie; Zhang, Zhiqiang; Li, Ming; Luo, Yuan; Thompson, Paul R.; Gilmour, David S.; Wang, Yanming

    2008-01-01

    Histone Arg methylation has been correlated with transcriptional activation of p53 target genes. However, whether this modification is reversed to repress the expression of p53 target genes is unclear. Here, we report that peptidylarginine deiminase 4, a histone citrullination enzyme, is involved in the repression of p53 target genes. Inhibition or depletion of PAD4 elevated the expression of a subset of p53 target genes, including p21/CIP1/WAF1, leading to cell cycle arrest and apoptosis. Moreover, the induction of p21, cell cycle arrest, and apoptosis by PAD4 depletion is p53 dependent. Protein-protein interaction studies showed an interaction between p53 and PAD4. Chromatin immunoprecipitation assays showed that PAD4 is recruited to the p21 promoter in a p53-dependent manner. RNA polymerase II (Pol II) activities and the association of PAD4 are dynamically regulated at the p21 promoter during UV irradiation. Paused RNA Pol II and high levels of PAD4 were detected before UV treatment. At early time points after UV treatment, an increase of histone Arg methylation and a decrease of citrullination were correlated with a transient activation of p21. At later times after UV irradiation, a loss of RNA Pol II and an increase of PAD4 were detected at the p21 promoter. The dynamics of RNA Pol II activities after UV treatment were further corroborated by permanganate footprinting. Together, these results suggest a role of PAD4 in the regulation of p53 target gene expression. PMID:18505818

  17. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  18. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Kim, Ryeo-Ok; Seo, Jung Soo; Kim, Il-Chan; Lee, Young-Mi; Lee, Jae-Seong

    2013-09-15

    To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4Gy of radiation, and biochemical and molecular damage became substantial from 8Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

    PubMed

    Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

    2011-01-01

    MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

  20. Diagnostic value of progesterone receptor, p16, p53 and pHH3 expression in uterine atypical leiomyoma.

    PubMed

    Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo

    2015-01-01

    The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors.

  1. Diagnostic value of progesterone receptor, p16, p53 and pHH3 expression in uterine atypical leiomyoma

    PubMed Central

    Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo

    2015-01-01

    The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors. PMID:26261614

  2. 27 CFR 19.391 - Mixing denatured spirits.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Mixing denatured spirits... Rules for Mixing and Converting Denatured Spirits § 19.391 Mixing denatured spirits. (a) Spirits of the... same formula, the proprietor may mix them on bonded premises. (b) Spirits of different formulas. A...

  3. 27 CFR 19.391 - Mixing denatured spirits.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Mixing denatured spirits... Rules for Mixing and Converting Denatured Spirits § 19.391 Mixing denatured spirits. (a) Spirits of the... same formula, the proprietor may mix them on bonded premises. (b) Spirits of different formulas. A...

  4. 27 CFR 19.391 - Mixing denatured spirits.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Mixing denatured spirits... Rules for Mixing and Converting Denatured Spirits § 19.391 Mixing denatured spirits. (a) Spirits of the... same formula, the proprietor may mix them on bonded premises. (b) Spirits of different formulas. A...

  5. 27 CFR 19.391 - Mixing denatured spirits.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Mixing denatured spirits... Rules for Mixing and Converting Denatured Spirits § 19.391 Mixing denatured spirits. (a) Spirits of the... same formula, the proprietor may mix them on bonded premises. (b) Spirits of different formulas. A...

  6. PML is a ROS sensor activating p53 upon oxidative stress

    PubMed Central

    Soilihi, Hassane

    2017-01-01

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

  7. PML is a ROS sensor activating p53 upon oxidative stress.

    PubMed

    Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

    2017-11-06

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

  8. RNA content in the nucleolus alters p53 acetylation via MYBBP1A

    PubMed Central

    Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn

    2011-01-01

    A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583

  9. Metformin Restores Parkin-Mediated Mitophagy, Suppressed by Cytosolic p53

    PubMed Central

    Song, Young Mi; Lee, Woo Kyung; Lee, Yong-ho; Kang, Eun Seok; Cha, Bong-Soo; Lee, Byung-Wan

    2016-01-01

    Metformin is known to alleviate hepatosteatosis by inducing 5’ adenosine monophosphate (AMP)-kinase-independent, sirtuin 1 (SIRT1)-mediated autophagy. Dysfunctional mitophagy in response to glucolipotoxicities might play an important role in hepatosteatosis. Here, we investigated the mechanism by which metformin induces mitophagy through restoration of the suppressed Parkin-mediated mitophagy. To this end, our ob/ob mice were divided into three groups: (1) ad libitum feeding of a standard chow diet; (2) intraperitoneal injections of metformin 300 mg/kg; and (3) 3 g/day caloric restriction (CR). HepG2 cells were treated with palmitate (PA) plus high glucose in the absence or presence of metformin. We detected enhanced mitophagy in ob/ob mice treated with metformin or CR, whereas mitochondrial spheroids were observed in mice fed ad libitum. Metabolically stressed ob/ob mice and PA-treated HepG2 cells showed an increase in expression of endoplasmic reticulum (ER) stress markers and cytosolic p53. Cytosolic p53 inhibited mitophagy by disturbing the mitochondrial translocation of Parkin, as demonstrated by immunoprecipitation. However, metformin decreased ER stress and p53 expression, resulting in induction of Parkin-mediated mitophagy. Furthermore, pifithrin-α, a specific inhibitor of p53, increased mitochondrial incorporation into autophagosomes. Taken together, these results indicate that metformin treatment facilitates Parkin-mediated mitophagy rather than mitochondrial spheroid formation by decreasing the inhibitory interaction with cytosolic p53 and increasing degradation of mitofusins. PMID:26784190

  10. Effect of sulfoxides on the thermal denaturation of hen lysozyme: A calorimetric and Raman study

    NASA Astrophysics Data System (ADS)

    Torreggiani, A.; Di Foggia, M.; Manco, I.; De Maio, A.; Markarian, S. A.; Bonora, S.

    2008-11-01

    A multidisciplinary study of the thermal denaturation of lysozyme in the presence of three sulfoxides with different length in hydrocarbon chain (DMSO, DESO, and DPSO) was carried out by means of DSC, Raman spectroscopy, and SDS-PAGE techniques. In particular, the Td and Δ H values obtained from the calorimetric measurements showed that lysozyme is partially unfolded by sulfoxides but most of the conformation holds native state. The sulfoxide denaturing ability increases in the order DPSO > DESO > DMSO. Moreover, only DMSO and DESO have a real effect in preventing the heat-induced inactivation of the protein and their maximum heat-protective ability is reached when the DMSO and DESO amount is ⩾25% w/w. The sulfoxide ability to act as effective protective agents against the heat-induced inactivation was confirmed by the protein analysis. The enzymatic activity, as well as the SDS-PAGE analysis, suggested that DESO, having a low hydrophobic character and a great ability to stabilise the three-dimensional water structure, is the most heat-protective sulfoxide. An accurate evaluation of the heat-induced conformational changes of the lysozyme structure before and after sulfoxide addition was obtained by the analysis of the Raman spectra. The addition of DMSO or DESO in low concentration resulted to sensitively decrease the heat-induced structural modifications of the protein.

  11. Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense

    PubMed Central

    Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.

    2006-01-01

    PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307

  12. Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.

    PubMed

    Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K

    2006-09-01

    PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.

  13. Rapid and efficient hydrophilicity tuning of p53/mdm2 antagonists*

    PubMed Central

    Srivastava, Stuti; Beck, Barbara; Wang, Wei; Czarna, Anna; Holak, Tad A.; Dömling, Alexander

    2009-01-01

    The protein-protein interaction of p53 and mdm2 is an important anticancer target. The interface, however, is very hydrophobic and naturally results in very hydrophobic antagonists. We used the Orru three component reaction (O-3CR) along with a rapid and efficient, recently discovered amidation reaction to dramatically improve the water solubility of our recently discovered low molecular weight p53/mdm2 antagonists. Arrays of amides were synthesized with improved hydrophilicity and retainment and/or improvement of p53/mdm2 inhibitory activity. PMID:19548636

  14. Polymorphism at codon 36 of the p53 gene.

    PubMed

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  15. Relationships between p53 mutation, HPV status and outcome in oropharyngeal squamous cell carcinoma.

    PubMed

    Hong, Angela; Zhang, Xiaoying; Jones, Deanna; Veillard, Anne-Sophie; Zhang, Mei; Martin, Andrew; Lyons, J Guy; Lee, C Soon; Rose, Barbara

    2016-02-01

    This study aimed to examine the rate and type of p53 mutation in oropharyngeal cancer (OSCC). Relationships were sought between human papillomavirus (HPV) status and p53 mutation. The role of p53 mutation as a prognostic factor independent of HPV status and as a modifier of the effect of HPV on outcomes was also examined. The HPV status of 202 cases was determined by HPV DNA by RT-PCR and p16 immunohistochemistry. P53 mutation in exon 5-8 was determined by pyrosequencing. Findings were correlated with known clinicopathological factors and outcomes. 48% of the cases were HPV positive and they were significantly less likely to have a p53 mutation than HPV-negative OSCCs (25.8% vs 46.7%, p=0.0021). Mutation was most common in exon 5. Among patients with HPV-positive OSCC, there was no significant difference in p53 mutation by smoking status (22.2% for never smokers and 30.8% for current or ex-smokers). Patients with p53 mutant OSCC had significantly worse overall survival (p=0.01). There was no statistical evidence that p53 mutation modified the effect of HPV status on outcomes. In the multivariate analysis, positive HPV status remained the strongest predictor of outcomes. p53 mutation status was not a significant predictor of outcome after adjusting for age, gender, T stage, N stage and HPV status. In summary, HPV-positive OSCC are less likely to have mutant p53 than HPV-negative OSCC. Our study did not show any evidence that p53 mutation could modify the effect of HPV status on outcomes. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    PubMed

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. 27 CFR 19.453 - Testing of denaturants.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Denaturation § 19.453 Testing of denaturants. (a) Testing. Proprietors shall ensure that the materials they... shall be taken in such manner as to represent a true composite of the total lot being sampled. When... part 21, the proprietor shall not use the material unless he treats or manipulates the denaturant to...

  18. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.

    PubMed

    Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R

    1999-05-01

    The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.

  19. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

  20. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  1. Differential programming of p53-deficient embryonic cells during rotenone block

    EPA Science Inventory

    Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...

  2. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    PubMed

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  3. Heat shock protein 70 negatively regulates the heat-shock-induced suppression of the I{kappa}B/NF-{kappa}B cascade by facilitating I{kappa}B kinase renaturation and blocking its further denaturation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Kyoung-Hee; Lee, Choon-Taek; Kim, Young Whan

    2005-07-01

    Heat shock (HS) treatment has been previously shown to suppress the I{kappa}B/nuclear factor-{kappa}B (NF-{kappa}B) cascade by denaturing, and thus inactivating I{kappa}B kinase (IKK). HS is characterized by the induction of a group of heat shock proteins (HSPs). However, their role in the HS-induced suppression of the I{kappa}B/NF-{kappa}B cascade is unclear. Adenovirus-mediated HSP70 overexpression was found not to suppress the TNF-{alpha}-induced activation of the I{kappa}B/NF-{kappa}B pathway, thus suggesting that HSP70 is unlikely to suppress this pathway. When TNF-{alpha}-induced activation of the I{kappa}B/NF-{kappa}B pathway was regained 24 h after HS, HSP70 was found to be highly up-regulated. Moreover, blocking HSP70 induction delayedmore » TNF-{alpha}-induced I{kappa}B{alpha} degradation and the resolubilization of IKK. In addition, HSP70 associated physically with IKK, suggesting that HSP70 is involved in the recovery process via molecular chaperone effect. Adenovirus-mediated HSP70 overexpression prior to HS blocked the I{kappa}B{alpha} stabilizing effect of HS by suppressing IKK insolubilization. Moreover, the up-regulation of endogenous HSP70 by preheating, suppressed this subsequent HS-induced IKK insolubilization, and this effect was abrogated by blocking HSP70 induction. These findings indicate that HSP70 accumulates during HS and negatively regulates the HS-induced suppression of the I{kappa}B/NF-{kappa}B cascade by facilitating the renaturation of IKK and blocking its further denaturation.« less

  4. Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

    PubMed Central

    González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

    1997-01-01

    AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

  5. Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

    PubMed Central

    Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

    2016-01-01

    Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

  6. Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53

    PubMed Central

    Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex

    2014-01-01

    Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697

  7. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less

  8. Deubiquitinating enzyme regulation of the p53 pathway: A lesson from Otub1

    PubMed Central

    Sun, Xiao-Xin; Dai, Mu-Shui

    2014-01-01

    Deubiquitination has emerged as an important mechanism of p53 regulation. A number of deubiquitinating enzymes (DUBs) from the ubiquitin-specific protease family have been shown to regulate the p53-MDM2-MDMX networks. We recently reported that Otub1, a DUB from the OTU-domain containing protease family, is a novel p53 regulator. Interestingly, Otub1 abrogates p53 ubiquitination and stabilizes and activates p53 in cells independently of its deubiquitinating enzyme activity. Instead, it does so by inhibiting the MDM2 cognate ubiquitin-conjugating enzyme (E2) UbcH5. Otub1 also regulates other biological signaling through this non-canonical mechanism, suppression of E2, including the inhibition of DNA-damage-induced chromatin ubiquitination. Thus, Otub1 evolves as a unique DUB that mainly suppresses E2 to regulate substrates. Here we review the current progress made towards the understanding of the complex regulation of the p53 tumor suppressor pathway by DUBs, the biological function of Otub1 including its positive regulation of p53, and the mechanistic insights into how Otub1 suppresses E2. PMID:24920999

  9. p53: traffic cop at the crossroads of DNA repair and recombination.

    PubMed

    Sengupta, Sagar; Harris, Curtis C

    2005-01-01

    p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

  10. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    PubMed

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  11. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

    PubMed Central

    Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

    2006-01-01

    The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

  12. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  13. Identification of a small molecule that overcomes HdmX-mediated suppression of p53

    PubMed Central

    Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

    2016-01-01

    Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

  14. Complement-fixing antibodies against denatured HLA and MICA antigens are associated with antibody mediated rejection.

    PubMed

    Cai, Junchao; Terasaki, Paul I; Zhu, Dong; Lachmann, Nils; Schönemann, Constanze; Everly, Matthew J; Qing, Xin

    2016-02-01

    We have found antibodies against denatured HLA class I antigens in the serum of allograft recipients which were not significantly associated with graft failure. It is unknown whether transplant recipients also have denatured HLA class II and MICA antibodies. The effects of denatured HLA class I, class II, and MICA antibodies on long-term graft outcome were further investigated based on their ability to fix complement c1q. In this 4-year retrospective cohort study, post-transplant sera from 975 kidney transplant recipients were tested for antibodies against denatured HLA/MICA antigens and these antibodies were further classified based on their ability to fix c1q. Thirty percent of patients had antibodies against denatured HLA class I, II, or MICA antigens. Among them, 8.5% and 21.5% of all patients had c1q-fixing and non c1q-fixing antibodies respectively. There was no significant difference on graft survival between patients with or without antibodies against denatured HLA/MICA. However, when these antibodies were further classified according to their ability to fix c1q, patients with c1q-fixing antibodies had a significantly lower graft survival rate than patients without antibodies or patients with non c1q-fixing antibodies (p=0.008). In 169 patients who lost renal grafts, 44% of them had c1q-fixing antibodies against denatured HLA/MICA antigens, which was significantly higher than that in patients with functioning renal transplants (25%, p<0.0001). C1q-fixing antibodies were more significantly associated with graft failure caused by AMR (72.73%) or mixed AMR/CMR (61.9%) as compared to failure due to CMR (35.3%) or other causes (39.2%) (p=0.026). Transplant recipients had antibodies against denatured HLA class I, II, and MICA antigens. However, only c1q-fixing antibodies were associated with graft failure which was related to antibody mediated rejection. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

    PubMed Central

    Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

    2011-01-01

    p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

  16. Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

    PubMed Central

    Kaller, Markus; Götz, Ursula; Hermeking, Heiko

    2017-01-01

    We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

  17. The efficacy of denaturing actinide elements as a means of decreasing materials attractiveness

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hase, K.R.; Bathke, C.G.; Ebbinghaus, B.B.

    2013-07-01

    This study considers the concept of denaturing as applied to the actinide elements present in spent fuel as a means to reduce materials attractiveness. Highly attractive materials generally have low values of bare critical mass, heat content, and dose. To denature an attractive element, its spent-fuel isotopic composition (isotopic vector) is intentionally modified by introducing sufficient quantities of a significantly less attractive isotope to dilute the concentration of a highly attractive isotope so that the overall attractiveness of the element is reduced. The authors used FOM (Figure of Merit) formula as the material attractiveness metric for their parametric determination ofmore » the attractiveness of the Pu and U. Materials attractiveness needs to be considered in three distinct phases in the process to construct a nuclear explosive device (NED): the acquisition phase, processing phase, and utilization phase. The results show that denaturing uranium with {sup 238}U is actually an effective means of reducing the attractiveness. For uranium with a large minority of {sup 235}U, a mixture of 80% {sup 238}U to 20% {sup 235}U is required to reduce the attractiveness to low. For uranium with a large concentration of {sup 233}U, a mixture of 88% {sup 238}U to 12% {sup 233}U is required to reduce the attractiveness to low. The results also show that denaturing plutonium with {sup 238}Pu is less effective than denaturing uranium with {sup 238}U. Using {sup 238}Pu as the denaturing agent would require 80% or more by mass in order to reduce the attractiveness to low. No amount of {sup 240}Pu is enough to reduce the plutonium attractiveness below medium. The combination of {sup 238}Pu and {sup 240}Pu would require approximately 70% {sup 238}Pu and 25% {sup 240}Pu by mass to reduce the plutonium attractiveness to low.« less

  18. Estimation of thermodynamic stability of human carbonic anhydrase IX from urea-induced denaturation and MD simulation studies.

    PubMed

    Idrees, Danish; Rahman, Safikur; Shahbaaz, Mohd; Haque, Md Anzarul; Islam, Asimul; Ahmad, Faizan; Hassan, Md Imtaiyaz

    2017-12-01

    Carbonic anhydrase IX (CAIX) is a transmembrane glycoprotein, overexpressed in cancer cells under hypoxia condition. In cancerous cells, CAIX plays an important role to combat the deleterious effects of a high rate of glycolytic metabolism. In order to favor tumor survival, CAIX maintains intracellular pH neutral or slightly alkaline and extracellular acidic pH. The equilibrium unfolding and conformational stability of CAIX were measured in the presence of increasing urea concentrations to understand it's structural features under stressed conditions. Two different spectroscopic techniques were used to follow urea-induced denaturation and observed that urea induces a reversible denaturation of CAIX. Coincidence of the normalized transition curves of both optical properties suggesting that denaturation of CAIX is a two-state process, i.e., native state ↔ denatured state. Each denaturation curve was analyzed to estimate thermodynamic parameters, ΔG D 0 ,value of Gibbs free energy change (ΔG D ) associated with the urea-induced denaturation, C m (midpoint of denaturation) and m (=δΔG D /δ[urea]). We further performed molecular dynamics simulation of CAIX for 50ns to see the dynamics of protein structure in the presence of different urea concentrations. An excellent agreement was observed between in silico and in vitro studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  20. [Association and interaction of heat shock proteins B1 gene and tumor-suppressor protein p53 gene with chromosome damage levels among coke oven workers].

    PubMed

    Li, X L; Deng, Q F; Zhang, X; Wang, T; Chen, Z W; Bai, Y S; Wang, S H; Wu, T C; Guo, H

    2016-10-06

    Objective: To investigate the association and interaction of heat shock proteins B1(HSPB1)gene rs2868371 and tumor-suppressor protein p53(TP53)gene rs1042522 polymorphisms with chromosome damage levels among coke oven workers. Methods: We recruited 1 333 male workers from a state-run coke oven plant in Wuhan in September-October 2010. Among them, 949 who had worked in coke oven workplaces, including auxiliary facilities and bottom, side, and top ovens, were nominated as coke oven workers(i.e., exposed), and 384 administrative or medical staff whose workplaces were offices were used as controls. General characteristics and 5 ml of venous blood were collected from each participant. The plasma concentrations of benzo[a]pyrene-diolepoxide(BPDE)-albumin adducts and the lymphocytic micronucleus(MN)frequencies for each individual were detected by ELISA and cytokinesis-block micronucleus assay, respectively. Gene polymorphisms were genotyped using TaqMan assays via quantitative PCR(ABI Prism 7900HT), and the corresponding frequency ratios( FR )with 95% confidence intervals( CI )were computed for all assays. Results: In the exposed group, the MN frequencies were higher in HSPB1 rs2868371 GC, CC, and GC+ CC genotype carriers((3.88 ± 2.88)‰,(4.00 ± 2.66)‰, and(3.91 ± 2.83)‰, respectively)than in rs2868371 GG genotype carriers((3.52±2.67)‰; FR =1.10, 1.13, and 1.11; 95% CI : 1.02-1.19, 1.02-1.25, and 1.03-1.19, respectively), and the HSPB1 rs2868371C allele was associated with increased MN frequency( P trend =0.006). Further, in the exposed group, the MN frequencies were lower in TP53 rs1042522 CG and CG+GG genotype carriers((3.63±2.61)‰ and(3.66±2.61)‰, respectively)than in TP53 rs1042522 CC genotype carriers(3.95±3.06)‰( FR =0.87 and 0.90; 95% CI : 0.83-0.96 and 0.84-0.97, respectively). The effect of gene-gene interaction between HSPB1, rs2868371, and TP53 rs1042522 on MN frequency was significant among coke oven workers( P= 0.001). Further stratified

  1. pH dependence of cyanide binding to the ferric heme domain of the direct oxygen sensor from Escherichia coli and the effect of alkaline denaturation.

    PubMed

    Bidwai, Anil K; Ok, Esther Y; Erman, James E

    2008-09-30

    The spectrum of the ferric heme domain of the direct oxygen sensor protein from Escherichia coli ( EcDosH) has been measured between pH 3.0 and 12.6. EcDosH undergoes acid denaturation with an apparent p K a of 4.24 +/- 0.05 and a Hill coefficient of 3.1 +/- 0.6 and reversible alkaline denaturation with a p K a of 9.86 +/- 0.04 and a Hill coefficient of 1.1 +/- 0.1. Cyanide binding to EcDosH has been investigated between pH 4 and 11. The EcDosH-cyanide complex is most stable at pH 9 with a K D of 0.29 +/- 0.06 microM. The kinetics of cyanide binding are monophasic between pH 4 and 8. At pH >or=8.5, the reaction is biphasic with the fast phase dependent upon the cyanide concentration and the slow phase independent of cyanide. The slow phase is attributed to conversion of denatured EcDosH to the native state, with a pH-independent rate of 0.052 +/- 0.006 s (-1). The apparent association rate constant for cyanide binding to EcDosH increases from 3.6 +/- 0.1 M (-1) s (-1) at pH 4 to 520 +/- 20 M (-1) s (-1) at pH 11. The dissociation rate constant averages (8.6 +/- 1.3) x 10 (-5) s (-1) between pH 5 and 9, increasing to (1.4 +/- 0.1) x 10 (-3) s (-1) at pH 4 and (2.5 +/- 0.1) x 10 (-3) s (-1) at pH 12.2. The mechanism of cyanide binding is consistent with preferential binding of the cyanide anion to native EcDosH. The reactions of imidazole and H 2O 2 with ferric EcDosH were also investigated and show little reactivity.

  2. p53 as the focus of gene therapy: past, present and future.

    PubMed

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

    2018-01-15

    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Structure of the Tetrameric p53 Tumor Suppressor Bound to DNA

    DTIC Science & Technology

    2002-05-01

    been unable to prepare suitable p53/DNA cocrystals for structure determination. Nonetheless, we have successfully determined the medium resolution (2.7A... cocrystallization with longer DNA targets or DNA targets assembled into nucleosome core particles. The structure of tetrameric p53 bound to DNA will provide

  4. A study of the thermal denaturation of the S-layer protein from Lactobacillus salivarius

    NASA Astrophysics Data System (ADS)

    Lighezan, Liliana; Georgieva, Ralitsa; Neagu, Adrian

    2012-09-01

    Surface layer (S-layer) proteins display an intrinsic self-assembly property, forming monomolecular crystalline arrays, identified in outermost structures of the cell envelope in many organisms, such as bacteria and archaea. Isolated S-layer proteins also possess the ability to recrystallize into regular lattices, being used in biotechnological applications, such as controlling the architecture of biomimetic surfaces. To this end, the stability of the S-layer proteins under high-temperature conditions is very important. In this study, the S-layer protein has been isolated from Lactobacillus salivarius 16 strain of human origin, and purified by cation-exchange chromatography. Using circular dichroism (CD) spectroscopy, we have investigated the thermal denaturation of the S-layer protein. The far- and near-UV CD spectra have been collected, and the temperature dependence of the CD signal in these spectral domains has been analyzed. The variable temperature results show that the secondary and tertiary structures of the S-layer protein change irreversibly due to the heating of the sample. After the cooling of the heated protein, the secondary and tertiary structures are partially recovered. The denaturation curves show that the protein unfolding depends on the sample concentration and on the heating rate. The secondary and tertiary structures of the protein suffer changes in the same temperature range. We have also detected an intermediate state in the protein denaturation pathway. Our results on the thermal behavior of the S-layer protein may be important for the use of S-layer proteins in biotechnological applications, as well as for a better understanding of the structure and function of S-layer proteins.

  5. Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation

    PubMed Central

    Procopio, Maria-Giuseppina; Laszlo, Csaba; Labban, Dania Al; Kim, Dong Eun; Bordignon, Pino; Jo, Seunghee; Goruppi, Sandro; Menietti, Elena; Ostano, Paola; Ala, Ugo; Provero, Paolo; Hoetzenecker, Wolfram; Neel, Victor; Kilarski, Witek; Swartz, Melody A.; Brisken, Cathrin; Lefort, Karine; Dotto, G. Paolo

    2015-01-01

    Stromal fibroblast senescence has been linked to aging-associated cancer risk. However, density and proliferation of cancer-associated fibroblasts (CAF) are frequently increased. Loss or down-modulation of the Notch effector CSL/RBP-Jκ in dermal fibroblasts is sufficient for CAF activation and ensuing keratinocyte-derived tumors. We report that CSL silencing induces senescence of primary fibroblasts from dermis, oral mucosa, breast and lung. CSL functions in these cells as direct repressor of multiple senescence- and CAF-effector genes. It also physically interacts with p53, repressing its activity. CSL is down-modulated in stromal fibroblasts of premalignant skin actinic keratosis lesions and squamous cell carcinomas (SCC), while p53 expression and function is down-modulated only in the latter, with paracrine FGF signaling as likely culprit. Concomitant loss of CSL and p53 overcomes fibroblast senescence, enhances expression of CAF effectors and promotes stromal and cancer cell expansion. The findings support a CAF activation/stromal co-evolution model under convergent CSL/p53 control. PMID:26302407

  6. p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

    PubMed Central

    Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

    2014-01-01

    The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

  7. ATM and MET kinases are synthetic lethal with non-genotoxic activation of p53

    PubMed Central

    Sullivan, Kelly D.; Padilla-Just, Nuria; Henry, Ryan E.; Porter, Christopher C.; Kim, Jihye; Tentler, John J.; Eckhardt, S. Gail; Tan, Aik Choon; DeGregori, James; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor orchestrates alternative stress responses including cell cycle arrest and apoptosis, but the mechanisms defining cell fate upon p53 activation are poorly understood. Several small molecule activators of p53 have been developed, including Nutlin-3, but their therapeutic potential is limited by the fact that they induce reversible cell cycle arrest in most cancer cell types. We report here the results of a ‘Synthetic Lethal with Nutlin-3’ genome-wide shRNA screen, which revealed that the ATM and MET kinases govern cell fate choice upon p53 activation. Genetic or pharmacological interference with ATM or MET activity converts the cellular response from cell cycle arrest into apoptosis in diverse cancer cell types without affecting expression of key p53 target genes. ATM and MET inhibitors enable Nutlin-3 to kill tumor spheroids. These results identify novel pathways controlling the cellular response to p53 activation and aid in the design of p53-based therapies. PMID:22660439

  8. Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry

    PubMed Central

    Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.

    2015-01-01

    p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145

  9. Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

    PubMed

    Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

    2000-11-23

    Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

  10. Immunohistochemical study of Ki67, CD34 and p53 expression in human tooth buds.

    PubMed

    Muica Nagy-Bota, Monica Cristina; Pap, Zsuzsanna; Denes, Lóránd; Ghizdavăţ, Alexandru; Brînzaniuc, Klara; Lup Coşarcă, Adina Simona; Chibelean Cireş-Mărginean, Manuela; Păcurar, Mariana; Pávai, Zoltán

    2014-01-01

    Establishment of Ki67, p53 and CD34 expression in human tooth buds of different stages of odontogenetic development. Tissue samples containing tooth buds were removed from the incisor areas of human fetuses in different stages of development (weeks 9-10, 12-13, 13-16, 21-24), and from the canine and molar areas of 21-24 weeks fetuses. The tissue fragments were fixed using formalin and were processed using common histological techniques with paraffin embedding. Immunostaining for Ki67, p53 and CD34 has been performed using the dextran method and moist heat antigen retrieval (except for CD34). The resulting slides were photographed and quantitatively evaluated. Ki67 immunoexpression decreases with advancement of the developmental stage of the tooth bud: in the inner enamel epithelium, between weeks 9 and 16 (IEE), in the preameloblasts (PB) between weeks 13 and 16, in the ameloblasts (AB) between weeks 21 and 24; outer enamel epithelium (OEE); stratum intermedium (SI); in the dental papilla: between weeks 9 and 10 in the dental papilla (DP), between weeks 13 and 16 in the outer layer of the dental papilla (DP1) and in the central layer of the dental papilla (DP2). Likewise, we noted Ki67 expression in the odontoblast layer (O) and pulp (P), between weeks 21 and 24. Concerning CD34 expression, we observed a decrease from weeks 9-10 until weeks 13-16, followed by an increase until weeks 21-24 of intrauterine life. From weeks 9-10, we observed a constant decrease of expression until weeks 13-16, followed by an increase during weeks 21-24. All Ki67, p53 and CD34 have been identified in the tooth bud. Ki67 expression gradually decreases with the embryonic development of the tooth, while p53 and CD34 expression decreases from weeks 9-10 to weeks 13-16 of intrauterine life, followed by an increase until weeks 21-24.

  11. SIRT1 activation mediates heat-induced survival of UVB damaged Keratinocytes.

    PubMed

    Calapre, Leslie; Gray, Elin S; Kurdykowski, Sandrine; David, Anthony; Descargues, Pascal; Ziman, Mel

    2017-06-10

    Exposure to heat stress after UVB irradiation induces a reduction of apoptosis, resulting in survival of DNA damaged human keratinocytes. This heat-mediated evasion of apoptosis appears to be mediated by activation of SIRT1 and inactivation of p53 signalling. In this study, we assessed the role of SIRT1 in the inactivation of p53 signalling and impairment of DNA damage response in UVB plus heat exposed keratinocytes. Activation of SIRT1 after multiple UVB plus heat exposures resulted in increased p53 deacetylation at K382, which is known to affect its binding to specific target genes. Accordingly, we noted decreased apoptosis and down regulation of the p53 targeted pro-apoptotic gene BAX and the DNA repair genes ERCC1 and XPC after UVB plus heat treatments. In addition, UVB plus heat induced increased expression of the cell survival gene Survivin and the proliferation marker Ki67. Notably, keratinocytes exposed to UVB plus heat in the presence of the SIRT1 inhibitor, Ex-527, showed a similar phenotype to those exposed to UV alone; i.e. an increase in p53 acetylation, increased apoptosis and low levels of Survivin. This study demonstrate that heat-induced SIRT1 activation mediates survival of DNA damaged keratinocytes through deacetylation of p53 after exposure to UVB plus heat.

  12. Mechanisms involved in p53 downregulation by leptin in trophoblastic cells.

    PubMed

    Toro, Ayelén Rayen; Pérez-Pérez, Antonio; Corrales Gutiérrez, Isabel; Sánchez-Margalet, Víctor; Varone, Cecilia Laura

    2015-11-01

    Leptin, a 16-kDa polypeptide hormone, is produced by the adipocyte and can also be synthesized by placenta. We previously demonstrated that leptin promotes proliferation and survival in placenta, in part mediated by the p53 pathway. In this work, we investigated the mechanisms involved in leptin down-regulation of p53 level. The human first trimester cytotrophoblastic Swan-71 cell line and human placental explants at term were used. In order to study the late phase of apoptosis, triggered by serum deprivation, experiments of DNA fragmentation were carried out. Exogenous leptin added to human placental explants, showed a decrease on DNA ladder formation and MAPK pathway is involved in this leptin effect. We also found that under serum deprivation condition, leptin decreases p53 levels and the inhibitory leptin effect is lost when cells were pretreated with 50 μM PD98059 or 10 μM LY29004; or were transfected with dominant negative mutants of intermediates of these pathways, suggesting that MAPK and PI3K signaling pathways are necessaries for leptin action. Additionally, leptin diminished Ser-46 p53 phosphorylation and this effect in placental explants was mediated by the activation of MAPK and PI3K pathways. Finally, in order to assess leptin effect on p53 half-life experiments with cycloheximide were performed and MDM-2 expression was analyzed. Leptin diminished p53 half-life and up-regulated MDM-2 expression. In summary, we provided evidence suggesting that leptin anti-apoptotic effect is mediated by MAPK and PI3K pathways. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. "Cooperative collapse" of the denatured state revealed through Clausius-Clapeyron analysis of protein denaturation phase diagrams.

    PubMed

    Tischer, Alexander; Machha, Venkata R; Rösgen, Jörg; Auton, Matthew

    2018-02-19

    Protein phase diagrams have a unique potential to identify the presence of additional thermodynamic states even when non-2-state character is not readily apparent from the experimental observables used to follow protein unfolding transitions. Two-state analysis of the von Willebrand factor A3 domain has previously revealed a discrepancy in the calorimetric enthalpy obtained from thermal unfolding transitions as compared with Gibbs-Helmholtz analysis of free energies obtained from the Linear Extrapolation Method (Tischer and Auton, Prot Sci 2013; 22(9):1147-60). We resolve this thermodynamic conundrum using a Clausius-Clapeyron analysis of the urea-temperature phase diagram that defines how ΔH and the urea m-value interconvert through the slope of c m versus T, (∂cm/∂T)=ΔH/(mT). This relationship permits the calculation of ΔH at low temperature from m-values obtained through iso-thermal urea denaturation and high temperature m-values from ΔH obtained through iso-urea thermal denaturation. Application of this equation uncovers sigmoid transitions in both cooperativity parameters as temperature is increased. Such residual thermal cooperativity of ΔH and the m-value confirms the presence of an additional state which is verified to result from a cooperative phase transition between urea-expanded and thermally-compact denatured states. Comparison of the equilibria between expanded and compact denatured ensembles of disulfide-intact and carboxyamidated A3 domains reveals that introducing a single disulfide crosslink does not affect the presence of the additional denatured state. It does, however, make a small thermodynamically favorable free energy (∼-13 ± 1 kJ/mol) contribution to the cooperative denatured state collapse transition as temperature is raised and urea concentration is lowered. The thermodynamics of this "cooperative collapse" of the denatured state retain significant compensations between the enthalpy and entropy contributions to the overall

  14. Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

    PubMed Central

    Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

    2010-01-01

    Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

  15. The Regulatory Subunit of PKA-I Remains Partially Structured and Undergoes β-Aggregation upon Thermal Denaturation

    PubMed Central

    Dao, Khanh K.; Pey, Angel L.; Gjerde, Anja Underhaug; Teigen, Knut; Byeon, In-Ja L.; Døskeland, Stein O.; Gronenborn, Angela M.; Martinez, Aurora

    2011-01-01

    Background The regulatory subunit (R) of cAMP-dependent protein kinase (PKA) is a modular flexible protein that responds with large conformational changes to the binding of the effector cAMP. Considering its highly dynamic nature, the protein is rather stable. We studied the thermal denaturation of full-length RIα and a truncated RIα(92-381) that contains the tandem cyclic nucleotide binding (CNB) domains A and B. Methodology/Principal Findings As revealed by circular dichroism (CD) and differential scanning calorimetry, both RIα proteins contain significant residual structure in the heat-denatured state. As evidenced by CD, the predominantly α-helical spectrum at 25°C with double negative peaks at 209 and 222 nm changes to a spectrum with a single negative peak at 212–216 nm, characteristic of β-structure. A similar α→β transition occurs at higher temperature in the presence of cAMP. Thioflavin T fluorescence and atomic force microscopy studies support the notion that the structural transition is associated with cross-β-intermolecular aggregation and formation of non-fibrillar oligomers. Conclusions/Significance Thermal denaturation of RIα leads to partial loss of native packing with exposure of aggregation-prone motifs, such as the B' helices in the phosphate-binding cassettes of both CNB domains. The topology of the β-sandwiches in these domains favors inter-molecular β-aggregation, which is suppressed in the ligand-bound states of RIα under physiological conditions. Moreover, our results reveal that the CNB domains persist as structural cores through heat-denaturation. PMID:21394209

  16. The immunoexpression of p53 and Snail in endometrioid endometrial carcinomas.

    PubMed

    Dragomirescu, Mihaela; Stepan, Alex Emilian; Mărgăritescu, Claudiu; Simionescu, Cristiana Eugenia

    2018-01-01

    Endometrial cancer is one of the most common tumors in women worldwide. P53 has a well-known function as tumor suppressor, but it can also regulate the tissues metabolism, differentiation and development. Snail is a zinc-finger transcription factor, involved in the cell differentiation and survival. We analyzed the immunoexpression of p53 and Snail in 55 cases of endometrioid endometrial carcinoma (EEC), in relation with the histopathological prognosis parameters and tumoral compartments, respectively intratumoral and advancing edge areas. For both markers, we found a statistically significant association with histological grade, in relation with tumoral compartments. P53 and Snail can be used in developing EEC targeted treatment.

  17. Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

    PubMed

    Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

    2010-12-01

    Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

  18. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    PubMed

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  19. Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

    PubMed Central

    Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

    2011-01-01

    Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

  20. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

    EPA Science Inventory

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...

  1. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  2. Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.

    PubMed

    Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo

    2016-08-01

    Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    PubMed

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  4. Ensemble-Based Computational Approach Discriminates Functional Activity of p53 Cancer and Rescue Mutants

    PubMed Central

    Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.

    2011-01-01

    The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641

  5. Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

    PubMed

    Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

    1995-04-15

    The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic

  6. Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

    PubMed Central

    Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

    2011-01-01

    We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

  7. Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function

    PubMed Central

    Fu, Ting; Min, Hanyi; Xu, Yong; Chen, Jianzhong; Li, Guohui

    2012-01-01

    As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level. PMID:22949826

  8. Caspase-2-mediated cleavage of Mdm2 creates p53-induced positive feedback loop

    PubMed Central

    Oliver, Trudy G.; Meylan, Etienne; Chang, Gregory P.; Xue, Wen; Burke, James R.; Humpton, Timothy J.; Hubbard, Diana; Bhutkar, Arjun; Jacks, Tyler

    2011-01-01

    SUMMARY Caspase-2 is an evolutionarily conserved caspase, yet its biological function and cleavage targets are poorly understood. Caspase-2 is activated by the p53 target gene product PIDD (also known as LRDD) in a complex called the Caspase-2-PIDDosome. We show that PIDD expression promotes growth arrest and chemotherapy resistance by a mechanism that depends on Caspase-2 and wild-type p53. PIDD-induced Caspase-2 directly cleaves the E3 ubiquitin ligase Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance. These data establish Mdm2 as a cleavage target of Caspase-2 and provide insight into a mechanism of Mdm2 inhibition that impacts p53 dynamics upon genotoxic stress. PMID:21726810

  9. Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.

    PubMed

    Simon, Christian M; Dai, Ya; Van Alstyne, Meaghan; Koutsioumpa, Charalampia; Pagiazitis, John G; Chalif, Joshua I; Wang, Xiaojian; Rabinowitz, Joseph E; Henderson, Christopher E; Pellizzoni, Livio; Mentis, George Z

    2017-12-26

    The hallmark of spinal muscular atrophy (SMA), an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  10. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin

    2008-01-25

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt}more » cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.« less

  11. p53 regulates the proliferation, differentiation and spontaneous transformation of mesenchymal stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es; Elvira, Gema; Silva, Augusto

    2009-12-10

    Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, amore » shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.« less

  12. Combined p16 and p53 expression in cervical cancer of unknown primary and other prognostic parameters : A single-center analysis.

    PubMed

    Yildirim, Müjdat; Müller von der Grün, Jens; Winkelmann, Ria; Fokas, Emmanouil; Rödel, Franz; Ackermann, Hanns; Rödel, Claus; Balermpas, Panagiotis

    2017-04-01

    Cervical cancer of unknown primary (CUP) represents an uncommon and heterogeneous subentity of head and neck cancer. However, both optimal diagnostics and therapy remain unclear. An improved understanding of the underlying pathology is essential to enable future tailored therapies and optimized outcomes. We retrospectively analyzed 53 patients with head and neck CUP and 48 available cervical lymph node specimens. All patients have received radiotherapy between 2007 and 2015. Preradiotherapy involved lymph node specimens were analyzed for p16 and p53 immunoreactivity. The prognostic relevance of the combined p16 and p53 status and other clinical parameters were examined by univariate and multivariate analyses. Median patient age was 61.5 years and median irradiation dose to the involved nodal levels was 66 Gy. Of the 48 evaluated specimens, 13 (27%) were p16-positive and 31 (64.6%) p53-positive. After a median follow up of 32.9 months, patients with p16-negative and simultaneously p53-positive tumors showed a significantly inferior tumor-specific survival (TSS) compared to those with either p16+/p53-, p16+/p53+, or p16-/p53- (univariate: p = 0.055, multivariate: p = 0.038). Other factors with an adverse impact on TSS in the univariate analysis were smoking history (p = 0.032) and nodal stage (p = 0.038). The combined p16- and p53-expression status in cervical metastases of CUP may represent a simple method for risk stratification. Further validation of these biomarkers in large prospective trials is essential to design rational trials for CUP treatment optimization.

  13. Phase I dendritic cell p53 peptide vaccine for head and neck cancer.

    PubMed

    Schuler, Patrick J; Harasymczuk, Malgorzata; Visus, Carmen; Deleo, Albert; Trivedi, Sumita; Lei, Yu; Argiris, Athanassios; Gooding, William; Butterfield, Lisa H; Whiteside, Theresa L; Ferris, Robert L

    2014-05-01

    p53 accumulation in head and neck squamous cell carcinoma (HNSCC) cells creates a targetable tumor antigen. Adjuvant dendritic cell (DC)-based vaccination against p53 was tested in a phase I clinical trial. Monocyte-derived DC from 16 patients were loaded with two modified HLA-class I p53 peptides (Arm 1), additional Th tetanus toxoid peptide (Arm 2), or additional Th wild-type (wt) p53-specific peptide (Arm 3). Vaccine DCs (vDC) were delivered to inguinal lymph nodes at three time points. vDC phenotype, circulating p53-specific T cells, and regulatory T cells (Treg) were serially monitored by flow cytometry and cytokine production by Luminex. vDC properties were compared with those of DC1 generated with an alternative maturation regimen. No grade II-IV adverse events were observed. Two-year disease-free survival of 88% was favorable. p53-specific T-cell frequencies were increased postvaccination in 11 of 16 patients (69%), with IFN-γ secretion detected in four of 16 patients. Treg frequencies were consistently decreased (P = 0.006) relative to prevaccination values. The phenotype and function of DC1 were improved relative to vDC. Adjuvant p53-specific vaccination of patients with HNSCC was safe and associated with promising clinical outcome, decreased Treg levels, and modest vaccine-specific immunity. HNSCC patients' DC required stronger maturation stimuli to reverse immune suppression and improve vaccine efficacy. ©2014 AACR.

  14. p53 elevation in human cells halt SV40 infection by inhibiting T-ag expression

    PubMed Central

    Drayman, Nir; Ben-nun-Shaul, Orly; Butin-Israeli, Veronika; Srivastava, Rohit; Rubinstein, Ariel M.; Mock, Caroline S.; Elyada, Ela; Ben-Neriah, Yinon; Lahav, Galit; Oppenheim, Ariella

    2016-01-01

    SV40 large T-antigen (T-ag) has been known for decades to inactivate the tumor suppressor p53 by sequestration and additional mechanisms. Our present study revealed that the struggle between p53 and T-ag begins very early in the infection cycle. We found that p53 is activated early after SV40 infection and defends the host against the infection. Using live cell imaging and single cell analyses we found that p53 dynamics are variable among individual cells, with only a subset of cells activating p53 immediately after SV40 infection. This cell-to-cell variabilty had clear consequences on the outcome of the infection. None of the cells with elevated p53 at the beginning of the infection proceeded to express T-ag, suggesting a p53-dependent decision between abortive and productive infection. In addition, we show that artificial elevation of p53 levels prior to the infection reduces infection efficiency, supporting a role for p53 in defending against SV40. We further found that the p53-mediated host defense mechanism against SV40 is not facilitated by apoptosis nor via interferon-stimulated genes. Instead p53 binds to the viral DNA at the T-ag promoter region, prevents its transcriptional activation by Sp1, and halts the progress of the infection. These findings shed new light on the long studied struggle between SV40 T-ag and p53, as developed during virus-host coevolution. Our studies indicate that the fate of SV40 infection is determined as soon as the viral DNA enters the nucleus, before the onset of viral gene expression. PMID:27462916

  15. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  16. Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

    PubMed

    La Perle, K M; Jhiang, S M; Capen, C C

    2000-08-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice p53-/- mice p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.

  17. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

    PubMed

    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

    2005-12-08

    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  18. Guanidinium-Induced Denaturation by Breaking of Salt Bridges.

    PubMed

    Meuzelaar, Heleen; Panman, Matthijs R; Woutersen, Sander

    2015-12-07

    Despite its wide use as a denaturant, the mechanism by which guanidinium (Gdm(+) ) induces protein unfolding remains largely unclear. Herein, we show evidence that Gdm(+) can induce denaturation by disrupting salt bridges that stabilize the folded conformation. We study the Gdm(+) -induced denaturation of a series of peptides containing Arg/Glu and Lys/Glu salt bridges that either stabilize or destabilize the folded conformation. The peptides containing stabilizing salt bridges are found to be denatured much more efficiently by Gdm(+) than the peptides containing destabilizing salt bridges. Complementary 2D-infrared measurements suggest a denaturation mechanism in which Gdm(+) binds to side-chain carboxylate groups involved in salt bridges. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    PubMed Central

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  20. Formation of Polyphenol-Denatured Protein Flocs in Alcohol Beverages Sweetened with Refined Cane Sugars.

    PubMed

    Eggleston, Gillian; Triplett, Alexa

    2017-11-08

    The sporadic appearance of floc from refined, white cane sugars in alcohol beverages remains a technical problem for both beverage manufacturers and sugar refiners. Cane invert sugars mixed with 60% pure alcohol and water increased light scattering by up to ∼1000-fold. Insoluble and soluble starch, fat, inorganic ash, oligosaccharides, Brix, and pH were not involved in the prevailing floc-formation mechanism. Strong polynomial correlations existed between the haze floc and indicator values (IVs) (color at 420 nm pH 9.0/color at pH 4.0-an indirect measure of polyphenolic and flavonoid colorants) (R 2 = 0.815) and protein (R 2 = 0.819) content of the invert sugars. Ethanol-induced denaturation of the protein exposed hydrophobic polyphenol-binding sites that were further exposed when heated to 80 °C. A tentative mechanism for floc formation was advanced by molecular probing with a haze (floc) active protein and polyphenol as well as polar, nonpolar, and ionic solvents.

  1. Papillomavirus, p53 alteration, and primary carcinoma of the vulva.

    PubMed

    Pilotti, S; D'Amato, L; Della Torre, G; Donghi, R; Longoni, A; Giarola, M; Sampietro, G; De Palo, G; Pierotti, M A; Rilke, F

    1995-12-01

    Twenty-nine samples from 28 cases of vulvar squamous cell carcinoma, of which 13 fulfilled the criteria of the bowenoid subtype (mean age 45 years, range 31-68) and 16 of the usual subtype of invasive squamous cell carcinoma (ISCC) (mean age 67.5 years, range 34-83) were investigated for human papillomavirus (HPV) DNA, TP53 alterations, and mdm2 and bcl-2 gene product deregulation. Microscopically all the bowenoid subtype cases (group I) showed a high-grade intraepithelial (VIN 3, carcinoma in situ) lesion associated with early invasive carcinoma in six cases and overt invasive carcinoma in one. By contrast, no evidence of early carcinoma was present in the ISCCs (group II). By in situ hybridization and/or Southern blot hybridization or polymerase chain reaction (PCR), HPV DNA was detected in all cases of group I and in four of 16 cases (25%) of group II, two only by Southern blot after PCR. By single-strand conformation polymorphism and immunocytochemistry only wild-type TP53 and absence of detectable p53 product, respectively, were found in all cases of group I, i.e., in high-risk HPV-positive carcinomas, whereas mutations and/or p53 overexpression accounted for 75% in group II, i.e., in mainly HPV-negative carcinomas. The TP53 gene mutations observed in invasive carcinomas were significantly related to node-positive cases (p = 0.04). Taken together and in agreement with in vitro data, these results support the view that an alteration of TP53, gained either by interaction with viral oncoproteins or by somatic mutations, is a crucial event in the pathogenesis of vulvar carcinomas, but that TP53 mutations are mainly associated with disease progression. Finally, a preliminary immunocytochemical analysis seems to speak against the possible involvement of both MDM2 and BCL-2 gene products in the development of vulvar carcinoma.

  2. Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase 'Synoviolin'.

    PubMed

    Yamasaki, Satoshi; Yagishita, Naoko; Sasaki, Takeshi; Nakazawa, Minako; Kato, Yukihiro; Yamadera, Tadayuki; Bae, Eunkyung; Toriyama, Sayumi; Ikeda, Rie; Zhang, Lei; Fujitani, Kazuko; Yoo, Eunkyung; Tsuchimochi, Kaneyuki; Ohta, Tomohiko; Araya, Natsumi; Fujita, Hidetoshi; Aratani, Satoko; Eguchi, Katsumi; Komiya, Setsuro; Maruyama, Ikuro; Higashi, Nobuyo; Sato, Mitsuru; Senoo, Haruki; Ochi, Takahiro; Yokoyama, Shigeyuki; Amano, Tetsuya; Kim, Jaeseob; Gay, Steffen; Fukamizu, Akiyoshi; Nishioka, Kusuki; Tanaka, Keiji; Nakajima, Toshihiro

    2007-01-10

    Synoviolin, also called HRD1, is an E3 ubiquitin ligase and is implicated in endoplasmic reticulum -associated degradation. In mammals, Synoviolin plays crucial roles in various physiological and pathological processes, including embryogenesis and the pathogenesis of arthropathy. However, little is known about the molecular mechanisms of Synoviolin in these actions. To clarify these issues, we analyzed the profile of protein expression in synoviolin-null cells. Here, we report that Synoviolin targets tumor suppressor gene p53 for ubiquitination. Synoviolin sequestrated and metabolized p53 in the cytoplasm and negatively regulated its cellular level and biological functions, including transcription, cell cycle regulation and apoptosis. Furthermore, these p53 regulatory functions of Synoviolin were irrelevant to other E3 ubiquitin ligases for p53, such as MDM2, Pirh2 and Cop1, which form autoregulatory feedback loops. Our results provide novel insights into p53 signaling mediated by Synoviolin.

  3. Inhibition of p53 Mutant Peptide Aggregation In Vitro by Cationic Osmolyte Acetylcholine Chloride.

    PubMed

    Chen, Zhaolin; Kanapathipillai, Mathumai

    2017-01-01

    Mutations of tumor suppressor protein p53 are present in almost about 50% of all cancers. It has been reported that the p53 mutations cause aggregation and subsequent loss of p53 function, leading to cancer progression. Here in this study we focus on the inhibitory effects of cationic osmolyte molecules acetylcholine chloride, and choline on an aggregation prone 10 amino acid p53 mutant peptide WRPILTIITL, and the corresponding wildtype peptide RRPILTIITL in vitro. The characterization tools used for this study include Thioflavin- T (ThT) induced fluorescence, transmission electron microscopy (TEM), congo red binding, turbidity, dynamic light scattering (DLS), and cell viability assays. The results show that acetylcholine chloride in micromolar concentrations significantly inhibit p53 mutant peptide aggregation in vitro, and could be promising candidate for p53 mutant/ misfolded protein aggregation inhibition. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. BTK blocks the inhibitory effects of MDM2 on p53 activity

    PubMed Central

    Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

    2017-01-01

    p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

  5. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together

  6. Prospective virtual screening for novel p53-MDM2 inhibitors using ultrafast shape recognition

    NASA Astrophysics Data System (ADS)

    Patil, Sachin P.; Ballester, Pedro J.; Kerezsi, Cassidy R.

    2014-02-01

    The p53 protein, known as the guardian of genome, is mutated or deleted in approximately 50 % of human tumors. In the rest of the cancers, p53 is expressed in its wild-type form, but its function is inhibited by direct binding with the murine double minute 2 (MDM2) protein. Therefore, inhibition of the p53-MDM2 interaction, leading to the activation of tumor suppressor p53 protein presents a fundamentally novel therapeutic strategy against several types of cancers. The present study utilized ultrafast shape recognition (USR), a virtual screening technique based on ligand-receptor 3D shape complementarity, to screen DrugBank database for novel p53-MDM2 inhibitors. Specifically, using 3D shape of one of the most potent crystal ligands of MDM2, MI-63, as the query molecule, six compounds were identified as potential p53-MDM2 inhibitors. These six USR hits were then subjected to molecular modeling investigations through flexible receptor docking followed by comparative binding energy analysis. These studies suggested a potential role of the USR-selected molecules as p53-MDM2 inhibitors. This was further supported by experimental tests showing that the treatment of human colon tumor cells with the top USR hit, telmisartan, led to a dose-dependent cell growth inhibition in a p53-dependent manner. It is noteworthy that telmisartan has a long history of safe human use as an approved anti-hypertension drug and thus may present an immediate clinical potential as a cancer therapeutic. Furthermore, it could also serve as a structurally-novel lead molecule for the development of more potent, small-molecule p53-MDM2 inhibitors against variety of cancers. Importantly, the present study demonstrates that the adopted USR-based virtual screening protocol is a useful tool for hit identification in the domain of small molecule p53-MDM2 inhibitors.

  7. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    PubMed Central

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  8. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  9. p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase.

    PubMed

    Teodoro, Jose G; Parker, Albert E; Zhu, Xiaochun; Green, Michael R

    2006-08-18

    Recent evidence suggests that antiangiogenic therapy is sensitive to p53 status in tumors, implicating a role for p53 in the regulation of angiogenesis. Here we show that p53 transcriptionally activates the alpha(II) collagen prolyl-4-hydroxylase [alpha(II)PH] gene, resulting in the extracellular release of antiangiogenic fragments of collagen type 4 and 18. Conditioned media from cells ectopically expressing either p53 or alpha(II)PH selectively inhibited growth of primary human endothelial cells. When expressed intracellularly or exogenously delivered, alpha(II)PH significantly inhibited tumor growth in mice. Our results reveal a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen fragments.

  10. Tumor suppressor p53 negatively regulates glycolysis stimulated by hypoxia through its target RRAD

    PubMed Central

    Wu, Rui; Liang, Yingjian; Lin, Meihua; Liu, Jia; Chan, Chang S.; Hu, Wenwei; Feng, Zhaohui

    2014-01-01

    Cancer cells display enhanced glycolysis to meet their energetic and biosynthetic demands even under normal oxygen concentrations. Recent studies have revealed that tumor suppressor p53 represses glycolysis under normoxia as a novel mechanism for tumor suppression. As the common microenvironmental stress for tumors, hypoxia drives the metabolic switch from the oxidative phosphorylation to glycolysis, which is crucial for survival and proliferation of cancer cells under hypoxia. The p53's role and mechanism in regulating glycolysis under hypoxia is poorly understood. Here, we found that p53 represses hypoxia-stimulated glycolysis in cancer cells through RRAD, a newly-identified p53 target. RRAD expression is frequently decreased in lung cancer. Ectopic expression of RRAD greatly reduces glycolysis whereas knockdown of RRAD promotes glycolysis in lung cancer cells. Furthermore, RRAD represses glycolysis mainly through inhibition of GLUT1 translocation to the plasma membrane. Under hypoxic conditions, p53 induces RRAD, which in turn inhibits the translocation of GLUT1 and represses glycolysis in lung cancer cells. Blocking RRAD by siRNA greatly abolishes p53's function in repressing glycolysis under hypoxia. Taken together, our results revealed an important role and mechanism of p53 in antagonizing the stimulating effect of hypoxia on glycolysis, which contributes to p53's function in tumor suppression. PMID:25114038

  11. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  12. Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

    PubMed Central

    Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

    2012-01-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

  13. Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

    PubMed Central

    La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

    2000-01-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

  14. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  15. The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

    PubMed

    Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

    2015-10-01

    The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Osteoblast differentiation and skeletal development are regulated by Mdm2–p53 signaling

    PubMed Central

    Lengner, Christopher J.; Steinman, Heather A.; Gagnon, James; Smith, Thomas W.; Henderson, Janet E.; Kream, Barbara E.; Stein, Gary S.; Lian, Jane B.; Jones, Stephen N.

    2006-01-01

    Mdm2 is required to negatively regulate p53 activity at the peri-implantation stage of early mouse development. However, the absolute requirement for Mdm2 throughout embryogenesis and in organogenesis is unknown. To explore Mdm2–p53 signaling in osteogenesis, Mdm2-conditional mice were bred with Col3.6-Cre–transgenic mice that express Cre recombinase in osteoblast lineage cells. Mdm2-conditional Col3.6-Cre mice die at birth and display multiple skeletal defects. Osteoblast progenitor cells deleted for Mdm2 have elevated p53 activity, reduced proliferation, reduced levels of the master osteoblast transcriptional regulator Runx2, and reduced differentiation. In contrast, p53-null osteoprogenitor cells have increased proliferation, increased expression of Runx2, increased osteoblast maturation, and increased tumorigenic potential, as mice specifically deleted for p53 in osteoblasts develop osteosarcomas. These results demonstrate that p53 plays a critical role in bone organogenesis and homeostasis by negatively regulating bone development and growth and by suppressing bone neoplasia and that Mdm2-mediated inhibition of p53 function is a prerequisite for Runx2 activation, osteoblast differentiation, and proper skeletal formation. PMID:16533949

  17. MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

    PubMed

    Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

    2017-01-01

    The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

  18. Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

    PubMed

    Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

    2018-05-29

    Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

  19. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  20. p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.

    PubMed

    Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J

    2012-04-01

    Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.