Science.gov

Sample records for heat denatured p53

  1. Constant denaturant gel electrophoresis as a rapid screening technique for p53 mutations.

    PubMed Central

    Børresen, A L; Hovig, E; Smith-Sørensen, B; Malkin, D; Lystad, S; Andersen, T I; Nesland, J M; Isselbacher, K J; Friend, S H

    1991-01-01

    At present, mutation of the p53 gene appears to be the most common genetic alteration found in human cancers. These mutations can occur within many different regions of the gene. We have developed a modification of denaturing gradient gel electrophoresis termed "constant denaturant gel electrophoresis" (CDGE), which provides a rapid and sensitive method to screen the four conserved regions within the p53 gene where the majority of p53 mutations have been reported. The sensitivity of CDGE was first tested with known p53 mutations in all four conserved regions. The CDGE technique was then used to screen 32 breast carcinomas that had been analyzed by immunohistochemical methods for altered p53 protein levels and whose DNA had already been shown to have loss of heterozygosity for a chromosome 17p marker. By immunostaining techniques, only 6 of the 32 tumors had elevated p53 expression. However, CDGE detected p53 mutations in 11 of the 32 tumors. DNA sequence analysis was performed to determine the nucleotide positions of these mutations in all 11 samples. Loss of heterozygosity for the pYNZ22 or p144D6 markers did not associate with either the loss of heterozygosity at the p53 locus or the mutations detected by CDGE. We conclude that CDGE is a rapid and effective technique to screen for p53 mutations. Images PMID:1924299

  2. Plasma protein denaturation with graded heat exposure.

    PubMed

    Vazquez, R; Larson, D F

    2013-11-01

    During cardiopulmonary bypass (CPB), perfusion at tepid temperatures (33-35 °C) is recommended to avoid high temperature cerebral hyperthermia during and after the operation. However, the ideal temperature for uncomplicated adult cardiac surgery is an unsettled question. Typically, the heat exchanger maximum temperature is monitored between 40-42 °C to prevent denaturation of plasma proteins, but studies have not been performed to make these conclusions. Therefore, our hypothesis was to determine the temperature in which blood plasma protein degradation occurs after 2 hours of heat exposure. As a result, blood plasma proteins were exposed to heat in the 37-50 °C range for 2 hours. Plasma protein samples were loaded onto an 8-12% gradient gel for SDS-PAGE and low molecular weight plasma protein degradation was detected with graded heat exposure. Protein degradation was first detected between 43-45 °C of heat exposure. This study supports the practice of monitoring the heat exchanger between 40-42 °C to prevent denaturation of plasma proteins.

  3. Expression of heat shock protein 70 and p53 in human lung cancer.

    PubMed

    Costa, M; Rosas, S; Chindano, A; Lima, P; Madi, K; Carvalho, M

    1997-01-01

    Bronchial biopsies of 21 patients with lung cancer were analyzed by Western blot for stress protein HSP70 and p53 proteins. Squamous carcinoma was the most common type found. The p53 protein was detectable in 14 cases. The HSP70 was detectable in 17 and overexpressed in 9 patients. Eleven patients showed positivity for both protein expressions, however no statistical significance was found (Kappa's test, p>0.05). Specific associations were not observed for HSP70 overexpression and p53 detection that could be related to clinical finds or tabagism. Our results indicate that the stress protein HSP70 is detectable and may be involved in the tumor development. PMID:21590207

  4. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

    SciTech Connect

    Gestl, Erin E.; Anne Boettger, S.

    2012-06-29

    gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.

  5. Roles of heat shock factor 1 and 2 in response to proteasome inhibition: consequence on p53 stability.

    PubMed

    Lecomte, S; Desmots, F; Le Masson, F; Le Goff, P; Michel, D; Christians, E S; Le Dréan, Y

    2010-07-22

    A single heat shock factor (HSF), mediating the heat shock response, exists from yeast to Drosophila, whereas several related HSFs have been found in mammals. This raises the question of the specific or redundant functions of the different members of the HSF family and in particular of HSF1 and HSF2, which are both ubiquitously expressed. Using immortalized mouse embryonic fibroblasts (iMEFs) derived from wild-type, Hsf1(-/-), Hsf2(-/-) or double-mutant mice, we observed the distinctive behaviors of these mutants with respect to proteasome inhibition. This proteotoxic stress reduces to the same extent the viability of Hsf1(-/-)- and Hsf2(-/-)-deficient cells, but through different underlying mechanisms. Contrary to Hsf2(-/-) cells, Hsf1(-/-) cells are unable to induce pro-survival heat shock protein expression. Conversely, proteasome activity is lower in Hsf2(-/-) cells and the expression of some proteasome subunits, such as Psmb5 and gankyrin, is decreased. As gankyrin is an oncoprotein involved in p53 degradation, we analyzed the status of p53 in HSF-deficient iMEFs and observed that it was strongly stabilized in Hsf2(-/-) cells. This study points a new role for HSF2 in the regulation of protein degradation and suggests that pan-HSF inhibitors could be valuable tools to reduce chemoresistance to proteasome inhibition observed in cancer therapy.

  6. Regulation of Mutant p53 Protein Expression

    PubMed Central

    Vijayakumaran, Reshma; Tan, Kah Hin; Miranda, Panimaya Jeffreena; Haupt, Sue; Haupt, Ygal

    2015-01-01

    For several decades, p53 has been detected in cancer biopsies by virtue of its high protein expression level which is considered indicative of mutation. Surprisingly, however, mouse genetic studies revealed that mutant p53 is inherently labile, similar to its wild type (wt) counterpart. Consistently, in response to stress conditions, both wt and mutant p53 accumulate in cells. While wt p53 returns to basal level following recovery from stress, mutant p53 remains stable. In part, this can be explained in mutant p53-expressing cells by the lack of an auto-regulatory loop with Mdm2 and other negative regulators, which are pivotal for wt p53 regulation. Further, additional protective mechanisms are acquired by mutant p53, largely mediated by the co-chaperones and their paralogs, the stress-induced heat shock proteins. Consequently, mutant p53 is accumulated in cancer cells in response to chronic stress and this accumulation is critical for its oncogenic gain of functions (GOF). Building on the extensive knowledge regarding wt p53, the regulation of mutant p53 is unraveling. In this review, we describe the current understanding on the major levels at which mutant p53 is regulated. These include the regulation of p53 protein levels by microRNA and by enzymes controlling p53 proteasomal degradation. PMID:26734569

  7. p53 immunolabeling in archival paraffin-embedded tissues: optimal protocol based on microwave heating for eight antibodies on lung carcinomas.

    PubMed

    Tenaud, C; Negoescu, A; Labat-Moleur, F; Legros, Y; Soussi, T; Brambilla, E

    1994-10-01

    The prognostic value of p53 gene mutations is dealt with by several recent reports. However, retrospective assessment of p53 tumor status on archived samples has been prevented by p53 epitope alteration during routine fixation and embedding procedures. This study aimed at establishing a reproducible low-cost protocol to retrieve not only N-terminal, but also midregion and C-terminal, epitopes, with special attention to possible artifacts induced by epitope retrieval procedures. Using microwave heating, we compared the epitope retrieval efficiency of five solutions with eight commercial antibodies on 21 lung carcinomas for which frozen tissue and samples fixed with formalin and Bouin's liquid were available. All eight epitopes were retrieved, citrate buffer proving efficient for seven. PAb 240 epitope was restored by target unmasking fluid only. No false positivity was observed. Fixation-induced loss of p53 immunoreactivity was minimal for formalin (two of 10 tumors for one antibody each), more significant for Bouin (six of 10 tumors for one to five antibodies). On the other hand, staining intensity was maintained or even improved, and nonspecific staining reduced, through fixation. We conclude that p53 stabilization can be detected on routinely processed archival tumor samples with a reliability similar to that of frozen tissue by means of a microwave-based procedure and a panel of at least three antibodies, with epitopes on the N-terminal, C-terminal, and midpart of the molecule.

  8. USP11 regulates p53 stability by deubiquitinating p53*

    PubMed Central

    Ke, Jia-ying; Dai, Cong-jie; Wu, Wen-lin; Gao, Jin-hua; Xia, Ai-juan; Liu, Guang-ping; Lv, Kao-sheng; Wu, Chun-lin

    2014-01-01

    The p53 tumor suppressor protein coordinates the cellular responses to a broad range of cellular stresses, leading to DNA repair, cell cycle arrest or apoptosis. The stability of p53 is essential for its tumor suppressor function, which is tightly controlled by ubiquitin-dependent degradation primarily through its negative regulator murine double minute 2 (Mdm2). To better understand the regulation of p53, we tested the interaction between p53 and USP11 using co-immunoprecipitation. The results show that USP11, an ubiquitin-specific protease, forms specific complexes with p53 and stabilizes p53 by deubiquitinating it. Moreover, down-regulation of USP11 dramatically attenuated p53 induction in response to DNA damage stress. These findings reveal that USP11 is a novel regulator of p53, which is required for p53 activation in response to DNA damage. PMID:25471832

  9. The p53 circuit board

    PubMed Central

    Sullivan, Kelly D.; Gallant-Behm, Corrie L.; Henry, Ryan E.; Fraikin, Jean-Luc; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor is embedded in a large gene network controlling diverse cellular and organismal phenotypes. Multiple signaling pathways converge onto p53 activation, mostly by relieving the inhibitory effects of its repressors, MDM2 and MDM4. In turn, signals originating from increased p53 activity diverge into distinct effector pathways to deliver a specific cellular response to the activating stimuli. Much attention has been devoted to dissecting how the various input pathways trigger p53 activation and how the activity of the p53 protein itself can be modulated by a plethora of co-factors and post-translational modifications. In this review we will focus instead on the multiple configurations of the effector pathways. We will discuss how p53-generated signals are transmitted, amplified, resisted and eventually integrated by downstream gene circuits operating at the transcriptional, post-transcriptional and post-translational level. We will also discuss how context-dependent variations in these gene circuits define the cellular response to p53 activation and how they may impact the clinical efficacy of p53-based targeted therapies. PMID:22333261

  10. Combined NMR-observation of cold denaturation in supercooled water and heat denaturation enables accurate measurement of deltaC(p) of protein unfolding.

    PubMed

    Szyperski, Thomas; Mills, Jeffrey L; Perl, Dieter; Balbach, Jochen

    2006-04-01

    Cold and heat denaturation of the double mutant Arg 3-->Glu/Leu 66-->Glu of cold shock protein Csp of Bacillus caldolyticus was monitored using 1D (1)H NMR spectroscopy in the temperature range from -12 degrees C in supercooled water up to +70 degrees C. The fraction of unfolded protein, f (u), was determined as a function of the temperature. The data characterizing the unfolding transitions could be consistently interpreted in the framework of two-state models: cold and heat denaturation temperatures were determined to be -11 degrees C and 39 degrees C, respectively. A joint fit to both cold and heat transition data enabled the accurate spectroscopic determination of the heat capacity difference between native and denatured state, DeltaC(p) of unfolding. The approach described in this letter, or a variant thereof, is generally applicable and promises to be of value for routine studies of protein folding.

  11. Development of novel short-term heating angioplasty: thermal denaturation dynamics of collagen in artery wall

    NASA Astrophysics Data System (ADS)

    Shimazaki, N.; Tokunaga, H.; Katou, Y.; Hayashi, T.; Arai, T.

    2009-02-01

    We have studied to develop the new thermal angioplasty methodology, photo-thermo dynamic balloon angioplasty (PTDBA), which provides artery dilatation with short-term (<15s) and uniform heating through the balloon by the combination of the efficient laser driven heat generation and fluid perfusion. Thermal denaturation degree of the collagen in artery media may be the important factor to attain sufficient artery dilatation for the PTDBA. In order to predict the optimum heating condition i.e. the balloon temperature and heating duration, we investigated the thermal denaturation dynamics of artery collagen in ex vivo. The extracted fresh porcine carotid artery was used. The temperature-dependent light scattering property and mechanical property of the artery specimen were simultaneously measured during artery temperature rising by specially made setup to assess the denaturation of arterial collagen. The change rate of the backscattered light intensity from the artery specimen; I(T)/I0 with 633nm was measured to evaluate the artery scattering property change with the thermal denaturation. The artery specimen was heated from 25°C to 80°C with constant temperature rising rate of 3°C/min. The measured I(T)/I0 was suddenly increased over 48°C. This boundary temperature might be the initiation temperature of the arterial collagen denaturation. We defined the variation of the I(T)/I0 as the collagen denaturation ratio, and calculated the reactive enthalpy by the chemical equilibrium theory. Since the calculated enthalpy was similar to the enthalpy in literature report, the variety of I(T)/I0 during the temperature rising might be attributed to the collagen conformational change due to the denaturation. In terms of the artery internal force measurement, the artery force was decreased with increasing of the artery temperature up to 65°C (i.e. softening), and increased over 65°C (i.e. shrinkage). We confirmed that the changes of the backscattered light (at 633nm in

  12. Surface characterization of proteins using multi-fractal property of heat-denatured aggregates

    PubMed Central

    Lahiri, Tapobrata; Mishra, Hrishikesh; Sarkar, Subrata; Misra, Krishna

    2008-01-01

    Multi-fractal property of heat-denatured protein aggregates (HDPA) is characteristic of its individual form. The visual similarity between digitally generated microscopic images of HDPA with that of surface-image of its individual X-ray structures in protein databank (PDB) displayed using Visual Molecular Dynamics (VMD) viewer is the basis of the study. We deigned experiments to view the fractal nature of proteins at different aggregate scales. Intensity based multi-fractal dimensions (ILMFD) extracted from various planes of digital microscopic images of protein aggregates were used to characterize HDPA into different classes. Moreover, the ILMFD parameters extracted from aggregates show similar classification pattern to digital images of protein surface displayed by VMD viewer using PDB entry. We discuss the use of irregular patterns of heat-denatured aggregate proteins to understand various surface properties in native proteins. PMID:18795110

  13. Mechanisms of p53-induced apoptosis.

    PubMed

    Bennett, M R

    1999-10-01

    The p53 tumour suppressor gene functions in both cell cycle arrest and apoptosis. Despite considerable advances in understanding as to how p53 regulates growth arrest, the mechanisms by which p53 regulates apoptosis are only just emerging. In particular, there appears to be a structural and functional separation between the ability of p53 to induce growth arrest and apoptosis. This review examines the interactions between p53-induced growth arrest and apoptosis, and the mechanisms of p53-induced apoptosis, both via induction of p53 transcriptional targets and via nontranscriptional mechanisms.

  14. Heat-Denatured Lysozyme Inactivates Murine Norovirus as a Surrogate Human Norovirus

    PubMed Central

    Takahashi, Hajime; Nakazawa, Moemi; Ohshima, Chihiro; Sato, Miki; Tsuchiya, Tomoki; Takeuchi, Akira; Kunou, Masaaki; Kuda, Takashi; Kimura, Bon

    2015-01-01

    Human norovirus infects humans through the consumption of contaminated food, contact with the excrement or vomit of an infected person, and through airborne droplets that scatter the virus through the air. Being highly infectious and highly viable in the environment, inactivation of the norovirus requires a highly effective inactivating agent. In this study, we have discovered the thermal denaturing capacity of a lysozyme with known antimicrobial activity against gram-positive bacteria, as well as its inactivating effect on murine norovirus. This study is the first report on the norovirus-inactivating effects of a thermally denatured lysozyme. We observed that lysozymes heat-treated for 40 min at 100 °C caused a 4.5 log reduction in infectivity of norovirus. Transmission electron microscope analysis showed that virus particles exposed to thermally denatured lysozymes were expanded, compared to the virus before exposure. The amino acid sequence of the lysozyme was divided into three sections and the peptides of each artificially synthesised, in order to determine the region responsible for the inactivating effect. These results suggest that thermal denaturation of the lysozyme changes the protein structure, activating the region responsible for imparting an inactivating effect against the virus. PMID:26134436

  15. Heat-induced Irreversible Denaturation of the Camelid Single Domain VHH Antibody Is Governed by Chemical Modifications

    PubMed Central

    Akazawa-Ogawa, Yoko; Takashima, Mizuki; Lee, Young-Ho; Ikegami, Takahisa; Goto, Yuji; Uegaki, Koichi; Hagihara, Yoshihisa

    2014-01-01

    The variable domain of camelid heavy chain antibody (VHH) is highly heat-resistant and is therefore ideal for many applications. Although understanding the process of heat-induced irreversible denaturation is essential to improve the efficacy of VHH, its inactivation mechanism remains unclear. Here, we showed that chemical modifications predominantly governed the irreversible denaturation of VHH at high temperatures. After heat treatment, the activity of VHH was dependent only on the incubation time at 90 °C and was insensitive to the number of heating (90 °C)-cooling (20 °C) cycles, indicating a negligible role for folding/unfolding intermediates on permanent denaturation. The residual activity was independent of concentration; therefore, VHH lost its activity in a unimolecular manner, not by aggregation. A VHH mutant lacking Asn, which is susceptible to chemical modifications, had significantly higher heat resistance than did the wild-type protein, indicating the importance of chemical modifications to VHH denaturation. PMID:24739391

  16. Viability of murine norovirus in salads and dressings and its inactivation using heat-denatured lysozyme.

    PubMed

    Takahashi, Hajime; Tsuchiya, Tomoki; Takahashi, Michiko; Nakazawa, Moemi; Watanabe, Tomoka; Takeuchi, Akira; Kuda, Takashi; Kimura, Bon

    2016-09-16

    In recent years, a number of food poisoning outbreaks due to the contamination of norovirus in ready-to-eat (RTE) foods such as salads have been reported, and this issue is regarded as a global problem. The risk of contamination of fresh vegetables with norovirus has been previously reported, but the survivability of norovirus that contaminates salads remains unknown. In addition, there have been limited reports on the control of norovirus in food products by using inactivating agents. In this study, the viability of norovirus in various types of salads and dressings was examined using murine norovirus strain 1 (MNV-1) as a surrogate for the closely related human norovirus. In addition, the inactivation of MNV-1 in salads was examined using heat-denatured lysozyme, which had been reported to inactivate norovirus. MNV-1 was inoculated in 4 types of salads (coleslaw, thousand island salad, vinaigrette salad, egg salad) and 3 types of dressings (mayonnaise, thousand island dressing, vinaigrette dressing), stored at 4°C for 5days. The results revealed that in the vinaigrette dressing, the infectivity of MNV-1 decreased by 2.6logPFU/mL in 5days, whereas in the other dressings and salads, the infectivity of MNV-1 did not show any significant decrease. Next, 1% heat-denatured lysozyme was added to the 4 types of salads, and subsequently it was found that in 2 types of salads (thousand island salad, vinaigrette salad), the infectivity of MNV-1 decreased by >4.0logPFU/g, whereas in coleslaw salad, a decrease of 3.0logPFU/g was shown. However, in egg salads, the infectivity of MNV-1 did not show such decrease. These results suggest that norovirus can survive for 5days in contaminated salads. Further, these findings also indicated that heat-denatured lysozyme had an inactivating effect on norovirus, even in salads. In the future, heat-denatured lysozyme can be used as a novel norovirus-inactivating agent, although it is essential to investigate the mechanism of inactivating

  17. Effect of heating strategies on whey protein denaturation--Revisited by liquid chromatography quadrupole time-of-flight mass spectrometry.

    PubMed

    Akkerman, M; Rauh, V M; Christensen, M; Johansen, L B; Hammershøj, M; Larsen, L B

    2016-01-01

    Previous standards in the area of effect of heat treatment processes on milk protein denaturation were based primarily on laboratory-scale analysis and determination of denaturation degrees by, for example, electrophoresis. In this study, whey protein denaturation was revisited by pilot-scale heating strategies and liquid chromatography quadrupole time-of-flight mass spectrometer (LC/MC Q-TOF) analysis. Skim milk was heat treated by the use of 3 heating strategies, namely plate heat exchanger (PHE), tubular heat exchanger (THE), and direct steam injection (DSI), under various heating temperatures (T) and holding times. The effect of heating strategy on the degree of denaturation of β-lactoglobulin and α-lactalbumin was determined using LC/MC Q-TOF of pH 4.5-soluble whey proteins. Furthermore, effect of heating strategy on the rennet-induced coagulation properties was studied by oscillatory rheometry. In addition, rennet-induced coagulation of heat-treated micellar casein concentrate subjected to PHE was studied. For skim milk, the whey protein denaturation increased significantly as T and holding time increased, regardless of heating method. High denaturation degrees were obtained for T >100°C using PHE and THE, whereas DSI resulted in significantly lower denaturation degrees, compared with PHE and THE. Rennet coagulation properties were impaired by increased T and holding time regardless of heating method, although DSI resulted in less impairment compared with PHE and THE. No significant difference was found between THE and PHE for effect on rennet coagulation time, whereas the curd firming rate was significantly larger for THE compared with PHE. Micellar casein concentrate possessed improved rennet coagulation properties compared with skim milk receiving equal heat treatment.

  18. Pathologies Associated with the p53 Response

    PubMed Central

    Gudkov, Andrei V.; Komarova, Elena A.

    2010-01-01

    Although p53 is a major cancer preventive factor, under certain extreme stress conditions it may induce severe pathologies. Analyses of animal models indicate that p53 is largely responsible for the toxicity of ionizing radiation or DNA damaging drugs contributing to hematopoietic component of acute radiation syndrome and largely determining severe adverse effects of cancer treatment. p53-mediated damage is strictly tissue specific and occurs in tissues prone to p53-dependent apoptosis (e.g., hematopoietic system and hair follicles); on the contrary, p53 can serve as a survival factor in tissues that respond to p53 activation by cell cycle arrest (e.g., endothelium of small intestine). There are multiple experimental indications that p53 contributes to pathogenicity of acute ischemic diseases. Temporary reversible suppression of p53 by small molecules can be an effective and safe approach to reduce severity of p53-associated pathologies. PMID:20595398

  19. Denaturation and Oxidative Stability of Hemp Seed (Cannabis sativa L.) Protein Isolate as Affected by Heat Treatment.

    PubMed

    Raikos, Vassilios; Duthie, Garry; Ranawana, Viren

    2015-09-01

    The present study investigated the impact of heat treatments on the denaturation and oxidative stability of hemp seed protein during simulated gastrointestinal digestion (GID). Heat-denatured hemp protein isolate (HPI) solutions were prepared by heating HPI (2 mg/ml, pH 6.8) to 40, 60, 80 and 100 °C for 10 min. Heat-induced denaturation of the protein isolates was monitored by polyacrylamide gel electrophoresis. Heating HPI at temperatures above 80 °C significantly reduced solubility and led to the formation of large protein aggregates. The isolates were then subjected to in vitro GID and the oxidative stability of the generated peptides was investigated. Heating did not significantly affect the formation of oxidation products during GID. The results suggest that heat treatments should ideally remain below 80 °C if heat stability and solubility of HPI are to be preserved. PMID:26142888

  20. Denaturation and Oxidative Stability of Hemp Seed (Cannabis sativa L.) Protein Isolate as Affected by Heat Treatment.

    PubMed

    Raikos, Vassilios; Duthie, Garry; Ranawana, Viren

    2015-09-01

    The present study investigated the impact of heat treatments on the denaturation and oxidative stability of hemp seed protein during simulated gastrointestinal digestion (GID). Heat-denatured hemp protein isolate (HPI) solutions were prepared by heating HPI (2 mg/ml, pH 6.8) to 40, 60, 80 and 100 °C for 10 min. Heat-induced denaturation of the protein isolates was monitored by polyacrylamide gel electrophoresis. Heating HPI at temperatures above 80 °C significantly reduced solubility and led to the formation of large protein aggregates. The isolates were then subjected to in vitro GID and the oxidative stability of the generated peptides was investigated. Heating did not significantly affect the formation of oxidation products during GID. The results suggest that heat treatments should ideally remain below 80 °C if heat stability and solubility of HPI are to be preserved.

  1. Prospective therapeutic applications of p53 inhibitors

    SciTech Connect

    Gudkov, Andrei V. . E-mail: gudkov@ccf.org; Komarova, Elena A.

    2005-06-10

    p53, in addition to being a key cancer preventive factor, is also a determinant of cancer treatment side effects causing excessive apoptotic death in several normal tissues during cancer therapy. p53 inhibitory strategy has been suggested to protect normal tissues from chemo- and radiotherapy, and to treat other pathologies associated with stress-mediated activation of p53. This strategy was validated by isolation and testing of small molecule p53 inhibitor pifithrin-{alpha} that demonstrated broad tissue protecting capacity. However, in some normal tissues and tumors p53 plays protective role by inducing growth arrest and preventing cells from premature entrance into mitosis and death from mitotic catastrophe. Inhibition of this function of p53 can sensitize tumor cells to chemo- and radiotherapy, thus opening new potential application of p53 inhibitors and justifying the need in pharmacological agents targeting specifically either pro-apoptotic or growth arrest functions of p53.

  2. Nanometer-Scale Dissection of Chromosomes by Atomic Force Microscopy Combined with Heat-Denaturing Treatment

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Kazumi; Kuwazaki, Seigo; Yamamoto, Kimiko; Shichiri, Motoharu; Yoshino, Tomoyuki; Ohtani, Toshio; Sugiyama, Shigeru

    2006-03-01

    We have developed a method for dissecting chromosome fragments with a size of a few hundred nanometers by atomic force microscopy (AFM). By using this method, we demonstrated reproducible dissections of silkworm chromosomes in the pachytene phase. The dissected fragments were successfully recovered on the cantilever tips, as confirmed by fluorescent microscopy using fluorescent stained chromosomes. To recover dissected chromosome fragments from a larger chromosome, such as the human metaphase chromosome of a somatic cell, heat denaturation was found to be effective. Further improvements in this method may lead to a novel tool for isolating valuable genes and/or investigating local genome structures in the near future.

  3. Kinetic and thermodynamic parameters for heat denaturation of Cry1a(b) protein from transgenic maize (Zea mays).

    PubMed

    De Luis, R; Pérez, M D; Sánchez, L; Lavilla, M; Calvo, M

    2008-08-01

    The effect of heat treatment on the denaturation of Cry1A(b) protein expressed in transgenic maize was studied over a temperature range of 69 to 77 degrees C. Denaturation of Cry1A(b) protein was measured by the loss of reactivity with its specific antibodies using a sandwich ELISA. The process of denaturation was studied by analyzing the values of inmunoreactive protein after each heat treatment by kinetic analysis. Denaturation of Cry1A(b) protein was best described assuming a reaction order of 1.5. D-values calculated were 4338, 2350, 1272, 734, and 601 s at 69, 71, 73, 75, and 77 degrees C, respectively. Z-value was estimated to be 9.0 degrees C and the activation energy value was 266.15 kJ/mol. Thermodynamic parameters for the process of denaturation of Cry1A(b) protein were also calculated. The high values of the enthalpy of activation and the positive values of the entropy of activation obtained for Cry1A(b) protein are typical of a reaction in which the denaturation of the protein is the rate-determining process that predominates over an aggregation process during heating.

  4. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds

    PubMed Central

    Cino, Elio A.; Soares, Iaci N.; Pedrote, Murilo M.; de Oliveira, Guilherme A. P.; Silva, Jerson L.

    2016-01-01

    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  5. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds

    NASA Astrophysics Data System (ADS)

    Cino, Elio A.; Soares, Iaci N.; Pedrote, Murilo M.; de Oliveira, Guilherme A. P.; Silva, Jerson L.

    2016-09-01

    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy.

  6. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides

    PubMed Central

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-01-01

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  7. Aggregation tendencies in the p53 family are modulated by backbone hydrogen bonds.

    PubMed

    Cino, Elio A; Soares, Iaci N; Pedrote, Murilo M; de Oliveira, Guilherme A P; Silva, Jerson L

    2016-01-01

    The p53 family of proteins is comprised of p53, p63 and p73. Because the p53 DNA binding domain (DBD) is naturally unstable and possesses an amyloidogenic sequence, it is prone to form amyloid fibrils, causing loss of functions. To develop p53 therapies, it is necessary to understand the molecular basis of p53 instability and aggregation. Light scattering, thioflavin T (ThT) and high hydrostatic pressure (HHP) assays showed that p53 DBD aggregates faster and to a greater extent than p63 and p73 DBDs, and was more susceptible to denaturation. The aggregation tendencies of p53, p63, and p73 DBDs were strongly correlated with their thermal stabilities. Molecular Dynamics (MD) simulations indicated specific regions of structural heterogeneity unique to p53, which may be promoted by elevated incidence of exposed backbone hydrogen bonds (BHBs). The results indicate regions of structural vulnerability in the p53 DBD, suggesting new targetable sites for modulating p53 stability and aggregation, a potential approach to cancer therapy. PMID:27600721

  8. Mouse models of p53 functions.

    PubMed

    Lozano, Guillermina

    2010-04-01

    Studies in mice have yielded invaluable insight into our understanding of the p53 pathway. Mouse models with activated p53, no p53, and mutant p53 have queried the role of p53 in development and tumorigenesis. In these models, p53 is activated and stabilized via redundant posttranslational modifications. On activation, p53 initiates two major responses: inhibition of proliferation (via cell-cycle arrest, quiescence, senescence, and differentiation) and induction of apoptosis. Importantly, these responses are cell-type and tumor-type-specific. The analysis of mutant p53 alleles has established a gain-of-function role for p53 mutants in metastasis. The development of additional models that can precisely time the oncogenic events in single cells will provide further insight into the evolution of tumors, the importance of the stroma, and the cooperating events that lead to disruption of the p53 pathway. Ultimately, these models should serve to study the effects of novel drugs on tumor response as well as normal homeostasis.

  9. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  10. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail: thierry.soussi@free.fr; Lozano, G.

    2005-06-10

    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  11. Comparative study of denaturation of whey protein isolate (WPI) in convective air drying and isothermal heat treatment processes.

    PubMed

    Haque, M Amdadul; Aldred, Peter; Chen, Jie; Barrow, Colin J; Adhikari, Benu

    2013-11-15

    The extent and nature of denaturation of whey protein isolate (WPI) in convective air drying environments was measured and analysed using single droplet drying. A custom-built, single droplet drying instrument was used for this purpose. Single droplets having 5±0.1μl volume (initial droplet diameter 1.5±0.1mm) containing 10% (w/v) WPI were dried at air temperatures of 45, 65 and 80°C for 600s at constant air velocity of 0.5m/s. The extent and nature of denaturation of WPI in isothermal heat treatment processes was measured at 65 and 80°C for 600s and compared with those obtained from convective air drying. The extent of denaturation of WPI in a high hydrostatic pressure environment (600MPa for 600s) was also determined. The results showed that at the end of 600s of convective drying at 65°C the denaturation of WPI was 68.3%, while it was only 10.8% during isothermal heat treatment at the same medium temperature. When the medium temperature was maintained at 80°C, the denaturation loss of WPI was 90.0% and 68.7% during isothermal heat treatment and convective drying, respectively. The bovine serum albumin (BSA) fraction of WPI was found to be more stable in the convective drying conditions than β-lactoglobulin and α-lactalbumin, especially at longer drying times. The extent of denaturation of WPI in convective air drying (65 and 80°C) and isotheral heat treatment (80°C) for 600s was found to be higher than its denaturation in a high hydrostatic pressure environment at ambient temperature (600MPa for 600s).

  12. Heat capacity changes in RNA folding: application of perturbation theory to hammerhead ribozyme cold denaturation

    PubMed Central

    Mikulecky, Peter J.; Feig, Andrew L.

    2004-01-01

    In proteins, empirical correlations have shown that changes in heat capacity (ΔCP) scale linearly with the hydrophobic surface area buried upon folding. The influence of ΔCP on RNA folding has been widely overlooked and is poorly understood. In addition to considerations of solvent reorganization, electrostatic effects might contribute to ΔCPs of folding in polyanionic species such as RNAs. Here, we employ a perturbation method based on electrostatic theory to probe the hot and cold denaturation behavior of the hammerhead ribozyme. This treatment avoids much of the error associated with imposing two-state folding models on non-two-state systems. Ribozyme stability is perturbed across a matrix of solvent conditions by varying the concentration of NaCl and methanol co-solvent. Temperature-dependent unfolding is then monitored by circular dichroism spectroscopy. The resulting array of unfolding transitions can be used to calculate a ΔCP of folding that accurately predicts the observed cold denaturation temperature. We confirm the accuracy of the calculated ΔCP by using isothermal titration calorimetry, and also demonstrate a methanol-dependence of the ΔCP. We weigh the strengths and limitations of this method for determining ΔCP values. Finally, we discuss the data in light of the physical origins of the ΔCPs for RNA folding and consider their impact on biological function. PMID:15282329

  13. Radionuclide imaging of the spleen with heat denatured technetium-99m RBC when the splenic reticuloendothelial system seems impaired

    SciTech Connect

    Owunwanne, A.; Halkar, R.; Al-Rasheed, A.; Abubacker, K.C.; Abdel-Dayem, H.

    1988-03-01

    Imaging of the spleen of 10 patients who had been hematologically diagnosed with sickle-cell anemia (SCA) was studied with (/sup 99m/Tc)tin colloid and heat denatured (/sup 99m/Tc)RBCs. In all ten patients, there was faint or nonvisualization of the spleen with (/sup 99m/Tc)tin colloid. However, with heat denatured (/sup 99m/Tc)RBCs, nine spleens were well visualized, and the uptake was homogenous. One spleen had two patchy areas of uptake. The results indicate that when splenic phagocytic function is impaired as reflected by nonvisualization of the spleen with (/sup 99m/Tc)tin colloid, it is still possible to image such a spleen with heat denatured (/sup 99m/Tc)RBCs

  14. The role of intra-domain disulfide bonds in heat-induced irreversible denaturation of camelid single domain VHH antibodies.

    PubMed

    Akazawa-Ogawa, Yoko; Uegaki, Koichi; Hagihara, Yoshihisa

    2016-01-01

    Camelid-derived single domain VHH antibodies are highly heat resistant, and the mechanism of heat-induced VHH denaturation predominantly relies on the chemical modification of amino acids. Although chemical modification of disulfide bonds has been recognized as a cause for heat-induced denaturation of many proteins, there have been no mutagenesis studies, in which the number of disulfide bonds was controlled. In this article, we examined a series of mutants of two different VHHs with single, double or no disulfide bonds, and scrutinized the effects of these disulfide bond modifications on VHH denaturation. With the exception of one mutant, the heat resistance of VHHs decreased when the number of disulfide bonds increased. The effect of disulfide bonds on heat denaturation was more striking if the VHH had a second disulfide bond, suggesting that the contribution of disulfide shuffling is significant in proteins with multiple disulfide bonds. Furthermore, our results directly indicate that removal of a disulfide bond can indeed increase the heat resistance of a protein, irrespective of the negative impact on equilibrium thermodynamic stability.

  15. Lysosomal destabilization in p53-induced apoptosis

    PubMed Central

    Yuan, Xi-Ming; Li, Wei; Dalen, Helge; Lotem, Joseph; Kama, Rachel; Sachs, Leo; Brunk, Ulf T.

    2002-01-01

    The tumor suppressor wild-type p53 can induce apoptosis. M1-t-p53 myeloid leukemic cells have a temperature-sensitive p53 protein that changes its conformation to wild-type p53 after transfer from 37°C to 32°C. We have now found that these cells showed an early lysosomal rupture after transfer to 32°C. Mitochondrial damage, including decreased membrane potential and release of cytochrome c, and the appearance of apoptotic cells occurred later. Lysosomal rupture, mitochondrial damage, and apoptosis were all inhibited by the cytokine IL-6. Some other compounds can also inhibit apoptosis induced by p53. The protease inhibitor N-tosyl-l-phenylalanine chloromethyl ketone inhibited the decrease in mitochondrial membrane potential and cytochrome c release, the Ca2+-ATPase inhibitor thapsigargin inhibited only cytochrome c release, and the antioxidant butylated hydroxyanisole inhibited only the decrease in mitochondrial membrane potential. In contrast to IL-6, these other compounds that inhibited some of the later occurring mitochondrial damage did not inhibit the earlier p53-induced lysosomal damage. The results indicate that apoptosis is induced by p53 through a lysosomal-mitochondrial pathway that is initiated by lysosomal destabilization, and that this pathway can be dissected by using different apoptosis inhibitors. These findings on the induction of p53-induced lysosomal destabilization can also help to formulate new therapies for diseases with apoptotic disorders. PMID:11959917

  16. [Synthetic lethal genes to mutant p53].

    PubMed

    Tongyang, Liu; Haiqiang, Guo; Meiyan, Zhu; Yingze, Huang; Shuting, Jia; Ying, Luo; Jihong, Zhang

    2015-04-01

    Targeted therapy has become a powerful approach for cancer treatment. Better understanding of oncogenes as well as synthetic lethal interactions with oncogenes will lead to new strategies for tumor-specific treatment. It is well known that mutant p53 plays an important role in tumorigenesis and tumor development. Thus, understanding the synthetic lethal relationship between p53 mutations and interacting genes in tumor is critical for the personalized treatments of p53 mutant tumors. Synthetic lethal genes to mutant p53 can be divided into cell cycle regulators and non-cell cycle regulators. This paper review show these two types of target genes contribute to synthetic lethal interactions with p53 mutations and potential applications of these interactions in anticancer therapy.

  17. New Plays in the p53 Theater

    PubMed Central

    Aylon, Yael; Oren, Moshe

    2010-01-01

    Summary The p53 tumor suppressor and its paralogs p63 and p73 are at the crux of a network modulating cellular responses against potentially tumorigenic events. p53 acts primarily as a transcription factor, regulating the expression of both coding and non-coding RNAs, as well as the activity of RNA processing complexes. In line with their anti-tumorigenic function, p53 and p63 have recently been implicated in restricting tumor cell invasion. In parallel, a growing number of non-canonical target genes have been added to the p53 repertoire. These include genes encoding for proteins that impinge on a broad spectrum of cellular functions, from cell metabolism to stem cell renewal. The p53 story is still far from being fully told. PMID:21317061

  18. SUMOylation of p53 mediates interferon activities

    PubMed Central

    Marcos-Villar, Laura; Pérez-Girón, José V; Vilas, Jéssica M; Soto, Atenea; de la Cruz-Hererra, Carlos F; Lang, Valerie; Collado, Manuel; Vidal, Anxo; Rodríguez, Manuel S; Muñoz-Fontela, César; Rivas, Carmen

    2013-01-01

    There is growing evidence that many host proteins involved in innate and intrinsic immunity are regulated by SUMOylation, and that SUMO contributes to the regulatory process that governs the initiation of the type I interferon (IFN) response. The tumor suppressor p53 is a modulator of the IFN response that plays a role in virus-induced apoptosis and in IFN-induced senescence. Here we demonstrate that IFN treatment increases the levels of SUMOylated p53 and induces cellular senescence through a process that is partially dependent upon SUMOylation of p53. Similarly, we show that vesicular stomatitis virus (VSV) infection induces p53 SUMOylation, and that this modification favors the control of VSV replication. Thus, our study provides evidence that IFN signaling induces p53 SUMOylation, which results in the activation of a cellular senescence program and contributes to the antiviral functions of interferon. PMID:23966171

  19. SUMOylation of p53 mediates interferon activities.

    PubMed

    Marcos-Villar, Laura; Pérez-Girón, José V; Vilas, Jéssica M; Soto, Atenea; de la Cruz-Hererra, Carlos F; Lang, Valerie; Collado, Manuel; Vidal, Anxo; Rodríguez, Manuel S; Muñoz-Fontela, César; Rivas, Carmen

    2013-09-01

    There is growing evidence that many host proteins involved in innate and intrinsic immunity are regulated by SUMOylation, and that SUMO contributes to the regulatory process that governs the initiation of the type I interferon (IFN) response. The tumor suppressor p53 is a modulator of the IFN response that plays a role in virus-induced apoptosis and in IFN-induced senescence. Here we demonstrate that IFN treatment increases the levels of SUMOylated p53 and induces cellular senescence through a process that is partially dependent upon SUMOylation of p53. Similarly, we show that vesicular stomatitis virus (VSV) infection induces p53 SUMOylation, and that this modification favors the control of VSV replication. Thus, our study provides evidence that IFN signaling induces p53 SUMOylation, which results in the activation of a cellular senescence program and contributes to the antiviral functions of interferon.

  20. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  1. p53 Mutations in Nasal Natural Killer/T-Cell Lymphoma from Mexico

    PubMed Central

    Quintanilla-Martinez, Leticia; Kremer, Marcus; Keller, Gisela; Nathrath, Michaela; Gamboa-Dominguez, Armando; Meneses, Abelardo; Luna-Contreras, Lourdes; Cabras, Antonello; Hoefler, Heinz; Mohar, Alejandro; Fend, Falko

    2001-01-01

    Nasal NK/T-cell lymphoma is a unique form of lymphoma highly associated with Epstein-Barr virus, and with a characteristic geographic distribution. Recently, we showed that p53 is overexpressed in a high percentage of nasal NK/T-cell lymphomas. The aim of this study was to analyze the status of the p53 gene, and correlate it with the expression of p53 protein and its downstream target, the cyclin-dependent kinase inhibitor p21, in a series of 25 cases of well-characterized nasal NK/T-cell lymphoma from Mexico. The highly conserved exons 5 to 8 of the p53 gene were amplified by polymerase chain reaction and screened for mutations by denaturing high-pressure liquid chromatography. Abnormal polymerase chain reaction products detected by denaturing high-pressure liquid chromatography and additional selected cases were sequenced. In addition, the incidence of loss of heterozygosity at the p53 locus was analyzed in 12 cases. Of the 25 patients, 17 were male and 8 female (M:F ratio, 2.1:1), with a median age of 43 years (range, 21 to 93 years). Morphologically, most of the cases were composed of a mixture of medium-sized cells and large transformed cells (21 cases), and four cases were composed exclusively of large transformed cells. Three different groups determined by p53 gene status and expression of p53 protein were identified: group 1 was p53 +/p53 mutated (five cases, all with p53 missense mutations). Morphologically, three of the five cases were composed of large cells. All five cases revealed overexpression of p53 in the majority of the tumor cells with a mean of 86%. Unexpectedly, three of these cases also showed overexpression of p21. Four of the five patients presented with clinical stage IVB and died with disease. Group 2 was p53+/p53 wild-type (10 cases). Histologically, nine cases were of the mixed type, and one of the large cell type. The percentage of p53 overexpressing cells was lower than in the previous group with a mean of 23%. p21 was positive in 7 of

  2. USP10 regulates p53 localization and stability by deubiquitinating p53.

    PubMed

    Yuan, Jian; Luo, Kuntian; Zhang, Lizhi; Cheville, John C; Lou, Zhenkun

    2010-02-01

    Stability and localization of p53 is essential for its tumor suppressor function. Ubiquitination by the E3 ubiquitin ligase Mdm2 is the major regulatory mechanism of p53, which induces p53 nuclear export and degradation. However, it is unclear whether ubiquitinated cytoplasmic p53 can be recycled. Here, we report that USP10, a cytoplasmic ubiquitin-specific protease, deubiquitinates p53, reversing Mdm2-induced p53 nuclear export and degradation. After DNA damage, USP10 is stabilized, and a fraction of USP10 translocates to the nucleus to activate p53. The translocation and stabilization of USP10 is regulated by ATM -mediated phosphorylation of USP10 at Thr42 and Ser337. Finally, USP10 suppresses tumor cell growth in cells with wild-type p53, with USP10 expression downregulated in a high percentage of clear cell carcinomas, known to have few p53 mutations. These findings reveal USP10 to be a novel regulator of p53, providing an alternative mechanism of p53 inhibition in cancers with wild-type p53.

  3. P53 mutations in Ewing's sarcoma.

    PubMed

    Park, Y K; Chi, S G; Kim, Y W; Park, H R; Unni, K K

    2001-01-01

    The p53 tumor suppressor gene is one of the most frequently altered genes in human malignancies. To explore the implication of p53 alteration in Ewing's sarcoma, we analyzed the deletion and sequence alterations of p53 and abnormal amplification of MDM2, which acts as a functional inhibitor of p53, in 35 tissue specimens. Quantitative genomic PCR analysis showed that 2 of 35 tumors have extremely low levels of the p53 gene, indicating a homozygous deletion of the gene. Mutational analysis of exons 4 to 9 of p53 by PCR-SSCP revealed that 3 of 35 tumors carry sequence alterations in exons 5 or 8, and DNA sequencing analysis identified missense point mutations at codon 132 (AAG-->ATG, lysine-->methionine) and codon 135 (TGC-->TCC, cystein-->serine) in exon 5, and codon 287 (GAG-->GTG, glutamic acid-->valine) in exon 8 from these tumors. No abnormal amplification of the MDM2 gene was recognized. Taken together, our data demonstrate that p53 is genetically altered in a small fraction of Ewing's sarcoma.

  4. Study of dynamical process of heat denaturation in optically trapped single microorganisms by near-infrared Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Xie, Changan; Li, Yong-qing; Tang, Wei; Newton, Ronald J.

    2003-11-01

    The development of laser traps has made it possible to investigate single cells and record real-time Raman spectra during a heat-denaturation process when the temperature of the surrounding medium is increased. Large changes in the phenylalanine band (1004 cm-1) of near-infrared spectra between living and heat-treated cells were observed in yeast and Escerichia coli and Enterobacter aerogenes bacteria. This change appears to reflect the change in environment of phenylalanine as proteins within the cells unfold as a result of increasing temperatures. As a comparison, we measured Raman spectra of native and heat-denatured solutions of bovine serum albumin proteins, and a similar change in the phenylalanine band of spectra was observed. In addition, we measured Raman spectra of native and heat-treated solutions of pure phenylalanine molecules; no observable difference in vibrational spectra was observed. These findings may make it possible to study conformational changes in proteins within single cells.

  5. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D

    1997-01-01

    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  6. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  7. Effects of chronic deoxynivalenol exposure on p53 heterozygous and p53 homozygous mice.

    PubMed

    Bondy, G S; Coady, L; Curran, I; Caldwell, D; Armstrong, C; Aziz, S A; Nunnikhoven, A; Gannon, A M; Liston, V; Shenton, J; Mehta, R

    2016-10-01

    Deoxynivalenol (DON) is a secondary metabolite associated with Fusarium species pathogenic to important food crops. A two-year feeding study reported that DON was non-carcinogenic in B6C3F1 mice. The present study was conducted to further characterize the chronic effects of DON by exposing cancer-prone transgenic p53 heterozygous (p53+/-) male mice and p53 homozygous (p53+/+) male mice to 0, 1, 5, or 10 mg DON/kg in diet for 26 weeks. Gross and microscopic organ-specific neoplastic and non-neoplastic changes and expression profiles of key hepatic and renal genes were assessed. Few toxicologic differences between p53+/+ and p53+/- mice were observed, and no tumours were observed due to DON. The results indicated that DON was non-carcinogenic and that reduced expression of the p53 gene did not play a key role in responses to DON toxicity. The lack of inflammatory and proliferative lesions in mice may be attributed to the anorectic effects of DON, which resulted in dose-dependent reductions in body weight in p53+/+ and p53+/- mice. Hepatic and renal gene expression analyses confirmed that chronic exposure to DON was noninflammatory. The effects of 26-week DON exposure on p53+/+ and p53+/-mice were consistent with those previously seen in B6C3F1 mice exposed to DON for two years.

  8. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53

    PubMed Central

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Casanova, M. Llanos; Paramio, Jesús M.; Bravo, Ana; Ramirez, Angel

    2016-01-01

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  9. Expression of p53 in endometrial polyps with special reference to the p53 signature.

    PubMed

    Sho, Tomoko; Hachisuga, Toru; Kawagoe, Toshinori; Urabe, Rie; Kurita, Tomoko; Kagami, Seiji; Shimajiri, Shohei; Fujino, Yoshihisa

    2016-07-01

    We herein examined the significance of the p53 expression in endometrial polyps (EMPs). A total of 133 EMPs, including 62 premenopausal and 71 postmenopausal women with EMP, were immunohistochemically studied for the expression of estrogen receptor (ER)-alpha, Ki-67 and p53. Apoptotic cells were identified using a TUNEL assay. A DNA sequence analysis of TP53 exons 5 to 9 was performed. Among the premenopausal EMPs, a multivariate analysis showed the labeling index (LI) for Ki-67 to correlate significantly with that for p53 (P<0.001), but not that for apoptosis. On the contrary, among the postmenopausal EMPs, the LI for Ki-67 correlated significantly with that for apoptosis (P<0.001). The p53 signature (p53S) was defined by endometrial epithelial cells, which are morphologically benign in appearance but display 12 or more consecutive epithelial cell nuclei with strong p53 immunostaining. The p53S was found in nine (12.7%) postmenopausal EMPs (mean age: 70.2 years). The median Ki-67 index for the p53S was 7%, with no significant difference from that of the glands of the postmenopausal EMPs without the p53S (P=0.058). The median apoptotic index for the p53S was 0%, which was significantly lower than that of the postmenopausal EMPs without the p53S (P=0.002). Two of four p53Ss showed TP53 mutations according to the DNA sequence analysis. The presence of the p53S is not rare in postmenopausal EMPs with an advanced age. Among postmenopausal EMPs, the LI of Ki-67 significantly correlates with that of apoptosis. However, such a positive correlation between the LI of Ki-67 and apoptosis is not observed in p53S. PMID:26727623

  10. Nucleolar stress with and without p53

    PubMed Central

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell’s energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  11. Nucleolar stress with and without p53.

    PubMed

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell's energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  12. Protein denaturation of whey protein isolates (WPIs) induced by high intensity ultrasound during heat gelation.

    PubMed

    Frydenberg, Rikke P; Hammershøj, Marianne; Andersen, Ulf; Greve, Marie T; Wiking, Lars

    2016-02-01

    In this study, the impact of high intensity ultrasound (HIU) on proteins in whey protein isolates was examined. Effects on thermal behavior, secondary structure and nature of intra- and intermolecular bonds during heat-induced gelling were investigated. Ultrasonication (24 kHz, 300 W/cm(2), 2078 J/mL) significantly reduced denaturation enthalpies, whereas no change in secondary structure was detected by circular dichroism. The thiol-blocking agent N-ethylmaleimide was applied in order to inhibit formation of disulfide bonds during gel formation. Results showed that increased contents of α-lactalbumin (α-La) were associated with increased sensitivity to ultrasonication. The α-La:β-lactoglobulin (β-Lg) ratio greatly affected the nature of the interactions formed during gelation, where higher amounts of α-La lead to a gel more dependent on disulfide bonds. These results contribute to clarifying the mechanisms mediating the effects of HIU on whey proteins on the molecular level, thus moving further toward implementing HIU in the processing chain in the food industry.

  13. Influence of sodium chloride and glucose on acid-induced gelation of heat-denatured ovalbumin.

    PubMed

    Choi, S J; Lee, S E; Moon, T W

    2008-06-01

    We examined the effects of NaCl and glucose on cold-set ovalbumin gelation. Cold-set gels were prepared by adding glucono-delta-lactone (GDL) to a 2% heated ovalbumin solution. For the gel prepared from ovalbumin heat-denatured with NaCl and glucose, the gel with 10 mM NaCl was most transparent and had high gel strength. Its maximum complex shear modulus (G*) and turbidity were 2.5 times greater and 3 times lower, respectively, than those of the gel without NaCl. The turbidity of the gel with the higher NaCl content increased steeply after the addition of GDL and did not change during the experimental period. The maximum G* of the gel exhibited positive correlations with the molar mass, radius, and surface hydrophobicity of soluble aggregates and the NaCl content, but the turbidity exhibited negative correlations with these factors. The presence of glucose did not significantly affect the turbidity or rheological properties of the gel. For the gel prepared by adding NaCl and glucose with GDL, the presence of glucose did not affect the turbidity, but the maximum G* decreased in inverse proportion to the glucose content. The turbidity of the gel with higher NaCl content (>or= 50 mM) was the greatest among all samples, and the increased turbidity was maintained throughout the measurements. The gels with 50 and 100 mM NaCl exhibited thixotropy during shearing at a constant shear rate. Therefore, the presence of NaCl and glucose during cold gelation could facilitate the preparation of cold-set gels having various properties for food applications.

  14. The role of p53 in ribosomopathies.

    PubMed

    Fumagalli, Stefano; Thomas, George

    2011-04-01

    Impaired ribosome biogenesis is the underlying cause of the pathological conditions collectively known as ribosomopathies. Several hypotheses have been advanced to explain the mechanisms by which deficiencies in ribosome biogenesis interfere with developmental processes leading eventually to the emergence of these diseases. In recent years it has become clear that perturbation of this process triggers a cell-cycle checkpoint that, through activation of the tumor-suppressor p53, leads to cell-cycle arrest and apoptosis. Indeed, evidence is accumulating from studies in animal models that the unscheduled activation of p53 is responsible for perturbations in tissue homeostasis that cause the development of ribosomopathies such as Treacher-Collins syndrome (TCS) and 5q(-) syndrome. These findings imply that inhibition of p53, or better, of mechanisms that specifically lead to p53 activation in response to inhibition of ribosome biogenesis, could be targeted in the treatment of ribosomopathies where activation of p53 is shown to play a pathogenic role. PMID:21435506

  15. p53-directed translational control can shape and expand the universe of p53 target genes.

    PubMed

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-10-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses.

  16. p53 and rapamycin are additive

    PubMed Central

    Campisi, Judith; Huang, Jing; Jones, Diane; Dodds, Sherry G.; Williams, Charnae; Hubbard, Gene; Livi, Carolina B.; Gao, Xiaoli; Weintraub, Susan; Curiel, Tyler; Sharp, Z. Dave; Hasty, Paul

    2015-01-01

    Mechanistic target of rapamycin (mTOR) is a kinase found in a complex (mTORC1) that enables macromolecular synthesis and cell growth and is implicated in cancer etiology. The rapamycin-FK506 binding protein 12 (FKBP12) complex allosterically inhibits mTORC1. In response to stress, p53 inhibits mTORC1 through a separate pathway involving cell signaling and amino acid sensing. Thus, these different mechanisms could be additive. Here we show that p53 improved the ability of rapamycin to: 1) extend mouse life span, 2) suppress ionizing radiation (IR)-induced senescence-associated secretory phenotype (SASP) and 3) increase the levels of amino acids and citric acid in mouse embryonic stem (ES) cells. This additive effect could have implications for cancer treatment since rapamycin and p53 are anti-oncogenic. PMID:26158292

  17. Accumulation of Tumor Suppressor P53 in Rat Muscle After a Space Flight

    NASA Astrophysics Data System (ADS)

    Ohnishi, T.; Wang, X.; Fukuda, S.; Takahashi, A.; Ohnishi, K.; Nagaoka, S.

    Tumor suppressor p53 functions as a cell cycle checkpoint under stressful conditions. Early studies have shown that genotoxic stress activates p53 pathway. Recently, many kinds of non-genotoxic stress such as heat shock, cold shock, and low pH also have been found to activate p53 pathway. The effects on living organism remains to be explored. Here, we show that an 18-day space flight induced a 3.6 fold accumulation of p53 in rat skeletal muscle. This results suggests that the p53 pathway plays a role in safeguarding genomic stability against the stressful space environments and supports our previous observation of p53 accumulation in rat skin after a space flight

  18. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.

    2016-06-01

    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal "tumor suppressor" is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  19. Heat-denatured lysozyme aggregation and gelation as revealed by combined dielectric relaxation spectroscopy and light scattering measurements.

    PubMed

    Giugliarelli, A; Sassi, P; Paolantoni, M; Onori, G; Cametti, C

    2012-09-01

    The dielectric behavior of native and heat-denatured lysozyme in ethanol-water solutions was examined in the frequency range from 1 MHz to 2 GHz, using frequency-domain dielectric relaxation spectroscopy. Because of the conformational changes on unfolding, dielectric methods provide information on the denaturation process of the protein and, at protein concentration high enough, on the subsequent aggregation and gelation. Moreover, the time evolution of the protein aggregation and gelation was monitored measuring, by means of dynamic light scattering methods, the diffusion coefficient of micro-sized polystyrene particles, deliberately added to the protein solution, which act as a probe of the viscosity of the microenvironment close to the particle surface. All together, our measurements indicate that heat-induced denaturation favors, at high concentrations, a protein aggregation process which evolves up to the full gelation of the system. These findings have a direct support from IR measurements of the absorbance of the amide I band that, because of the unfolding, indicate that proteins entangle each other, producing a network structure which evolves, in long time limit, in the gel.

  20. A p53-like protein from a freshwater mollusc Lamellidens corrianus.

    PubMed

    Mohanty, B P

    2006-08-01

    p53 is the most frequently mutated protein in human cancers and the accumulation of its high levels is a potential novel marker for malignancy. Recently, its homologues such as p63 and p73 have been reported in human, mice and fish. Environmentally induced alterations in p53 protein have been reported to contribute to pathogenesis of leukemia in soft-shell clam Mya arenaria inhabiting polluted water, suggesting that p53 proteins can also be used as pollution markers. In the present study, the presence of p53 protein or its homologues was investigated in tissues of bivalve molluscs Lamellidens corrianus that are predominant in the freshwater riverine environment and are well suited to act as test organisms for evaluation of habitat degradation. The molluscs were collected live from the river Ganga at three sampling sites viz., Kanpur, Allahabad and Varanasi and different tissues (foot, gill and mantle) were collected. Proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). On immunoblot analysis, a 45 kDa protein (p45) was recognized by the monoclonal anti-p53 antibody in the molluscan tissues. The p45 showed immunoreactivity in all the three tissues of molluscs collected at Kanpur, in foot and gill tissues in those collected at Allahabad, and in foot tissue only, in those collected at Varanasi. Since monoclonal anti-p53 recognizes a denaturation-resistant epitope on the p53 (53 kDa) nuclear protein and does not react with other cellular proteins, the molluscan p45 is a p53-homologue or p53-like protein. Further, the differential expression of p45 in the different organs might serve as a useful biomarker that would help in establishing pollution gradient for environmental monitoring in the large aquatic ecosystems.

  1. A p53-like protein from a freshwater mollusc Lamellidens corrianus.

    PubMed

    Mohanty, B P

    2006-08-01

    p53 is the most frequently mutated protein in human cancers and the accumulation of its high levels is a potential novel marker for malignancy. Recently, its homologues such as p63 and p73 have been reported in human, mice and fish. Environmentally induced alterations in p53 protein have been reported to contribute to pathogenesis of leukemia in soft-shell clam Mya arenaria inhabiting polluted water, suggesting that p53 proteins can also be used as pollution markers. In the present study, the presence of p53 protein or its homologues was investigated in tissues of bivalve molluscs Lamellidens corrianus that are predominant in the freshwater riverine environment and are well suited to act as test organisms for evaluation of habitat degradation. The molluscs were collected live from the river Ganga at three sampling sites viz., Kanpur, Allahabad and Varanasi and different tissues (foot, gill and mantle) were collected. Proteins were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). On immunoblot analysis, a 45 kDa protein (p45) was recognized by the monoclonal anti-p53 antibody in the molluscan tissues. The p45 showed immunoreactivity in all the three tissues of molluscs collected at Kanpur, in foot and gill tissues in those collected at Allahabad, and in foot tissue only, in those collected at Varanasi. Since monoclonal anti-p53 recognizes a denaturation-resistant epitope on the p53 (53 kDa) nuclear protein and does not react with other cellular proteins, the molluscan p45 is a p53-homologue or p53-like protein. Further, the differential expression of p45 in the different organs might serve as a useful biomarker that would help in establishing pollution gradient for environmental monitoring in the large aquatic ecosystems. PMID:17133770

  2. Effects of Chronic Ochratoxin A Exposure on p53 Heterozygous and p53 Homozygous Mice.

    PubMed

    Bondy, Genevieve S; Caldwell, Donald S; Aziz, Syed A; Coady, Laurie C; Armstrong, Cheryl L; Curran, Ivan H A; Koffman, Robyn L; Kapal, Kamla; Lefebvre, David E; Mehta, Rekha

    2015-07-01

    Exposure to the mycotoxin ochratoxin A (OTA) causes nephropathy in domestic animals and rodents and renal tumors in rodents and poultry. Humans are exposed to OTA by consuming foods made with contaminated cereal grains and other commodities. Management of human health risks due to OTA exposure depends, in part, on establishing a mode of action (MOA) for OTA carcinogenesis. To further investigate OTA's MOA, p53 heterozygous (p53+/-) and p53 homozygous (p53+/+) mice were exposed to OTA in diet for 26 weeks. The former are susceptible to tumorigenesis upon chronic exposure to genotoxic carcinogens. OTA-induced renal damage but no tumors were observed in either strain, indicating that p53 heterozygosity conferred little additional sensitivity to OTA. Renal changes included dose-dependent increases in cellular proliferation, apoptosis, karyomegaly, and tubular degeneration in proximal tubules, which were consistent with ochratoxicosis. The lowest observed effect level for renal changes in p53+/- and p53+/+ mice was 200 μg OTA/kg bw/day. Based on the lack of tumors and the severity of renal and body weight changes at a maximum tolerated dose, the results were interpreted as suggestive of a primarily nongenotoxic (epigenetic) MOA for OTA carcinogenesis in this mouse model.

  3. Status quo of p53 in the treatment of tumors.

    PubMed

    Guan, Yong-Song; He, Qing; Zou, Qing

    2016-10-01

    The p53 gene is pivotal for oncogenesis in a combination of mutations in oncogenes and antioncogenes. The ubiquitous loss of the p53 pathway in human cancers has generated considerable interest in developing p53-targeted cancer therapies, but current ideas and approaches targeting p53 are conflicting. Current researches focus on cancer-selective drugs with therapeutic strategies that both activate and inhibit p53. As p53 is ubiquitously lost in human cancers, the strategy of exogenous p53 addition is reasonable. However, p53 acts not equally in all cell types; thus, individualized p53 therapy is the direction of future research. To clarify the controversies on p53 for improvement of future antitumor studies, the review focuses on the available technological protocols, including their advantages and limitations in terms of future therapeutic use of p53 in the management of tumors.

  4. The Hippo pathway, p53 and cholesterol.

    PubMed

    Aylon, Yael; Oren, Moshe

    2016-09-01

    ASBTRACT Increased rates of cholesterol and lipid synthesis have long been recognized as important aspects of the metabolic rewiring that occurs during cancerous transformation. Many genes encoding enzymes involved in cholesterol and fatty acid biogenesis are transcriptional targets of the sterol regulatory element-binding proteins (SREBPs). The SREBPs act as a hub for metabolic and proliferation-related signals; their activity is the focus of a tug-of-war between tumor suppressors, who generally inhibit SREBP function, and oncogenes, who often promote, and rely on, SREBP activity. The Hippo pathway plays a central role in coordinating cell proliferation and organ size, whereas p53 is a crucial tumor suppressor that maintains metabolic homeostasis and orchestrates cellular stress responses. Together, the Hippo and p53 signaling pathways cooperate on multiple levels to fine-tune SREPB activity and regulate cholesterol/lipid levels. Cholesterol biosynthesis inhibitors such as statins are appealing conceptually, but have yet to show an indisputable effect on cancer development. Fortunately, the complex regulation surrounding the Hippo-p53-SREBP network potentially provides a broad interface for additional novel cancer-targeting interventions. PMID:27419353

  5. Necdin, a p53-Target Gene, Is an Inhibitor of p53-Mediated Growth Arrest

    PubMed Central

    Lafontaine, Julie; Rodier, Francis; Ouellet, Véronique; Mes-Masson, Anne-Marie

    2012-01-01

    In vitro, cellular immortalization and transformation define a model for multistep carcinogenesis and current ongoing challenges include the identification of specific molecular events associated with steps along this oncogenic pathway. Here, using NIH3T3 cells, we identified transcriptionally related events associated with the expression of Polyomavirus Large-T antigen (PyLT), a potent viral oncogene. We propose that a subset of these alterations in gene expression may be related to the early events that contribute to carcinogenesis. The proposed tumor suppressor Necdin, known to be regulated by p53, was within a group of genes that was consistently upregulated in the presence of PyLT. While Necdin is induced following p53 activation with different genotoxic stresses, Necdin induction by PyLT did not involve p53 activation or the Rb-binding site of PyLT. Necdin depletion by shRNA conferred a proliferative advantage to NIH3T3 and PyLT-expressing NIH3T3 (NIHLT) cells. In contrast, our results demonstrate that although overexpression of Necdin induced a growth arrest in NIH3T3 and NIHLT cells, a growing population rapidly emerged from these arrested cells. This population no longer showed significant proliferation defects despite high Necdin expression. Moreover, we established that Necdin is a negative regulator of p53-mediated growth arrest induced by nutlin-3, suggesting that Necdin upregulation could contribute to the bypass of a p53-response in p53 wild type tumors. To support this, we characterized Necdin expression in low malignant potential ovarian cancer (LMP) where p53 mutations rarely occur. Elevated levels of Necdin expression were observed in LMP when compared to aggressive serous ovarian cancers. We propose that in some contexts, the constitutive expression of Necdin could contribute to cancer promotion by delaying appropriate p53 responses and potentially promote genomic instability. PMID:22355404

  6. The C-terminal region of alpha-crystallin: involvement in protection against heat-induced denaturation

    NASA Technical Reports Server (NTRS)

    Takemoto, L.; Emmons, T.; Horwitz, J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Recent studies have demonstrated that the alpha-crystallins can protect other proteins against heat-induced denaturation and aggregation. To determine the possible involvement of the C-terminal region in this activity, the alpha-crystallins were subjected to limited tryptic digestion, and the amount of cleavage from the N-terminal and C-terminal regions of the alpha-A and alpha-B crystallin chains was assessed using antisera specific for these regions. Limited tryptic digestion resulted in cleavage only from the C-terminal region of alpha-A crystallin. This trypsin-treated alpha-A crystallin preparation showed a decreased ability to protect proteins from heat-induced aggregation using an in vitro assay. Together, these results demonstrate that the C-terminal region of alpha-A crystallin is important for its ability to protect against heat-induced aggregation, which is consistent with the hypothesis that post-translational changes that are known to occur at the C-terminal region may have significant effects on the ability of alpha-A crystallin to protect against protein denaturation in vivo.

  7. Introduction of mutant p53 into a wild-type p53-expressing glioma cell line confers sensitivity to Ad-p53-induced apoptosis.

    PubMed Central

    Cerrato, J. A.; Yung, W. K.; Liu, T. J.

    2001-01-01

    Transient expression of the tumor suppressor gene p53 via adenoviral-mediated gene transfer induces apoptosis in glioma cells expressing mutant p53, while causing cell cycle arrest in cells with wild-type p53. To determine whether a change in p53 status of a wild-type p53-expressing cell line such as U-87 MG would alter its apoptotic resistant phenotype in response to Ad-p53 infection, we generated cell lines U-87-175.4 and U-87-175.13 via retroviral-mediated gene transfer of the p53 (175H) mutant into the U-87 MG parental line. Control cell lines U-87-Lux.6 and U-87-Lux.8 were also generated and express the reporter gene luciferase. Both U-87-175.4 and U-87-175.13, but not control cell lines, exhibited morphology characteristic of apoptosis after Ad-p53 infection. Furthermore, expression of other p53 mutants (248W, 273H) in U-87 MG also sensitized cells to Ad-p53-induced apoptosis. Apoptosis was confirmed by TUNEL and cell cycle analysis. Several p53 response genes were examined in cells infected with Ad-p53, and among these, BCL2, p21WAF1/CIP1, CPP32/caspase 3, and PARP showed differences in expression between U87-175 and U87-Lux cell lines. Taken together, our data demonstrate that the introduction of p53 mutants in U-87 MG promotes an apoptotic response in association with adenoviral-mediated wild-type p53 gene transfer. These results underscore the importance of glioma p53 genotype for predicting tumor response to p53-based gene therapy. PMID:11296482

  8. EDD induces cell cycle arrest by increasing p53 levels.

    PubMed

    Smits, Veronique A J

    2012-02-15

    Tight regulation of p53 is essential for its central role in maintaining genome stability and tumor prevention. Here, EDD/ UBR5/hHyd, hereafter called EDD, is identified as a novel regulator of p53. Downregulation of EDD results in elevated p53 protein levels both in transformed and untransformed cells. Concomitant with a rise in p53, the levels of p21, a critical p53 target, are also elevated in these conditions. Surprisingly, EDD knockdown does not affect p53 protein stability, and p53 mRNA levels do not increase significantly upon EDD depletion. Consistent with the function of p53, EDD downregulation triggers a senescent phenotype in fibroblasts at later time points. In addition, the increased p53 levels upon EDD depletion cause a G(1) arrest, as co-depletion of EDD and p53 completely rescues this effect on cell cycle progression. PMID:22374670

  9. The combination of 5-fluorouracil plus p53 pathway restoration is associated with depletion of p53-deficient or mutant p53-expressing putative colon cancer stem cells.

    PubMed

    Huang, Catherine; Zhang, Xiang M; Tavaluc, Raluca T; Hart, Lori S; Dicker, David T; Wang, Wenge; El-Deiry, Wafik S

    2009-11-01

    The cancer stem cell hypothesis suggests that rare populations of tumor-initiating cells may be resistant to therapy, lead to tumor relapse and contribute to poor prognosis for cancer patients. We previously demonstrated the feasibility of p53 pathway restoration in p53-deficient tumor cell populations using small molecules including ellipticine or its derivatives. We now establish a single cell p53-regulated green fluorescent protein (EGFP)-reporter system in human DLD1 colon tumor cells expressing mutant p53 protein. We use these p53-EGFP reporter DLD1 cells to investigate the status of p53 transcriptional activity in putative colon cancer stem cell populations following exposure to p53 pathway-restoring drugs and/or classical chemotherapy. We demonstrate induction of p53-specific EGFP reporter fluorescence following overexpression of p53 family member p73 by an Adenovirus vector. We further show that p53-reporter activity is induced in DLD1 putative cancer stem cell side-populations analyzed by their Hoechst dye efflux properties following treatment with the p53 pathway restoring drug ellipticine. Combination of ellipticine with the cytotoxic agent 5-fluorouracil resulted in increased cytotoxicity as compared to either agent alone and this was associated with depletion of putative cancer stem cell populations as compared with 5-FU alone treatment. Our results support the feasibility of therapeutic targeting of mutant p53 in putative cancer stem cells as well as the potential to enhance cytotoxic chemotherapy. PMID:19923910

  10. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-05-01

    Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  11. Analysis of p53 mutants for transcriptional activity.

    PubMed Central

    Raycroft, L; Schmidt, J R; Yoas, K; Hao, M M; Lozano, G

    1991-01-01

    The wild-type p53 protein functions to suppress transformation, but numerous mutant p53 proteins are transformation competent. To examine the role of p53 as a transcription factor, we made fusion proteins containing human or mouse p53 sequences fused to the DNA binding domain of a known transcription factor, GAL4. Human and mouse wild-type p53/GAL4 specifically transactivated expression of a chloramphenicol acetyltransferase reporter in HeLa, CHO, and NIH 3T3 cells. Several mutant p53 proteins, including a mouse p53 mutant which is temperature sensitive for suppression, were also analyzed. A p53/GAL4 fusion protein with this mutation was also transcriptionally active only at the permissive temperature. Another mutant p53/GAL4 fusion protein analyzed mimics the mutation inherited in Li-Fraumeni patients. This fusion protein was as active as wild-type p53/GAL4 in our assay. Two human p53 mutants that arose from alterations of the p53 gene in colorectal carcinomas were 30- to 40-fold less effective at activating transcription than wild-type p53/GAL4 fusion proteins. Thus, functional wild-type p53/GAL4 fusion proteins activate transcription, while several transformation competent mutants do so poorly or not at all. Only one mutant p53/GAL4 fusion protein remained transcriptionally active. Images PMID:1944276

  12. Targeting Oncogenic Mutant p53 for Cancer Therapy

    PubMed Central

    Parrales, Alejandro; Iwakuma, Tomoo

    2015-01-01

    Among genetic alterations in human cancers, mutations in the tumor suppressor p53 gene are the most common, occurring in over 50% of human cancers. The majority of p53 mutations are missense mutations and result in the accumulation of dysfunctional p53 protein in tumors. These mutants frequently have oncogenic gain-of-function activities and exacerbate malignant properties of cancer cells, such as metastasis and drug resistance. Increasing evidence reveals that stabilization of mutant p53 in tumors is crucial for its oncogenic activities, while depletion of mutant p53 attenuates malignant properties of cancer cells. Thus, mutant p53 is an attractive druggable target for cancer therapy. Different approaches have been taken to develop small-molecule compounds that specifically target mutant p53. These include compounds that restore wild-type conformation and transcriptional activity of mutant p53, induce depletion of mutant p53, inhibit downstream pathways of oncogenic mutant p53, and induce synthetic lethality to mutant p53. In this review article, we comprehensively discuss the current strategies targeting oncogenic mutant p53 in cancers, with special focus on compounds that restore wild-type p53 transcriptional activity of mutant p53 and those reducing mutant p53 levels. PMID:26732534

  13. P53 licensed to kill? Operating the assassin.

    PubMed

    Haupt, Susan; Louria-Hayon, Igal; Haupt, Ygal

    2003-01-01

    The p53 protein is a key player in the cellular response to stress. Proper regulation of p53 is imperative for the suppression of tumor development. This regulation is largely governed by its master inhibitor, Mdm2, which both blocks p53 activities and promotes its destabilization. This tight regulation of p53 by Mdm2 must be interrupted under stress conditions in order for p53 to be stabilized in an active form. A combined action of partner proteins and modifying enzymes is essential for the relief of p53 from Mdm2. The recent revelation of p53 association with the PML-nuclear bodies provides one explanation of how this regulatory network is coordinated within the nucleus in response to certain stress conditions. Thus, it is not only the nature of the p53 regulatory complex but also the spatial and temporal context of this association that governs the output inhibitory signals mediated by p53. PMID:12461776

  14. The dichotomy of p53 regulation by noncoding RNAs.

    PubMed

    Deng, Qipan; Becker, Lindsey; Ma, Xiaodong; Zhong, Xiaoming; Young, Ken; Ramos, Kenneth; Li, Yong

    2014-06-01

    The p53 tumor suppressor gene is the most frequently mutated gene in cancer. Significant progress has been made to discern the importance of p53 in coordinating cellular responses to DNA damage, oncogene activation, and other stresses. Noncoding RNAs are RNA molecules functioning without being translated into proteins. In this work, we discuss the dichotomy of p53 regulation by noncoding RNAs with four unconventional questions. First, is overexpression of microRNAs responsible for p53 inactivation in the absence of p53 mutation? Second, are there somatic mutations in the noncoding regions of the p53 gene? Third, is there a germline mutant in the noncoding regions of the p53 gene that predisposes carriers to cancer? Fourth, can p53 activation mediated by a noncoding RNA mutation cause cancer? This work highlights the prominence of noncoding RNAs in p53 dysregulation and tumorigenesis. PMID:24706938

  15. Up-regulation of inducible nitric oxide synthase expression in cancer-prone p53 knockout mice.

    PubMed

    Ambs, S; Ogunfusika, M O; Merriam, W G; Bennett, W P; Billiar, T R; Harris, C C

    1998-07-21

    High concentrations of nitric oxide (NO) cause DNA damage and apoptosis in many cell types. Thus, regulation of NO synthase (NOS) activity is essential for minimizing effects of cytotoxic and genotoxic nitrogen oxide species. We have shown previously that NO-induced p53 protein accumulation down-regulates basal and cytokine-modulated inducible NOS (NOS2) expression in human cells in vitro. To further characterize the feedback loop between NOS2 and p53, we have investigated NO production, i.e., urinary nitrate plus nitrite excretion, and NOS2 expression in homozygous p53 knockout (KO) mice. We report here that untreated p53 KO mice excreted 70% more nitrite plus nitrate than mice with wild-type (wt) p53. NOS2 protein expression was constitutively detected in the spleen of untreated p53 KO mice, whereas it was undetectable in the spleen of wt p53 controls. Upon treatment with heat-inactivated Corynebacterium parvum, urinary nitrite plus nitrate excretion of p53 KO mice exceeded that of wt controls by approximately 200%. C. parvum treatment also induced p53 accumulation in the liver. Splenectomy reduced the NO output of C. parvum-treated p53 KO mice but not of wt p53 controls. Although NO production and NOS2 protein expression were increased similarly in KO and wt p53 mice 10 days after injection of C. parvum, NOS2 expression returned to baseline levels only in wt p53 controls while remaining up-regulated in p53 KO mice. These genetic and functional data indicate that p53 is an important transrepressor of NOS2 expression in vivo and attenuates excessive NO production in a regulatory negative feedback loop. PMID:9671763

  16. Solution X-ray scattering analysis of cold- heat-, and urea-denatured states in a protein, Streptomyces subtilisin inhibitor.

    PubMed

    Konno, T; Kataoka, M; Kamatari, Y; Kanaori, K; Nosaka, A; Akasaka, K

    1995-08-01

    Streptomyces subtilisin inhibitor (SSI), a homo-dimeric protein with a subunit of 113 residues with two disulfide bonds, is known to exist at low pH in at least three distinct thermodynamic states namely, the native (N), cold-denatured (D') and heat-denatured (D). Small-angle X-ray scattering was used to analyze and to compare overall chain conformations of SSI in typical, N, D', D and urea-denatured states (Durea). Molecular masses were determined from scattering intensities extrapolated to a scattering angle of zero, which showed that SSI exists as a homo-dimer in the N state, but as dissociated monomers in the D', D and Durea states. From Guinier plots of the scattering intensities, radii of gyration (Rg) were determined to be 20.1(+/- 1.8) A for N, and 20.7(+/- 1.3), 25.8(+/- 1.5) and 32 to 35 A for D', D and Durea, respectively. Kratky plots for both N and D' exhibited a bell-shape indicating that the polypeptide chain has a globular part not only in N but also in D', while Kratky plots for D and Durea showed that the polypeptide chain has no globular part either in Durea or D. Combined with the results from circular dichroism and 1H NMR spectra, a picture emerges for the polypeptide chain conformation of SSI such that in N it is a globular dimer close to that in the crystal, in Durea it is totally disordered and expanded nearly to a fully random chain with restrictions only from the disulfide bridges, in D the entire chain is disordered and expanded but with considerable local intra-chain interactions, and in D' the chain consists of a part with a unique tertiary structure and a part disordered and expanded to a degree comparable to D. PMID:7643393

  17. The multiple levels of regulation by p53 ubiquitination

    PubMed Central

    Lee, JT; Gu, W

    2013-01-01

    p53 is a central integrator of a plethora of signals and outputs these signals in the form of tumor suppression. It is well accepted that ubiquitination plays a major part in p53 regulation. Nonetheless, the molecular mechanisms by which p53 activity is controlled by ubiquitination are complex. Mdm2, a RING oncoprotein, was once thought to be the sole E3 ubiquitin ligase for p53, however recent studies have shown that p53 is stabilized but still degraded in the cells of Mdm2-null mice. Although the essential role of Mdm2 in p53 regulation is well established, there are an increasing number of other E3 ligases implicated in Mdm2-independent regulation of p53 by ubiquitination. The different types of ubiquitination on p53 by various E3 ligases have been linked to its differential effects on p53-mediated stress responses. In addition to proteasome-mediated degradation, ubiquitination of p53 acts as signals for degradation-independent functions, such as nuclear export. The function of ubiquitinated p53 varies in the nucleus and cytosol underlying the many potential contributions ubiquitinated p53 may have in promoting cell proliferation or death. Thus, p53 requires multiple layers of regulatory control to ensure correct temporal and spatial functions. PMID:19543236

  18. p53 Cellular Localization and Function in Neuroblastoma

    PubMed Central

    Tweddle, Deborah A.; Malcolm, Archie J.; Cole, Michael; Pearson, Andrew D.J.; Lunec, John

    2001-01-01

    This study investigated the hypothesis that p53 accumulation in neuroblastoma, in the absence of mutation, is associated with functional inactivation, which interferes with downstream mediators of p53 function. To test this hypothesis, p53 expression, location, and functional integrity was examined in neuroblastoma by irradiating 6 neuroblastoma cell lines and studying the effects on p53 transcriptional function, cell cycle arrest, and induction of apoptosis, together with the transcriptional function of p53 after irradiation in three ex vivo primary, untreated neuroblastoma tumors. p53 sequencing showed five neuroblastoma cell lines, two of which were MYCN-amplified, and that all of the tumors were wild-type for p53. p53 was found to be predominantly nuclear before and after irradiation and to up-regulate the p53 responsive genes WAF1 and MDM2 in wild-type p53 cell lines and a poorly-differentiated neuroblastoma, but not a differentiating neuroblastoma or the ganglioneuroblastoma part of a nodular ganglioneuroblastoma in short term culture. This suggests intact p53 transcriptional activity in proliferating neuroblastoma. Irradiation of wild-type p53 neuroblastoma cell lines led to G1 cell cycle arrest in cell lines without MYCN amplification, but not in those with MYCN amplification, despite induction of WAF1. This suggests MYCN amplification may alter downstream mediators of p53 function in neuroblastoma. PMID:11395384

  19. Reversible denaturation of oligomeric human chaperonin 10: denatured state depends on chemical denaturant.

    PubMed Central

    Guidry, J. J.; Moczygemba, C. K.; Steede, N. K.; Landry, S. J.; Wittung-Stafshede, P.

    2000-01-01

    Chaperonins cpn60/cpn10 (GroEL/GroES in Escherichia coli) assist folding of nonnative polypeptides. Folding of the chaperonins themselves is distinct in that it entails assembly of a sevenfold symmetrical structure. We have characterized denaturation and renaturation of the recombinant human chaperonin 10 (cpn10), which forms a heptamer. Denaturation induced by chemical denaturants urea and guanidine hydrochloride (GuHCl) as well as by heat was monitored by tyrosine fluorescence, far-ultraviolet circular dichroism, and cross-linking; all denaturation reactions were reversible. GuHCl-induced denaturation was found to be cpn10 concentration dependent, in accord with a native heptamer to denatured monomer transition. In contrast, urea-induced denaturation was not cpn10 concentration dependent, suggesting that under these conditions cpn10 heptamers denature without dissociation. There were no indications of equilibrium intermediates, such as folded monomers, in either denaturant. The different cpn10 denatured states observed in high [GuHCl] and high [urea] were supported by cross-linking experiments. Thermal denaturation revealed that monomer and heptamer reactions display the same enthalpy change (per monomer), whereas the entropy-increase is significantly larger for the heptamer. A thermodynamic cycle for oligomeric cpn10, combining chemical denaturation with the dissociation constant in absence of denaturant, shows that dissociated monomers are only marginally stable (3 kJ/mol). The thermodynamics for co-chaperonin stability appears conserved; therefore, instability of the monomer could be necessary to specify the native heptameric structure. PMID:11152122

  20. Mutant p53: One, No One, and One Hundred Thousand

    PubMed Central

    Walerych, Dawid; Lisek, Kamil; Del Sal, Giannino

    2015-01-01

    Encoded by the mutated variants of the TP53 tumor suppressor gene, mutant p53 proteins are getting an increased experimental support as active oncoproteins promoting tumor growth and metastasis. p53 missense mutant proteins are losing their wild-type tumor suppressor activity and acquire oncogenic potential, possessing diverse transforming abilities in cell and mouse models. Whether various mutant p53s differ in their oncogenic potential has been a matter of debate. Recent discoveries are starting to uncover the existence of mutant p53 downstream programs that are common to different mutant p53 variants. In this review, we discuss a number of studies on mutant p53, underlining the advantages and disadvantages of alternative experimental approaches that have been used to describe the numerous mutant p53 gain-of-function activities. Therapeutic possibilities are also discussed, taking into account targeting either individual or multiple mutant p53 proteins in human cancer. PMID:26734571

  1. Watching the watcher: regulation of p53 by mitochondria

    PubMed Central

    Holley, Aaron K; St Clair, Daret K

    2009-01-01

    p53 has been referred to as the ‘guardian of the genome’ because of its role in protecting the cell from DNA damage. p53 performs its duties by regulating cell-cycle progression and DNA repair and, in cases of irreparable DNA damage, by executing programmed cell death. Mitochondria are an important target of transcription-dependent and -independent actions of p53 to carry out the apoptotic function. However, increasing evidence suggests that p53 activity is regulated by mitochondria. Cellular insults that alter mitochondrial function can have important consequences on p53 activity. In light of these new findings, the following review focuses on p53/mitochondria connections, in particular how reactive oxygen species generated at mitochondria regulate p53 activity. A better understanding of the mechanisms by which mitochondria regulate p53 may have an impact on our understanding of the development and progression of many diseases, especially cancer. PMID:19243304

  2. Expression and mutations of p53 in salivary gland tumours.

    PubMed

    Kärjä, V J; Syrjänen, K J; Kurvinen, A K; Syrjänen, S M

    1997-05-01

    A series of 219 salivary gland tumours (103 carcinomas and 116 benign tumours) were analysed for p53 protein expression using immunohistochemistry, and for mutations in p53 gene using non-radioactive single strand conformation polymorphism (SSCP). p53 expression was present in 36% (42/116) of the benign tumours and in 54% (56/103) of the carcinomas. The highest prevalence of p53 expression was found in adenoid cystic carcinomas (69%), followed by mucoepidermoid carcinomas (67%). Of the benign tumours, pleomorphic adenomas showed the highest prevalence of p53 positivity (41%). In malignant tumours, expression of p53 bore no correlation to local recurrence, metastatic disease or survival of the patients. Exons 5 through 9 were analysed and four mutations were found in 20 cases of p53-immunopositive tumours and two in 20 p53-negative tumours. Each of the exons 5, 6 and 8/9 had two mutations, whereas no mutations were detected in exon 7.

  3. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53.

    PubMed

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1-393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using "hot-spot" p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  4. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53

    PubMed Central

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1–393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using “hot-spot” p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  5. Identification of p53-target genes in Danio rerio.

    PubMed

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  6. Identification of p53-target genes in Danio rerio

    PubMed Central

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M. Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  7. p53 mutations increase resistance to ionizing radiation

    SciTech Connect

    Lee, J.M. ); Bernstein, A. Univ. of Toronto, Ontario )

    1993-06-15

    Mouse and human tumors of diverse origin frequently have somatically acquired mutations or rearrangements of the p53 gene, or they have lost one or both copies of the gene. Although wild-type p53 protein is believed to function as a tumor-suppressor gene, it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by [gamma] radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. The authors have used transgenic mice expressing one of two mutant alleles of p53 to test this prediction. Their results show that expression of both mutant variants of the mouse p53 gene significantly increases the cellular resistance of a variety of hematopoietic cell lineages to [gamma] radiation. These observations provide direct evidence that p53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests possible mechanisms through which alterations in the p53 gene might lead to oncogenic transformation. 53 refs., 5 figs.

  8. Identification of p53-target genes in Danio rerio.

    PubMed

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species.

  9. Tumor suppressor p53 protects mice against Listeria monocytogenes infection.

    PubMed

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection. PMID:27644341

  10. Tumor suppressor p53 protects mice against Listeria monocytogenes infection

    PubMed Central

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection. PMID:27644341

  11. Tumor suppressor p53 protects mice against Listeria monocytogenes infection.

    PubMed

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection.

  12. Utility of birefringence changes due to collagen thermal denaturation rate process analysis: vessel wall temperature estimation for new short term heating balloon angioplasty

    NASA Astrophysics Data System (ADS)

    Kaneko, Kenji; Shimazaki, Natsumi; Gotoh, Maya; Nakatani, Eriko; Arai, Tsunenori

    2007-02-01

    Our photo thermal reaction heating architecture balloon realizes less than 10 s short term heating that can soften vessel wall collagen without damaging surrounding tissue thermally. New thermal balloon angioplasty, photo-thermo dynamic balloon angioplasty (PTDBA) has experimentally shown sufficient opening with 2 atm low pressure dilation and prevention of chronic phase restenosis and acute phase thrombus in vivo. Even though PTDBA has high therapeutic potential, the most efficient heating condition is still under study, because relationship of treatment and thermal dose to vessel wall is not clarified yet. To study and set the most efficient heating condition, we have been working on establishment of temperature history estimation method from our previous experimental results. Heating target of PTDBA, collagen, thermally denatures following rate process. Denaturation is able to be quantified with measured collagen birefringence value. To express the denaturation with equation of rate process, the following ex vivo experiments were performed. Porcine extracted carotid artery was soaked in two different temperature saline baths to enforce constant temperature heating. Higher temperature bath was set to 40 to 80 degree Celsius and soaking duration was 5 to 40 s. Samples were observed by a polarizing microscope and a scanning electron microscope. The birefringence was measured by polarizing microscopic system using Brace-Koehler compensator 1/30 wavelength. The measured birefringence showed temperature dependency and quite fit with the rate process equation. We think vessel wall temperature is able to be estimated using the birefringence changes due to thermal denaturation.

  13. Heat-denaturation and aggregation of quinoa (Chenopodium quinoa) globulins as affected by the pH value.

    PubMed

    Mäkinen, Outi E; Zannini, Emanuele; Koehler, Peter; Arendt, Elke K

    2016-04-01

    The influence of heating (100 °C; 0-15 min) on the relative molecular mass, protein unfolding and secondary structure of quinoa globulins was studied at pH 6.5 (low solubility), 8.5 and 10.5 (high solubility). The patterns of denaturation and aggregation varied with pH. Heating triggered the disruption of the disulfide bonds connecting the acidic and basic chains of the chenopodin subunits at pH 8.5 and 10.5, but not at pH 6.5. Large aggregates unable to enter a 4% SDS-PAGE gel were formed at pH 6.5 and 8.5, which became soluble under reducing conditions. Heating at pH 10.5 lead to a rapid dissociation of the native chenopodin and to the disruption of the subunits, but no SDS-insoluble aggregates were formed. No major changes in secondary structure occurred during a 15 min heating, but an increase in hydrophobicity indicated unfolding of the tertiary structure in all samples.

  14. Heat-denaturation and aggregation of quinoa (Chenopodium quinoa) globulins as affected by the pH value.

    PubMed

    Mäkinen, Outi E; Zannini, Emanuele; Koehler, Peter; Arendt, Elke K

    2016-04-01

    The influence of heating (100 °C; 0-15 min) on the relative molecular mass, protein unfolding and secondary structure of quinoa globulins was studied at pH 6.5 (low solubility), 8.5 and 10.5 (high solubility). The patterns of denaturation and aggregation varied with pH. Heating triggered the disruption of the disulfide bonds connecting the acidic and basic chains of the chenopodin subunits at pH 8.5 and 10.5, but not at pH 6.5. Large aggregates unable to enter a 4% SDS-PAGE gel were formed at pH 6.5 and 8.5, which became soluble under reducing conditions. Heating at pH 10.5 lead to a rapid dissociation of the native chenopodin and to the disruption of the subunits, but no SDS-insoluble aggregates were formed. No major changes in secondary structure occurred during a 15 min heating, but an increase in hydrophobicity indicated unfolding of the tertiary structure in all samples. PMID:26593460

  15. Splenic scintigraphy using Tc-99m-labeled heat-denatured red blood cells in pediatric patients: concise communication

    SciTech Connect

    Ehrlich, C.P.; Papanicolaou, N.; Treves, S.; Hurwitz, R.A.; Richards, P.

    1982-03-01

    Ten children underwent splenic imaging with heat-denatured red blood cells labeled with technetium-99m (Tc-99m DRBC). The presenting problems included the heterotaxia syndrome, recurrent idiopathic thrombocytopenic purpura following splenectomy, mass in the left posterior hemithorax, and blunt abdominal trauma. In nine patients, the presence or absence of splenic tissue was established. A splenic hematoma was identified in the tenth patient. All patients were initially scanned with Tc-99m sulfur colloid (Tc-99m SC), and were selected for Tc-99m DRBC scintigraphy only after the results of the SC scans failed to establish the clinical problem beyond doubt. The availability of kits containing stannous ions, essential for efficient and stable labeling of red blood cells with Tc-99m and requiring only a small volume of blood, make splenic scintigraphy in children a relatively simple and definitive diagnostic procedure, when identification of splenic tissue is of clinical importance.

  16. Targeting p53 Null Neuroblastomas through RLIP76**

    PubMed Central

    Singhal, Jyotsana; Yadav, Sushma; Nagaprashantha, Lokesh Dalasanur; Vatsyayan, Rit; Singhal, Sharad S; Awasthi, Sanjay

    2011-01-01

    The search for p53-independent mechanism of cancer cell killing is highly relevant to pediatric neuroblastomas, where successful therapy is limited by its transformation into p53 mutant and a highly drug-resistant neoplasm. Our studies on the drug-resistant p53 mutant as compared with drug-resistant p53 wild-type neuroblastoma revealed a novel mechanism for resistance to apoptosis: a direct role of p53 in regulating the cellular concentration of pro-apoptotic alkenals by functioning as a specific and saturable allosteric inhibitor of the alkenal-glutathione-conjugate transporter, RLIP76. The RLIP76-p53 complex was demonstrated both using immuno-precipitation analyses of purified proteins as well as by immuno-fluorescence analysis. Drug transport studies revealed that p53 inhibited both basal and PKCα stimulated transport of glutathione-conjugates of 4HNE (GS-HNE) and cisplatin. Drug resistance was significantly greater for p53 mutant as compared with p53 wild-type neuroblastoma cell lines, but both were susceptible to depletion of RLIP76 by antisense alone. In addition, inhibition of RLIP76 significantly enhanced the cytotoxicity of cisplatin. Taken together, these studies provide powerful evidence for a novel mechanism for drug and apoptosis resistance in p53 mutant neuroblastoma, based on a model of regulation of p53 induced apoptosis by RLIP76, where p53 is a saturable and specific allosteric inhibitor of RLIP76, and p53 loss results in over-expression of RLIP76; thus, in the absence of p53, the drug and glutathione-conjugate transport activities of RLIP76 are enhanced. Most importantly, our findings strongly indicate RLIP76 as a novel target for therapy of drug-resistant and p53 mutant neuroblastoma. PMID:21411502

  17. Resistance of mitochondrial p53 to dominant inhibition

    PubMed Central

    Heyne, Kristina; Schmitt, Katrin; Mueller, Daniel; Armbruester, Vivienne; Mestres, Pedro; Roemer, Klaus

    2008-01-01

    Background Mutation of a tumor suppressor allele leaves the second as backup. Not necessarily so with p53. This homo-tetrameric transcription factor can become contaminated with mutant p53 through hetero-tetramerization. In addition, it can be out-competed by the binding to p53 DNA recognition motifs of transactivation-incompetent isoforms (ΔN and ΔTA-isoforms) of the p53/p63/p73 family of proteins. Countermeasures against such dominant-negative or dominant-inhibitory action might include the evolutionary gain of novel, transactivation-independent tumor suppressor functions by the wild-type monomer. Results Here we have studied, mostly in human HCT116 colon adenocarcinoma cells with an intact p53 pathway, the effects of dominant-inhibitory p53 mutants and of Δex2/3p73, a tumor-associated ΔTA-competitor of wild-type p53, on the nuclear transactivation-dependent and extra-nuclear transactivation-independent functions of wild-type p53. We report that mutant p53 and Δex2/3p73, expressed from a single gene copy per cell, interfere with the stress-induced expression of p53-responsive genes but leave the extra-nuclear apoptosis by mitochondrial p53 largely unaffected, although both wild-type and mutant p53 associate with the mitochondria. In accord with these observations, we present evidence that in contrast to nuclear p53 the vast majority of mitochondrial p53, be it wild-type or mutant, is consisting of monomeric protein. Conclusion The extra-nuclear p53-dependent apoptosis may constitute a fail-safe mechanism against dominant inhibition. PMID:18547443

  18. p53 as an Effector or Inhibitor of Therapy Response.

    PubMed

    Ablain, Julien; Poirot, Brigitte; Esnault, Cécile; Lehmann-Che, Jacqueline; de Thé, Hugues

    2015-12-04

    Although integrity of the p53 signaling pathway in a given tumor was expected to be a critical determinant of response to therapies, most clinical studies failed to link p53 status and treatment outcome. Here, we present two opposite situations: one in which p53 is an essential effector of cure by targeted leukemia therapies and another one in advanced breast cancers in which p53 inactivation is required for the clinical efficacy of dose-dense chemotherapy. If p53 promotes or blocks therapy response, therapies must be tailored on its status in individual tumors.

  19. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  20. Endogenous p53 protein generated from wild-type alternatively spliced p53 RNA in mouse epidermal cells.

    PubMed Central

    Kulesz-Martin, M F; Lisafeld, B; Huang, H; Kisiel, N D; Lee, L

    1994-01-01

    We previously demonstrated that a wild-type alternatively spliced p53 (p53as) RNA exists in mouse cultured cells and normal mouse tissues at approximately 25 to 33% of the level of the major p53 RNA form. The alternative RNA transcript is 96 nucleotides longer than the major transcript as a result of alternative splicing of intron 10 sequences. The protein expected to be generated from the p53as transcript is 9 amino acids shorter than the major p53 protein and has 17 different amino acids at the carboxyl terminus. We report here that p53as protein exists in nontransformed and malignant epidermal cells and is localized to the nucleus. In addition, p53as protein is preferentially expressed during the G2 phase of the cell cycle and in cells with greater than G2 DNA content compared with the major p53 protein, which is preferentially expressed in G1. The p53as immunoreactivity is elevated and shifted to the G1 phase of the cell cycle following actinomycin D treatment of nontransformed cells but not malignant cells. In view of the dimerization and tetramerization of p53 protein which may be necessary for its DNA binding and transcriptional activation activities, the presence of p53as protein in cells has important implications for understanding the physiological function(s) of the p53 gene. Images PMID:8114705

  1. Flexible lid to the p53-binding domain of human Mdm2: implications for p53 regulation.

    PubMed

    McCoy, Mark A; Gesell, Jennifer J; Senior, Mary M; Wyss, Daniel F

    2003-02-18

    The stabilization of p53 against Mdm2-mediated degradation is an important event in DNA damage response. Initial models of p53 stabilization focused on posttranslational modification of p53 that would disrupt the p53-Mdm2 interaction. The N-terminal regions of both p53 and Mdm2 are modified in vivo in response to cellular stress, suggesting that modifications to Mdm2 also may affect the p53-Mdm2 interaction. Our NMR studies of apo-Mdm2 have found that, in addition to Mdm2 residues 25-109 that form the well ordered p53-binding domain that was observed in the p52-Mdm2 complex, Mdm2 residues 16-24 form a lid that closes over the p53-binding site. The Mdm2 lid, which is strictly conserved in mammals, may help to stabilize apo-Mdm2. It also competes weakly with peptidic and nonpeptidic antagonists. Modifications to the Mdm2 lid may disrupt p53-Mdm2 binding leading to p53 stabilization. Mdm2 and Mdm4 possess nearly identical p53-binding domains but different lids suggesting that lid modifications may select for p53 binding.

  2. A p53-bound enhancer region controls a long intergenic noncoding RNA required for p53 stress response.

    PubMed

    Melo, C A; Léveillé, N; Rooijers, K; Wijchers, P J; Geeven, G; Tal, A; Melo, S A; de Laat, W; Agami, R

    2016-08-18

    Genome-wide chromatin studies identified the tumor suppressor p53 as both a promoter and an enhancer-binding transcription factor. As an enhancer factor, p53 can induce local production of enhancer RNAs, as well as transcriptional activation of distal neighboring genes. Beyond the regulation of protein-coding genes, p53 has the capacity to regulate long intergenic noncoding RNA molecules (lincRNAs); however, their importance to the p53 tumor suppressive function remains poorly characterized. Here, we identified and characterized a novel p53-bound intronic enhancer that controls the expression of its host, the lincRNA00475 (linc-475). We demonstrate the requirement of linc-475 for the proper induction of a p53-dependent cell cycle inhibitory response. We further confirm the functional importance of linc-475 in the maintenance of CDKN1A/p21 levels, a cell cycle inhibitor and a major p53 target gene, following p53 activation. Interestingly, loss of linc-475 reduced the binding of both p53 and RNA polymerase II (RNAPII) to the promoter of p21, attenuating its transcription rate following p53 activation. Altogether, our data suggest a direct role of p53-bound enhancer domains in the activation of lincRNAs required for an efficient p53 transcriptional response.

  3. Comprehensive mutational scanning of the p53 coding region by two-dimensional gene scanning.

    PubMed

    Rines, R D; van Orsouw, N J; Sigalas, I; Li, F P; Eng, C; Vijg, J

    1998-06-01

    A comprehensive mutational scanning test for the p53 coding region based on multiplex PCR and two-dimensional DNA electrophoresis was designed and evaluated. In a 2-step multiplex PCR, the p53 coding region (exons 2-11) was amplified as a single 8646-bp fragment by long-distance PCR in step one. This fragment served as a template for the subsequent co-amplification of the individual exons in two multiplex groups in step two. The multiplex products were then separated, first on the basis of size in non-denaturant polyacrylamide gels and then on the basis of sequence by denaturing gradient gel electrophoresis (DGGE). Primers for optimal PCR, melting behavior and 2-D gel distribution were designed using a recently developed computer program. The resulting two-dimensional gene scanning (TDGS) test was evaluated by screening, in a blinded fashion, 29 coded DNA samples from Li-Fraumeni syndrome patients with previously identified germline mutations. All mutations were correctly detected. This assay provides an accurate, cost-effective and non-radioactive method for simultaneous mutational scanning of all p53 coding exons.

  4. Lysine methylation represses p53 activity in teratocarcinoma cancer cells.

    PubMed

    Zhu, Jiajun; Dou, Zhixun; Sammons, Morgan A; Levine, Arnold J; Berger, Shelley L

    2016-08-30

    TP53 (which encodes the p53 protein) is the most frequently mutated gene among all human cancers, whereas tumors that retain the wild-type TP53 gene often use alternative mechanisms to repress the p53 tumor-suppressive function. Testicular teratocarcinoma cells rarely contain mutations in TP53, yet the transcriptional activity of wild-type p53 is compromised, despite its high expression level. Here we report that in the teratocarcinoma cell line NTera2, p53 is subject to lysine methylation at its carboxyl terminus, which has been shown to repress p53's transcriptional activity. We show that reduction of the cognate methyltransferases reactivates p53 and promotes differentiation of the NTera2 cells. Furthermore, reconstitution of methylation-deficient p53 mutants into p53-depleted NTera2 cells results in elevated expression of p53 downstream targets and precocious loss of pluripotent gene expression compared with re-expression of wild-type p53. Our results provide evidence that lysine methylation of endogenous wild-type p53 represses its activity in cancer cells and suggest new therapeutic possibilities of targeting testicular teratocarcinoma. PMID:27535933

  5. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.

  6. Proteasome inhibitors suppress the protein expression of mutant p53.

    PubMed

    Halasi, Marianna; Pandit, Bulbul; Gartel, Andrei L

    2014-01-01

    Tumor suppressor p53 is one of the most frequently mutated genes in cancer, with almost 50% of all types of cancer expressing a mutant form of p53. p53 transactivates the expression of its primary negative regulator, HDM2. HDM2 is a ubiquitin ligase, which initiates the proteasomal degradation of p53 following ubiquitination. Proteasome inhibitors, by targeting the ubiquitin proteasome pathway inhibit the degradation of the majority of cellular proteins including wild-type p53. In contrast, in this study we found that the protein expression of mutant p53 was suppressed following treatment with established or novel proteasome inhibitors. Furthermore, for the first time we demonstrated that Arsenic trioxide, which was previously shown to suppress mutant p53 protein level, exhibits proteasome inhibitory activity. Proteasome inhibitor-mediated suppression of mutant p53 was partially rescued by the knockdown of HDM2, suggesting that the stabilization of HDM2 by proteasome inhibitors might be responsible for mutant p53 suppression to some extent. This study suggests that suppression of mutant p53 is a general property of proteasome inhibitors and it provides additional rationale to use proteasome inhibitors for the treatment of tumors with mutant p53.

  7. Proteasome inhibitors suppress the protein expression of mutant p53

    PubMed Central

    Halasi, Marianna; Pandit, Bulbul; Gartel, Andrei L

    2014-01-01

    Tumor suppressor p53 is one of the most frequently mutated genes in cancer, with almost 50% of all types of cancer expressing a mutant form of p53. p53 transactivates the expression of its primary negative regulator, HDM2. HDM2 is a ubiquitin ligase, which initiates the proteasomal degradation of p53 following ubiquitination. Proteasome inhibitors, by targeting the ubiquitin proteasome pathway inhibit the degradation of the majority of cellular proteins including wild-type p53. In contrast, in this study we found that the protein expression of mutant p53 was suppressed following treatment with established or novel proteasome inhibitors. Furthermore, for the first time we demonstrated that Arsenic trioxide, which was previously shown to suppress mutant p53 protein level, exhibits proteasome inhibitory activity. Proteasome inhibitor-mediated suppression of mutant p53 was partially rescued by the knockdown of HDM2, suggesting that the stabilization of HDM2 by proteasome inhibitors might be responsible for mutant p53 suppression to some extent. This study suggests that suppression of mutant p53 is a general property of proteasome inhibitors and it provides additional rationale to use proteasome inhibitors for the treatment of tumors with mutant p53. PMID:25485499

  8. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  9. Lysine methylation represses p53 activity in teratocarcinoma cancer cells.

    PubMed

    Zhu, Jiajun; Dou, Zhixun; Sammons, Morgan A; Levine, Arnold J; Berger, Shelley L

    2016-08-30

    TP53 (which encodes the p53 protein) is the most frequently mutated gene among all human cancers, whereas tumors that retain the wild-type TP53 gene often use alternative mechanisms to repress the p53 tumor-suppressive function. Testicular teratocarcinoma cells rarely contain mutations in TP53, yet the transcriptional activity of wild-type p53 is compromised, despite its high expression level. Here we report that in the teratocarcinoma cell line NTera2, p53 is subject to lysine methylation at its carboxyl terminus, which has been shown to repress p53's transcriptional activity. We show that reduction of the cognate methyltransferases reactivates p53 and promotes differentiation of the NTera2 cells. Furthermore, reconstitution of methylation-deficient p53 mutants into p53-depleted NTera2 cells results in elevated expression of p53 downstream targets and precocious loss of pluripotent gene expression compared with re-expression of wild-type p53. Our results provide evidence that lysine methylation of endogenous wild-type p53 represses its activity in cancer cells and suggest new therapeutic possibilities of targeting testicular teratocarcinoma.

  10. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  11. Controlling the Mdm2-Mdmx-p53 Circuit

    PubMed Central

    Waning, David L.; Lehman, Jason A.; Batuello, Christopher N.; Mayo, Lindsey D.

    2010-01-01

    The p53 tumor suppressor is a key protein in maintaining the integrity of the genome by inducing either cell cycle arrest or apoptosis following cellular stress signals. Two human family members, Mdm2 and Mdmx, are primarily responsible for inactivating p53 transcription and targeting p53 protein for ubiquitin-mediated degradation. In response to genotoxic stress, post-translational modifications to p53, Mdm2 and Mdmx stabilize and activate p53. The role that phosphorylation of these molecules plays in the cellular response to genotoxic agents has been extensively studied with respect to cancer biology. In this review, we discuss the main phosphorylation events of p53, Mdm2 and Mdmx in response to DNA damage that are important for p53 stability and activity. In tumors that harbor wild-type p53, reactivation of p53 by modulating both Mdm2 and Mdmx signaling is well suited as a therapeutic strategy. However, the rationale for development of kinase inhibitors that target the Mdm2-Mdmx-p53 axis must be carefully considered since modulation of certain kinase signaling pathways has the potential to destabilize and inactivate p53. PMID:20651945

  12. Chemical Variations on the p53 Reactivation Theme

    PubMed Central

    Ribeiro, Carlos J. A.; Rodrigues, Cecília M. P.; Moreira, Rui; Santos, Maria M. M.

    2016-01-01

    Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX). Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented. PMID:27187415

  13. A novel p53-binding domain in CUL7

    SciTech Connect

    Kasper, Jocelyn S.; Arai, Takehiro; De Caprio, James A. . E-mail: james_decaprio@dfci.harvard.edu

    2006-09-15

    CUL7 is a member of the cullin RING ligase family and forms an SCF-like complex with SKP1 and FBXW8. CUL7 is required for normal mouse embryonic development and cellular proliferation, and is highly homologous to PARC, a p53-associated, parkin-like cytoplasmic protein. We determined that CUL7, in a manner similar to PARC, can bind directly to p53 but does not affect p53 expression. We identified a discrete, co-linear domain in CUL7 that is conserved in PARC and HERC2, and is necessary and sufficient for p53-binding. The presence of p53 stabilized expression of this domain and we demonstrate that this p53-binding domain of CUL7 contributes to the cytoplasmic localization of CUL7. The results support the model that p53 plays a role in regulation of CUL7 activity.

  14. Regulation of p53 during senescence in normal human keratinocytes

    PubMed Central

    Kim, Reuben H; Kang, Mo K; Kim, Terresa; Yang, Paul; Bae, Susan; Williams, Drake W; Phung, Samantha; Shin, Ki-Hyuk; Hong, Christine; Park, No-Hee

    2015-01-01

    p53, the guardian of the genome, is a tumor suppressor protein and critical for the genomic integrity of the cells. Many studies have shown that intracellular level of p53 is enhanced during replicative senescence in normal fibroblasts, and the enhanced level of p53 is viewed as the cause of senescence. Here, we report that, unlike in normal fibroblasts, the level of intracellular p53 reduces during replicative senescence and oncogene-induced senescence (OIS) in normal human keratinocytes (NHKs). We found that the intracellular p53 level was also decreased in age-dependent manner in normal human epithelial tissues. Senescent NHKs exhibited an enhanced level of p16INK4A, induced G2 cell cycle arrest, and lowered the p53 expression and transactivation activity. We found that low level of p53 in senescent NHKs was due to reduced transcription of p53. The methylation status at the p53 promoter was not altered during senescence, but senescent NHKs exhibited notably lower level of acetylated histone 3 (H3) at the p53 promoter in comparison with rapidly proliferating cells. Moreover, p53 knockdown in rapidly proliferating NHKs resulted in the disruption of fidelity in repaired DNA. Taken together, our study demonstrates that p53 level is diminished during replicative senescence and OIS and that such diminution is associated with H3 deacetylation at the p53 promoter. The reduced intracellular p53 level in keratinocytes of the elderly could be a contributing factor for more frequent development of epithelial cancer in the elderly because of the loss of genomic integrity of cells. PMID:26138448

  15. Plasma p53 protein and anti-p53 antibody expression in vinyl chloride monomer workers in Taiwan.

    PubMed

    Luo, J C; Liu, H T; Cheng, T J; Du, C L; Wang, J D

    1999-06-01

    Vinyl chloride (VC) workers are known to be at risk for development of angiosarcoma of the liver (ASL), a rare tumor. Previously, a study of p53 gene mutations in tumors of VC-exposed workers found that 50% of liver angiosarcomas contained such mutations. Mutant p53 oncoprotein and anti-p53 antibodies can also be found in the sera of ASL patients and VC-exposed workers without cancer. Workers in Taiwan have also been exposed to VC, and some have contracted liver tumors. In this study, we used enzyme-linked immunosorbent assays to detect mutant p53 protein and anti-p53 antibodies in the plasma of VC-exposed workers in Taiwan. Thirty-three of 251 (13.2%) VC-workers tested positive for the p53 overexpression (10% with positive mutant p53 protein and 3.6% with positive anti-p53) in their plasma, but only 2 of 36 controls (5.6%) tested positive (2.8% with positive mutant p53 protein and 2.8% with positive anti-p53). There was a significant association between cumulative VC exposure concentration and positive p53 expression (P = 0.032) among VC workers after we adjusted for age, hepatitis, drinking, and smoking status. In summary, P53 overexpression (mutant p53 protein or anti-p53 antibody) can be found in the plasma of VC workers in Taiwan, and a significant dose-response relationship exists between plasma p53 overexpression and VC cumulative exposure concentration.

  16. Loss of p53-regulatory protein IFI16 induces NBS1 leading to activation of p53-mediated checkpoint by phosphorylation of p53 SER37.

    PubMed

    Tawara, Hideyuki; Fujiuchi, Nobuko; Sironi, Juan; Martin, Sarah; Aglipay, Jason; Ouchi, Mutsuko; Taga, Makoto; Chen, Phang-Lang; Ouchi, Toru

    2008-01-01

    Our previous results that IFI16 is involved in p53 transcription activity under conditions of ionizing radiation (IR), and that the protein is frequently lost in human breast cancer cell lines and breast adenocarcinoma tissues suggesting that IFI16 plays a crucial role in controlling cell growth. Here, we show that loss of IFI16 by RNA interference in cell culture causes elevated phosphorylation of p53 Ser37 and accumulated NBS1 (nibrin) and p21WAF1, leading to growth retardation. Consistent with these observations, doxycyclin-induced NBS1 caused accumulation of p21WAF1 and increased phosphorylation of p53 Ser37, leading to cell cycle arrest in G1 phase. Wortmannin treatment was found to decrease p53 Ser37 phosphorylation in NBS-induced cells. These results suggest that loss of IFI16 activates p53 checkpoint through NBS1-DNA-PKcs pathway. PMID:17981542

  17. NAT10 regulates p53 activation through acetylating p53 at K120 and ubiquitinating Mdm2.

    PubMed

    Liu, Xiaofeng; Tan, Yuqin; Zhang, Chunfeng; Zhang, Ying; Zhang, Liangliang; Ren, Pengwei; Deng, Hongkui; Luo, Jianyuan; Ke, Yang; Du, Xiaojuan

    2016-03-01

    As a genome guardian, p53 maintains genome stability by arresting cells for damage repair or inducing cell apoptosis to eliminate the damaged cells in stress response. Several nucleolar proteins stabilize p53 by interfering Mdm2-p53 interaction upon cellular stress, while other mechanisms by which nucleolar proteins activate p53 remain to be determined. Here, we identify NAT10 as a novel regulator for p53 activation. NAT10 acetylates p53 at K120 and stabilizes p53 by counteracting Mdm2 action. In addition, NAT10 promotes Mdm2 degradation with its intrinsic E3 ligase activity. After DNA damage, NAT10 translocates to nucleoplasm and activates p53-mediated cell cycle control and apoptosis. Finally, NAT10 inhibits cell proliferation and expression of NAT10 decreases in human colorectal carcinomas. Thus, our data demonstrate that NAT10 plays a critical role in p53 activation via acetylating p53 and counteracting Mdm2 action, providing a novel pathway by which nucleolar protein activates p53 as a cellular stress sensor. PMID:26882543

  18. C-Abl as a modulator of p53

    SciTech Connect

    Levav-Cohen, Yaara; Goldberg, Zehavit; Zuckerman, Valentina; Grossman, Tamar; Haupt, Sue; Haupt, Ygal . E-mail: haupt@md.huji.ac.il

    2005-06-10

    P53 is renowned as a cellular tumor suppressor poised to instigate remedial responses to various stress insults that threaten DNA integrity. P53 levels and activities are kept under tight regulation involving a complex network of activators and inhibitors, which determine the type and extent of p53 growth inhibitory signaling. Within this complexity, the p53-Mdm2 negative auto-regulatory loop serves as a major route through which intra- and extra-cellular stress signals are channeled to appropriate p53 responses. Mdm2 inhibits p53 transcriptional activities and through its E3 ligase activity promotes p53 proteasomal degradation either within the nucleus or following nuclear export. Upon exposure to stress signals these actions of Mdm2 have to be moderated, or even interrupted, in order to allow sufficient p53 to accumulate in an active form. Multiple mechanisms involving a variety of factors have been demonstrated to mediate this interruption. C-Abl is a critical factor that under physiological conditions is required for the maximal and efficient accumulation of active p53 in response to DNA damage. C-Abl protects p53 by antagonizing the inhibitory effect of Mdm2, an action that requires a direct interplay between c-Abl and Mdm2. In addition, c-Abl protects p53 from other inhibitors of p53, such as the HPV-E6/E6AP complex, that inhibits and degrades p53 in HPV-infected cells. Surprisingly, the oncogenic form of c-Abl, the Bcr-Abl fusion protein in CML cells, also promotes the accumulation of wt p53. However, in contrast to the activation of p53 by c-Abl, its oncogenic form, Bcr-Abl, counteracts the growth inhibitory activities of p53 by modulating the p53-Mdm2 loop. Thus, it appears that by modulating the p53-Mdm2 loop, c-Abl and its oncogenic forms critically determine the type and extent of the cellular response to DNA damage.

  19. Role of p53 isoforms and aggregations in cancer.

    PubMed

    Kim, SeJin; An, Seong Soo A

    2016-06-01

    p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers.Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways.Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects.As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  20. p53: a molecular marker for the detection of cancer

    PubMed Central

    Boyd, Mark T; Vlatkovic, Nikolina

    2013-01-01

    Background The p53 gene is the most frequently mutated gene in cancer and accordingly has been the subject of intensive investigation for almost 30 years. Loss of p53 function due to mutations has been unequivocally demonstrated to promote cancer in both humans and in model systems. As a consequence, there exists an enormous body of information regarding the function of normal p53 in biology and the pathobiological consequences of p53 mutation. It has long been recognised that analysis of p53 has considerable potential as a tool for use in both diagnostic and, to a greater extent, prognostic settings and some significant progress has been made in both of these arenas. Objective To provide an overview of the biology of p53, particularly in the context of uses of p53 as a diagnostic tool. Methods A literature review focused upon the methods and uses of p53 analysis in the diagnosis of sporadic cancers, rare genetic disorders and in detection of residual disease. Conclusion p53 is currently an essential diagnostic for the rare inherited cancer prone syndrome (Li-Fraumeni) and is an important diagnostic in only a limited number of settings in sporadic disease. Research in specific cancers indicates that the uses of increasingly well informed p53 mutational analysis are likely to expand to other cancers. PMID:23495923

  1. Mitofusin-2 is a novel direct target of p53

    SciTech Connect

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-10-01

    Research highlights: {yields} Mfn2 is a novel target gene of p53. {yields} Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. {yields} Mfn2 promoter activity can be elevated by the p53 protein. {yields} P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  2. Role of p53 isoforms and aggregations in cancer

    PubMed Central

    Kim, SeJin; An, Seong Soo A.

    2016-01-01

    Abstract p53 is a master regulatory protein that is involved in diverse cellular metabolic processes such as apoptosis, DNA repair, and cell cycle arrest. The protective function of p53 (in its homotetrameric form) as a tumor suppressor is lost in more than 50% of human cancers. Despite considerable experimental evidence suggesting the presence of multiple p53 states, it has been difficult to correlate the status of p53 with cancer response to treatments and clinical outcomes, which suggest the importance of complex but essential p53 regulatory pathways. Recent studies have indicated that the expression pattern of p53 isoforms may play a crucial role in regulating normal and cancer cell fates in response to diverse stresses. The human TP53 gene encodes at least 12 p53 isoforms, which are produced in normal tissue through alternative initiation of translation, usage of alternative promoters, and alternative splicing. Furthermore, some researchers have suggested that the formation of mutant p53 aggregates may be associated with cancer pathogenesis due to loss-of function (LoF), dominant-negative (DN), and gain-of function (GoF) effects. As different isoforms or the aggregation state of p53 may influence tumorigenesis, this review aims to examine the correlation of p53 isoforms and aggregation with cancer. PMID:27368003

  3. Targeting the p53 Pathway in Ewing Sarcoma

    PubMed Central

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  4. Immunohistochemical Determination of p53 Protein Overexpression for Predicting p53 Gene Mutations in Hepatocellular Carcinoma: A Meta-Analysis

    PubMed Central

    Deng, Miao; Liu, Dechun; Ma, Qingyong; Feng, Xiaoshan

    2016-01-01

    Background Whether increased expression of the tumor suppressor protein p53 indicates a p53 gene mutation in hepatocellular carcinoma (HCC) remains unclear. We conducted a meta-analysis to determine whether p53 protein overexpression detected by immunohistochemistry (IHC) offers a diagnostic prediction for p53 gene mutations in HCC patients. Methods Systematic literature searches were conducted with an end date of December 2015. A meta-analysis was performed to estimate the diagnostic accuracy of IHC-determined p53 protein overexpression in the prediction of p53 gene mutations in HCC. Sensitivity, subgroup, and publication bias analyses were also conducted. Results Thirty-six studies were included in the meta-analysis. The results showed that the overall sensitivity and specificity for IHC-determined p53 overexpression in the diagnostic prediction of p53 mutations in HCC were 0.83 (95% CI: 0.80–0.86) and 0.74 (95% CI: 0.71–0.76), respectively. The summary positive likelihood ratio (PLR) and negative likelihood ratio (NLR) were 2.65 (95% CI: 2.21–3.18) and 0.36 (95% CI: 0.26–0.50), respectively. The diagnostic odds ratio (DOR) of IHC-determined p53 overexpression in predicting p53 mutations ranged from 0.56 to 105.00 (pooled, 9.77; 95% CI: 6.35–15.02), with significant heterogeneity between the included studies (I2 = 40.7%, P = 0.0067). Moreover, subgroup and sensitivity analyses did not alter the results of the meta-analysis. However, potential publication bias was present in the current meta-analysis. Conclusion The upregulation of the tumor suppressor protein p53 was indeed linked to p53 gene mutations. IHC determination of p53 overexpression can predict p53 gene mutations in HCC patients. PMID:27428001

  5. Cell fate decision mediated by p53 pulses

    PubMed Central

    Zhang, Xiao-Peng; Liu, Feng; Cheng, Zhang; Wang, Wei

    2009-01-01

    The tumor suppressor p53 plays a crucial role in cellular response to various stresses. Recent experiments have shown that p53 level exhibits a series of pulses after DNA damage caused by ionizing radiation (IR). However, how the p53 pulses govern cell survival and death remains unclear. Here, we develop an integrated model with four modules for the p53 network and explore the mechanism for cell fate decision based on the dynamics of the network. By numerical simulations, the following processes are characterized. First, DNA repair proteins bind to IR-induced double-strand breaks, forming complexes, which are then detected by ataxia telangiectasia mutated (ATM). Activated ATM initiates the p53 oscillator to produce pulses. Consequently, the target genes of p53 are selectively induced to control cell fate. We propose that p53 promotes the repair of minor DNA damage but suppresses the repair of severe damage. We demonstrate that cell fate is determined by the number of p53 pulses relying on the extent of DNA damage. At low damage levels, few p53 pulses evoke cell cycle arrest by inducing p21 and promote cell survival, whereas at high damage levels, sustained p53 pulses trigger apoptosis by inducing p53AIP1. We find that p53 can effectively maintain genomic integrity by regulating the efficiency and fidelity of DNA repair. We also show that stochasticity in the generation and repair of DNA damage leads to variability in cell fate. These findings are consistent with experimental observations and advance our understanding of the dynamics and functions of the p53 network. PMID:19617533

  6. Mutant p53 interactome identifies nardilysin as a p53R273H-specific binding partner that promotes invasion.

    PubMed

    Coffill, Cynthia R; Muller, Patricia A J; Oh, Hue Kian; Neo, Suat Peng; Hogue, Kelly A; Cheok, Chit Fang; Vousden, Karen H; Lane, David P; Blackstock, Walter P; Gunaratne, Jayantha

    2012-07-01

    The invasiveness of tumour cells depends on changes in cell shape, polarity and migration. Mutant p53 induces enhanced tumour metastasis in mice, and human cells overexpressing p53R273H have aberrant polarity and increased invasiveness, demonstrating the 'gain of function' of mutant p53 in carcinogenesis. We hypothesize that p53R273H interacts with mutant p53-specific binding partners that control polarity, migration or invasion. Here we analyze the p53R273H interactome using stable isotope labelling by amino acids in cell culture and quantitative mass spectrometry, and identify at least 15 new potential mutant p53-specific binding partners. The interaction of p53R273H with one of them--nardilysin (NRD1)--promotes an invasive response to heparin binding-epidermal growth factor-like growth factor that is p53R273H-dependant but does not require Rab coupling protein or p63. Advanced proteomics has thus allowed the detection of a new mechanism of p53-driven invasion.

  7. Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA.

    PubMed Central

    Balagurumoorthy, P; Sakamoto, H; Lewis, M S; Zambrano, N; Clore, G M; Gronenborn, A M; Appella, E; Harrington, R E

    1995-01-01

    Recent structural studies of the minimal core DNA-binding domain of p53 (p53DBD) complexed to a single consensus pentamer sequence and of the isolated p53 tetramerization domain have provided valuable insights into their functions, but many questions about their interacting roles and synergism remain unanswered. To better understand these relationships, we have examined the binding of the p53DBD to two biologically important full-response elements (the WAF1 and ribosomal gene cluster sites) by using DNA circularization and analytical ultracentrifugation. We show that the p53DBD binds DNA strongly and cooperatively with p53DBD to DNA binding stoichiometries of 4:1. For the WAF1 element, the mean apparent Kd is (8.3 +/- 1.4) x 10(-8) M, and no intermediate species of lower stoichiometries can be detected. We show further that complex formation induces an axial bend of at least 60 degrees in both response elements. These results, taken collectively, demonstrate that p53DBD possesses the ability to direct the formation of a tight nucleoprotein complex having the same 4:1 DNA-binding stoichiometry as wild-type p53 which is accompanied by a substantial conformational change in the response-element DNA. This suggests that the p53DBD may play a role in the tetramerization function of p53. A possible role in this regard is proposed. Images Fig. 2 Fig. 4 PMID:7567980

  8. [Denaturalized psychoanalysts].

    PubMed

    Peglau, Andreas

    2011-01-01

    This paper presents hitherto unknown material from the German Foreign Office referring to the denaturalization of Therese Benedek, Bruno Bettelheim, Adolf Storfer and Wilhelm Reich by Nazi Germany. It corroborates the finding that nobody was persecuted by the Nazis solely on the basis of psychoanalytic activities or membership in a psychoanalytic organization.

  9. ZBP-89 Promotes Growth Arrest through Stabilization of p53

    PubMed Central

    Bai, Longchuan; Merchant, Juanita L.

    2001-01-01

    Transcription factor p53 can induce growth arrest and/or apoptosis in cells through activation or repression of downstream target genes. Recently, we reported that ZBP-89 cooperates with histone acetyltransferase coactivator p300 in the regulation of p21waf1, a cyclin-dependent kinase inhibitor whose associated gene is a target gene of p53. Therefore, we examined whether ZBP-89 might also inhibit cell growth by activating p53. In the present study, we demonstrate that elevated levels of ZBP-89 induce growth arrest and apoptosis in human gastrointestinal cell lines. The ZBP-89 protein accumulated within 4 h, and the p53 protein accumulated within 16 h, of serum starvation without changes in p14ARF levels, demonstrating a physiological increase in the cellular levels of these two proteins. Overexpression of ZBP-89 stabilized the p53 protein and enhanced its transcriptional activity through direct protein-protein interactions. The DNA binding and C-terminal domains of p53 and the zinc finger domain of ZBP-89 mediated the interaction. A point mutation in the p53 DNA binding domain, R273H, greatly reduced ZBP-89-mediated stabilization but not their physical interaction. Furthermore, ZBP-89 formed a complex with p53 and MDM2 and therefore did not prevent the MDM2-p53 interaction. However, heterokaryon assays demonstrated that ZBP-89 retained p53 in the nucleus. Collectively, these data indicate that ZBP-89 regulates cell proliferation in part through its ability to directly bind the p53 protein and retard its nuclear export. Our findings further our understanding of how ZBP-89 modulates cell proliferation and reveals a novel mechanism by which the p53 protein is stabilized. PMID:11416144

  10. p53 isoforms regulate astrocyte-mediated neuroprotection and neurodegeneration.

    PubMed

    Turnquist, C; Horikawa, I; Foran, E; Major, E O; Vojtesek, B; Lane, D P; Lu, X; Harris, B T; Harris, C C

    2016-09-01

    Bidirectional interactions between astrocytes and neurons have physiological roles in the central nervous system and an altered state or dysfunction of such interactions may be associated with neurodegenerative diseases, such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS). Astrocytes exert structural, metabolic and functional effects on neurons, which can be either neurotoxic or neuroprotective. Their neurotoxic effect is mediated via the senescence-associated secretory phenotype (SASP) involving pro-inflammatory cytokines (e.g., IL-6), while their neuroprotective effect is attributed to neurotrophic growth factors (e.g., NGF). We here demonstrate that the p53 isoforms Δ133p53 and p53β are expressed in astrocytes and regulate their toxic and protective effects on neurons. Primary human astrocytes undergoing cellular senescence upon serial passaging in vitro showed diminished expression of Δ133p53 and increased p53β, which were attributed to the autophagic degradation and the SRSF3-mediated alternative RNA splicing, respectively. Early-passage astrocytes with Δ133p53 knockdown or p53β overexpression were induced to show SASP and to exert neurotoxicity in co-culture with neurons. Restored expression of Δ133p53 in near-senescent, otherwise neurotoxic astrocytes conferred them with neuroprotective activity through repression of SASP and induction of neurotrophic growth factors. Brain tissues from AD and ALS patients possessed increased numbers of senescent astrocytes and, like senescent astrocytes in vitro, showed decreased Δ133p53 and increased p53β expression, supporting that our in vitro findings recapitulate in vivo pathology of these neurodegenerative diseases. Our finding that Δ133p53 enhances the neuroprotective function of aged and senescent astrocytes suggests that the p53 isoforms and their regulatory mechanisms are potential targets for therapeutic intervention in neurodegenerative diseases. PMID:27104929

  11. Stochastic modelling of tumorigenesis in p53 deficient mice.

    PubMed Central

    Mao, J. H.; Lindsay, K. A.; Balmain, A.; Wheldon, T. E.

    1998-01-01

    Stochastic models of tumorigenesis have been developed to investigate the implications of experimental data on tumour induction in wild-type and p53-deficient mice for tumorigenesis mechanisms. Conventional multistage models in which inactivation of each p53 allele represents a distinct stage predict excessively large numbers of tumours in p53-deficient genotypes, allowing this category of model to be rejected. Multistage multipath models, in which a p53-mediated pathway co-exists with one or more p53-independent pathways, are consistent with the data, although these models require unknown pathways and do not enable age-specific curves of tumour appearance to be computed. An alternative model that fits the data is the 'multigate' model in which tumorigenesis results from a small number of gate-pass (enabling) events independently of p53 status. The role of p53 inactivation is as a rate modifier that accelerates the gate-pass events. This model implies that wild-type p53 acts as a 'caretaker' to maintain genetic uniformity in cell populations, and that p53 inactivation increases the probability of occurrence of a viable cellular mutant by a factor of about ten. The multigate model predicts a relationship between the time pattern of tumour occurrence and tumour genotype that should be experimentally testable. Stochastic modelling may help to distinguish 'gatekeeper' and 'caretaker' genes in other tumorigenic pathays. PMID:9460995

  12. Regulation of p53 and MDM2 Activity by MTBP

    PubMed Central

    Brady, Mark; Vlatković, Nikolina; Boyd, Mark T.

    2005-01-01

    p53 is a critical coordinator of a wide range of stress responses. To facilitate a rapid response to stress, p53 is produced constitutively but is negatively regulated by MDM2. MDM2 can inhibit p53 in multiple independent ways: by binding to its transcription activation domain, inhibiting p53 acetylation, promoting nuclear export, and probably most importantly by promoting proteasomal degradation of p53. The latter is achieved via MDM2's E3 ubiquitin ligase activity harbored within the MDM2 RING finger domain. We have discovered that MTBP promotes MDM2-mediated ubiquitination and degradation of p53 and also MDM2 stabilization in an MDM2 RING finger-dependent manner. Moreover, using small interfering RNA to down-regulate endogenous MTBP in unstressed cells, we have found that MTBP significantly contributes to MDM2-mediated regulation of p53 levels and activity. However, following exposure of cells to UV, but not γ-irradiation, MTBP is destabilized as part of the coordinated cellular response. Our findings suggest that MTBP differentially regulates the E3 ubiquitin ligase activity of MDM2 towards two of its most critical targets (itself and p53) and in doing so significantly contributes to MDM2-dependent p53 homeostasis in unstressed cells. PMID:15632057

  13. Immunoexpression of p53 in cutaneous and subcutaneous leiomyosarcomas.

    PubMed

    Fernandez-Flores, Angel; Monteagudo, Carlos

    2016-10-01

    The diagnosis of malignancy in cutaneous and subcutaneous smooth muscle tumors is based on subtle criteria. Therefore, any ancillary technique useful in this differential diagnosis is always welcome. In this report, we study the immunoexpression of p53 in 19 malignant smooth muscle tumors of the skin (15 cutaneous leiomyosarcomas, 2 subcutaneous leiomyosarcomas, and 2 cutaneous metastases of leiomyosarcoma), as well as in 1 leiomyoma with cellular atypia, therefore complementing a previous study on p53 immunoexpression in leiomyomas of the skin. The p53 staining was positive in 12 (63.16%) of 19 leiomyosarcomas. Percentages of immunostaining in the positive cases varied from 2% to 95%. Ten (66.66%) of 15 cutaneous leiomyosarcomas were positive for p53, and in 4 of these cases, immunoexpression was demonstrated by more than 50% of the cells. Five (33.33%) cutaneous leiomyosarcomas did not show any expression of p53. Of the 2 subcutaneous leiomyosarcomas, one was negative for p53 and the other expressed the marker in 70% of the cells. The only atypical leiomyoma included in the study did not express p53. Of the 2 cutaneous metastases of leiomyosarcoma, one was negative and the other expressed p53 in 20% of the cells. The current study supports our previous conclusions that p53 immunoexpression in more than 1% of the cells in a cutaneous smooth muscle tumor is indicative of malignancy. However, we believe that additional studies on atypical leiomyoma are needed.

  14. GATA-1 associates with and inhibits p53

    PubMed Central

    Mas, Caroline; Archambault, Patrick; Di Lello, Paola

    2009-01-01

    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1–responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  15. GATA-1 associates with and inhibits p53.

    PubMed

    Trainor, Cecelia D; Mas, Caroline; Archambault, Patrick; Di Lello, Paola; Omichinski, James G

    2009-07-01

    In addition to orchestrating the expression of all erythroid-specific genes, GATA-1 controls the growth, differentiation, and survival of the erythroid lineage through the regulation of genes that manipulate the cell cycle and apoptosis. The stages of mammalian erythropoiesis include global gene inactivation, nuclear condensation, and enucleation to yield circulating erythrocytes, and some of the genes whose expression are altered by GATA-1 during this process are members of the p53 pathway. In this study, we demonstrate a specific in vitro interaction between the transactivation domain of p53 (p53TAD) and a segment of the GATA-1 DNA-binding domain that includes the carboxyl-terminal zinc-finger domain. We also show by immunoprecipitation that the native GATA-1 and p53 interact in erythroid cells and that activation of p53-responsive promoters in an erythroid cell line can be inhibited by the overexpression of GATA-1. Mutational analysis reveals that GATA-1 inhibition of p53 minimally requires the segment of the GATA-1 DNA-binding domain that interacts with p53TAD. This inhibition is reciprocal, as the activation of a GATA-1-responsive promoter can be inhibited by p53. Based on these findings, we conclude that inhibition of the p53 pathway by GATA-1 may be essential for erythroid cell development and survival. PMID:19411634

  16. Immunoexpression of p53 in cutaneous and subcutaneous leiomyosarcomas.

    PubMed

    Fernandez-Flores, Angel; Monteagudo, Carlos

    2016-10-01

    The diagnosis of malignancy in cutaneous and subcutaneous smooth muscle tumors is based on subtle criteria. Therefore, any ancillary technique useful in this differential diagnosis is always welcome. In this report, we study the immunoexpression of p53 in 19 malignant smooth muscle tumors of the skin (15 cutaneous leiomyosarcomas, 2 subcutaneous leiomyosarcomas, and 2 cutaneous metastases of leiomyosarcoma), as well as in 1 leiomyoma with cellular atypia, therefore complementing a previous study on p53 immunoexpression in leiomyomas of the skin. The p53 staining was positive in 12 (63.16%) of 19 leiomyosarcomas. Percentages of immunostaining in the positive cases varied from 2% to 95%. Ten (66.66%) of 15 cutaneous leiomyosarcomas were positive for p53, and in 4 of these cases, immunoexpression was demonstrated by more than 50% of the cells. Five (33.33%) cutaneous leiomyosarcomas did not show any expression of p53. Of the 2 subcutaneous leiomyosarcomas, one was negative for p53 and the other expressed the marker in 70% of the cells. The only atypical leiomyoma included in the study did not express p53. Of the 2 cutaneous metastases of leiomyosarcoma, one was negative and the other expressed p53 in 20% of the cells. The current study supports our previous conclusions that p53 immunoexpression in more than 1% of the cells in a cutaneous smooth muscle tumor is indicative of malignancy. However, we believe that additional studies on atypical leiomyoma are needed. PMID:27649950

  17. Versatile Functions of p53 Protein in Multicellular Organisms

    PubMed Central

    Chumakov, P. M.

    2009-01-01

    The p53 tumor suppressor plays a pivotal role by controlling virtually all processes in the cell. The functions of p53 determine modes of behavior of cells in multicellular organisms and ensure priorities of interests of the organism as a whole above the interests of an individual cell. Multiple signaling pathways of the cell report signals modifying the activities of p53 through numerous connections, ensuring highly selective and gradual regulation of functions that depend on the ongoing events in the cell. The task of p53 is to control the integrity and correctness of all processes in each individual cell and in the organism as a whole. The changes in the activity of p53 depend on the degree of errors or faults, and the effect is directed either toward correction of an imbalance or damage, or, in case of severe damages, leads to the prevention of multiplication of abnormal cells or their death. The strategy of p53 ensures genetic identity of cells and prevents the selection of cells having growth or other advantages. By accomplishing these strategic tasks, p53 may use a wide spectrum of activities. The majority of the activities are due to the ability of p53 to function as a transcription factor, by inducing or repressing different genes. However, p53 can also function as an enzyme, acting as an exonuclease during DNA reparation, or as an adaptor or a regulatory protein, intervening into functions of numerous signaling pathways. It can also act as direct inducer of apoptosis by translocation into mitochondria. Loss of function of the p53 gene occurs in virtually every case of cancer, and deficiency in p53 is an unavoidable prerequisite to the development of malignancies. The functions of p53 play substantial roles in many other pathologies as well as in the aging process. This review is focused on strategies of the p53 gene, demonstrating individual mechanisms underlying its functions. The p53 tumor suppressor plays a pivotal role in multicellular organism by

  18. Thermal protein denaturation and protein aggregation in cells made thermotolerant by various chemicals: role of heat shock proteins.

    PubMed

    Kampinga, H H; Brunsting, J F; Stege, G J; Burgman, P W; Konings, A W

    1995-08-01

    Thermotolerance (TT) induced by sodium arsenite (A-TT: 100 microM, 1 h, 37 degrees C) was compared to heat-induced thermotolerance (H-TT: 15 min, 44 degrees C) using HeLa S3 cells. All four pretreatments led to comparable levels of thermotolerance and also induced resistance to arsenite-, ethanol-, and diamide-induced toxicity (clonogenic ability). Stress-induced expression of the major heat shock proteins (hsp27, hsc70(p73), hsp70(p72), and hsp90) was generally highest in H-TT cells and lowest in A-TT cells. Interestingly, the four types of TT cells showed distinct differences in certain aspects of resistance against thermal protein damage. Thermal protein denaturation and aggregation determined in isolated cellular membrane fractions was found to be attenuated when they were isolated from H-TT and A-TT cells but not when isolated from E-TT and D-TT cells. The heat resistance in the proteins of the membrane fraction corresponded with elevated levels of hsp70(p72) associated with the isolated membrane fractions. In the nuclear fraction, only marginal (not significant) attenuation of the formation of protein aggregates (as determined by TX-100 (in)solubility) was observed. However, the postheat recovery from heat-induced protein aggregation in the nucleus was faster in H-TT, E-TT, and D-TT cells, but not in A-TT cells. Despite the fact that elevated levels of hsp27, hsp70(p73), and hsp70(p72) were found in the TX-100 insoluble nuclear fraction derived from all TT cells, no correlation was found with the degree of resistance in terms of the accelerated recovery from nuclear protein aggregation. The only correlation between accelerated recovery from nuclear protein aggregates was that with total cellular levels of hsp27. The data indicate that heat-induced loss of clonogenic ability may be a multitarget rather than a single target event. A threshold of damage may exist in cells after exposure to heat; multiple sets of proteins in (different compartments of) the cell

  19. Modifying the Cold Gelation Properties of Quinoa Protein Isolate: Influence of Heat-Denaturation pH in the Alkaline Range.

    PubMed

    Mäkinen, Outi E; Zannini, Emanuele; Arendt, Elke K

    2015-09-01

    Heat-denaturation of quinoa protein isolate (QPI) at alkali pH and its influence on the physicochemical and cold gelation properties was investigated. Heating QPI at pH 8.5 led to increased surface hydrophobicity and decreases in free and bound sulfhydryl group contents. Heating at pH 10.5 caused a lesser degree of changes in sulfhydryl groups and surface hydrophobicity, and the resulting solutions showed drastically increased solubility. SDS PAGE revealed the presence of large aggregates only in the sample heated at pH 8.5, suggesting that any aggregates present in the sample heated at pH 10.5 were non-covalently bound and disintegrated in the presence of SDS. Reducing conditions partially dissolved the aggregates in the pH 8.5 heated sample indicating the occurrence of disulphide bonding, but caused no major alterations in the separation pattern of the pH 10.5 heated sample. Denaturation pH influenced the cold gelation properties greatly. Solutions heated at pH 8.5 formed a coarse coagulum with maximum G' of 5 Pa. Heat-denaturation at 10.5 enabled the proteins to form a finer and regularly structured gel with a maximum G' of 1140 Pa. Particle size analysis showed that the pH 10.5 heated sample contained a higher level of very small particles (0.1-2 μm), and these readily aggregated into large particles (30-200 μm) when pH was lowered to 5.5. Differences in the nature of aggregates formed during heating may explain the large variation in gelation properties.

  20. Modifying the Cold Gelation Properties of Quinoa Protein Isolate: Influence of Heat-Denaturation pH in the Alkaline Range.

    PubMed

    Mäkinen, Outi E; Zannini, Emanuele; Arendt, Elke K

    2015-09-01

    Heat-denaturation of quinoa protein isolate (QPI) at alkali pH and its influence on the physicochemical and cold gelation properties was investigated. Heating QPI at pH 8.5 led to increased surface hydrophobicity and decreases in free and bound sulfhydryl group contents. Heating at pH 10.5 caused a lesser degree of changes in sulfhydryl groups and surface hydrophobicity, and the resulting solutions showed drastically increased solubility. SDS PAGE revealed the presence of large aggregates only in the sample heated at pH 8.5, suggesting that any aggregates present in the sample heated at pH 10.5 were non-covalently bound and disintegrated in the presence of SDS. Reducing conditions partially dissolved the aggregates in the pH 8.5 heated sample indicating the occurrence of disulphide bonding, but caused no major alterations in the separation pattern of the pH 10.5 heated sample. Denaturation pH influenced the cold gelation properties greatly. Solutions heated at pH 8.5 formed a coarse coagulum with maximum G' of 5 Pa. Heat-denaturation at 10.5 enabled the proteins to form a finer and regularly structured gel with a maximum G' of 1140 Pa. Particle size analysis showed that the pH 10.5 heated sample contained a higher level of very small particles (0.1-2 μm), and these readily aggregated into large particles (30-200 μm) when pH was lowered to 5.5. Differences in the nature of aggregates formed during heating may explain the large variation in gelation properties. PMID:25986749

  1. Effects of p53 knockout on ochratoxin A-induced genotoxicity in p53-deficient gpt delta mice.

    PubMed

    Hibi, Daisuke; Kijima, Aki; Suzuki, Yuta; Ishii, Yuji; Jin, Meilan; Sugita-Konishi, Yoshiko; Yanai, Tokuma; Nishikawa, Akiyoshi; Umemura, Takashi

    2013-02-01

    Ochratoxin A (OTA) is a mycotoxin produced by fungal species and is carcinogenic targeting the S3 segment of the renal proximal tubules in rodents. We previously reported that exposure of gpt delta rats to OTA induced both mutations in the red/gam gene (Spi(-)), suggesting large deletion mutations, and fluctuations in genes transcribed by p53 in the kidneys, which were associated with DNA double-strand break (DSB) repair, particularly homologous recombination (HR) repair. In the present study, to investigate the effects of p53 knockout on OTA-induced mutagenicity, apoptosis, and karyomegaly in renal tubular cells, p53-proficient and p53-deficient gpt delta mice were given 1 and 5mg/kg of OTA for 4 weeks. Significant increases in Spi(-) mutant frequencies (MFs) were observed in the kidneys of p53-deficient gpt delta mice given 5 mg/kg of OTA, but not in the kidneys of p53-proficient gpt delta mice given the same dose. There were no changes in gpt MFs in both genotypes of mice treated with OTA. Western blotting analysis demonstrated that p53 protein levels in the kidneys of p53-proficient mice given OTA were significantly increased compared with the control. Incidences of apoptosis and karyomegaly in not only the outer stripe of outer medulla but also the cortex were significantly higher in p53-deficient at 5mg/kg than in p53-proficient gpt delta mice at same dose, which had no change in the cortex, the inner stripe of outer stripe, and the inner medulla. Given that p53 regulates HR repair in DSBs, these results suggest that OTA may promote large deletion mutations in the process of HR repair for DSBs. Additionally, the lower incidence of karyomegaly and apoptosis found in the p53-proficient gpt delta mice suggests that these phenomena may arise from OTA-induced DNA damage.

  2. The p53 gene and protein in human brain tumors

    SciTech Connect

    Louis, D.N. )

    1994-01-01

    Because p53 gene alterations are commonplace in human tumors and because p53 protein is involved in a number of important cellular pathways, p53 has become a topic of intensive investigation, both by basic scientists and clinicians. p53 was initially identified by two independent laboratories in 1979 as a 53 kilodalton (kD) protein that complexes with the large T antigen of SV40 virus. Shortly thereafter, it was shown that the E1B oncoprotein of adenovirus also binds p53. The binding of two different oncogenic viral tumor proteins to the same cellular protein suggested that p53 might be integral to tumorigenesis. The human p53 cDNA and gene were subsequently cloned in the mid-1980s, and analysis of p53 gene alterations in human tumors followed a few year later. During these 10 years, researchers grappling with the vagaries of p53 first characterized the gene as an oncogene, then as a tumor suppressor gene, and most recently as both a tumor suppressor gene and a so-called [open quotes]dominant negative[close quotes] oncogene. The last few years have seen an explosion in work on this single gene and its protein product. A review of a computerized medical database revealed approximately 650 articles on p53 in 1992 alone. p53 has assumed importance in neuro-oncology because p53 mutations and protein alterations are frequent in the common diffuse, fibrillary astrocytic tumors of adults. p53 mutations in astrocytomas were first described in 1989 and were followed by more extensive analyses of gene mutations and protein alterations in adult astrocytomas. The gene has also been studied in less common brain tumors. Elucidating the role of p53 in brain tumorigenesis will not only enhance understanding of brain tumor biology but may also contribute to improved diagnosis and therapy. This discussion reviews key aspects of the p53 gene and protein, and describe their emerging roles in central nervous system neoplasia. 102 refs., 6 figs., 1 tab.

  3. Influence of Human p53 on Plant Development.

    PubMed

    Ma, Huimin; Song, Teng; Wang, Tianhua; Wang, Shui

    2016-01-01

    Mammalian p53 is a super tumor suppressor and plays a key role in guarding genome from DNA damage. However, p53 has not been found in plants which do not bear cancer although they constantly expose to ionizing radiation of ultraviolet light. Here we introduced p53 into the model plant Arabidopsis and examined p53-conferred phenotype in plant. Most strikingly, p53 caused early senescence and fasciation. In plants, fasciation has been shown as a result of the elevated homologous DNA recombination. Consistently, a reporter with overlapping segments of the GUS gene (1445) showed that the frequency of homologous recombination was highly induced in p53-transgenic plants. In contrast to p53, SUPPRESSOR OF NPR1-1 INDUCIBLE 1 (SNI1), as a negative regulator of homologous recombination in plants, is not present in mammals. Comet assay and clonogenic survival assay demonstrated that SNI1 inhibited DNA damage repair caused by either ionizing radiation or hydroxyurea in human osteosarcoma U2OS cancer cells. RAD51D is a recombinase in homologous recombination and functions downstream of SNI1 in plants. Interestingly, p53 rendered the sni1 mutants madly branching of inflorescence, a phenotype of fasciation, whereas rad51d mutant fully suppressed the p53-induced phenotype, indicating that human p53 action in plant is mediated by the SNI1-RAD51D signaling pathway. The reciprocal species-swap tests of p53 and SNI1 in human and Arabidopsis manifest that these species-specific proteins play a common role in homologous recombination across kingdoms of animals and plants. PMID:27648563

  4. IGFBP-3 mediates p53-induced apoptosis during serum starvation.

    PubMed

    Grimberg, Adda; Liu, Bingrong; Bannerman, Peter; El-Deiry, Wafik S; Cohen, Pinchas

    2002-08-01

    Insulin-like growth factor binding protein (IGFBP)-3, a p53-response gene, can induce apoptosis in an IGF-independent manner. Here we demonstrate that IGFBP-3 mediates p53-induced apoptosis during serum starvation using two foil neoplastic cell models: one which introduces p53 activity and one which eliminates it. We created a doxycycline-inducible p53 model from the p53-negative PC-3 prostate cancer cell line. Doxycycline treatment increased both p53 and IGFBP-3 levels. It also augmented apoptosis, but not during insulin-like growth factor-I co-treatment. In a second model, lung carcinoma H460 cells expressing fully functional p53 were stably transfected with E6, which targets p53 for degradation. H460-E6 cells contained less p53 and IGFBP-3 than control neo-transfected cells, and proteasome blockade restored both. In serum deprivation, H460-E6 cells had enhanced growth and less apoptosis than did H460-neo cells. Reductions in H460-neo apoptosis, comparable in magnitude to H460-E6, were achieved by adding anti-IGFBP-3-antibody or IGFBP-3 antisense oligomers, but not non-specific immunoglobulin or IGFBP-3 sense oligomers. In summary, turning p53 in two foil neoplastic cell models induced IGFBP-3 expression and increased apoptosis during serum starvation, an effect inhibited by insulin-like growth factor-I treatment and specific IGFBP-3 blockade. This is the first demonstration of inhibition of p53 action by antagonizing IGFBP-3.

  5. Influence of Human p53 on Plant Development

    PubMed Central

    2016-01-01

    Mammalian p53 is a super tumor suppressor and plays a key role in guarding genome from DNA damage. However, p53 has not been found in plants which do not bear cancer although they constantly expose to ionizing radiation of ultraviolet light. Here we introduced p53 into the model plant Arabidopsis and examined p53-conferred phenotype in plant. Most strikingly, p53 caused early senescence and fasciation. In plants, fasciation has been shown as a result of the elevated homologous DNA recombination. Consistently, a reporter with overlapping segments of the GUS gene (1445) showed that the frequency of homologous recombination was highly induced in p53-transgenic plants. In contrast to p53, SUPPRESSOR OF NPR1-1 INDUCIBLE 1 (SNI1), as a negative regulator of homologous recombination in plants, is not present in mammals. Comet assay and clonogenic survival assay demonstrated that SNI1 inhibited DNA damage repair caused by either ionizing radiation or hydroxyurea in human osteosarcoma U2OS cancer cells. RAD51D is a recombinase in homologous recombination and functions downstream of SNI1 in plants. Interestingly, p53 rendered the sni1 mutants madly branching of inflorescence, a phenotype of fasciation, whereas rad51d mutant fully suppressed the p53-induced phenotype, indicating that human p53 action in plant is mediated by the SNI1-RAD51D signaling pathway. The reciprocal species-swap tests of p53 and SNI1 in human and Arabidopsis manifest that these species-specific proteins play a common role in homologous recombination across kingdoms of animals and plants. PMID:27648563

  6. Endocytosis of heat-denatured albumin by cultured rat Kupffer cells

    SciTech Connect

    Brouwer, A.; Knook, D.L.

    1982-10-01

    Purified Kupffer cells were obtained by centrifugal elutriation of sinusoidal cells isolated by pronase treatment of the rat liver. The endocytosis of radioactively labeled heat-aggregated colloidal albumin (CA /sup 125/I) was investigated in maintenance cultures of the purified Kupffer cells. The endocytic capacity of the cells was studied during 4 days of culture. Maximum uptake was observed after 24 hr of culture, with a gradual decline during the following days. When the uptake was measured after incubation with increasing concentrations of CA /sup 125/I, a saturation effect was observed. This finding and the observed high rate of uptake are strong indications that receptor sites on the cell membrane are involved in the mechanism of endocytosis. The uptake of CA /sup 125/I by Kupffer cells was inhibited by the metabolic inhibitors fluoride and antimycin A, indicating that endocytosis of CA /sup 125/I is dependent on energy derived from both glycolysis and mitochondrial respiration. The mechanism of internalization may also require the action of microfilaments as well as intact microtubules, since both cytochalasin B and colchicine inhibited the uptake of CA /sup 125/I. The intracellular degradation of CA /sup 125/I by Kupffer cells was strongly inhibited by chloroquine but not by colchicine. The degradation of ingested CA /sup 125/I occurred within the Kupffer cell lysosomes.

  7. Physical Interaction between Bacterial Heat Shock Protein (Hsp) 90 and Hsp70 Chaperones Mediates Their Cooperative Action to Refold Denatured Proteins*

    PubMed Central

    Nakamoto, Hitoshi; Fujita, Kensaku; Ohtaki, Aguru; Watanabe, Satoru; Narumi, Shoichi; Maruyama, Takahiro; Suenaga, Emi; Misono, Tomoko S.; Kumar, Penmetcha K. R.; Goloubinoff, Pierre; Yoshikawa, Hirofumi

    2014-01-01

    In eukaryotes, heat shock protein 90 (Hsp90) is an essential ATP-dependent molecular chaperone that associates with numerous client proteins. HtpG, a prokaryotic homolog of Hsp90, is essential for thermotolerance in cyanobacteria, and in vitro it suppresses the aggregation of denatured proteins efficiently. Understanding how the non-native client proteins bound to HtpG refold is of central importance to comprehend the essential role of HtpG under stress. Here, we demonstrate by yeast two-hybrid method, immunoprecipitation assays, and surface plasmon resonance techniques that HtpG physically interacts with DnaJ2 and DnaK2. DnaJ2, which belongs to the type II J-protein family, bound DnaK2 or HtpG with submicromolar affinity, and HtpG bound DnaK2 with micromolar affinity. Not only DnaJ2 but also HtpG enhanced the ATP hydrolysis by DnaK2. Although assisted by the DnaK2 chaperone system, HtpG enhanced native refolding of urea-denatured lactate dehydrogenase and heat-denatured glucose-6-phosphate dehydrogenase. HtpG did not substitute for DnaJ2 or GrpE in the DnaK2-assisted refolding of the denatured substrates. The heat-denatured malate dehydrogenase that did not refold by the assistance of the DnaK2 chaperone system alone was trapped by HtpG first and then transferred to DnaK2 where it refolded. Dissociation of substrates from HtpG was either ATP-dependent or -independent depending on the substrate, indicating the presence of two mechanisms of cooperative action between the HtpG and the DnaK2 chaperone system. PMID:24415765

  8. Long Noncoding RNA MEG3 Interacts with p53 Protein and Regulates Partial p53 Target Genes in Hepatoma Cells.

    PubMed

    Zhu, Juanjuan; Liu, Shanshan; Ye, Fuqiang; Shen, Yuan; Tie, Yi; Zhu, Jie; Wei, Lixin; Jin, Yinghua; Fu, Hanjiang; Wu, Yongge; Zheng, Xiaofei

    2015-01-01

    Maternally Expressed Gene 3 (MEG3) encodes a lncRNA which is suggested to function as a tumor suppressor. Previous studies suggested that MEG3 functioned through activation of p53, however, the functional properties of MEG3 remain obscure and their relevance to human diseases is under continuous investigation. Here, we try to illuminate the relationship of MEG3 and p53, and the consequence in hepatoma cells. We find that transfection of expression construct of MEG3 enhances stability and transcriptional activity of p53. Deletion analysis of MEG3 confirms that full length and intact structure of MEG3 are critical for it to activate p53-mediated transactivation. Interestingly, our results demonstrate for the first time that MEG3 can interact with p53 DNA binding domain and various p53 target genes are deregulated after overexpression of MEG3 in hepatoma cells. Furthermore, results of qRT-PCR have shown that MEG3 RNA is lost or reduced in the majority of HCC samples compared with adjacent non-tumorous samples. Ectopic expression of MEG3 in hepatoma cells significantly inhibits proliferation and induces apoptosis. In conclusion, our data demonstrates that MEG3 functions as a tumor suppressor in hepatoma cells through interacting with p53 protein to activate p53-mediated transcriptional activity and influence the expression of partial p53 target genes.

  9. Reappraisal of p53 mutations in human malignant astrocytic neoplasms by p53 functional assay: comparison with conventional structural analyses.

    PubMed

    Tada, M; Iggo, R D; Waridel, F; Nozaki, M; Matsumoto, R; Sawamura, Y; Shinohe, Y; Ikeda, J; Abe, H

    1997-03-01

    We previously reported clonal expansion of p53 mutations in malignant astrocytic tumors detected with a yeast p53 functional assay that measures mutant p53 alleles quantitatively and loss of p53 transcriptional competence qualitatively (Tada et al., Int J Cancer 67:447-450, 1996). This method selectively detects inactivating mutations and is relatively insensitive to contamination of tumor samples with normal tissue. To determine whether the mutation frequency and spectrum detected in this way differ from those seen with conventional techniques, 54 malignant astrocytomas were tested with the yeast assay, and the abnormalities detected were characterized by DNA sequencing. Inactivating p53 mutations were found in 67% of anaplastic astrocytomas and 41% of glioblastomas. Overall, mutations were found in 48% of tumors, compared with only 29% in previous studies (P < 0.005), a difference that probably reflects the greater sensitivity of the yeast assay than of conventional techniques. The frequency of mutations in anaplastic astrocytomas (in our study plus published studies) was significantly higher than in glioblastomas (39% vs 29%; P < 0.05). This suggests that acquisition of p53 mutations is not rate limiting for progression to glioblastoma and that many glioblastomas develop by p53-independent pathways. Sequencing of mutant p53 cDNAs rescued from yeast showed that the mutation spectrum for functionally inactive mutants was nearly identical to the spectra from previous studies on structural mutants, indicating that transcriptional activity is the critical biological target of p53 mutation in malignant astrocytomas.

  10. Mitochondrially targeted p53 has tumor suppressor activities in vivo.

    PubMed

    Talos, Flaminia; Petrenko, Oleksi; Mena, Patricio; Moll, Ute M

    2005-11-01

    Complex proapoptotic functions are essential for the tumor suppressor activity of p53. We recently described a novel transcription-independent mechanism that involves a rapid proapoptotic action of p53 at the mitochondria and executes the shortest known circuitry of p53 death signaling. Here, we examine if this p53-dependent mitochondrial program could be exploited for tumor suppression in vivo. To test this, we engage Emu-Myc transgenic mice, a well-established model of p53-dependent lymphomagenesis. We show that exclusive delivery of p53 to the outer mitochondrial membrane confers a significant growth disadvantage on Emu-Myc-transformed B-cells of p53-deficient or alternate reading frame-deficient genotypes, resulting in efficient induction of apoptosis and impinged proliferation. Conversely, normal cells from thymus, spleen, and bone marrow showed poor infectivity with these viruses. This proof-of-principle experiment shows that exclusive reliance on the direct mitochondrial program exerts a significant tumor suppressor activity in vivo. Our in vivo data on the direct mitochondrial apoptotic p53 program lays the groundwork to further investigate its efficacy and safety and to address its possible therapeutic value in the future.

  11. Expression of P53 protein after exposure to ionizing radiation

    NASA Astrophysics Data System (ADS)

    Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

    2001-10-01

    One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

  12. p53 and mitochondrial dysfunction: novel insight of neurodegenerative diseases.

    PubMed

    Dai, Chun-Qiu; Luo, Ting-Ting; Luo, Shi-Cheng; Wang, Jia-Qi; Wang, Sheng-Ming; Bai, Yun-Hu; Yang, Yan-Ling; Wang, Ya-Yun

    2016-08-01

    Mitochondria are organelles responsible for vital cell functions. p53 is a transcription factor that regulates the DNA stability and cell growth normality. Recent studies revealed that p53 can influence mitochondrial function changing from normal condition to abnormal condition under different stress levels. In normal state, p53 can maintain mitochondrial respiration through transactivation of SCO2. When stress stimuli presents, SCO2 overexpresses and leads to ROS generation. ROS promotes p53 inducing MALM (Mieap-induced accumulation of lysosome-like organelles within mitochondria) to repair dysfunctional mitochondria and MIV (Mieap-induced vacuole) to accomplish damaged mitochondria degradation. If stress or damage is irreversible, p53 will translocate to mitochondria, leading into apoptosis or necrosis. Neurodegenerative diseases including Parkinson's disease, Huntington's disease and Alzheimer's disease are still lack of clear explanations of mechanisms, but more studies have revealed the functional relationship between mitochondria and p53 towards the pathological development of these diseases. In this review, we discuss that p53 plays the vital role in the function of mitochondria in the aspect of pathological change metabolism. We also analyze these diseases with novel targeted treating molecules which are related to p53 and mitochondria, hoping to present novel therapies in future clinic.

  13. p53 and mitochondrial dysfunction: novel insight of neurodegenerative diseases.

    PubMed

    Dai, Chun-Qiu; Luo, Ting-Ting; Luo, Shi-Cheng; Wang, Jia-Qi; Wang, Sheng-Ming; Bai, Yun-Hu; Yang, Yan-Ling; Wang, Ya-Yun

    2016-08-01

    Mitochondria are organelles responsible for vital cell functions. p53 is a transcription factor that regulates the DNA stability and cell growth normality. Recent studies revealed that p53 can influence mitochondrial function changing from normal condition to abnormal condition under different stress levels. In normal state, p53 can maintain mitochondrial respiration through transactivation of SCO2. When stress stimuli presents, SCO2 overexpresses and leads to ROS generation. ROS promotes p53 inducing MALM (Mieap-induced accumulation of lysosome-like organelles within mitochondria) to repair dysfunctional mitochondria and MIV (Mieap-induced vacuole) to accomplish damaged mitochondria degradation. If stress or damage is irreversible, p53 will translocate to mitochondria, leading into apoptosis or necrosis. Neurodegenerative diseases including Parkinson's disease, Huntington's disease and Alzheimer's disease are still lack of clear explanations of mechanisms, but more studies have revealed the functional relationship between mitochondria and p53 towards the pathological development of these diseases. In this review, we discuss that p53 plays the vital role in the function of mitochondria in the aspect of pathological change metabolism. We also analyze these diseases with novel targeted treating molecules which are related to p53 and mitochondria, hoping to present novel therapies in future clinic. PMID:27422544

  14. Guilty as CHARGED: p53's expanding role in disease

    PubMed Central

    Van Nostrand, Jeanine L; Attardi, Laura D

    2014-01-01

    Unrestrained p53 activity during development, as occurs upon loss of the p53 negative regulators Mdm2 or Mdmx, causes early embryonic lethality. Surprisingly, co-expression of wild-type p53 and a transcriptionally-dead variant of p53, with mutations in both transactivation domains (p53L25Q,W26S,F53Q,F54S), also causes lethality, but later in gestation and in association with a host of very specific phenotypes reminiscent of a syndrome known as CHARGE. Molecular analyses revealed that wild-type p53 is inappropriately activated in p535,26,53,54/+ embryos, triggering cell-cycle arrest or apoptosis during development to cause CHARGE phenotypes. In addition, CHARGE syndrome is typically caused by mutations in the CHD7 chromatin remodeler, and we have shown that activated p53 contributes to phenotypes caused by CHD7-deficiency. Together, these studies provide new insight into CHARGE syndrome and expand our understanding of the role of p53 in diseases other than cancer. PMID:25483057

  15. A Platform for Interrogating Cancer-Associated p53 Alleles

    PubMed Central

    D’Brot, Alejandro; Kurtz, Paula; Regan, Erin; Jakubowski, Brandon; Abrams, John M

    2016-01-01

    p53 is the most frequently mutated gene in human cancer. Compelling evidence argues that full transformation involves loss of growth suppression encoded by wild-type p53 together with poorly understood oncogenic activity encoded by missense mutations. Furthermore, distinguishing disease alleles from natural polymorphisms is an important clinical challenge. To interrogate the genetic activity of human p53 variants, we leveraged the Drosophila model as an in vivo platform. We engineered strains that replace the fly p53 gene with human alleles, producing a collection of stocks that are, in effect, ‘humanized’ for p53 variants. Like the fly counterpart, human p53 transcriptionally activated a biosensor and induced apoptosis after DNA damage. However, all humanized strains representing common alleles found in cancer patients failed to complement in these assays. Surprisingly, stimulus-dependent activation of hp53 occurred without stabilization, demonstrating that these two processes can be uncoupled. Like its fly counterpart, hp53 formed prominent nuclear foci in germline cells but cancer-associated p53 variants did not. Moreover, these same mutant alleles disrupted hp53 foci and inhibited biosensor activity, suggesting that these properties are functionally linked. Together these findings establish a functional platform for interrogating human p53 alleles and suggest that simple phenotypes could be used to stratify disease variants. PMID:26996664

  16. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  17. p53 in the DNA-Damage-Repair Process.

    PubMed

    Williams, Ashley B; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability.

  18. p53 immunoreactivity is uncommon in primary cutaneous lymphoma.

    PubMed

    McGregor, J M; Dublin, E A; Levison, D A; MacDonald, D M; Smith, N P; Whittaker, S

    1995-03-01

    p53 gene mutation appears to play an important role in the development of systemic lymphoma, and may be associated with tumour progression. Its role in cutaneous lymphoma is currently unknown. We examined p53 expression in 55 biopsies of cutaneous lymphoma, including patch-, plaque- and tumour-stage mycosis fungoides (MF), T- and B-cell lymphoma and lymphomatoid papulosis. Strong, homogeneous p53 expression, thought to correlate most closely with p53 gene mutation, was seen in only three cases; in a plaque and tumour from a patient with tumour-stage MF, in plaque-stage MF in a patient without tumours, and in one case of CD30+ large-cell anaplastic lymphoma. These data suggest that p53 gene mutation is not a critical step in the development of the majority of primary cutaneous lymphomas.

  19. p53 in the DNA-Damage-Repair Process.

    PubMed

    Williams, Ashley B; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability. PMID:27048304

  20. p53 in the DNA damage repair process

    PubMed Central

    Williams, Ashley B.; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA damage response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA repair systems. It thus appears as if p53 is multitasking in protecting from cancer development by maintaining genome stability. PMID:27048304

  1. p53 prevents neurodegeneration by regulating synaptic genes.

    PubMed

    Merlo, Paola; Frost, Bess; Peng, Shouyong; Yang, Yawei J; Park, Peter J; Feany, Mel

    2014-12-16

    DNA damage has been implicated in neurodegenerative disorders, including Alzheimer's disease and other tauopathies, but the consequences of genotoxic stress to postmitotic neurons are poorly understood. Here we demonstrate that p53, a key mediator of the DNA damage response, plays a neuroprotective role in a Drosophila model of tauopathy. Further, through a whole-genome ChIP-chip analysis, we identify genes controlled by p53 in postmitotic neurons. We genetically validate a specific pathway, synaptic function, in p53-mediated neuroprotection. We then demonstrate that the control of synaptic genes by p53 is conserved in mammals. Collectively, our results implicate synaptic function as a central target in p53-dependent protection from neurodegeneration.

  2. Low Levels of p53 Protein and Chromatin Silencing of p53 Target Genes Repress Apoptosis in Drosophila Endocycling Cells

    PubMed Central

    Zhang, Bingqing; Mehrotra, Sonam; Ng, Wei Lun; Calvi, Brian R.

    2014-01-01

    Apoptotic cell death is an important response to genotoxic stress that prevents oncogenesis. It is known that tissues can differ in their apoptotic response, but molecular mechanisms are little understood. Here, we show that Drosophila polyploid endocycling cells (G/S cycle) repress the apoptotic response to DNA damage through at least two mechanisms. First, the expression of all the Drosophila p53 protein isoforms is strongly repressed at a post-transcriptional step. Second, p53-regulated pro-apoptotic genes are epigenetically silenced in endocycling cells, preventing activation of a paused RNA Pol II by p53-dependent or p53-independent pathways. Over-expression of the p53A isoform did not activate this paused RNA Pol II complex in endocycling cells, but over-expression of the p53B isoform with a longer transactivation domain did, suggesting that dampened p53B protein levels are crucial for apoptotic repression. We also find that the p53A protein isoform is ubiquitinated and degraded by the proteasome in endocycling cells. In mitotic cycling cells, p53A was the only isoform expressed to detectable levels, and its mRNA and protein levels increased after irradiation, but there was no evidence for an increase in protein stability. However, our data suggest that p53A protein stability is regulated in unirradiated cells, which likely ensures that apoptosis does not occur in the absence of stress. Without irradiation, both p53A protein and a paused RNA pol II were pre-bound to the promoters of pro-apoptotic genes, preparing mitotic cycling cells for a rapid apoptotic response to genotoxic stress. Together, our results define molecular mechanisms by which different cells in development modulate their apoptotic response, with broader significance for the survival of normal and cancer polyploid cells in mammals. PMID:25211335

  3. The regulation of p53 by phosphorylation: a model for how distinct signals integrate into the p53 pathway.

    PubMed

    Maclaine, Nicola J; Hupp, Ted R

    2009-05-01

    The tumour suppressor p53 is a transcription factor that has evolved the ability to integrate distinct environmental signals including DNA damage, virus infection, and cytokine signaling into a common biological outcome that maintains normal cellular control. Mutations in p53 switch the cellular transcription program resulting in deregulation of the stress responses that normally maintain cell and tissue integrity. Transgenic studies in mice have indicated that changes in the specific activity of p53 can have profound effects not only on cancer development, but also on organism aging. As the specific activity of p53 is regulated at a post-translational level by sets of enzymes that mediate phosphorylation, acetylation, methylation, and ubiquitin-like modifications, it is likely that physiological modifiers of the aging function of p53 would be enzymes that catalyze such covalent modifications. We demonstrate that distinct stress-activated kinases, including ataxia telangiectasia mutated (ATM), casein kinase 1 (CK1) and AMP-activated protein kinase (AMPK), mediate phosphorylation of a key phospho-acceptor site in the p53 transactivation domain in response to diverse stresses including ionizing radiation, DNA virus infection, and elevation in the intracellular AMP/ATP ratio. As diseases linked to aging can involve activation of p53-dependent changes in cellular protective pathways, the development of specific physiological models might further shed light on the role of p53 kinases in modifying age-related diseases. PMID:20157532

  4. Cytoplasmic p53 and Activated Bax Regulate p53-dependent, Transcription-independent Neural Precursor Cell Apoptosis

    PubMed Central

    Geng, Ying; Walls, K.C.; Ghosh, Arindam P.; Akhtar, Rizwan S.; Klocke, Barbara J.; Roth, Kevin A.

    2010-01-01

    The prodeath effects of p53 are typically mediated via its transcriptional upregulation of proapoptotic Bcl-2 family members, including PUMA, Noxa, and/or Bax. We previously reported that staurosporine (STS), a broad-spectrum kinase inhibitor and prototypical apoptosis-inducing agent, produced p53-dependent, Bax-dependent, neural precursor cell (NPC) apoptosis, but that this effect occurred independently of new gene transcription and PUMA expression. To further characterize the mechanism by which p53 regulates NPC death, we used primary cerebellar NPCs derived from wild-type, p53-deficient, and Bax-deficient neonatal mice and the mouse cerebellar neural stem cell line, C17.2. We found that STS rapidly increased p53 cytoplasmic immunoreactivity in neuritic-like processes in C17.2 cells, which preceded Bax activation and caspase-3 cleavage. Confocal microscopy analysis of STS-treated cells revealed partial colocalization of p53 with the mitochondrial marker pyruvate dehydrogenase as well as with conformationally altered “activated” Bax, suggesting an interaction between these proapoptotic molecules in triggering apoptotic death. Nucleophosmin (NPM), a CRM1-dependent nuclear chaperone, also exhibited partial colocalization with both activated Bax and p53 following STS treatment. These observations suggest that cytoplasmic p53 can trigger transcription-independent NPC apoptosis through its potential interaction with NPM and activated Bax. (J Histochem Cytochem 58:265–275, 2010) PMID:19901272

  5. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction

    PubMed Central

    Thayer, Kelly M.; Beyer, George A.

    2016-01-01

    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  6. Energetic Landscape of MDM2-p53 Interactions by Computational Mutagenesis of the MDM2-p53 Interaction.

    PubMed

    Thayer, Kelly M; Beyer, George A

    2016-01-01

    The ubiquitin ligase MDM2, a principle regulator of the tumor suppressor p53, plays an integral role in regulating cellular levels of p53 and thus a prominent role in current cancer research. Computational analysis used MUMBO to rotamerize the MDM2-p53 crystal structure 1YCR to obtain an exhaustive search of point mutations, resulting in the calculation of the ΔΔG comprehensive energy landscape for the p53-bound regulator. The results herein have revealed a set of residues R65-E69 on MDM2 proximal to the p53 hydrophobic binding pocket that exhibited an energetic profile deviating significantly from similar residues elsewhere in the protein. In light of the continued search for novel competitive inhibitors for MDM2, we discuss possible implications of our findings on the drug discovery field. PMID:26992014

  7. Heat shock protein induction by certain chemical stressors is correlated with their cytotoxicity, lipophilicity and protein-denaturing capacity.

    PubMed

    Neuhaus-Steinmetz, U; Rensing, L

    1997-12-01

    Seven agents were analyzed with respect to their ability to induce heat shock protein (HSP) synthesis in C6 rat glioma cells. Induction of HSP synthesis was correlated with cytotoxicity and lipophilicity of the substances. In addition to the first four n-alcohols (methanol, ethanol, propanol and butanol) and phenol, whose capacity to induce HSP was analyzed earlier (Neuhaus-Steinmetz et al., 1994. Mol. Pharmacol. 45, 36-41), isopropanol, 1,4-dinitrophenol (DNP), diethylstilbestrol (DES), carbonylcyanide-m-chlorophenylhydrazone (CCCP), rotenone, paracetamol and acetyl salicylic acid (ASA) induced HSP synthesis after a 1-h incubation at a substance-specific concentration. The maximal induction of HSPs was closely correlated with the cytotoxicity of all substances and occurred when cell viability was reduced to 75 +/- 11% of the controls. Cytotoxicity and the ability to induce HSP were correlated with the lipophilicity of the alcohols, phenol, rotenone and paracetamol. Calculation of the hypothetical membrane concentrations of these compounds yielded a nearly equal value (0.54 +/- 0.13 M), indicating that interaction of substances with lipophilic cellular compounds, such as membranes or lipophilic core regions of proteins, is a critical step leading to HSP induction. This assumption is supported by a correlation between HSP induction and protein denaturation by the different alcohols (Herskovits et al., 1970. J. Biol. Chem. 245, 2588-2598). We assume that the amount of misfolded proteins induced by these lipophilic agents is responsible for the induction of HSP synthesis. ASA, DNP and CCCP induced HSP at lower concentrations than substances with a similar lipophilicity, which may be due to effects which add to the misfolding of proteins or to other signal pathways.

  8. p53MVA therapy in patients with refractory gastrointestinal malignancies elevates p53-specific CD8+ T cell responses

    PubMed Central

    Hardwick, Nicola R; Carrol, Mary; Kaltcheva, Teodora; Qian, Dajun; Lim, Dean; Leong, Lucille; Chu, Peiguo; Kim, Joseph; Chao, Joseph; Fakih, Marwan; Yen, Yun; Espenschied, Jonathan; Ellenhorn, Joshua D I; Diamond, Don J; Chung, Vincent

    2014-01-01

    PURPOSE: To conduct a Phase I trial of a Modified Vaccinia Ankara vaccine delivering wild type human p53 (p53MVA) in patients with refractory gastrointestinal cancers. EXPERIMENTAL DESIGN: Three patients were vaccinated with 1.0 × 108 pfu p53MVA followed by nine patients at 5.6 × 108 pfu. Toxicity was classified using the NCI Common Toxicity Criteria and clinical responses were assessed by CT scan. Peripheral blood samples were collected pre- and post-immunization for immunophenotyping, monitoring of p53MVA induced immune response and examination of PD-1 checkpoint inhibition in vitro. RESULTS: p53MVA immunization was well tolerated at both doses, with no adverse events above grade 2. CD4+ and CD8+ T cells showing enhanced recognition of a p53 overlapping peptide library were detectable after the first immunization, particularly in the CD8+ T cell compartment (p=0.03). However in most patients this did not expand further with the second and third immunization. The frequency of PD-1+ T cells detectable in patients PBMC was significantly higher than in healthy controls. Furthermore, the frequency of PD-1+ CD8+ T cells showed an inverse correlation with the peak CD8+ p53 response (p=0.02) and antibody blockade of PD-1 in vitro increased the p53 immune responses detected after the second or third immunizations. Induction of strong T cell and antibody responses to the MVA backbone were also apparent. CONCLUSION: p53MVA was well tolerated and induced robust CD8+ T cell responses. Combination of p53MVA with immune checkpoint inhibition could help sustain immune responses and lead to enhanced clinical benefit. PMID:24987057

  9. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  10. Crosstalk between p53 and TGF-β Signalling

    PubMed Central

    Elston, Rebecca; Inman, Gareth J.

    2012-01-01

    Wild-type p53 and TGF-β are key tumour suppressors which regulate an array of cellular responses. TGF-β signals in part via the Smad signal transduction pathway. Wild-type p53 and Smads physically interact and coordinately induce transcription of a number of key tumour suppressive genes. Conversely mutant p53 generally subverts tumour suppressive TGF-β responses, diminishing transcriptional activation of key TGF-β target genes. Mutant p53 can also interact with Smads and this enables complex formation with the p53 family member p63 and blocks p63-mediated activation of metastasis suppressing genes to promote tumour progression. p53 and Smad function may also overlap during miRNA biogenesis as they can interact with the same components of the Drosha miRNA processing complex to promote maturation of specific subsets of miRNAs. This paper investigates the crosstalk between p53 and TGF-β signalling and the potential roles this plays in cancer biology. PMID:22545213

  11. p53 and the pathogenesis of skin cancer

    SciTech Connect

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-11-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients.

  12. Long story short: p53 mediates innate immunity.

    PubMed

    Miciak, Jessica; Bunz, Fred

    2016-04-01

    The story of p53 and how we came to understand it is punctuated by fundamental insights into the essence of cancer. In the decades since its discovery, p53 has been shown to be centrally involved in most, if not all, of the cellular processes that maintain tissue homeostasis. Extensive functional analyses of p53 and its tumor-associated mutants have illuminated many of the common defects shared by most cancer cells. As the central character in a tale that continues to unfold, p53 has become increasingly familiar and yet remains surprisingly inscrutable. New relationships periodically come to light, and surprising, novel activities continue to emerge, thereby revealing new dimensions and aspects of its function. What lies at the very core of this complex protagonist? What is its prime motivation? As every avid reader knows, the elements of character are profoundly shaped by adversity--originating from within and without. And so it is with p53. This review will briefly recap the coordinated responses of p53 to viral infection, and outline a hypothetical model that would explain how an abundance of seemingly unrelated phenotypic attributes may in the end reflect a singular function. All stories eventually draw to a conclusion. This epic tale may eventually leave us with the realization that p53, most simply described, is a protein that evolved to mediate immune surveillance. PMID:26951863

  13. Regulation of the DNA Damage Response by p53 Cofactors

    PubMed Central

    Zhang, Xiao-Peng; Liu, Feng; Wang, Wei

    2012-01-01

    The selective expression of p53-targeted genes is central to the p53-mediated DNA damage response. It is affected by multiple factors including posttranslational modifications and cofactors of p53. Here, we proposed an integrated model of the p53 network to characterize how the cellular response is regulated by key cofactors of p53, Hzf and ASPP. We found that the sequential induction of Hzf and ASPP is crucial to a reliable cell-fate decision between survival and death. After DNA damage, activated p53 first induces Hzf, which promotes the expression of p21 to arrest the cell cycle and facilitate DNA repair. The cell recovers to normal proliferation after the damage is repaired. If the damage is beyond repair, Hzf is effectively degraded, and activated E2F1 induces ASPP, which promotes the expression of Bax to trigger apoptosis. Furthermore, interrupting the induction of Hzf or ASPP remarkably impairs the cellular function. We also proposed two schemes for the production of the unknown E3 ubiquitin ligase for Hzf degradation: it is induced by either E2F1 or p53. In both schemes, the sufficient degradation of Hzf is required for apoptosis induction. These results are in good agreement with experimental observations or are experimentally testable. PMID:22677378

  14. Cyclooxygenase-2 and p53 expressions in endometrial cancer.

    PubMed

    Jeon, Yong-Tark; Kang, Sokbom; Kang, Dae-Hee; Yoo, Keun-Young; Park, In-Ae; Bang, Yung-Jue; Kim, Jae Weon; Park, Noh-Hyun; Kang, Soon-Beom; Lee, Hyo-Pyo; Song, Yong-Sang

    2004-09-01

    Cyclooxygenase-2 (COX-2) has been known to be related with various types of carcinoma, but we have insufficient knowledge about the association between COX-2 and endometrial cancer. Many have reported a close relationship between p53 expression and a poor prognosis in endometrial cancer, but it is unclear whether p53 is an independent prognostic factor. To clarify these uncertainties, we examined the expressions of COX-2 and p53 in endometrial cancer tissues. The study was carried on 152 endometrial cancer patients who had operation at Seoul National University Hospital. Paraffin-embedded tissue blocks were sectioned and immunostained using monoclonal anti-COX-2 and anti-p53 antibodies. Twenty-seven (17.8%) specimens stained as COX-2 positive. COX-2 positivity was more frequently observed in postmenopausal patients than in premenopausal patients (8.8% versus 25.0%; P = 0.009). However, COX-2 positivity did not show a statistically significant association with any other clinicopathologic characteristic (parity, body mass index, histotype, International Federation of Gynecology and Obstetrics stage, grade, lymph node metastasis, deep myometrial invasion, or p53 overexpression). Thirty-one (20.4%) specimens showed p53 overexpression and this was significantly correlated with an advanced stage (P = 0.001), poor differentiation (P < 0.001), lymph node metastasis (P = 0.012), and deep myometrial invasion (P < 0.001). Multivariate Cox regression analysis showed that advanced stage was an independent prognostic factor of survival, but p53 overexpression was not. COX-2 may be associated with endometrial cancer carcinogenesis during the postmenopausal period but not with tumor aggressiveness and p53 overexpression. The p53 overexpression was found to be strongly associated with endometrial cancer aggressiveness.

  15. p53 as guardian of the mitochondrial genome.

    PubMed

    Park, Ji-Hoon; Zhuang, Jie; Li, Jie; Hwang, Paul M

    2016-04-01

    Participating in the repair of nuclear DNA is one mechanism by which p53 suppresses tumorigenesis, but there is growing evidence that p53 also helps maintain the mitochondrial genome through its translocation into mitochondria and interactions with mtDNA repair proteins. Because of the susceptibility of mtDNA to oxidative damage and replication errors, it is vital to protect mtDNA genomic stability to preserve health and fitness. Here, we focus on reviewing the evidence for the involvement of p53 in maintaining the integrity of mtDNA through its activities in both the nucleus and the mitochondria. PMID:26780878

  16. Robustness of the p53 network and biological hackers.

    PubMed

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-01

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  17. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    SciTech Connect

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  18. The emerging role of p53 in exercise metabolism.

    PubMed

    Bartlett, Jonathan D; Close, Graeme L; Drust, Barry; Morton, James P

    2014-03-01

    The major tumour suppressor protein, p53, is one of the most well-studied proteins in cell biology. Often referred to as the Guardian of the Genome, the list of known functions of p53 include regulatory roles in cell cycle arrest, apoptosis, angiogenesis, DNA repair and cell senescence. More recently, p53 has been implicated as a key molecular player regulating substrate metabolism and exercise-induced mitochondrial biogenesis in skeletal muscle. In this context, the study of p53 therefore has obvious implications for both human health and performance, given that impaired mitochondrial content and function is associated with the pathology of many metabolic disorders such as ageing, type 2 diabetes, obesity and cancer, as well as reduced exercise performance. Studies on p53 knockout (KO) mice collectively demonstrate that ablation of p53 content reduces intermyofibrillar (IMF) and subsarcolemmal (SS) mitochondrial yield, reduces cytochrome c oxidase (COX) activity and peroxisome proliferator-activated receptor gamma co-activator 1-α protein content whilst also reducing mitochondrial respiration and increasing reactive oxygen species production during state 3 respiration in IMF mitochondria. Additionally, p53 KO mice exhibit marked reductions in exercise capacity (in the magnitude of 50 %) during fatiguing swimming, treadmill running and electrical stimulation protocols. p53 may regulate contractile-induced increases in mitochondrial content via modulating mitochondrial transcription factor A (Tfam) content and/or activity, given that p53 KO mice display reduced skeletal muscle mitochondrial DNA, Tfam messenger RNA and protein levels. Furthermore, upon muscle contraction, p53 is phosphorylated on serine 15 and subsequently translocates to the mitochondria where it forms a complex with Tfam to modulate expression of mitochondrial-encoded subunits of the COX complex. In human skeletal muscle, the exercise-induced phosphorylation of p53(Ser15) is enhanced in conditions

  19. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  20. p53 E3 ubiquitin protein ligase homolog regulates p53 in vivo in the adult mouse eye lens

    PubMed Central

    Jaramillo-Rangel, Gilberto; Ortega-Martínez, Marta; Sepúlveda-Saavedra, Julio; Saucedo-Cárdenas, Odila; Montes-de-Oca-Luna, Roberto

    2013-01-01

    Purpose p53 is a transcription factor that plays an important role in preventing cancer development. p53 participates in relevant aspects of cell biology, including apoptosis and cell cycle control and must be strictly regulated to maintain normal tissue homeostasis. p53 E3 ubiquitin protein ligase homolog (Mdm2) is an important negative regulator of p53. The purpose of this study was to determine if Mdm2 regulates p53 in vivo in the adult lens. Methods We analyzed mice expressing human p53 transgene (Tgp53) selectively in the lens in the presence or absence of Mdm2. Mice with the required genotypes were obtained by crossing transgenic, mdm2+/−, and p53−/− mice. Eye phenotype and lens histology and ultrastructure were analyzed in adult mice. Results In a wild-type genetic background (mdm2+/+), lens damage and microphthalmia were observed only in mice homozygous for Tgp53 (t/t). However, in an mdm2 null background, just one allele of Tgp53 (mdm2−/−/Tgp53t/0 mice) was sufficient to cause lens damage and microphthalmia. Furthermore, Mdm2 in only one allele was sufficient to rescue these deleterious effects, since the mdm2+/−/Tgp53t/0 mice had eye size and lens morphology similar to the control mice. Conclusions Mdm2 regulates p53 in the adult lens in vivo. This information may have relevance for analyzing normal and pathological conditions of the lens, and designing cancer therapies targeting Mdm2–p53 interaction. PMID:24339722

  1. Nitric oxide evoked p53-accumulation and apoptosis.

    PubMed

    Brüne, Bernhard; Schneiderhan, Nicole

    2003-04-01

    The tumor suppressor p53 accumulates under conditions of cellular stress and affects cell cycle progression and/or apoptosis. This has been exemplified for endogenously produced or exogenously supplied nitric oxide (NO) and thus accounts at least in part for cell destructive signaling qualities of this bioactive molecule and/or derived reactive nitrogen species. However, detailed mechanisms of toxicity and pathways of cell demise remain to be elucidated. Establishing that NO-treatment left the ubiquitination and the p53-Mdm2 interaction intact may point to an impaired nuclear-cytoplasmic shuttling to account for p53 stabilization. This was verified by heterokaryon analysis. We conclude that attenuated nuclear export contributes to stabilization and activation of p53 under the influence of NO.

  2. Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.

    PubMed

    Barthelery, Nicolas J; Manfredi, James J

    2016-05-01

    The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. PMID:27085812

  3. Characterization of the human p53 gene promoter

    SciTech Connect

    Tuck, S.P.; Crawford, L.

    1989-05-01

    Transcriptional deregulation of the p53 gene may play an important part in the genesis of some tumors. The authors report here an accurate determination of the transcriptional start sites of the human p53 gene and show that the majority of p53 mRNA molecules do not contain a postulated stem-loop structure at their 5' ends. Recombinant plasmids of the human p53 promoter-leader region fused to the bacterial chloramphenicol acetyltransferase gene (cat) were constructed. After transfection into rodent or human cells, a 350-base-pair fragment spanning the promoter region conferred 4% of the CAT activity mediated by the simian virus 40 early promoter/enhancer. They monitored the efficiency with which 15 3' and 5' promoter deletion constructs initiated transcription. Their results show that an 85-base-pair fragment, previously thought to have resided in exon 1, is that is required for full promoter activity.

  4. Influence of metabolic stress on translation of p53 isoforms.

    PubMed

    Khan, Debjit; Chattopadhyay, Samit; Das, Saumitra

    2016-01-01

    p53 and its isoforms are integral in modulating transcriptional gene expression programs and maintaining cellular homeostasis. We recently reported that glucose deprivation/caloric restriction induced translational control of p53 mRNA by scaffold/matrix attachment region binding-protein 1 (SMAR1), adding a cytoplasmic role of SMAR1 to its traditional nuclear role as a transcription factor. PMID:27308557

  5. Overexpression and mutations of p53 in metastatic malignant melanomas.

    PubMed

    Hartmann, A; Blaszyk, H; Cunningham, J S; McGovern, R M; Schroeder, J S; Helander, S D; Pittelkow, M R; Sommer, S S; Kovach, J S

    1996-07-29

    Alterations of the p53 tumor suppressor gene are the most frequent genetic abnormalities in human malignancies, but the role of p53 in the etiology of malignant melanomas is unclear. Fifty unselected malignant melanomas were analyzed for p53 overexpression by immunohistochemistry using 3 monoclonal antibodies (MAbs). Fifteen tumors (29.4%) showed positive staining with at least 2 different antibodies. In the first 20 consecutive tumors exons 5-9 and adjacent splice sites of the p53 gene were analyzed by genomic sequencing. There were 4 mutations in 20 metastatic melanomas. Three of 4 mutations were C:G-->T:A transitions. A search of our database of p53 mutations revealed that out of 8 p53 mutations reported by others, 4 are C:G-->T:A transitions at dipyrimidine sites, and one is a tandem CC-->TT mutation. This mutational pattern is comparable with the pattern of p53 mutations in squamous cell and basal cell carcinomas of the skin and is related to exposure to ultraviolet B (UV-B) wavelength radiation. Taken together with a predominance of UV-induced mutations in the CDKN2/ p16 gene demonstrated in melanoma cell lines, our data support a role of sunlight exposure in the etiology of malignant melanoma. The low frequency of p53 mutants in melanomas compared with other types of skin cancers suggests that although mutations in this gene are likely to be involved in the development of some malignant melanomas, they do not play as large a role as in squamous and basal cell carcinomas of the skin. PMID:8707401

  6. Tracing the Evolution of the p53 Tetramerization Domain

    PubMed Central

    Joerger, Andreas C.; Wilcken, Rainer; Andreeva, Antonina

    2014-01-01

    Summary The tetrameric transcription factors p53, p63, and p73 evolved from a common ancestor and play key roles in tumor suppression and development. Surprisingly, p63 and p73 require a second helix in their tetramerization domain for the formation of stable tetramers that is absent in human p53, raising questions about the evolutionary processes leading to diversification. Here we determined the crystal structure of the zebrafish p53 tetramerization domain, which contains a second helix, reminiscent of p63 and p73, combined with p53-like features. Through comprehensive phylogenetic analyses, we systematically traced the evolution of vertebrate p53 family oligomerization domains back to the beginning of multicellular life. We provide evidence that their last common ancestor also had an extended p63/p73-like domain and pinpoint evolutionary events that shaped this domain during vertebrate radiation. Domain compaction and transformation of a structured into a flexible, intrinsically disordered region may have contributed to the expansion of the human p53 interactome. PMID:25185827

  7. UHRF2, another E3 ubiquitin ligase for p53

    SciTech Connect

    Bai, Lu; Wang, Xiaohui; Jin, Fangmin; Yang, Yan; Qian, Guanhua; Duan, Changzhu

    2012-09-07

    Highlights: Black-Right-Pointing-Pointer UHRF2 associates with p53 in vivo and in vitro. Black-Right-Pointing-Pointer UHRF2 interacts with p53 through its SRA/YDG domain. Black-Right-Pointing-Pointer UHRF2 ubiquitinates p53 in vivo and in vitro. -- Abstract: UHRF2, ubiquitin-like with PHD and ring finger domains 2, is a nuclear E3 ubiquitin ligase, which is involved in cell cycle and epigenetic regulation. UHRF2 interacts with multiple cell cycle proteins, including cyclins (A2, B1, D1, and E1), CDK2, and pRb; moreover, UHRF2 could ubiquitinate cyclin D1 and cyclin E1. Also, UHRF2 has been shown to be implicated in epigenetic regulation by associating with DNMTs, G9a, HDAC1, H3K9me2/3 and hemi-methylated DNA. We found that UHRF2 associates with tumor suppressor protein p53, and p53 is ubiquitinated by UHRF2 in vivo and in vitro. Given that both UHRF2 and p53 are involved in cell cycle regulation, this study may suggest a novel signaling pathway on cell proliferation.

  8. The RP-Mdm2-p53 Pathway and Tumorigenesis

    PubMed Central

    Miliani de Marval, Paula L.; Zhang, Yanping

    2011-01-01

    The dynamic processes of cell growth and division are under constant surveillance. As one of the primary “gatekeepers” of the cell, the p53 tumor suppressor plays a major role in sensing and responding to a variety of stressors to maintain cellular homeostasis. Recent studies have shown that inhibition of ribosomal biogenesis can activate p53 through ribosomal protein (RP)-mediated suppression of Mdm2 E3 ligase activity. Mutations in Mdm2 that disrupt RP binding have been detected in human cancers; however, the physiological significance of the RP-Mdm2 interaction is not completely understood. We generated mice carrying a single cysteine-to-phenylalanine substitution in the central zinc finger of Mdm2 (Mdm2C305F) that disrupts Mdm2’s binding to RPL11 and RPL5. Despite being developmentally normal and maintaining an intact p53 response to DNA damage, the Mdm2C305F mice demonstrate a diminished p53 response to perturbations in ribosomal biogenesis, providing the first in vivo evidence for an RP-Mdm2-p53 signaling pathway. Here we review some recent studies about RP-Mdm2-p53 signaling and speculate on the relevance of this pathway to human cancer. PMID:21406728

  9. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    SciTech Connect

    Okazaki, Ryuji; Ootsuyama, Akira; Kakihara, Hiroyo; Mabuchi, Yo; Matsuzaki, Yumi; Michikawa, Yuichi; Imai, Takashi; Norimura, Toshiyuki

    2011-01-01

    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situ hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.

  10. NSC-87877 inhibits DUSP26 function in neuroblastoma resulting in p53-mediated apoptosis

    PubMed Central

    Shi, Y; Ma, I T; Patel, R H; Shang, X; Chen, Z; Zhao, Y; Cheng, J; Fan, Y; Rojas, Y; Barbieri, E; Chen, Z; Yu, Y; Jin, J; Kim, E S; Shohet, J M; Vasudevan, S A; Yang, J

    2015-01-01

    Dual specificity protein phosphatase 26 (DUSP26) is overexpressed in high-risk neuroblastoma (NB) and contributes to chemoresistance by inhibiting p53 function. In vitro, DUSP26 has also been shown to effectively inhibit p38 MAP kinase. We hypothesize that inhibiting DUSP26 will result in decreased NB cell growth in a p53 and/or p38-mediated manner. NSC-87877 (8-hydroxy-7-[(6-sulfo-2-naphthyl)azo]-5-quinolinesulfonic acid), a novel DUSP26 small molecule inhibitor, shows effective growth inhibition and induction of apoptosis in NB cell lines. NB cell lines treated with small hairpin RNA (shRNA) targeting DUSP26 also exhibit a proliferation defect both in vitro and in vivo. Treatment of NB cell lines with NSC-87877 results in increased p53 phosphorylation (Ser37 and Ser46) and activation, increased activation of downstream p38 effector proteins (heat shock protein 27 (HSP27) and MAP kinase-activated protein kinase 2 (MAPKAPK2)) and poly ADP ribose polymerase/caspase-3 cleavage. The cytotoxicity resulting from DUSP26 inhibition is partially reversed by knocking down p53 expression with shRNA and also by inhibiting p38 activity with SB203580 (4-[4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-1H-imidazol-5-yl]pyridine). In an intrarenal mouse model of NB, NSC-87877 treatment results in decreased tumor growth and increased p53 and p38 activity. Together, these results suggest that DUSP26 inhibition with NSC-87877 is an effective strategy to induce NB cell cytotoxicity in vitro and in vivo through activation of the p53 and p38 mitogen-activated protein kinase (MAPK) tumor-suppressor pathways. PMID:26247726

  11. p53 protein, EGF receptor, and anti-p53 antibodies in serum from patients with occupationally derived lung cancer.

    PubMed

    Schneider, J; Presek, P; Braun, A; Bauer, P; Konietzko, N; Wiesner, B; Woitowitz, H J

    1999-08-01

    The oncogene product epidermal growth factor receptor (EGF-R), the tumour suppressor gene product p53 and anti-p53 antibodies are detectable in the serum of certain cancer patients. Increased levels of some of these products were reported in lung cancer patients after occupational asbestos exposure and after exposure to polycyclic aromatic hydrocarbons or vinylchloride. In the first step, this study investigated the possible diagnostic value of serum EGF-R, p53-protein and anti-p53 antibodies, measured by an enzyme-linked immunosorbent assay, in lung tumour patients. In addition to being investigated on a molecular epidemiological basis, these parameters were examined as biomarkers of carcinogenesis, especially with regard to asbestos incorporation effects or of radon-induced lung cancers. Also, a possible effect of cigarette smoking and age dependence were studied. A total of 116 male patients with lung or pleural tumours were examined. The histological classification was four small-cell cancers, six large-cell cancers, 32 adenocarcinomas, 47 squamous carcinomas, 12 mixed lung carcinomas, five diffuse malignant mesotheliomas and ten lung metastasis of extrapulmonary tumours. Twenty-two lung cancers and all mesotheliomas were related to asbestos, 22 lung cancers were related to ionizing radiation and 61 patients had cigarette smoke-related lung cancer. Besides these patients 50 male patients with non-malignant lung or pleural diseases were included; of the latter eight subjects suffered from asbestosis. Controls were 129 male subjects without any lung disease. No significantly elevated or decreased serum values for p53 protein, EGF-R, or anti-p53 antibodies as a function of histological tumour type, age, or degree and type of exposure (asbestos, smoking, ionizing radiation) could be found. The utility of p53-protein, EGF-R and anti-p53 antibodies as routine biomarkers for screening occupationally derived lung cancers is limited.

  12. Phosphorylation of p53 by TAF1 inactivates p53-dependent transcription in the DNA damage response

    PubMed Central

    Wu, Yong; Lin, Joy C.; Piluso, Landon G.; Dhahbi, Joseph M.; Bobadilla, Selene; Spindler, Stephen R.; Liu, Xuan

    2014-01-01

    Summary While p53 activation has long been studied, the mechanisms by which its targets genes are restored to their pre-activation state are less clear. We report here that TAF1 phosphorylates p53 at Thr55, leading to dissociation of p53 from the p21 promoter and inactivation of transcription late in the DNA damage response. We further show that cellular ATP level might act as a molecular switch for Thr55 phosphorylation on the p21 promoter, indicating that TAF1 is a cellular ATP sensor. Upon DNA damage, cells undergo PARP-1-dependent ATP depletion, which is correlated with reduced TAF1 kinase activity and Thr55 phosphorylation, resulting in p21 activation. As cellular ATP levels recover, TAF1 is able to phosphorylate p53 on Thr55, which leads to dissociation of p53 from the p21 promoter. ChIP-sequencing analysis reveals p53 dissociates from promoters genome-wide as cells recover from DNA damage, suggesting the general nature of this mechanism. PMID:24289924

  13. Modeling the Etiology of p53-mutated Cancer Cells.

    PubMed

    Perez, Ricardo E; Shen, Hong; Duan, Lei; Kim, Reuben H; Kim, Terresa; Park, No-Hee; Maki, Carl G

    2016-05-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds.

  14. Accumulated p53 protein and UVA protection level of sunscreens.

    PubMed

    Seité, S; Moyal, D; Verdier, M P; Hourseau, C; Fourtanier, A

    2000-02-01

    Nuclear p53 expression is a sensitive parameter for the detection of ultraviolet (UV)-induced skin damage, and it has been used as an endpoint to evaluate the effectiveness of sunscreens. In this study, we compared the protection provided by two sunscreens having identical sun protection factors (SPF) but different UVA protection factors (UVA-PF) measured by the persistent pigment darkening method (PPD). The SPF of the sunscreens was 7 and the UVA-PF were respectively 7 and 3. Nuclear p53 protein was quantified in human skin biopsies treated with sunscreens and exposed 8 times to 5 MED of solar simulated radiation (SSR). The results showed that both sunscreens offered only partial protection against the increased expression of nuclear p53 protein induced by repetitive SSR exposures. However, a significantly lower level of p53-positive cells was found in areas protected with the sunscreen having the higher UVA-PF compared to the other sunscreen protected areas. In order to verify whether the difference in efficacy of these products was due to the difference in UVA absorption capacity, we quantified epidermal p53 protein accumulation after 8 exposures to either UVA (320-400 nm) or UVA1 (340-400 nm). We showed that as with SSR, repetitive exposures to 12.5 and 25 J/cm2 of UVA or UVA1 induced a significant increase in p53-positive cells in the human epidermis. These results confirmed that SPF determined on the basis of an acute erythemal reaction does not predict the level of protection against cumulative damage. They also showed that the protection provided by two sunscreens with different UVA protection factors is different (based on nuclear p53 protein accumulation), and that the PPD method can distinguish varying levels of sunscreen efficacy against UVA-induced cell damage. PMID:10721857

  15. Expression pattern of the apoptosis-stimulating protein of p53 family in p53+ human breast cancer cell lines

    PubMed Central

    2013-01-01

    Background The apoptosis-stimulating protein of p53 (ASPP) family comprises three members, namely, ASPP1, ASPP2, and iASPP. They regulate the promotive effect of p53 on apoptosis. Breast cancer (BC) remains as one of the leading causes of cancer or cancer-related mortality among women. However, the relationship between the ASPP family members and p53, as well as the dissemination and expression pattern of ASPP family members in p53+ BC, has not been elucidated. Our objectives are to detect the expression of ASPP family members in p53+ BC cell lines and determine its significance in tumor cell apoptosis. Methods The mRNA expression of ASPP family members in five p53+ BC cell lines was detected through RT-PCR and assayed using Quality-one software. The p53 protein expression was detected by immunohistochemistry. Afterward, the apoptosis indices of the five BC cell lines were detected by flow cytometry. Results The iASPP mRNA was expressed in Bcap-37, MCF-7, and HBL-100. Compared with the human peripheral blood mononuclear cells, significant differences were found in the ASPP1 mRNA in Bcap-37, MDA-MB-231, MCF-7, and HBL-100 (p < 0.05), except that in ZR-75-30 (p > 0.05). The ASPP2 mRNA was expressed in MDA-MB-231, Bcap-37, and MCF-7, but not in HBL-100 and ZR-75-30. The p53 protein was expressed in five breast cancer cell lines. ZR-75-30 and MDA-MB-231 apoptosis indices were higher than those of other breast cancer cell line and peripheral blood mononuclear cells (p < 0.01). Conclusions The mRNA expression of ASPP family members varied in the five p53+ BC cell lines. The results also verified that the family members have an important function in apoptosis, which was promoted by p53 protein. ZR-75-30 BC showed high apoptosis index, without expression of any ASPP family members, indicating that the pathway of apoptosis in this cell line may be related to other cell transduction pathway. MDA-MB-231, Bcap37, and MCF-7 cell lines all expressed ASPP1/2. However, the

  16. PHD1 regulates p53-mediated colorectal cancer chemoresistance

    PubMed Central

    Deschoemaeker, Sofie; Di Conza, Giusy; Lilla, Sergio; Martín-Pérez, Rosa; Mennerich, Daniela; Boon, Lise; Hendrikx, Stefanie; Maddocks, Oliver DK; Marx, Christian; Radhakrishnan, Praveen; Prenen, Hans; Schneider, Martin; Myllyharju, Johanna; Kietzmann, Thomas; Vousden, Karen H; Zanivan, Sara; Mazzone, Massimiliano

    2015-01-01

    Overcoming resistance to chemotherapy is a major challenge in colorectal cancer (CRC) treatment, especially since the underlying molecular mechanisms remain unclear. We show that silencing of the prolyl hydroxylase domain protein PHD1, but not PHD2 or PHD3, prevents p53 activation upon chemotherapy in different CRC cell lines, thereby inhibiting DNA repair and favoring cell death. Mechanistically, PHD1 activity reinforces p53 binding to p38α kinase in a hydroxylation-dependent manner. Following p53–p38α interaction and chemotherapeutic damage, p53 can be phosphorylated at serine 15 and thus activated. Active p53 allows nucleotide excision repair by interacting with the DNA helicase XPB, thereby protecting from chemotherapy-induced apoptosis. In accord with this observation, PHD1 knockdown greatly sensitizes CRC to 5-FU in mice. We propose that PHD1 is part of the resistance machinery in CRC, supporting rational drug design of PHD1-specific inhibitors and their use in combination with chemotherapy. PMID:26290450

  17. Noncoding RNAs Regulating p53 and c-Myc Signaling.

    PubMed

    Mei, Yide; Wu, Mian

    2016-01-01

    p53 is one of the most important tumor suppressors and is known to play critical roles in the process of tumor development. Similarly, as an important proto-oncogenes, c-Myc is activated in over half of human cancers. Both p53 and c-Myc participate in almost every crucial decision of almost every cell. Therefore, it is utmost important to gain a better understanding of how they affect multiple cellular processes. The physiological and pathologic patterns of p53 and c-Myc regulations are modulated by a large number of cis-elements and transfactors (RNAs and proteins). These elements and factors are composed of a complicated network of intracellular and extracellular pathways. How the noncoding RNAs are involved in their regulations has not been comprehensively reviewed. In this chapter, we will list and describe recently published important noncoding RNAs including microRNAs and long noncoding RNAs, which act as effectors and regulators for both p53 and c-Myc regulation. The purpose of this chapter is to provide a recent progress of noncoding RNA in the regulation of p53 and c-Myc on network of cellular signaling and its potential implications in both basic science and clinical application. PMID:27376742

  18. The expanding regulatory universe of p53 in gastrointestinal cancer.

    PubMed

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  19. The expanding regulatory universe of p53 in gastrointestinal cancer.

    PubMed

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer. PMID:27508057

  20. The expanding regulatory universe of p53 in gastrointestinal cancer

    PubMed Central

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer. PMID:27508057

  1. Regulation of p53 is critical for vertebrate limb regeneration.

    PubMed

    Yun, Maximina H; Gates, Phillip B; Brockes, Jeremy P

    2013-10-22

    Extensive regeneration of the vertebrate body plan is found in salamander and fish species. In these organisms, regeneration takes place through reprogramming of differentiated cells, proliferation, and subsequent redifferentiation of adult tissues. Such plasticity is rarely found in adult mammalian tissues, and this has been proposed as the basis of their inability to regenerate complex structures. Despite their importance, the mechanisms underlying the regulation of the differentiated state during regeneration remain unclear. Here, we analyzed the role of the tumor-suppressor p53 during salamander limb regeneration. The activity of p53 initially decreases and then returns to baseline. Its down-regulation is required for formation of the blastema, and its up-regulation is necessary for the redifferentiation phase. Importantly, we show that a decrease in the level of p53 activity is critical for cell cycle reentry of postmitotic, differentiated cells, whereas an increase is required for muscle differentiation. In addition, we have uncovered a potential mechanism for the regulation of p53 during limb regeneration, based on its competitive inhibition by ΔNp73. Our results suggest that the regulation of p53 activity is a pivotal mechanism that controls the plasticity of the differentiated state during regeneration. PMID:24101460

  2. The evolution of thymic lymphomas in p53 knockout mice

    PubMed Central

    Dudgeon, Crissy; Chan, Chang; Kang, Wenfeng; Sun, Yvonne; Emerson, Ryan; Robins, Harlan

    2014-01-01

    Germline deletion of the p53 gene in mice gives rise to spontaneous thymic (T-cell) lymphomas. In this study, the p53 knockout mouse was employed as a model to study the mutational evolution of tumorigenesis. The clonality of the T-cell repertoire from p53 knockout and wild-type thymic cells was analyzed at various ages employing TCRβ sequencing. These data demonstrate that p53 knockout thymic lymphomas arose in an oligoclonal fashion, with tumors evolving dominant clones over time. Exon sequencing of tumor DNA revealed that all of the independently derived oligoclonal mouse tumors had a deletion in the Pten gene prior to the formation of the TCRβ rearrangement, produced early in development. This was followed in each independent clone of the thymic lymphoma by the amplification or overexpression of cyclin Ds and Cdk6. Alterations in the expression of Ikaros were common and blocked further development of CD-4/CD-8 T cells. While the frequency of point mutations in the genome of these lymphomas was one per megabase, there were a tremendous number of copy number variations producing the tumors’ driver mutations. The initial inherited loss of p53 functions appeared to delineate an order of genetic alterations selected for during the evolution of these thymic lymphomas. PMID:25452272

  3. The p53 activation domain binds the TATA box-binding polypeptide in Holo-TFIID, and a neighboring p53 domain inhibits transcription.

    PubMed Central

    Liu, X; Miller, C W; Koeffler, P H; Berk, A J

    1993-01-01

    Antioncogene product p53 is a transcriptional transactivator. To investigate how p53 stimulates transcription, we examined the interaction of p53 with general transcription factors in vitro. We found that p53 binds directly to the human TATA box-binding polypeptide (TBP). We also observed a direct interaction between p53 and purified holo-TFIID, a complex composed of TBP and a group of TBP-associated polypeptides known as TAFs. The p53 binding domain on TBP was mapped to the conserved region of TBP, including residues 220 to 271. The TBP binding domain on p53 was mapped to the p53 activation domain between residues 20 and 57. To analyze the significance of the p53-TBP interaction in p53 transactivation, we compared the ability of Gal4-p53 fusion proteins to bind to TBP in vitro and to activate transcription in transient transfection assays. Fusion proteins which bound to TBP activated transcription, and those that did not bind to TBP did not activate transcription to a detectable level, suggesting that a direct interaction between TBP and p53 is required for p53 transactivation. We also found that inclusion of residues 93 to 160 of p53 in a Gal4-p53 fusion repressed transcriptional activation 100-fold. Consequently, this region of p53 inhibits transcriptional activation by the minimal p53 activation domain. Highest levels of activation were observed with sequences 1 to 92 of p53 fused to Gal4, even though this construct bound to TBP in vitro with an affinity similar to that of other Gal4-p53 fusion proteins. We conclude that TBP binding is necessary for p53 transcriptional activation and that p53 sequences outside the TBP binding domain modulate the level of activation. Images PMID:8497252

  4. Enhanced radiosensitization of p53 mutant cells by oleamide

    SciTech Connect

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil . E-mail: yslee@kcch.re.kr

    2006-04-01

    Purpose: Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. Methods and Materials: NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Results: Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Conclusions: Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  5. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein.

    PubMed

    Bromley, Dennis; Bauer, Matthias R; Fersht, Alan R; Daggett, Valerie

    2016-09-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be 'rescued' and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  6. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein.

    PubMed

    Bromley, Dennis; Bauer, Matthias R; Fersht, Alan R; Daggett, Valerie

    2016-09-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be 'rescued' and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant.

  7. Stochastic and Deterministic Models of Cellular p53 Regulation

    PubMed Central

    Leenders, Gerald B.; Tuszynski, Jack A.

    2013-01-01

    The protein p53 is a key regulator of cellular response to a wide variety of stressors. In cancer cells inhibitory regulators of p53 such as MDM2 and MDMX proteins are often overexpressed. We apply in silico techniques to better understand the role and interactions of these proteins in a cell cycle process. Furthermore we investigate the role of stochasticity in determining system behavior. We have found that stochasticity is able to affect system behavior profoundly. We also derive a general result for the way in which initially synchronized oscillating stochastic systems will fall out of synchronization with each other. PMID:23565502

  8. Constructive role of noise in p53 regulatory network

    NASA Astrophysics Data System (ADS)

    Hung, Yao-Chen; Hu, Chin-Kun

    2011-01-01

    We study the effect of noise on p53 regulatory network, the core of a cell's modulator for switching between survival and apoptosis. We find that the fluctuations, originating from stochastic expression of p53-responsive genes, introduce marked advantages for the system to sense external stimuli and sustain the function of switches. The coherence between a stimulus and the system's response undergoes a maximum with the raise of noise level, indicating the occurrence of stochastic resonance. The biological significance of our results is discussed.

  9. Effect of Y220C mutation on p53 and its rescue mechanism: a computer chemistry approach.

    PubMed

    Rauf, Shah Md Abdur; Endou, Akira; Takaba, Hiromitsu; Miyamoto, Akira

    2013-01-01

    Mutation causes inactivation of 'p53' tumor suppressor protein in almost fifty percent of cancers in humans. Outside the DNA-binding surface of p53, Y220C is the most common cancerous mutation. Previous studies have shown that a surface cavity is created by this mutation which destabilizes p53. PhiKan083, a carbazole derivative capable of binding with that cavity, and slows down its thermal denaturation rate. We investigated, theoretically, on mechanisms of structural stability loss due to Y220C mutation and mechanisms of stability restoration by PhiKan083 at the atomic level. From this study it is found that in Tp53C, Tyr220 has five electrostatic interactions with residues Val 147, Prol51, Pro153 and Pro223 located on S3/S4 loop and S7/S8 loop. The S7/S8 loop is stabilized by these electrostatic interactions. Due to the Y220C mutation all these electrostatic interactions are lost. As a result the structural fluctuation occurs at S7/S8 loop, and the loop is displaced from its original position after 6 ns MD simulation. When PhiKan083 is present (inserted) at the mutation site it provides five electrostatic interactions with Pro155, Glu221 and Thr230, and two hydrogen bonds with Leu145 and Asp228, respectively. These interactions provided by Pkikan083 stabilized the S7/S8 loop, and as a result it couldn't be displaced. Our results showed that due to Y220C mutation p53 became destabilized through structural fluctuations surrounding the mutation site. When PhiKan083 is present at the Y220C mutation site (in 2vuk), it provides electrostatic and hydrogen bonding interactions among residue-220, its neighboring residues and PhiKan08. These interactions give additional stability to Y220C mutant p53, thus Y220C mutant p53 doesn't destabilize.

  10. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

    PubMed Central

    Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

    2016-01-01

    Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

  11. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    SciTech Connect

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  12. Protecting the hedgerow: p53 and hedgehog pathway interactions.

    PubMed

    Ho, Louisa; Alman, Benjamin

    2010-02-01

    A common environment for the Hedgehog (Subfamily: erinaceinae) is a row of shrubs and trees often used on farms for enclosing or separating fields, called a hedgerow. Maintenance of a continuous shrub border is important for shielding crops from weather damage, but also provides an ideal protective habitat for the hedgehog. Similar to its mammalian counterpart, the Hedgehog (Hh) signalling pathway requires a controlled environment to regulate proper functioning of the cell. When allowed to run wild, constitutive activation of the Hh pathway results in tumorigenesis in different tissues types, including brain, skin and cartilage. With an additional loss of p53 tumor suppressor activity, an increase in tumor incidence, size and metastasis have been observed. p53 has a number of functions that can suppress tumor formation and growth in most, if not all Hh-related cancers, such as the inhibition of cell cycle progression and cell survival. Furthermore, increasing evidence of an interaction between p53 and Hedgehog signalling pathways suggests a critical role for the tumor suppressor activity of p53 in "protecting the hedgerow".

  13. A role for p53 in selenium-induced senescence

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The tumor suppressor p53 and the ataxia-telangiectasia mutated (ATM) kinase play important roles in the senescence response to oncogene activation and DNA damage. We have previously shown that selenium-containing compounds can activate an ATM-dependent senescence response in MRC-5 normal fibroblasts...

  14. p53 at the crossroads between cancer and neurodegeneration.

    PubMed

    Lanni, Cristina; Racchi, Marco; Memo, Maurizio; Govoni, Stefano; Uberti, Daniela

    2012-05-01

    Aging, dementia, and cancer share a critical set of altered cellular functions in response to DNA damage, genotoxic stress, and other insults. Recent data suggest that the molecular machinery involved in maintaining neural function in neurodegenerative disease may be shared with oncogenic pathways. Cancer and neurodegenerative diseases may be influenced by common signaling pathways regulating the balance of cell survival versus death, a decision often governed by checkpoint proteins. This paper focuses on one such protein, p53, which represents one of the most extensively studied proteins because of its role in cancer prevention and which, furthermore, has been recently shown to be involved in aging and Alzheimer disease (AD). The contribution of a conformational change in p53 to aging and neurodegenerative processes has yet to be elucidated. In this review we discuss the multiple functions of p53 and how these correlate between cancer and neurodegeneration, focusing on various factors that may have a role in regulating p53 activity. The observation that aging and AD interfere with proteins controlling duplication and cell cycle may lead to the speculation that, in senescent neurons, aberrations in proteins generally dealing with cell cycle control and apoptosis could affect neuronal plasticity and functioning rather than cell duplication. PMID:22387179

  15. Distinct tumor protein p53 mutants in breast cancer subgroups.

    PubMed

    Dumay, Anne; Feugeas, Jean-Paul; Wittmer, Evelyne; Lehmann-Che, Jacqueline; Bertheau, Philippe; Espié, Marc; Plassa, Louis-François; Cottu, Paul; Marty, Michel; André, Fabrice; Sotiriou, Christos; Pusztai, Lajos; de Thé, Hugues

    2013-03-01

    Tumor protein p53 (TP53) is mutated in approximately 30% of breast cancers, but this frequency fluctuates widely between subclasses. We investigated the p53 mutation status in 572 breast tumors, classified into luminal, basal and molecular apocrine subgroups. As expected, the lowest mutation frequency was observed in luminal (26%), and the highest in basal (88%) tumors. Luminal tumors showed significantly higher frequency of substitutions (82 vs. 65%), notably A/T to G/C transitions (31 vs. 15%), whereas molecular apocrine and basal tumors presented much higher frequencies of complex mutations (deletions/insertions) (36 and 33%, respectively, vs. 18%). Accordingly, missense mutations were significantly more frequent in luminal tumors (75 vs. 54%), whereas basal tumors displayed significantly increased rates of TP53 truncations (43 vs. 25%), resulting in loss of function and/or expression. Interestingly, as basal tumors, molecular apocrine tumors presented with a high rate of complex mutations, but paradoxically, these were not associated with increased frequency of p53 truncation. As in luminal tumors, this could reflect a selective pressure for p53 gain of function, possibly through P63/P73 inactivation. Collectively, these observations point not only to different mechanisms of TP53 alterations, but also to different functional consequences in the different breast cancer subtypes.

  16. p53 mutations and overexpression in locally advanced breast cancers.

    PubMed Central

    Faille, A.; De Cremoux, P.; Extra, J. M.; Linares, G.; Espie, M.; Bourstyn, E.; De Rocquancourt, A.; Giacchetti, S.; Marty, M.; Calvo, F.

    1994-01-01

    Alterations in the p53 gene were analysed in 39 patients with locally advanced breast cancers (LABCs) (stage III-IV) with inflammatory signs in most cases (UICC stage T4d = 32 patients) by molecular and immunohistochemical (IHC) approaches. All patients were included in the same therapy protocol. Using polymerase chain reaction (PCR) and a single-strand conformational polymorphism migration technique (SSCP), the presence of mutations in exons 2-11, covering the entire coding sequence of the p53 gene, was evaluated. Using the mouse specific anti-human p53 monoclonal antibody (PAb 1801), we also looked for overexpression of the p53 protein in tissue sections. In 16 cases shifted bands were reproducibly identified by PCR-SSCP, and all but one (localised to exon 10) were in exons 5-8, the usual mutational hotspots. Fifteen of these 16 samples were sequenced and 14 of the suspected mutations (36%) were confirmed. Most of them (12) were single nucleotide substitutions, and transitions were more frequent (eight cases) than transversions (four cases). Fourteen of the tumour samples were positively stained with the monoclonal antibody PAb 1801, 11 with nuclear staining only, two with mixed cytoplasmic and nuclear staining and one with cytoplasmic staining only. Staining patterns were very heterogeneous in terms of the percentage of positive cells (10-75%) and their distribution in the tissue section (isolated foci or dispersed cells). In 11 of the 14 mutated cases a positive immunostaining was observed. The presence of a p53 mutation was significantly associated with larger tumour diameter (chi 2 = 7.490, P = 0.0062) and the presence of clinical metastases (stage IV) (chi 2 = 10.113, P = 0.0015). A non-statistically significant trend of association was observed between p53 mutation, negative oestrogen receptors and lower response rate to therapy. Our results in this group of patients and the heterogeneity of the staining of tumour cells in tissue sections suggest that p53

  17. Role of p53β in the inhibition of proliferation of gastric cancer cells expressing wild-type or mutated p53.

    PubMed

    Ji, Wansheng; Ma, Jingrong; Zhang, Hongmei; Zhong, Hua; Li, Lei; Ding, Na; Jiao, Jianxin; Gao, Zhixing

    2015-07-01

    p53 is a tumor suppressor gene whose mutation is highly associated with tumorigenesis. The present study investigated the role of p53β in the inhibition of proliferation of gastric cancer cell lines expressing wild-type or mutated p53. Wild-type p53 is expressed in MKN45 cells, but deleted in KATOIII cells, whereas mutated p53 is expressed in SGC7901 cells. The mRNA expression levels of p53β and Δ133p53 were detected in MKN45, SGC-7901 and KATOIII gastric cancer cell lines using nested polymerase chain reaction (PCR). The mRNA expression levels of p53, p53β and B-cell lymphoma 2-associated X protein (Bax) were detected in the MKN45 and SGC-7901 cells following treatment with cisplatin by reverse transcription-PCR. The inhibition of cellular proliferation following treatment with cisplatin was measured by MTT assay. The results of the present study demonstrated that both p53β and Δ133p53 mRNA were expressed in the MKN45 cells, whereas only p53β mRNA was expressed in the SGC7901 cells. No expression of p53β or Δ133p53 mRNA was detected in the KATOIII cells. Following treatment with cisplatin, the number of both MKN45 and SGC-7901 cells was significantly reduced (P<0.001). In the MKN45 cells, p53β, p53 and Bax mRNA expression levels gradually increased with the dose of cisplatin, and the expression of p53β was positively correlated with the expression of p53 (tr=6.358, P<0.05) and Bax (tr=8.023, P<0.05). In the SGC-7901 cells, the expression levels of p53β, p53 and Bax mRNA did not alter with the dose of cisplatin, and the expression of p53β was positively correlated to the expression of p53 (tr=26.41, P<0.01) but not that of Bax. The present study identified the different roles of the p53β isoform in gastric cancer cells with different p53 backgrounds. Enhanced knowledge regarding the p53 status is required for the development of specific biological therapies against gastric cancer. PMID:25695150

  18. The effect of p53-RNAi and p53 knockout on human 8-oxoguanine DNA glycosylase (hOgg1) activity.

    PubMed

    Chatterjee, Aditi; Mambo, Elizabeth; Osada, Motonobu; Upadhyay, Sunil; Sidransky, David

    2006-01-01

    Recent evidence indicates that in vitro p53 augments base excision repair (BER) activities in mammalian cells. To understand the role of p53 in BER, we analyzed the repair activity of hOgg1 in isogenic cell lines HCT116p53+/+ and HCT116p53-/-. We found that hOgg1 activity was significantly decreased in HCT116p53-/- cells as compared with HCT116p53+/+ cells, indicating a functional role for p53 in the regulation of hOGG1. Using gel-shift assays, we showed that p53 binds to its putative cis-elements within the hOGG1 promoter. In addition we demonstrated that supplementing p53 in HCT116p53-/- cells enhanced the transcription of hOGG1. To further strengthen our findings, we used p53-RNAi to study the effects of decreased p53 levels on hOgg1 activity. We observed that p53-RNAi resulted in decreased hOGG1 expression both at the mRNA and protein levels. This decrease in hOGG1 expression was associated with reduced cell viability upon oxidative damage and reduced hOgg1 activity as evidenced by the 8-oxoG incision assay. Taken together, our results indicate that loss of p53 function can lead to decreased hOgg1 repair activity.

  19. Prodigiosin rescues deficient p53 signaling and anti-tumor effects via up-regulating p73 and disrupting its interaction with mutant p53

    PubMed Central

    Hong, Bo; Prabhu, Varun V.; Zhang, Shengliang; van den Heuvel, A. Pieter J.; Dicker, David T.; Kopelovich, Levy; El-Deiry, Wafik S.

    2015-01-01

    p53 reactivation offers a broad-based strategy for cancer therapy. In this study we report the identification of prodigiosin that can reactivate p53 family-dependent transcriptional activity in p53 deficient human colon cancer cells. Prodigiosin and its structural analogue (compound R) induced the expression of p53 target genes accompanied by cell cycle arrest and apoptosis in p53 deficient cancer cells. Prodigiosin restored p53 signaling in cancer cells harboring hotspot p53 mutations, with little to no detectable cytotoxicity in normal human fibroblasts and with no genotoxicity. Prodigiosin induced the expression of p73 and disrupted its interaction with mutant p53, thereby rescuing p53 pathway deficiency and promoting anti-tumor effects. The disruption of mutant p53/p73 interaction was specific to prodigiosin and not related to mTOR inhibition. Our findings suggest that mutant p53 needs to be targeted in the context of p73 stimulation to allow efficient restoration of the p53 pathway. In exhibiting this capability, prodigiosin and its analogue provide lead compounds to rescue deficiencies in the p53 pathway in cancer cells by up-regulating p73 and targeting mutant p53/p73 interaction there. PMID:24247721

  20. Phosphorylation at Ser-15 and Ser-392 in mutant p53 molecules from tumors is altered compared to wild-type p53

    SciTech Connect

    Ullrich, S.J.; Sakaguchi, K.; Fiscella, M.; Appella, E. ); Lees-Miller, S.P.; Anderson, C.W. ); Mercer, W.E. )

    1993-07-01

    The product of the p53 gene suppresses cell growth and plays a critical role in suppressing development of human tumors. p53 protein binds DNA, activates transcription, and can be phosphorylated at N- and C-terminal sites. Previously, wild-type p53 was shown to be hyperphosphorylated compared to mutant p53 during p53-mediated growth arrest in vivo. Here we show that Ser-15 and Ser-9 in the N-terminal transactivation domain of wild-type human p53 are phosphorylated in vivo in cells derived from the human glioblastoma line T98G. In [IIe[sup 237

  1. Transcriptional activation of the human epidermal growth factor receptor promoter by human p53.

    PubMed Central

    Ludes-Meyers, J H; Subler, M A; Shivakumar, C V; Munoz, R M; Jiang, P; Bigger, J E; Brown, D R; Deb, S P; Deb, S

    1996-01-01

    The human epidermal growth factor receptor (EGFR) promoter is activated by both wild-type and tumor-derived mutant p53. In this communication, we demonstrate that EGFR promoter sequence requirements for transactivation by wild-type and mutant p53 are different. Transient-expression assays with EGFR promoter deletions identified a wild-type human p53 response element, 5'-AGCTAGACGTCCGGGCAGCCCCCGGCG -3', from positions --265 to --239. Electrophoretic mobility shift analysis and DNase I footprinting assays indicated that wild-type p53 binds sequence specifically to the response element. Using circularly permuted DNA fragments containing the p53-binding site, we show that wild-type p53 binding induces DNA bending at this site. We further show that the EGFR promoter is also activated by tumor-derived p53 mutants p53-143A, p53-175H, p53-248W, p53-273H, and p53-281G. However, the transactivation by mutant p53 does not require the wild-type p53-binding site. The minimal EGFR promoter from positions --104 to --20 which does not contain the wild-type p53-binding site is transactivated by the p53 mutants but not by the wild-type protein, showing a difference in the mechanism of transactivation by wild-type and mutant p53. Transactivation of the EGFR promoter by p53 may represent a novel mechanism of cell growth regulation. PMID:8887630

  2. Depression of p53-independent Akt survival signals after high-LET radiation in mutated p53 cells

    NASA Astrophysics Data System (ADS)

    Ohnishi, Takeo; Takahashi, Akihisa; Nakagawa, Yosuke

    Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses the activities of serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signals were analyzed with Western blotting analysis 1 h, 2 h, 3 h and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis.Akt-related protein levels were decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G _{2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and depresses cell growth by suppressing Akt-related signals, even in the mp53 cells.

  3. A novel mutant p53 binding partner BAG5 stabilizes mutant p53 and promotes mutant p53 GOFs in tumorigenesis

    PubMed Central

    Yue, Xuetian; Zhao, Yuhan; Huang, Grace; Li, Jun; Zhu, Junlan; Feng, Zhaohui; Hu, Wenwei

    2016-01-01

    Tumor suppressor p53 is the most frequently mutated gene in human tumors. Many tumor-associated mutant p53 (mutp53) proteins gain new tumor-promoting activities, including increased proliferation, metastasis and chemoresistance of tumor cells, which are defined as gain-of-functions (GOFs). Mutp53 proteins often accumulate at high levels in human tumors, which is important for mutp53 to exert their GOFs. The mechanism underlying mutp53 proteins accumulation in tumors is not fully understood. Here, we report that BAG5, a member of Bcl-2-associated athanogene (BAG) family proteins, promotes mutp53 accumulation in tumors, which in turn enhances mutp53 GOFs. Mechanistically, BAG5 interacts with mutp53 proteins to protect mutp53 from ubiquitination and degradation by E3 ubiquitin ligases MDM2 and CHIP, which in turn promotes mutp53 protein accumulation and therefore GOFs in promoting cell proliferation, tumor growth, cell migration and chemoresistance. BAG5 is frequently overexpressed in many human tumors and the overexpression of BAG5 is associated with poor prognosis of cancer patients. Altogether, this study revealed that inhibition of mutp53 degradation by BAG5 is a novel and critical mechanism underlying mutp53 protein accumulation and GOFs in cancer. Furthermore, our results also uncovered that promoting mutp53 accumulation and GOFs is a novel mechanism of BAG5 in tumorigenesis. PMID:27807478

  4. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype

    PubMed Central

    Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    Background A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. Methods The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. Results p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. Conclusion In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways. PMID:26447864

  5. Stabilization of p53 in Influenza A Virus-infected Cells Is Associated with Compromised MDM2-mediated Ubiquitination of p53*

    PubMed Central

    Wang, Xiaodu; Deng, Xufang; Yan, Wenjun; Zhu, Zixiang; Shen, Yang; Qiu, Yafeng; Shi, Zixue; Shao, Donghua; Wei, Jianchao; Xia, Xianzhu; Ma, Zhiyong

    2012-01-01

    Influenza A virus (IAV) induces apoptosis of infected cells. In response to IAV infection, p53, a tumor suppressor involved in regulating apoptosis and host antiviral defense, accumulates and becomes activated. This study was undertaken to examine the mechanism of p53 accumulation in IAV-infected cells. Here we show that p53 accumulation in IAV-infected cells results from protein stabilization, which was associated with compromised Mdm2-mediated ubiquitination of p53. In IAV-infected cells, p53 was stabilized and its half-life was remarkably extended. The ladders of polyubiquitinated p53 were not detectable in the presence of the proteasome inhibitor MG132 and were less sensitive to proteasome-mediated degradation. IAV infection did not affect the abundance of Mdm2, a major ubiquitin E3 ligase responsible for regulating p53 ubiquitination and degradation, but weakened the interaction between p53 and Mdm2. Viral nucleoprotein (NP) was able to increase the transcriptional activity and stability of p53. Furthermore, NP was found to associate with p53 and to impair the p53-Mdm2 interaction and Mdm2-mediated p53 ubiquitination, demonstrating its role in inhibiting Mdm2-mediated p53 ubiquitination and degradation. PMID:22474335

  6. Prodigiosin rescues deficient p53 signaling and antitumor effects via upregulating p73 and disrupting its interaction with mutant p53.

    PubMed

    Hong, Bo; Prabhu, Varun V; Zhang, Shengliang; van den Heuvel, A Pieter J; Dicker, David T; Kopelovich, Levy; El-Deiry, Wafik S

    2014-02-15

    p53 reactivation offers a broad-based strategy for cancer therapy. In this study, we report the identification of prodigiosin that can reactivate p53 family-dependent transcriptional activity in p53-deficient human colon cancer cells. Prodigiosin and its structural analogue (compound R) induced the expression of p53 target genes accompanied by cell-cycle arrest and apoptosis in p53-deficient cancer cells. Prodigiosin restored p53 signaling in cancer cells harboring hotspot TP53 mutations, with little to no detectable cytotoxicity in normal human fibroblasts and with no genotoxicity. Prodigiosin induced the expression of p73 and disrupted its interaction with mutant p53, thereby rescuing p53 pathway deficiency and promoting antitumor effects. The disruption of mutant p53/p73 interaction was specific to prodigiosin and not related to mTOR inhibition. Our findings suggest that mutant p53 needs to be targeted in the context of p73 stimulation to allow efficient restoration of the p53 pathway. In exhibiting this capability, prodigiosin and its analogue provide lead compounds to rescue deficiencies in the p53 pathway in cancer cells by upregulating p73 and targeting mutant p53/p73 interaction there.

  7. FTIR observation of compression recovery of the secondary structure of heat denaturated ribonuclease A in sucrose solution

    NASA Astrophysics Data System (ADS)

    Yamamoto, T.; Chatani, E.; Kato, M.

    2010-03-01

    We have investigated the effect of pressure on the secondary structure of ribonuclease A using FTIR spectroscopy. In the presence of 47 %w/w sucrose, the intensity of an amide I' peak assigned to β-sheets of ribonuclease A was slightly recovered by applying pressure up to 200 MPa, while the peak was monotonically decreased with increasing pressure in the absence of sucrose. The present study is the first observation of the compression recovery of β-sheets in a protein by pressure in high concentration of sucrose. This result is consistent with a pressure perturbation calorimetric study (Ravindra et al. 2004 Phys. Chem. Chem. Phys. 6 1952) reported that the sign of volume change of the protein thermal denaturation changed from negative to positive by adding sugars.

  8. p53 protects against genome instability following centriole duplication failure.

    PubMed

    Lambrus, Bramwell G; Uetake, Yumi; Clutario, Kevin M; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield; Holland, Andrew J

    2015-07-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure.

  9. Molecular dynamics of the full-length p53 monomer

    PubMed Central

    Chillemi, Giovanni; Davidovich, Pavel; D’Abramo, Marco; Mametnabiev, Tazhir; Garabadzhiu, Alexander Vasilievich; Desideri, Alessandro; Melino, Gerry

    2013-01-01

    The p53 protein is frequently mutated in a very large proportion of human tumors, where it seems to acquire gain-of-function activity that facilitates tumor onset and progression. A possible mechanism is the ability of mutant p53 proteins to physically interact with other proteins, including members of the same family, namely p63 and p73, inactivating their function. Assuming that this interaction might occurs at the level of the monomer, to investigate the molecular basis for this interaction, here, we sample the structural flexibility of the wild-type p53 monomeric protein. The results show a strong stability up to 850 ns in the DNA binding domain, with major flexibility in the N-terminal transactivations domains (TAD1 and TAD2) as well as in the C-terminal region (tetramerization domain). Several stable hydrogen bonds have been detected between N-terminal or C-terminal and DNA binding domain, and also between N-terminal and C-terminal. Essential dynamics analysis highlights strongly correlated movements involving TAD1 and the proline-rich region in the N-terminal domain, the tetramerization region in the C-terminal domain; Lys120 in the DNA binding region. The herein presented model is a starting point for further investigation of the whole protein tetramer as well as of its mutants. PMID:23974096

  10. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue.

    PubMed

    Wallentine, Brad D; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F; Luecke, Hartmut

    2013-10-01

    To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol(-1) (15.1 kJ mol(-1)). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

  11. p53 protein oxidation in cultured cells in response to pyrrolidine dithiocarbamate: a novel method for relating the amount of p53 oxidation in vivo to the regulation of p53-responsive genes.

    PubMed Central

    Wu, H H; Thomas, J A; Momand, J

    2000-01-01

    A novel method was developed to determine the oxidation status of proteins in cultured cells. Methoxy-polyethylene glycol-maleimide MW 2000 (MAL-PEG) was used to covalently tag p53 protein that was oxidized at cysteine residues in cultured cells. Treatment of MCF7 breast cancer cells with pyrrolidine dithiocarbamate (PDTC), a metal chelator, resulted in a minimum of 25% oxidation of p53. The oxidized p53 had an average of one cysteine residue oxidized per p53 protein molecule. The effect of PDTC treatment on downstream components of the p53 signal-transduction pathway was tested. PDTC treatment prevented actinomycin D-mediated up-regulation of two p53 effector gene products, murine double minute clone 2 oncoprotein and p21(WAF1/CIP1) (where WAF1 corresponds to wild-type p53-activated fragment 1 and CIP1 corresponds to cyclin-dependent kinase-interacting protein 1). Actinomycin D treatment led to accumulation of p53 protein in the nucleus. However, when cells were simultaneously treated with PDTC and actinomycin D, p53 accumulated in both the nucleus and the cytoplasm. The data indicate that an average of one cysteine residue per p53 protein molecule is highly sensitive to oxidation and that p53 can be efficiently oxidized by PDTC in cultured cells. PDTC-mediated oxidation of p53 correlates with altered p53 subcellular localization and reduced activation of p53 downstream effector genes. The novel method for detecting protein oxidation detailed in the present study may be used to determine the oxidation status of specific proteins in cells. PMID:10998350

  12. Differential regulation of the REGγ–proteasome pathway by p53/TGF-β signalling and mutant p53 in cancer cells

    PubMed Central

    Ali, Amjad; Wang, Zhuo; Fu, Junjiang; Ji, Lei; Liu, Jiang; Li, Lei; Wang, Hui; Chen, Jiwu; Caulin, Carlos; Myers, Jeffrey N.; Zhang, Pei; Xiao, Jianru; Zhang, Bianhong; Li, Xiaotao

    2013-01-01

    Proteasome activity is frequently enhanced in cancer to accelerate metastasis and tumorigenesis. REGγ, a proteasome activator known to promote p53/p21/p16 degradation, is often overexpressed in cancer cells. Here we show that p53/TGF-β signalling inhibits the REGγ–20S proteasome pathway by repressing REGγ expression. Smad3 and p53 interact on the REGγ promoter via the p53RE/SBE region. Conversely, mutant p53 binds to the REGγ promoter and recruits p300. Importantly, mutant p53 prevents Smad3/N-CoR complex formation on the REGγ promoter, which enhances the activity of the REGγ–20S proteasome pathway and contributes to mutant p53 gain of function. Depletion of REGγ alters the cellular response to p53/TGF-β signalling in drug resistance, proliferation, cell cycle progression and proteasome activity. Moreover, p53 mutations show a positive correlation with REGγ expression in cancer samples. These findings suggest that targeting REGγ–20S proteasome for cancer therapy may be applicable to human tumours with abnormal p53/Smad protein status. Furthermore, this study demonstrates a link between p53/TGF-β signalling and the REGγ–20S proteasome pathway, and provides insight into the REGγ/p53 feedback loop. PMID:24157709

  13. Oxazoloisoindolinones with in vitro antitumor activity selectively activate a p53-pathway through potential inhibition of the p53-MDM2 interaction.

    PubMed

    Soares, Joana; Pereira, Nuno A L; Monteiro, Ângelo; Leão, Mariana; Bessa, Cláudia; Dos Santos, Daniel J V A; Raimundo, Liliana; Queiroz, Glória; Bisio, Alessandra; Inga, Alberto; Pereira, Clara; Santos, Maria M M; Saraiva, Lucília

    2015-01-23

    One of the most appealing targets for anticancer treatment is the p53 tumor suppressor protein. In half of human cancers, this protein is inactivated due to endogenous negative regulators such as MDM2. Actually, restoring the p53 activity, particularly through the inhibition of its interaction with MDM2, is considered a valuable therapeutic strategy against cancers with a wild-type p53 status. In this work, we report the synthesis of nine enantiopure phenylalaninol-derived oxazolopyrrolidone lactams and the evaluation of their biological effects as p53-MDM2 interaction inhibitors. Using a yeast-based screening assay, two oxazoloisoindolinones, compounds 1b and 3a, were identified as potential p53-MDM2 interaction inhibitors. The molecular mechanism of oxazoloisoindolinone 3a was further validated in human colon adenocarcinoma HCT116 cells with wild-type p53 (HCT116 p53(+/+)) and in its isogenic derivative without p53 (HCT116 p53(-/-)). Indeed, using these cells, we demonstrated that oxazoloisoindolinone 3a exhibited a p53-dependent in vitro antitumor activity through induction of G0/G1-phase cell cycle arrest and apoptosis. The selective activation of a p53-apoptotic pathway by oxazoloisoindolinone 3a was further supported by the occurrence of PARP cleavage only in p53-expressing HCT116 cells. Moreover, oxazoloisoindolinone 3a led to p53 protein stabilization and to the up-regulation of p53 transcriptional activity with increased expression levels of several p53 target genes, as p21(WAF1/CIP1), MDM2, BAX and PUMA, in p53(+/+) but not in p53(-/-) HCT116 cells. Additionally, the ability of oxazoloisoindolinone 3a to block the p53-MDM2 interaction in HCT116 p53(+/+) cells was confirmed by co-immunoprecipitation. Finally, the molecular docking analysis of the interactions between the synthesized compounds and MDM2 revealed that oxazoloisoindolinone 3a binds to MDM2. Altogether, this work adds, for the first time, the oxazoloisoindolinone scaffold to the list of

  14. Expression of full-length p53 and its isoform Δp53 in breast carcinomas in relation to mutation status and clinical parameters

    PubMed Central

    Baumbusch, Lars O; Myhre, Simen; Langerød, Anita; Bergamaschi, Anna; Geisler, Stephanie B; Lønning, Per E; Deppert, Wolfgang; Dornreiter, Irene; Børresen-Dale, Anne-Lise

    2006-01-01

    Background The tumor suppressor gene p53 (TP53) controls numerous signaling pathways and is frequently mutated in human cancers. Novel p53 isoforms suggest alternative splicing as a regulatory feature of p53 activity. Results In this study we have analyzed mRNA expression of both wild-type and mutated p53 and its respective Δp53 isoform in 88 tumor samples from breast cancer in relation to clinical parameters and molecular subgroups. Three-dimensional structure differences for the novel internally deleted p53 isoform Δp53 have been predicted. We confirmed the expression of Δp53 mRNA in tumors using quantitative real-time PCR technique. The mRNA expression levels of the two isoforms were strongly correlated in both wild-type and p53-mutated tumors, with the level of the Δp53 isoform being approximately 1/3 of that of the full-length p53 mRNA. Patients expressing mutated full-length p53 and non-mutated (wild-type) Δp53, "mutational hybrids", showed a slightly higher frequency of patients with distant metastasis at time of diagnosis compared to other patients with p53 mutations, but otherwise did not differ significantly in any other clinical parameter. Interestingly, the p53 wild-type tumors showed a wide range of mRNA expression of both p53 isoforms. Tumors with mRNA expression levels in the upper or lower quartile were significantly associated with grade and molecular subtypes. In tumors with missense or in frame mutations the mRNA expression levels of both isoforms were significantly elevated, and in tumors with nonsense, frame shift or splice mutations the mRNA levels were significantly reduced compared to those expressing wild-type p53. Conclusion Expression of p53 is accompanied by the functionally different isoform Δp53 at the mRNA level in cell lines and human breast tumors. Investigations of "mutational hybrid" patients highlighted that wild-type Δp53 does not compensates for mutated p53, but rather may be associated with a worse prognosis. In tumors

  15. Oxazoloisoindolinones with in vitro antitumor activity selectively activate a p53-pathway through potential inhibition of the p53-MDM2 interaction.

    PubMed

    Soares, Joana; Pereira, Nuno A L; Monteiro, Ângelo; Leão, Mariana; Bessa, Cláudia; Dos Santos, Daniel J V A; Raimundo, Liliana; Queiroz, Glória; Bisio, Alessandra; Inga, Alberto; Pereira, Clara; Santos, Maria M M; Saraiva, Lucília

    2015-01-23

    One of the most appealing targets for anticancer treatment is the p53 tumor suppressor protein. In half of human cancers, this protein is inactivated due to endogenous negative regulators such as MDM2. Actually, restoring the p53 activity, particularly through the inhibition of its interaction with MDM2, is considered a valuable therapeutic strategy against cancers with a wild-type p53 status. In this work, we report the synthesis of nine enantiopure phenylalaninol-derived oxazolopyrrolidone lactams and the evaluation of their biological effects as p53-MDM2 interaction inhibitors. Using a yeast-based screening assay, two oxazoloisoindolinones, compounds 1b and 3a, were identified as potential p53-MDM2 interaction inhibitors. The molecular mechanism of oxazoloisoindolinone 3a was further validated in human colon adenocarcinoma HCT116 cells with wild-type p53 (HCT116 p53(+/+)) and in its isogenic derivative without p53 (HCT116 p53(-/-)). Indeed, using these cells, we demonstrated that oxazoloisoindolinone 3a exhibited a p53-dependent in vitro antitumor activity through induction of G0/G1-phase cell cycle arrest and apoptosis. The selective activation of a p53-apoptotic pathway by oxazoloisoindolinone 3a was further supported by the occurrence of PARP cleavage only in p53-expressing HCT116 cells. Moreover, oxazoloisoindolinone 3a led to p53 protein stabilization and to the up-regulation of p53 transcriptional activity with increased expression levels of several p53 target genes, as p21(WAF1/CIP1), MDM2, BAX and PUMA, in p53(+/+) but not in p53(-/-) HCT116 cells. Additionally, the ability of oxazoloisoindolinone 3a to block the p53-MDM2 interaction in HCT116 p53(+/+) cells was confirmed by co-immunoprecipitation. Finally, the molecular docking analysis of the interactions between the synthesized compounds and MDM2 revealed that oxazoloisoindolinone 3a binds to MDM2. Altogether, this work adds, for the first time, the oxazoloisoindolinone scaffold to the list of

  16. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  17. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction

    EPA Science Inventory

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protei...

  18. A SENSITIVE IMMUNOFLUORESCENCE ASSAY FOR DETECTION OF P53 PROTEIN ACCUMULATION IN SPUTUM

    EPA Science Inventory

    p53 mutations are common genetic alterations in lung cancers and usually result in p53 protein accumulation in tumor cells. Sputum is noninvasive to collect and ideal for screening p53 abnormalities. This study was to determine the feasibility of detecting p53 protein accumulatio...

  19. Synechocystis HSP17 is an amphitropic protein that stabilizes heat-stressed membranes and binds denatured proteins for subsequent chaperone-mediated refolding

    PubMed Central

    Török, Zsolt; Goloubinoff, Pierre; Horváth, Ibolya; Tsvetkova, Nelly M.; Glatz, Attila; Balogh, Gábor; Varvasovszki, Viktória; Los, Dmitry A.; Vierling, Elizabeth; Crowe, John H.; Vígh, László

    2001-01-01

    The small heat shock proteins (sHSPs) are ubiquitous stress proteins proposed to act as molecular chaperones to prevent irreversible protein denaturation. We characterized the chaperone activity of Synechocystis HSP17 and found that it has not only protein-protective activity, but also a previously unrecognized ability to stabilize lipid membranes. Like other sHSPs, recombinant Synechocystis HSP17 formed stable complexes with denatured malate dehydrogenase and served as a reservoir for the unfolded substrate, transferring it to the DnaK/DnaJ/GrpE and GroEL/ES chaperone network for subsequent refolding. Large unilamellar vesicles made of synthetic and cyanobacterial lipids were found to modulate this refolding process. Investigation of HSP17-lipid interactions revealed a preference for the liquid crystalline phase and resulted in an elevated physical order in model lipid membranes. Direct evidence for the participation of HSP17 in the control of thylakoid membrane physical state in vivo was gained by examining an hsp17− deletion mutant compared with the isogenic wild-type hsp17+ revertant Synechocystis cells. We suggest that, together with GroEL, HSP17 behaves as an amphitropic protein and plays a dual role. Depending on its membrane or cytosolic location, it may function as a “membrane stabilizing factor” as well as a member of a multichaperone protein-folding network. Membrane association of sHSPs could antagonize the heat-induced hyperfluidization of specific membrane domains and thereby serve to preserve structural and functional integrity of biomembranes. PMID:11248038

  20. Adenovirus-mediated p53 and ING4 gene co-transfer elicits synergistic antitumor effects through enhancement of p53 acetylation in breast cancer.

    PubMed

    Wu, Jie; Zhu, Yanbo; Xu, Chun; Xu, Hong; Zhou, Xiumin; Yang, Jicheng; Xie, Yufeng; Tao, Min

    2016-01-01

    Multigene-based combination therapy may be an effective practice in cancer gene therapy. Substantial studies have demonstrated that tumor suppressor p53 acetylation is indispensable for p53 activation. Inhibitor of growth 4 (ING4), as a novel tumor suppressor, is capable of remarkably enhancing p53 acetylation and its transcriptional activity. Hence, we assumed that combined treatment of p53 and ING4 double tumor suppressors would exhibit enhanced antitumor effects. The combined therapeutic efficacy of p53 and ING4 for human cancers has not been previously reported. We thus generated multiple promoter expression cassette-based recombinant adenovirus-co-expressing ING4 and p53 double tumor suppressor genes (AdVING4/p53), evaluated the combined effects of AdVING4/p53 on breast cancer using the MDA-MB-231 (mutant p53) human breast cancer cell line, and also elucidated its underlying molecular mechanisms. We demonstrated that AdVING4/p53-mediated p53 and ING4 co-expression induced synergistic growth inhibition and apoptosis as well as enhanced effects on upregulation of acetylated p53, P21, Bax, PUMA, Noxa, cleaved caspase-9, cleaved caspase-3 and cleaved PARP, and downregulation of Bcl-2, CD31 and microvessel density (MVD) in MDA-MB-231 breast cancer in vitro and/or in vivo subcutaneous (s.c.) xenografted tumors. The synergistic antitumor activity elicited by AdVING4/p53 was closely associated with the enhanced activation of the intrinsic apoptotic pathway and synergistic inhibition of tumor angiogenesis, very possibly via ING4-mediated enhancement of p53 acetylation and activity. Thus, our results indicate that cancer gene therapy combining two or more tumor suppressors such as p53 and ING4 may constitute a novel and effective therapeutic modality for human breast cancer and other cancers.

  1. The Wip1 Phosphatase acts as a gatekeeper in the p53-Mdm2 autoregulatory loop.

    PubMed

    Lu, Xiongbin; Ma, Ou; Nguyen, Thuy-Ai; Jones, Stephen N; Oren, Moshe; Donehower, Lawrence A

    2007-10-01

    The tumor suppressor p53 is a transcription factor that responds to cellular stresses by initiating cell cycle arrest or apoptosis. One transcriptional target of p53 is Mdm2, an E3 ubiquitin ligase that interacts with p53 to promote its proteasomal degradation in a negative feedback regulatory loop. Here we show that the wild-type p53-induced phosphatase 1 (Wip1), or PPM1D, downregulates p53 protein levels by stabilizing Mdm2 and facilitating its access to p53. Wip1 interacts with and dephosphorylates Mdm2 at serine 395, a site phosphorylated by the ATM kinase. Dephosphorylated Mdm2 has increased stability and affinity for p53, facilitating p53 ubiquitination and degradation. Thus, Wip1 acts as a gatekeeper in the Mdm2-p53 regulatory loop by stabilizing Mdm2 and promoting Mdm2-mediated proteolysis of p53.

  2. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide

    SciTech Connect

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschella, Giuseppe

    2008-04-04

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53.

  3. Ribosomal protein S7 as a novel modulator of p53-MDM2 interaction: binding to MDM2, stabilization of p53 protein, and activation of p53 function.

    PubMed

    Chen, D; Zhang, Z; Li, M; Wang, W; Li, Y; Rayburn, E R; Hill, D L; Wang, H; Zhang, R

    2007-08-01

    As a major negative regulator of p53, the MDM2 oncogene plays an important role in carcinogenesis and tumor progression. MDM2 promotes p53 proteasomal degradation and negatively regulates p53 function. The mechanisms by which the MDM2-p53 interaction is regulated are not fully understood, although several MDM2-interacting molecules have recently been identified. To search for novel MDM2-binding partners, we screened a human prostate cDNA library by the yeast two-hybrid assay using full-length MDM2 protein as the bait. Among the candidate proteins, ribosomal protein S7 was identified and confirmed as a novel MDM2-interacting protein. Herein, we demonstrate that S7 binds to MDM2, in vitro and in vivo, and that the interaction between MDM2 and S7 leads to modulation of MDM2-p53 binding by forming a ternary complex among MDM2, p53 and S7. This results in the stabilization of p53 protein through abrogation of MDM2-mediated p53 ubiquitination. Consequently, S7 overexpression increases p53 transactivational activities, induces apoptosis, and inhibits cell proliferation. The identification of S7 as a novel MDM2-interacting partner contributes to elucidation of the complex regulation of the MDM2-p53 interaction and has implications in cancer prevention and therapy.

  4. p53 acetylation enhances Taxol-induced apoptosis in human cancer cells.

    PubMed

    Kim, Jae Hyeong; Yoon, Eun-Kyung; Chung, Hye-Jin; Park, Seong-Yeol; Hong, Kyeong-Man; Lee, Chang-Hun; Lee, Yeon-Su; Choi, Kyungho; Yang, Young; Kim, Kyungtae; Kim, In-Hoo

    2013-01-01

    Microtubule inhibitors (MTIs) such as Taxol have been used for treating various malignant tumors. Although MTIs have been known to induce cell death through mitotic arrest, other mechanisms can operate in MTI-induced cell death. Especially, the role of p53 in this process has been controversial for a long time. Here we investigated the function of p53 in Taxol-induced apoptosis using p53 wild type and p53 null cancer cell lines. p53 was upregulated upon Taxol treatment in p53 wild type cells and deletion of p53 diminished Taxol-induced apoptosis. p53 target proteins including MDM2, p21, BAX, and β-isoform of PUMA were also upregulated by Taxol in p53 wild type cells. Conversely, when the wild type p53 was re-introduced into two different p53 null cancer cell lines, Taxol-induced apoptosis was enhanced. Among post-translational modifications that affect p53 stability and function, p53 acetylation, rather than phosphorylation, increased significantly in Taxol-treated cells. When acetylation was enhanced by anti-Sirt1 siRNA or an HDAC inhibitor, Taxol-induced apoptosis was enhanced, which was not observed in p53 null cells. When an acetylation-defective mutant of p53 was re-introduced to p53 null cells, apoptosis was partially reduced compared to the re-introduction of the wild type p53. Thus, p53 plays a pro-apoptotic role in Taxol-induced apoptosis and acetylation of p53 contributes to this pro-apoptotic function in response to Taxol in several human cancer cell lines, suggesting that enhancing acetylation of p53 could have potential implication for increasing the sensitivity of cancer cells to Taxol.

  5. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  6. Translational approaches targeting the p53 pathway for anti-cancer therapy

    PubMed Central

    Essmann, Frank; Schulze-Osthoff, Klaus

    2012-01-01

    The p53 tumour suppressor blocks cancer development by triggering apoptosis or cellular senescence in response to oncogenic stress or DNA damage. Consequently, the p53 signalling pathway is virtually always inactivated in human cancer cells. This unifying feature has commenced tremendous efforts to develop p53-based anti-cancer therapies. Different strategies exist that are adapted to the mechanisms of p53 inactivation. In p53-mutated tumours, delivery of wild-type p53 by adenovirus-based gene therapy is now practised in China. Also, remarkable progress has been made in the development of p53-binding drugs that can rescue and reactivate the function of mutant or misfolded p53. Other biologic approaches include the development of oncolytic viruses that are designed to specifically replicate in and kill p53-defective cells. Inactivation of wt-p53 frequently results from dysregulation of MDM2, an E3 ligase that regulates p53 levels. Small-molecule drugs that inhibit the interaction of MDM2 and p53 and block p53 degradation are currently tested in clinical trials. This survey highlights the recent developments that attempt to modulate the function of p53 and outlines strategies that are being investigated for pharmacological intervention in the p53 pathway. PMID:21718309

  7. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context. PMID:25728675

  8. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  9. A dynamic P53-MDM2 model with time delay

    NASA Astrophysics Data System (ADS)

    Mihalaş, Gh. I.; Neamţu, M.; Opriş, D.; Horhat, R. F.

    2006-11-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [6] and the process described into [5] we developed a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  10. A dynamic p53-mdm2 model with distributed delay

    NASA Astrophysics Data System (ADS)

    Horhat, Raluca; Horhat, Raul Florin

    2014-12-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcripion factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. In this paper, the dynamic P53-Mdm2 interaction model with distributed delays is investigated. Both weak and Dirac kernels are taken into consideration. For Dirac case, the Hopf bifurcation is investigated. Some numerical examples are finally given for justifying the theoretical results.

  11. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53.

    PubMed

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Vande Pol, Scott; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2016-01-28

    The p53 pro-apoptotic tumour suppressor is mutated or functionally altered in most cancers. In epithelial tumours induced by 'high-risk' mucosal human papilloma viruses, including human cervical carcinoma and a growing number of head-and-neck cancers, p53 is degraded by the viral oncoprotein E6 (ref. 2). In this process, E6 binds to a short leucine (L)-rich LxxLL consensus sequence within the cellular ubiquitin ligase E6AP. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 (ref. 4). Neither E6 nor E6AP are separately able to recruit p53 (refs 3, 5), and the precise mode of assembly of E6, E6AP and p53 is unknown. Here we solve the crystal structure of a ternary complex comprising full-length human papilloma virus type 16 (HPV-16) E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumour suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against oncogenesis mediated by human papilloma virus.

  12. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2015-01-01

    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  13. p53 alteration in morphologically normal/benign breast tissue in patients with triple-negative high-grade breast carcinomas: breast p53 signature?

    PubMed

    Wang, Xi; Stolla, Moritz; Ring, Brian Z; Yang, Qi; Laughlin, Todd S; Rothberg, Paul G; Skinner, Kristin; Hicks, David G

    2016-09-01

    p53 alterations have been identified in approximately 23% of breast carcinomas, particularly in hormone receptor-negative high-grade carcinomas. It is considered to be an early event in breast carcinogenesis. Nevertheless, the putative precursor lesion of high-grade breast carcinoma remains elusive. Breast excision specimens from 93 triple-negative high-grade invasive ductal carcinomas, 48 estrogen receptor (ER)-positive/progesterone receptor-positive/Her2-negative non-high-grade invasive ductal carcinomas, and 50 mammoplasty breasts were selected. At least 2 tissue blocks with tumor and adjacent benign tissue were sectioned and subjected to immunohistochemistry staining for p53. TP53 gene sequencing was performed on select tumors. Further immunohistochemistry staining for ER and Ki-67 was performed on consecutive sections of tissue with p53-positive normal/benign cells. Of the 93 high-grade carcinomas, 51 (55%) were positive for p53 alteration, whereas only 3 (6.25%) of the 48 non-high-grade carcinomas were p53 altered. Focal p53 positivity in adjacent normal/benign breast tissue was identified in 19 cases, and 18 of them also had p53 alteration in their carcinomas. Only 1 case had focal p53 staining in normal/benign tissue, but the tumor was negative for p53 alteration. No p53 staining positivity was identified in the mammoplasty specimens. The p53-stained normal/benign cells were ER negative and did not show an increase in the Ki-67 labeling index. These findings indicate that the p53 staining positivity in normal/benign breast tissue is not a random event. It could be considered as the "p53 signature" in breast and serve as an indicator for future potential risk of p53-positive high-grade breast carcinoma.

  14. ACTIVATION OF p53 IN DOWN SYNDROME AND IN THE Ts65Dn MOUSE BRAIN IS ASSOCIATED WITH A PRO-APOPTOTIC PHENOTYPE

    PubMed Central

    Di Domenico, Fabio; Barone, Eugenio; Arena, Andrea; Lanzillotta, Chiara; Brokeaart, Diede; Blarzino, Carla; Head, Elizabeth; Butterfield, D Allan; Perluigi, Marzia

    2016-01-01

    Down Syndrome (DS) is the most common genetic cause of intellectual disability resulting from trisomy of chromosome 21. The main feature of DS neuropathology includes early onset of Alzheimer's disease, with deposition of senile plaques and tangles. We hypothesized that apoptosis may be activated in the presence of AD neuropathology in DS, thus we measured proteins associated with upstream and downstream pathways of p53 in the frontal cortex from DS cases with and without AD pathology and from Ts65Dn mice, at different ages. We observed increased acetylation and phosphorylation of p53, coupled to reduced MDM2-mediated ubiquitination and lower levels of SIRT1. Activation of p53 was associated with a number of down-stream targets (bax, PARP1, caspase-3, heat shock proteins and PGC1α) that were modulated in both DS and DS/AD compared with age-matched controls. In particular, the most relevant changes (increased p-p53, acetyl-p53 and reduced formation of MDM2/p53 complex) were found to be modified only in the presence of AD pathology in DS. In addition, a similar pattern of alterations in the p53 pathway were found in Ts65Dn mice. These results suggest that p53 may integrate different signals, which can result in a pro-apoptotic-phenotype contributing to AD neuropathology in people with DS. PMID:26967221

  15. Transponder-induced sarcoma in the heterozygous p53+/- mouse.

    PubMed

    Blanchard, K T; Barthel, C; French, J E; Holden, H E; Moretz, R; Pack, F D; Tennant, R W; Stoll, R E

    1999-01-01

    Heterozygous p53+/- transgenic mice are being studied for utility as a short-term alternative model to the 2-yr rodent carcinogenicity bioassay. During a 26-wk study to assess the potential carcinogenicity of oxymetholone using p-cresidine as a positive control, glass/polypropylene microchips (radio transponder identification devices) were subcutaneously implanted into male and female p53+/- mice. During week 15, the first palpable mass was clinically observed at an implant site. This rapidly growing mass virtually quadrupled in size by week 25. Microscopic examination of all implant sites revealed that 18 of 177 animals had a subcutaneous histologically malignant sarcoma. The neoplasms were characterized as undifferentiated sarcomas unrelated to drug treatment, as indicated by the relatively even distribution among dose groups, including controls. An unusual preneoplastic mesenchymal change characterized by the term "mesenchymal dysplasia" was present in most groups and was considered to be a prodromal change to sarcoma development. The tumors were observed to arise from dysplastic mesenchymal tissue that developed within the tissue capsule surrounding the transponder. The preneoplastic changes, including mesenchymal dysplasia, appeared to arise at the transponder's plastic anchoring barb and then progressed as a neoplasm to eventually surround the entire microchip. Capsule membrane endothelialization, inflammation, mesenchymal basophilia and dysplasia, and sarcoma were considered unequivocal preneoplastic/neoplastic responses to the transponder and were not related to treatment with either oxymetholone or p-cresidine.

  16. Crystal structure of a p53 core tetramer bound to DNA

    SciTech Connect

    Malecka, K.A.; Ho, W.C.; Marmorstein, R.

    2009-09-02

    The tumor suppressor p53 regulates downstream genes in response to many cellular stresses and is frequently mutated in human cancers. Here, we report the use of a crosslinking strategy to trap a tetrameric p53 DNA-binding domain (p53DBD) bound to DNA and the X-ray crystal structure of the protein/DNA complex. The structure reveals that two p53DBD dimers bind to B form DNA with no relative twist and that a p53 tetramer can bind to DNA without introducing significant DNA bending. The numerous dimer-dimer interactions involve several strictly conserved residues, thus suggesting a molecular basis for p53DBD-DNA binding cooperativity. Surface residue conservation of the p53DBD tetramer bound to DNA highlights possible regions of other p53 domain or p53 cofactor interactions.

  17. Proteasome inhibitors induce p53-independent apoptosis in human cancer cells.

    PubMed

    Pandit, Bulbul; Gartel, Andrei L

    2011-01-01

    Proteasome inhibitors are used against human cancer, but their mechanisms of action are not entirely understood. For example, the role of the tumor suppressor p53 is controversial. We reevaluated the role of p53 in proteasome inhibitor-induced apoptosis by using isogenic human cancer cell lines with different p53 status. We found that well-known proteasome inhibitors such as MG132 and bortezomib, as well as the recently discovered proteasome inhibitor thiostrepton, induced p53-independent apoptosis in human cancer cell lines that correlated with p53-independent induction of proapoptotic Noxa but not Puma protein. In addition, these drugs inhibited growth of several cancer cell lines independently of p53 status. Notably, thiostrepton induced more potent apoptosis in HepG2 cells with p53 knockdown than in parental cells with wild-type p53. Our data confirm that proteasome inhibitors generally induce p53-independent apoptosis in human cancer cells.

  18. In Vivo Mitochondrial p53 Translocation Triggers a Rapid First Wave of Cell Death in Response to DNA Damage That Can Precede p53 Target Gene Activation

    PubMed Central

    Erster, Susan; Mihara, Motohiro; Kim, Roger H.; Petrenko, Oleksi; Moll, Ute M.

    2004-01-01

    p53 promotes apoptosis in response to death stimuli by transactivation of target genes and by transcription-independent mechanisms. We recently showed that wild-type p53 rapidly translocates to mitochondria in response to multiple death stimuli in cultured cells. Mitochondrial p53 physically interacts with antiapoptotic Bcl proteins, induces Bak oligomerization, permeabilizes mitochondrial membranes, and rapidly induces cytochrome c release. Here we characterize the mitochondrial p53 response in vivo. Mice were subjected to γ irradiation or intravenous etoposide administration, followed by cell fractionation and immunofluorescence studies of various organs. Mitochondrial p53 accumulation occurred in radiosensitive organs like thymus, spleen, testis, and brain but not in liver and kidney. Of note, mitochondrial p53 translocation was rapid (detectable at 30 min in thymus and spleen) and triggered an early wave of marked caspase 3 activation and apoptosis. This caspase 3-mediated apoptosis was entirely p53 dependent, as shown by p53 null mice, and preceded p53 target gene activation. The transcriptional p53 program had a longer lag phase than the rapid mitochondrial p53 program. In thymus, the earliest apoptotic target gene products PUMA, Noxa, and Bax appeared at 2, 4, and 8 h, respectively, while Bid, Killer/DR5, and p53DinP1 remained uninduced even after 20 h. Target gene induction then led to further increase in active caspase 3. Similar biphasic kinetics was seen in cultured human cells. Our results suggest that in sensitive organs mitochondrial p53 accumulation in vivo occurs soon after a death stimulus, triggering a rapid first wave of apoptosis that is transcription independent and may precede a second slower wave that is transcription dependent. PMID:15254240

  19. Shifting p53-induced senescence to cell death by TIS21(/BTG2/Pc3) gene through posttranslational modification of p53 protein.

    PubMed

    Choi, Ok Ran; Ryu, Min Sook; Lim, In Kyoung

    2016-09-01

    Cellular senescence and apoptosis can be regulated by p53 activity, although the underlying mechanism of the switch between the two events remains largely unknown. Cells exposed to cancer chemotherapy can escape to senescence phenotype rather than undergoing apoptosis. By employing adenoviral transduction of p53 or TIS21 genes, we observed shifting of p53 induced-senescence to apoptosis in EJ bladder cancer cells, which express H-RasV12 and mutant p53; transduction of p53 increased H-RasV12 expression along with senescence phenotypes, whereas coexpression with TIS21 (p53+TIS21) induced cell death rather than senescence. The TIS21-mediated switch of senescence to apoptosis was accompanied by nuclear translocation of p53 protein and its modifications on Ser-15 and Ser-46 phosphorylation and acetylations on Lys-120, -320, -373 and -382 residues. Mechanistically, TIS21(/BTG2) regulated posttranslational modification of p53 via enhancing miR34a and Bax expressions as opposed to inhibiting SIRT1 and Bcl2 expression. At the same time, TIS21 increased APAF-1 and p53AIP1 expressions, but inhibited the interaction of p53 with iASPP. In vitro tumorigenicity was significantly reduced in the p53+TIS21 expresser through inhibiting micro-colony proliferation by TIS21. Effect of TIS21 on the regulation of p53 activity was confirmed by knockdown of TIS21 expression by RNA interference. Therefore, we suggest TIS21 expression as an endogenous cell death inducer at the downstream of p53 gene, which might be useful for intractable cancer chemotherapy.

  20. The Corepressor mSin3a Interacts with the Proline-Rich Domain of p53 and Protects p53 from Proteasome-Mediated Degradation

    PubMed Central

    Zilfou, Jack T.; Hoffman, William H.; Sank, Michael; George, Donna L.; Murphy, Maureen

    2001-01-01

    While the transactivation function of the tumor suppressor p53 is well understood, less is known about the transrepression functions of this protein. We have previously shown that p53 interacts with the corepressor protein mSin3a (hereafter designated Sin3) in vivo and that this interaction is critical for the ability of p53 to repress gene expression. In the present study, we demonstrate that expression of Sin3 results in posttranslational stabilization of both exogenous and endogenous p53, due to an inhibition of proteasome-mediated degradation of this protein. Stabilization of p53 by Sin3 requires the Sin3-binding domain, determined here to map to the proline-rich region of p53, from amino acids 61 to 75. The correlation between Sin3 binding and stabilization supports the hypothesis that this domain of p53 may normally be subject to a destabilizing influence. The finding that a synthetic mutant of p53 lacking the Sin3-binding domain has an increased half-life in cells, compared to wild-type p53, supports this premise. Interestingly, unlike retinoblastoma tumor suppressor protein, MDMX, and p14ARF, Sin3 stabilizes p53 in an MDM2-independent manner. The ability of Sin3 to stabilize p53 is consistent with the model whereby these two proteins must exist on a promoter for extended periods, in order for repression to be an effective mechanism of gene regulation. This model is consistent with our data indicating that, unlike the p300-p53 complex, the p53-Sin3 complex is immunologically detectable for prolonged periods following exposure of cells to agents of DNA damage. PMID:11359905

  1. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    SciTech Connect

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  2. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  3. Wild-Type p53 Binds to the TATA-Binding Protein and Represses Transcription

    NASA Astrophysics Data System (ADS)

    Seto, Edward; Usheva, Anny; Zambetti, Gerard P.; Momand, Jamil; Horikoshi, Nobuo; Weinmann, Roberto; Levine, Arnold J.; Shenk, Thomas

    1992-12-01

    p53 activates transcription of genes with a p53 response element, and it can repress genes lacking the element. Here we demonstrate that wild-type but not mutant p53 inhibits transcription in a HeLa nuclear extract from minimal promoters. Wild-type but not mutant p53 binds to human TATA-binding protein (TBP). p53 does not bind to yeast TBP, and it cannot inhibit transcription in a HeLa extract where yeast TBP substitutes for human TBP. These results suggest a model in which p53 binds to TBP and interferes with transcriptional initiation.

  4. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    SciTech Connect

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  5. Single-strand conformational polymorphism (SSCP)-detected p53 gene mutations are a less sensitive marker of malignancy in pleural fluids than p53 immunostaining.

    PubMed

    Mayall, F; Cursons, R; Jacobson, G; Chang, B

    1999-08-01

    p53 immunostaining has been advocated as a marker of malignancy in pleural biopsies and serous fluids. The object of this study was to compare the sensitivity and specificity of p53 immunostaining for the detection of malignant cells in pleural fluids with a technique designed to detect p53 gene mutations in exons 5, 6, 7 and 8 by SSCP and nucleotide sequencing. Five out of eight pleural fluids containing adenocarcinoma showed p53 immunostaining and two of these also showed polymorphisms on SSCP and a mutation on sequencing. None of the 10 benign pleural fluids showed immunostaining for p53 or polymorphisms on SSCP. We believe that the poor sensitivity of p53 gene mutation by SSCP is mainly due to DNA from the background reactive cells 'swamping' the mutant DNA. We do not advocate its use as a diagnostic aid.

  6. Complete reduction of p53 expression by RNA interference following heterozygous knockout in porcine fibroblasts.

    PubMed

    Kim, Young June; Kim, Tae-Hyun; Kim, Minjeong; Kim, Min Ju; Kim, Hae-Won; Shim, Hosup

    2016-08-01

    Tumor suppressor p53 plays a critical role in the regulation of cell cycle and apoptosis in mammals. Mutations of p53 often cause various cancers. Murine models have improved our understanding on tumorigenesis associated with p53 mutations. However, mice and humans are different in many ways. For example, the short lifespans of mice limit the clinical application of the data obtained from this species. Porcine model could be an alternative as pigs share many anatomical and physiological similarities with humans. Here, we modified the expression levels of p53 messenger RNA (mRNA) and protein in porcine fetal fibroblasts using a combination of gene targeting and RNA interference. First, we disrupted the p53 gene to produce p53 knockout (KO) cells. Second, the p53 shRNA expression vector was introduced into fibroblasts to isolate p53 knockdown (KD) cells. We obtained p53 KO, KD, and KO + KD fibroblasts which involve p53 KO and KD either separately or simultaneously. The mRNA expression of p53 in p53 KO fibroblasts was similar to that in the wild-type control. However, the mRNA expression levels of p53 in KD and KO + KD cells were significantly decreased. The p53 protein level significant reduced in p53 KD. Interestingly, no p53 protein was detected in KO + KD, suggesting a complete reduction of the protein by synergistic effect of KO and KD. This study demonstrated that various expression levels of p53 in porcine fibroblasts could be achieved by gene targeting and RNA interference. Moreover, complete abolishment of protein expression is feasible using a combination of gene targeting and RNA interference.

  7. Complete reduction of p53 expression by RNA interference following heterozygous knockout in porcine fibroblasts.

    PubMed

    Kim, Young June; Kim, Tae-Hyun; Kim, Minjeong; Kim, Min Ju; Kim, Hae-Won; Shim, Hosup

    2016-08-01

    Tumor suppressor p53 plays a critical role in the regulation of cell cycle and apoptosis in mammals. Mutations of p53 often cause various cancers. Murine models have improved our understanding on tumorigenesis associated with p53 mutations. However, mice and humans are different in many ways. For example, the short lifespans of mice limit the clinical application of the data obtained from this species. Porcine model could be an alternative as pigs share many anatomical and physiological similarities with humans. Here, we modified the expression levels of p53 messenger RNA (mRNA) and protein in porcine fetal fibroblasts using a combination of gene targeting and RNA interference. First, we disrupted the p53 gene to produce p53 knockout (KO) cells. Second, the p53 shRNA expression vector was introduced into fibroblasts to isolate p53 knockdown (KD) cells. We obtained p53 KO, KD, and KO + KD fibroblasts which involve p53 KO and KD either separately or simultaneously. The mRNA expression of p53 in p53 KO fibroblasts was similar to that in the wild-type control. However, the mRNA expression levels of p53 in KD and KO + KD cells were significantly decreased. The p53 protein level significant reduced in p53 KD. Interestingly, no p53 protein was detected in KO + KD, suggesting a complete reduction of the protein by synergistic effect of KO and KD. This study demonstrated that various expression levels of p53 in porcine fibroblasts could be achieved by gene targeting and RNA interference. Moreover, complete abolishment of protein expression is feasible using a combination of gene targeting and RNA interference. PMID:27142766

  8. Full p53 transcriptional activation potential is dispensable for tumor suppression in diverse lineages.

    PubMed

    Jiang, Dadi; Brady, Colleen A; Johnson, Thomas M; Lee, Eunice Y; Park, Eunice J; Scott, Matthew P; Attardi, Laura D

    2011-10-11

    Over half of all human cancers, of a wide variety of types, sustain mutations in the p53 tumor suppressor gene. Although p53 limits tumorigenesis through the induction of apoptosis or cell cycle arrest, its molecular mechanism of action in tumor suppression has been elusive. The best-characterized p53 activity in vitro is as a transcriptional activator, but the identification of numerous additional p53 biochemical activities in vitro has made it unclear which mechanism accounts for tumor suppression. Here, we assess the importance of transcriptional activation for p53 tumor suppression function in vivo in several tissues, using a knock-in mouse strain expressing a p53 mutant compromised for transcriptional activation, p53(25,26). p53(25,26) is severely impaired for the transactivation of numerous classical p53 target genes, including p21, Noxa, and Puma, but it retains the ability to activate a small subset of p53 target genes, including Bax. Surprisingly, p53(25,26) can nonetheless suppress tumor growth in cancers derived from the epithelial, mesenchymal, central nervous system, and lymphoid lineages. Therefore, full transactivation of most p53 target genes is dispensable for p53 tumor suppressor function in a range of tissue types. In contrast, a transcriptional activation mutant that is completely defective for transactivation, p53(25,26,53,54), fails to suppress tumor development. These findings demonstrate that transcriptional activation is indeed broadly critical for p53 tumor suppressor function, although this requirement reflects the limited transcriptional activity observed with p53(25,26) rather than robust transactivation of a full complement of p53 target genes.

  9. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    SciTech Connect

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  10. Comparative study of p53 gene and protein alterations in human astrocytic tumors.

    PubMed

    Louis, D N; von Deimling, A; Chung, R Y; Rubio, M P; Whaley, J M; Eibl, R H; Ohgaki, H; Wiestler, O D; Thor, A D; Seizinger, B R

    1993-01-01

    The p53 gene is a tumor suppressor gene involved in many common malignancies, including astrocytomas. Genetic analysis of the p53 gene and immunohistochemistry of the p53 protein have each been used to screen astrocytomas. To compare these methods, we performed immunohistochemistry with the monoclonal antibody PAb 1801 and single-strand conformational polymorphism (SSCP) with sequence analysis on 34 astrocytic tumors (WHO grades II, III and IV). Seven cases had detectable p53 protein and gene mutations, while twelve cases had neither detectable protein nor gene mutations. Four tumors had frameshift mutations in the p53 gene that were not revealed by immunohistochemistry. One tumor had a genetic polymorphism and no detectable p53 protein. Ten tumors had p53 protein accumulation but no mutations by SSCP; these cases may represent p53 mutations outside of the conserved exons or elevated levels of wild-type p53 protein. Thus, some p53 mutations are missed with PAb 1801 immunohistochemistry alone. p53 immunohistochemistry, however, may reveal p53 accumulation independent of mutations in the conserved portions of the gene. Finally, we suggest that glioblastomas with p53 mutations in the conserved region of the gene may be a subset that are more common in women and in younger patients.

  11. Targeting the replication of adenovirus to p53-defective thyroid carcinoma with a p53-regulated Cre/loxP system.

    PubMed

    Nagayama, Y; Nishihara, E; Namba, H; Yokoi, H; Hasegawa, M; Mizuguchi, H; Hayakawa, T; Hamada, H; Yamashita, S; Niwa, M

    2001-01-01

    In this article, we evaluated the feasibility of the restricted replication-competent adenoviruses for treatment of anaplastic thyroid carcinomas (ATCs), which are very aggressive and difficult to treat. Because ATCs very often harbor p53 mutations, we used wt-p53 as a regulatory factor to restrict virus replication and cytopathic effect to p53-mutated cells. The recently reported "gene inactivation strategy" using p53-regulated Cre/loxP system was employed; this system consists of two recombinant adenoviruses. One has an expression unit of the synthetic p53 - responsive promoter and the Cre recombinase gene (Axyp53RECre), and another contains two expression units; the first consists of E1A gene flanked by a pair of loxP sites downstream of the constitutive CAG promoter and the second E1B19K gene under the control of the CMV promoter (AdCALE1AL). We expected that coinfection of these two adenoviruses into the cells with wt-p53 would lead to expression of the Cre, which excises E1A gene and switches off E1A expression resulting in no virus replication, whereas in the cells with mutant p53 E1A could be expressed that leads to virus replication and cell lysis. Our in vitro data demonstrate that although infection of AdCALE1AL alone led to E1A expression, viral replication and cytolysis in all the thyroid cells examined irrespective of their p53 status, the double infection did so in FRO cells (p53-null ATC) but not in FRO cells stably expressing wt-p53 and normal thyroid cells with wt-p53. These data indicate that our double infection method may have a potential for treatment of ATC and probably also other p53-defective cancer cells. PMID:11219492

  12. Gene expression profiling analysis reveals arsenic-induced cell cycle arrest and apoptosis in p53-proficient and p53-deficient cells through differential gene pathways

    SciTech Connect

    Yu Xiaozhong Robinson, Joshua F.; Gribble, Elizabeth; Hong, Sung Woo; Sidhu, Jaspreet S.; Faustman, Elaine M.

    2008-12-15

    Arsenic (As) is a well-known environmental toxicant and carcinogen as well as an effective chemotherapeutic agent. The underlying mechanism of this dual capability, however, is not fully understood. Tumor suppressor gene p53, a pivotal cell cycle checkpoint signaling protein, has been hypothesized to play a possible role in mediating As-induced toxicity and therapeutic efficiency. In this study, we found that arsenite (As{sup 3+}) induced apoptosis and cell cycle arrest in a dose-dependent manner in both p53{sup +/+} and p53{sup -/-} mouse embryonic fibroblasts (MEFs). There was, however, a distinction between genotypes in the apoptotic response, with a more prominent induction of caspase-3 in the p53{sup -/-} cells than in the p53{sup +/+} cells. To examine this difference further, a systems-based genomic analysis was conducted comparing the critical molecular mechanisms between the p53 genotypes in response to As{sup 3+}. A significant alteration in the Nrf2-mediated oxidative stress response pathway was found in both genotypes. In p53{sup +/+} MEFs, As{sup 3+} induced p53-dependent gene expression alterations in DNA damage and cell cycle regulation genes. However, in the p53{sup -/-} MEFs, As{sup 3+} induced a significant up-regulation of pro-apoptotic genes (Noxa) and down-regulation of genes in immune modulation. Our findings demonstrate that As-induced cell death occurs through a p53-independent pathway in p53 deficient cells while apoptosis induction occurs through p53-dependent pathway in normal tissue. This difference in the mechanism of apoptotic responses between the genotypes provides important information regarding the apparent dichotomy of arsenic's dual mechanisms, and potentially leads to further advancement of its utility as a chemotherapeutic agent.

  13. Papillomavirus, p53 alteration, and primary carcinoma of the vulva.

    PubMed

    Pilotti, S; D'Amato, L; Della Torre, G; Donghi, R; Longoni, A; Giarola, M; Sampietro, G; De Palo, G; Pierotti, M A; Rilke, F

    1995-12-01

    Twenty-nine samples from 28 cases of vulvar squamous cell carcinoma, of which 13 fulfilled the criteria of the bowenoid subtype (mean age 45 years, range 31-68) and 16 of the usual subtype of invasive squamous cell carcinoma (ISCC) (mean age 67.5 years, range 34-83) were investigated for human papillomavirus (HPV) DNA, TP53 alterations, and mdm2 and bcl-2 gene product deregulation. Microscopically all the bowenoid subtype cases (group I) showed a high-grade intraepithelial (VIN 3, carcinoma in situ) lesion associated with early invasive carcinoma in six cases and overt invasive carcinoma in one. By contrast, no evidence of early carcinoma was present in the ISCCs (group II). By in situ hybridization and/or Southern blot hybridization or polymerase chain reaction (PCR), HPV DNA was detected in all cases of group I and in four of 16 cases (25%) of group II, two only by Southern blot after PCR. By single-strand conformation polymorphism and immunocytochemistry only wild-type TP53 and absence of detectable p53 product, respectively, were found in all cases of group I, i.e., in high-risk HPV-positive carcinomas, whereas mutations and/or p53 overexpression accounted for 75% in group II, i.e., in mainly HPV-negative carcinomas. The TP53 gene mutations observed in invasive carcinomas were significantly related to node-positive cases (p = 0.04). Taken together and in agreement with in vitro data, these results support the view that an alteration of TP53, gained either by interaction with viral oncoproteins or by somatic mutations, is a crucial event in the pathogenesis of vulvar carcinomas, but that TP53 mutations are mainly associated with disease progression. Finally, a preliminary immunocytochemical analysis seems to speak against the possible involvement of both MDM2 and BCL-2 gene products in the development of vulvar carcinoma.

  14. Structure of the Tfb1/p53 complex: Insights into the interaction between the p62/Tfb1 subunit of TFIIH and the activation domain of p53.

    PubMed

    Di Lello, Paola; Jenkins, Lisa M Miller; Jones, Tamara N; Nguyen, Bao D; Hara, Toshiaki; Yamaguchi, Hiroshi; Dikeakos, Jimmy D; Appella, Ettore; Legault, Pascale; Omichinski, James G

    2006-06-23

    The interaction between the amino-terminal transactivation domain (TAD) of p53 and TFIIH is directly correlated with the ability of p53 to activate both transcription initiation and elongation. We have identified a region within the p53 TAD that specifically interacts with the pleckstrin homology (PH) domain of the p62 and Tfb1 subunits of human and yeast TFIIH. We have solved the 3D structure of a complex between the p53 TAD and the PH domain of Tfb1 by NMR spectroscopy. Our structure reveals that p53 forms a nine residue amphipathic alpha helix (residues 47-55) upon binding to Tfb1. In addition, we demonstrate that diphosphorylation of p53 at Ser46 and Thr55 leads to a significant enhancement in p53 binding to p62 and Tfb1. These results indicate that a phosphorylation cascade involving Ser46 and Thr55 of p53 could play an important role in the regulation of select p53 target genes. PMID:16793543

  15. Mitochondrial localization of the low level p53 protein in proliferative cells

    SciTech Connect

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  16. Nerve growth factor receptor negates the tumor suppressor p53 as a feedback regulator

    PubMed Central

    Zhou, Xiang; Hao, Qian; Liao, Peng; Luo, Shiwen; Zhang, Minhong; Hu, Guohui; Liu, Hongbing; Zhang, Yiwei; Cao, Bo; Baddoo, Melody; Flemington, Erik K; Zeng, Shelya X; Lu, Hua

    2016-01-01

    Cancer develops and progresses often by inactivating p53. Here, we unveil nerve growth factor receptor (NGFR, p75NTR or CD271) as a novel p53 inactivator. p53 activates NGFR transcription, whereas NGFR inactivates p53 by promoting its MDM2-mediated ubiquitin-dependent proteolysis and by directly binding to its central DNA binding domain and preventing its DNA-binding activity. Inversely, NGFR ablation activates p53, consequently inducing apoptosis, attenuating survival, and reducing clonogenic capability of cancer cells, as well as sensitizing human cancer cells to chemotherapeutic agents that induce p53 and suppressing mouse xenograft tumor growth. NGFR is highly expressed in human glioblastomas, and its gene is often amplified in breast cancers with wild type p53. Altogether, our results demonstrate that cancers hijack NGFR as an oncogenic inhibitor of p53. DOI: http://dx.doi.org/10.7554/eLife.15099.001 PMID:27282385

  17. p53 binds human telomeric G-quadruplex in vitro.

    PubMed

    Adámik, Matej; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    The tumor suppressor protein p53 is a key factor in genome stability and one of the most studied of DNA binding proteins. This is the first study on the interaction of wild-type p53 with guanine quadruplexes formed by the human telomere sequence. Using electromobility shift assay and ELISA, we show that p53 binding to telomeric G-quadruplexes increases with the number of telomeric repeats. Further, p53 strongly favors G-quadruplexes folded in potassium over those formed in sodium, thus indicating the telomeric G-quadruplex conformational selectivity of p53. The presence of the quadruplex-stabilizing ligand, N-methyl mesoporphyrin IX (NMM), increases p53 recognition of G-quadruplexes in potassium. Using deletion mutants and selective p53 core domain oxidation, both p53 DNA binding domains are shown to be crucial for telomeric G-quadruplex recognition.

  18. Reactivating mutant p53 using small molecules as zinc metallochaperones: awakening a sleeping giant in cancer

    PubMed Central

    Blanden, Adam R.; Yu, Xin; Loh, Stewart N.; Levine, Arnold J.; Carpizo, Darren R.

    2016-01-01

    Tumor protein p53 (TP53) is the most commonly mutated gene in human cancer. The majority of mutations are missense, and generate a defective protein that is druggable. Yet, for decades, the small-molecule restoration of wild-type (WT) p53 function in mutant p53 tumors (so-called p53 mutant ‘reactivation’) has been elusive to researchers. The p53 protein requires the binding of a single zinc ion for proper folding, and impairing zinc binding is a major mechanism for loss of function in missense mutant p53. Here, we describe recent work defining a new class of drugs termed zinc metallochaperones that restore WT p53 structure and function by restoring Zn2+ to Zn2+-deficient mutant p53. PMID:26205328

  19. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  20. p53 negatively regulates Aurora A via both transcriptional and posttranslational regulation

    PubMed Central

    Wu, Chun-Chi; Yang, Tsung-Ying; Yu, Chang-Tze Ricky; Phan, Liem; Ivan, Cristina; Sood, Anil K.; Hsu, Shih-Lan; Lee, Mong-Hong

    2012-01-01

    p53 plays an important role in mitotic checkpoint, but what its role is remains enigmatic. Aurora A is a Ser/Thr kinase involved in correcting progression of mitosis. Here, we show that p53 is a negative regulator for Aurora A. We found that p53 deficiency leads to Aurora A elevation. Ectopic expression of p53 or DNA damage-induced expression of p53 can suppress the expression of Aurora A. Mechanistic studies show that p53 is a negative regulator for Aurora A expression through both transcriptional and posttranslational regulation. p53 knockdown in cancer cells reduces the level of p21, which, in turn, increases the activity of CDK2 followed by induction of Rb1 hyperphosphorylation and its dissociation with transcriptional factor E2F3. E2F3 can bind to Aurora A gene promoter, potentiating Aurora A gene expression and p53 deficiency, enhancing the binding of E2F3 on Aurora A promoter. Also, p53 deficiency leads to decelerating Aurora A’s turnover rate, due to the fact that p53 deficiency causes the downregulation of Fbw7α, a component of E3 ligase of Aurora A. Consistently, p53 knockdown-mediated Aurora A elevation is mitigated when Fbw7α is ectopically expressed. Thus, p53-mediated Aurora A degradation requires Fbw7α expression. Significantly, inverse correlation between p53 and Aurora A elevation is translated into the deregulation of centrosome amplification. p53 knockdown leads to high percentages of cells with abnormal amplification of centrosome. These data suggest that p53 is an important negative regulator of Aurora A, and that loss of p53 in many types of cancer could lead to abnormal elevation of Aurora A and dysregulated mitosis, which provides a growth advantage for cancer cells. PMID:22894933

  1. Divergence between the high rate of p53 mutations in skin carcinomas and the low prevalence of anti-p53 antibodies

    PubMed Central

    Moch, C; Moysan, A; Lubin, R; Salmonière, P de La; Soufir, N; Galisson, F; Vilmer, C; Venutolo, E; Pelletier, F Le; Janin, A; Basset-Séguin, N

    2001-01-01

    Circulating anti-p53 antibodies have been described and used as tumoural markers in patients with various cancers and strongly correlate with the p53 mutated status of the tumours. No study has yet looked at the prevalence of such antibodies in skin carcinoma patients although these tumours have been shown to be frequently p53 mutated. Most skin carcinoma can be diagnosed by examination or biopsy, but aggressive, recurrent and/or non-surgical cases' follow up would be helped by a biological marker of residual disease. We performed a prospective study looking at the prevalence of anti-p53 antibodies using an ELISA technique in a series of 105 skin carcinoma patients in comparison with a sex- and age-matched control skin carcinoma-free group (n = 130). Additionally, p53 accumulation was studied by immunohistochemistry to confirm p53 protein altered expression in a sample of tumours. Anti-p53 antibodies were detected in 2.9% of the cases, with a higher prevalence in patients suffering from the more aggressive squamous cell type (SCC) of skin carcinoma (8%) than for the more common and slowly growing basal cell carcinoma type or BCC (1.5%). p53 protein stabilization could be confirmed in 80% of tumours studied by IHC. This low level of anti-p53 antibody detection contrasts with the high rate of p53 mutations reported in these tumours. This observation shows that the anti-p53 humoral response is a complex and tissue-specific mechanism. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11747330

  2. Sam68 functions as a transcriptional coactivator of the p53 tumor suppressor

    PubMed Central

    Li, Naomi; Richard, Stéphane

    2016-01-01

    Sam68 is a known sequence-specific RNA binding protein that regulates alternative splicing events during the cell cycle and apoptosis. Sam68 has also been shown to influence transcription, but the molecular mechanism remains undefined. Herein we identify Sam68 as a transcriptional coactivator of the p53 tumor suppressor in response to DNA damage. Using CRISPR/Cas9 generated isogenic HCT116 Sam68−/− cell lines wild type or deficient for p53, we show that Sam68 is required for the efficient transactivation of p53 target genes. Consistently, Sam68 depletion caused defects in DNA damage-induced cell cycle arrest and apoptosis mediated by p53. Mechanistically, we demonstrate that Sam68 physically interacted with p53 in an RNA-dependent manner, and that this interaction was essential for the coactivator function of Sam68. Furthermore, we show that both Sam68 and p53 were recruited to promoters of p53-responsive genes, suggesting interdependence. Finally, Sam68 acted in concert with the p53 long noncoding RNA (lncRNA) target PR-lncRNA-1 for p53 recruitment, implicating a positive-feedback mechanism in which lncRNAs induced by the Sam68/p53 complex can enhance p53 transcriptional activity. These findings define a hitherto novel mechanism of action for Sam68 in governing p53 transcriptional activation, and represent the first report of Sam68 in the regulation of tumor suppressor activities. PMID:27365047

  3. The Mdm2 and p53 genes are conserved in the Arachnids.

    PubMed

    Lane, David P; Cheok, Chit Fang; Brown, Christopher J; Madhumalar, Arumugam; Ghadessy, Farid J; Verma, Chandra

    2010-02-15

    The p53 protein and its negative regulator the ubiquitin E3 ligase Mdm2 have been shown to be conserved from the T. adhaerens to man. In common with D. melanogaster and C. elegans, there is a single copy of the p53 gene in T. adhaerens, while in the vertebrates three p53-like genes can be found: p53, p63 and p73. The Mdm2 gene is not present within the fully sequenced and highly annotated genomes of C. elegans and D. melanogaster. However, it is present in Placazoanand the presence of multiple distinct p53 genes in the Sea anemone N. vectensis led us to examine the genomes of other phyla for p53 and Mdm2-like genes. We report here the discovery of an Mdm2-like gene and two distinct p53-like genes in the Arachnid Ioxodes scapularis (Northern Deer Tick). The two predicted Deer Tick p53 proteins are much more highly related to the human p53 protein in sequence than are the fruit fly and nematode proteins. One of the Deer Tick genes encodes a p53 protein that is initiated within the DNA binding domain of p53 and shows remarkable homology to the newly described N-terminally truncated delta isoforms of human and zebrafish p53. PMID:20160485

  4. KSHV latent protein LANA2 inhibits sumo2 modification of p53.

    PubMed

    Laura, Marcos-Villar; de la Cruz-Herrera, Carlos F; Ferreirós, Alba; Baz-Martínez, Maite; Lang, Valerie; Vidal, Anxo; Muñoz-Fontela, Cesar; Rodríguez, Manuel S; Collado, Manuel; Rivas, Carmen

    2015-01-01

    Tumor suppressor p53 plays a crucial antiviral role and targeting of p53 by viral proteins is a common mechanism involved in virus oncogenesis. The activity of p53 is tightly regulated at the post-translational levels through a myriad of modifications. Among them, modification of p53 by SUMO has been associated with the onset of cellular senescence. Kaposi´s sarcoma-associated herpesvirus (KSHV) expresses several proteins targeting p53, including the latent protein LANA2 that regulates polyubiquitylation and phosphorylation of p53. Here we show that LANA2 also inhibits the modification of p53 by SUMO2. Furthermore, we show that the reduction of p53-SUMO2 conjugation by LANA2, as well as the p53-LANA2 interaction, both require the SUMOylation of the viral protein and its interaction with SUMO or SUMOylated proteins in a non-covalent manner. Finally, we show that the control of p53-SUMO2 conjugation by LANA2 correlates with its ability to inhibit SUMO2- and type I interferon-induced senescence. These results highlight the importance of p53 SUMOylation in the control of virus infection and suggest that viral oncoproteins could contribute to viral infection and cell transformation by abrogating p53 SUMOylation.

  5. Treating cancer when pRb and p53 cannot be reactivated.

    PubMed

    Zhu, Liang

    2015-01-01

    Activation of oncoproteins and inactivation of tumor suppressors induces tumorigenesis. When these events happen upstream of pRb and p53, cancer therapies may initially succeed and then fail when pRb and p53 are activated and then re-inactivated. Therapies might succeed if they remain effective when pRb and p53 are genetically inactivated.

  6. Release of targeted p53 from the mitochondrion as an early signal during mitochondrial dysfunction.

    PubMed

    Green, M L; Pisano, M M; Prough, R A; Knudsen, T B

    2013-12-01

    Increased accumulation of p53 tumor suppressor protein is an early response to low-level stressors. To investigate the fate of mitochondrial-sequestered p53, mouse embryonic fibroblast cells (MEFs) on a p53-deficient genetic background were transfected with p53-EGFP fusion protein led by a sense (m53-EGFP) or antisense (c53-EGFP) mitochondrial import signal. Rotenone exposure (100nM, 1h) triggered the translocation of m53-EGFP from the mitochondrion to the nucleus, thus shifting the transfected cells from a mitochondrial p53 to a nuclear p53 state. Antibodies for p53 serine phosphorylation or lysine acetylation indicated a different post-translational status of recombinant p53 in the nucleus and mitochondrion, respectively. These data suggest that cycling of p53 through the mitochondria may establish a direct pathway for p53 signaling from the mitochondria to the nucleus during mitochondrial dysfunction. PK11195, a pharmacological ligand of mitochondrial TSPO (formerly known as the peripheral-type benzodiazepine receptor), partially suppressed the release of mitochondria-sequestered p53. These findings support the notion that p53 function mediates a direct signaling pathway from the mitochondria to nucleus during mitochondrial dysfunction.

  7. Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

    PubMed

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-02-11

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

  8. KSHV latent protein LANA2 inhibits sumo2 modification of p53

    PubMed Central

    Laura, Marcos-Villar; de la Cruz-Herrera, Carlos F; Ferreirós, Alba; Baz-Martínez, Maite; Lang, Valerie; Vidal, Anxo; Muñoz-Fontela, Cesar; Rodríguez, Manuel S; Collado, Manuel; Rivas, Carmen

    2015-01-01

    Tumor suppressor p53 plays a crucial antiviral role and targeting of p53 by viral proteins is a common mechanism involved in virus oncogenesis. The activity of p53 is tightly regulated at the post-translational levels through a myriad of modifications. Among them, modification of p53 by SUMO has been associated with the onset of cellular senescence. Kaposi´s sarcoma-associated herpesvirus (KSHV) expresses several proteins targeting p53, including the latent protein LANA2 that regulates polyubiquitylation and phosphorylation of p53. Here we show that LANA2 also inhibits the modification of p53 by SUMO2. Furthermore, we show that the reduction of p53-SUMO2 conjugation by LANA2, as well as the p53-LANA2 interaction, both require the SUMOylation of the viral protein and its interaction with SUMO or SUMOylated proteins in a non-covalent manner. Finally, we show that the control of p53-SUMO2 conjugation by LANA2 correlates with its ability to inhibit SUMO2- and type I interferon-induced senescence. These results highlight the importance of p53 SUMOylation in the control of virus infection and suggest that viral oncoproteins could contribute to viral infection and cell transformation by abrogating p53 SUMOylation. PMID:25607652

  9. p53 directly suppresses BNIP3 expression to protect against hypoxia-induced cell death

    PubMed Central

    Feng, Xi; Liu, Xing; Zhang, Wei; Xiao, Wuhan

    2011-01-01

    Hypoxia stabilizes the tumour suppressor p53, allowing it to function primarily as a transrepressor; however, the function of p53 during hypoxia remains unclear. In this study, we showed that p53 suppressed BNIP3 expression by directly binding to the p53-response element motif and recruiting corepressor mSin3a to the BNIP3 promoter. The DNA-binding site of p53 must remain intact for the protein to suppress the BNIP3 promoter. In addition, taking advantage of zebrafish as an in vivo model, we confirmed that zebrafish nip3a, a homologous gene of mammalian BNIP3, was indeed induced by hypoxia and p53 mutation/knockdown enhanced nip3a expression under hypoxia resulted in cell death enhancement in p53 mutant embryos. Furthermore, p53 protected against hypoxia-induced cell death mediated by p53 suppression of BNIP3 as illustrated by p53 knockdown/loss assays in both human cell lines and zebrafish model, which is in contrast to the traditional pro-apoptotic role of p53. Our results suggest a novel function of p53 in hypoxia-induced cell death, leading to the development of new treatments for ischaemic heart disease and cerebral stoke. PMID:21792176

  10. p53 expression in squamous dysplasia associated with carcinoma of the oesophagus: evidence for field carcinogenesis

    PubMed Central

    Yasuda, M; Kuwano, H; Watanabe, M; Toh, Y; Ohno, S; Sugimachi, K

    2000-01-01

    Squamous epithelial dysplasia is often observed multifocally in the cancerous oesophagus and is presumably considered to be a pre-cancerous lesion. A mutation of the p53 tumour suppressor gene is commonly identified in oesophageal cancer and dysplasia. p53 mutations can be anticipated immunohistochemically. In order to confirm the biological and clinical significance of p53 expressions in oesophageal field carcinogenesis, immunostaining for p53 in cancerous and multifocal precancerous lesions from resected human oesophagus was systematically investigated, while paying special attention to the contiguity of these lesions. Lesions expressing p53 were detected in 46.5% (20 of 43 lesions) of the invasive carcinoma, and in 51.0% (46 of 90 lesions) of the carcinoma in situ, and in 51.4% (92 of 179 lesions) of the dysplasia. Next, the p53 expression in dysplasia was compared with that in carcinoma for the same case. 37 of 39 (94.8%) dysplasias contiguous to p53-positive carcinomas also expressed p53 (P < 0.0001). On the other hand, the isolated dysplasias without contiguity to p53-positive carcinomas, only expressed p53 protein in 44.0% (11 of 25 lesions). No significant correlations were found between the p53 staining and either the clinicopathological features or prognosis. Discordant p53 alterations, such as those seen in cancerous and isolated precancerous lesions, may thus demonstrate further evidence for a multicentric or field carcinogenesis of the human oesophagus. © 2000 Cancer Research Campaign PMID:10993651

  11. HIPK2 modulates p53 activity towards pro-apoptotic transcription

    PubMed Central

    Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

    2009-01-01

    Background Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Results Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. Conclusion These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation

  12. Genome-scale functional analysis of the human genes modulating p53 activity by regulating MDM2 expression in a p53-independent manner.

    PubMed

    Kim, Dong Min; Choi, Seung-Hyun; Yeom, Young Il; Min, Sang-Hyun; Kim, Il-Chul

    2016-09-16

    MDM2, a critical negative regulator of p53, is often overexpressed in leukemia, but few p53 mutations are found, suggesting that p53-independent MDM2 expression occurs due to alterations in MDM2 upstream regulators. In this study, a high MDM2 transcription level was observed (41.17%) regardless of p53 expression in patient with acute myeloid leukemia (AML). Therefore, we performed genome-scale functional screening of the human genes modulating MDM2 expression in a p53-independent manner. We searched co-expression profiles of genes showing a positive or negative pattern with MDM2 expression in a DNA microarray database, selected1089 links, and composed a screening library of 368 genes. Using MDM2 P1 and P2 promoter-reporter systems, we screened clones regulating MDM2 transcriptions in a p53-independent manner by overexpression. Nine clones from the screening library showed enhanced MDM2 promoter activity and MDM2 expression in p53-deficient HCT116 cells. Among them, six clones, including NTRK2, GNA15, SFRS2, EIF5A, ELAVL1, and YWHAB mediated MAPK signaling for expressing MDM2. These results indicate that p53-independent upregulation of MDM2 by increasing selected clones may lead to oncogenesis in AML and that MDM2-modulating genes are novel potential targets for AML treatment. PMID:27524244

  13. p53MutaGene: an online tool to estimate the effect of p53 mutational status on gene regulation in cancer.

    PubMed

    Amelio, I; Knight, R A; Lisitsa, A; Melino, G; Antonov, A V

    2016-01-01

    p53MutaGene is the first online tool for statistical validation of hypotheses regarding the effect of p53 mutational status on gene regulation in cancer. This tool is based on several large-scale clinical gene expression data sets and currently covers breast, colon and lung cancers. The tool detects differential co-expression patterns in expression data between p53 mutated versus p53 normal samples for the user-specified genes. Statistically significant differential co-expression for a gene pair is indicative that regulation of two genes is sensitive to the presence of p53 mutations. p53MutaGene can be used in 'single mode' where the user can test a specific pair of genes or in 'discovery mode' designed for analysis of several genes. Using several examples, we demonstrate that p53MutaGene is a useful tool for fast statistical validation in clinical data of p53-dependent gene regulation patterns. The tool is freely available at http://www.bioprofiling.de/tp53.

  14. Analysis of p53 transactivation domain mutants reveals Acad11 as a metabolic target important for p53 pro-survival function

    PubMed Central

    Jiang, Dadi; LaGory, Edward L.; Brož, Daniela Kenzelmann; Bieging, Kathryn T.; Brady, Colleen A.; Link, Nichole; Abrams, John M.; Giaccia, Amato J.; Attardi, Laura D.

    2015-01-01

    SUMMARY The p53 tumor suppressor plays a key role in maintaining cellular integrity. In response to diverse stress signals, p53 can trigger apoptosis to eliminate damaged cells or cell-cycle arrest to enable cells to cope with stress and survive. However, the transcriptional networks underlying p53 pro-survival function are incompletely understood. Here, we show that in oncogenic-Ras-expressing cells, p53 promotes oxidative phosphorylation (OXPHOS) and cell survival upon glucose starvation. Analysis of p53 transcriptional activation domain mutants reveals that these responses depend on p53 transactivation function. Using gene expression profiling and ChIP-seq analysis, we identify several p53-inducible fatty acid metabolism-related genes. One such gene, Acad11, encoding a protein involved in fatty acid oxidation, is required for efficient OXPHOS and cell survival upon glucose starvation. This study provides new mechanistic insight into the pro-survival function of p53 and suggests that targeting this pathway may provide a strategy for therapeutic intervention based on metabolic perturbation. PMID:25704813

  15. Genome-scale functional analysis of the human genes modulating p53 activity by regulating MDM2 expression in a p53-independent manner.

    PubMed

    Kim, Dong Min; Choi, Seung-Hyun; Yeom, Young Il; Min, Sang-Hyun; Kim, Il-Chul

    2016-09-16

    MDM2, a critical negative regulator of p53, is often overexpressed in leukemia, but few p53 mutations are found, suggesting that p53-independent MDM2 expression occurs due to alterations in MDM2 upstream regulators. In this study, a high MDM2 transcription level was observed (41.17%) regardless of p53 expression in patient with acute myeloid leukemia (AML). Therefore, we performed genome-scale functional screening of the human genes modulating MDM2 expression in a p53-independent manner. We searched co-expression profiles of genes showing a positive or negative pattern with MDM2 expression in a DNA microarray database, selected1089 links, and composed a screening library of 368 genes. Using MDM2 P1 and P2 promoter-reporter systems, we screened clones regulating MDM2 transcriptions in a p53-independent manner by overexpression. Nine clones from the screening library showed enhanced MDM2 promoter activity and MDM2 expression in p53-deficient HCT116 cells. Among them, six clones, including NTRK2, GNA15, SFRS2, EIF5A, ELAVL1, and YWHAB mediated MAPK signaling for expressing MDM2. These results indicate that p53-independent upregulation of MDM2 by increasing selected clones may lead to oncogenesis in AML and that MDM2-modulating genes are novel potential targets for AML treatment.

  16. p53-Dependent and p53-independent induction of insulin-like growth factor binding protein-3 by deoxyribonucleic acid damage and hypoxia.

    PubMed

    Grimberg, Adda; Coleman, Carrie M; Burns, Timothy F; Himelstein, Bruce P; Koch, Cameron J; Cohen, Pinchas; El-Deiry, Wafik S

    2005-06-01

    IGF binding protein (IGFBP)-3, the principal carrier of IGFs in the circulation, contributes to both endocrine and autocrine/paracrine growth control; it can be induced by GH, cytokines, retinoic acid, and tumor suppressors. Induction of IGFBP-3 by the tumor suppressor p53 has been shown in various models that directly manipulate p53 activity. However, the physiologic settings under which this induction occurs have not been established. DNA damage and hypoxia are two important physiologic activators of p53. We have demonstrated for the first time that IGFBP-3 is an in vivo target of p53 in response to ionizing radiation. This effect was tissue specific. Furthermore, we demonstrated that genotoxic drugs could increase IGFBP-3 protein levels and secretion in tumor cell lines in a p53-independent manner. Finally, we have established that IGFBP-3 induction under hypoxic conditions is independent of p53 in tumor cell lines derived form multiple tissue types. Thus, IGFBP-3 is induced by physiologic conditions that also induce p53, although p53 is not always required. Because IGFBP-3 can inhibit growth and induce apoptosis in IGF-dependent and IGF-independent manners, its induction by DNA damage and hypoxia suggest IGFBP-3 plays a role in the physiologic protection against aberrant cell growth.

  17. PPM1D phosphatase, a target of p53 and RBM38 RNA-binding protein, inhibits p53 mRNA translation via dephosphorylation of RBM38.

    PubMed

    Zhang, M; Xu, E; Zhang, J; Chen, X

    2015-11-26

    PPM1D phosphatase, also called wild-type p53-induced phosphatase 1, promotes tumor development by inactivating the p53 tumor suppressor pathway. RBM38 RNA-binding protein, also called RNPC1 and a target of p53, inhibits p53 messenger RNA (mRNA) translation, which can be reversed by GSK3 protein kinase via phosphorylation of RBM38 at serine 195. Here we showed that ectopic expression of RBM38 increases, whereas knockdown of RBM38 inhibits, PPM1D mRNA translation. Consistent with this, we found that RBM38 directly binds to PPM1D 3'-untranslated region (3'-UTR) and promotes expression of a heterologous reporter gene that carries PPM1D 3'-UTR in a dose-dependent manner. Interestingly, we showed that PPM1D directly interacts with and dephosphorylates RBM38 at serine 195. Furthermore, we showed that PPM1D modulates p53 mRNA translation and p53-dependent growth suppression through dephosphorylation of RBM38. These findings provide evidence that the crosstalk between PPM1D and RBM38, both of which are targets and modulators of p53, has a critical role in p53 expression and activity.

  18. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  19. Inhibition of tumor angiogenesis and growth by nanoparticle-mediated p53 gene therapy in mice.

    PubMed

    Prabha, S; Sharma, B; Labhasetwar, V

    2012-08-01

    Mutation of the p53 tumor suppressor gene, the most common genetic alteration in human cancers, results in more aggressive disease and increased resistance to conventional therapies. Aggressiveness may be related to the increased angiogenic activity of cancer cells containing mutant p53. To restore wild-type p53 function in cancer cells, we developed polymeric nanoparticles (NPs) for p53 gene delivery. Previous in vitro and in vivo studies demonstrated the ability of these NPs to provide sustained intracellular release of DNA, thus sustained gene transfection and decreased tumor cell proliferation. We investigated in vivo mechanisms involved in NP-mediated p53 tumor inhibition, with focus on angiogenesis. We hypothesize that sustained p53 gene delivery will help decrease tumor angiogenic activity and thus reduce tumor growth and improve animal survival. Xenografts of p53 mutant tumors were treated with a single intratumoral injection of p53 gene-loaded NPs (p53NPs). We observed intratumoral p53 gene expression corresponding to tumor growth inhibition, over 5 weeks. Treated tumors showed upregulation of thrombospondin-1, a potent antiangiogenic factor, and a decrease in microvessel density vs controls (saline, p53 DNA alone, and control NPs). Greater levels of apoptosis were also observed in p53NP-treated tumors. Overall, this led to significantly improved survival in p53NP-treated animals. NP-mediated p53 gene delivery slowed cancer progression and improved survival in an in vivo cancer model. One mechanism by which this was accomplished was disruption of tumor angiogenesis. We conclude that the NP-mediated sustained tumor p53 gene therapy can effectively be used for tumor growth inhibition.

  20. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  1. Immunohistochemical detection of p53 in Wilms' tumors correlates with unfavorable outcome.

    PubMed Central

    Lahoti, C.; Thorner, P.; Malkin, D.; Yeger, H.

    1996-01-01

    The role of p53 in the pathogenesis and progression of Wilms' tumors is only partly understood. Although p53 mutations were initially reported only in anaplastic Wilms' tumors, we had reported that, of two of twenty-one cases that had a p53 mutation, one tumor showed no evidence of anaplasia. To determine the significance of p53 expression in all clinical stages of Wilms' tumor, twenty-eight cases were analyzed for p53 immunoreactivity. Paraffin sections were immunolabeled with two different monoclonal antibodies, recognizing both mutant and wild-type p53. Fifteen of sixteen tumors in the recurrent/metastatic group and three of twelve tumors in the nonmetastatic/nonrecurrent group showed p53 immunopositivity. Only one of three positive tumors in the latter group showed moderate to strong positivity, whereas twelve of sixteen metastatic/recurrent tumors revealed a similar degree of p53 positivity. The positivity was stronger in the metastasis/recurrences as compared with the corresponding primary tumor. Western blot analysis revealed p53 expression in all of the Wilms' tumors tested, suggesting its involvement in the development of Wilms' tumors. Single-strand conformation polymorphism analysis performed on twenty-three of these tumors revealed p53 mutations in four of fourteen recurrent/metastatic tumors and none in the nonmetastatic/nonrecurrent group. Our results show that, whereas 60% of cases were immunopositive for p53 protein, mutations were detected in only 16% of tumors, indicating that wild-type p53 protein is retained in the other tumors. We conclude that p53 immunopositivity strongly correlates with recurrence/metastasis in Wilms' tumors. Furthermore, the accumulation of p53 in these tumors is not only due to mutations but may also involve stabilization of normal p53 with other proteins. Images Figure 1 Figure 2 Figure 3 PMID:8623926

  2. Reversible induction of translational isoforms of p53 in glucose deprivation

    PubMed Central

    Khan, D; Katoch, A; Das, A; Sharathchandra, A; Lal, R; Roy, P; Das, S; Chattopadhyay, S; Das, S

    2015-01-01

    Tumor suppressor protein p53 is a master transcription regulator, indispensable for controlling several cellular pathways. Earlier work in our laboratory led to the identification of dual internal ribosome entry site (IRES) structure of p53 mRNA that regulates translation of full-length p53 and Δ40p53. IRES-mediated translation of both isoforms is enhanced under different stress conditions that induce DNA damage, ionizing radiation and endoplasmic reticulum stress, oncogene-induced senescence and cancer. In this study, we addressed nutrient-mediated translational regulation of p53 mRNA using glucose depletion. In cell lines, this nutrient-depletion stress relatively induced p53 IRES activities from bicistronic reporter constructs with concomitant increase in levels of p53 isoforms. Surprisingly, we found scaffold/matrix attachment region-binding protein 1 (SMAR1), a predominantly nuclear protein is abundant in the cytoplasm under glucose deprivation. Importantly under these conditions polypyrimidine-tract-binding protein, an established p53 ITAF did not show nuclear-cytoplasmic relocalization highlighting the novelty of SMAR1-mediated control in stress. In vivo studies in mice revealed starvation-induced increase in SMAR1, p53 and Δ40p53 levels that was reversible on dietary replenishment. SMAR1 associated with p53 IRES sequences ex vivo, with an increase in interaction on glucose starvation. RNAi-mediated-transient SMAR1 knockdown decreased p53 IRES activities in normal conditions and under glucose deprivation, this being reflected in changes in mRNAs in the p53 and Δ40p53 target genes involved in cell-cycle arrest, metabolism and apoptosis such as p21, TIGAR and Bax. This study provides a new physiological insight into the regulation of this critical tumor suppressor in nutrient starvation, also suggesting important functions of the p53 isoforms in these conditions as evident from the downstream transcriptional target activation. PMID:25721046

  3. Two-phase dynamics of p53 in the DNA damage response

    PubMed Central

    Zhang, Xiao-Peng; Liu, Feng; Wang, Wei

    2011-01-01

    The tumor suppressor p53 mainly induces cell cycle arrest/DNA repair or apoptosis in the DNA damage response. How to choose between these two outcomes is not fully understood. We proposed a four-module model of the p53 signaling network and associated the network dynamics with cellular outcomes after ionizing radiation. We found that the cellular response is mediated by both the level and posttranslational modifications of p53 and that p53 is activated in a progressive manner. First, p53 is partially activated by primary modifications such as phosphorylation at Ser-15/20 to induce cell cycle arrest, with its level varying in a series of pulses. If the damage cannot be fixed after a critical number of p53 pulses, then p53 is fully activated by further modifications such as phosphorylation at Ser-46 to trigger apoptosis, with its concentration switching to rather high levels. Thus, p53 undergoes a two-phase response in irreparably damaged cells. Such combinations of pulsatile and switch-like behaviors of p53 may represent a flexible and efficient control mode, avoiding the premature apoptosis and promoting the execution of apoptosis. In our model, p53 pulses are recurrently driven by ataxia telangiectasia mutated (ATM) pulses triggered by DNA damage. The p53-Mdm2 and ATM-p53-Wip1 negative feedback loops are responsible for p53 pulses, whereas the switching behavior occurs when the p53-PTEN-Akt-Mdm2 positive feedback loop becomes dominant. Our results suggest that a sequential predominance of distinct feedback loops may elicit multiple-phase dynamical behaviors. This work provides a new mechanism for p53 dynamics and cell fate decision. PMID:21576488

  4. p53 and Cell Cycle Effects After DNA Damage

    PubMed Central

    Senturk, Emir; Manfredi, James J.

    2016-01-01

    Flow cytometry, a valuable technique that employs the principles of light scattering, light excitation, and emission of fluorochrome molecules, can be used to assess the cell cycle position of individual cells based on DNA content. After the permeabilization of cells, the DNA can be stained with a fluorescent dye. Cells which have a 2N amount of DNA can be distinguished from cells with a 4N amount of DNA, making flow cytometry a very useful tool for the analysis of cell cycle checkpoints following DNA damage. A critical feature of the cellular response to DNA damage is the ability to pause and repair the damage so that consequential mutations are not passed along to daughter generations of cells. If cells arrest prior to DNA replication, they will contain a 2N amount of DNA, whereas arrest after replication but before mitosis will result in a 4N amount of DNA. Using this technique, the role that p53 plays in cell cycle checkpoints following DNA damage can be evaluated based on changes in the profile of the G1, S, and G2/M phases of the cell cycle. PMID:23150436

  5. Wild-type human p53 transactivates the human proliferating cell nuclear antigen promoter

    SciTech Connect

    Shivakumar, C.V.; Brown, D.R.; Deb, S.; Deb, S.P.

    1995-12-01

    The p53 tumor suppressor protein negatively regulates cell growth and somatic mutations in the p53 gene lead to uncontrolled cell growth and oncogenesis. This report describes research which demonstrates, using a number of different cell lines, that at low levels, wild-type p53 transactivates the human proliferating cell nuclear antigen (PCNA) promoter. When expressed at similar levels, tumor-derived p53 mutants did not transactivate the PCNA promoter. It also reports the identification of a wild-type human p53-binding site on the human PCNA promote. 84 refs., 5 figs, 3 tabs.

  6. Modeling the effect of p53 on tumor heterogeneity and the mutator phenotype

    NASA Astrophysics Data System (ADS)

    Ryan, Melissa; Berryman, Matthew J.; Abbott, Derek

    2005-02-01

    p53 is an important gene, involved in apoptosis (programmed cell death), DNA repair, and cell cycle progression. We explore the selective advantages and disadvantages of mutations in the p53 gene on tumor cells, and the heterogeneity of tumor cell populations. Based on an evolutionary computational approach, our model considers changes in mutation rate caused by lack of DNA repair processes, and the lack of apoptosis caused by mutations in p53. We find that the degree of robustness of p53 to mutations has a significant effect on the tumor heterogeneity and "fitness", with clinical consequences for people who inherit p53 mutations.

  7. The anti-leukemic activity of sodium dichloroacetate in p53mutated/null cells is mediated by a p53-independent ILF3/p21 pathway

    PubMed Central

    Agnoletto, Chiara; Brunelli, Laura; Melloni, Elisabetta; Pastorelli, Roberta; Casciano, Fabio; Rimondi, Erika; Rigolin, Gian Matteo; Cuneo, Antonio; Secchiero, Paola; Zauli, Giorgio

    2015-01-01

    B-chronic lymphocytic leukemia (B-CLL) patients harboring p53 mutations are invariably refractory to therapies based on purine analogues and have limited treatment options and poor survival. Having recently demonstrated that the mitochondria-targeting small molecule sodium dichloroacetate (DCA) exhibits anti-leukemic activity in p53wild-type B-CLL cells, the aim of this study was to evaluate the effect of DCA in p53mutated B-CLL cells and in p53mutated/null leukemic cell lines. DCA exhibited comparable cytotoxicity in p53wild-type and p53mutated B-CLL patient cell cultures, as well as in p53mutated B leukemic cell lines (MAVER, MEC-1, MEC-2). At the molecular level, DCA promoted the transcriptional induction of p21 in all leukemic cell types investigated, including p53null HL-60. By using a proteomic approach, we demonstrated that DCA up-regulated the ILF3 transcription factor, which is a known regulator of p21 expression. The role of the ILF3/p21 axis in mediating the DCA anti-leukemic activity was underscored by knocking-down experiments. Indeed, transfection with ILF3 and p21 siRNAs significantly decreased both the DCA-induced p21 expression and the DCA-mediated cytotoxicity. Taken together, our results emphasize that DCA is a small molecule that merits further evaluation as a therapeutic agent also for p53mutated leukemic cells, by acting through the induction of a p53-independent pathway. PMID:25544776

  8. Human papillomavirus type 16 E6 and E7 oncogenes abrogate radiation-induced DNA damage responses in vivo through p53-dependent and p53-independent pathways.

    PubMed

    Song, S; Gulliver, G A; Lambert, P F

    1998-03-01

    E6 and E7 oncoproteins from high risk human papillomaviruses (HPVs) transform cells in tissue culture and induce tumors in vivo. Both E6, which inhibits p53 functions, and E7, which inhibits pRb, can also abrogate growth arrest induced by DNA-damaging agents in cultured cells. In this study, we have used transgenic mice that express HPV-16 E6 or E7 in the epidermis to determine how these two proteins modulate DNA damage responses in vivo. Our results demonstrate that both E6 and E7 abrogate the inhibition of DNA synthesis in the epidermis after treatment with ionizing radiation. Increases in the levels of p53 and p21 proteins after irradiation were suppressed by E6 but not by E7. Through the study of p53-null mice, we found that radiation-induced growth arrest in the epidermis is mediated through both p53-dependent and p53-independent pathways. The abrogation of radiation responses in both E6 and E7 transgenic mice was more complete than was seen in the p53-null epidermis. We conclude that E6 and E7 each have the capacity to modulate p53-dependent as well as p53-independent cellular responses to radiation. Additionally, we found that the conserved region (CR) 1 and CR2 domains in E7 protein, which are involved in the inactivation of pRb function and required for E7's transforming function, were also required for E7 to modulate DNA damage responses in vivo. Thus pRb and/or pRb-like proteins likely mediate both p53-dependent and p53-independent responses to radiation.

  9. The transcription factor CREBZF is a novel positive regulator of p53

    PubMed Central

    López-Mateo, Irene; Villaronga, M. Ángeles; Llanos, Susana; Belandia, Borja

    2012-01-01

    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  10. p53-mediated control of gene expression via mRNA translation during Endoplasmic Reticulum stress.

    PubMed

    López, Ignacio; Tournillon, Anne-Sophie; Nylander, Karin; Fåhraeus, Robin

    2015-01-01

    p53 is activated by different stress and damage pathways and regulates cell biological responses including cell cycle arrest, repair pathways, apoptosis and senescence. Following DNA damage, the levels of p53 increase and via binding to target gene promoters, p53 induces expression of multiple genes including p21(CDKN1A) and mdm2. The effects of p53 on gene expression during the DNA damage response are well mimicked by overexpressing p53 under normal conditions. However, stress to the Endoplasmic Reticulum (ER) and the consequent Unfolded Protein Response (UPR) leads to the induction of the p53/47 isoform that lacks the first 40 aa of p53 and to an active suppression of p21(CDKN1A) transcription and mRNA translation. We now show that during ER stress p53 also suppresses MDM2 protein levels via a similar mechanism. These observations not only raise questions about the physiological role of MDM2 during ER stress but it also reveals a new facet of p53 as a repressor toward 2 of its major target genes during the UPR. As suppression of p21(CDKN1A) and MDM2 protein synthesis is mediated via their coding sequences, it raises the possibility that p53 controls mRNA translation via a common mechanism that might play an important role in how p53 regulates gene expression during the UPR, as compared to the transcription-dependent gene regulation taking place during the DNA damage response.

  11. p53 status in stromal fibroblasts modulates tumor growth in an SDF1-dependent manner

    PubMed Central

    Addadi, Yoseph; Moskovits, Neta; Granot, Dorit; Lozano, Guillermina; Carmi, Yaron; Apte, Ron N.; Neeman, Michal; Oren, Moshe

    2010-01-01

    The p53 tumor suppressor exerts a variety of cell-autonomous effects that are aimed to thwart tumor development. In addition, however, there is growing evidence for cell non-autonomous tumor suppressor effects of p53. In the present study, we investigated the impact of stromal p53 on tumor growth. Specifically, we found that ablation of p53 in fibroblasts enabled them to promote more efficiently the growth of tumors initiated by PC3 prostate cancer-derived cells. This stimulatory effect was dependent on the increased expression of the chemokine SDF-1 in the p53-deficient fibroblasts. Notably, fibroblasts harboring mutant p53 protein were more effective than p53-null fibroblasts in promoting tumor growth. The presence of either p53-null or p53-mutant fibroblasts led also to a markedly elevated rate of metastatic spread of the PC3 tumors. These findings implicate p53 in a cell non-autonomous tumor suppressor role within stromal fibroblasts, through suppressing the production of tumor-stimulatory factors by these cells. Moreover, expression of mutant p53 by tumor stroma fibroblasts might exert a gain of function effect, further accelerating tumor development. PMID:20952507

  12. Altered p53 in microdissected, metachronous, premalignant and malignant oral lesions from the same patients

    PubMed Central

    Li, Y-Q; Pavelic, Z P; Wang, L-J; McDonald, J S; Gleich, L; Munck-Wikland, E; Dacic, S; Danilovic, Z; Pavelic, L J; Wilson, K M; Gluckman, J L; Stambrook, P J

    1995-01-01

    Aims—To determine whether mutant p53 alleles harboured by malignant tumours of the oral cavity were also present in previous premalignant lesions at the same site. Methods—Paraffin embedded tumour specimens along with their premalignant counterparts were analysed for p53 alterations using immunohistochemistry, microdissection, polymerase chain reaction amplification, and DNA sequencing. Results—Malignant lesions from five of eight patients showed overexpression of p53 protein by immunohistochemistry. Upon DNA sequencing, two of these five specimens had p53 mutations. Of the five patients whose cancers showed p53 overexpression by immunohistochemistry, three had previous premalignant lesions that also had immunohistochemically detectable p53 protein. However, DNA sequencing showed that none of these three had mutations in the p53 gene. The remaining five premalignant lesions had no immunohistochemically detectable p53 protein. Conclusions—Some premalignant lesions have increased p53 protein which can be detected by staining with antibody to p53. This staining is not caused by mutations in p53 that are found in subsequent tumours at the same site. Images PMID:16696020

  13. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-01

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  14. Binding sequence-dependent regulation of the human proliferating cell nuclear antigen promoter by p53

    SciTech Connect

    Shan Bin . E-mail: gmorris2@tulane.edu

    2005-04-15

    Exposure of a lung epithelial cell line to ionizing radiation (IR) arrests cell cycle progression through 48 h post-exposure. Coincidentally, IR differentially activates expression of the cell cycle inhibitor, p21/WAF1, and the DNA replication protein, proliferating cell nuclear antigen (PCNA). p21/WAF1 mRNA levels remain elevated through 48 h post-exposure to IR, while PCNA mRNA levels increase transiently at early times. Since p21/WAF1 inhibits DNA replication by directly binding PCNA, the relative levels of the two proteins can determine cell cycle progression. The PCNA p53-binding site displayed reduced p53 binding affinity in vitro relative to the distal p21/WAF1 p53-binding site. Substitution of the p21/WAF1 site for the resident p53-binding site in the PCNA promoter altered the responses to increasing amounts of p53 or IR in transient expression assays. The p21/WAF1 p53-binding site sustained activation of the chimeric PCNA promoter under conditions (high p53 levels or high dose IR) that the PCNA p53-binding site did not. Binding site-specific regulation by wild-type p53 was not observed with mutant p53 harboring a serine to alanine change at amino acid 46. Limited activation of the PCNA promoter by p53 and its modified forms would restrict the amount of PCNA made available for DNA repair.

  15. A unique role for p53 in the regulation of M2 macrophage polarization.

    PubMed

    Li, L; Ng, D S W; Mah, W-C; Almeida, F F; Rahmat, S A; Rao, V K; Leow, S C; Laudisi, F; Peh, M T; Goh, A M; Lim, J S Y; Wright, G D; Mortellaro, A; Taneja, R; Ginhoux, F; Lee, C G; Moore, P K; Lane, D P

    2015-07-01

    P53 is critically important in preventing oncogenesis but its role in inflammation in general and in the function of inflammatory macrophages in particular is not clear. Here, we show that bone marrow-derived macrophages exhibit endogenous p53 activity, which is increased when macrophages are polarized to the M2 (alternatively activated macrophage) subtype. This leads to reduced expression of M2 genes. Nutlin-3a, which destabilizes the p53/MDM2 (mouse double minute 2 homolog) complex, promotes p53 activation and further downregulates M2 gene expression. In contrast, increased expression of M2 genes was apparent in M2-polarized macrophages from p53-deficient and p53 mutant mice. Furthermore, we show, in mice, that p53 also regulates M2 polarization in peritoneal macrophages from interleukin-4-challenged animals and that nutlin-3a retards the development of tolerance to Escherichia coli lipopolysaccharide. P53 acts via transcriptional repression of expression of c-Myc (v-myc avian myelocytomatosis viral oncogene homolog) gene by directly associating with its promoter. These data establish a role for the p53/MDM2/c-MYC axis as a physiological 'brake' to the M2 polarization process. This work reveals a hitherto unknown role for p53 in macrophages, provides further insight into the complexities of macrophage plasticity and raises the possibility that p53-activating drugs, many of which are currently being trialled clinically, may have unforeseen effects on macrophage function. PMID:25526089

  16. Clinical and pathological correlations of marrow PUMA and P53 expressions in myelodysplastic syndromes.

    PubMed

    Bektas, Ozlen; Uner, Aysegul; Buyukasik, Yahya; Uz, Burak; Bozkurt, Sureyya; Eliacik, Eylem; Işik, Ayse; Haznedaroglu, Ibrahim Celalettin; Goker, Hakan; Demiroglu, Haluk; Aksu, Salih; Ozcebe, Osman Ilhami; Sayinalp, Nilgun

    2015-05-01

    p53 is a key regulator of apoptosis. p53 upregulated modulator of apoptosis (PUMA) is a critical mediator of p53-dependent and independent apoptosis. The objective of this study was to evaluate the relationship of p53 and PUMA to the prognosis of MDS. Bone marrow biopsies of MDS patients at the time of diagnosis (n = 76) and at the time of transformation (n = 19) were included in the study group. The expression of p53 and PUMA was evaluated using immunohistochemistry. When compared to the control group, both p53 (p < 0.001) and PUMA (p = 0.012) expression levels were significantly higher in MDS group. In MDS group, there was a moderate positive correlation between p53 and PUMA expressions. PUMA expression was not correlated with event free and overall survival. However, overall survival was significantly lower in cases with p53 expression in more than 50% of the cells. There was an increase in PUMA expression in cases that showed transformation as compared to the initial diagnostic bone marrows but was not statistically significant. The correlation that existed between p53 and PUMA was lost in transformed cases. Our results showed that PUMA and p53 expressions are increased in MDS marrows compared to normal marrows. PUMA expression increases further during transformation while the expression of p53 is not significantly altered which suggests that PUMA alterations might be a late event during the evolution of MDS.

  17. p53 Small-molecule inhibitor enhances temozolomide cytotoxic activity against intracranial glioblastoma xenografts.

    PubMed

    Dinca, Eduard B; Lu, Kan V; Sarkaria, Jann N; Pieper, Russell O; Prados, Michael D; Haas-Kogan, Daphne A; Vandenberg, Scott R; Berger, Mitchel S; James, C David

    2008-12-15

    In this study, we investigated the precursor and active forms of a p53 small-molecule inhibitor for their effects on temozolomide (TMZ) antitumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when p53 wild-type (p53(wt)) GBMs were cotreated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased poly(ADP-ribose) polymerase cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, which is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: TMZ + p53 inhibitor precursor cotreatment of three distinct p53(wt) GBM xenografts resulted in significant enhancement of TMZ antitumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (P < 0.001 for cotreatment survival benefit in each case). Mice receiving intracranial injection with p53(null) GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhances TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner.

  18. A unique role for p53 in the regulation of M2 macrophage polarization.

    PubMed

    Li, L; Ng, D S W; Mah, W-C; Almeida, F F; Rahmat, S A; Rao, V K; Leow, S C; Laudisi, F; Peh, M T; Goh, A M; Lim, J S Y; Wright, G D; Mortellaro, A; Taneja, R; Ginhoux, F; Lee, C G; Moore, P K; Lane, D P

    2015-07-01

    P53 is critically important in preventing oncogenesis but its role in inflammation in general and in the function of inflammatory macrophages in particular is not clear. Here, we show that bone marrow-derived macrophages exhibit endogenous p53 activity, which is increased when macrophages are polarized to the M2 (alternatively activated macrophage) subtype. This leads to reduced expression of M2 genes. Nutlin-3a, which destabilizes the p53/MDM2 (mouse double minute 2 homolog) complex, promotes p53 activation and further downregulates M2 gene expression. In contrast, increased expression of M2 genes was apparent in M2-polarized macrophages from p53-deficient and p53 mutant mice. Furthermore, we show, in mice, that p53 also regulates M2 polarization in peritoneal macrophages from interleukin-4-challenged animals and that nutlin-3a retards the development of tolerance to Escherichia coli lipopolysaccharide. P53 acts via transcriptional repression of expression of c-Myc (v-myc avian myelocytomatosis viral oncogene homolog) gene by directly associating with its promoter. These data establish a role for the p53/MDM2/c-MYC axis as a physiological 'brake' to the M2 polarization process. This work reveals a hitherto unknown role for p53 in macrophages, provides further insight into the complexities of macrophage plasticity and raises the possibility that p53-activating drugs, many of which are currently being trialled clinically, may have unforeseen effects on macrophage function.

  19. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-01

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells. PMID:27551077

  20. BRCA1 regulates PIG3-mediated apoptosis in a p53-dependent manner.

    PubMed

    Zhang, Wenwen; Luo, Jiayan; Chen, Fengxia; Yang, Fang; Song, Wei; Zhu, Aiyu; Guan, Xiaoxiang

    2015-04-10

    BRCA1 plays a key role in the regulation of p53-dependent target gene transcription activation. Meanwhile, the p53 inducible gene 3 (PIG3) is a downstream target of p53 and is involved in p53-initiated apoptosis. However, little is known about whether BRCA1 can regulate PIG3-mediated apoptosis. Using a tissue microarray containing 149 breast cancer patient samples, we found that BRCA1 and PIG3 expression status were significantly positively correlated (r = 0.678, P < 0.001) and identified a significant positive correlation between high expression of BRCA1 and/or PIG3 and overall survival (OS). Moreover, we reveal that overexpression of BRCA1 significantly increased expression of PIG3 in cells with intact p53, whereas no increase in PIG3 was observed in p53-null MDA-MB-157 cells and p53-depleted HCT116p53-/- cells. Meanwhile, ectopic expression of BRCA1 could not lead to an increase expression level of prohibitin (PHB), which we have previously identified to induce PIG3-mediated apoptosis. Finally, ChIP analysis revealed that PHB can bind to the PIG3 promoter and activate PIG3 transcription independent of p53, although p53 presence did enhance this process. Taken together, our findings suggest that BRCA1 regulates PIG3-mediated apoptosis in a p53-dependent manner, and that PIG3 expression is associated with a better OS in breast cancer patients.

  1. Transcriptional repressor NIR interacts with the p53-inhibiting ubiquitin ligase MDM2

    PubMed Central

    Heyne, Kristina; Förster, Juliane; Schüle, Roland; Roemer, Klaus

    2014-01-01

    NIR (novel INHAT repressor) can bind to p53 at promoters and inhibit p53-mediated gene transactivation by blocking histone acetylation carried out by p300/CBP. Like NIR, the E3 ubiquitin ligase MDM2 can also bind and inhibit p53 at promoters. Here, we present data indicating that NIR, which shuttles between the nucleolus and nucleoplasm, not only binds to p53 but also directly to MDM2, in part via the central acidic and zinc finger domain of MDM2 that is also contacted by several other nucleolus-based MDM2/p53-regulating proteins. Like some of these, NIR was able to inhibit the ubiquitination of MDM2 and stabilize MDM2; however, unlike these nucleolus-based MDM2 regulators, NIR did not inhibit MDM2 to activate p53. Rather, NIR cooperated with MDM2 to repress p53-induced transactivation. This cooperative repression may at least in part involve p300/CBP. We show that NIR can block the acetylation of p53 and MDM2. Non-acetylated p53 has been documented previously to more readily associate with inhibitory MDM2. NIR may thus help to sustain the inhibitory p53:MDM2 complex, and we present evidence suggesting that all three proteins can indeed form a ternary complex. In sum, our findings suggest that NIR can support MDM2 to suppress p53 as a transcriptional activator. PMID:24413661

  2. The transcription factor CREBZF is a novel positive regulator of p53.

    PubMed

    López-Mateo, Irene; Villaronga, M Ángeles; Llanos, Susana; Belandia, Borja

    2012-10-15

    CREBZF is a member of the mammalian ATF/CREB family of transcription factors. Here, we describe a novel functional interaction between CREBZF and the tumor suppressor p53. CREBZF was identified in a yeast two-hybrid screen using HEY1, recently characterized as an indirect p53 activator, as bait. CREBZF interacts in vitro with both HEY1 and p53, and CREBZF expression stabilizes and activates p53. Moreover, CREBZF cooperates synergistically with HEY1 to enhance p53 transcriptional activity. On the other hand, partial depletion of endogenous CREBZF diminishes p53 protein levels and inhibits HEY1-mediated activation of p53. CREBZF-positive effects on p53 signaling may reflect, at least in part, an observed induction of posttranslational modifications in p53 known to prevent its degradation. CREBZF expression protects HCT116 cells from UV radiation-induced cell death. In addition, CREBZF expression confers sensitivity to 5-fluorouracil, a p53-activating chemotherapeutic drug. Our study suggests that CREBZF may participate in the modulation of p53 tumor suppressor function. PMID:22983008

  3. Loss of p53 induces epidermal growth factor receptor promoter activity in normal human keratinocytes

    PubMed Central

    Bheda, A; Creek, KE; Pirisi, L

    2008-01-01

    Overexpression of the epidermal growth factor receptor (EGFR) in human papillomavirus type 16-immortalized human keratinocytes (HKc) is caused by the viral oncoprotein E6, which targets p53 for degradation. We have previously observed that expression of p53 RNAi in normal HKc is associated with an increase in EGFR mRNA and protein. We now report that p53 RNAi induces EGFR promoter activity up to approximately 10-fold in normal HKc, and this effect does not require intact p53 binding sites on the EGFR promoter. Exogenous wild-type p53 inhibits the EGFR promoter at low levels, and activates it at higher concentrations. Yin Yang 1 (YY1), which negatively regulates p53, induces EGFR promoter activity, and this effect is augmented by p53 RNAi. Intact p53 binding sites on the EGFR promoter are not required for activation by YY1. In addition, Sp1 and YY1 synergistically induce the EGFR promoter in normal HKc, indicating that Sp1 may recruit YY1 as a co-activator. Wild-type p53 suppressed Sp1- and YY1-mediated induction of the EGFR promoter. We conclude that acute loss of p53 in normal HKc induces EGFR expression bya mechanism that involves YY1 and Sp1 and does not require p53 binding to the EGFR promoter. PMID:18391986

  4. Role of the p53 family in stabilizing the genome and preventing polyploidization.

    PubMed

    Talos, Flaminia; Moll, Ute M

    2010-01-01

    Cellular defects resulting in chromosomal instability and aneuploidy are the most common features of human cancers. As a major tumor suppressor and intrinsic part of several cellular checkpoints, p53 contributes to maintenance of the stability of the genetic material, both in quality (ensures faithful replication) and quantity (preservation of diploidy). Although the exact trigger of p53 in case of numerical chromosomal aberrations is unknown, the absence of p53 allows polyploid cells to proliferate and generate unstable aneuploid progeny. A more recent addition to the p53 family, p73, emerged as an important contributor to genomic integrity when p53 is inactivated. p73 loss in p53-null background leads to a rapid increase in polyploidy and aneuploidy, markedly exceeding that caused by p53 loss alone. Constitutive deregulation of Cyclin-Cdk and p27/Kip1 activities and excess failure of the G2/M DNA damage checkpoint are important deficiencies associated with p73 loss.

  5. MSK2 negatively regulates p53 activity in the absence of stress

    PubMed Central

    Llanos, Susana; Cuadrado, Ana; Serrano, Manuel

    2013-01-01

    Mitogen- and stress-activated kinase 2 (MSK2) is an inhibitor of the transcription factor p53; here, we investigate the mechanisms underlying this inhibition. In the absence of stress stimuli, MSK2 selectively suppressed the expression of a subset of p53 target genes. This basal inhibition of p53 by MSK2 occurred independently of its catalytic kinase activity and of upstream mitogen-activated protein kinase (MAPK) signaling to MSK2. Furthermore, MSK2 interacted with and inhibited the p53 coactivator p300, and associated with the Noxa promoter. Apoptotic stimuli promoted the degradation of MSK2, thus relieving its inhibitory activity towards p53 and allowing efficient p53-dependent transactivation of Noxa, which contributed to apoptosis. Together, these findings constitute a new mechanism of p53 activation in response to stress. PMID:19797274

  6. Crosstalk between tumor suppressors p53 and PKCδ: Execution of the intrinsic apoptotic pathways.

    PubMed

    Dashzeveg, Nurmaa; Yoshida, Kiyotsugu

    2016-07-28

    p53 and PKCδ are tumor suppressors that execute apoptotic mechanisms in response to various cellular stresses. p53 is a transcription factor that is frequently mutated in human cancers; it regulates apoptosis in transcription-dependent and -independent ways in response to genotoxic stresses. PKCδ is a serine/threonine protein kinase and mutated in human cancers. Available evidence shows that PKCδ activates p53 by direct and/or indirect mechanisms. Moreover, PKCδ is also implicated in the transcriptional regulation of p53 in response to DNA damage. Recent findings demonstrated that p53, in turn, binds onto the PKCδ promoter and induces its expression upon DNA damage to facilitate apoptosis. Both p53 and PKCδ are associated with the apoptotic mechanisms in the mitochondria by regulating Bcl-2 family proteins to provide mitochondrial outer membrane permeabilization. This review discusses the crosstalk between p53 and PKCδ in the context of apoptotic cell death and cancer therapy.

  7. PML IV/ARF interaction enhances p53 SUMO-1 conjugation, activation, and senescence.

    PubMed

    Ivanschitz, Lisa; Takahashi, Yuki; Jollivet, Florence; Ayrault, Olivier; Le Bras, Morgane; de Thé, Hugues

    2015-11-17

    Promyelocytic leukemia protein (PML) nuclear bodies (NBs) recruit multiple partners, including p53 and many of its regulators. NBs are believed to facilitate several posttranslational modifications and are key regulators of senescence. PML, the organizer of NBs, is expressed as a number of splice variants that all efficiently recruit p53 partners. However, overexpression of only one of them, PML IV, triggers p53-driven senescence. Here, we show that PML IV specifically binds ARF, a key p53 regulator. Similar to ARF, PML IV enhances global SUMO-1 conjugation, particularly that of p53, resulting in p53 stabilization and activation. ARF interacts with and stabilizes the NB-associated UBC9 SUMO-conjugating enzyme, possibly explaining PML IV-enhanced SUMOylation. These results unexpectedly link two key tumor suppressors, highlighting their convergence for global control of SUMO conjugation, p53 activation, and senescence induction.

  8. New insights into p53 functions through its target microRNAs

    PubMed Central

    Liao, Jun-Ming; Cao, Bo; Zhou, Xiang; Lu, Hua

    2014-01-01

    The tumor suppressor p53 pathway, whose alterations are highly associated with all types of human cancers, plays an essential role in preventing tumor development and progression mostly through its downstream target genes. Over the last decade, a growing list of p53 microRNA (miRNA) targets has been identified as additional downstream players of this pathway. Further studies of these miRNAs have revealed their more complicated regulations and functions in executing and/or regulating p53 activity. Here, we review the p53 miRNA targets identified thus far, and discuss how they fine-tune p53 stress responses, mediate the crosstalk between p53 and other signaling pathways, and expand the role of p53 in other human diseases in addition to cancers. PMID:24740682

  9. Expression of the human tumor suppressor p53 induces cell death in Pichia pastoris.

    PubMed

    Abdelmoula-Souissi, Salma; Mabrouk, Imed; Gargouri, Ali; Mokdad-Gargouri, Raja

    2012-02-01

    The human tumor suppressor p53 is known as guardian of genome because of its involvement in many signals related to cell life or death. In this work, we report that human p53 induces cell death in the yeast Pichia pastoris. We showed a growth inhibition effect, which increased with the p53 protein expression level in recombinant Mut(s) (methanol utilization slow) strain of Pichia. However, no effect of p53 was observed in recombinant strain of Mut(+) (methanol utilization plus) phenotype. Interestingly, human p53 induces cell death in recombinant strains Mut(s) with characteristic markers of apoptosis such as DNA fragmentation, exposure of phosphatidylserine, and reactive oxygen species generation. Taken together, our results strongly suggest that human p53 is biologically active in this heterologous context. Thus, we propose that P. pastoris could be a useful tool to better understand the biological function of human p53.

  10. TAp73 promotes cell survival upon genotoxic stress by inhibiting p53 activity

    PubMed Central

    Chen, Dongshi; Ming, Lihua; Zou, Fangdong; Peng, Ye; Houten, Bennett Van; Yu, Jian; Zhang, Lin

    2014-01-01

    p53 plays a key role in regulating DNA damage response by suppressing cell cycle progression or inducing apoptosis depending on extent of DNA damage. However, it is not clear why mild genotoxic stress favors growth arrest, whereas excessive lesions signal cells to die. Here we showed that TAp73, a p53 homologue thought to have a similar function as p53, restrains the transcriptional activity of p53 and prevents excessive activation of its downstream targets upon low levels of DNA damage, which results in cell cycle arrest. Extensive DNA damage triggers TAp73 depletion through ubiquitin/proteasome-mediated degradation of E2F1, leading to enhanced transcriptional activation by p53 and subsequent induction of apoptosis. These findings provide novel insights into the regulation of p53 function and suggest that TAp73 keeps p53 activity in check in regulating cell fate decisions upon genotoxic stress. PMID:25237903

  11. Human TAFII31 protein is a transcriptional coactivator of the p53 protein.

    PubMed Central

    Lu, H; Levine, A J

    1995-01-01

    The p53 protein activates transcription of a target gene by binding to a specific DNA response element and interacting with the transcriptional apparatus of RNA polymerase II. The amino-terminal domain of p53 interacts with a component of the TFIID basal transcription complex. The human TATA-binding-protein-associated factor TAFII31, a component of TFIID, has been identified as a critical protein required for p53-mediated transcriptional activation. TAFII31 and p53 proteins bind to each other via amino acid residues in the amino-terminal domain of p53 that are essential for transcription. Antibodies directed against TAFII31 protein inhibit p53-activated but not basal transcription in vitro. These results demonstrate that TAFII31 is a coactivator for the p53 protein. Images Fig. 3 Fig. 4 Fig. 6 PMID:7761466

  12. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail: Alan.Pollack@fccc.edu

    2005-09-01

    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  13. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

    PubMed Central

    2014-01-01

    Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be

  14. Controlled access of p53 to the nucleus regulates its proteasomal degradation by MDM2.

    PubMed

    Davis, James R; Mossalam, Mohanad; Lim, Carol S

    2013-04-01

    The tumor suppressor p53 can be sent to the proteasome for degradation by placing its nucleo-cytoplasmic shuttling under ligand control. Endogenous p53 is ubiquitinated by MDM2 in the nucleus, and controlling the access of p53 to the nuclear compartment regulates its ubiquitination and proteasomal degradation. This was accomplished by the use of a protein switch that places nuclear translocation under the control of externally applied dexamethasone. Fluorescence microscopy revealed that sending protein switch p53 (PS-p53) to the nucleus produces a distinct punctate distribution in both the cytoplasm and nucleus. The nuclear role in accessing the proteasome was investigated by inhibiting classical nuclear export with leptomycin B. Trapping PS-p53 in the nucleus only allows this punctate staining in that compartment, suggesting that PS-p53 must translocate first to the nuclear compartment for cytoplasmic punctate staining to occur. The role of MDM2 binding was explored by inhibiting MDM2/p53 binding with nutlin-3. Inhibition of this interaction blocked both nuclear export and cytoplasmic and nuclear punctate staining, providing evidence that any change in localization after nuclear translocation is due to MDM2 binding. Further, blocking the proteolytic activity of the proteasome maintained the nuclear localization of the construct. Truncations of p53 were made to determine smaller constructs still capable of interacting with MDM2, and their subcellular localization and degradation potential was observed. PS-p53 and a smaller construct containing the two MDM2 binding regions of p53 (Box I + V) were indeed degraded by the proteasome as measured by loss of enhanced green fluorescent protein that was also fused to the construct. The influence of these constructs on p53 gene transactivation function was assessed and revealed that PS-p53 decreased gene transactivation, while PS-p53(Box I + V) did not significantly change baseline gene transactivation.

  15. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia.

    PubMed

    Blume, C J; Hotz-Wagenblatt, A; Hüllein, J; Sellner, L; Jethwa, A; Stolz, T; Slabicki, M; Lee, K; Sharathchandra, A; Benner, A; Dietrich, S; Oakes, C C; Dreger, P; te Raa, D; Kater, A P; Jauch, A; Merkel, O; Oren, M; Hielscher, T; Zenz, T

    2015-10-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We exploited the impaired transcriptional activity of mutant p53 to map out p53 targets in CLL by small RNA sequencing. We describe the landscape of p53-dependent microRNA/non-coding RNA induced in response to DNA damage in CLL. Besides the key p53 target miR-34a, we identify a set of p53-dependent microRNAs (miRNAs; miR-182-5p, miR-7-5p and miR-320c/d). In addition to miRNAs, the long non-coding RNAs (lncRNAs) nuclear enriched abundant transcript 1 (NEAT1) and long intergenic non-coding RNA p21 (lincRNA-p21) are induced in response to DNA damage in the presence of functional p53 but not in CLL with p53 mutation. Induction of NEAT1 and lincRNA-p21 are closely correlated to the induction of cell death after DNA damage. We used isogenic lymphoma cell line models to prove p53 dependence of NEAT1 and lincRNA-p21. The current work describes the p53-dependent miRNome and identifies lncRNAs NEAT1 and lincRNA-p21 as novel elements of the p53-dependent DNA damage response machinery in CLL and lymphoma.

  16. p53 suppresses hyper-recombination by modulating BRCA1 function.

    PubMed

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N; Feng, Zhihui

    2015-09-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level.

  17. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    PubMed

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  18. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    PubMed

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  19. Lack of p53 Affects the Expression of Several Brain Mitochondrial Proteins: Insights from Proteomics into Important Pathways Regulated by p53

    PubMed Central

    Fiorini, Ada; Sultana, Rukhsana; Barone, Eugenio; Cenini, Giovanna; Perluigi, Marzia; Mancuso, Cesare; Cai, Jian; Klein, Jon B.; St. Clair, Daret; Butterfield, D. Allan

    2012-01-01

    The tumor suppressor protein p53 has been described “as the guardian of the genome” for its crucial role in regulating the transcription of numerous genes responsible for cells cycle arrest, senescence, or apoptosis in response to various stress signals. Although p53 promotes longevity by decreasing the risk of cancer through activation of apoptosis or cellular senescence, several findings suggest that an increase of its activity may have deleterious effects leading to selected aspects of the aging phenotype and neurodegenerative diseases. There is the link between p53 and oxidative stress, the latter a crucial factor that contributes to neurodegenerative processes like Alzheimer disease (AD). In the present study, using a proteomics approach, we analyzed the impact of lack of p53 on the expression of several brain mitochondrial proteins involved in different pathways, and how lack of p53 may present a target to restore neuronal impairments. Our investigation on isolated brain mitochondria from p53(−/−) mice also provides a better understanding of the p53-mitochondria relationship and its involvement in the development of many diseases. PMID:23209608

  20. Suppressing activity of tributyrin on hepatocarcinogenesis is associated with inhibiting the p53-CRM1 interaction and changing the cellular compartmentalization of p53 protein

    PubMed Central

    Ortega, Juliana F.; de Conti, Aline; Tryndyak, Volodymyr; Furtado, Kelly S.; Heidor, Renato; Horst, Maria Aderuza; Fernandes, Laura Helena Gasparini; Tavares, Paulo Eduardo Latorre Martins; Pogribna, Marta; Shpyleva, Svitlana; Beland, Frederick A.; Pogribny, Igor P.; Moreno, Fernando Salvador

    2016-01-01

    Hepatocellular carcinoma (HCC), an aggressive and the fastest growing life-threatening cancer worldwide, is often diagnosed at intermediate or advanced stages of the disease, which substantially limits therapeutic approaches for its successful treatment. This indicates that the prevention of hepatocarcinogenesis is probably the most promising approach to reduce both the HCC incidence and cancer-related mortality. In previous studies, we demonstrated a potent chemopreventive effect of tributyrin, a butyric acid prodrug, on experimental hepatocarcinogenesis. The cancer-inhibitory effect of tributyrin was linked to the suppression of sustained cell proliferation and induction of apoptotic cell death driven by an activation of the p53 apoptotic signaling pathway. The goal of the present study was to investigate the underlying molecular mechanisms linked to tributyrin-mediated p53 activation. Using in vivo and in vitro models of liver cancer, we demonstrate that an increase in the level of p53 protein in nuclei, a decrease in the level of cytoplasmic p53, and, consequently, an increase in the ratio of nuclear/cytoplasmic p53 in rat preneoplastic livers and in rat and human HCC cell lines caused by tributyrin or sodium butyrate treatments was associated with a marked increase in the level of nuclear chromosome region maintenance 1 (CRM1) protein. Mechanistically, the increase in the level of nuclear p53 protein was associated with a substantially reduced binding interaction between CRM1 and p53. The results demonstrate that the cancer-inhibitory activity of sodium butyrate and its derivatives on liver carcinogenesis may be attributed to retention of p53 and CRM1 proteins in the nucleus, an event that may trigger activation of p53-mediated apoptotic cell death in neoplastic cells. PMID:27013579

  1. A Temperature Sensitive Variant of p53 Drives p53-Dependent MicroRNA Expression without Evidence of Widespread Post-Transcriptional Gene Silencing.

    PubMed

    Cabrita, Miguel A; Vanzyl, Erin J; Hamill, Jeff D; Pan, Elysia; Marcellus, Kristen A; Tolls, Victoria J; Alonzi, Rhea C; Pastic, Alyssa; Rambo, Teeghan M E; Sayed, Hadil; McKay, Bruce C

    2016-01-01

    The p53 tumour suppressor is a transcription factor that can regulate the expression of numerous genes including many encoding proteins and microRNAs (miRNAs). The predominant outcomes of a typical p53 response are the initiation of apoptotic cascades and the activation of cell cycle checkpoints. HT29-tsp53 cells express a temperature sensitive variant of p53 and in the absence of exogenous DNA damage, these cells preferentially undergo G1 phase cell cycle arrest at the permissive temperature that correlates with increased expression of the cyclin-dependent kinase inhibitor p21WAF1. Recent evidence also suggests that a variety of miRNAs can induce G1 arrest by inhibiting the expression of proteins like CDK4 and CDK6. Here we used oligonucleotide microarrays to identify p53-regulated miRNAs that are induced in these cells undergoing G1 arrest. At the permissive temperature, the expression of several miRNAs was increased through a combination of either transcriptional or post-transcriptional regulation. In particular, miR-34a-5p, miR-143-3p and miR-145-5p were strongly induced and they reached levels comparable to that of reference miRNAs (miR-191 and miR-103). Importantly, miR-34a-5p and miR-145-5p are known to silence the Cdk4 and/or Cdk6 G1 cyclin-dependent kinases (cdks). Surprisingly, there was no p53-dependent decrease in the expression of either of these G1 cdks. To search for other potential targets of p53-regulated miRNAs, p53-downregulated mRNAs were identified through parallel microarray analysis of mRNA expression. Once again, there was no clear effect of p53 on the repression of mRNAs under these conditions despite a remarkable increase in p53-induced mRNA expression. Therefore, despite a strong p53 transcriptional response, there was no clear evidence that p53-responsive miRNA contributed to gene silencing. Taken together, the changes in cell cycle distribution in this cell line at the permissive temperature is likely attributable to transcriptional

  2. A Temperature Sensitive Variant of p53 Drives p53-Dependent MicroRNA Expression without Evidence of Widespread Post-Transcriptional Gene Silencing

    PubMed Central

    Cabrita, Miguel A.; Vanzyl, Erin J.; Hamill, Jeff D.; Pan, Elysia; Marcellus, Kristen A.; Tolls, Victoria J.; Alonzi, Rhea C.; Pastic, Alyssa; Rambo, Teeghan M. E.; Sayed, Hadil; McKay, Bruce C.

    2016-01-01

    The p53 tumour suppressor is a transcription factor that can regulate the expression of numerous genes including many encoding proteins and microRNAs (miRNAs). The predominant outcomes of a typical p53 response are the initiation of apoptotic cascades and the activation of cell cycle checkpoints. HT29-tsp53 cells express a temperature sensitive variant of p53 and in the absence of exogenous DNA damage, these cells preferentially undergo G1 phase cell cycle arrest at the permissive temperature that correlates with increased expression of the cyclin-dependent kinase inhibitor p21WAF1. Recent evidence also suggests that a variety of miRNAs can induce G1 arrest by inhibiting the expression of proteins like CDK4 and CDK6. Here we used oligonucleotide microarrays to identify p53-regulated miRNAs that are induced in these cells undergoing G1 arrest. At the permissive temperature, the expression of several miRNAs was increased through a combination of either transcriptional or post-transcriptional regulation. In particular, miR-34a-5p, miR-143-3p and miR-145-5p were strongly induced and they reached levels comparable to that of reference miRNAs (miR-191 and miR-103). Importantly, miR-34a-5p and miR-145-5p are known to silence the Cdk4 and/or Cdk6 G1 cyclin-dependent kinases (cdks). Surprisingly, there was no p53-dependent decrease in the expression of either of these G1 cdks. To search for other potential targets of p53-regulated miRNAs, p53-downregulated mRNAs were identified through parallel microarray analysis of mRNA expression. Once again, there was no clear effect of p53 on the repression of mRNAs under these conditions despite a remarkable increase in p53-induced mRNA expression. Therefore, despite a strong p53 transcriptional response, there was no clear evidence that p53-responsive miRNA contributed to gene silencing. Taken together, the changes in cell cycle distribution in this cell line at the permissive temperature is likely attributable to transcriptional

  3. Development of an adenoviral vector with robust expression driven by p53

    SciTech Connect

    Bajgelman, Marcio C.; Strauss, Bryan E.

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG served as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.

  4. The transcription factor p53: Not a repressor, solely an activator

    PubMed Central

    Fischer, Martin; Steiner, Lydia; Engeland, Kurt

    2014-01-01

    The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

  5. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death.

    PubMed

    Baudot, Alice D; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M

    2016-09-01

    p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  6. Renal cell carcinoma escapes death by p53 depletion through transglutaminase 2-chaperoned autophagy

    PubMed Central

    Kang, J H; Lee, J-S; Hong, D; Lee, S-H; Kim, N; Lee, W-K; Sung, T-W; Gong, Y-D; Kim, S-Y

    2016-01-01

    In renal cell carcinoma, transglutaminase 2 (TGase 2) crosslinks p53 in autophagosomes, resulting in p53 depletion and the tumor's evasion of apoptosis. Inhibition of TGase 2 stabilizes p53 and induces tumor cells to enter apoptosis. This study explored the mechanism of TGase 2-dependent p53 degradation. We found that TGase 2 competes with human double minute 2 homolog (HDM2) for binding to p53; promotes autophagy-dependent p53 degradation in renal cell carcinoma (RCC) cell lines under starvation; and binds to p53 and p62 simultaneously without ubiquitin-dependent recognition of p62. The bound complex does not have crosslinking activity. A binding assay using a series of deletion mutants of p62, p53 and TGase 2 revealed that the PB1 (Phox and Bem1p-1) domain of p62 (residues 85–110) directly interacts with the β-barrel domains of TGase 2 (residues 592–687), whereas the HDM2-binding domain (transactivation domain, residues 15–26) of p53 interacts with the N terminus of TGase 2 (residues 1–139). In addition to the increase in p53 stability due to TGase 2 inhibition, the administration of a DNA-damaging anti-cancer drug such as doxorubicin-induced apoptosis in RCC cell lines and synergistically reduced tumor volume in a xenograft model. Combination therapy with a TGase 2 inhibitor and a DNA-damaging agent may represent an effective therapeutic approach for treating RCC. PMID:27031960

  7. 2-Phenylethynesulfonamide (PES) uncovers a necrotic process regulated by oxidative stress and p53.

    PubMed

    Mattiolo, Paolo; Barbero-Farran, Ares; Yuste, Víctor J; Boix, Jacint; Ribas, Judit

    2014-10-01

    2-Phenylethynesulfonamide (PES) or pifithrin-μ is a promising anticancer agent with preferential toxicity for cancer cells. The type of cell death and the molecular cascades activated by this compound are controversial. Here, we demonstrate PES elicits a caspase- and BAX/BAK-independent non-necroptotic necrotic cell death, since it is not inhibited by necrostatin-1. This process is characterized by an early generation of reactive oxygen species (ROS) resulting in p53 up-regulation. Accordingly, thiolic antioxidants protect cells from PES-induced death. Furthermore, inhibiting the natural sources of glutathione with l-buthionine-sulfoximine (BSO) strongly cooperates with PES in triggering cytotoxicity. Genetically modified p53-null or p53 knocked-down cells show resistance to PES-driven necrosis. The predominant localization of p53 in chromatin-enriched fractions added to the up-regulation of the p53-responsive gene p21, strongly suggest the involvement of a transcription-dependent p53 program. On the other hand, we report an augmented production of ROS in p53-positive cells that, added to the increased p53 content in response to PES-elicited ROS, suggests that p53 and ROS are mutually regulated in response to PES. In sum, p53 up-regulation by ROS triggers a positive feedback loop responsible of further increasing ROS production and reinforcing PES-driven non-necroptotic necrosis. PMID:25139326

  8. Persistent STAT5 activation in myeloid neoplasms recruits p53 into gene regulation.

    PubMed

    Girardot, M; Pecquet, C; Chachoua, I; Van Hees, J; Guibert, S; Ferrant, A; Knoops, L; Baxter, E J; Beer, P A; Giraudier, S; Moriggl, R; Vainchenker, W; Green, A R; Constantinescu, S N

    2015-03-01

    STAT (Signal Transducer and Activator of Transcription) transcription factors are constitutively activated in most hematopoietic cancers. We previously identified a target gene, LPP/miR-28 (LIM domain containing preferred translocation partner in lipoma), induced by constitutive activation of STAT5, but not by transient cytokine-activated STAT5. miR-28 exerts negative effects on thrombopoietin receptor signaling and platelet formation. Here, we demonstrate that, in transformed hematopoietic cells, STAT5 and p53 must be synergistically bound to chromatin for induction of LPP/miR-28 transcription. Genome-wide association studies show that both STAT5 and p53 are co-localized on the chromatin at 463 genomic positions in proximal promoters. Chromatin binding of p53 is dependent on persistent STAT5 activation at these proximal promoters. The transcriptional activity of selected promoters bound by STAT5 and p53 was significantly changed upon STAT5 or p53 inhibition. Abnormal expression of several STAT5-p53 target genes (LEP, ATP5J, GTF2A2, VEGFC, NPY1R and NPY5R) is frequently detected in platelets of myeloproliferative neoplasm (MPN) patients, but not in platelets from healthy controls. In conclusion, persistently active STAT5 can recruit normal p53, like in the case of MPN cells, but also p53 mutants, such as p53 M133K in human erythroleukemia cells, leading to pathologic gene expression that differs from canonical STAT5 or p53 transcriptional programs.

  9. p53 Small Molecule Inhibitor Enhances Temozolomide Cytotoxic Activity against Intracranial Glioblastoma Xenografts

    PubMed Central

    Dinca, Eduard B.; Lu, Kan V.; Sarkaria, Jann N.; Pieper, Russell O.; Prados, Michael D.; Haas-Kogan, Daphne A.; VandenBerg, Scott R.; Berger, Mitchel S.; James, C. David

    2010-01-01

    In this study we investigated corresponding precursor and active forms of a p53 small molecule inhibitor for effect on temozolomide (TMZ) anti-tumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when GBMs with wild-type p53 were co-treated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased PARP cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, that is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: i.e., TMZ + p53 inhibitor precursor co-treatment, of three distinct wild-type p53 GBM xenografts, resulted in significant enhancement of TMZ anti-tumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (p < 0.001 for co-treatment survival benefit in each case). Mice receiving intracranial injection with p53 null GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhance TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner. PMID:19074867

  10. Wild-type p53 controls cell motility and invasion by dual regulation of MET expression

    PubMed Central

    Hwang, Chang-Il; Matoso, Andres; Corney, David C.; Flesken-Nikitin, Andrea; Körner, Stefanie; Wang, Wei; Boccaccio, Carla; Thorgeirsson, Snorri S.; Comoglio, Paolo M.; Hermeking, Heiko; Nikitin, Alexander Yu.

    2011-01-01

    Recent observations suggest that p53 mutations are responsible not only for growth of primary tumors but also for their dissemination. However, mechanisms involved in p53-mediated control of cell motility and invasion remain poorly understood. By using the primary ovarian surface epithelium cell culture, we show that conditional inactivation of p53 or expression of its mutant forms results in overexpression of MET receptor tyrosine kinase, a crucial regulator of invasive growth. At the same time, cells acquire increased MET-dependent motility and invasion. Wild-type p53 negatively regulates MET expression by two mechanisms: (i) transactivation of MET-targeting miR-34, and (ii) inhibition of SP1 binding to MET promoter. Both mechanisms are not functional in p53 absence, but mutant p53 proteins retain partial MET promoter suppression. Accordingly, MET overexpression, cell motility, and invasion are particularly high in p53-null cells. These results identify MET as a critical effector of p53 and suggest that inhibition of MET may be an effective antimetastatic approach to treat cancers with p53 mutations. These results also show that the extent of advanced cancer traits, such as invasion, may be determined by alterations in individual components of p53/MET regulatory network. PMID:21831840

  11. A defect in the p53 response pathway induced by de novo purine synthesis inhibition.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2003-12-01

    p53 is believed to sense cellular ribonucleotide depletion in the absence of DNA strand breaks and to respond by imposition of a p21-dependent G1 cell cycle arrest. We now report that the p53-dependent G1 checkpoint is blocked in human carcinoma cell lines after inhibition of de novo purine synthesis by folate analogs inhibitory to glycinamide ribonucleotide formyltransferase (GART). p53 accumulated in HCT116, MCF7, or A549 carcinoma cells upon GART inhibition, but, surprisingly, transcription of several p53 targets, including p21cip1/waf1, was impaired. The mechanism of this defect was examined. The p53 accumulating in these cells was nuclear but was not phosphorylated at serines 6, 15, and 20, nor was it acetylated at lysines 373 or 382. The DDATHF-stabilized p53 bound to the p21 promoter in vitro and in vivo but did not activate histone acetylation over the p53 binding sites in the p21 promoter that is an integral part of the transcriptional response mediated by the DNA damage pathway. We concluded that the robust initial response of the p53 pathway to GART inhibitors is not transcriptionally propagated to target genes due to a defect in p53 post-translational modifications and a failure to open chromatin structure despite promoter binding of this unmodified p53. PMID:14517211

  12. P53 functional abnormality in mesenchymal stem cells promotes osteosarcoma development

    PubMed Central

    Velletri, T; Xie, N; Wang, Y; Huang, Y; Yang, Q; Chen, X; Chen, Q; Shou, P; Gan, Y; Cao, G; Melino, G; Shi, Y

    2016-01-01

    It has been shown that p53 has a critical role in the differentiation and functionality of various multipotent progenitor cells. P53 mutations can lead to genome instability and subsequent functional alterations and aberrant transformation of mesenchymal stem cells (MSCs). The significance of p53 in safeguarding our body from developing osteosarcoma (OS) is well recognized. During bone remodeling, p53 has a key role in negatively regulating key factors orchestrating the early stages of osteogenic differentiation of MSCs. Interestingly, changes in the p53 status can compromise bone homeostasis and affect the tumor microenvironment. This review aims to provide a unique opportunity to study the p53 function in MSCs and OS. In the context of loss of function of p53, we provide a model for two sources of OS: MSCs as progenitor cells of osteoblasts and bone tumor microenvironment components. Standing at the bone remodeling point of view, in this review we will first explain the determinant function of p53 in OS development. We will then summarize the role of p53 in monitoring MSC fidelity and in regulating MSC differentiation programs during osteogenesis. Finally, we will discuss the importance of loss of p53 function in tissue microenvironment. We expect that the information provided herein could lead to better understanding and treatment of OS. PMID:26775693

  13. Radiation response and cell cycle regulation of p53 rescued malignant keratinocytes

    SciTech Connect

    Niemantsverdriet, Maarten; Jongmans, Wim; Backendorf, Claude . E-mail: backendo@chem.leidenuniv.nl

    2005-10-15

    Mutations in the tumor suppressor gene p53 were found in more than 90% of all human squamous cell carcinomas (SCC). To study the function of p53 in a keratinocyte background, a tetracycline-controlled p53 transgene was introduced into a human SCC cell line (SCC15), lacking endogenous p53. Conditional expression of wild-type p53 protein upon withdrawal of tetracycline was accompanied with increased expression of p21{sup WAF1/Cip1} resulting in reduced cell proliferation. Flow-cytometric analysis revealed that these cells were transiently arrested in the G1/S phase of the cell cycle. However, when SCC15 cells expressing p53 were exposed to ionizing radiation (IR), a clear shift from a G1/S to a G2/M cell cycle arrest was observed. This effect was greatly depending on the presence of wild-type p53, as it was not observed to the same extent in SCC15 cells lacking p53. Unexpectedly, the p53- and IR-dependent G2/M cell cycle arrest in the keratinocyte background was not depending on increased expression or stabilization of 14-3-3{sigma}, a p53-regulated effector of G2/M progression in colorectal cancer cells. In keratinocytes, 14-3-3{sigma} (stratifin) is involved in terminal differentiation and its cell cycle function in this cell type might diverge from the one it fulfills in other cellular backgrounds.

  14. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death.

    PubMed

    Baudot, Alice D; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M

    2016-09-01

    p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  16. Interactions of the p53 protein family in cellular stress response in gastrointestinal tumors

    PubMed Central

    Vilgelm, Anna E.; Washington, Mary K.; Wei, Jinxiong; Chen, Heidi; Prassolov, Vladimir S.; Zaika, Alexander I.

    2010-01-01

    p53, p63 and p73 are members of the p53 protein family involved in regulation of cell cycle, apoptosis, differentiation and other critical cellular processes. Here we investigated the contribution of the entire p53 family in chemotherapeutic drug response in gastrointestinal tumors. Real-time PCR and immunohistochemistry revealed complexity and variability of expression profiles of the p53 protein family. Using colon and esophageal cancer cells, we found that the integral transcription activity of the entire p53 family, as measured by the reporter analysis, associated with response to drug treatment in studied cells. We also found that p53 and p73, as well as p63 and p73, bind simultaneously to the promoters of p53 target genes. Taken together, our results support the view that the p53 protein family functions as an interacting network of proteins and show that cellular responses to chemotherapeutic drug treatment are determined by the total activity of the entire p53 family, rather than p53 alone. PMID:20197393

  17. Interactions of the p53 protein family in cellular stress response in gastrointestinal tumors.

    PubMed

    Vilgelm, Anna E; Washington, Mary K; Wei, Jinxiong; Chen, Heidi; Prassolov, Vladimir S; Zaika, Alexander I

    2010-03-01

    p53, p63, and p73 are members of the p53 protein family involved in regulation of cell cycle, apoptosis, differentiation, and other critical cellular processes. Here, we investigated the contribution of the entire p53 family in chemotherapeutic drug response in gastrointestinal tumors. Real-time PCR and immunohistochemistry revealed complexity and variability of expression profiles of the p53 protein family. Using colon and esophageal cancer cells, we found that the integral transcription activity of the entire p53 family, as measured by the reporter analysis, associated with response to drug treatment in studied cells. We also found that p53 and p73, as well as p63 and p73, bind simultaneously to the promoters of p53 target genes. Taken together, our results support the view that the p53 protein family functions as an interacting network of proteins and show that cellular responses to chemotherapeutic drug treatment are determined by the total activity of the entire p53 family rather than p53 alone.

  18. An acetyl-methyl switch drives a conformational change in p53.

    PubMed

    Tong, Qiong; Mazur, Sharlyn J; Rincon-Arano, Hector; Rothbart, Scott B; Kuznetsov, Dmitry M; Cui, Gaofeng; Liu, Wallace H; Gete, Yantenew; Klein, Brianna J; Jenkins, Lisa; Mer, Georges; Kutateladze, Andrei G; Strahl, Brian D; Groudine, Mark; Appella, Ettore; Kutateladze, Tatiana G

    2015-02-01

    Individual posttranslational modifications (PTMs) of p53 mediate diverse p53-dependent responses; however, much less is known about the combinatorial action of adjacent modifications. Here, we describe crosstalk between the early DNA damage response mark p53K382me2 and the surrounding PTMs that modulate binding of p53 cofactors, including 53BP1 and p300. The 1.8 Å resolution crystal structure of the tandem Tudor domain (TTD) of 53BP1 in complex with p53 peptide acetylated at K381 and dimethylated at K382 (p53K381acK382me2) reveals that the dual PTM induces a conformational change in p53. The α-helical fold of p53K381acK382me2 positions the side chains of R379, K381ac, and K382me2 to interact with TTD concurrently, reinforcing a modular design of double PTM mimetics. Biochemical and nuclear magnetic resonance analyses show that other surrounding PTMs, including phosphorylation of serine/threonine residues of p53, affect association with TTD. Our findings suggest a novel PTM-driven conformation switch-like mechanism that may regulate p53 interactions with binding partners.

  19. Change in oligomerization specificity of the p53 tetramerization domain by hydrophobic amino acid substitutions.

    PubMed Central

    Stavridi, E. S.; Chehab, N. H.; Caruso, L. C.; Halazonetis, T. D.

    1999-01-01

    The tumor suppressor function of the wild-type p53 protein is transdominantly inhibited by tumor-derived mutant p53 proteins. Such transdominant inhibition limits the prospects for gene therapy approaches that aim to introduce wild-type p53 into cancer cells. The molecular mechanism for transdominant inhibition involves sequestration of wild-type p53 subunits into inactive wild-type/mutant hetero-tetramers. Thus, p53 proteins, whose oligomerization specificity is altered so they cannot interact with tumor-derived mutant p53, would escape transdominant inhibition. Aided by the known three-dimensional structure of the p53 tetramerization domain and by trial and error we designed a novel domain with seven amino acid substitutions in the hydrophobic core. A full-length p53 protein bearing this novel domain formed homo-tetramers and had tumor suppressor function, but did not hetero-oligomerize with tumor-derived mutant p53 and resisted transdominant inhibition. Thus, hydrophobic core residues influence the oligomerization specificity of the p53 tetramerization domain. PMID:10493578

  20. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  1. EBNA3C regulates p53 through induction of Aurora kinase B.

    PubMed

    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S

    2015-03-20

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation.

  2. Salmonella typhimurium infection increases p53 acetylation in intestinal epithelial cells.

    PubMed

    Wu, Shaoping; Ye, Zhongde; Liu, Xingyin; Zhao, Yun; Xia, Yinglin; Steiner, Andrew; Petrof, Elaine O; Claud, Erika C; Sun, Jun

    2010-05-01

    The ability of Salmonella typhimurium to enter intestinal epithelial cells constitutes a crucial step in pathogenesis. Salmonella invasion of the intestinal epithelium requires bacterial type three secretion system. Type three secretion system is a transport device that injects virulence proteins, called effectors, to paralyze or reprogram the eukaryotic cells. Avirulence factor for Salmonella (AvrA) is a Salmonella effector that inhibits the host's inflammatory responses. The mechanism by which AvrA modulates host cell signaling is not entirely clear. p53 is situated at the crossroads of a network of signaling pathways that are essential for genotoxic and nongenotoxic stress responses. We hypothesized that Salmonella infection activates the p53 pathway. We demonstrated that Salmonella infection increased p53 acetylation. Cells infected with AvrA-sufficient Salmonella have increased p53 acetylation, whereas cells infected with AvrA-deficient Salmonella have less p53 acetylation. In a cell-free system, AvrA possessed acetyltransferase activity and used p53 as a substrate. AvrA expression increased p53 transcriptional activity and induced cell cycle arrest. HCT116 p53-/- cells had less inflammatory responses. In a mouse model of Salmonella infection, intestinal epithelial p53 acetylation was increased by AvrA expression. Our studies provide novel mechanistic evidence that Salmonella modulates the p53 pathway during intestinal inflammation and infection.

  3. p53 directly regulates the glycosidase FUCA1 to promote chemotherapy-induced cell death

    PubMed Central

    Baudot, Alice D.; Crighton, Diane; O'Prey, Jim; Somers, Joanna; Sierra Gonzalez, Pablo; Ryan, Kevin M.

    2016-01-01

    ABSTRACT p53 is a central factor in tumor suppression as exemplified by its frequent loss in human cancer. p53 exerts its tumor suppressive effects in multiple ways, but the ability to invoke the eradication of damaged cells by programmed cell death is considered a key factor. The ways in which p53 promotes cell death can involve direct activation or engagement of the cell death machinery, or can be via indirect mechanisms, for example though regulation of ER stress and autophagy. We present here another level of control in p53-mediated tumor suppression by showing that p53 activates the glycosidase, FUCA1, a modulator of N-linked glycosylation. We show that p53 transcriptionally activates FUCA1 and that p53 modulates fucosidase activity via FUCA1 up-regulation. Importantly, we also report that chemotherapeutic drugs induce FUCA1 and fucosidase activity in a p53-dependent manner. In this context, while we found that over-expression of FUCA1 does not induce cell death, RNAi-mediated knockdown of endogenous FUCA1 significantly attenuates p53-dependent, chemotherapy-induced apoptotic death. In summary, these findings add an additional component to p53s tumor suppressive response and highlight another mechanism by which the tumor suppressor controls programmed cell death that could potentially be exploited for cancer therapy. PMID:27315169

  4. Low p53 protein expression in salivary gland tumours compared with lung carcinomas.

    PubMed

    Soini, Y; Kamel, D; Nuorva, K; Lane, D P; Vähäkangas, K; Pääkkö, P

    1992-01-01

    Fifty-one salivary gland tumours (23 pleomorphic adenomas, 5 Warthin's tumours, 12 mucoepidermoid carcinomas, 7 adenoid cystic carcinomas, 3 undifferentiated carcinomas and 1 acinic cell tumour) and 27 lung carcinomas (18 squamous cell carcinomas) were analysed immunohistochemically for the expression of p53 nuclear phosphoprotein. Eight out of 51 (16%) salivary gland tumours were p53 positive. Three of these were benign and 5 malignant. All 3 benign salivary gland tumours were pleomorphic adenomas and expressed only occasional nuclear positivity with less than 1% of tumour cells positive. Of the 5 p53-positive malignant tumours, 3 were mucoepidermoid carcinomas and 2 undifferentiated carcinomas. The malignant salivary gland tumours expressed more than 1% of positive nuclei in every case. Seventeen lung carcinomas were p53 positive (63%). Thirteen of these were squamous cell carcinomas, 3 were adenocarcinomas and 1 small cell lung carcinoma. The results show that mutations of the p53 gene may be infrequent in salivary gland tumours when compared with lung carcinomas. The relatively indolent course of some histological types of malignant salivary gland tumours could be associated with the preservation of the non-mutated p53 gene in most of these tumours. The presence of p53 positivity in some pleomorphic adenomas might, on one hand, suggest that p53 gene alterations are also present in these tumours; on the other hand, the accumulation of the p53 protein in these tumours might also be due to some unknown mechanism, not necessarily related to p53 gene mutation.

  5. Regulation of p53 in NIH3T3 mouse fibroblasts following hyperosmotic stress

    PubMed Central

    Lambert, Ian Henry; Enghoff, Maria Stine; Brandi, Marie-Luise; Hoffmann, Else Kay

    2015-01-01

    The aim of this project was to analyze the regulation of p53 expression in NIH3T3 fibroblasts under the influence of increasing hyperosmotic stress. Expression of p53 showed a biphasic response pattern in NIH3T3 cells under increasing osmotic stress (337 mOsm to 737 mOsm) with a maximum at 587 mOsm. Under isotonic conditions p53 expression increased after addition of the proteasome inhibitor MG132 indicating that cellular p53 levels in unperturbed cells is kept low by proteasomal degradation. However, under hypertonic conditions p53 synthesis as well as p53 degradation were significantly reduced and it is demonstrated that the increase in p53 expression observed when tonicity is increased from 337 to 587 mOsm reflects that degradation is more inhibited than synthesis, whereas the decrease in p53 expression at higher tonicities reflects that synthesis is more inhibited than degradation. The activity of the p53 regulating proteins p38 MAP kinase and the ubiquitin ligase MDM2 were studied as a function of increasing osmolarity. MDM2 protein expression was unchanged at all osmolarities, whereas MDM2 phosphorylation (Ser166) increased at osmolarities up to 537 mOsm and remained constant at higher osmolarities. Phosphorylation of p38 increased at osmolarities up to 687 mOsm which correlated with an increased phosphorylation of p53 (Ser15) and the decreased p53 degradation. Caspase-3 activity increased gradually with hypertonicity and at 737 mOsm both Caspase-3 activity and annexin V binding are high even though p53 expression and activity are low, indicating that initiation of apoptosis under severe hypertonic conditions is not strictly controlled by p53. PMID:26056062

  6. Targeting Mdmx to treat breast cancers with wild-type p53

    PubMed Central

    Haupt, S; Buckley, D; Pang, J-MB; Panimaya, J; Paul, P J; Gamell, C; Takano, E A; Ying Lee, Y; Hiddingh, S; Rogers, T-M; Teunisse, A F A S; Herold, M J; Marine, J-C; Fox, S B; Jochemsen, A; Haupt, Y

    2015-01-01

    The function of the tumor suppressor p53 is universally compromised in cancers. It is the most frequently mutated gene in human cancers (reviewed). In cases where p53 is not mutated, alternative regulatory pathways inactivate its tumor suppressive functions. This is primarily achieved through elevation in the expression of the key inhibitors of p53: Mdm2 or Mdmx (also called Mdm4) (reviewed). In breast cancer (BrCa), the frequency of p53 mutations varies markedly between the different subtypes, with basal-like BrCas bearing a high frequency of p53 mutations, whereas luminal BrCas generally express wild-type (wt) p53. Here we show that Mdmx is unexpectedly highly expressed in normal breast epithelial cells and its expression is further elevated in most luminal BrCas, whereas p53 expression is generally low, consistent with wt p53 status. Inducible knockdown (KD) of Mdmx in luminal BrCa MCF-7 cells impedes the growth of these cells in culture, in a p53-dependent manner. Importantly, KD of Mdmx in orthotopic xenograft transplants resulted in growth inhibition associated with prolonged survival, both in a preventative model and also in a treatment model. Growth impediment in response to Mdmx KD was associated with cellular senescence. The growth inhibitory capacity of Mdmx KD was recapitulated in an additional luminal BrCa cell line MPE600, which expresses wt p53. Further, the growth inhibitory capacity of Mdmx KD was also demonstrated in the wt p53 basal-like cell line SKBR7 line. These results identify Mdmx growth dependency in wt p53 expressing BrCas, across a range of subtypes. Based on our findings, we propose that Mdmx targeting is an attractive strategy for treating BrCas harboring wt p53. PMID:26181202

  7. Extensive Post-translational Modification of Active and Inactivated Forms of Endogenous p53*

    PubMed Central

    DeHart, Caroline J.; Chahal, Jasdave S.; Flint, S. J.; Perlman, David H.

    2014-01-01

    The p53 tumor suppressor protein accumulates to very high concentrations in normal human fibroblasts infected by adenovirus type 5 mutants that cannot direct assembly of the viral E1B 55-kDa protein-containing E3 ubiquitin ligase that targets p53 for degradation. Despite high concentrations of nuclear p53, the p53 transcriptional program is not induced in these infected cells. We exploited this system to examine select post-translational modifications (PTMs) present on a transcriptionally inert population of endogenous human p53, as well as on p53 activated in response to etoposide treatment of normal human fibroblasts. These forms of p53 were purified from whole cell lysates by means of immunoaffinity chromatography and SDS-PAGE, and peptides derived from them were subjected to nano-ultra-high-performance LC-MS and MS/MS analyses on a high-resolution accurate-mass MS platform (data available via ProteomeXchange, PXD000464). We identified an unexpectedly large number of PTMs, comprising phosphorylation of Ser and Thr residues, methylation of Arg residues, and acetylation, ubiquitinylation, and methylation of Lys residues—for example, some 150 previously undescribed modifications of p53 isolated from infected cells. These modifications were distributed across all functional domains of both forms of the endogenous human p53 protein, as well as those of an orthologous population of p53 isolated from COS-1 cells. Despite the differences in activity, including greater in vitro sequence-specific DNA binding activity exhibited by p53 isolated from etoposide-treated cells, few differences were observed in the location, nature, or relative frequencies of PTMs on the two populations of human p53. Indeed, the wealth of PTMs that we have identified is consistent with a far greater degree of complex, combinatorial regulation of p53 by PTM than previously anticipated. PMID:24056736

  8. Regulation of p53 in NIH3T3 mouse fibroblasts following hyperosmotic stress.

    PubMed

    Lambert, Ian Henry; Enghoff, Maria Stine; Brandi, Marie-Luise; Hoffmann, Else Kay

    2015-06-01

    The aim of this project was to analyze the regulation of p53 expression in NIH3T3 fibroblasts under the influence of increasing hyperosmotic stress. Expression of p53 showed a biphasic response pattern in NIH3T3 cells under increasing osmotic stress (337 mOsm to 737 mOsm) with a maximum at 587 mOsm. Under isotonic conditions p53 expression increased after addition of the proteasome inhibitor MG132 indicating that cellular p53 levels in unperturbed cells is kept low by proteasomal degradation. However, under hypertonic conditions p53 synthesis as well as p53 degradation were significantly reduced and it is demonstrated that the increase in p53 expression observed when tonicity is increased from 337 to 587 mOsm reflects that degradation is more inhibited than synthesis, whereas the decrease in p53 expression at higher tonicities reflects that synthesis is more inhibited than degradation. The activity of the p53 regulating proteins p38 MAP kinase and the ubiquitin ligase MDM2 were studied as a function of increasing osmolarity. MDM2 protein expression was unchanged at all osmolarities, whereas MDM2 phosphorylation (Ser(166)) increased at osmolarities up to 537 mOsm and remained constant at higher osmolarities. Phosphorylation of p38 increased at osmolarities up to 687 mOsm which correlated with an increased phosphorylation of p53 (Ser(15)) and the decreased p53 degradation. Caspase-3 activity increased gradually with hypertonicity and at 737 mOsm both Caspase-3 activity and annexin V binding are high even though p53 expression and activity are low, indicating that initiation of apoptosis under severe hypertonic conditions is not strictly controlled by p53. PMID:26056062

  9. Mutant p53 expression in fallopian tube epithelium drives cell migration.

    PubMed

    Quartuccio, Suzanne M; Karthikeyan, Subbulakshmi; Eddie, Sharon L; Lantvit, Daniel D; Ó hAinmhire, Eoghainín; Modi, Dimple A; Wei, Jian-Jun; Burdette, Joanna E

    2015-10-01

    Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the "p53 signature," or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53(R273H) MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53(R273H) with KRAS(G12V) activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53(R273H) in the fallopian tube will improve understanding of changes at the earliest stage of transformation. This information can help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the "p53 signature" thereby, improving survival rates.

  10. Mutant p53 expression in fallopian tube epithelium drives cell migration

    PubMed Central

    Quartuccio, Suzanne M.; Karthikeyan, Subbulakshmi; Eddie, Sharon L.; Lantvit, Daniel D.; Ó hAinmhire, Eoghainín; Modi, Dimple A.; Wei, Jian-Jun; Burdette, Joanna E.

    2015-01-01

    Ovarian cancer is the fifth leading cause of cancer death among US women. Evidence supports the hypothesis that high-grade serous ovarian cancers (HGSC) may originate in the distal end of the fallopian tube. Although a heterogeneous disease, 96% of HGSC contain mutations in p53. In addition, the “p53 signature”, or overexpression of p53 protein (usually associated with mutation), is a potential precursor lesion of fallopian tube derived HGSC suggesting an essential role for p53 mutation in early serous tumorigenesis. To further clarify p53-mutation dependent effects on cells, murine oviductal epithelial cells (MOE) were stably transfected with a construct encoding for the R273H DNA binding domain mutation in p53, the most common mutation in HGSC. Mutation in p53 was not sufficient to transform MOE cells, but did significantly increase cell migration. A similar p53 mutation in murine ovarian surface epithelium (MOSE), another potential progenitor cell for serous cancer, was not sufficient to transform the cells nor change migration suggesting tissue specific effects of p53 mutation. Microarray data confirmed expression changes of pro-migratory genes in p53R273H MOE compared to parental cells, which could be reversed by suppressing Slug expression. Combining p53R273H with KRASG12V activation caused transformation of MOE into high-grade sarcomatoid carcinoma when xenografted into nude mice. Elucidating the specific role of p53R273H in the fallopian tube will improve understanding of changes at the earliest stage of transformation and could help develop chemopreventative strategies to prevent the accumulation of additional mutations and reverse progression of the “p53 signature” thereby, improving survival rates. PMID:25810107

  11. Loss of P53 facilitates invasion and metastasis of prostate cancer cells.

    PubMed

    Wang, Yi; Zhang, Y X; Kong, C Z; Zhang, Z; Zhu, Y Y

    2013-12-01

    Prostate cancer is a lethal cancer for the invasion and metastasis in its earlier period. P53 is a tumor suppressor gene which plays a critical role on safeguarding the integrity of genome. However, loss of P53 facilitates or inhibits the invasion and metastasis of tumor is still suspended. In this study, we are going to explain whether loss of P53 affect the invasion and metastasis of prostate cancer cells. To explore whether loss of P53 influences the invasion and metastasis ability of prostate cancer cells, we first compared the invasion ability of si-P53 treated cells and control cells by wound healing, transwell assay, and adhesion assay. We next tested the activity of MMP-2, MMP-9, and MMP-14 by western blot and gelatin zymography. Moreover, we employed WB and IF to identify the EMT containing E-cad, N-cad, vimentin, etc. We also examined the expression of cortactin, cytoskeleton, and paxillin by immunofluorescence, and tested the expression of ERK and JNK by WB. Finally, we applied WB to detect the expression of FAK, Src, and the phosphorylation of them to elucidate the mechanism of si-P53 influencing invasion and metastasis. According to the inhibition rate of si-P53, we choose the optimized volume of si-P53. With the volume, we compare the invasion and metastasis ability of Du145 and si-P53 treated cells. We find si-P53 promotes the invasion and metastasis in prostate cancer cells, increases the expression and activity of MMP-2/9 and MMP-14. Also, si-P53 promotes EMT and cytoskeleton rearrangement. Further analyses explain that this effect is associated with FAK-Src signaling pathway. Loss of P53 promotes the invasion and metastasis ability of prostate cancer cells and the mechanism is correlated with FAK-Src signaling pathway. P53 is involved in the context of invasion and metastasis. PMID:23982184

  12. An expression signature for p53 status in human breast cancer predicts mutation status, transcriptional effects, and patient survival.

    PubMed

    Miller, Lance D; Smeds, Johanna; George, Joshy; Vega, Vinsensius B; Vergara, Liza; Ploner, Alexander; Pawitan, Yudi; Hall, Per; Klaar, Sigrid; Liu, Edison T; Bergh, Jonas

    2005-09-20

    Perturbations of the p53 pathway are associated with more aggressive and therapeutically refractory tumors. However, molecular assessment of p53 status, by using sequence analysis and immunohistochemistry, are incomplete assessors of p53 functional effects. We posited that the transcriptional fingerprint is a more definitive downstream indicator of p53 function. Herein, we analyzed transcript profiles of 251 p53-sequenced primary breast tumors and identified a clinically embedded 32-gene expression signature that distinguishes p53-mutant and wild-type tumors of different histologies and outperforms sequence-based assessments of p53 in predicting prognosis and therapeutic response. Moreover, the p53 signature identified a subset of aggressive tumors absent of sequence mutations in p53 yet exhibiting expression characteristics consistent with p53 deficiency because of attenuated p53 transcript levels. Our results show the primary importance of p53 functional status in predicting clinical breast cancer behavior. PMID:16141321

  13. Molecular Dynamics Simulations of p53 DNA-Binding Domain

    PubMed Central

    Lu, Qiang; Tan, Yu-Hong; Luo, Ray

    2008-01-01

    We have studied room-temperature structural and dynamic properties of the p53 DNA-binding domain in both DNA-bound and DNA-free states. A cumulative 55ns of explicit solvent molecular dynamics simulations with the Particle Mesh Ewald treatment of electrostatics were performed. It is found that the mean structures in the production portions of the trajectories agree well with the crystal structure: backbone root-mean squared deviations are in the range of 1.6Å and 2.0Å. In both simulations, noticeable backbone deviations from the crystal structure are observed only in loop L6, due to the lack of crystal packing in the simulations. More deviations are observed in the DNA-free simulation, apparently due to the absence of DNA. Computed backbone B-factor is also in qualitative agreement with the crystal structure. Interestingly little backbone structural change was observed between the mean simulated DNA-bound and DNA-free structures. Notable difference is only observed at the DNA-binding interface. The correlation between native contacts and inactivation mechanisms of tumor mutations is also discussed. In the H2 region, tumor mutations at sites D281, R282, E285, and E286 may weaken five key interactions that stabilize H2, indicating that their inactivation mechanisms may be related to the loss of local structure around H2, which in turn may reduce the overall stability to a measurable amount. In the L2 region, tumor mutations at sites Y163, K164, E171, V173, L194, R249, I251 and E271 are likely to be responsible for the loss of stability in the protein. In addition to apparent DNA contacts that are related to DNA binding, interactions R175/S183, S183/R196, and E198/N235 are highly occupied only in the DNA-bound form, indicating that they are more likely to be responsible for DNA binding. PMID:17824689

  14. Reactivation of mutant p53 by a dietary-related compound phenethyl isothiocyanate inhibits tumor growth.

    PubMed

    Aggarwal, M; Saxena, R; Sinclair, E; Fu, Y; Jacobs, A; Dyba, M; Wang, X; Cruz, I; Berry, D; Kallakury, B; Mueller, S C; Agostino, S D; Blandino, G; Avantaggiati, M L; Chung, F-L

    2016-10-01

    Mutations in the p53 tumor-suppressor gene are prevalent in human cancers. The majority of p53 mutations are missense, which can be classified into contact mutations (that directly disrupts the DNA-binding activity of p53) and structural mutations (that disrupts the conformation of p53). Both of the mutations can disable the normal wild-type (WT) p53 activities. Nevertheless, it has been amply documented that small molecules can rescue activity from mutant p53 by restoring WT tumor-suppressive functions. These compounds hold promise for cancer therapy and have now entered clinical trials. In this study, we show that cruciferous-vegetable-derived phenethyl isothiocyanate (PEITC) can reactivate p53 mutant under in vitro and in vivo conditions, revealing a new mechanism of action for a dietary-related compound. PEITC exhibits growth-inhibitory activity in cells expressing p53 mutants with preferential activity toward p53(R175), one of the most frequent 'hotspot' mutations within the p53 sequence. Mechanistic studies revealed that PEITC induces apoptosis in a p53(R175) mutant-dependent manner by restoring p53 WT conformation and transactivation functions. Accordingly, in PEITC-treated cells the reactivated p53(R175) mutant induces apoptosis by activating canonical WT p53 targets, inducing a delay in S and G2/M phase, and by phosphorylating ATM/CHK2. Interestingly, the growth-inhibitory effects of PEITC depend on the redox state of the cell. Further, PEITC treatments render the p53(R175) mutant sensitive to degradation by the proteasome and autophagy in a concentration-dependent manner. PEITC-induced reactivation of p53(R175) and its subsequent sensitivity to the degradation pathways likely contribute to its anticancer activities. We further show that dietary supplementation of PEITC is able to reactivate WT activity in vivo as well, inhibiting tumor growth in xenograft mouse model. These findings provide the first example of mutant p53 reactivation by a dietary

  15. Reactivation of mutant p53 by a dietary-related compound phenethyl isothiocyanate inhibits tumor growth

    PubMed Central

    Aggarwal, M; Saxena, R; Sinclair, E; Fu, Y; Jacobs, A; Dyba, M; Wang, X; Cruz, I; Berry, D; Kallakury, B; Mueller, S C; Agostino, S D; Blandino, G; Avantaggiati, M L; Chung, F-L

    2016-01-01

    Mutations in the p53 tumor-suppressor gene are prevalent in human cancers. The majority of p53 mutations are missense, which can be classified into contact mutations (that directly disrupts the DNA-binding activity of p53) and structural mutations (that disrupts the conformation of p53). Both of the mutations can disable the normal wild-type (WT) p53 activities. Nevertheless, it has been amply documented that small molecules can rescue activity from mutant p53 by restoring WT tumor-suppressive functions. These compounds hold promise for cancer therapy and have now entered clinical trials. In this study, we show that cruciferous-vegetable-derived phenethyl isothiocyanate (PEITC) can reactivate p53 mutant under in vitro and in vivo conditions, revealing a new mechanism of action for a dietary-related compound. PEITC exhibits growth-inhibitory activity in cells expressing p53 mutants with preferential activity toward p53R175, one of the most frequent ‘hotspot' mutations within the p53 sequence. Mechanistic studies revealed that PEITC induces apoptosis in a p53R175 mutant-dependent manner by restoring p53 WT conformation and transactivation functions. Accordingly, in PEITC-treated cells the reactivated p53R175 mutant induces apoptosis by activating canonical WT p53 targets, inducing a delay in S and G2/M phase, and by phosphorylating ATM/CHK2. Interestingly, the growth-inhibitory effects of PEITC depend on the redox state of the cell. Further, PEITC treatments render the p53R175 mutant sensitive to degradation by the proteasome and autophagy in a concentration-dependent manner. PEITC-induced reactivation of p53R175 and its subsequent sensitivity to the degradation pathways likely contribute to its anticancer activities. We further show that dietary supplementation of PEITC is able to reactivate WT activity in vivo as well, inhibiting tumor growth in xenograft mouse model. These findings provide the first example of mutant p53 reactivation by a dietary compound and

  16. Unc5D regulates p53-dependent apoptosis in neuroblastoma cells.

    PubMed

    Wang, Hong; Wu, Qiong; Li, Shuang; Zhang, Bin; Chi, Zuofei; Hao, Liangchun

    2014-06-01

    The mechanism of apoptosis via the p53‑dependent pathway remains to be fully understood. In the present study, a novel p53 target gene, Unc5D, was identified and its possible function in human neuroblastoma cells was investigated. The apoptotic effects of Unc5D in SK‑N‑BE (p53‑/‑) and SH‑SY5Y (p53+/+) cells were measured by an 3‑(4,5‑dimethylthiazol‑2‑yl)2,5‑diphenyltetrazolium bromide solution assay. Reverse transcription‑polymerase chain reaction (RT‑PCR) was also performed to detect the endogenous expression of Unc5D. In H1299 (p53‑/‑) cells, following overexpression of p53, RT‑PCR and western blot analysis were used to detect the Unc5D mRNA and protein levels. In order to detect the promoter activity in the Unc5D gene, a luciferase assay was performed. Finally, to confirm the activate site of p53 subsequent to DNA damage, western blot analysis was used to analyze the phosphorylation site of Unc5D stable and mock clones in H1299 cells by co‑expression of p53. Unc5D‑induced apoptosis may be largely dependent on the p53 status. Notably, Unc5D was found to be a direct transcriptional target of p53. During adriamycin‑mediated apoptosis, Unc5D was significantly induced in p53‑proficient SH‑SY5Y cells but not in p53‑deficient SK‑N‑BE cells. Overexpression of p53 resulted in an increase in the expression levels of endogenous Unc5D. Additionally, two elements were identified in the sequence of Unc5D. Notably, Unc5D expression also induced phosphorylation of p53 at serine‑15. Unc5D is thus a newly identified transcriptional target of pro‑apoptotic p53 and may also act upstream of p53 to induce p53‑dependent apoptosis by phosphorylation at ser‑15.

  17. Gain-of-function of mutant p53: mutant p53 enhances cancer progression by inhibiting KLF17 expression in invasive breast carcinoma cells.

    PubMed

    Ali, Amjad; Shah, Abdus Saboor; Ahmad, Ayaz

    2014-11-01

    Kruppel-like-factor 17 (KLF17) is a negative regulator of metastasis and epithelial-mesenchymal-transition (EMT). However, its expression is downregulated in metastatic breast cancer that contains p53 mutations. Here, we show that mutant-p53 plays a key role to suppress KLF17 and thereby enhances cancer progression, which defines novel gain-of-function (GOF) of mutant-p53. Mutant-p53 interacts with KLF17 and antagonizes KLF17 mediated EMT genes transcription. Depletion of KLF17 promotes cell viability, decreases apoptosis and induces drug resistance in metastatic breast cancer cells. KLF17 suppresses cell migration and invasion by decreasing CD44, PAI-1 and Cyclin-D1 expressions. Taken together, our results show that KLF17 is important for the suppression of metastasis and could be a potential therapeutic target during chemotherapy.

  18. p53 tumour suppressor gene expression in pancreatic neuroendocrine tumour cells.

    PubMed Central

    Bartz, C; Ziske, C; Wiedenmann, B; Moelling, K

    1996-01-01

    Neuroendocrine pancreatic tumours grow slower and metastasise later than ductal and acinar carcinomas. The expression of the p53 tumour suppressor gene in pancreatic neuroendocrine tumour cells is unknown. Pancreatic neuroendocrine cell lines (n = 5) and human tumour tissues (n = 19) were studied for changed p53 coding sequence, transcription, and translation. Proliferative activity of tumour cells was determined analysing Ki-67 expression. No mutation in the p53 nucleotide sequence of neuroendocrine tumour cell was found. However, an overexpression of p53 could be detected in neuroendocrine pancreatic tumour cell lines at a protein level. As no p53 mutations were seen, it is suggested that post-translational events can also lead to an overexpression of p53. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8675094

  19. Characterization of a unique mutation of p53 in rat epithelial cell strain

    SciTech Connect

    Carpenter, T.R.; Swafford, D.S.; Hickman, A.W.; Johnson, N.F.

    1994-11-01

    The tumor suppressor gene p53 is the most commonly mutated gene known in human cancer. Mutational alteration of p53 function appears to be an important carcinogenic event in a wide variety of tumor types. Altered activity caused by mutation results in reduction of the following: transcriptional activity, nuclear localization, growth supression, and cell cycle inhibitory activities. Wild-type p53 protein has been shown to accumulate in cells exposed to a variety of DNA-damaging agents, including ionizing radiation, primarily through protein stabilization. Mutant forms of p53 fail to accumulate after irradiation indicating a failure to respond to upstream regulatory actions. The accumulation of p53 protein may serve as a sensitive biologic indicator of DNA damage. The purpose of these investigations was to establish the mutational state of the LEC p53 gene and to characterize some of the consequences of such a mutation.

  20. Autoregulatory control of the p53 response by caspase-mediated processing of HIPK2

    PubMed Central

    Gresko, Ekaterina; Roscic, Ana; Ritterhoff, Stefanie; Vichalkovski, Anton; del Sal, Giannino; Schmitz, M Lienhard

    2006-01-01

    The serine/threonine kinase HIPK2 phosphorylates the p53 protein at Ser 46, thus promoting p53-dependent gene expression and subsequent apoptosis. Here, we show that DNA damaging chemotherapeutic drugs cause degradation of endogenous HIPK2 dependent on the presence of a functional p53 protein. Early induced p53 allows caspase-mediated cleavage of HIPK2 following aspartic acids 916 and 977. The resulting C-terminally truncated HIPK2 forms show an enhanced induction of the p53 response and cell death, thus allowing the rapid amplification of the p53-dependent apoptotic program during the initiation phase of apoptosis by a regulatory feed-forward loop. The active HIPK2 fragments are further degraded during the execution and termination phase of apoptosis, thus ensuring the occurrence of HIPK2 signaling only during the early phases of apoptosis induction. PMID:16601678

  1. Nuclear expression of p53 in mature tumor endothelium of retinoblastoma.

    PubMed

    Lee, Byung Joo; Kim, Jin Hyoung; Jo, Dong Hyun; Kim, Kyu-Won; Yu, Young Suk; Kim, Jeong Hun

    2014-08-01

    The present study aimed to investigate the p53 expression pattern in tumor cells and in mature tumor vascular endothelium of retinoblastoma. Nuclear p53 accumulation was observed in most of the tumor cells in both the human and orthotopic retinoblastoma animal models using SNUOT-Rb1 and Y79 cells. In the orthotopic animal model, some of the tumor vascular endothelium also demonstrated nuclear p53 immunoreactivity, and the ratio of p53 positivity among the total mature tumor vascular endothelium was slightly higher in the Y79 cell model when compared with the SNUOT-Rb1 cell model. In addition, in the human retinoblastoma specimens, 32.9% of the tumor vascular endothelium showed p53 nuclear staining. In conclusion, some of the mature tumor vascular endothelium in both the human and orthotopic models of retinoblastoma share the same cytogenetic abnormality (an abnormal nuclear accumulation of p53) with retinoblastoma cells. PMID:24898002

  2. Rapamycin extends lifespan and delays tumorigenesis in heterozygous p53+/- mice.

    PubMed

    Komarova, Elena A; Antoch, Marina P; Novototskaya, Liliya R; Chernova, Olga B; Paszkiewicz, Geraldine; Leontieva, Olga V; Blagosklonny, Mikhail V; Gudkov, Andrei V

    2012-10-01

    TOR (Target of Rapamycin) pathway accelerates cellular and organismal aging. Similar to rapamycin, p53 can inhibit the mTOR pathway in some mammalian cells. Mice lacking one copy of p53 (p53+/- mice) have an increased cancer incidence and a shorter lifespan. We hypothesize that rapamycin can delay cancer in heterozygous p53+/- mice. Here we show that rapamycin (given in a drinking water) extended the mean lifespan of p53+/- mice by 10% and when treatment started early in life (at the age less than 5 months) by 28%. In addition, rapamycin decreased the incidence of spontaneous tumors. This observation may have applications in management of Li-Fraumeni syndrome patients characterized by heterozygous mutations in the p53 gene.

  3. Alterations in Mitochondrial and Endoplasmic Reticulum Signaling by p53 Mutants

    PubMed Central

    Giorgi, Carlotta; Bonora, Massimo; Missiroli, Sonia; Morganti, Claudia; Morciano, Giampaolo; Wieckowski, Mariusz R.; Pinton, Paolo

    2016-01-01

    The p53 protein is probably the most important tumor suppressor, acting as a nuclear transcription factor primarily through the modulation of cell death. However, currently, it is well accepted that p53 can also exert important transcription-independent pro-cell death actions. Indeed, cytosolic localization of endogenous wild-type or transactivation-deficient p53 is necessary and sufficient for the induction of apoptosis and autophagy. Here, we present the extra-nuclear activities of p53 associated with the mitochondria and the endoplasmic reticulum, highlighting the activities of the p53 mutants on these compartments. These two intracellular organelles play crucial roles in the regulation of cell death, and it is now well established that they also represent sites where p53 can accumulate. PMID:26942128

  4. As a novel p53 direct target, bidirectional gene HspB2/αB-crystallin regulates the ROS level and Warburg effect.

    PubMed

    Liu, Shuang; Yan, Bin; Lai, Weiwei; Chen, Ling; Xiao, Desheng; Xi, Sichuan; Jiang, Yiqun; Dong, Xin; An, Jing; Chen, Xiang; Cao, Ya; Tao, Yongguang

    2014-07-01

    Many mammalian genes are composed of bidirectional gene pairs with the two genes separated by less than 1.0kb. The transcriptional regulation and function of these bidirectional genes remain largely unclear. Here, we report that bidirectional gene pair HspB2/αB-crystallin, both of which are members of the small heat shock protein gene family, is a novel direct target gene of p53. Two potential binding sites of p53 are present in the intergenic region of HspB2/αB-crystallin. p53 up-regulated the bidirectional promoter activities of HspB2/αB-crystallin. Actinomycin D (ActD), an activator of p53, induces the promoter and protein activities of HspB2/αB-crystallin. p53 binds to two p53 binding sites in the intergenic region of HspB2/αB-crystallin in vitro and in vivo. Moreover, the products of bidirectional gene pair HspB2/αB-crystallin regulate glucose metabolism, intracellular reactive oxygen species (ROS) level and the Warburg effect by affecting metabolic genes, including the synthesis of cytochrome c oxidase 2 (SCO2), hexokinase II (HK2), and TP53-induced glycolysis and apoptosis regulator (TIGAR). The ROS level and the Warburg effect are affected after the depletion of p53, HspB2 and αB-crystallin respectively. Finally, we show that both HspB2 and αB-crystallin are linked with human renal carcinogenesis. These findings provide novel insights into the role of p53 as a regulator of bidirectional gene pair HspB2/αB-crystallin-mediated ROS and the Warburg effect.

  5. Oncomir miR-125b Suppresses p14ARF to Modulate p53-Dependent and p53-Independent Apoptosis in Prostate Cancer

    PubMed Central

    Amir, Sumaira; Ma, Ai-Hong; Shi, Xu-Bao; Xue, Lingru; Kung, Hsing-Jien; deVere White, Ralph W.

    2013-01-01

    MicroRNAs are a class of naturally occurring small non-coding RNAs that target protein-coding mRNAs at the post-transcriptional level and regulate complex patterns of gene expression. Our previous studies demonstrated that in human prostate cancer the miRNA miR-125b is highly expressed, leading to a negative regulation of some tumor suppressor genes. In this study, we further extend our studies by showing that miR-125b represses the protein product of the ink4a/ARF locus, p14ARF, in two prostate cancer cell lines, LNCaP (wild type-p53) and 22Rv1 (both wild type and mutant p53), as well as in the PC-346C prostate cancer xenograft model that lentivirally overexpressed miR-125b. Our results highlight that miR-125b modulates the p53 network by hindering the down-regulation of Mdm2, thereby affecting p53 and its target genes p21 and Puma to a degree sufficient to inhibit apoptosis. Conversely, treatment of prostate cancer cells with an inhibitor of miR-125b (anti-miR-125b) resulted in increased expression of p14ARF, decreased level of Mdm2, and induction of apoptosis. In addition, overexpression of miR-125b in p53-deficient PC3 cells induced down-regulation of p14ARF, which leads to increased cell proliferation through a p53-independent manner. Thus, we conclude that miR-125b acts as an oncogene which regulates p14ARF/Mdm2 signaling, stimulating proliferation of prostate cancer cells through a p53-dependent or p53-independent function. This reinforces our belief that miR-125b has potential as a therapeutic target for the management of patients with metastatic prostate cancer. PMID:23585871

  6. AS-2, a novel inhibitor of p53-dependent apoptosis, prevents apoptotic mitochondrial dysfunction in a transcription-independent manner and protects mice from a lethal dose of ionizing radiation

    SciTech Connect

    Morita, Akinori; Ariyasu, Shinya; Wang, Bing; Asanuma, Tetsuo; Onoda, Takayoshi; Sawa, Akiko; Tanaka, Kaoru; Takahashi, Ippei; Togami, Shotaro; Nenoi, Mitsuru; Inaba, Toshiya; Aoki, Shin

    2014-08-08

    Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated mice because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2. AS-2 also

  7. p53 Requires the Stress Sensor USF1 to Direct Appropriate Cell Fate Decision

    PubMed Central

    Bouafia, Amine; Corre, Sébastien; Gilot, David; Mouchet, Nicolas; Prince, Sharon; Galibert, Marie-Dominique

    2014-01-01

    Genomic instability is a major hallmark of cancer. To maintain genomic integrity, cells are equipped with dedicated sensors to monitor DNA repair or to force damaged cells into death programs. The tumor suppressor p53 is central in this process. Here, we report that the ubiquitous transcription factor Upstream Stimulatory factor 1 (USF1) coordinates p53 function in making proper cell fate decisions. USF1 stabilizes the p53 protein and promotes a transient cell cycle arrest, in the presence of DNA damage. Thus, cell proliferation is maintained inappropriately in Usf1 KO mice and in USF1-deficient melanoma cells challenged by genotoxic stress. We further demonstrate that the loss of USF1 compromises p53 stability by enhancing p53-MDM2 complex formation and MDM2-mediated degradation of p53. In USF1-deficient cells, the level of p53 can be restored by the re-expression of full-length USF1 protein similarly to what is observed using Nutlin-3, a specific inhibitor that prevents p53-MDM2 interaction. Consistent with a new function for USF1, a USF1 truncated protein lacking its DNA-binding and transactivation domains can also restore the induction and activity of p53. These findings establish that p53 function requires the ubiquitous stress sensor USF1 for appropriate cell fate decisions in response to DNA-damage. They underscore the new role of USF1 and give new clues of how p53 loss of function can occur in any cell type. Finally, these findings are of clinical relevance because they provide new therapeutic prospects in stabilizing and reactivating the p53 pathway. PMID:24831529

  8. Inhibition of experimental lung metastasis by aerosol delivery of PEI-p53 complexes.

    PubMed

    Gautam, A; Densmore, C L; Waldrep, J C

    2000-10-01

    Mutations in the p53 tumor suppressor gene and the pathways mediated by the p53 protein are common in many human cancers. Replacement of functional p53 by gene therapy is a potential way of combating these cancers and the associated drug resistance and tumor growth. Aerosol delivery of genes is a noninvasive way of targeting genes to the lung for gene therapy. Here we demonstrate, using a murine melanoma lung metastasis model, that aerosol delivery of polyethyleneimine-p53 (PEI-p53) complexes inhibits the growth of lung metastasis. A significantly reduced number of visible foci were observed in C57BL/6 mice injected with B16-F10 melanoma and treated with PEI-p53 complexes by aerosol for 3 weeks at twice a week. Fifty percent of the mice in the PEI-p53-treated group exhibited no visible tumor foci. There was a significant reduction in the lung weights of p53-treated mice (P < 0.01) compared to control groups. The tumor burden was also significantly lower (P < 0.001) in mice treated with PEI-p53 complexes. No extrapulmonary metastasis was observed in the groups treated with PEI-p53 complexes compared to 50% of the mice in control groups, which showed metastasis to lymph nodes in the neck or abdomen. Treatment with PEI-p53 aerosol also led to about a 50% increase in the mean length of survival of the mice injected with B16-F10 cells. These data suggest that delivery of the p53 gene by aerosol using PEI as the gene delivery vector can inhibit the growth of lung metastasis. PMID:11020346

  9. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  10. Regulation of glucose metabolism by p53: emerging new roles for the tumor suppressor.

    PubMed

    Madan, Esha; Gogna, Rajan; Bhatt, Madan; Pati, Uttam; Kuppusamy, Periannan; Mahdi, Abbas Ali

    2011-12-01

    p53 is well known as the "guardian of the genome" for differentiated and neoplastic cells. p53 induces cell-cycle arrest and cell death after DNA damage and thus contributes to the maintenance of genomic stability. In addition to this tumor suppressor function for pro-oncogenic cells, p53 also plays an important role as the central regulator of stress response by maintaining cellular homeostasis at the molecular and biochemical level. p53 regulates aerobic respiration at the glycolytic and oxidative phosphorylation (OXPHOS) steps via transcriptional regulation of its downstream genes TP53-induced glycolysis regulator (TIGAR) and synthesis of cytochrome c oxidase (SCO2). p53 negatively regulates glycolysis through activation of TIGAR (an inhibitor of the fructose-2,6-bisphosphate). On the contrary p53 positively regulates OXPHOS through upregulation of SCO2, a member of the COX-2 assembly involved in the electron-transport chain. It is interesting to notice that p53 antagonistically regulates the inter-dependent glycolytic and OXPHOS cycles. It is important to understand whether the p53-mediated transcriptional regulation of TIGAR and SCO2 is temporally segregated in cancer cells and what is the relation between these paradoxical regulations of glycolytic pathway with the tumor suppressor activity of p53. In this review we will elucidate the importance of p53-mediated regulation of glycolysis and OXPHOS and its relation with the tumor suppressor function of p53. Further since cellular metabolism shares great relation with the process of aging we will also try and establish the role of p53 in regulation of aging via its transcriptional control of cellular metabolism.

  11. Wt p53 impairs response to chemotherapy: make lemonade to spare normal cells

    PubMed Central

    Blagosklonny, Mikhail V.

    2012-01-01

    As published recently in Cancer Cell, p53 impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. I discuss that, while treating tumors lacking wt p53, this phenomenon can be exploited to protect normal cells from chemotherapy because all normal cells have wt p53. Also, several therapeutic paradigms can be reassessed, including the role of cellular senescence in cancer therapy. PMID:22802145

  12. Lack of Transcription Factor p53 Exacerbates Elastase-Induced Emphysema in Mice.

    PubMed

    Chrusciel, Sandra; Zysman, Maéva; Caramelle, Philippe; Tiendrebeogo, Arnaud; Baskara, Indoumady; Le Gouvello, Sabine; Chabot, François; Giraudier, Stéphane; Boczkowski, Jorge; Boyer, Laurent

    2016-02-01

    The transcription factor p53 is overexpressed in the lung of patients with emphysema, but it remains unclear if it has a deleterious or protective effect in disease progression. We investigated the role of p53 in the elastase-induced emphysema model and the molecular underlining mechanisms. Wild-type (WT) and p53(-/-) mice were instilled with pancreatic porcine elastase. We quantified emphysema (morphometric analysis), chemokine (C-C motif) ligand 2 (CCL2), and TNF-α in bronchoalveolar lavage (BAL) (ELISA), oxidative stress markers [heme oxygenase 1 (HO1), NAD(P)H dehydrogenase quinone 1 (NQO1), and quantitative RT-PCR], matrix metalloproteinase 12 (MMP12) expression, and macrophage apoptosis (cleaved caspase-3, immunofluorescence). p53 gene expression was up-regulated in the lung of elastase-instilled mice. p53 deletion aggravated elastase-induced emphysema severity, pulmonary inflammation (macrophage and neutrophil numbers and CCL2 and TNF-α levels in BAL), and lung oxidative stress. These findings, except for the increase in CCL2, were reproduced in WT mice transplanted with p53(-/-) bone marrow cells. The increased number of macrophages in p53(-/-) mice was not a consequence of reduced apoptosis or an excess of chemotaxis toward CCL2. Macrophage expression of MMP12 was higher in p53(-/-) mice compared with WT mice after elastase instillation. These findings provide evidence that p53(-/-) mice and WT mice grafted with p53(-/-) bone marrow cells are more prone to developing elastase-induced emphysema, supporting a protective role of p53, and more precisely p53 expressed in macrophages, against emphysema development. The pivotal role played by macrophages in this phenomenon may involve the MMP12-TNF-α pathway.

  13. DNA–protein crosslinks and p53 protein expression in relation to occupational exposure to formaldehyde

    PubMed Central

    Shaham, J; Bomstein, Y; Gurvich, R; Rashkovsky, M; Kaufman, Z

    2003-01-01

    Background: Formaldehyde (FA) is classified as a probable human carcinogen. Aims: To examine DNA protein crosslinks (DPC) and p53, which are generally known to be involved in carcinogenesis, in peripheral blood lymphocytes of workers exposed to FA. Methods: DPC and p53 ("wild type" and mutant) were examined in peripheral blood lymphocytes of 186 workers exposed to FA (mean years of exposure = 16) and 213 unexposed workers. Every worker completed a questionnaire on demographic data, occupational and medical history, smoking, and hygiene. Results: The adjusted mean level of DPC in the exposed and the unexposed workers differed significantly. Adjustment was made for age, sex, years of education, smoking, and origin. Exposure to FA increased the risk of having a higher level of pantropic p53 above 150 pg/ml (OR 1.6, 95% CI 0.8 to 3.1). A significant positive correlation was found between the increase of pantropic p53 protein and mutant p53 protein, as well as between pantropic p53 >150 pg/ml and mutant p53 protein. In the exposed group a significantly higher proportion of p53 >150 pg/ml was found among workers with DPC >0.187 (55.7%) (0.187 = median level of DPC) than among workers with DPC ⩽0.187 (33.3%). The risk of having pantropic p53 protein >150 pg/ml was determined mainly by levels of DPC. Workers with DPC above the median level had a significantly higher risk of having pantropic p53 >150 pg/ml (adjusted OR 2.5, 95% CI 1.2 to 5.4). Conclusions: Results suggest that DPC and mutation in p53 may represent steps in FA carcinogenesis and a possible causal relation between DPC and mutation in p53. These biomarkers can be applied in the assessment of the development of cancer due to FA exposure. PMID:12771391

  14. Resistance and gain-of-resistance phenotypes in cancers harboring wild-type p53

    PubMed Central

    Martinez-Rivera, Michelle; Siddik, Zahid H.

    2012-01-01

    Chemotherapy is the bedrock for the clinical management of cancer, and the tumor suppressor p53 has a central role in this therapeutic modality. This protein facilitates favorable antitumor drug response through a variety of key cellular functions, including cell cycle arrest, senescence, and apoptosis. These functions essentially cease once p53 becomes mutated, as occurs in ~50% of cancers, and some p53 mutants even exhibit gain-of-function effects, which lead to greater drug resistance. However, it is becoming increasingly evident that resistance is also seen in cancers harboring wild-type p53. In this review, we discuss how wild-type p53 is inactivated to render cells resistant to antitumor drugs. This may occur through various mechanisms, including an increase in proteasomal degradation, defects in post-translational modification, and downstream defects in p53 target genes. We also consider evidence that the resistance seen in wild-type p53 cancers can be substantially greater than that seen in mutant p53 cancers, and this poses a far greater challenge for efforts to design strategies that increase drug response in resistant cancers already primed with wild-type p53. Because the mechanisms contributing to this wild-type p53 “gain-of-resistance” phenotype are largely unknown, a concerted research effort is needed to identify the underlying basis for the occurrence of this phenotype and, in parallel, to explore the possibility that the phenotype may be a product of wild-type p53 gain-of-function effects. Such studies are essential to lay the foundation for a rational therapeutic approach in the treatment of resistant wild-type p53 cancers. PMID:22227014

  15. Glycogen synthase kinase 3 promotes p53 mRNA translation via phosphorylation of RNPC1

    PubMed Central

    Zhang, Min; Zhang, Jin; Chen, Xiangling; Cho, Seong-Jun; Chen, Xinbin

    2013-01-01

    The RNPC1 RNA-binding protein, also called Rbm38, is a target of p53 and a repressor of p53 mRNA translation. Thus, the p53–RNPC1 loop is critical for modulating p53 tumor suppression, but it is not clear how the loop is regulated. Here, we showed that RNPC1 is phosphorylated at Ser195 by glycogen synthase kinase 3 (GSK3). We also showed that GSK3 promotes p53 mRNA translation through phosphorylation of RNPC1. Interestingly, we found that the phosphor-mimetic mutant S195D and the deletion mutant Δ189–204, which lacks the GSK3 phosphorylation site, are unable to repress p53 mRNA translation due to loss of interaction with eukaryotic translation factor eIF4E on p53 mRNA. Additionally, we found that phosphorylated RNPC1, RNPC1-S195D, and RNPC1(Δ189–204) promote p53 mRNA translation through interaction with eukaryotic translation factor eIF4G, which then facilitates the assembly of the eIF4F complex on p53 mRNA. Furthermore, we showed that upon inhibition of the phosphatidylinositol 3-kinase (PI3K)–Akt pathway, GSK3 is activated, leading to increased RNPC1 phosphorylation and increased p53 expression in a RNPC1-dependent manner. Together, we postulate that the p53–RNPC1 loop can be explored to increase or decrease p53 activity for cancer therapy. PMID:24142875

  16. Isolation, characterization and functional analysis of full length p53 cDNA from Bubalus bubalis.

    PubMed

    Singh, Minu; Aggarwal, Suruchi; Mohanty, Ashok K; Mukhopadhyay, Tapas

    2015-09-01

    p53 plays a pivotal role in maintaining the genomic integrity of the cell and has an important role in cellular transformation. We isolated and cloned a full length p53 cDNA (Bp53) from water buffalo in expression vectors designed to generate tagged proteins with FLAG or GFP. Bp53 was found to be 1161 nucleotide long and codes for 386 amino acid residues with 79% homology with human p53 containing 393 amino acids. Although Bp53 has some inherent differences in amino acid composition in different functional domains as compared to human p53 but the total electrostatic charge of amino acids has been maintained. Bp53 cDNA was transiently transfected in a p53 null human NSCLC cell line and as expected, it was predominantly localized in the nucleus. Besides, Bp53 effectively transactivates a number of target genes similar to human p53 and exerts most of its anti-tumorigenic potential in culture as observed in clonogenic and cell viability assays. Like human p53 mutants, core domain mutant version of Bp53 was found to be mis-localized to cytoplasm with diminished tumor suppressor activity. However, Bp53 appeared to be more sensitive to mdm2 mediated degradation and as a result, this protein was less stable as compared to human p53. For the first time we have characterized a functionally efficient wild-type p53 from buffalo having lower stability than human p53 and thus, buffalo p53 could be used as a model system for further insight to the molecular basis of wild-type p53 instability.

  17. Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death.

    PubMed

    Rosso, Melissa; Polotskaia, Alla; Bargonetti, Jill

    2015-10-27

    A single nucleotide polymorphism (T to G) in the mdm2 P2 promoter, mdm2 SNP309, leads to MDM2 overexpression promoting chemotherapy resistant cancers. Two mdm2 G/G SNP309 cancer cell lines, MANCA and A875, have compromised wild-type p53 that co-localizes with MDM2 on chromatin. We hypothesized that MDM2 in these cells inhibited transcription initiation at the p53 target genes p21 and puma. Surprisingly, following etoposide treatment transcription initiation occurred at the compromised target genes in MANCA and A875 cells similar to the T/T ML-1 cell line. In all cell lines tested there was equally robust recruitment of total and initiated RNA polymerase II (Pol II). We found that knockdown of MDM2 in G/G cells moderately increased expression of subsets of p53 target genes without increasing p53 stability. Importantly, etoposide and actinomycin D treatments increased histone H3K36 trimethylation in T/T, but not G/G cells, suggesting a G/G correlated inhibition of transcription elongation. We therefore tested a chemotherapeutic agent (8-amino-adenosine) that induces p53-independent cell death for higher clinically relevant cytotoxicity. We demonstrated that T/T and G/G mdm2 SNP309 cells were equally sensitive to 8-amino-adenosine induced cell death. In conclusion for cancer cells overexpressing MDM2, targeting MDM2 may be less effective than inducing p53-independent cell death.

  18. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  19. Regulation of ES cell differentiation by functional and conformational modulation of p53.

    PubMed Central

    Sabapathy, K; Klemm, M; Jaenisch, R; Wagner, E F

    1997-01-01

    Embryonic stem (ES) cell lines were used to examine the role of p53 during in vitro differentiation. Undifferentiated ES cells express high levels of p53 exclusively in the wild-type conformation, immunoprecipitable by monoclonal antibody PAb246, and p53 was found to be functionally active as determined by its ability to bind DNA specifically and to activate transcription of target genes. Differentiation in vitro resulted in a decrease in the levels of p53 and in a shift in its conformational status to the mutant form, detectable by monoclonal antibody PAb240, with a concomitant loss of functional activity. The presence of functional p53 in the undifferentiated ES cells renders them hypersensitive to UV irradiation, whereas the differentiated cells were resistant to UV treatment. ES cells lacking p53 exhibit enhanced proliferation in both the undifferentiated and differentiated state, and apoptosis accompanying differentiation was found to be reduced. Furthermore, wild-type ES cells undergoing apoptosis expressed functional p53. Expression of the temperature-sensitive p53val135 mutant in wild-type ES cells resulted in a reduction of apoptosis accompanying differentiation when it adopted a mutant conformation at 39 degrees C. These data demonstrate that functional inactivation of p53 allows differentiating cells to escape from apoptosis, and suggest that the conformational switch could regulate the inactivation process. PMID:9321401

  20. p53 integrates host defense and cell fate during bacterial pneumonia

    PubMed Central

    Madenspacher, Jennifer H.; Azzam, Kathleen M.; Gowdy, Kymberly M.; Malcolm, Kenneth C.; Nick, Jerry A.; Dixon, Darlene; Aloor, Jim J.; Draper, David W.; Guardiola, John J.; Shatz, Maria; Menendez, Daniel; Lowe, Julie; Lu, Jun; Bushel, Pierre; Li, Leping; Merrick, B. Alex; Resnick, Michael A.

    2013-01-01

    Cancer and infection are predominant causes of human mortality and derive, respectively, from inadequate genomic and host defenses against environmental agents. The transcription factor p53 plays a central role in human tumor suppression. Despite its expression in immune cells and broad responsiveness to stressors, it is virtually unknown whether p53 regulates host defense against infection. We report that the lungs of naive p53−/− mice display genome-wide induction of NF-κB response element–enriched proinflammatory genes, suggestive of type 1 immune priming. p53-null and p53 inhibitor–treated mice clear Gram-negative and -positive bacteria more effectively than controls after intrapulmonary infection. This is caused, at least in part, by cytokines produced by an expanded population of apoptosis-resistant, TLR-hyperresponsive alveolar macrophages that enhance airway neutrophilia. p53−/− neutrophils, in turn, display heightened phagocytosis, Nox-dependent oxidant generation, degranulation, and bacterial killing. p53 inhibition boosts bacterial killing by mouse neutrophils and oxidant generation by human neutrophils. Despite enhanced bacterial clearance, infected p53−/− mice suffer increased mortality associated with aggravated lung injury. p53 thus modulates host defense through regulating microbicidal function and fate of phagocytes, revealing a fundamental link between defense of genome and host during environmental insult. PMID:23630228

  1. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics. PMID:27327543

  2. Systems-level analysis of the regulation and function of p53 dynamics in cancer

    NASA Astrophysics Data System (ADS)

    Batchelor, Eric

    Living cells use complex signaling pathways to detect environmental stimuli and generate appropriate responses. As methods for quantifying intracellular signaling have improved, several signaling pathways have been found to transmit information using signals that pulse in time. The transcription factor p53 is a key tumor suppressor and stress-response regulator that exhibits pulsatile dynamics. In response to DNA double-strand breaks, the concentration of p53 in the cell nucleus increases in pulses with a fixed amplitude, duration, and period; the mean number of pulses increases with DNA damage. p53 regulates the expression of over 100 target genes involved in a range of cellular stress responses including apoptosis, cell cycle arrest, and changes in metabolism. p53 pulsing directly impacts p53 function: altering p53 dynamics by pharmacologically inhibiting p53 degradation changes patterns of target gene expression and cell fate. While p53 pulsing serves an important signaling function, it is less clear what it accomplishes mechanistically. Here we will describe our recent efforts to determine the impact of p53 pulsing on the dynamics and coordination of target gene expression.

  3. p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal

    PubMed Central

    Zhao, Zhen; Zuber, Johannes; Diaz-Flores, Ernesto; Lintault, Laura; Kogan, Scott C.; Shannon, Kevin; Lowe, Scott W.

    2010-01-01

    The p53 tumor suppressor limits proliferation in response to cellular stress through several mechanisms. Here, we test whether the recently described ability of p53 to limit stem cell self-renewal suppresses tumorigenesis in acute myeloid leukemia (AML), an aggressive cancer in which p53 mutations are associated with drug resistance and adverse outcome. Our approach combined mosaic mouse models, Cre-lox technology, and in vivo RNAi to disable p53 and simultaneously activate endogenous KrasG12D—a common AML lesion that promotes proliferation but not self-renewal. We show that p53 inactivation strongly cooperates with oncogenic KrasG12D to induce aggressive AML, while both lesions on their own induce T-cell malignancies with long latency. This synergy is based on a pivotal role of p53 in limiting aberrant self-renewal of myeloid progenitor cells, such that loss of p53 counters the deleterious effects of oncogenic Kras on these cells and enables them to self-renew indefinitely. Consequently, myeloid progenitor cells expressing oncogenic Kras and lacking p53 become leukemia-initiating cells, resembling cancer stem cells capable of maintaining AML in vivo. Our results establish an efficient new strategy for interrogating oncogene cooperation, and provide strong evidence that the ability of p53 to limit aberrant self-renewal contributes to its tumor suppressor activity. PMID:20595231

  4. Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

    PubMed Central

    Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

    2012-01-01

    Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

  5. Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

    SciTech Connect

    Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy; Limesand, Kirsten H.

    2009-02-01

    Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glands of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.

  6. p53 Response to Ultrasound: Preliminary Observations in MCF7 Human Breast Cancer Cells

    NASA Astrophysics Data System (ADS)

    Burns, Janis M.; Campbell, Paul A.

    2011-09-01

    Mutated p53 can be found in approximately half of all human cancers. Strategies which seek to restore, or at least exercise a level of external control over, p53 functionality are thus potentially useful as adjuncts to therapy. Here, we report our preliminary measurements in this area, and demonstrate that short-burst pulsed ultrasound can indeed affect p53 activity. Specifically, we have observed that expression of the p53 protein can be regulated in the period immediately following low intensity short pulse (millisecond) ultrasound exposure, and that altered activity levels return to basal levels over a 24 hour period post-insonation.

  7. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics.

  8. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  9. Mutations in p53 as potential molecular markers for human breast cancer

    SciTech Connect

    Runnebaum, I.B.; Nagarajan, M.; Bowman, M.; Soto, D.; Sukumar, S. )

    1991-12-01

    Based on the high incidence of loss of heterozygosity for loci on chromosome 17p in the vicinity of the p53 locus in human breast tumors. The authors investigated the frequency and effects of mutations in the p53 tumor suppressor gene in mammary neoplasia. They examined the p53 gene in 20 breast cancer cell lines and 59 primary breast tumors. Northern blot analysis, immunoprecipitation, and nucleotide sequencing analysis revealed aberrant mRNA expression, over-expression of protein, and point mutations in the p53 gene in 50% of the cell line tested. A multiplex PCR assay was developed to search for deletions in the p53 genomic locus. Multiplex PCR of genomic DNA showed that up to 36% of primary tumors contained aberrations in the p53 locus. Mutations in exons 5-9 of the p53 gene were found in 10 out of 59 (17%) of the primary tumors studied by single-stranded conformation polymorphism analysis. They conclude that, compared to amplification of HER2/NEU, MYC, or INT2 oncogene loci, p53 gene mutations and deletions are the most frequently observed genetic change in breast cancer related to a single gene. Correlated to disease status, p53 gene mutations could prove to be a valuable marker for diagnosis and/or prognosis of breast neoplasia.

  10. Quantitative assessment of the p53-Mdm2 feedback loop using protein lysate microarrays.

    PubMed

    Ramalingam, Sundhar; Honkanen, Peter; Young, Lynn; Shimura, Tsutomu; Austin, John; Steeg, Patricia S; Nishizuka, Satoshi

    2007-07-01

    Mathematical simulations of the p53-Mdm2 feedback loop suggest that both proteins will exhibit impulsive expression characteristics in response to high cellular stress levels. However, little quantitative experimental evaluation has been done, particularly of the phosphorylated forms. To evaluate the mathematical models experimentally, we used lysate microarrays from an isogenic pair of gamma-ray-irradiated cell lysates from HCT116 (p53(+/+) and p53(-/-)). Both p53 and Mdm2 proteins showed expected pulses in the wild type, whereas no pulses were seen in the knockout. Based on experimental observations, we determined model parameters and generated an in silico "knockout," reflecting the experimental data, including phosphorylated proteins.

  11. P63 and P73: P53 mimics, menaces and more.

    PubMed

    Yang, A; McKeon, F

    2000-12-01

    Inactivation of the tumour suppressor p53 is the most common defect in cancer cells. The discovery of its two close relatives, p63 and p73, was therefore both provocative and confounding. Were these new genes tumour suppressors, p53 regulators, or evolutionary spin-offs? Both oncogenic and tumour-suppressor properties have now been attributed to the p53 homologues, perhaps reflecting the complex, often contradictory, protein products encoded by these genes. p63 and p73 are further implicated in many p53-independent pathways, including stem-cell regeneration, neurogenesis and sensory processes.

  12. Immunohistochemical expression of p53 and its clinicopathological correlation with modified Anneroth's histological grading system

    PubMed Central

    Dave, Kajal V; Chalishazar, Monali; Dave, Vishal R; Panja, Pritam; Singh, Manisha; Modi, Tapan G

    2016-01-01

    Introduction and Objectives: Oral squamous cell carcinoma (OSCC) is an epithelial neoplasm generally beginning as focal overgrowth of altered stem cells near the basement membrane, moving upward and laterally, replacing the normal epithelium. Histopathological grading has been used for many decades in an attempt to predict the clinical behavior of oral squamous cell carcinoma. In the present study, Forty biopsies were studied for histological grading and p53 expression. The p53 expression was studied in relation to clinical parameters such as age, sex of patient and site of tumors. Relation between histological grade of malignancy and p53 protein expression was analysed. All cases were classified according to Anneroth's histological malignancy grading system (1987). Materials and Methods: 40 cases of OSCC were assessed for clinical parameters, Anneroth's histological grading and immunohistochemically stained with p53 protien. Statistical Analysis: The results obtained were analyzed using Spearman's Co-relation. Observations and Results: The positive expression of p53 was found in 62% of carcinomas studied. Positivity of p53 showed correlation with histological grade of malignancy and with individual parameters like degree of keratinization, nuclear polymorphism, number of mitoses and lymphoplasmacytic infiltration while showed a negative correlation with pattern of invasion. Conclusion: Our study showed a significant correlation between parameters of tumor cell population, lymphoplasmacytic infiltration and p53 expression. A significant association between high grade of malignancy and p53 overexpression and insignificant correlation of p53 with age, sex of the patient and site of the tumor was found. PMID:27194859

  13. Human pregnane X receptor compromises the function of p53 and promotes malignant transformation

    PubMed Central

    Robbins, D; Cherian, M; Wu, J; Chen, T

    2016-01-01

    The pregnane X receptor (PXR) is well established as a nuclear receptor that has a central role in xenobiotic metabolism and disposition. However, emerging evidence suggests that PXR is also a regulator of apoptosis, promoting a malignant phenotype both in vitro and in vivo. The tumor suppressor p53 can be activated in the presence of DNA damage and induce cell cycle arrest to allow for DNA repair or, ultimately, apoptosis to suppress tumor formation. We previously identified p53 as a novel PXR-associated protein by using a mass spectrometric approach. In the current study, we identified a novel inhibitory effect of PXR on p53, revealing an anti-apoptotic function of PXR in colon carcinogenesis. PXR expression reduced p53 transactivation and the expression of its downstream target genes involved in cell cycle arrest and apoptosis by decreasing p53 recruitment to the promoter regions of these genes. Consistent with the inhibitory effect of PXR on p53, elevated PXR levels decreased doxorubicin- or nutlin-3a-mediated toxicity and promoted malignant transformation in colon cancer cells. Our findings show for the first time that PXR expression modulates p53 target gene promoter binding and contributes to the downregulation of p53 function in human colon cancer cells. These results define the functional significance of PXR expression in modulating p53-mediated mechanisms of tumor suppression. PMID:27547448

  14. Autophagy induced by p53-reactivating molecules protects pancreatic cancer cells from apoptosis.

    PubMed

    Fiorini, Claudia; Menegazzi, Marta; Padroni, Chiara; Dando, Ilaria; Dalla Pozza, Elisa; Gregorelli, Alex; Costanzo, Chiara; Palmieri, Marta; Donadelli, Massimo

    2013-03-01

    TP53 mutations compromising p53 transcriptional function occur in more than 50 % of human cancers, including pancreatic adenocarcinoma, and render cancer cells more resistant to conventional therapy. In the last few years, many efforts have been addressed to identify p53-reactivating molecules able to restore the wild-type transcriptionally competent conformation of the mutated proteins. Here, we show that two of these compounds, CP-31398 and RITA, induce cell growth inhibition, apoptosis, and autophagy by activating p53/DNA binding and p53 phosphorylation (Ser15), without affecting the total p53 amount. These effects occur in both wild-type and mutant p53 pancreatic adenocarcinoma cell lines, whereas they are much less pronounced in normal human primary fibroblasts. Furthermore, CP-31398 and RITA regulate the axis SESN1-2/AMPK/mTOR by inducing AMPK phosphorylation on Thr172, which has a crucial role in the autophagic response. The protective role of autophagy in cell growth inhibition by CP-31398 and RITA is supported by the finding that the AMPK inhibitor compound C or the autophagy inhibitors chloroquine or 3-methyladenine sensitize both pancreatic adenocarcinoma cell lines to the apoptotic response induced by p53-reactivating molecules. Our results demonstrate for the first time a survival role for autophagy induced by p53-reactivating molecules, supporting the development of an anti-cancer therapy based on autophagy inhibition associated to p53 activation.

  15. Interplay between p53-family, their regulators, and PARPs in DNA repair.

    PubMed

    Emami, S

    2011-02-01

    Abnormalities of the p53 tumor suppressor gene are among the most frequent molecular events in human neoplasia. p53 is consequently one of the most studied proteins, and is the subject of over 55,500 scientific papers. In this review, attention is focused on the functions of p53 in DNA repair. We highlight the recent progress in the analysis of protein signals to p53, including PARPs, and ubiquitination cascade proteins MDM2, CRM1, USP10 and 14-3-3σ.

  16. Positive regulation of p53 stability and activity by the deubiquitinating enzyme Otubain 1.

    PubMed

    Sun, Xiao-Xin; Challagundla, Kishore B; Dai, Mu-Shui

    2012-02-01

    The ubiquitin (Ub)-proteasome system plays a pivotal role in the regulation of p53 protein stability and activity. p53 is ubiquitinated and destabilized by MDM2 and several other Ub E3s, whereas it is deubiquitinated and stabilized by Ub-specific protease (USP)7 and USP10. Here we show that the ovarian tumour domain-containing Ub aldehyde-binding protein 1 (Otub1) is a novel p53 regulator. Otub1 directly suppresses MDM2-mediated p53 ubiquitination in cells and in vitro. Overexpression of Otub1 drastically stabilizes and activates p53, leading to apoptosis and marked inhibition of cell proliferation in a p53-dependent manner. These effects are independent of its catalytic activity but require residue Asp88. Mutation of Asp88 to Ala (Otub1(D88A)) abolishes activity of Otub1 to suppress p53 ubiquitination. Further, wild-type Otub1 and its catalytic mutant (Otub1(C91S)), but not Otub1(D88A), bind to the MDM2 cognate E2, UbcH5, and suppress its Ub-conjugating activity in vitro. Overexpression of Otub1(D88A) or ablation of endogenous Otub1 by siRNA markedly impaired p53 stabilization and activation in response to DNA damage. Together, these results reveal a novel function for Otub1 in regulating p53 stability and activity.