Science.gov

Sample records for heat stress response

  1. Human cardiovascular responses to passive heat stress.

    PubMed

    Crandall, Craig G; Wilson, Thad E

    2015-01-01

    Heat stress increases human morbidity and mortality compared to normothermic conditions. Many occupations, disease states, as well as stages of life are especially vulnerable to the stress imposed on the cardiovascular system during exposure to hot ambient conditions. This review focuses on the cardiovascular responses to heat stress that are necessary for heat dissipation. To accomplish this regulatory feat requires complex autonomic nervous system control of the heart and various vascular beds. For example, during heat stress cardiac output increases up to twofold, by increases in heart rate and an active maintenance of stroke volume via increases in inotropy in the presence of decreases in cardiac preload. Baroreflexes retain the ability to regulate blood pressure in many, but not all, heat stress conditions. Central hypovolemia is another cardiovascular challenge brought about by heat stress, which if added to a subsequent central volumetric stress, such as hemorrhage, can be problematic and potentially dangerous, as syncope and cardiovascular collapse may ensue. These combined stresses can compromise blood flow and oxygenation to important tissues such as the brain. It is notable that this compromised condition can occur at cardiac outputs that are adequate during normothermic conditions but are inadequate in heat because of the increased systemic vascular conductance associated with cutaneous vasodilation. Understanding the mechanisms within this complex regulatory system will allow for the development of treatment recommendations and countermeasures to reduce risks during the ever-increasing frequency of severe heat events that are predicted to occur. © 2015 American Physiological Society.

  2. Human Cardiovascular Responses to Passive Heat Stress

    PubMed Central

    Crandall, Craig G.; Wilson, Thad E.

    2016-01-01

    Heat stress increases human morbidity and mortality compared to normothermic conditions. Many occupations, disease states, as well as stages of life are especially vulnerable to the stress imposed on the cardiovascular system during exposure to hot ambient conditions. This review focuses on the cardiovascular responses to heat stress that are necessary for heat dissipation. To accomplish this regulatory feat requires complex autonomic nervous system control of the heart and various vascular beds. For example, during heat stress cardiac output increases up to twofold, by increases in heart rate and an active maintenance of stroke volume via increases in inotropy in the presence of decreases in cardiac preload. Baroreflexes retain the ability to regulate blood pressure in many, but not all, heat stress conditions. Central hypovolemia is another cardiovascular challenge brought about by heat stress, which if added to a subsequent central volumetric stress, such as hemorrhage, can be problematic and potentially dangerous, as syncope and cardiovascular collapse may ensue. These combined stresses can compromise blood flow and oxygenation to important tissues such as the brain. It is notable that this compromised condition can occur at cardiac outputs that are adequate during normothermic conditions but are inadequate in heat because of the increased systemic vascular conductance associated with cutaneous vasodilation. Understanding the mechanisms within this complex regulatory system will allow for the development of treatment recommendations and countermeasures to reduce risks during the ever-increasing frequency of severe heat events that are predicted to occur. PMID:25589263

  3. Molecular mechanisms of the plant heat stress response

    SciTech Connect

    Qu, Ai-Li; Ding, Yan-Fei; Jiang, Qiong; Zhu, Cheng

    2013-03-08

    Highlights: ► This review elaborates the response networks of heat stress in plants. ► It elaborates proteins responding to heat stress in special physiological period. ► The proteins and pathways have formed a basic network of the heat stress response. ► Achievements of the various technologies are also combined. -- Abstract: High temperature has become a global concern, which seriously affects the growth and production of plants, particularly crops. Thus, the molecular mechanism of the heat stress response and breeding of heat-tolerant plants is necessary to protect food production and ensure crop safety. This review elaborates on the response networks of heat stress in plants, including the Hsf and Hsp response pathways, the response of ROS and the network of the hormones. In addition, the production of heat stress response elements during particular physiological periods of the plant is described. We also discuss the existing problems and future prospects concerning the molecular mechanisms of the heat stress response in plants.

  4. Contrasting urban and rural heat stress responses to climate change

    NASA Astrophysics Data System (ADS)

    Fischer, E. M.; Oleson, K. W.; Lawrence, D. M.

    2012-02-01

    Hot temperatures in combination with high humidity cause human discomfort and may increase morbidity and mortality. A global climate model with an embedded urban model is used to explore the urban-rural contrast in the wet-bulb globe temperature, a heat stress index accounting for temperature and humidity. Wet-bulb globe temperatures are calculated at each model time step to resolve the heat stress diurnal cycle. The model simulates substantially higher heat stress in urban areas compared to neighbouring rural areas. Urban humidity deficit only weakly offsets the enhanced heat stress due to the large night-time urban heat island. The urban-rural contrast in heat stress is most pronounced at night and over mid-latitudes and subtropics. During heatwaves, the urban heat stress amplification is particularly pronounced. Heat stress strongly increases with doubled CO2 concentrations over both urban and rural surfaces. The tropics experience the greatest increase in number of high-heat-stress nights, despite a relatively weak ˜2°C warming. Given the lack of a distinct annual cycle and high relative humidity, the modest tropical warming leads to exceedance of the present-day record levels during more than half of the year in tropical regions, where adaptive capacity is often low. While the absolute urban and rural heat stress response to 2 × CO2 is similar, the occurrence of nights with extremely high heat stress increases more in cities than surrounding rural areas.

  5. Proteomics Analysis of Alfalfa Response to Heat Stress

    PubMed Central

    Li, Weimin; Wei, Zhenwu; Qiao, Zhihong; Wu, Zinian; Cheng, Lixiang; Wang, Yuyang

    2013-01-01

    The proteome responses to heat stress have not been well understood. In this study, alfalfa (Medicago sativa L. cv. Huaiyin) seedlings were exposed to 25°C (control) and 40°C (heat stress) in growth chambers, and leaves were collected at 24, 48 and 72 h after treatment, respectively. The morphological, physiological and proteomic processes were negatively affected under heat stress. Proteins were extracted and separated by two-dimensional polyacrylamide gel electrophoresis (2-DE), and differentially expressed protein spots were identified by mass spectrometry (MS). Totally, 81 differentially expressed proteins were identified successfully by MALDI-TOF/TOF. These proteins were categorized into nine classes: including metabolism, energy, protein synthesis, protein destination/storage, transporters, intracellular traffic, cell structure, signal transduction and disease/defence. Five proteins were further analyzed for mRNA levels. The results of the proteomics analyses provide a better understanding of the molecular basis of heat-stress responses in alfalfa. PMID:24324825

  6. Chloroplast Retrograde Regulation of Heat Stress Responses in Plants

    PubMed Central

    Sun, Ai-Zhen; Guo, Fang-Qing

    2016-01-01

    It is well known that intracellular signaling from chloroplast to nucleus plays a vital role in stress responses to survive environmental perturbations. The chloroplasts were proposed as sensors to heat stress since components of the photosynthetic apparatus housed in the chloroplast are the major targets of thermal damage in plants. Thus, communicating subcellular perturbations to the nucleus is critical during exposure to extreme environmental conditions such as heat stress. By coordinating expression of stress specific nuclear genes essential for adaptive responses to hostile environment, plants optimize different cell functions and activate acclimation responses through retrograde signaling pathways. The efficient communication between plastids and the nucleus is highly required for such diverse metabolic and biosynthetic functions during adaptation processes to environmental stresses. In recent years, several putative retrograde signals released from plastids that regulate nuclear genes have been identified and signaling pathways have been proposed. In this review, we provide an update on retrograde signals derived from tetrapyrroles, carotenoids, reactive oxygen species (ROS) and organellar gene expression (OGE) in the context of heat stress responses and address their roles in retrograde regulation of heat-responsive gene expression, systemic acquired acclimation, and cellular coordination in plants. PMID:27066042

  7. Hormonal modulation of the heat shock response: insights from fish with divergent cortisol stress responses.

    PubMed

    LeBlanc, Sacha; Höglund, Erik; Gilmour, Kathleen M; Currie, Suzanne

    2012-01-01

    Acute temperature stress in animals results in increases in heat shock proteins (HSPs) and stress hormones. There is evidence that stress hormones influence the magnitude of the heat shock response; however, their role is equivocal. To determine whether and how stress hormones may affect the heat shock response, we capitalized on two lines of rainbow trout specifically bred for their high (HR) and low (LR) cortisol response to stress. We predicted that LR fish, with a low cortisol but high catecholamine response to stress, would induce higher levels of HSPs after acute heat stress than HR trout. We found that HR fish have significantly higher increases in both catecholamines and cortisol compared with LR fish, and LR fish had no appreciable stress hormone response to heat shock. This unexpected finding prevented further interpretation of the hormonal modulation of the heat shock response but provided insight into stress-coping styles and environmental stress. HR fish also had a significantly greater and faster heat shock response and less oxidative protein damage than LR fish. Despite these clear differences in the physiological and cellular responses to heat shock, there were no differences in the thermal tolerance of HR and LR fish. Our results support the hypothesis that responsiveness to environmental change underpins the physiological differences in stress-coping styles. Here, we demonstrate that the heat shock response is a distinguishing feature of the HR and LR lines and suggest that it may have been coselected with the hormonal responses to stress.

  8. Cardiovascular responses to heat stress in chronic heart failure

    PubMed Central

    Cui, Jian; Sinoway, Lawrence I.

    2014-01-01

    Clinical reports have suggested that patients with heart diseases may be particularly vulnerable to heat injury. This review examines the effects of heat stress on cardiovascular and autonomic functions in patients with chronic heart failure (CHF). Laboratory investigations have shown that cutaneous vasodilator responses to heating are impaired in patients, whereas activation of skin sympathetic nerve activation is not attenuated in CHF as compared to controls. Attenuated cutaneous vasodilation may increase the risk of a heat related illness when CHF subjects are exposed to hyperthermic conditions. PMID:24599558

  9. Heat shock protein response in phosphorus-deficient heat-stressed broiler chickens.

    PubMed

    Edens, F W; Hill, C H; Wang, S

    1992-12-01

    1. During acute in vivo heat stress, a normal heat shock protein (HSP) response was not inducible in chickens deficient in inorganic phosphorus (P(i)-deficient). 2. Small quantities of HSP 70 and HSP 90 were induced, but little or no HSP 23 was induced in P(i)-deficient chickens compared to P(i)-adequate chickens. 3. Increased susceptibility of P(i)-deficient chickens to acute heat stress was attributed to their inability to produce an adequate HSP response.

  10. Carotid baroreflex responsiveness in heat-stressed humans

    NASA Technical Reports Server (NTRS)

    Crandall, C. G.

    2000-01-01

    The effects of whole body heating on human baroreflex function are relatively unknown. The purpose of this project was to identify whether whole body heating reduces the maximal slope of the carotid baroreflex. In 12 subjects, carotid-vasomotor and carotid-cardiac baroreflex responsiveness were assessed in normothermia and during whole body heating. Whole body heating increased sublingual temperature (from 36.4 +/- 0.1 to 37.4 +/- 0.1 degrees C, P < 0.01) and increased heart rate (from 59 +/- 3 to 83 +/- 3 beats/min, P < 0. 01), whereas mean arterial blood pressure (MAP) was slightly decreased (from 88 +/- 2 to 83 +/- 2 mmHg, P < 0.01). Carotid-vasomotor and carotid-cardiac responsiveness were assessed by identifying the maximal gain of MAP and heart rate to R wave-triggered changes in carotid sinus transmural pressure. Whole body heating significantly decreased the responsiveness of the carotid-vasomotor baroreflex (from -0.20 +/- 0.02 to -0.13 +/- 0.02 mmHg/mmHg, P < 0.01) without altering the responsiveness of the carotid-cardiac baroreflex (from -0.40 +/- 0.05 to -0.36 +/- 0.02 beats x min(-1) x mmHg(-1), P = 0.21). Carotid-vasomotor and carotid-cardiac baroreflex curves were shifted downward and upward, respectively, to accommodate the decrease in blood pressure and increase in heart rate that accompanied the heat stress. Moreover, the operating point of the carotid-cardiac baroreflex was shifted closer to threshold (P = 0.02) by the heat stress. Reduced carotid-vasomotor baroreflex responsiveness, coupled with a reduction in the functional reserve for the carotid baroreflex to increase heart rate during a hypotensive challenge, may contribute to increased susceptibility to orthostatic intolerance during a heat stress.

  11. Carotid baroreflex responsiveness in heat-stressed humans

    NASA Technical Reports Server (NTRS)

    Crandall, C. G.

    2000-01-01

    The effects of whole body heating on human baroreflex function are relatively unknown. The purpose of this project was to identify whether whole body heating reduces the maximal slope of the carotid baroreflex. In 12 subjects, carotid-vasomotor and carotid-cardiac baroreflex responsiveness were assessed in normothermia and during whole body heating. Whole body heating increased sublingual temperature (from 36.4 +/- 0.1 to 37.4 +/- 0.1 degrees C, P < 0.01) and increased heart rate (from 59 +/- 3 to 83 +/- 3 beats/min, P < 0. 01), whereas mean arterial blood pressure (MAP) was slightly decreased (from 88 +/- 2 to 83 +/- 2 mmHg, P < 0.01). Carotid-vasomotor and carotid-cardiac responsiveness were assessed by identifying the maximal gain of MAP and heart rate to R wave-triggered changes in carotid sinus transmural pressure. Whole body heating significantly decreased the responsiveness of the carotid-vasomotor baroreflex (from -0.20 +/- 0.02 to -0.13 +/- 0.02 mmHg/mmHg, P < 0.01) without altering the responsiveness of the carotid-cardiac baroreflex (from -0.40 +/- 0.05 to -0.36 +/- 0.02 beats x min(-1) x mmHg(-1), P = 0.21). Carotid-vasomotor and carotid-cardiac baroreflex curves were shifted downward and upward, respectively, to accommodate the decrease in blood pressure and increase in heart rate that accompanied the heat stress. Moreover, the operating point of the carotid-cardiac baroreflex was shifted closer to threshold (P = 0.02) by the heat stress. Reduced carotid-vasomotor baroreflex responsiveness, coupled with a reduction in the functional reserve for the carotid baroreflex to increase heart rate during a hypotensive challenge, may contribute to increased susceptibility to orthostatic intolerance during a heat stress.

  12. Peripheral vascular responses to heat stress after hindlimb suspension

    NASA Technical Reports Server (NTRS)

    Looft-Wilson, Robin C.; Gisolfi, Carl V.

    2002-01-01

    PURPOSE: The purpose of this study was to determine whether hindlimb suspension (which simulates the effects of microgravity) results in impaired hemodynamic responses to heat stress or alterations in mesenteric small artery sympathetic nerve innervation. METHODS: Over 28 d, 16 male Sprague-Dawley rats were hindlimb-suspended, and 13 control rats were housed in the same type of cage. After the treatment, mean arterial pressure (MAP), colonic temperature (Tcol), and superior mesenteric and iliac artery resistances (using Doppler flowmetry) were measured during heat stress [exposure to 42 degrees C until the endpoint of 80 mm Hg blood pressure was reached (75 +/- 9 min); endpoint Tcore = 43.6 +/- 0.2] while rats were anesthetized (sodium pentobarbital, 50 mg x kg(-1) BW). RESULTS: Hindlimb-suspended and control rats exhibited similar increases in Tcol, MAP, and superior mesenteric artery resistance, and similar decreases in iliac resistance during heat stress (endpoint was a fall in MAP below 80 mm Hg). Tyrosine hydroxylase immunostaining indicated similar sympathetic nerve innervation in small mesenteric arteries from both groups. CONCLUSION: Hindlimb suspension does not alter the hemodynamic or thermoregulatory responses to heat stress in the anesthetized rat or mesenteric sympathetic nerve innervation, suggesting that this sympathetic pathway is intact.

  13. Peripheral vascular responses to heat stress after hindlimb suspension

    NASA Technical Reports Server (NTRS)

    Looft-Wilson, Robin C.; Gisolfi, Carl V.

    2002-01-01

    PURPOSE: The purpose of this study was to determine whether hindlimb suspension (which simulates the effects of microgravity) results in impaired hemodynamic responses to heat stress or alterations in mesenteric small artery sympathetic nerve innervation. METHODS: Over 28 d, 16 male Sprague-Dawley rats were hindlimb-suspended, and 13 control rats were housed in the same type of cage. After the treatment, mean arterial pressure (MAP), colonic temperature (Tcol), and superior mesenteric and iliac artery resistances (using Doppler flowmetry) were measured during heat stress [exposure to 42 degrees C until the endpoint of 80 mm Hg blood pressure was reached (75 +/- 9 min); endpoint Tcore = 43.6 +/- 0.2] while rats were anesthetized (sodium pentobarbital, 50 mg x kg(-1) BW). RESULTS: Hindlimb-suspended and control rats exhibited similar increases in Tcol, MAP, and superior mesenteric artery resistance, and similar decreases in iliac resistance during heat stress (endpoint was a fall in MAP below 80 mm Hg). Tyrosine hydroxylase immunostaining indicated similar sympathetic nerve innervation in small mesenteric arteries from both groups. CONCLUSION: Hindlimb suspension does not alter the hemodynamic or thermoregulatory responses to heat stress in the anesthetized rat or mesenteric sympathetic nerve innervation, suggesting that this sympathetic pathway is intact.

  14. Root proteomic responses to heat stress in two Agrostis grass species contrasting in heat tolerance.

    PubMed

    Xu, Chenping; Huang, Bingru

    2008-01-01

    Protein metabolism plays an important role in plant adaptation to heat stress. This study was designed to identify heat-responsive proteins in roots associated with thermotolerance for two C3 grass species contrasting in heat tolerance, thermal Agrostis scabra and heat-sensitive Agrostis stolonifera L. Plants were exposed to 20 degrees C (control), 30 C (moderate heat stress), or 40 degrees C (severe heat stress) in growth chambers. Roots were harvested at 2 d and 10 d after temperature treatment. Proteins were extracted and separated by two-dimensional polyacrylamide gel electrophoresis. Seventy protein spots were regulated by heat stress in at least one species. Under both moderate and severe heat stress, more proteins were down-regulated than were up-regulated, and thermal A. scabra roots had more up-regulated proteins than A. stolonifera roots. The sequences of 66 differentially expressed protein spots were identified using mass spectrometry. The results suggested that the up-regulation of sucrose synthase, glutathione S-transferase, superoxide dismutase, and heat shock protein Sti (stress-inducible protein) may contribute to the superior root thermotolerance of A. scabra. In addition, phosphoproteomic analysis indicated that two isoforms of fructose-biphosphate aldolase were highly phosphorylated under heat stress, and thermal A. scabra had greater phosphorylation than A. stolonifera, suggesting that the aldolase phosphorylation might be involved in root thermotolerance.

  15. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses

    PubMed Central

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention. PMID:26904076

  16. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses.

    PubMed

    Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Luo, De-Xu; Gong, Zhen-Hui; Lu, Ming-Hui

    2016-01-01

    Abiotic stresses such as high temperature, salinity, and drought adversely affect the survival, growth, and reproduction of plants. Plants respond to such unfavorable changes through developmental, physiological, and biochemical ways, and these responses require expression of stress-responsive genes, which are regulated by a network of transcription factors (TFs), including heat stress transcription factors (HSFs). HSFs play a crucial role in plants response to several abiotic stresses by regulating the expression of stress-responsive genes, such as heat shock proteins (Hsps). In this review, we describe the conserved structure of plant HSFs, the identification of HSF gene families from various plant species, their expression profiling under abiotic stress conditions, regulation at different levels and function in abiotic stresses. Despite plant HSFs share highly conserved structure, their remarkable diversification across plants reflects their numerous functions as well as their integration into the complex stress signaling and response networks, which can be employed in crop improvement strategies via biotechnological intervention.

  17. Differential proteomic response to heat stress in thermal Agrostis scabra and heat-sensitive Agrostis stolonifera.

    PubMed

    Xu, Chenping; Huang, Bingru

    2010-06-01

    Knowledge of heat-responsive proteins is critical for further understanding of the molecular mechanisms of heat tolerance. The objective of this study was to compare proteins differentially expressed in two C(3) grass species contrasting in heat tolerance, heat-tolerant thermal Agrostis scabra and heat-sensitive Agrostis stolonifera L., and to identify heat-responsive proteins for short- and long-term responses. Plants were exposed to 20/15 degrees C (day/night, control) or 40/35 degrees C (day/night, heat stress) in growth chambers. Leaves were harvested at 2 and 10 days after temperature treatment. Proteins were extracted and separated by fluorescence difference gel electrophoresis (DIGE). Thermal A. scabra had superior heat tolerance than A. stolonifera, as indicated by the maintenance of higher chlorophyll content and photochemical efficiency under heat stress. The two-dimensional difference electrophoresis detected 68 heat-responsive proteins in the two species. Thermal A. scabra had more protein spots either down- or up-regulated at 2 days of heat stress, but fewer protein spots were altered at 10 days of heat stress compared with A. stolonifera. Many protein spots exhibited transient down-regulation in thermal A. scabra (only at 2 days of heat treatment), whereas down-regulation of many proteins was also found at 10 days of heat treatment in A. stolonifera, which suggested that protein metabolism in thermal A. scabra might acclimate to heat stress more rapidly than those in A. stolonifera. The sequences of 56 differentially expressed protein spots were identified using mass spectrometry. The results suggest that the maintenance or less severe down-regulation of proteins during long-term (10 days) heat stress may contribute to the superior heat tolerance in thermal A. scabra, including those involved in photosynthesis [RuBisCo, RuBisCo activase, chloroplastic glyceraldehydes-3-phosphate dehydrogenase (GAPDH), chloroplastic aldolase, oxygen-evolving complex

  18. Quantifying livestock responses for heat stress management: a review

    NASA Astrophysics Data System (ADS)

    Nienaber, J. A.; Hahn, G. L.; Eigenberg, R. A.

    Hot weather challenges livestock production but technology exists to offset the challenge if producers have made appropriate strategic decisions. Key issues include understanding the hazards of heat stress, being prepared to offer relief from the heat, recognizing when an animal is in danger, and taking appropriate action. This paper describes our efforts to develop biological response functions; assesses climatic probabilities and performs associated risk analyses; provides inputs for computer models used to make environmental management decisions; and evaluates threshold temperatures as estimates of critical temperature limits for swine, cattle and sheep.

  19. Proteomic response of mouse pituitary gland under heat stress revealed active regulation of stress responsive proteins.

    PubMed

    Memon, Shahar Bano; Lian, Li; Gadahi, Javaid Ali; Genlin, Wang

    2016-10-01

    The mapping of tissue proteomes can identify the molecular regulators and effectors of their physiological activity. However, proteomic response of a mammalian tissue against heat stress (HS) particularly of the pituitary gland has not yet been resolved. The proteomic response of the mouse pituitary gland against HS at 40(o)C was evaluated by iTRAQ. We found that, HS actively regulates stress-related proteins. Among 375 differentially expressed proteins, 26 up and 46 downregulated proteins were found as stress responsive proteins. Two proteins belonging to the HSP70 and one to HSP90 family were found upregulated. Meanwhile, the expression of HSP90α (Cytosolic), HSP60, and HSP84b were observed to be downregulated. A neuroprotective enzyme Nmnat3 was observed to be significantly upregulated. Three proteins related to the intermediate filament (IF) proteins (lamins, vimentin and keratins) were also found to be upregulated. We reported, an association between the IF proteins and HSPs as a biological marker of HS. The expression of Apo A-IV was upregulated and might be one explanation for low food intake during HS. Our findings indicated that, differentially expressed proteins might be played important roles in combating HS. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Does heat stress alter the pig's response to dietary fat?

    PubMed

    Kellner, T A; Baumgard, L H; Prusa, K J; Gabler, N K; Patience, J F

    2016-11-01

    Heat stress (HS) results in major losses to the pork industry via reduced growth performance and, possibly, carcass fat quality. The experimental objective was to measure the effects of HS on the pig's response to dietary fat in terms of lipid digestion, metabolism, and deposition over a 35-d finishing period. A total of 96 PIC 337 × C22/C29 (PIC, Inc., Hendersonville, TN) barrows (initial BW of 100.4 ± 1.2 kg) were randomly allotted to 1 of 9 treatments arranged as a 3 × 3 factorial: thermoneutral (TN; constant 24°C; ad libitum access to feed), pair-fed thermoneutral (PFTN; constant 24°C; limit fed based on previous HS daily feed intake), or HS (cyclical 28°C nighttime, 33°C from d 0 to 7, 33.5°C from d 7 to 14, 34°C from d 14 to 21, 34.5°C from d 21 to 28, and 35°C from d 28 to 35 daytime; ab libitum access to feed) and diet (a corn-soybean meal-based diet with 0% added fat [CNTR], CNTR with 3% added tallow [TAL; iodine value {IV} = 41.8], or CNTR with 3% added corn oil [CO; IV = 123.0]). No interactions between environment and diet were evident for any major response criteria ( ≥ 0.063). Rectal temperature increased due to HS (39.0°C for HS, 38.1°C for TN, and 38.2°C for PFTN; < 0.001). Heat stress decreased ADFI (27.8%; < 0.001), ADG (0.72 kg/d for HS, 1.03 kg/d for TN, and 0.78 kg/d for PFTN; < 0.001), and G:F (0.290 for HS, 0.301 for TN, and 0.319 for PFTN; = 0.006). Heat stress barrows required 1.2 Mcal of ME intake more per kilogram of BW gain than PFTN ( < 0.001). Heat stress tended to result in the lowest apparent total tract digestibility of acid hydrolyzed ether extract (AEE; 59.0% for HS, 60.2% for TN, and 61.4% for PFTN; = 0.055). True total tract digestibility (TTTD) of AEE of CO-based diets (99.3%) was greater than that of CNTR (97.3%) and TAL-based diets (96.3%; = 0.012). Environment had no impact on TTTD of AEE ( = 0.118). Environment had no impact on jowl IV at market (69.2 g/100 g for HS, 69.3 g/100 g for TN, and 69.8 g/100 g for

  1. When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress.

    PubMed

    Rizhsky, Ludmila; Liang, Hongjian; Shuman, Joel; Shulaev, Vladimir; Davletova, Sholpan; Mittler, Ron

    2004-04-01

    Within their natural habitat, plants are subjected to a combination of abiotic conditions that include stresses such as drought and heat. Drought and heat stress have been extensively studied; however, little is known about how their combination impacts plants. The response of Arabidopsis plants to a combination of drought and heat stress was found to be distinct from that of plants subjected to drought or heat stress. Transcriptome analysis of Arabidopsis plants subjected to a combination of drought and heat stress revealed a new pattern of defense response in plants that includes a partial combination of two multigene defense pathways (i.e. drought and heat stress), as well as 454 transcripts that are specifically expressed in plants during a combination of drought and heat stress. Metabolic profiling of plants subjected to drought, heat stress, or a combination of drought and heat stress revealed that plants subject to a combination of drought and heat stress accumulated sucrose and other sugars such as maltose and glucose. In contrast, Pro that accumulated in plants subjected to drought did not accumulate in plants during a combination of drought and heat stress. Heat stress was found to ameliorate the toxicity of Pro to cells, suggesting that during a combination of drought and heat stress sucrose replaces Pro in plants as the major osmoprotectant. Our results highlight the plasticity of the plant genome and demonstrate its ability to respond to complex environmental conditions that occur in the field.

  2. Heat stress responses modulate calcium regulations and electrophysiological characteristics in atrial myocytes.

    PubMed

    Chen, Yao-Chang; Kao, Yu-Hsun; Huang, Chun-Feng; Cheng, Chen-Chuan; Chen, Yi-Jen; Chen, Shih-Ann

    2010-04-01

    Heat stress-induced responses change the ionic currents and calcium homeostasis. However, the molecular insights into the heat stress responses on calcium homeostasis remain unclear. The purposes of this study were to examine the mechanisms of heat stress responses on calcium handling and electrophysiological characteristics in atrial myocytes. We used indo-1 fluorimetric ratio technique and whole-cell patch clamp to investigate the intracellular calcium, action potentials, and ionic currents in isolated rabbit single atrial cardiomyocytes with or without (control) exposure to heat stress (43 degrees C, 15 min) 5+/-1 h before experiments. The expressions of sarcoplasmic reticulum ATPase (SERCA2a), and Na(+)-Ca(2+) exchanger (NCX) in the control and heat stress-treated atrial myocytes were evaluated by Western blot and real-time PCR. As compared with control myocytes, the heat stress-treated myocytes had larger sarcoplasmic reticulum calcium content and larger intracellular calcium transient with a shorter decay portion. Heat stress-treated myocytes also had larger L-type calcium currents, transient outward potassium currents, but smaller NCX currents. Heat stress responses increased the protein expressions, SERCA2a, NCX, and heat shock protein. However, heat stress responses did not change the RNA expression of SERCA2a and NCX. In conclusion, heat stress responses change calcium handling through protein but not RNA regulation.

  3. Can intradermal administration of angiotensin II influence human heat loss responses during whole body heat stress?

    PubMed

    Fujii, Naoto; Meade, Robert D; Paull, Gabrielle; McGinn, Ryan; Foudil-bey, Imane; Akbari, Pegah; Kenny, Glen P

    2015-05-01

    It is unclear if angiotensin II, which can increase the production of reactive oxygen species (oxidative stress), modulates heat loss responses of cutaneous blood flow and sweating. We tested the hypothesis that angiotensin II-induced increases in oxidative stress impair cutaneous perfusion and sweating during rest and exercise in the heat. Eleven young (24 ± 4 yr) healthy adults performed two 30-min cycling bouts at a fixed rate of metabolic heat production (400 W) in the heat (35°C). The first and second exercises were followed by a 20- and 40-min recovery. Four microdialysis fibers were placed in the forearm skin for continuous administration of either: 1) lactated Ringer (control), 2) 10 μM angiotensin II, 3) 10 mM ascorbate (an antioxidant), or 4) a combination of 10 μM angiotensin II + 10 mM ascorbate. Cutaneous vascular conductance (CVC; laser-Doppler perfusion units/mean arterial pressure) and sweating (ventilated capsule) were evaluated at each skin site. Compared with control, angiotensin II reduced both CVC and sweating at baseline resting and during each recovery in the heat (all P < 0.05). However, during both exercise bouts, there were no differences in CVC or sweating between the treatment sites (all P > 0.05). When ascorbate was coinfused with angiotensin II, the effect of angiotensin II on sweating was abolished (all P > 0.05); however, its effect on CVC at baseline resting and during each recovery remained intact (all P < 0.05). We show angiotensin II impairs cutaneous perfusion independent of oxidative stress, while it impairs sweating through increasing oxidative stress during exposure to an ambient heat stress before and following exercise. Copyright © 2015 the American Physiological Society.

  4. Can intradermal administration of angiotensin II influence human heat loss responses during whole body heat stress?

    PubMed Central

    Fujii, Naoto; Meade, Robert D.; Paull, Gabrielle; McGinn, Ryan; Foudil-bey, Imane; Akbari, Pegah

    2015-01-01

    It is unclear if angiotensin II, which can increase the production of reactive oxygen species (oxidative stress), modulates heat loss responses of cutaneous blood flow and sweating. We tested the hypothesis that angiotensin II-induced increases in oxidative stress impair cutaneous perfusion and sweating during rest and exercise in the heat. Eleven young (24 ± 4 yr) healthy adults performed two 30-min cycling bouts at a fixed rate of metabolic heat production (400 W) in the heat (35°C). The first and second exercises were followed by a 20- and 40-min recovery. Four microdialysis fibers were placed in the forearm skin for continuous administration of either: 1) lactated Ringer (control), 2) 10 μM angiotensin II, 3) 10 mM ascorbate (an antioxidant), or 4) a combination of 10 μM angiotensin II + 10 mM ascorbate. Cutaneous vascular conductance (CVC; laser-Doppler perfusion units/mean arterial pressure) and sweating (ventilated capsule) were evaluated at each skin site. Compared with control, angiotensin II reduced both CVC and sweating at baseline resting and during each recovery in the heat (all P < 0.05). However, during both exercise bouts, there were no differences in CVC or sweating between the treatment sites (all P > 0.05). When ascorbate was coinfused with angiotensin II, the effect of angiotensin II on sweating was abolished (all P > 0.05); however, its effect on CVC at baseline resting and during each recovery remained intact (all P < 0.05). We show angiotensin II impairs cutaneous perfusion independent of oxidative stress, while it impairs sweating through increasing oxidative stress during exposure to an ambient heat stress before and following exercise. PMID:25767030

  5. Genome scale transcriptional response diversity among ten ecotypes of Arabidopsis thaliana during heat stress

    PubMed Central

    Barah, Pankaj; Jayavelu, Naresh D.; Mundy, John; Bones, Atle M.

    2013-01-01

    In the scenario of global warming and climate change, heat stress is a serious threat to crop production worldwide. Being sessile, plants cannot escape from heat. Plants have developed various adaptive mechanisms to survive heat stress. Several studies have focused on diversity of heat tolerance levels in divergent Arabidopsis thaliana (A. thaliana) ecotypes, but comprehensive genome scale understanding of heat stress response in plants is still lacking. Here we report the genome scale transcript responses to heat stress of 10 A. thaliana ecotypes (Col, Ler, C24, Cvi, Kas1, An1, Sha, Kyo2, Eri, and Kond) originated from different geographical locations. During the experiment, A. thaliana plants were subjected to heat stress (38°C) and transcript responses were monitored using Arabidopsis NimbleGen ATH6 microarrays. The responses of A. thaliana ecotypes exhibited considerable variation in the transcript abundance levels. In total, 3644 transcripts were significantly heat regulated (p < 0.01) in the 10 ecotypes, including 244 transcription factors and 203 transposable elements. By employing a systems genetics approach- Network Component Analysis (NCA), we have constructed an in silico transcript regulatory network model for 35 heat responsive transcription factors during cellular responses to heat stress in A. thaliana. The computed activities of the 35 transcription factors showed ecotype specific responses to the heat treatment. PMID:24409190

  6. Genome scale transcriptional response diversity among ten ecotypes of Arabidopsis thaliana during heat stress.

    PubMed

    Barah, Pankaj; Jayavelu, Naresh D; Mundy, John; Bones, Atle M

    2013-01-01

    In the scenario of global warming and climate change, heat stress is a serious threat to crop production worldwide. Being sessile, plants cannot escape from heat. Plants have developed various adaptive mechanisms to survive heat stress. Several studies have focused on diversity of heat tolerance levels in divergent Arabidopsis thaliana (A. thaliana) ecotypes, but comprehensive genome scale understanding of heat stress response in plants is still lacking. Here we report the genome scale transcript responses to heat stress of 10 A. thaliana ecotypes (Col, Ler, C24, Cvi, Kas1, An1, Sha, Kyo2, Eri, and Kond) originated from different geographical locations. During the experiment, A. thaliana plants were subjected to heat stress (38°C) and transcript responses were monitored using Arabidopsis NimbleGen ATH6 microarrays. The responses of A. thaliana ecotypes exhibited considerable variation in the transcript abundance levels. In total, 3644 transcripts were significantly heat regulated (p < 0.01) in the 10 ecotypes, including 244 transcription factors and 203 transposable elements. By employing a systems genetics approach- Network Component Analysis (NCA), we have constructed an in silico transcript regulatory network model for 35 heat responsive transcription factors during cellular responses to heat stress in A. thaliana. The computed activities of the 35 transcription factors showed ecotype specific responses to the heat treatment.

  7. Chronic Heat Stress Induces Immune Response, Oxidative Stress Response, and Apoptosis of Finishing Pig Liver: A Proteomic Approach.

    PubMed

    Cui, Yanjun; Hao, Yue; Li, Jielei; Bao, Weiguang; Li, Gan; Gao, Yanli; Gu, Xianhong

    2016-05-11

    Heat stress (HS) negatively affects human health, animal welfare, and livestock production. We analyzed the hepatic proteomes of finishing pigs subjected to chronic heat stress (HS), thermal neutral (TN), and restricted feed intake conditions, identifying differences between direct and indirect (via reduced feed intake) HS. Twenty-four castrated male pigs were randomly allocated to three treatments for three weeks: (1) thermal neutral (TN) (22 °C) with ad libitum feeding; (2) chronic HS (30 °C) with ad libitum feeding; and (3) TN, pair-fed to HS intake (PF). Hepatic proteome analysis was conducted using two-dimensional gel electrophoresis and mass spectrometry. Both HS and PF significantly reduced liver weight (p < 0.05). Forty-five hepatic proteins were differentially abundant when comparing HS with TN (37), PF with TN (29), and HS with PF (16). These proteins are involved in heat shock response and immune defense, oxidative stress response, cellular apoptosis, metabolism, signal transduction, and cytoskeleton. We also observed increased abundance of proteins and enzymes associated with heat shock response and immune defense, reduced the redox state, enhanced multiple antioxidant abilities, and increased apoptosis in HS liver. Heat-load, independent of reduced feed intake, induced an innate immune response, while food restriction caused stress and cellular apoptosis. Our results provide novel insights into the effects of chronic HS on liver.

  8. Plastic and evolutionary responses to heat stress in a temperate dung fly: negative correlation between basal and induced heat tolerance?

    PubMed

    Esperk, T; Kjaersgaard, A; Walters, R J; Berger, D; Blanckenhorn, W U

    2016-05-01

    Extreme weather events such as heat waves are becoming more frequent and intense. Populations can cope with elevated heat stress by evolving higher basal heat tolerance (evolutionary response) and/or stronger induced heat tolerance (plastic response). However, there is ongoing debate about whether basal and induced heat tolerance are negatively correlated and whether adaptive potential in heat tolerance is sufficient under ongoing climate warming. To evaluate the evolutionary potential of basal and induced heat tolerance, we performed experimental evolution on a temperate source population of the dung fly Sepsis punctum. Offspring of flies adapted to three thermal selection regimes (Hot, Cold and Reference) were subjected to acute heat stress after having been exposed to either a hot-acclimation or non-acclimation pretreatment. As different traits may respond differently to temperature stress, several physiological and life history traits were assessed. Condition dependence of the response was evaluated by exposing juveniles to different levels of developmental (food restriction/rearing density) stress. Heat knockdown times were highest, whereas acclimation effects were lowest in the Hot selection regime, indicating a negative association between basal and induced heat tolerance. However, survival, adult longevity, fecundity and fertility did not show such a pattern. Acclimation had positive effects in heat-shocked flies, but in the absence of heat stress hot-acclimated flies had reduced life spans relative to non-acclimated ones, thereby revealing a potential cost of acclimation. Moreover, body size positively affected heat tolerance and unstressed individuals were less prone to heat stress than stressed flies, offering support for energetic costs associated with heat tolerance. Overall, our results indicate that heat tolerance of temperate insects can evolve under rising temperatures, but this response could be limited by a negative relationship between basal and

  9. Heat stress-induced response of the proteomes of leaves from Salvia splendens Vista and King

    PubMed Central

    2013-01-01

    Background Salvia splendens Ker-Gawl, most commonly used in China to add a splash of brilliant color to the surroundings during the warm season, is subject to heat stress, which can greatly affect its growth and yield. Results To gain a comprehensive understanding of heat-tolerance mechanisms of S. splendens, we assessed the heat-stress responses and characterized the proteomes of leaves from two varieties, Vista (heat resistant) and King (heat sensitive). Denaturing two-dimensional gel electrophoresis (2–DE) and tandem mass spectrometry were used to identify heat-responsive proteins. Heat stress induced the reversible inactivation of photosystem II reaction centers and increased the amounts of antioxidative enzymes, thereby decreasing oxidative damage. Vista leaves had a much greater ability than King leaves to develop light-protective and oxygen-scavenging systems in response to heat stress. More than 1213 leaf proteome spots were reproducibly detected in the gels, with a total of 33 proteins in each leaf type differentially regulated when Salvia splendens were heat stress treated. Of these proteins, 23 and 28 from Vista and King, respectively, were identified. Conclusions Most of the identified proteins are involved in photosynthesis, metabolism, protein processing, or stress response, indicating that many different processes work together to establish a new cellular homeostasis in response to heat stress. PMID:23773552

  10. Transcriptome response to heat stress in a chicken hepatocellular carcinoma cell line.

    PubMed

    Sun, Liang; Lamont, Susan J; Cooksey, Amanda M; McCarthy, Fiona; Tudor, Catalina O; Vijay-Shanker, K; DeRita, Rachael M; Rothschild, Max; Ashwell, Chris; Persia, Michael E; Schmidt, Carl J

    2015-11-01

    Heat stress triggers an evolutionarily conserved set of responses in cells. The transcriptome responds to hyperthermia by altering expression of genes to adapt the cell or organism to survive the heat challenge. RNA-seq technology allows rapid identification of environmentally responsive genes on a large scale. In this study, we have used RNA-seq to identify heat stress responsive genes in the chicken male white leghorn hepatocellular (LMH) cell line. The transcripts of 812 genes were responsive to heat stress (p < 0.01) with 235 genes upregulated and 577 downregulated following 2.5 h of heat stress. Among the upregulated were genes whose products function as chaperones, along with genes affecting collagen synthesis and deposition, transcription factors, chromatin remodelers, and genes modulating the WNT and TGF-beta pathways. Predominant among the downregulated genes were ones that affect DNA replication and repair along with chromosomal segregation. Many of the genes identified in this study have not been previously implicated in the heat stress response. These data extend our understanding of the transcriptome response to heat stress with many of the identified biological processes and pathways likely to function in adapting cells and organisms to hyperthermic stress. Furthermore, this study should provide important insight to future efforts attempting to improve species abilities to withstand heat stress through genome-wide association studies and breeding.

  11. Full genome gene expression analysis of the heat stress response in Drosophila melanogaster

    PubMed Central

    Sørensen, Jesper G.; Nielsen, Morten M.; Kruhøffer, Mogens; Justesen, Just; Loeschcke, Volker

    2005-01-01

    The availability of full genome sequences has allowed the construction of microarrays, with which screening of the full genome for changes in gene expression is possible. This method can provide a wealth of information about biology at the level of gene expression and is a powerful method to identify genes and pathways involved in various processes. In this study, we report a detailed analysis of the full heat stress response in Drosophila melanogaster females, using whole genome gene expression arrays (Affymetrix Inc, Santa Clara, CA, USA). The study focuses on up- as well as downregulation of genes from just before and at 8 time points after an application of short heat hardening (36°C for 1 hour). The expression changes were followed up to 64 hours after the heat stress, using 4 biological replicates. This study describes in detail the dramatic change in gene expression over time induced by a short-term heat treatment. We found both known stress responding genes and new candidate genes, and processes to be involved in the stress response. We identified 3 main groups of stress responsive genes that were early–upregulated, early– downregulated, and late–upregulated, respectively, among 1222 differentially expressed genes in the data set. Comparisons with stress sensitive genes identified by studies of responses to other types of stress allow the discussion of heat-specific and general stress responses in Drosophila. Several unexpected features were revealed by this analysis, which suggests that novel pathways and mechanisms are involved in the responses to heat stress and to stress in general. The majority of stress responsive genes identified in this and other studies were downregulated, and the degree of overlap among downregulated genes was relatively high, whereas genes responding by upregulation to heat and other stress factors were more specific to the stress applied or to the conditions of the particular study. As an expected exception, heat shock

  12. Regulation of Non-coding RNAs in Heat Stress Responses of Plants

    PubMed Central

    Zhao, Jianguo; He, Qingsong; Chen, Gang; Wang, Li; Jin, Biao

    2016-01-01

    Heat stress is an important factor limiting plant growth, development, and productivity; thus, plants have evolved special adaptive mechanisms to cope with high-temperature stress. Non-coding RNAs (ncRNAs) are a class of regulatory RNAs that play an important role in many biological processes. Recently developed advanced technologies, such as genome-wide transcriptomic analysis, have revealed that abundant ncRNAs are expressed under heat stress. Although this area of research is still in its infancy, an increasing number of several classes of regulatory ncRNA (i.e., miRNA, siRNA, and lncRNA) related to heat stress responses have been reported. In this mini-review, we discuss our current understanding of the role of ncRNAs in heat stress responses in plants, especially miRNAs, siRNAs, and their targets. For example, the miR398-CSD/CCS-HSF, miR396-WRKY6, miR159-GAMYB, and TAS1-HTT-HSF pathways regulate plant heat tolerance. We highlight the hormone/development-related miRNAs involved in heat stress, and discuss the regulatory networks of miRNA-targets. We also note that DNA methylation and alternative splicing could affect miRNA expression under heat stress, and some lncRNAs could respond to heat stress. Finally, we briefly discuss future prospects concerning the ncRNA-related mechanisms of heat stress responses in plants. PMID:27588021

  13. Comparison of heat dissipation response between Malaysian and Japanese males during exercise in humid heat stress.

    PubMed

    Wakabayashi, Hitoshi; Wijayanto, Titis; Lee, Joo-Young; Hashiguchi, Nobuko; Saat, Mohamed; Tochihara, Yutaka

    2011-07-01

    This study investigated the differences in heat dissipation response to intense heat stress during exercise in hot and humid environments between tropical and temperate indigenes with matched physical characteristics. Ten Japanese (JP) and ten Malaysian (MY) males participated in this study. Subjects performed exercise for 60 min at 55% peak oxygen uptake in 32°C air with 70% relative humidity, followed by 30 min recovery. The increase in rectal temperature (T(re)) was smaller in MY during exercise compared to JP. The local sweat rate and total body mass loss were similar in both groups. Both skin blood flow and mean skin temperature was lower in MY compared to JP. A significantly greater increase in hand skin temperature was observed in MY during exercise, which is attributable to heat loss due to the greater surface area to mass ratio and large number of arteriovenous anastomoses. Also, the smaller increase in T(re) in MY may be explained by the presence of a significantly greater core-skin temperature gradient in MY than JP. The thermal gradient is also a major factor in increasing the convective heat transfer from core to skin as well as skin blood flow. It is concluded that the greater core-skin temperature gradient observed in MY is responsible for the smaller increase in T(re).

  14. Comparison of heat dissipation response between Malaysian and Japanese males during exercise in humid heat stress

    NASA Astrophysics Data System (ADS)

    Wakabayashi, Hitoshi; Wijayanto, Titis; Lee, Joo-Young; Hashiguchi, Nobuko; Saat, Mohamed; Tochihara, Yutaka

    2011-07-01

    This study investigated the differences in heat dissipation response to intense heat stress during exercise in hot and humid environments between tropical and temperate indigenes with matched physical characteristics. Ten Japanese (JP) and ten Malaysian (MY) males participated in this study. Subjects performed exercise for 60 min at 55% peak oxygen uptake in 32°C air with 70% relative humidity, followed by 30 min recovery. The increase in rectal temperature ( T re) was smaller in MY during exercise compared to JP. The local sweat rate and total body mass loss were similar in both groups. Both skin blood flow and mean skin temperature was lower in MY compared to JP. A significantly greater increase in hand skin temperature was observed in MY during exercise, which is attributable to heat loss due to the greater surface area to mass ratio and large number of arteriovenous anastomoses. Also, the smaller increase in T re in MY may be explained by the presence of a significantly greater core-skin temperature gradient in MY than JP. The thermal gradient is also a major factor in increasing the convective heat transfer from core to skin as well as skin blood flow. It is concluded that the greater core-skin temperature gradient observed in MY is responsible for the smaller increase in T re.

  15. Testing the responses of four wheat crop models to heat stress at anthesis and grain filling.

    PubMed

    Liu, Bing; Asseng, Senthold; Liu, Leilei; Tang, Liang; Cao, Weixing; Zhu, Yan

    2016-05-01

    Higher temperatures caused by future climate change will bring more frequent heat stress events and pose an increasing risk to global wheat production. Crop models have been widely used to simulate future crop productivity but are rarely tested with observed heat stress experimental datasets. Four wheat models (DSSAT-CERES-Wheat, DSSAT-Nwheat, APSIM-Wheat, and WheatGrow) were evaluated with 4 years of environment-controlled phytotron experimental datasets with two wheat cultivars under heat stress at anthesis and grain filling stages. Heat stress at anthesis reduced observed grain numbers per unit area and individual grain size, while heat stress during grain filling mainly decreased the size of the individual grains. The observed impact of heat stress on grain filling duration, total aboveground biomass, grain yield, and grain protein concentration (GPC) varied depending on cultivar and accumulated heat stress. For every unit increase of heat degree days (HDD, degree days over 30 °C), grain filling duration was reduced by 0.30-0.60%, total aboveground biomass was reduced by 0.37-0.43%, and grain yield was reduced by 1.0-1.6%, but GPC was increased by 0.50% for cv Yangmai16 and 0.80% for cv Xumai30. The tested crop simulation models could reproduce some of the observed reductions in grain filling duration, final total aboveground biomass, and grain yield, as well as the observed increase in GPC due to heat stress. Most of the crop models tended to reproduce heat stress impacts better during grain filling than at anthesis. Some of the tested models require improvements in the response to heat stress during grain filling, but all models need improvements in simulating heat stress effects on grain set during anthesis. The observed significant genetic variability in the response of wheat to heat stress needs to be considered through cultivar parameters in future simulation studies. © 2016 John Wiley & Sons Ltd.

  16. Stress response in the ascidian Ciona intestinalis: transcriptional profiling of genes for the heat shock protein 70 chaperone system under heat stress and endoplasmic reticulum stress.

    PubMed

    Fujikawa, Tetsuya; Munakata, Takeo; Kondo, Shin-ichi; Satoh, Nori; Wada, Shuichi

    2010-03-01

    The genome of Ciona intestinalis contains eight genes for HSP70 superfamily proteins, 36 genes for J-proteins, a gene for a J-like protein, and three genes for BAG family proteins. To understand the stress responses of genes in the HSP70 chaperone system comprehensively, the transcriptional profiles of these 48 genes under heat stress and endoplasmic reticulum (ER) stress were studied using real-time reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Heat stress treatment increased the messenger RNA (mRNA) levels of six HSP70 superfamily genes, eight J-protein family genes, and two BAG family genes. In the cytoplasmic group of the DnaK subfamily of the HSP70 family, Ci-HSPA1/6/7-like was the only heat-inducible gene and Ci-HSPA2/8 was the only constitutively active gene which showed striking simplicity in comparison with other animals that have been examined genome-wide so far. Analyses of the time course and temperature dependency of the heat stress responses showed that the induction of Ci-HSPA1/6/7-like expression rises to a peak after heat stress treatment at 28 degrees C (10 degrees C upshift from control temperature) for 1 h. ER stress treatment with Brefeldin A, a drug that is known to act as ER stress inducer, increased the mRNA levels of four HSP70 superfamily genes and four J-protein family genes. Most stress-inducible genes are conserved between Ciona and vertebrates, as expected from a close evolutionary relationship between them. The present study characterized the stress responses of HSP70 chaperone system genes in Ciona for the first time and provides essential data for comprehensive understanding of the functions of the HSP70 chaperone system.

  17. Use of heat stress responsive gene expression levels for early selection of heat tolerant cabbage (Brassica oleracea L.).

    PubMed

    Park, Hyun Ji; Jung, Won Yong; Lee, Sang Sook; Song, Jun Ho; Kwon, Suk-Yoon; Kim, Hyeran; Kim, Chulwook; Ahn, Jun Cheul; Cho, Hye Sun

    2013-06-04

    Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL), "HO", and a heat-sensitive cabbage line (HSCL), "JK", by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR) to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13) were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS). Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress.

  18. Use of Heat Stress Responsive Gene Expression Levels for Early Selection of Heat Tolerant Cabbage (Brassica oleracea L.)

    PubMed Central

    Park, Hyun Ji; Jung, Won Yong; Lee, Sang Sook; Song, Jun Ho; Kwon, Suk-Yoon; Kim, HyeRan; Kim, ChulWook; Ahn, Jun Cheul; Cho, Hye Sun

    2013-01-01

    Cabbage is a relatively robust vegetable at low temperatures. However, at high temperatures, cabbage has disadvantages, such as reduced disease tolerance and lower yields. Thus, selection of heat-tolerant cabbage is an important goal in cabbage breeding. Easier or faster selection of superior varieties of cabbage, which are tolerant to heat and disease and have improved taste and quality, can be achieved with molecular and biological methods. We compared heat-responsive gene expression between a heat-tolerant cabbage line (HTCL), “HO”, and a heat-sensitive cabbage line (HSCL), “JK”, by Genechip assay. Expression levels of specific heat stress-related genes were increased in response to high-temperature stress, according to Genechip assays. We performed quantitative RT-PCR (qRT-PCR) to compare expression levels of these heat stress-related genes in four HTCLs and four HSCLs. Transcript levels for heat shock protein BoHsp70 and transcription factor BoGRAS (SCL13) were more strongly expressed only in all HTCLs compared to all HSCLs, showing much lower level expressions at the young plant stage under heat stress (HS). Thus, we suggest that expression levels of these genes may be early selection markers for HTCLs in cabbage breeding. In addition, several genes that are involved in the secondary metabolite pathway were differentially regulated in HTCL and HSCL exposed to heat stress. PMID:23736694

  19. TC1 (C8orf4) is upregulated by cellular stress and mediates heat shock response.

    PubMed

    Park, Juhee; Jung, Yusun; Kim, Jungtae; Kim, Ka-Young; Ahn, Sang-Gun; Song, Kyuyoung; Lee, Inchul

    2007-08-24

    TC1 (C8orf4) is associated with aggressive behavior and poor survival in cancer. We have recently reported that it is a target gene of NF-kappaB and regulates the Wnt/beta-catenin pathway. Here, we show that TC1 is upregulated by various cellular stresses and mediates heat shock response. Heat shock and other cellular stresses including H2O2, 12-O-tetradecanoylphorbol 13-acetate (TPA), lipopolysaccharide (LPS), and UV enhance TC1 transcription in HeLa, KATO-III, HEK293T, and HK cells. TC1 protein then moves into the nuclei independently of NF-kappaB activation. TC1 upregulates heat shock proteins, and TC1-knockdown inhibits stress-induced downstream regulation significantly. Heat shock factor 1(HSF1) and TC1 upregulate each other, suggesting a potential positive feedback in the heat shock response regulation. Our data suggest that TC1 is a novel heat shock response regulator.

  20. Phosphoproteomic analysis of the response of maize leaves to drought, heat and their combination stress.

    PubMed

    Hu, Xiuli; Wu, Liuji; Zhao, Feiyun; Zhang, Dayong; Li, Nana; Zhu, Guohui; Li, Chaohao; Wang, Wei

    2015-01-01

    Drought and heat stress, especially their combination, greatly affect crop production. Many studies have described transcriptome, proteome and phosphoproteome changes in response of plants to drought or heat stress. However, the study about the phosphoproteomic changes in response of crops to the combination stress is scare. To understand the mechanism of maize responses to the drought and heat combination stress, phosphoproteomic analysis was performed on maize leaves by using multiplex iTRAQ-based quantitative proteomic and LC-MS/MS methods. Five-leaf-stage maize was subjected to drought, heat or their combination, and the leaves were collected. Globally, heat, drought and the combined stress significantly changed the phosphorylation levels of 172, 149, and 144 phosphopeptides, respectively. These phosphopeptides corresponded to 282 proteins. Among them, 23 only responded to the combined stress and could not be predicted from their responses to single stressors; 30 and 75 only responded to drought and heat, respectively. Notably, 19 proteins were phosphorylated on different sites in response to the single and combination stresses. Of the seven significantly enriched phosphorylation motifs identified, two were common for all stresses, two were common for heat and the combined stress, and one was specific to the combined stress. The signaling pathways in which the phosphoproteins were involved clearly differed among the three stresses. Functional characterization of the phosphoproteins and the pathways identified here could lead to new targets for the enhancement of crop stress tolerance, which will be particularly important in the face of climate change and the increasing prevalence of abiotic stressors.

  1. Crop Production under Drought and Heat Stress: Plant Responses and Management Options.

    PubMed

    Fahad, Shah; Bajwa, Ali A; Nazir, Usman; Anjum, Shakeel A; Farooq, Ayesha; Zohaib, Ali; Sadia, Sehrish; Nasim, Wajid; Adkins, Steve; Saud, Shah; Ihsan, Muhammad Z; Alharby, Hesham; Wu, Chao; Wang, Depeng; Huang, Jianliang

    2017-01-01

    Abiotic stresses are one of the major constraints to crop production and food security worldwide. The situation has aggravated due to the drastic and rapid changes in global climate. Heat and drought are undoubtedly the two most important stresses having huge impact on growth and productivity of the crops. It is very important to understand the physiological, biochemical, and ecological interventions related to these stresses for better management. A wide range of plant responses to these stresses could be generalized into morphological, physiological, and biochemical responses. Interestingly, this review provides a detailed account of plant responses to heat and drought stresses with special focus on highlighting the commonalities and differences. Crop growth and yields are negatively affected by sub-optimal water supply and abnormal temperatures due to physical damages, physiological disruptions, and biochemical changes. Both these stresses have multi-lateral impacts and therefore, complex in mechanistic action. A better understanding of plant responses to these stresses has pragmatic implication for remedies and management. A comprehensive account of conventional as well as modern approaches to deal with heat and drought stresses have also been presented here. A side-by-side critical discussion on salient responses and management strategies for these two important abiotic stresses provides a unique insight into the phenomena. A holistic approach taking into account the different management options to deal with heat and drought stress simultaneously could be a win-win approach in future.

  2. Crop Production under Drought and Heat Stress: Plant Responses and Management Options

    PubMed Central

    Fahad, Shah; Bajwa, Ali A.; Nazir, Usman; Anjum, Shakeel A.; Farooq, Ayesha; Zohaib, Ali; Sadia, Sehrish; Nasim, Wajid; Adkins, Steve; Saud, Shah; Ihsan, Muhammad Z.; Alharby, Hesham; Wu, Chao; Wang, Depeng; Huang, Jianliang

    2017-01-01

    Abiotic stresses are one of the major constraints to crop production and food security worldwide. The situation has aggravated due to the drastic and rapid changes in global climate. Heat and drought are undoubtedly the two most important stresses having huge impact on growth and productivity of the crops. It is very important to understand the physiological, biochemical, and ecological interventions related to these stresses for better management. A wide range of plant responses to these stresses could be generalized into morphological, physiological, and biochemical responses. Interestingly, this review provides a detailed account of plant responses to heat and drought stresses with special focus on highlighting the commonalities and differences. Crop growth and yields are negatively affected by sub-optimal water supply and abnormal temperatures due to physical damages, physiological disruptions, and biochemical changes. Both these stresses have multi-lateral impacts and therefore, complex in mechanistic action. A better understanding of plant responses to these stresses has pragmatic implication for remedies and management. A comprehensive account of conventional as well as modern approaches to deal with heat and drought stresses have also been presented here. A side-by-side critical discussion on salient responses and management strategies for these two important abiotic stresses provides a unique insight into the phenomena. A holistic approach taking into account the different management options to deal with heat and drought stress simultaneously could be a win-win approach in future. PMID:28706531

  3. Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways

    PubMed Central

    Swindell, William R; Huebner, Marianne; Weber, Andreas P

    2007-01-01

    Background The heat shock response of Arabidopsis thaliana is dependent upon a complex regulatory network involving twenty-one known transcription factors and four heat shock protein families. It is known that heat shock proteins (Hsps) and transcription factors (Hsfs) are involved in cellular response to various forms of stress besides heat. However, the role of Hsps and Hsfs under cold and non-thermal stress conditions is not well understood, and it is unclear which types of stress interact least and most strongly with Hsp and Hsf response pathways. To address this issue, we have analyzed transcriptional response profiles of Arabidopsis Hsfs and Hsps to a range of abiotic and biotic stress treatments (heat, cold, osmotic stress, salt, drought, genotoxic stress, ultraviolet light, oxidative stress, wounding, and pathogen infection) in both above and below-ground plant tissues. Results All stress treatments interact with Hsf and Hsp response pathways to varying extents, suggesting considerable cross-talk between heat and non-heat stress regulatory networks. In general, Hsf and Hsp expression was strongly induced by heat, cold, salt, and osmotic stress, while other types of stress exhibited family or tissue-specific response patterns. With respect to the Hsp20 protein family, for instance, large expression responses occurred under all types of stress, with striking similarity among expression response profiles. Several genes belonging to the Hsp20, Hsp70 and Hsp100 families were specifically upregulated twelve hours after wounding in root tissue, and exhibited a parallel expression response pattern during recovery from heat stress. Among all Hsf and Hsp families, large expression responses occurred under ultraviolet-B light stress in aerial tissue (shoots) but not subterranean tissue (roots). Conclusion Our findings show that Hsf and Hsp family member genes represent an interaction point between multiple stress response pathways, and therefore warrant functional

  4. Genome-wide analysis of the heat stress response in Zebu (Sahiwal) cattle.

    PubMed

    Mehla, Kusum; Magotra, Ankit; Choudhary, Jyoti; Singh, A K; Mohanty, A K; Upadhyay, R C; Srinivasan, Surendran; Gupta, Pankaj; Choudhary, Neelam; Antony, Bristo; Khan, Farheen

    2014-01-10

    Environmental-induced hyperthermia compromises animal production with drastic economic consequences to global animal agriculture and jeopardizes animal welfare. Heat stress is a major stressor that occurs as a result of an imbalance between heat production within the body and its dissipation and it affects animals at cellular, molecular and ecological levels. The molecular mechanism underlying the physiology of heat stress in the cattle remains undefined. The present study sought to evaluate mRNA expression profiles in the cattle blood in response to heat stress. In this study we report the genes that were differentially expressed in response to heat stress using global scale genome expression technology (Microarray). Four Sahiwal heifers were exposed to 42°C with 90% humidity for 4h followed by normothermia. Gene expression changes include activation of heat shock transcription factor 1 (HSF1), increased expression of heat shock proteins (HSP) and decreased expression and synthesis of other proteins, immune system activation via extracellular secretion of HSP. A cDNA microarray analysis found 140 transcripts to be up-regulated and 77 down-regulated in the cattle blood after heat treatment (P<0.05). But still a comprehensive explanation for the direction of fold change and the specific genes involved in response to acute heat stress still remains to be explored. These findings may provide insights into the underlying mechanism of physiology of heat stress in cattle. Understanding the biology and mechanisms of heat stress is critical to developing approaches to ameliorate current production issues for improving animal performance and agriculture economics. © 2013 Elsevier B.V. All rights reserved.

  5. Linking physiological and cellular responses to thermal stress: β-adrenergic blockade reduces the heat shock response in fish.

    PubMed

    Templeman, Nicole M; LeBlanc, Sacha; Perry, Steve F; Currie, Suzanne

    2014-08-01

    When faced with stress, animals use physiological and cellular strategies to preserve homeostasis. We were interested in how these high-level stress responses are integrated at the level of the whole animal. Here, we investigated the capacity of the physiological stress response, and specifically the β-adrenergic response, to affect the induction of the cellular heat shock proteins, HSPs, following a thermal stress in vivo. We predicted that blocking β-adrenergic stimulation during an acute heat stress in the whole animal would result in reduced levels of HSPs in red blood cells (RBCs) of rainbow trout compared to animals where adrenergic signaling remained intact. We first determined that a 1 h heat shock at 25 °C in trout acclimated to 13 °C resulted in RBC adrenergic stimulation as determined by a significant increase in cell swelling, a hallmark of the β-adrenergic response. A whole animal injection with the β2-adrenergic antagonist, ICI-118,551, successfully reduced this heat-induced RBC swelling. The acute heat shock caused a significant induction of HSP70 in RBCs of 13 °C-acclimated trout as well as a significant increase in plasma catecholamines. When heat-shocked fish were treated with ICI-118,551, we observed a significant attenuation of the HSP70 response. We conclude that circulating catecholamines influence the cellular heat shock response in rainbow trout RBCs, demonstrating physiological/hormonal control of the cellular stress response.

  6. Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster

    PubMed Central

    Landis, Gary; Shen, Jie; Tower, John

    2012-01-01

    Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging. PMID:23211361

  7. Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster.

    PubMed

    Landis, Gary; Shen, Jie; Tower, John

    2012-11-01

    Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging.

  8. The role of cardiac sympathetic innervation and skin thermoreceptors on cardiac responses during heat stress

    PubMed Central

    Umemoto, Yasunori; Kinoshita, Tokio; Kouda, Ken; Ito, Tomoyuki; Nakamura, Takeshi; Crandall, Craig G.; Tajima, Fumihiro

    2015-01-01

    The mechanism(s) for the changes in cardiac function during heat stress remain unknown. This study tested two unique hypotheses. First, sympathetic innervation to the heart is required for increases in cardiac systolic function during heat stress. This was accomplished by comparing responses during heat stress between paraplegics versus tetraplegics, with tetraplegics having reduced/absent cardiac sympathetic innervation. Second, stimulation of skin thermoreceptors contributes to cardiovascular adjustments that occur during heat stress in humans. This was accomplished by comparing responses during leg only heating between paraplegic versus able-bodied individuals. Nine healthy able-bodied, nine paraplegics, and eight tetraplegics participated in this study. Lower body (i.e., nonsensed area for para/tetraplegics) was heated until esophageal temperature had increased by ∼1.0°C. Echocardiographic indexes of diastolic and systolic function were performed before and at the end of heat stress. The heat stress increased cardiac output in all groups, but the magnitude of this increase was attenuated in the tetraplegics relative to the able-bodied (1.3 ± 0.4 vs. 2.3 ± 1.0 l/min; P < 0.05). Diastolic function was maintained in all groups. Indexes of left atrial and ventricular systolic function were enhanced in the able-bodied, but did not change in tetraplegics, while these changes in paraplegics were attenuated relative to the able-bodied. These data suggest that the cardiac sympathetic innervation is required to achieve normal increases in cardiac systolic function during heat stress but not required to maintain diastolic function during this exposure. Second, elevated systolic function during heat stress primarily occurs as a result of increases in internal temperature, although stimulation of skin thermoreceptors may contribute. PMID:25795714

  9. The cell specificity of gene expression in the response to heat stress in corals.

    PubMed

    Traylor-Knowles, N; Rose, N H; Palumbi, S R

    2017-03-02

    Previous transcriptional studies in heat stressed corals have shown that many genes are responsive to generalized heat stress whereas the expression patterns of specific gene networks after heat stress show strong correlations with variation in bleaching outcomes. However, where these specific genes are expressed is unknown. Here we employed in situ hybridization to identify patterns of spatial gene expression of genes previously predicted to be involved in general stress response and bleaching. We found that Tumor Necrosis Factor Receptors (TNFRs), known to be strong responders to heat stress, were not expressed in gastrodermal symbiont-containing cells but were widely expressed in specific cells of the epidermal layer. The transcription factors AP-1 and FosB implicated as early signals of heat stress and were widely expressed throughout the oral gastrodermis and epidermis. By contrast, a G-protein coupled receptor gene (GPCR), and a fructose bisphosphate aldolase C gene (Aldolase), previously implicated in bleaching, was expressed in symbiont containing gastrodermal cells, and in epidermal tissue. Finally, Chordin-like/Kielin (Chordin-like) a gene highly correlated to bleaching was expressed solely in the oral gastrodermis. From this study we confirm that heat responsive genes occur widely in coral tissues outside of symbiont containing cells, and that gene expression in response to heat stress that causes bleaching does not signal by itself that a gene is expressed in the symbiotic cells where bleaching occurs. Joint information about expression patterns in response to heat and cell specificity will allow greater dissection of the regulatory pathways and specific cell reactions that lead to coral bleaching.

  10. Leaf Proteome Analysis Reveals Prospective Drought and Heat Stress Response Mechanisms in Soybean.

    PubMed

    Das, Aayudh; Eldakak, Moustafa; Paudel, Bimal; Kim, Dea-Wook; Hemmati, Homa; Basu, Chhandak; Rohila, Jai S

    2016-01-01

    Drought and heat are among the major abiotic stresses that affect soybean crops worldwide. During the current investigation, the effect of drought, heat, and drought plus heat stresses was compared in the leaves of two soybean varieties, Surge and Davison, combining 2D-DIGE proteomic data with physiology and biochemical analyses. We demonstrated how 25 differentially expressed photosynthesis-related proteins affect RuBisCO regulation, electron transport, Calvin cycle, and carbon fixation during drought and heat stress. We also observed higher abundance of heat stress-induced EF-Tu protein in Surge. It is possible that EF-Tu might have activated heat tolerance mechanisms in the soybean. Higher level expressions of heat shock-related protein seem to be regulating the heat tolerance mechanisms. This study identifies the differential expression of various abiotic stress-responsive proteins that regulate various molecular processes and signaling cascades. One inevitable outcome from the biochemical and proteomics assays of this study is that increase of ROS levels during drought stress does not show significant changes at the phenotypic level in Davison and this seems to be due to a higher amount of carbonic anhydrase accumulation in the cell which aids the cell to become more resistant to cytotoxic concentrations of H2O2.

  11. Leaf Proteome Analysis Reveals Prospective Drought and Heat Stress Response Mechanisms in Soybean

    PubMed Central

    Das, Aayudh; Eldakak, Moustafa; Paudel, Bimal; Kim, Dea-Wook; Hemmati, Homa; Basu, Chhandak

    2016-01-01

    Drought and heat are among the major abiotic stresses that affect soybean crops worldwide. During the current investigation, the effect of drought, heat, and drought plus heat stresses was compared in the leaves of two soybean varieties, Surge and Davison, combining 2D-DIGE proteomic data with physiology and biochemical analyses. We demonstrated how 25 differentially expressed photosynthesis-related proteins affect RuBisCO regulation, electron transport, Calvin cycle, and carbon fixation during drought and heat stress. We also observed higher abundance of heat stress-induced EF-Tu protein in Surge. It is possible that EF-Tu might have activated heat tolerance mechanisms in the soybean. Higher level expressions of heat shock-related protein seem to be regulating the heat tolerance mechanisms. This study identifies the differential expression of various abiotic stress-responsive proteins that regulate various molecular processes and signaling cascades. One inevitable outcome from the biochemical and proteomics assays of this study is that increase of ROS levels during drought stress does not show significant changes at the phenotypic level in Davison and this seems to be due to a higher amount of carbonic anhydrase accumulation in the cell which aids the cell to become more resistant to cytotoxic concentrations of H2O2. PMID:27034942

  12. Stress response in the ascidian Ciona intestinalis: transcriptional profiling of genes for the heat shock protein 70 chaperone system under heat stress and endoplasmic reticulum stress

    PubMed Central

    Fujikawa, Tetsuya; Munakata, Takeo; Kondo, Shin-ichi; Satoh, Nori

    2009-01-01

    The genome of Ciona intestinalis contains eight genes for HSP70 superfamily proteins, 36 genes for J-proteins, a gene for a J-like protein, and three genes for BAG family proteins. To understand the stress responses of genes in the HSP70 chaperone system comprehensively, the transcriptional profiles of these 48 genes under heat stress and endoplasmic reticulum (ER) stress were studied using real-time reverse transcriptase–polymerase chain reaction (RT-PCR) analysis. Heat stress treatment increased the messenger RNA (mRNA) levels of six HSP70 superfamily genes, eight J-protein family genes, and two BAG family genes. In the cytoplasmic group of the DnaK subfamily of the HSP70 family, Ci-HSPA1/6/7-like was the only heat-inducible gene and Ci-HSPA2/8 was the only constitutively active gene which showed striking simplicity in comparison with other animals that have been examined genome-wide so far. Analyses of the time course and temperature dependency of the heat stress responses showed that the induction of Ci-HSPA1/6/7-like expression rises to a peak after heat stress treatment at 28°C (10°C upshift from control temperature) for 1 h. ER stress treatment with Brefeldin A, a drug that is known to act as ER stress inducer, increased the mRNA levels of four HSP70 superfamily genes and four J-protein family genes. Most stress-inducible genes are conserved between Ciona and vertebrates, as expected from a close evolutionary relationship between them. The present study characterized the stress responses of HSP70 chaperone system genes in Ciona for the first time and provides essential data for comprehensive understanding of the functions of the HSP70 chaperone system. Electronic supplementary material The online version of this article (doi:10.1007/s12192-009-0133-x) contains supplementary material, which is available to authorized users. PMID:19629754

  13. Transgenerational phenotypic and epigenetic changes in response to heat stress in Arabidopsis thaliana

    PubMed Central

    Migicovsky, Zoë; Yao, Youli; Kovalchuk, Igor

    2014-01-01

    Exposure to heat stress causes physiological and epigenetic changes in plants, which may also be altered in the progeny. We compared the progeny of stressed and control Arabidopsis thaliana wild type and Dicer-like mutant dcl2, dcl3, and dcl4 plants for variations in physiology and molecular profile, including global genome methylation, mRNA levels, and histone modifications in the subset of differentially expressed genes at normal conditions and in response to heat stress. We found that the immediate progeny of heat-stressed plants had fewer, but larger leaves, and tended to bolt earlier. Transposon expression was elevated in the progeny of heat-stressed plants, and heat stress in the same generation tended to decrease global genome methylation. Progeny of stressed plants had increased expression of HSFA2, and reduction in MSH2, ROS1, and several SUVH genes. Gene expression positively correlated with permissive histone marks and negatively correlated with repressive marks. Overall, the progeny of heat stressed plants varied in both their physiology and epigenome and dcl2 and dcl3 mutants were partially deficient for these changes. PMID:24513700

  14. Transgenerational phenotypic and epigenetic changes in response to heat stress in Arabidopsis thaliana.

    PubMed

    Migicovsky, Zoë; Yao, Youli; Kovalchuk, Igor

    2014-01-01

    Exposure to heat stress causes physiological and epigenetic changes in plants, which may also be altered in the progeny. We compared the progeny of stressed and control Arabidopsis thaliana wild type and Dicer-like mutant dcl2, dcl3, and dcl4 plants for variations in physiology and molecular profile, including global genome methylation, mRNA levels, and histone modifications in the subset of differentially expressed genes at normal conditions and in response to heat stress. We found that the immediate progeny of heat-stressed plants had fewer, but larger leaves, and tended to bolt earlier. Transposon expression was elevated in the progeny of heat-stressed plants, and heat stress in the same generation tended to decrease global genome methylation. Progeny of stressed plants had increased expression of HSFA2, and reduction in MSH2, ROS1, and several SUVH genes. Gene expression positively correlated with permissive histone marks and negatively correlated with repressive marks. Overall, the progeny of heat stressed plants varied in both their physiology and epigenome and dcl2 and dcl3 mutants were partially deficient for these changes.

  15. Conserved and novel heat stress-responsive microRNAs were identified by deep sequencing in Saccharina japonica (Laminariales, Phaeophyta).

    PubMed

    Liu, Fuli; Wang, Wenjun; Sun, Xiutao; Liang, Zhourui; Wang, Feijiu

    2015-07-01

    As a temperate-cold species, Saccharina japonica often suffers heat stress when it is transplanted to temperate and subtropical zones. Study the heat stress response and resistance mechanism of Saccharina is of great significance for understanding the acclimation to heat stress under domestication as well as for breeding new cultivars with heat stress resistance. In this study, we identified a set of heat stress-responsive miRNAs and analysed their regulation during the heat stress response. CO (control) and heat stress (HS) sRNA libraries were constructed and sequenced. Forty-nine known miRNAs and 75 novel miRNAs were identified, of which seven known and 25 novel miRNAs were expressed differentially under heat stress. Quantitative PCR of six selected miRNAs confirmed that these loci were responsive to heat stress. Thirty-nine and 712 genes were predicted to be targeted by the seven known miRNAs and 25 novel miRNAs, respectively. Gene function and pathway analyses showed that these genes probably play important roles in S. japonica heat stress tolerance. The miRNAs identified represent the first set of heat-responsive miRNAs identified from S. japonica, and their identification can help elucidate the heat stress response and resistance mechanisms in S. japonica.

  16. Oxidative Stress and Heat-Shock Responses in Desulfovibrio vulgaris by Genome-Wide Transcriptomic Analysis

    SciTech Connect

    Zhang, Weiwen; Culley, David E.; Hogan, Mike; Vitiritti, Luigi; Brockman, Fred J.

    2006-05-30

    Abstract Sulfate-reducing bacteria, like Desulfovibrio vulgaris have developed a set of reactions allowing them to survive in environments. To obtain further knowledge of the protecting mechanisms employed in D. vulgaris against the oxidative stress and heat shock, we performed a genome-wide transcriptomic analysis to determine the cellular responses to both stimuli. The results showed that 130 genes were responsive to oxidative stress, while 427 genes responsive to heat-shock, respectively. Functional analyses suggested that the genes regulated were involved in a variety of cellular functions. Metabolic analysis showed that amino acid biosynthetic pathways were induced by both oxidative stress and heat shock treatments, while fatty acid metabolism, purine and cofactor biosynthesis were induced by heat shock only. Rubrerythrin gene (rbR) were upregulated by the oxidative stress, suggesting its important role in the oxidative resistance, whereas the expression of rubredoxin oxidoreductase (rbO), superoxide ismutase (sodB) and catalase (katA) genes were not subjected to regulation by oxidative stress in D. vulgaris. In addition, the results showed that thioredoxin reductase (trxB) was responsive to oxidative stress, suggesting the thiol-specific redox system might be involved in oxidative protection in D. vulgaris. Comparison of cellular responses to oxidative stress and heat-shock allowed the identification of 66 genes that showed a similar drastic response to both environmental stimuli, implying that they might be part of the general stress response (GSR) network in D. vulgaris, which was further supported by the finding of a conserved motif upstream these common-responsive genes.

  17. Boechera Species Exhibit Species-Specific Responses to Combined Heat and High Light Stress

    PubMed Central

    Gallas, Genna; Waters, Elizabeth R.

    2015-01-01

    As sessile organisms, plants must be able to complete their life cycle in place and therefore tolerance to abiotic stress has had a major role in shaping biogeographical patterns. However, much of what we know about plant tolerance to abiotic stresses is based on studies of just a few plant species, most notably the model species Arabidopsis thaliana. In this study we examine natural variation in the stress responses of five diverse Boechera (Brassicaceae) species. Boechera plants were exposed to basal and acquired combined heat and high light stress. Plant response to these stresses was evaluated based on chlorophyll fluorescence measurements, induction of leaf chlorosis, and gene expression. Many of the Boechera species were more tolerant to heat and high light stress than A. thaliana. Gene expression data indicates that two important marker genes for stress responses: APX2 (Ascorbate peroxidase 2) and HsfA2 (Heat shock transcription factor A2) have distinct species-specific expression patterns. The findings of species-specific responses and tolerance to stress indicate that stress pathways are evolutionarily labile even among closely related species. PMID:26030823

  18. Boechera species exhibit species-specific responses to combined heat and high light stress.

    PubMed

    Gallas, Genna; Waters, Elizabeth R

    2015-01-01

    As sessile organisms, plants must be able to complete their life cycle in place and therefore tolerance to abiotic stress has had a major role in shaping biogeographical patterns. However, much of what we know about plant tolerance to abiotic stresses is based on studies of just a few plant species, most notably the model species Arabidopsis thaliana. In this study we examine natural variation in the stress responses of five diverse Boechera (Brassicaceae) species. Boechera plants were exposed to basal and acquired combined heat and high light stress. Plant response to these stresses was evaluated based on chlorophyll fluorescence measurements, induction of leaf chlorosis, and gene expression. Many of the Boechera species were more tolerant to heat and high light stress than A. thaliana. Gene expression data indicates that two important marker genes for stress responses: APX2 (Ascorbate peroxidase 2) and HsfA2 (Heat shock transcription factor A2) have distinct species-specific expression patterns. The findings of species-specific responses and tolerance to stress indicate that stress pathways are evolutionarily labile even among closely related species.

  19. Heat Stress

    MedlinePlus

    ... Work in the Heat: Why Acclimatization Matters The natural adaptation to the heat takes time, and from a management perspective, it may require careful planning. NIOSH Science Blog: Extreme Heat – Are you prepared for summer ...

  20. Gene Expression Profile in the Long-Living Lotus: Insights into the Heat Stress Response Mechanism

    PubMed Central

    Li, Naiwei; Chang, Yajun; Yao, Dongrui

    2016-01-01

    Lotus (Nelumbo Adans) is an aquatic perennial plant that flourished during the middle Albian stage. In this study, we characterized the digital gene expression signatures for China Antique lotus under conditions of heat shock stress. Using RNA-seq technology, we sequenced four libraries, specifically, two biological replicates for control plant samples and two for heat stress samples. As a result, 6,528,866 to 8,771,183 clean reads were mapped to the reference genome, accounting for 92–96% total clean reads. A total of 396 significantly altered genes were detected across the genome, among which 315 were upregulated and 81 were downregulated by heat shock stress. Gene ontology (GO) enrichment of differentially expressed genes revealed protein folding, cell morphogenesis and cellular component morphogenesis as the top three functional terms under heat shock stress. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis led to the identification of protein processing in endoplasmic reticulum, plant-pathogen interactions, spliceosome, endocytosis, and protein export as significantly enriched pathways. Among the upregulated genes, small heat shock proteins (sHsps) and genes related to cell morphogenesis were particularly abundant under heat stress. Data from the current study provide valuable clues that may help elucidate the molecular events underlying heat stress response in China Antique lotus. PMID:27018792

  1. Transcriptome analysis of heat stress response in switchgrass (Panicum virgatum L.).

    PubMed

    Li, Yong-Fang; Wang, Yixing; Tang, Yuhong; Kakani, Vijaya Gopal; Mahalingam, Ramamurthy

    2013-10-06

    Global warming predictions indicate that temperatures will increase by another 2-6°C by the end of this century. High temperature is a major abiotic stress limiting plant growth and productivity in many areas of the world. Switchgrass (Panicum virgatum L.) is a model herbaceous bioenergy crop, due to its rapid growth rate, reliable biomass yield, minimal requirements of water and nutrients, adaptability to grow on marginal lands and widespread distribution throughout North America. The effect of high temperature on switchgrass physiology, cell wall composition and biomass yields has been reported. However, there is void in the knowledge of the molecular responses to heat stress in switchgrass. We conducted long-term heat stress treatment (38°/30°C, day/night, for 50 days) in the switchgrass cultivar Alamo. A significant decrease in the plant height and total biomass was evident in the heat stressed plants compared to controls. Total RNA from control and heat stress samples were used for transcriptome analysis with switchgrass Affymetrix genechips. Following normalization and pre-processing, 5365 probesets were identified as differentially expressed using a 2-fold cutoff. Of these, 2233 probesets (2000 switchgrass unigenes) were up-regulated, and 3132 probesets (2809 unigenes) were down-regulated. Differential expression of 42 randomly selected genes from this list was validated using RT-PCR. Rice orthologs were retrieved for 78.7% of the heat stress responsive switchgrass probesets. Gene ontology (GOs) enrichment analysis using AgriGO program showed that genes related to ATPase regulator, chaperone binding, and protein folding was significantly up-regulated. GOs associated with protein modification, transcription, phosphorus and nitrogen metabolic processes, were significantly down-regulated by heat stress. Plausible connections were identified between the identified GOs, physiological responses and heat response phenotype observed in switchgrass plants

  2. Expression and interaction of small heat shock proteins (sHsps) in rice in response to heat stress.

    PubMed

    Chen, Xinhai; Lin, Shoukai; Liu, Qiulin; Huang, Jian; Zhang, Wenfeng; Lin, Jun; Wang, Yongfei; Ke, Yuqin; He, Huaqin

    2014-04-01

    The inherent immobility of rice (Oryza sativa L.) limited their abilities to avoid heat stress and required them to contend with heat stress through innate defense abilities in which heat shock proteins played important roles. In this study, Hsp26.7, Hsp23.2, Hsp17.9A, Hsp17.4 and Hsp16.9A were up-regulated in Nipponbare during seedling and anthesis stages in response to heat stress. Subsequently, the expressing levels of these five sHsps in the heat-tolerant rice cultivar, Co39, were all significantly higher than that in the heat-susceptible rice cultivar, Azucena. This indicated that the expressive level of these five sHsps was positively related to the ability of rice plants to avoid heat stress. Thus, the expression level of these five sHsps can be regarded as bio-markers for screening rice cultivars with different abilities to avoid heat stress. Hsp18.1, Hsp17.9A, Hsp17.7 and Hsp16.9A, in the three rice cultivars under heat stress were found to be involved in one protein complex by Native-PAGE, and the interactions of Hsp18.1 and Hsp 17.7, Hsp18.1 and Hsp 17.9A, and Hsp17.7 and Hsp16.9A were further validated by yeast 2-hybridization. Pull down assay also confirmed the interaction between Hsp17.7 and Hsp16.9A in rice under heat stress. In conclusion, the up-regulation of the 5 sHsps is a key step for rice to tolerate heat stress, after that some sHsps assembled into a large hetero-oligomeric complex. In addition, through protein-protein interaction, Hsp101 regulated thiamine biosynthesis, and Hsp82 homology affected nitrogen metabolism, while Hsp81-1 were involved in the maintenance of sugar or starch synthesis in rice plants under heat stress. These results provide new insight into the regulatory mechanism of sHsps in rice. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. The Heat Stress Factor HSFA6b Connects ABA Signaling and ABA-Mediated Heat Responses1[OPEN

    PubMed Central

    Yang, Chen-Ru

    2016-01-01

    Heat stress response (HSR) is a conserved mechanism developed to increase the expression of heat shock proteins (HSPs) via a heat shock factor (HSF)-dependent mechanism. Signaling by the stress phytohormone abscisic acid (ABA) is involved in acquired thermotolerance as well. Analysis of Arabidopsis (Arabidopsis thaliana) microarray databases revealed that the expression of HSFA6b, a class A HSF, extensively increased with salinity, osmotic, and cold stresses, but not heat. Here, we show that HSFA6b plays a pivotal role in the response to ABA and in thermotolerance. Salt-inducible HSFA6b expression was down-regulated in ABA-insensitive and -deficient mutants; however, exogenous ABA application restored expression in ABA-deficient, but not -insensitive plants. Thus, ABA signaling is required for proper HSFA6b expression. A transcriptional activation assay of protoplasts revealed that ABA treatment and coexpression of an ABA signaling master effector, ABA-RESPONSIVE ELEMENT-BINDING PROTEIN1, could activate the HSFA6b promoter. In addition, HSFA6b directly bound to the promoter of DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN2A and enhanced its expression. Analysis of ABA responses in seed germination, cotyledon greening, and root growth as well as salt and drought tolerance in HSFA6b-null, overexpression, and dominant negative mutants revealed that HSFA6b is a positive regulator participating in ABA-mediated salt and drought resistance. Thermoprotection tests showed that HSFA6b was required for thermotolerance acquisition. Our study reveals a network in which HSFA6b operates as a downstream regulator of the ABA-mediated stress response and is required for heat stress resistance. This new ABA-signaling pathway is integrated into the complex HSR network in planta. PMID:27493213

  4. Expression of heat shock protein genes in insect stress responses

    USDA-ARS?s Scientific Manuscript database

    The heat shock proteins (HSPs) that are abundantly expressed in insects are important modulators of insect survival. Expression of HSP genes in insects is not only developmentally regulated, but also induced by various stressors in order to confer protection against such stressors. The expression o...

  5. ATF1 modulates the heat shock response by regulating the stress-inducible heat shock factor 1 transcription complex.

    PubMed

    Takii, Ryosuke; Fujimoto, Mitsuaki; Tan, Ke; Takaki, Eiichi; Hayashida, Naoki; Nakato, Ryuichiro; Shirahige, Katsuhiko; Nakai, Akira

    2015-01-01

    The heat shock response is an evolutionally conserved adaptive response to high temperatures that controls proteostasis capacity and is regulated mainly by an ancient heat shock factor (HSF). However, the regulation of target genes by the stress-inducible HSF1 transcription complex has not yet been examined in detail in mammalian cells. In the present study, we demonstrated that HSF1 interacted with members of the ATF1/CREB family involved in metabolic homeostasis and recruited them on the HSP70 promoter in response to heat shock. The HSF1 transcription complex, including the chromatin-remodeling factor BRG1 and lysine acetyltransferases p300 and CREB-binding protein (CBP), was formed in a manner that was dependent on the phosphorylation of ATF1. ATF1-BRG1 promoted the establishment of an active chromatin state and HSP70 expression during heat shock, whereas ATF1-p300/CBP accelerated the shutdown of HSF1 DNA-binding activity during recovery from acute stress, possibly through the acetylation of HSF1. Furthermore, ATF1 markedly affected the resistance to heat shock. These results revealed the unanticipated complexity of the primitive heat shock response mechanism, which is connected to metabolic adaptation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. ATF1 Modulates the Heat Shock Response by Regulating the Stress-Inducible Heat Shock Factor 1 Transcription Complex

    PubMed Central

    Takii, Ryosuke; Fujimoto, Mitsuaki; Tan, Ke; Takaki, Eiichi; Hayashida, Naoki; Nakato, Ryuichiro; Shirahige, Katsuhiko

    2014-01-01

    The heat shock response is an evolutionally conserved adaptive response to high temperatures that controls proteostasis capacity and is regulated mainly by an ancient heat shock factor (HSF). However, the regulation of target genes by the stress-inducible HSF1 transcription complex has not yet been examined in detail in mammalian cells. In the present study, we demonstrated that HSF1 interacted with members of the ATF1/CREB family involved in metabolic homeostasis and recruited them on the HSP70 promoter in response to heat shock. The HSF1 transcription complex, including the chromatin-remodeling factor BRG1 and lysine acetyltransferases p300 and CREB-binding protein (CBP), was formed in a manner that was dependent on the phosphorylation of ATF1. ATF1-BRG1 promoted the establishment of an active chromatin state and HSP70 expression during heat shock, whereas ATF1-p300/CBP accelerated the shutdown of HSF1 DNA-binding activity during recovery from acute stress, possibly through the acetylation of HSF1. Furthermore, ATF1 markedly affected the resistance to heat shock. These results revealed the unanticipated complexity of the primitive heat shock response mechanism, which is connected to metabolic adaptation. PMID:25312646

  7. Physiological Responses to Acute Exercise-Heat Stress

    DTIC Science & Technology

    1988-01-01

    changes in blood temperature elicited by extracorporeal circulation (89.141). and by body cooling during anesthesia (29). For example. Shiraki et al...Evaporation b. Control of the Sweat Gland c. Skin Temperature. Wettedness and Sweat Gland Fatigue VII. SKIN CIRCULATION AND HEAT TRANSFER a. Control...skin temperature. Although the most accurate mathematical representation of the control of the thermoregulatory effectors may well be a complicated

  8. Water availability as dominant control of heat stress responses in two contrasting tree species.

    PubMed

    Ruehr, Nadine K; Gast, Andreas; Weber, Christina; Daub, Baerbel; Arneth, Almut

    2016-02-01

    Heat waves that trigger severe droughts are predicted to increase globally; however, we lack an understanding of how trees respond to the combined change of extreme temperatures and water availability. Here, we studied the impacts of two consecutive heat waves as well as post-stress recovery in young Pseudotsuga menziesii (Mirb.) Franco (Douglas-fir) and Robinia pseudoacacia L. (black locust) growing under controlled conditions. Responses were compared under water supply close to the long-term average and under reduced irrigation to represent drought. Exposure to high temperatures (+10 °C above ambient) and vapour pressure deficit strongly affected the trees in terms of water relations, photosynthesis and growth. Douglas-fir used water resources conservatively, and transpiration decreased in response to mild soil water limitation. In black locust, heat stress led to pronounced tree water deficits (stem diameter shrinkage), accompanied by leaf shedding to alleviate stress on the hydraulic system. The importance of water availability during the heat waves became further apparent by a concurrent decline in photosynthesis and stomatal conductance with increasing leaf temperatures in both species, reaching the lowest rates in the heat-drought treatments. Stress severity determined both the speed and the amount of recovery. Upon release of stress, photosynthesis recovered rapidly in drought-treated black locust, while it remained below control rates in heat (t = -2.4, P < 0.05) and heat-drought stressed trees (t = 2.96, P < 0.05). In Douglas-fir, photosynthesis recovered quickly, while water-use efficiency increased in heat-drought trees because stomatal conductance remained reduced (t = -2.92, P < 0.05). Moreover, Douglas-fir was able to compensate for stem-growth reductions following heat (-40%) and heat-drought stress (-68%), but most likely at the expense of storage and other growth processes. Our results highlight the importance of studying heat waves alongside

  9. The Response to Heat Shock and Oxidative Stress in Saccharomyces cerevisiae

    PubMed Central

    Morano, Kevin A.; Grant, Chris M.; Moye-Rowley, W. Scott

    2012-01-01

    A common need for microbial cells is the ability to respond to potentially toxic environmental insults. Here we review the progress in understanding the response of the yeast Saccharomyces cerevisiae to two important environmental stresses: heat shock and oxidative stress. Both of these stresses are fundamental challenges that microbes of all types will experience. The study of these environmental stress responses in S. cerevisiae has illuminated many of the features now viewed as central to our understanding of eukaryotic cell biology. Transcriptional activation plays an important role in driving the multifaceted reaction to elevated temperature and levels of reactive oxygen species. Advances provided by the development of whole genome analyses have led to an appreciation of the global reorganization of gene expression and its integration between different stress regimens. While the precise nature of the signal eliciting the heat shock response remains elusive, recent progress in the understanding of induction of the oxidative stress response is summarized here. Although these stress conditions represent ancient challenges to S. cerevisiae and other microbes, much remains to be learned about the mechanisms dedicated to dealing with these environmental parameters. PMID:22209905

  10. The response to heat shock and oxidative stress in Saccharomyces cerevisiae.

    PubMed

    Morano, Kevin A; Grant, Chris M; Moye-Rowley, W Scott

    2012-04-01

    A common need for microbial cells is the ability to respond to potentially toxic environmental insults. Here we review the progress in understanding the response of the yeast Saccharomyces cerevisiae to two important environmental stresses: heat shock and oxidative stress. Both of these stresses are fundamental challenges that microbes of all types will experience. The study of these environmental stress responses in S. cerevisiae has illuminated many of the features now viewed as central to our understanding of eukaryotic cell biology. Transcriptional activation plays an important role in driving the multifaceted reaction to elevated temperature and levels of reactive oxygen species. Advances provided by the development of whole genome analyses have led to an appreciation of the global reorganization of gene expression and its integration between different stress regimens. While the precise nature of the signal eliciting the heat shock response remains elusive, recent progress in the understanding of induction of the oxidative stress response is summarized here. Although these stress conditions represent ancient challenges to S. cerevisiae and other microbes, much remains to be learned about the mechanisms dedicated to dealing with these environmental parameters.

  11. Genome-wide transcriptional responses of Escherichia coli K-12 to continuous osmotic and heat stresses.

    PubMed

    Gunasekera, Thusitha S; Csonka, Laszlo N; Paliy, Oleg

    2008-05-01

    Osmotic stress is known to increase the thermotolerance and oxidative-stress resistance of bacteria by a mechanism that is not adequately understood. We probed the cross-regulation of continuous osmotic and heat stress responses by characterizing the effects of external osmolarity (0.3 M versus 0.0 M NaCl) and temperature (43 degrees C versus 30 degrees C) on the transcriptome of Escherichia coli K-12. Our most important discovery was that a number of genes in the SoxRS and OxyR oxidative-stress regulons were up-regulated by high osmolarity, high temperature, or a combination of both stresses. This result can explain the previously noted cross-protection of osmotic stress against oxidative and heat stresses. Most of the genes shown in previous studies to be induced during the early phase of adaptation to hyperosmotic shock were found to be also overexpressed under continuous osmotic stress. However, there was a poorer overlap between the heat shock genes that are induced transiently after high temperature shifts and the genes that we found to be chronically up-regulated at 43 degrees C. Supplementation of the high-osmolarity medium with the osmoprotectant glycine betaine, which reduces the cytoplasmic K(+) pool, did not lead to a universal reduction in the expression of osmotically induced genes. This finding does not support the hypothesis that K(+) is the central osmoregulatory signal in Enterobacteriaceae.

  12. Transcription of four Rhopalosiphum padi (L.) heat shock protein genes and their responses to heat stress and insecticide exposure.

    PubMed

    Li, Yuting; Zhao, Qi; Duan, Xinle; Song, Chunman; Chen, Maohua

    2017-03-01

    The bird cherry-oat aphid, Rhopalosiphum padi (L.), a worldwide destructive pest, is more heat tolerant than other wheat aphids, and it has developed resistance to different insecticides. Heat shock proteins (HSPs) play an important role in coping with environmental stresses. To investigate Hsp transcriptional responses to heat and insecticide stress, four full-length Hsp genes from R. padi (RpHsp60, RpHsc70, RpHsp70-1, and RpHsp70-2) were cloned. Four RpHsps were expressed during all R. padi developmental stages, but at varying levels. The mRNA levels of RpHsps were increased under thermal stress and reached maximal induction at a lower temperature (36°C) in the alate morph than in the apterous morph (37°C or 38°C). RpHsp expressions under heat stress suggest that RpHsp70-1 and RpHsp70-2 are inducible in both apterous and alate morphs, RpHsc70 is only heat-inducible in apterous morph, and RpHsp60 exhibits poor sensitivity to heat stress. The pretreatment at 37°C significantly increase both the survival rate and the RpHsps expression level of R. padi at subsequent lethal temperature. Under exposure to two sublethal concentrations (LC10 and LC30) of beta-cypermethrin, both RpHsp70-1 and RpHsp70-2 expressions were induced and reached a maximum 24h after exposure. In contrast, expression of RpHsp60 was not induced by either sublethal concentration of beta-cypermethrin. Moreover, the responses of RpHsp70-1 and RpHsp70-2 to heat shock were more sensitive than those to beta-cypermethrin. These results suggest that induction of RpHsp expression is related to thermal tolerance, and that RpHsp70-1 and RpHsp70-2 are the primary genes involved in the response to both heat and pesticide stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Heat-shock response of the upper intertidal barnacle Balanus glandula: thermal stress and acclimation.

    PubMed

    Berger, Michael S; Emlet, Richard B

    2007-06-01

    In the intertidal zone in the Pacific Northwest, body temperatures of sessile marine organisms can reach 35 degrees C for an extended time during low tide, resulting in potential physiological stress. We used immunochemical assays to examine the effects of thermal stress on endogenous Hsp70 levels in the intertidal barnacle Balanus glandula. After thermal stress, endogenous Hsp70 levels did not increase above control levels in B. glandula exposed to 20 and 28 degrees C. In a separate experiment, endogenous Hsp70 levels were higher than control levels when B. glandula was exposed to 34 degrees C for 8.5 h. Although an induced heat-shock response was observed, levels of conjugated ubiquitin failed to indicate irreversible protein damage at temperatures up to 34 degrees C. With metabolic labeling, we examined temperature acclimation and thermally induced heat-shock proteins in B. glandula. An induced heat-shock response of proteins in the 70-kDa region (Hsp70) occurred in B. glandula above 23 degrees C. This heat-shock response was similar in molting and non-molting barnacles. Acclimation of B. glandula to relatively higher temperatures resulted in higher levels of protein synthesis in the 70-kDa region and lack of an upward shift in the induction temperature for heat-shock proteins. Our results suggest that B. glandula may be well adapted to life in the high intertidal zone but may lack the plasticity to acclimate to higher temperatures.

  14. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat

    PubMed Central

    Nakashima, Kazuo; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2014-01-01

    Drought negatively impacts plant growth and the productivity of crops around the world. Understanding the molecular mechanisms in the drought response is important for improvement of drought tolerance using molecular techniques. In plants, abscisic acid (ABA) is accumulated under osmotic stress conditions caused by drought, and has a key role in stress responses and tolerance. Comprehensive molecular analyses have shown that ABA regulates the expression of many genes under osmotic stress conditions, and the ABA-responsive element (ABRE) is the major cis-element for ABA-responsive gene expression. Transcription factors (TFs) are master regulators of gene expression. ABRE-binding protein and ABRE-binding factor TFs control gene expression in an ABA-dependent manner. SNF1-related protein kinases 2, group A 2C-type protein phosphatases, and ABA receptors were shown to control the ABA signaling pathway. ABA-independent signaling pathways such as dehydration-responsive element-binding protein TFs and NAC TFs are also involved in stress responses including drought, heat, and cold. Recent studies have suggested that there are interactions between the major ABA signaling pathway and other signaling factors in stress responses. The important roles of these TFs in crosstalk among abiotic stress responses will be discussed. Control of ABA or stress signaling factor expression can improve tolerance to environmental stresses. Recent studies using crops have shown that stress-specific overexpression of TFs improves drought tolerance and grain yield compared with controls in the field. PMID:24904597

  15. Molecular basis of the defective heat stress response in Mycobacterium leprae.

    PubMed

    Williams, Diana L; Pittman, Tana L; Deshotel, Mike; Oby-Robinson, Sandra; Smith, Issar; Husson, Robert

    2007-12-01

    Mycobacterium leprae, a major human pathogen, grows poorly at 37 degrees C. The basis for its inability to survive at elevated temperatures was investigated. We determined that M. leprae lacks a protective heat shock response as a result of the lack of transcriptional induction of the alternative sigma factor genes sigE and sigB and the major heat shock operons, HSP70 and HSP60, even though heat shock promoters and regulatory circuits for these genes appear to be intact. M. leprae sigE was found to be capable of complementing the defective heat shock response of mycobacterial sigE knockout mutants only in the presence of a functional mycobacterial sigH, which orchestrates the mycobacterial heat shock response. Since the sigH of M. leprae is a pseudogene, these data support the conclusion that a key aspect of the defective heat shock response in M. leprae is the absence of a functional sigH. In addition, 68% of the genes induced during heat shock in M. tuberculosis were shown to be either absent from the M. leprae genome or were present as pseudogenes. Among these is the hsp/acr2 gene, whose product is essential for M. tuberculosis survival during heat shock. Taken together, these results suggest that the reduced ability of M. leprae to survive at elevated temperatures results from the lack of a functional transcriptional response to heat shock and the absence of a full repertoire of heat stress response genes, including sigH.

  16. Molecular Basis of the Defective Heat Stress Response in Mycobacterium leprae▿ †

    PubMed Central

    Williams, Diana L.; Pittman, Tana L.; Deshotel, Mike; Oby-Robinson, Sandra; Smith, Issar; Husson, Robert

    2007-01-01

    Mycobacterium leprae, a major human pathogen, grows poorly at 37°C. The basis for its inability to survive at elevated temperatures was investigated. We determined that M. leprae lacks a protective heat shock response as a result of the lack of transcriptional induction of the alternative sigma factor genes sigE and sigB and the major heat shock operons, HSP70 and HSP60, even though heat shock promoters and regulatory circuits for these genes appear to be intact. M. leprae sigE was found to be capable of complementing the defective heat shock response of mycobacterial sigE knockout mutants only in the presence of a functional mycobacterial sigH, which orchestrates the mycobacterial heat shock response. Since the sigH of M. leprae is a pseudogene, these data support the conclusion that a key aspect of the defective heat shock response in M. leprae is the absence of a functional sigH. In addition, 68% of the genes induced during heat shock in M. tuberculosis were shown to be either absent from the M. leprae genome or were present as pseudogenes. Among these is the hsp/acr2 gene, whose product is essential for M. tuberculosis survival during heat shock. Taken together, these results suggest that the reduced ability of M. leprae to survive at elevated temperatures results from the lack of a functional transcriptional response to heat shock and the absence of a full repertoire of heat stress response genes, including sigH. PMID:17933896

  17. Stress Responses to Heat Exposure in Three Species of Australian Desert Birds.

    PubMed

    Xie, Shangzhe; Romero, L Michael; Htut, Zaw Win; McWhorter, Todd J

    Birds need to respond to weather changes quickly and appropriately for their own well-being and survival. The inability to respond appropriately to heat waves can be fatal to individual birds and can translate into large-scale mortality events. We investigated corticosterone (CORT) and heterophil∶lymphocyte (H∶L) ratio responses of budgerigars (Melopsittacus undulatus), zebra finches (Taeniopygia guttata), and diamond doves (Geopelia cuneata) to heat exposures. The birds were exposed to a temperature similar to what they experience during a typical summer day (35°C) and a higher temperature (45°C) similar to that experienced during a heat wave. There were no significant increases between the CORT concentrations before and after heat exposure in zebra finches and budgerigars at 35° and 45°C, but there was a significant increase in CORT concentrations in diamond doves after exposure to 45°C. The H∶L ratios increased significantly after heat exposure in budgerigars at 35° and 45°C and in diamond doves at 35°C. No significant correlation was found between the changes in CORT and H∶L ratios. The data suggest that there are species differences in birds' stress responses to heat exposure that may reflect their ability to detect and adapt to high temperatures. There appear to be differences between the two types of stress measurements, which may reflect differences in the timescales of these responses.

  18. Transcriptomic responses to heat stress and nickel in the mussel Mytilus galloprovincialis.

    PubMed

    Mohamed, Banni; Hajer, Attig; Susanna, Sforzini; Caterina, Oliveri; Flavio, Mignone; Hamadi, Boussetta; Aldo, Viarengo

    2014-03-01

    The exposure of marine organisms to stressing agents may affect the level and pattern of gene expression. Although many studies have examined the ecological effects of heat stress on mussels, little is known about the physiological mechanisms that maybe affected by co-exposure to heat stress and environmental contaminants such as nickel (Ni). In the present work, we investigated the effects of simultaneous changes in temperature and Ni supply on lysosomal membrane stability (LMS) and malondialdehyde accumulation (MDA) in the digestive gland (DG) of the blue mussel Mytilus galloprovincialis (Lam.). To elucidate how the molecular response to environmental stressors is modulated, we employed a cDNA microarray with 1673 sequences to measure relative transcript abundances in the DG of mussels exposed to Ni along with a temperature increase. A two-way ANOVA revealed that temperature and Ni rendered additive effects on LMS and MDA accumulation, increasing the toxic effects of metal cations. Ni loads in the DG were also affected by co-exposure to 26°C. In animals exposed only to heat stress, functional genomics analysis of the microarray data (171 differentially expressed genes (DEGs)) highlighted seven biological processes, largely dominated by the up-regulation of folding protein-related genes and the down-regulation of genes involved in cell migration and cellular component assembly. Exposure to Ni at 18°C and 26°C yielded 188 and 262 DEGs, respectively, exhibiting distinct patterns in terms of biological processes. In particular, the response of mussels exposed to Ni at 26°C was characterized by the up-regulation of proteolysis, ribosome biogenesis, response to unfolded proteins, and catabolic-related genes, as well as the down-regulation of genes encoding cellular metabolic processes. Our data provide new insights into the transcriptomic response in mussels experiencing temperature increases and Ni exposure; these data should be carefully considered in view of the

  19. Tomato yellow leaf curl virus infection mitigates the heat stress response of plants grown at high temperatures.

    PubMed

    Anfoka, Ghandi; Moshe, Adi; Fridman, Lilia; Amrani, Linoy; Rotem, Or; Kolot, Mikhail; Zeidan, Mouhammad; Czosnek, Henryk; Gorovits, Rena

    2016-01-21

    Cultured tomatoes are often exposed to a combination of extreme heat and infection with Tomato yellow leaf curl virus (TYLCV). This stress combination leads to intense disease symptoms and yield losses. The response of TYLCV-susceptible and resistant tomatoes to heat stress together with viral infection was compared. The plant heat-stress response was undermined in TYLCV infected plants. The decline correlated with the down-regulation of heat shock transcription factors (HSFs) HSFA2 and HSFB1, and consequently, of HSF-regulated genes Hsp17, Apx1, Apx2 and Hsp90. We proposed that the weakened heat stress response was due to the decreased capacity of HSFA2 to translocate into the nuclei of infected cells. All the six TYLCV proteins were able to interact with tomato HSFA2 in vitro, moreover, coat protein developed complexes with HSFA2 in nuclei. Capturing of HSFA2 by viral proteins could suppress the transcriptional activation of heat stress response genes. Application of both heat and TYLCV stresses was accompanied by the development of intracellular large protein aggregates containing TYLCV proteins and DNA. The maintenance of cellular chaperones in the aggregated state, even after recovery from heat stress, prevents the circulation of free soluble chaperones, causing an additional decrease in stress response efficiency.

  20. Tomato yellow leaf curl virus infection mitigates the heat stress response of plants grown at high temperatures

    PubMed Central

    Ghandi, Anfoka; Adi, Moshe; Lilia, Fridman; Linoy, Amrani; Or, Rotem; Mikhail, Kolot; Mouhammad, Zeidan; Henryk, Czosnek; Rena, Gorovits

    2016-01-01

    Cultured tomatoes are often exposed to a combination of extreme heat and infection with Tomato yellow leaf curl virus (TYLCV). This stress combination leads to intense disease symptoms and yield losses. The response of TYLCV-susceptible and resistant tomatoes to heat stress together with viral infection was compared. The plant heat-stress response was undermined in TYLCV infected plants. The decline correlated with the down-regulation of heat shock transcription factors (HSFs) HSFA2 and HSFB1, and consequently, of HSF-regulated genes Hsp17, Apx1, Apx2 and Hsp90. We proposed that the weakened heat stress response was due to the decreased capacity of HSFA2 to translocate into the nuclei of infected cells. All the six TYLCV proteins were able to interact with tomato HSFA2 in vitro, moreover, coat protein developed complexes with HSFA2 in nuclei. Capturing of HSFA2 by viral proteins could suppress the transcriptional activation of heat stress response genes. Application of both heat and TYLCV stresses was accompanied by the development of intracellular large protein aggregates containing TYLCV proteins and DNA. The maintenance of cellular chaperones in the aggregated state, even after recovery from heat stress, prevents the circulation of free soluble chaperones, causing an additional decrease in stress response efficiency. PMID:26792235

  1. Elevated local skin temperature impairs cutaneous vasoconstrictor responses to a simulated haemorrhagic challenge while heat stressed

    PubMed Central

    Pearson, J.; Lucas, R. A. I.; Crandall, C. G.

    2016-01-01

    During a simulated haemorrhagic challenge, syncopal symptoms develop sooner when individuals are hyperthermic relative to normothermic. This is due, in part, to a large displacement of blood to the cutaneous circulation during hyperthermia, coupled with inadequate cutaneous vasoconstriction during the hypotensive challenge. The influence of local skin temperature on these cutaneous vasoconstrictor responses is unclear. This project tested the hypothesis that local skin temperature modulates cutaneous vasoconstriction during simulated haemorrhage in hyperthermic humans. Eight healthy participants (four men and four women; 32 ± 7 years old; 75.2 ± 10.8 kg) underwent lower-body negative pressure to presyncope while heat stressed via a water-perfused suit sufficiently to increase core temperature by 1.2 ± 0.2°C. At forearm skin sites distal to the water-perfused suit, local skin temperature was either 35.2 ± 0.6 (mild heating) or 38.2 ± 0.2°C (moderate heating) throughout heat stress and lower-body negative pressure, and remained at these temperatures until presyncope. The reduction in cutaneous vascular conductance during the final 90 s of lower-body negative pressure, relative to heat-stress baseline, was greatest at the mildly heated site (−10 ± 15% reduction) relative to the moderately heated site (−2 ± 12%; P = 0.05 for the magnitude of the reduction in cutaneous vascular conductance between sites), because vasoconstriction at the moderately heated site was either absent or negligible. In hyperthermic individuals, the extent of cutaneous vasoconstriction during a simulated haemorrhage can be modulated by local skin temperature. In situations where skin temperature is at least 38°C, as is the case in soldiers operating in warm climatic conditions, a haemorrhagic insult is unlikely to be accompanied by cutaneous vasoconstriction. PMID:22903981

  2. Cardiovascular disease-induced thermal responses during passive heat stress: an integrated computational study.

    PubMed

    Zhang, Xiancheng; Noda, Shigeho; Himeno, Ryutaro; Liu, Hao

    2016-11-01

    The cardiovascular system plays a crucial role in human thermoregulation; cardiovascular diseases may lead to significantly degrading the thermoregulation ability for patients during exposure to heat stress. To evaluate the thermal responses of patients with common chronic cardiovascular diseases, we here propose an integrated computational model by coupling a two-node thermoregulation model with a closed-loop, multi-compartment, lumped-parameter cardiovascular model. This bioheat transfer model is validated, capable to predict cardiovascular functions and thermal responses under varying environmental conditions. Our results demonstrate that the cardiovascular disease-induced reduction in cardiac output and skin blood flow causes extra elevation in core temperature during hyperthermic challenges. In addition, a combination of aging, obesity, and cardiovascular diseases shows a pronounced increase in core temperature during heat exposure, which implies that such combined effect may increase the risk of heat-related morbidity and mortality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Assessment of male anthropometric trends and the effects on simulated heat stress responses.

    PubMed

    Yokota, Miyo; Bathalon, Gaston P; Berglund, Larry G

    2008-09-01

    Assessing temporal changes in anthropometrics and body composition of US Army soldiers is important because these changes may affect fitness, performance, and safety. This study investigated differences in body dimensions (height, weight, percent body fat (%BF)) of US Army male soldiers by comparing 2004 and 1988 databases. Anthropometric somatotypes were identified and physiological responses of the different somatotypes to simulated heat stress (35 degrees C/50%rh, approximately 550 W work rate, carrying 12 kg load including battle dress uniform and body armor, rest for 30 min and walk for 70 min) using a thermal regulatory model were evaluated. A significant increase in body weight (2.4 kg) was observed between the 2004 and 1988 data (P < 0.05, after Bonferroni correction). However, changes in height and circumference measurements for %BF were insignificant, with the magnitude of the changes not exceeding inter-observer errors. Multivariate analyses demonstrated that anthropometric distributions did not differ between the two databases and identified five primary somatotypes: "tall-fat", "tall-lean", "average", "short-lean", and "short-fat." Within each database, anthropometric values differed among the somatotypes. However, simulated physiological responses to heat stress in each somatotype were similar in the 2004 and 1988 populations. In conclusion, an increase in body weight was the primary change observed in this sample of US Army male soldiers. Temporal changes in somatotypes of soldiers over a 16-year period had minimal impact on simulated physiological response to heat stress using a thermal regulatory model.

  4. Neurotoxicity induced by arsenic in Gallus Gallus: Regulation of oxidative stress and heat shock protein response.

    PubMed

    Zhao, Panpan; Guo, Ying; Zhang, Wen; Chai, Hongliang; Xing, Houjuan; Xing, Mingwei

    2017-01-01

    Arsenic, a naturally occurring heavy metal pollutant, is one of the functioning risk factors for neurological toxicity in humans. However, little is known about the effects of arsenic on the nervous system of Gallus Gallus. To investigate whether arsenic induce neurotoxicity and influence the oxidative stress and heat shock proteins (Hsps) response in chickens, seventy-two 1-day-old male Hy-line chickens were treated with different doses of arsenic trioxide (As2O3). The histological changes, antioxidant enzyme activity, and the expressions of Hsps were detected. Results showed slightly histology changes were obvious in the brain tissues exposure to arsenic. The activities of Glutathione peroxidase (GSH-Px) and catalase (CAT) were decreased compared to the control, whereas the malondialdehyde (MDA) content was increased gradually along with increase in diet-arsenic. The mRNA levels of Hsps and protein expressions of Hsp60 and Hsp70 were up-regulated. These results suggested that sub-chronic exposure to arsenic induced neurotoxicity in chickens. Arsenic exposure disturbed the balance of oxidants and antioxidants. Increased heat shock response tried to protect chicken brain tissues from tissues damage caused by oxidative stress. The mechanisms of neurotoxicity induced by arsenic include oxidative stress and heat shock protein response in chicken brain tissues. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Long-term heat stress induces the inflammatory response in dairy cows revealed by plasma proteome analysis.

    PubMed

    Min, Li; Zheng, Nan; Zhao, Shengguo; Cheng, Jianbo; Yang, Yongxin; Zhang, Yangdong; Yang, Hongjian; Wang, Jiaqi

    2016-03-04

    In this work we employed a comparative proteomic approach to evaluate seasonal heat stress and investigate proteomic alterations in plasma of dairy cows. Twelve lactating Holstein dairy cows were used and the treatments were: heat stress (n = 6) in hot summer (at the beginning of the moderate heat stress) and no heat stress (n = 6) in spring natural ambient environment, respectively. Subsequently, heat stress treatment lasted 23 days (at the end of the moderate heat stress) to investigate the alterations of plasma proteins, which might be employed as long-term moderate heat stress response in dairy cows. Changes in plasma proteins were analyzed by two-dimensional electrophoresis (2-DE) combined with mass spectrometry. Analysis of the properties of the identified proteins revealed that the alterations of plasma proteins were related to inflammation in long-term moderate heat stress. Furthermore, the increase in plasma tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) directly demonstrated that long-term moderate heat stress caused an inflammatory response in dairy cows.

  6. The sphingosine rheostat is involved in the cnidarian heat stress response but not necessarily in bleaching.

    PubMed

    Kitchen, Sheila A; Weis, Virginia M

    2017-02-22

    Sphingolipids play important roles in mitigating cellular heat and oxidative stress by altering membrane fluidity, receptor clustering and gene expression. Accumulation of signaling sphingolipids that comprise the sphingosine rheostat, pro-apoptotic sphingosine (Sph) and pro-survival sphingosine-1-phosphate (S1P), is key to determining cell fate. Reef-building corals and other symbiotic cnidarians living in shallow tropical waters can experience elevated seawater temperature and high UV irradiance, two stressors that are increasing in frequency and severity with climate change. In symbiotic cnidarians, these stressors disrupt the photosynthetic machinery of the endosymbiont and ultimately result in the collapse of the partnership (dysbiosis), known as cnidarian bleaching. In a previous study, exogenously applied sphingolipids altered heat-induced bleaching in the symbiotic anemone Aiptasia pallida, but endogenous regulation of these lipids is unknown. Here, we characterized the role of the rheostat in the cnidarian heat stress response (HSR) and in dysbiosis. Gene expression of rheostat enzymes sphingosine kinase (AP-SPHK) and S1P phosphatase (AP-SGPP), and concentrations of sphingolipids were quantified from anemones incubated at elevated temperatures. We observed a biphasic HSR in A. pallida. At early exposure, rheostat gene expression and lipid levels were suppressed while gene expression of a heat stress biomarker increased and 40% of symbionts were lost. After longer incubations at the highest temperature, AP-SGPP and then Sph levels both increased. These results indicate that the sphingosine rheostat in A. pallida does not participate in initiation of dysbiosis, but instead functions in the chronic response to prolonged heat stress that promotes host survival.

  7. Experience Modulates the Reproductive Response to Heat Stress in C. elegans via Multiple Physiological Processes

    PubMed Central

    Gouvêa, Devin Y.; Aprison, Erin Z.; Ruvinsky, Ilya

    2015-01-01

    Natural environments are considerably more variable than laboratory settings and often involve transient exposure to stressful conditions. To fully understand how organisms have evolved to respond to any given stress, prior experience must therefore be considered. We investigated the effects of individual and ancestral experience on C. elegans reproduction. We documented ways in which cultivation at 15°C or 25°C affects developmental time, lifetime fecundity, and reproductive performance after severe heat stress that exceeds the fertile range of the organism but is compatible with survival and future fecundity. We found that experience modulates multiple aspects of reproductive physiology, including the male and female germ lines and the interaction between them. These responses vary in their environmental sensitivity, suggesting the existence of complex mechanisms for coping with unpredictable and stressful environments. PMID:26713620

  8. Relationship between Aflatoxin Contamination and Physiological Responses of Corn Plants under Drought and Heat Stress

    PubMed Central

    Kebede, Hirut; Abbas, Hamed K.; Fisher, Daniel K.; Bellaloui, Nacer

    2012-01-01

    Increased aflatoxin contamination in corn by the fungus Aspergillus flavus is associated with frequent periods of drought and heat stress during the reproductive stages of the plants. The objective of this study was to evaluate the relationship between aflatoxin contamination and physiological responses of corn plants under drought and heat stress. The study was conducted in Stoneville, MS, USA under irrigated and non-irrigated conditions. Five commercial hybrids, P31G70, P33F87, P32B34, P31B13 and DKC63-42 and two inbred germplasm lines, PI 639055 and PI 489361, were evaluated. The plants were inoculated with Aspergillus flavus (K-54) at mid-silk stage, and aflatoxin contamination was determined on the kernels at harvest. Several physiological measurements which are indicators of stress response were determined. The results suggested that PI 639055, PI 489361 and hybrid DKC63-42 were more sensitive to drought and high temperature stress in the non-irrigated plots and P31G70 was the most tolerant among all the genotypes. Aflatoxin contamination was the highest in DKC63-42 and PI 489361 but significantly lower in P31G70. However, PI 639055, which is an aflatoxin resistant germplasm, had the lowest aflatoxin contamination, even though it was one of the most stressed genotypes. Possible reasons for these differences are discussed. These results suggested that the physiological responses were associated with the level of aflatoxin contamination in all the genotypes, except PI 639055. These and other physiological responses related to stress may help examine differences among corn genotypes in aflatoxin contamination. PMID:23202322

  9. Transcriptome analysis provides insights into hepatic responses to moderate heat stress in the rainbow trout (Oncorhynchus mykiss).

    PubMed

    Li, Yongjuan; Huang, Jinqiang; Liu, Zhe; Zhou, Yanjing; Xia, Binpeng; Wang, Yongjie; Kang, Yujun; Wang, Jianfu

    2017-07-01

    The rainbow trout is an economically important fish in the world. The limited stress tolerance of this species to high summer-like temperatures usually leads to mass mortality and great economic loss. However, there is limited information on the mechanisms underlying moderate heat responses in the liver of the rainbow trout. Here, we performed transcriptome profiling of rainbow trout liver under moderate heat stress by using the Hiseq™ 4000 sequencing platform. More than 277 million clean reads were obtained from 6 libraries and aligned against the rainbow trout genome. A total of 128 unique transcripts were differentially expressed in the liver under heat-stress and control conditions, many heat shock protein genes for thermoregulation and some novel genes involved in heat stress were identified. Nine of the differently expressed genes were further validated by qRT-PCR. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses revealed that several pathways, including those for protein metabolism, energy metabolism, and immune system, were influenced by heat stress. Moreover, an important protein-processing pathway in the endoplasmic reticulum (ER) was identified, and the key role of ER-associated degradation and function of calpain as an upstream regulator of apoptosis were confirmed under heat stress. The results of this study provide a comprehensive overview of heat stress-induced transcriptional patterns in rainbow trout liver and would be particularly useful for further studies on the molecular mechanisms underlying responses to heat stress in this species. Copyright © 2017. Published by Elsevier B.V.

  10. The transcriptional response of the Pacific oyster Crassostrea gigas against acute heat stress.

    PubMed

    Yang, Chuanyan; Gao, Qiang; Liu, Chang; Wang, Lingling; Zhou, Zhi; Gong, Changhao; Zhang, Anguo; Zhang, Huan; Qiu, Limei; Song, Linsheng

    2017-09-01

    The Pacific oyster, Crassostrea gigas, has evolved sophisticated mechanisms to adapt the changing ambient conditions, and protect themselves from stress-induced injuries. In the present study, the expression profiles of mRNA transcripts in the haemocytes of oysters under heat stress were examined to reveal the possible mechanism of heat stress response. There were 23,315, 23,904, 23,123 and 23,672 transcripts identified in the haemocytes of oysters cultured at 25 °C for 0, 6, 12, and 24 h (designed as B, H6, H12, H24), respectively. And 22,330 differentially expressed transcripts (DTs) were yielded in the pairwise comparisons between the above four samples, which corresponded to 8074 genes. There were 9, 12 and 22 Gene Ontology (GO) terms identified in the DT pairwise comparison groups of H6_B, H12_H6 and H24_H12, respectively, and the richest GO terms in biological process category were cellular catabolic process, translational initiation and apoptotic process, respectively. There were 108, 102 and 102 KEGG pathways successfully retrieved from DTs comparison groups DTH6_B, DTH12_H6 and DTH24_H12, respectively, among which 93 pathways were shared by all three comparison groups, and most of them were related to metabolism of protein, carbohydrate and fat. The expression patterns of 12 representative heat stress response-relevant genes detected by quantitative real-time PCR (qRT-PCR) were similar to those obtained from transcriptome analysis. By flow cytometric analysis, the apoptosis rate of haemocytes increased significantly after oysters were treated at 25 °C for 24 h and recovered at 4 °C for 12 h (p < 0.05) and 36 h (p < 0.01), and it also increased significantly when the heat treatment lasted to 60 h (p < 0.01). The present results indicated that, when oysters encountered short term heat stress, the expression of genes related to energy metabolism, as well as unfolded protein response (UPR) and anti-apoptotic system, were firstly regulated to

  11. Heat Shock Factor Genes of Tall Fescue and Perennial Ryegrass in Response to Temperature Stress by RNA-Seq Analysis

    PubMed Central

    Wang, Yan; Dai, Ya; Tao, Xiang; Wang, Jia-Zhen; Cheng, Hai-Yang; Yang, Hong; Ma, Xin-Rong

    2016-01-01

    Heat shock factors (Hsfs) are important regulators of stress-response in plants. However, our understanding of Hsf genes and their responses to temperature stresses in two Pooideae cool-season grasses, Festuca arundinacea, and Lolium perenne, is limited. Here we conducted comparative transcriptome analyses of plant leaves exposed to heat or cold stress for 10 h. Approximately, 30% and 25% of the genes expressed in the two species showed significant changes under heat and cold stress, respectively, including subsets of Hsfs and their target genes. We uncovered 74 Hsfs in F. arundinacea and 52 Hsfs in L. perenne, and categorized these genes into three subfamilies, HsfA, HsfB, and HsfC based on protein sequence homology to known Hsf members in model organisms. The Hsfs showed a strong response to heat and/or cold stress. The expression of HsfAs was elevated under heat stress, especially in class HsfA2, which exhibited the most dramatic responses. HsfBs were upregulated by the both temperature conditions, and HsfCs mainly showed an increase in expression under cold stress. The target genes of Hsfs, such as heat shock protein (HSP), ascorbate peroxidase (APX), inositol-3-phosphate synthase (IPS), and galactinol synthase (GOLS1), showed strong and unique responses to different stressors. We comprehensively detected Hsfs and their target genes in F. arundinacea and L. perenne, providing a foundation for future gene function studies and genetic engineering to improve stress tolerance in grasses and other crops. PMID:26793208

  12. Biological stress responses to radio frequency electromagnetic radiation: are mobile phones really so (heat) shocking?

    PubMed

    Cotgreave, Ian A

    2005-03-01

    Cells phenotypically adapt to alterations in their intra- and extracellular environment via organised alterations to gene and protein expression. Many chemical and physical stimuli are known to drive such responses, including the induction of oxidative stress and heat shock. Increasing use of mobile telephones in our society, has brought focus on the potential for radio frequency (microwave) electromagnetic radiation to elicit biological stress responses, in association with potentially detrimental effects of this to human health. Here we review evidence suggesting altered gene and protein expression in response to such emissions, with particular focus on heat shock proteins. Non-thermal induction of heat shock proteins has been claimed by a number of investigations in in vitro cellular systems, and appears pleiotropic for many other regulatory events. However, many of these studies are flawed by inconsistencies in exposure models, cell types used and the independent reproducibility of the findings. Further, the paucity of evidence from in vivo experimentation is largely contradictory. Therefore, the validity of these effects in human health risk assessment remain unsubstantiated. Where possible, suggestions for further experimental clarification have been provided.

  13. Proteomic profiling of Rhizobium tropici PRF 81: identification of conserved and specific responses to heat stress.

    PubMed

    Gomes, Douglas Fabiano; Batista, Jesiane Stefânia da Silva; Schiavon, Aline Luiza; Andrade, Diva Souza; Hungria, Mariangela

    2012-05-30

    Rhizobium tropici strain PRF 81 (= SEMIA 4080) has been used in commercial inoculants for application to common-bean crops in Brazil since 1998, due to its high efficiency in fixing nitrogen, competitiveness against indigenous rhizobial populations and capacity to adapt to stressful tropical conditions, representing a key alternative to application of N-fertilizers. The objective of our study was to obtain an overview of adaptive responses to heat stress of strain PRF 81, by analyzing differentially expressed proteins when the bacterium is grown at 28°C and 35°C. Two-dimensional gel electrophoresis (2DE) revealed up-regulation of fifty-nine spots that were identified by MALDI-TOF/TOF-TOF. Differentially expressed proteins were associated with the functional COG categories of metabolism, cellular processes and signaling, information storage and processing. Among the up-regulated proteins, we found some related to conserved heat responses, such as molecular chaperones DnaK and GroEL, and other related proteins, such as translation factors EF-Tu, EF-G, EF-Ts and IF2. Interestingly, several oxidative stress-responsive proteins were also up-regulated, and these results reveal the diversity of adaptation mechanisms presented by this thermotolerant strain, suggesting a cross-talk between heat and oxidative stresses. Our data provide valuable protein-expression information relevant to the ongoing genome sequencing of strain PRF 81, and contributes to our still-poor knowledge of the molecular determinants of the thermotolerance exhibited by R. tropici species.

  14. Review of comparative responses of men and women to heat stress

    SciTech Connect

    Kenney, W.L.

    1985-01-01

    Most of their present knowledge regarding human responses to thermal stress is primarily a result of research conducted on male subjects. Recently, as women have moved into the industrial workplace and forefront of athletic activity, attention has turned to comparative responses of men and women. Very limited research on preadolescent children suggests no physiological thermoregulatory sex differences except for a slightly higher sweat rate in lean boys as compared to lean girls of a similar age. Boys also tended to be more tolerant of higher temperatures. Current beliefs regarding men and women are: (1) women, as a population, are less tolerant to a given imposed heat stress however, if cardiovascular fitness level, body size, and acclimation state are standardized, the differences tend to disappear; (2) women have a lower sweat rate than men of equal fitness, size, and acclimation which is disadvantageous in hot-dry environments, but advantageous in hot-wet environments; and (3) menstrual cycle effects are minimal. It is concluded that aerobic capacity, surface area-to-mass ratio, and state of acclimation are more important than sex in determining physiological responses to heat stress.

  15. Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.

    PubMed

    Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

    2016-02-01

    Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.

  16. Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans

    PubMed Central

    Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

    2016-01-01

    Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest. PMID:26743903

  17. Expression of OsMYB55 in maize activates stress-responsive genes and enhances heat and drought tolerance.

    PubMed

    Casaretto, José A; El-Kereamy, Ashraf; Zeng, Bin; Stiegelmeyer, Suzy M; Chen, Xi; Bi, Yong-Mei; Rothstein, Steven J

    2016-04-29

    Plant response mechanisms to heat and drought stresses have been considered in strategies for generating stress tolerant genotypes, but with limited success. Here, we analyzed the transcriptome and improved tolerance to heat stress and drought of maize plants over-expressing the OsMYB55 gene. Over-expression of OsMYB55 in maize decreased the negative effects of high temperature and drought resulting in improved plant growth and performance under these conditions. This was evidenced by the higher plant biomass and reduced leaf damage exhibited by the transgenic lines compared to wild type when plants were subjected to individual or combined stresses and during or after recovery from stress. A global transcriptomic analysis using RNA sequencing revealed that several genes induced by heat stress in wild type plants are constitutively up-regulated in OsMYB55 transgenic maize. In addition, a significant number of genes up-regulated in OsMYB55 transgenic maize under control or heat treatments have been associated with responses to abiotic stresses including high temperature, dehydration and oxidative stress. The latter is a common and major consequence of imposed heat and drought conditions, suggesting that this altered gene expression may be associated with the improved stress tolerance in these transgenic lines. Functional annotation and enrichment analysis of the transcriptome also pinpoint the relevance of specific biological processes for stress responses. Our results show that expression of OsMYB55 can improve tolerance to heat stress and drought in maize plants. Enhanced expression of stress-associated genes may be involved in OsMYB55-mediated stress tolerance. Possible implications for the improved tolerance to heat stress and drought of OsMYB55 transgenic maize are discussed.

  18. Inactivation of GABAA receptor is related to heat shock stress response in organism model Caenorhabditis elegans.

    PubMed

    Camargo, Gabriela; Elizalde, Alejandro; Trujillo, Xochitl; Montoya-Pérez, Rocío; Mendoza-Magaña, María Luisa; Hernandez-Chavez, Abel; Hernandez, Leonardo

    2016-09-01

    The mechanisms underlying oxidative stress (OS) resistance are not completely clear. Caenorhabditis elegans (C. elegans) is a good organism model to study OS because it displays stress responses similar to those in mammals. Among these mechanisms, the insulin/IGF-1 signaling (IIS) pathway is thought to affect GABAergic neurotransmission. The aim of this study was to determine the influence of heat shock stress (HS) on GABAergic activity in C. elegans. For this purpose, we tested the effect of exposure to picrotoxin (PTX), gamma-aminobutyric acid (GABA), hydrogen peroxide, and HS on the occurrence of a shrinking response (SR) after nose touch stimulus in N2 (WT) worms. Moreover, the effect of HS on the expression of UNC-49 (GABAA receptor ortholog) in the EG1653 strain and the effect of GABA and PTX exposure on HSP-16.2 expression in the TJ375 strain were analyzed. PTX 1 mM- or H2O2 0.7 mM-exposed worms displayed a SR in about 80 % of trials. GABA exposure did not cause a SR. HS prompted the occurrence of a SR as did PTX 1 mM or H2O2 0.7 mM exposure. In addition, HS increased UNC-49 expression, and PTX augmented HSP-16.2 expression. Thus, the results of the present study suggest that oxidative stress, through either H2O2 exposure or application of heat shock, inactivates the GABAergic system, which subsequently would affect the oxidative stress response, perhaps by enhancing the activity of transcription factors DAF-16 and HSF-1, both regulated by the IIS pathway and related to hsp-16.2 expression.

  19. ROLE OF ENVIRONMENTAL HEAT AND COLD STRESS ON THE PHYSIOLOGICAL RESPONSE TO ORGANOPHOSPHATES AND OTHER TOXICANTS.

    EPA Science Inventory

    Most toxicological and pharmacological studies are performed in laboratory rodents maintained under comfortable environmental conditions. However, exposure to toxicants as well as some drugs can occur under stressful conditions during rest or while exercising. Heat stress can exa...

  20. ROLE OF ENVIRONMENTAL HEAT AND COLD STRESS ON THE PHYSIOLOGICAL RESPONSE TO ORGANOPHOSPHATES AND OTHER TOXICANTS.

    EPA Science Inventory

    Most toxicological and pharmacological studies are performed in laboratory rodents maintained under comfortable environmental conditions. However, exposure to toxicants as well as some drugs can occur under stressful conditions during rest or while exercising. Heat stress can exa...

  1. Effects of Heat Stress Treatment on Age-dependent Unfolded Protein Response in Different Types of Skeletal Muscle.

    PubMed

    Tamura, Yuki; Matsunaga, Yutaka; Kitaoka, Yu; Hatta, Hideo

    2017-03-01

    Mitochondrial and endoplasmic reticulum (ER) stress, and subsequently activated responses (mitochondrial/ER unfolded protein responses; UPRmt/UPRER), are involved in the pathogenesis of sarcopenia. To extend both basic and translational knowledge, we examined (i) whether age-induced mitochondrial and ER stress depend on skeletal muscle type in mice and (ii) whether heat stress treatment, a suggested strategy for sarcopenia, improves age-induced mitochondrial and ER stress. Aged (21-month-old) mice showed more severe mitochondrial stress and UPRmt than young (12-week-old) mice, based on increased oxidative stress, mitochondrial proteases, and mitochondrial E3 ubiquitin ligase. The aged mice also showed ER stress and UPRER, based on decreased ER enzymes and increased ER stress-related cell death. These changes were much more evident in soleus muscle than in gastrocnemius and plantaris muscles. After daily heat stress treatment (40 °C chamber for 30 minutes per day) for 4 weeks, mice showed remarkable improvements in age-related changes in soleus muscle. Heat stress had only minor effects in gastrocnemius and plantaris muscles. Based on these findings, age-associated mitochondrial stress, ER stress, and UPRmt/ER vary qualitatively with skeletal muscle type. Our results suggest a molecular basis for the beneficial effects of heat stress on muscle atrophy with age in soleus muscle. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Chromium(III) nanoparticles affect hormone and immune responses in heat-stressed rats.

    PubMed

    Zha, Longying; Zeng, Jingwen; Sun, Suxia; Deng, Hong; Luo, Haiji; Li, Wanli

    2009-01-01

    This study was conducted to evaluate the effects of chromium nanoparticles (CrNano) on the hormone and immune responses of rats in heat stress condition. A total of 80 male Sprague-Dawley rats were randomly assigned to four dietary treatment groups (n = 20). The first group was offered a basal diet as a control. The second, third, and fourth groups received basal diet supplemented with 150, 300, and 450 microg/kg Cr, respectively, in the form of CrNano. At the end of the 8-week trial, growth performance, food utilization, and sera concentrations of hormones, immunoglobulins, and alexins were determined. Lymphocyte proliferation activity, antibody response to injected sheep red blood cells (SRBCs), and phagocytosis of peritoneal macrophages were determined by (3)H-thymidine uptake method, plaque-forming cells (PFC) assay, and ingesting chicken red blood cells test, respectively. The results indicated that rats that received CrNano exhibited no changes in growth rate and food efficiency compared to the control group. However, dietary supplementation of 150, 300, and 450 microg/kg Cr from CrNano significantly decreased serum concentrations of insulin and cortisol, increased sera levels of insulin-like growth factor I and immunoglobulin G, and enhanced the lymphoproliferative response, anti-SRBC PFC response, and phagocytic activity of peritoneal macrophages. These results suggest that dietary supplementation of Cr as CrNano affects hormone and immune status in heat-stressed rats.

  3. Separating heat stress from moisture stress: analyzing yield response to high temperature in irrigated maize

    NASA Astrophysics Data System (ADS)

    Carter, Elizabeth K.; Melkonian, Jeff; Riha, Susan J.; Shaw, Stephen B.

    2016-09-01

    Several recent studies have indicated that high air temperatures are limiting maize (Zea mays L.) yields in the US Corn Belt and project significant yield losses with expected increases in growing season temperatures. Further work has suggested that high air temperatures are indicative of high evaporative demand, and that decreases in maize yields which correlate to high temperatures and vapor pressure deficits (VPD) likely reflect underlying soil moisture limitations. It remains unclear whether direct high temperature impacts on yields, independent of moisture stress, can be observed under current temperature regimes. Given that projected high temperature and moisture may not co-vary the same way as they have historically, quantitative analyzes of direct temperature impacts are critical for accurate yield projections and targeted mitigation strategies under shifting temperature regimes. To evaluate yield response to above optimum temperatures independent of soil moisture stress, we analyzed climate impacts on irrigated maize yields obtained from the National Corn Growers Association (NCGA) corn yield contests for Nebraska, Kansas and Missouri. In irrigated maize, we found no evidence of a direct negative impact on yield by daytime air temperature, calculated canopy temperature, or VPD when analyzed seasonally. Solar radiation was the primary yield-limiting climate variable. Our analyses suggested that elevated night temperature impacted yield by increasing rates of phenological development. High temperatures during grain-fill significantly interacted with yields, but this effect was often beneficial and included evidence of acquired thermo-tolerance. Furthermore, genetics and management—information uniquely available in the NCGA contest data—explained more yield variability than climate, and significantly modified crop response to climate. Thermo-acclimation, improved genetics and changes to management practices have the potential to partially or completely

  4. Ebola Response: Modeling the Risk of Heat Stress from Personal Protective Clothing

    PubMed Central

    Potter, Adam W.; Gonzalez, Julio A.; Xu, Xiaojiang

    2015-01-01

    Introduction A significant number of healthcare workers have responded to aid in the relief and containment of the 2013 Ebola virus disease (EVD) outbreak in West Africa. Healthcare workers are required to wear personal protective clothing (PPC) to impede the transmission of the virus; however, the impermeable design and the hot humid environment lead to risk of heat stress. Objective Provide healthcare workers quantitative modeling and analysis to aid in the prevention of heat stress while wearing PPC in West Africa. Methods A sweating thermal manikin was used to measure the thermal (Rct) and evaporative resistance (Ret) of the five currently used levels of PPC for healthcare workers in the West Africa EVD response. Mathematical methods of predicting the rise in core body temperature (Tc) in response to clothing, activity, and environment was used to simulate different responses to PPC levels, individual body sizes, and two hot humid conditions: morning/evening (air temperature: 25°C, relative humidity: 40%, mean radiant temperature: 35°C, wind velocity: 1 m/s) and mid-day (30°C, 60%, 70°C, 1 m/s). Results Nearly still air (0.4 m/s) measures of Rct ranged from 0.18 to 0.26 m2 K/W and Ret ranged from 25.53 to 340.26 m2 Pa/W. Conclusion Biophysical assessments and modeling in this study provide quantitative guidance for prevention of heat stress of healthcare workers wearing PPC responding to the EVD outbreak in West Africa. PMID:26575389

  5. Ebola Response: Modeling the Risk of Heat Stress from Personal Protective Clothing.

    PubMed

    Potter, Adam W; Gonzalez, Julio A; Xu, Xiaojiang

    2015-01-01

    A significant number of healthcare workers have responded to aid in the relief and containment of the 2013 Ebola virus disease (EVD) outbreak in West Africa. Healthcare workers are required to wear personal protective clothing (PPC) to impede the transmission of the virus; however, the impermeable design and the hot humid environment lead to risk of heat stress. Provide healthcare workers quantitative modeling and analysis to aid in the prevention of heat stress while wearing PPC in West Africa. A sweating thermal manikin was used to measure the thermal (Rct) and evaporative resistance (Ret) of the five currently used levels of PPC for healthcare workers in the West Africa EVD response. Mathematical methods of predicting the rise in core body temperature (Tc) in response to clothing, activity, and environment was used to simulate different responses to PPC levels, individual body sizes, and two hot humid conditions: morning/evening (air temperature: 25°C, relative humidity: 40%, mean radiant temperature: 35°C, wind velocity: 1 m/s) and mid-day (30°C, 60%, 70°C, 1 m/s). Nearly still air (0.4 m/s) measures of Rct ranged from 0.18 to 0.26 m2 K/W and Ret ranged from 25.53 to 340.26 m2 Pa/W. Biophysical assessments and modeling in this study provide quantitative guidance for prevention of heat stress of healthcare workers wearing PPC responding to the EVD outbreak in West Africa.

  6. Expression of Heat Shock and Other Stress Response Proteins in Ticks and Cultured Tick Cells in Response to Anaplasma spp. Infection and Heat Shock

    PubMed Central

    Villar, Margarita; Ayllón, Nieves; Busby, Ann T.; Galindo, Ruth C.; Blouin, Edmour F.; Kocan, Katherine M.; Bonzón-Kulichenko, Elena; Zivkovic, Zorica; Almazán, Consuelo; Torina, Alessandra; Vázquez, Jesús; de la Fuente, José

    2010-01-01

    Ticks are ectoparasites of animals and humans that serve as vectors of Anaplasma and other pathogens that affect humans and animals worldwide. Ticks and the pathogens that they transmit have coevolved molecular interactions involving genetic traits of both the tick and the pathogen that mediate their development and survival. In this paper, the expression of heat shock proteins (HSPs) and other stress response proteins (SRPs) was characterized in ticks and cultured tick cells by proteomics and transcriptomics analyses in response to Anaplasma spp. infection and heat shock. The results of these studies demonstrated that the stress response was activated in ticks and cultured tick cells after Anaplasma spp. infection and heat shock. However, in the natural vector-pathogen relationship, HSPs and other SRPs were not strongly activated, which likely resulted from tick-pathogen coevolution. These results also demonstrated pathogen- and tick-specific differences in the expression of HSPs and other SRPs in ticks and cultured tick cells infected with Anaplasma spp. and suggested the existence of post-transcriptional mechanisms induced by Anaplasma spp. to control tick response to infection. These results illustrated the complexity of the stress response in ticks and suggested a function for the HSPs and other SRPs during Anaplasma spp. infection. PMID:22084679

  7. The hypophagic response to heat stress is not mediated by GPR109A or peripheral β-OH butyrate.

    PubMed

    Hepler, Chelsea; Foy, Caroline E; Higgins, Mark R; Renquist, Benjamin J

    2016-05-15

    Rising temperatures resulting from climate change will increase the incidence of heat stress, negatively impacting the labor force and food animal production. Heat stress elevates circulating β-OH butyrate, which induces vasodilation through GPR109a. Interestingly, both heat stress and intraperitoneal β-OH butyrate administration induce hypophagia. Thus, we aimed to investigate the role of β-OH butyrate in heat stress hypophagia in mice. We found that niacin, a β-OH butyrate mimetic that cannot be oxidized to generate ATP, also reduces food intake. Interestingly, the depression in food intake as a result of 8-h intraperitoneal niacin or 48-h heat exposure did not result from changes in hypothalamic expression of orexigenic or anorexigenic signals (AgRP, NPY, or POMC). Genetically eliminating GPR109a expression did not prevent the hypophagic response to heat exposure, intraperitoneal β-OH butyrate (5.7 mmol/kg), or niacin (0.8 mmol/kg). Hepatic vagotomy eliminated the hypophagic response to β-OH butyrate and niacin but did not affect the hypophagic response to heat exposure. We subsequently hypothesized that the hypophagic response to heat stress may depend on direct effects of β-OH butyrate at the central nervous system: β-OH butyrate induced hormonal changes (hyperinsulinemia, hypercorticosteronemia, and hyperleptinemia), or gene expression changes. To test these possibilities, we blocked expression of hepatic hydroxyl methyl glutaryl CoA synthase II (HMGCS2) to prevent hepatic β-OH butyrate synthesis. Mice that lack HMGCS2 maintain a hypophagic response to heat stress. Herein, we establish that the hypophagia of heat stress is independent of GPR109a, the hepatic vagus afferent nerve, and hepatic ketone body synthesis. Copyright © 2016 the American Physiological Society.

  8. Heat stress in pregnant sows: Thermal responses and subsequent performance of sows and their offspring.

    PubMed

    Lucy, Matthew C; Safranski, Timothy J

    2017-09-01

    Seasonal infertility is a significant problem in the swine industry, and may be influenced by photoperiod and heat stress. Heat stress during gestation in particular affects pregnancy, resulting in long-term developmental damage to the offspring. This review summarizes what is known about how heat stress on the pregnant sow affects lactation and her offspring. Sows responded to heat stress during gestation with increased rectal temperature, respiration rate, and skin temperature, and tended to reduce their activity-which may have changed their body composition, increasing the adipose-to-muscle ratio. Heat stress during gestation caused temporary insulin resistance during lactation, but this metabolic state did not seem to affect health, lactation, or rebreeding performance of the sow. Heat-stressed sows also presented with a shorter gestation period and reduced litter birth weight, although weaning weights are not affected when these sows are moved to thermoneutral conditions for lactation. The offspring of gestational heat-stressed sows, however, possessed unique phenotypes, including elevated body temperature, greater fat deposition, and impaired gonad development. Thus, gestational heat stress may significantly impact a herd through its effects on sows and their offspring. Further work is necessary to determine the magnitude of the effects across fa cilities and breeds. © 2017 Wiley Periodicals, Inc.

  9. Vascular heat shock protein expression in response to stress. Endocrine and autonomic regulation of this age-dependent response.

    PubMed Central

    Udelsman, R; Blake, M J; Stagg, C A; Li, D G; Putney, D J; Holbrook, N J

    1993-01-01

    Adaptation to stress requires coordinated interactions between the vascular and endocrine systems. Previously we demonstrated that restraint stress induces the expression of the major heat shock protein, HSP70, in the adrenal cortex of the rat. Here we demonstrate that restraint also induces expression of HSP70 in the vasculature. We further demonstrate that the adrenal and vascular responses are differentially regulated: the adrenal response is adrenocorticotropin dependent, whereas the vascular response is under adrenergic control. In addition, the adrenal response is restricted to members of the HSP70 gene family, whereas in vascular tissue the low molecular weight HSP, HSP27, is also induced by restraint. Further characterization of the vascular response revealed that HSP70 induction occurred in both the thoracic and abdominal aortas as well as in the vena cava. However, no HSP70 induction was apparent in the heart or in a wide variety of other tissues examined. In situ hybridization showed that the vascular expression was localized to the aortic smooth muscle cells with minimal expression in the endothelium. Induction of HSP70 mRNA in both the adrenal cortex and aorta was followed by an elevation in HSP70 protein. Maximum HSP70 protein levels were seen within 3-12 h after restraint, but declined thereafter. Stress induced HSP70 expression was dramatically reduced with age, which may explain, in part, the diminished tolerance to stress seen in elderly individuals. Images PMID:8094399

  10. Effect of heat stress on production parameters and immune responses of commercial laying hens.

    PubMed

    Mashaly, M M; Hendricks, G L; Kalama, M A; Gehad, A E; Abbas, A O; Patterson, P H

    2004-06-01

    The present study was conducted to determine the adverse effects of high temperature and humidity not only on live performance and egg quality but also on immune function in commercial laying hens. One hundred eighty 31-wk-old laying hens at peak production were used in this study. Hens were housed in cages (15 cages of 4 birds/cage) in each of 3 environmental chambers and received 1 of 3 treatments. The 3 treatments were control (average temperature and relative humidity), cyclic (daily cyclic temperature and humidity), and heat stress (constant heat and humidity) for 5 wk. Different production and immune parameters were measured. Body weight and feed consumption were significantly reduced in hens in the heat stress group. Egg production, egg weight, shell weight, shell thickness, and specific gravity were significantly inhibited among hens in the heat stress group. Likewise, total white blood cell (WBC) counts and antibody production were significantly inhibited in hens in the heat stress group. In addition, mortality was higher in the heat stress group compared to the cyclic and control groups. Even though T- and B-lymphocyte activities were not significantly affected by any of the treatments, lymphocytes from hens in the heat stress group had the least activity at 1 wk following treatment. These results indicate that heat stress not only adversely affects production performance but also inhibits immune function.

  11. Heat shock (stress response) proteins and renal ischemia/reperfusion injury.

    PubMed

    Kelly, Katherine J

    2005-01-01

    Acute renal failure occurs frequently, may be increasing, carries an unacceptably high mortality, yet there is no specific treatment. The induction of stress response (heat shock) proteins (HSPs) is a highly conserved response that protects many cell types from diverse physiological and environmental stressors. HSP families of different sizes function as molecular chaperones that facilitate the folding of enzymes and other proteins into functional conformations. After injury, HSPs are believed to facilitate the restoration of normal function by assisting in the refolding of denatured proteins and degradation of irreparably damaged proteins and toxic metabolites, limitation of aggregation of damaged peptides and aiding appropriate folding of newly synthesized essential polypeptides. HSPs may also regulate apoptosis and immune functions. We have demonstrated protection from the functional deficits and histological evidence of experimental ischemic renal injury with heat stress 6 but not 48 h prior to ischemia. Limitation of the induction of HSPs (either with a short period of hyperthermia or pharmacologically) attenuated the protection observed. Other investigators have demonstrated a correlation between the levels of HSP25 and renal ischemic preconditioning in the mouse. Several pharmacological agents have been shown to increase HSP expression. Enhancement of these endogenous protective mechanisms has potential benefit in human disease.

  12. Heat stress mortality and desired adaptation responses of healthcare system in Poland

    NASA Astrophysics Data System (ADS)

    Błażejczyk, Anna; Błażejczyk, Krzysztof; Baranowski, Jarosław; Kuchcik, Magdalena

    2017-09-01

    Heat stress is one of the environmental factors influencing the health of individuals and the wider population. There is a large body of research to document significant increases in mortality and morbidity during heat waves all over the world. This paper presents key results of research dealing with heat-related mortality (HRM) in various cities in Poland which cover about 25% of the country's population. Daily mortality and weather data reports for the years 1991-2000 were used. The intensity of heat stress was assessed by the universal thermal climate index (UTCI). The research considers also the projections of future bioclimate to the end of twenty-first century. Brain storming discussions were applied to find necessary adaptation strategies of healthcare system (HCS) in Poland, to minimise negative effects of heat stress. In general, in days with strong and very strong heat stress, ones must expect increase in mortality (in relation to no thermal stress days) of 12 and 47%, respectively. Because of projected rise in global temperature and heat stress frequency, we must expect significant increase in HRM to the end of twenty-first century of even 165% in comparison to present days. The results of research show necessity of urgent implementation of adaptation strategies to heat in HCS.

  13. Heat stress mortality and desired adaptation responses of healthcare system in Poland.

    PubMed

    Błażejczyk, Anna; Błażejczyk, Krzysztof; Baranowski, Jarosław; Kuchcik, Magdalena

    2017-09-01

    Heat stress is one of the environmental factors influencing the health of individuals and the wider population. There is a large body of research to document significant increases in mortality and morbidity during heat waves all over the world. This paper presents key results of research dealing with heat-related mortality (HRM) in various cities in Poland which cover about 25% of the country's population. Daily mortality and weather data reports for the years 1991-2000 were used. The intensity of heat stress was assessed by the universal thermal climate index (UTCI). The research considers also the projections of future bioclimate to the end of twenty-first century. Brain storming discussions were applied to find necessary adaptation strategies of healthcare system (HCS) in Poland, to minimise negative effects of heat stress. In general, in days with strong and very strong heat stress, ones must expect increase in mortality (in relation to no thermal stress days) of 12 and 47%, respectively. Because of projected rise in global temperature and heat stress frequency, we must expect significant increase in HRM to the end of twenty-first century of even 165% in comparison to present days. The results of research show necessity of urgent implementation of adaptation strategies to heat in HCS.

  14. Characterization of physiological response and identification of associated genes under heat stress in rice seedlings.

    PubMed

    Xue, Da-Wei; Jiang, Hua; Hu, Jiang; Zhang, Xiao-Qin; Guo, Long-Biao; Zeng, Da-Li; Dong, Guo-Jun; Sun, Guo-Chang; Qian, Qian

    2012-12-01

    Global warming, which is caused by greenhouse gas emissions, makes food crops more vulnerable to heat stress. Understanding the heat stress-related mechanisms in crops and classifying heat stress-related genes can increase our knowledge in heat-resistant molecular biology and propel developments in molecular design breeding, which can help rice cope with unfavorable temperatures. In this study, we carried out a physiological analysis of rice plants after heat stress. The results show a dramatic increase in malondialdehyde contents and SOD activities. We successfully isolated 11 heat-related rice genes with known function annotation through DNSH, which is an improved SSH method for screening long cDNA fragments. The reanalysis of microarray data from public database revealed that all these genes displayed various expression patterns after heat stress, drought, cold and salt. Quantitative real-time reverse transcription PCR was also performed to validate the expression of these genes after heat stress. The expressions in 10 genes were all significantly changed except for contig 77, which is a CBL-interacting protein kinase. Several reports have been published about the members of the same gene family. Copyright © 2012. Published by Elsevier Masson SAS.

  15. Physiological and Metabolic Changes of Purslane (Portulaca oleracea L.) in Response to Drought, Heat, and Combined Stresses

    PubMed Central

    Jin, Rui; Wang, Yanping; Liu, Ruijie; Gou, Junbo; Chan, Zhulong

    2016-01-01

    Purslane (Portulaca oleracea L.) is a fleshy herbaceous plant. So far, little information is available on the response of this plant to combined drought and heat stress. In this study, changes in physiological and metabolic levels were characterized after treatments with drought, heat and combined stresses. Both individual and combined stress treatments increased malondialdehyde (MDA), electrolyte leakage (EL), O2•− and activities of superoxide dismutase (SOD), peroxidase (POD), while declined chlorophyll content. No significant differences were found between control and treatments in leaf water content (LWC) and catalase (CAT) activity. Additionally, 37 metabolic compounds were detected in purslane. Through pathway analysis, 17 metabolites were directly involved in the glycolysis metabolic pathway. The present study indicated that combined drought and heat stress caused more serious damage in purslane than individual stress. To survive, purslane has a high capability to cope with environmental stress conditions through activation of physiological and metabolic pathways. PMID:26779204

  16. Proteomic changes of the porcine small intestine in response to chronic heat stress.

    PubMed

    Cui, Yanjun; Gu, Xianhong

    2015-12-01

    Acute heat stress (HS) negatively affects intestinal integrity and barrier function. In contrast, chronic mild HS poses a distinct challenge to animals. Therefore, this study integrates biochemical, histological and proteomic approaches to investigate the effects of chronic HS on the intestine in finishing pigs. Castrated male crossbreeds (79.00 ± 1.50 kg BW) were subjected to either thermal neutral (TN, 21 °C; 55% ± 5% humidity; n=8) or HS conditions (30 °C; 55% ± 5% humidity; n=8) for 3 weeks. The pigs were sacrificed after 3 weeks of high environmental exposure and the plasma hormones, the intestinal morphology, integrity, and protein profiles of the jejunum mucosa were determined. Chronic HS reduced the free triiodothyronine (FT3) and GH levels. HS damaged intestinal morphology, increased plasma d-lactate concentrations and decreased alkaline phosphatase activity of intestinal mucosa. Proteome analysis of the jejunum mucosa was conducted by 2D gel electrophoresis and mass spectrometry. Fifty-three intestinal proteins were found to be differentially abundant, 18 of which were related to cell structure and motility, and their changes in abundance could comprise intestinal integrity and function. The down-regulation of proteins involved in tricarboxylic acid cycle (TCA cycle), electron transport chain (ETC), and oxidative phosphorylation suggested that chronic HS impaired energy metabolism and thus induced oxidative stress. Moreover, the changes of ten proteins in abundance related to stress response and defense indicated pigs mediated long-term heat exposure and counteracted its negative effects of heat exposure. These findings have important implications for understanding the effect of chronic HS on intestines.

  17. Cognitive and perceptual responses during passive heat stress in younger and older adults

    PubMed Central

    Schlader, Zachary J.; Gagnon, Daniel; Adams, Amy; Rivas, Eric; Cullum, C. Munro

    2015-01-01

    We tested the hypothesis that attention, memory, and executive function are impaired to a greater extent in passively heat-stressed older adults than in passively heat-stressed younger adults. In a randomized, crossover design, 15 older (age: 69 ± 5 yr) and 14 younger (age: 30 ± 4 yr) healthy subjects underwent passive heat stress and time control trials. Cognitive tests (outcomes: accuracy and reaction time) from the CANTAB battery evaluated attention [rapid visual processing (RVP), choice reaction time (CRT)], memory [spatial span (SSP), pattern recognition memory (PRM)], and executive function [one touch stockings of Cambridge (OTS)]. Testing was undertaken on two occasions during each trial, at baseline and after internal temperature had increased by 1.0 ± 0.2°C or after a time control period. For tests that measured attention, reaction time during RVP and CRT was slower (P ≤ 0.01) in the older group. During heat stress, RVP reaction time improved (P < 0.01) in both groups. Heat stress had no effect (P ≥ 0.09) on RVP or CRT accuracy in either group. For tests that measured memory, accuracy on SSP and PRM was lower (P < 0.01) in the older group, but there was no effect of heat stress (P ≥ 0.14). For tests that measured executive function, overall, accuracy on OTS was lower, and reaction time was slower in the older group (P ≤ 0.05). Reaction time generally improved during heat stress, but there was no effect of heat stress on accuracy in either group. These data indicate that moderate increases in body temperature during passive heat stress do not differentially compromise cognitive function in younger and older adults. PMID:25786484

  18. Cognitive and perceptual responses during passive heat stress in younger and older adults.

    PubMed

    Schlader, Zachary J; Gagnon, Daniel; Adams, Amy; Rivas, Eric; Cullum, C Munro; Crandall, Craig G

    2015-05-15

    We tested the hypothesis that attention, memory, and executive function are impaired to a greater extent in passively heat-stressed older adults than in passively heat-stressed younger adults. In a randomized, crossover design, 15 older (age: 69 ± 5 yr) and 14 younger (age: 30 ± 4 yr) healthy subjects underwent passive heat stress and time control trials. Cognitive tests (outcomes: accuracy and reaction time) from the CANTAB battery evaluated attention [rapid visual processing (RVP), choice reaction time (CRT)], memory [spatial span (SSP), pattern recognition memory (PRM)], and executive function [one touch stockings of Cambridge (OTS)]. Testing was undertaken on two occasions during each trial, at baseline and after internal temperature had increased by 1.0 ± 0.2°C or after a time control period. For tests that measured attention, reaction time during RVP and CRT was slower (P ≤ 0.01) in the older group. During heat stress, RVP reaction time improved (P < 0.01) in both groups. Heat stress had no effect (P ≥ 0.09) on RVP or CRT accuracy in either group. For tests that measured memory, accuracy on SSP and PRM was lower (P < 0.01) in the older group, but there was no effect of heat stress (P ≥ 0.14). For tests that measured executive function, overall, accuracy on OTS was lower, and reaction time was slower in the older group (P ≤ 0.05). Reaction time generally improved during heat stress, but there was no effect of heat stress on accuracy in either group. These data indicate that moderate increases in body temperature during passive heat stress do not differentially compromise cognitive function in younger and older adults. Copyright © 2015 the American Physiological Society.

  19. Metabolic responses and "omics" technologies for elucidating the effects of heat stress in dairy cows

    NASA Astrophysics Data System (ADS)

    Min, Li; Zhao, Shengguo; Tian, He; Zhou, Xu; Zhang, Yangdong; Li, Songli; Yang, Hongjian; Zheng, Nan; Wang, Jiaqi

    2016-11-01

    Heat stress (HS) negatively affects various industries that rely on animal husbandry, particularly the dairy industry. A better understanding of metabolic responses in HS dairy cows is necessary to elucidate the physiological mechanisms of HS and offer a new perspective for future research. In this paper, we review the current knowledge of responses of body metabolism (lipid, carbohydrate, and protein), endocrine profiles, and bovine mammary epithelial cells during HS. Furthermore, we summarize the metabolomics and proteomics data that have revealed the metabolite profiles and differentially expressed proteins that are a feature of HS in dairy cows. Analysis of metabolic changes and "omics" data demonstrated that HS is characterized by reduced lipolysis, increased glycolysis, and catabolism of amino acids in dairy cows. Here, analysis of the impairment of immune function during HS and of the inflammation that arises after long-term HS might suggest new strategies to ameliorate the effects of HS in dairy production.

  20. Transgenic sickle cell trait mice do not exhibit abnormal thermoregulatory and stress responses to heat shock exposure.

    PubMed

    Chen, Yifan; Islam, Aminul

    2016-07-01

    There remains controversy over whether individuals with sickle cell trait (SCT) are vulnerable to health risks during physical activity in high temperatures. We examined thermoregulatory and stress-related responses to heat exposure in SCT and wild-type (WT) mice. No significant differences in core temperature (Tc) were observed between SCT and WT mice during heat exposure. There was no correlation between peak Tc during heat exposure and levels of hemoglobin S in SCT mice. Basal levels of circulating inflammatory and stress-related markers were not significantly different between SCT and WT mice. Although heat exposure caused significant increases in plasma interleukins 1β and 6, and 8-isoprostane in SCT and WT mice, no differences were found between SCT and WT mice with similar thermal response profiles during heat exposure. SCT mice had significantly higher expression of heat shock protein 72 in heart, liver and gastrocnemius muscle than WT mice under control and post-heat conditions. In conclusion, there is neither thermoregulatory dysfunction nor abnormal stress-related response in SCT mice exposed to moderate heat. The hemoglobin variant in mice is associated with altered tissue stress protein homeostasis.

  1. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq.

    PubMed

    Wang, Zhang-Xun; Zhou, Xia-Zhi; Meng, Hui-Min; Liu, Yu-Jun; Zhou, Quan; Huang, Bo

    2014-06-01

    The entomopathogenic fungus Metarhizium anisopliae is widely used for biological control of a variety of insect pests. The effectiveness of the microbial pest control agent, however, is limited by poor thermotolerance. The molecular mechanism underlying the response to heat stress in the conidia of entomopathogenic fungi remains unclear. Here, we conducted high-throughput RNA-Seq to analyze the differential gene expression between control and heat treated conidia of M. anisopliae at the transcriptome level. RNA-Seq analysis generated 6,284,262 and 5,826,934 clean reads in the control and heat treated groups, respectively. A total of 2,722 up-regulated and 788 down-regulated genes, with a cutoff of twofold change, were identified by expression analysis. Among these differentially expressed genes, many were related to metabolic processes, biological regulation, cellular processes and response to stimuli. The majority of genes involved in endocytic pathways, proteosome pathways and regulation of autophagy were up-regulated, while most genes involved in the ribosome pathway were down-regulated. These results suggest that these differentially expressed genes may be involved in the heat stress response in conidia. As expected, significant changes in expression levels of genes encoding heat shock proteins and proteins involved in trehalose accumulation were observed in conditions of heat stress. These results expand our understanding of the molecular mechanisms of the heat stress response of conidia and provide a foundation for future investigations.

  2. Effect of cooling heat-stressed dairy cows during the dry period on insulin response.

    PubMed

    Tao, S; Thompson, I M; Monteiro, A P A; Hayen, M J; Young, L J; Dahl, G E

    2012-09-01

    affect the insulin responses to GTT and IC during the transition period and glucose responses to GTT and IC at -14 and 28 DRC were not affected by treatments. At 7 DRC, CL cows tended to have slower glucose clearance to GTT and weaker glucose response to IC relative to HT cows. Cows from the cooling treatment had stronger nonesterified fatty acid responses to IC postpartum but not prepartum compared with HT. In conclusion, cooling heat-stressed dairy cows in the dry period reduced insulin effects on peripheral tissues in early lactation but not in the dry period.

  3. Differences in response to heat stress due to production level and breed of dairy cows.

    PubMed

    Gantner, Vesna; Bobic, Tina; Gantner, Ranko; Gregic, Maja; Kuterovac, Kresimir; Novakovic, Jurica; Potocnik, Klemen

    2017-05-06

    The climatic conditions in Croatia are deteriorating which significantly increases the frequency of heat stress. This creates a need for an adequate dairy farming strategy. The impact of heat stress can be reduced in many ways, but the best long-term solution includes the genetic evaluation and selection for heat stress resistance. In order to create the basis for genetic evaluation, this research determined the variation in daily milk yield (DMY) and somatic cell count (SCC) as well as the differences in resistance to heat stress due to production level (high, low) and breed (Holstein, Simmental) of dairy cattle breed in Croatia. For statistical analysis, 1,070,554 test-day records from 70,135 Holsteins reared on 5679 farms and 1,300,683 test-day records from 86,013 Simmentals reared on 8827 farms in Croatia provided by the Croatian Agricultural Agency were used. The results of this research indicate that the high-producing cows are much more susceptible to heat stress than low-producing especially Holsteins. Also, the results of this research indicate that Simmental breed, in terms of daily milk production and somatic cell count, could be more resistant to heat stress than Holstein. The following research should determine whether Simmentals are genetically more appropriate for the challenges that are in store for the future milk production in this region. Furthermore, could an adequate production level be achieved with Simmentals by maintaining the heat resistance?

  4. Differences in response to heat stress due to production level and breed of dairy cows

    NASA Astrophysics Data System (ADS)

    Gantner, Vesna; Bobic, Tina; Gantner, Ranko; Gregic, Maja; Kuterovac, Kresimir; Novakovic, Jurica; Potocnik, Klemen

    2017-05-01

    The climatic conditions in Croatia are deteriorating which significantly increases the frequency of heat stress. This creates a need for an adequate dairy farming strategy. The impact of heat stress can be reduced in many ways, but the best long-term solution includes the genetic evaluation and selection for heat stress resistance. In order to create the basis for genetic evaluation, this research determined the variation in daily milk yield (DMY) and somatic cell count (SCC) as well as the differences in resistance to heat stress due to production level (high, low) and breed (Holstein, Simmental) of dairy cattle breed in Croatia. For statistical analysis, 1,070,554 test-day records from 70,135 Holsteins reared on 5679 farms and 1,300,683 test-day records from 86,013 Simmentals reared on 8827 farms in Croatia provided by the Croatian Agricultural Agency were used. The results of this research indicate that the high-producing cows are much more susceptible to heat stress than low-producing especially Holsteins. Also, the results of this research indicate that Simmental breed, in terms of daily milk production and somatic cell count, could be more resistant to heat stress than Holstein. The following research should determine whether Simmentals are genetically more appropriate for the challenges that are in store for the future milk production in this region. Furthermore, could an adequate production level be achieved with Simmentals by maintaining the heat resistance?

  5. Heat Stress Monitor

    NASA Technical Reports Server (NTRS)

    1994-01-01

    The heavy, cumbersome body protection suits worn by members of hazardous materials response teams cause marked elevation of body temperatures, which can reduce effectiveness and lead to heat stress and injury. The CorTemp System, marketed by Human Technologies, Inc., provides the basis for a body temperature monitoring alarm system. Encased in a three-quarter-inch ingestible capsule, the system includes a mini-thermometer, miniature telemetry system, a microbattery and temperature sensor. It makes its way through the digestive system, continuously monitoring temperature. Findings are sent to the recorder by telemetry, and then displayed and stored for transfer to a computer.

  6. Differential proteomic analysis of grapevine leaves by iTRAQ reveals responses to heat stress and subsequent recovery

    PubMed Central

    2014-01-01

    Background High temperature is a major environmental factor limiting grape yield and affecting berry quality. Thermotolerance includes the direct response to heat stress and the ability to recover from heat stress. To better understand the mechanism of the thermotolerance of Vitis, we combined a physiological analysis with iTRAQ-based proteomics of Vitis vinifera cv Cabernet Sauvignon, subjected to 43°C for 6 h, and then followed by recovery at 25/18°C. Results High temperature increased the concentrations of TBARS and inhibited electronic transport in photosynthesis apparatus, indicating that grape leaves were damaged by heat stress. However, these physiological changes rapidly returned to control levels during the subsequent recovery phase from heat stress. One hundred and seventy-four proteins were differentially expressed under heat stress and/or during the recovery phase, in comparison to unstressed controls, respectively. Stress and recovery conditions shared 42 proteins, while 113 and 103 proteins were respectively identified under heat stress and recovery conditions alone. Based on MapMan ontology, functional categories for these dysregulated proteins included mainly photosynthesis (about 20%), proteins (13%), and stress (8%). The subcellular localization using TargetP showed most proteins were located in the chloroplasts (34%), secretory pathways (8%) and mitochondrion (3%). Conclusion On the basis of these findings, we proposed that some proteins related to electron transport chain of photosynthesis, antioxidant enzymes, HSPs and other stress response proteins, and glycolysis may play key roles in enhancing grapevine adaptation to and recovery capacity from heat stress. These results provide a better understanding of the proteins involved in, and mechanisms of thermotolerance in grapevines. PMID:24774513

  7. The response of Bacillus licheniformis to heat and ethanol stress and the role of the SigB regulon.

    PubMed

    Voigt, Birgit; Schroeter, Rebecca; Jürgen, Britta; Albrecht, Dirk; Evers, Stefan; Bongaerts, Johannes; Maurer, Karl-Heinz; Schweder, Thomas; Hecker, Michael

    2013-07-01

    The heat and ethanol stress response of Bacillus licheniformis DSM13 was analyzed at the transcriptional and/or translational level. During heat shock, regulons known to be heat-induced in Bacillus subtilis 168 are upregulated in B. licheniformis, such as the HrcA, SigB, CtsR, and CssRS regulon. Upregulation of the SigY regulon and of genes controlled by other extracytoplasmic function (ECF) sigma factors indicates a cell-wall stress triggered by the heat shock. Furthermore, tryptophan synthesis enzymes were upregulated in heat stressed cells as well as regulons involved in usage of alternative carbon and nitrogen sources. Ethanol stress led to an induction of the SigB, HrcA, and CtsR regulons. As indicated by the upregulation of a SigM-dependent protein, ethanol also triggered a cell wall stress. To characterize the SigB regulon of B. licheniformis, we analyzed the heat stress response of a sigB mutant. It is shown that the B. licheniformis SigB regulon comprises additional genes, some of which do not exist in B. subtilis, such as BLi03885, encoding a hypothetical protein, the Na/solute symporter gene BLi02212, the arginase homolog-encoding gene BLi00198 and mcrA, encoding a protein with endonuclease activity.

  8. Stress-adaptive responses by heat under the microscope of predictive microbiology.

    PubMed

    Valdramidis, V P; Geeraerd, A H; Van Impe, J F

    2007-11-01

    In previous studies the microbial kinetics of Escherichia coli K12 have been evaluated under static and dynamic conditions (Valdramidis et al. 2005, 2006). An acquired microbial thermotolerance following heating rates lower than 0.82 degrees C min(-1) for the studied micro-organism was observed. Quantification of this induced physiological phenomenon and incorporation, as a model building block, in a general microbial inactivation model is the main outcome of this work. The microbial inactivation rate observed (k(obs)) under time-varying temperature conditions is studied and expressed as a function of the heating rate (dT/ dt). Hereto, a model building block related to the microbial physiology (k(phys)) under stress conditions is developed. Evaluation of the performance of the developed mathematical approach depicts that physiological adaptation is an essential issue to be considered when modelling microbial inactivation. Consideration, at a mathematical level, of microbial responses resulting in physiological adaptations contribute to the reliable quantification of the safety risks during food processing. By taking into account the physiological adaptation, the microbiological evolution during heat processing can be accurately assessed, and overly conservative or fail dangerous food processing designs can be avoided.

  9. Antioxidant responses to heat and light stress differ with habitat in a common reef coral

    NASA Astrophysics Data System (ADS)

    Hawkins, Thomas D.; Krueger, Thomas; Wilkinson, Shaun P.; Fisher, Paul L.; Davy, Simon K.

    2015-12-01

    Coral bleaching—the stress-induced collapse of the coral- Symbiodinium symbiosis—is a significant driver of worldwide coral reef degradation. Yet, not all corals are equally susceptible to bleaching, and we lack a clear understanding of the mechanisms underpinning their differential susceptibilities. Here, we focus on cellular redox regulation as a potential determinant of bleaching susceptibility in the reef coral Stylophora pistillata. Using slow heating (1 °C d-1) and altered irradiance, we induced bleaching in S. pistillata colonies sampled from two depths [5-8 m (shallow) and 15-18 m (deep)]. There was significant depth-dependent variability in the timing and extent of bleaching (loss of symbiont cells), as well as in host enzymatic antioxidant activity [specifically, superoxide dismutase and catalase (CAT)]. However, among the coral fragments that bleached, most did so without displaying any evidence of a host enzymatic antioxidant response. For example, both deep and shallow corals suffered significant symbiont loss at elevated temperature, but only deep colonies exposed to high temperature and high light displayed any up-regulation of host antioxidant enzyme activity (CAT). Surprisingly, this preceded the equivalent antioxidant responses of the symbiont, which raises questions about the source(s) of hydrogen peroxide in the symbiosis. Overall, changes in enzymatic antioxidant activity in the symbionts were driven primarily by irradiance rather than temperature, and responses were similar across depth groups. Taken together, our results suggest that in the absence of light stress, heating of 1 °C d-1 to 4 °C above ambient is not sufficient to induce a substantial oxidative challenge in S. pistillata. We provide some of the first evidence that regulation of coral enzymatic antioxidants can vary significantly depending on habitat, and, in terms of determining bleaching susceptibility, our results suggest a significant role for the host's differential

  10. Diverse set of microRNAs are responsive to powdery mildew infection and heat stress in wheat (Triticum aestivum L.)

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs) are a class of small non-coding regulatory RNAs that regulate gene expression by guiding target mRNA cleavage or translational inhibition. MiRNAs can have large-scale regulatory effects on development and stress response in plants. Results To test whether miRNAs play roles in regulating response to powdery mildew infection and heat stress in wheat, by using Solexa high-throughput sequencing we cloned the small RNA from wheat leaves infected by preponderant physiological strain Erysiphe graminis f. sp. tritici (Egt) or by heat stress treatment. A total of 153 miRNAs were identified, which belong to 51 known and 81 novel miRNA families. We found that 24 and 12 miRNAs were responsive to powdery mildew infection and heat stress, respectively. We further predicted that 149 target genes were potentially regulated by the novel wheat miRNA. Conclusions Our results indicated that diverse set of wheat miRNAs were responsive to powdery mildew infection and heat stress and could function in wheat responses to both biotic and abiotic stresses. PMID:20573268

  11. Deteriorated Stress Response in Stationary-Phase Yeast: Sir2 and Yap1 Are Essential for Hsf1 Activation by Heat Shock and Oxidative Stress, Respectively

    PubMed Central

    Cohen, Aviv; Bar-Nun, Shoshana

    2014-01-01

    Stationary-phase cultures have been used as an important model of aging, a complex process involving multiple pathways and signaling networks. However, the molecular processes underlying stress response of non-dividing cells are poorly understood, although deteriorated stress response is one of the hallmarks of aging. The budding yeast Saccharomyces cerevisiae is a valuable model organism to study the genetics of aging, because yeast ages within days and are amenable to genetic manipulations. As a unicellular organism, yeast has evolved robust systems to respond to environmental challenges. This response is orchestrated largely by the conserved transcription factor Hsf1, which in S. cerevisiae regulates expression of multiple genes in response to diverse stresses. Here we demonstrate that Hsf1 response to heat shock and oxidative stress deteriorates during yeast transition from exponential growth to stationary-phase, whereas Hsf1 activation by glucose starvation is maintained. Overexpressing Hsf1 does not significantly improve heat shock response, indicating that Hsf1 dwindling is not the major cause for Hsf1 attenuated response in stationary-phase yeast. Rather, factors that participate in Hsf1 activation appear to be compromised. We uncover two factors, Yap1 and Sir2, which discretely function in Hsf1 activation by oxidative stress and heat shock. In Δyap1 mutant, Hsf1 does not respond to oxidative stress, while in Δsir2 mutant, Hsf1 does not respond to heat shock. Moreover, excess Sir2 mimics the heat shock response. This role of the NAD+-dependent Sir2 is supported by our finding that supplementing NAD+ precursors improves Hsf1 heat shock response in stationary-phase yeast, especially when combined with expression of excess Sir2. Finally, the combination of excess Hsf1, excess Sir2 and NAD+ precursors rejuvenates the heat shock response. PMID:25356557

  12. Different Responses to Heat Shock Stress Revealed Heteromorphic Adaptation Strategy of Pyropia haitanensis (Bangiales, Rhodophyta)

    PubMed Central

    Zhu, Zhujun; Yang, Rui; Qian, Feijian; Chen, Haimin; Yan, Xiaojun

    2014-01-01

    Pyropia has a unique heteromorphic life cycle with alternation stages between thallus and conchocelis, which lives at different water temperatures in different seasons. To better understand the different adaptation strategies for temperature stress, we tried to observe comparative biochemical changes of Pyropia haitanensis based on a short term heat shock model. The results showed that: (1) At normal temperature, free-living conchocelis contains significantly higher levels of H2O2, fatty acid-derived volatiles, the copy number of Phrboh and Phhsp70 genes,the activities of NADPH oxidase and floridoside than those in thallus. The released H2O2 and NADPH oxidase activity of conchocelis were more than 7 times higher than those of thallus. The copy number of Phrboh in conchocelis was 32 times that in thallus. (2) After experiencing heat shock at 35°C for 30 min, the H2O2 contents, the mRNA levels of Phrboh and Phhsp70, NADPH oxidase activity and the floridoside content in thallus were all significantly increased. The mRNA levels of Phrboh increased 5.78 times in 5 min, NADPH oxidase activity increased 8.45 times in 20 min. (3) Whereas, in conchocelis, the changes in fatty acids and their down-stream volatiles predominated, significantly increasing levels of saturated fatty acids and decreasing levels of polyunsaturated fatty acids occurred, and the 8-carbon volatiles were accumulated. However, the changes in H2O2 content and expression of oxidant-related genes and enzymatic activity were not obvious. Overall, these results indicate that conchocelis maintains a high level of active protective apparatus to endure its survival at high temperature, while thallus exhibit typical stress responses to heat shock. It is concluded that Pyropia haitanensis has evolved a delicate strategy for temperature adaptation for its heteromorphic life cycle. PMID:24709783

  13. Different responses to heat shock stress revealed heteromorphic adaptation strategy of Pyropia haitanensis (Bangiales, Rhodophyta).

    PubMed

    Luo, Qijun; Zhu, Zhenggang; Zhu, Zhujun; Yang, Rui; Qian, Feijian; Chen, Haimin; Yan, Xiaojun

    2014-01-01

    Pyropia has a unique heteromorphic life cycle with alternation stages between thallus and conchocelis, which lives at different water temperatures in different seasons. To better understand the different adaptation strategies for temperature stress, we tried to observe comparative biochemical changes of Pyropia haitanensis based on a short term heat shock model. The results showed that: (1) At normal temperature, free-living conchocelis contains significantly higher levels of H2O2, fatty acid-derived volatiles, the copy number of Phrboh and Phhsp70 genes,the activities of NADPH oxidase and floridoside than those in thallus. The released H2O2 and NADPH oxidase activity of conchocelis were more than 7 times higher than those of thallus. The copy number of Phrboh in conchocelis was 32 times that in thallus. (2) After experiencing heat shock at 35°C for 30 min, the H2O2 contents, the mRNA levels of Phrboh and Phhsp70, NADPH oxidase activity and the floridoside content in thallus were all significantly increased. The mRNA levels of Phrboh increased 5.78 times in 5 min, NADPH oxidase activity increased 8.45 times in 20 min. (3) Whereas, in conchocelis, the changes in fatty acids and their down-stream volatiles predominated, significantly increasing levels of saturated fatty acids and decreasing levels of polyunsaturated fatty acids occurred, and the 8-carbon volatiles were accumulated. However, the changes in H2O2 content and expression of oxidant-related genes and enzymatic activity were not obvious. Overall, these results indicate that conchocelis maintains a high level of active protective apparatus to endure its survival at high temperature, while thallus exhibit typical stress responses to heat shock. It is concluded that Pyropia haitanensis has evolved a delicate strategy for temperature adaptation for its heteromorphic life cycle.

  14. Macro-level Modeling of the Response of C. elegans Reproduction to Chronic Heat Stress

    PubMed Central

    Amaral, Luis A. N.; Morimoto, Richard I.; Ruvinsky, Ilya

    2012-01-01

    A major goal of systems biology is to understand how organism-level behavior arises from a myriad of molecular interactions. Often this involves complex sets of rules describing interactions among a large number of components. As an alternative, we have developed a simple, macro-level model to describe how chronic temperature stress affects reproduction in C. elegans. Our approach uses fundamental engineering principles, together with a limited set of experimentally derived facts, and provides quantitatively accurate predictions of performance under a range of physiologically relevant conditions. We generated detailed time-resolved experimental data to evaluate the ability of our model to describe the dynamics of C. elegans reproduction. We find considerable heterogeneity in responses of individual animals to heat stress, which can be understood as modulation of a few processes and may represent a strategy for coping with the ever-changing environment. Our experimental results and model provide quantitative insight into the breakdown of a robust biological system under stress and suggest, surprisingly, that the behavior of complex biological systems may be determined by a small number of key components. PMID:22291584

  15. Differential response of Aspen and Birch trees to heat stress under elevated carbon dioxide

    Treesearch

    Joseph N.T. Darbah; Thomas D. Sharkey; Carlo Calfapietra; David F. Karnosky

    2010-01-01

    The effect of high temperature on photosynthesis of isoprene-emitting (aspen) and non-isoprene-emitting (birch) trees were measured under elevated CO2 and ambient conditions. Aspen trees tolerated heat better than birch trees and elevated CO2 protected photosynthesis of both species against moderate heat stress. Elevated CO...

  16. Environmental heat stress modulates thyroid status and its response to repeated endotoxin (LPS) challenge in steers

    USDA-ARS?s Scientific Manuscript database

    Thyroid hormones are important in the adaptation to heat stress, allowing the adjustment of metabolic rates in favor of decreased energy utilization and heat production. Thyroid status is compromised in a variety of acute and chronic infections and toxin-mediated disease states. Our objective was to...

  17. Sweat mineral element responses during 7 h of exercise-heat stress

    USDA-ARS?s Scientific Manuscript database

    Uncertainty exists regarding the effect of sustained sweating on sweat mineral element composition. This study determined the effect of multiple hours of exercise-heat stress on sweat mineral concentrations. Seven heat acclimated subjects (6 males, 1 female) completed 5 consecutive 60 min bouts of...

  18. MYB30 transcription factor regulates oxidative and heat stress responses through ANNEXIN-mediated cytosolic calcium signaling in Arabidopsis.

    PubMed

    Liao, Chancan; Zheng, Yuan; Guo, Yan

    2017-10-01

    Cytosolic calcium signaling is critical for regulating downstream responses in plants encountering unfavorable environmental conditions. In a genetic screen for Arabidopsis thaliana mutants defective in stress-induced cytosolic free Ca(2+) ([Ca(2+) ]cyt ) elevations, we identified the R2R3-MYB transcription factor MYB30 as a regulator of [Ca(2+) ]cyt in response to H2 O2 and heat stresses. Plants lacking MYB30 protein exhibited greater elevation of [Ca(2+) ]cyt in response to oxidative and heat stimuli. Real-time reverse transcription-polymerase chain reaction (RT-PCR) results indicated that the expression of a number of ANNEXIN (ANN) genes, which encode Ca(2+) -regulated membrane-binding proteins modulating cytosolic calcium signatures, were upregulated in myb30 mutants. Further analysis showed that MYB30 bound to the promoters of ANN1 and ANN4 and repressed their expression. myb30 mutants were sensitive to methyl viologen (MV) and heat stresses. The H2 O2 - and heat-induced abnormal [Ca(2+) ]cyt in myb30 was dependent on the function of ANN proteins. Moreover, the MV and heat sensitivity of myb30 was suppressed in mutants lacking ANN function or by application of LaCl3 , a calcium channel blocker. These results indicate that MYB30 regulates oxidative and heat stress responses through calcium signaling, which is at least partially mediated by ANN1 and ANN4. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  19. Three heat shock proteins from Spodoptera exigua: Gene cloning, characterization and comparative stress response during heat and cold shocks.

    PubMed

    Xu, Qi; Zou, Qi; Zheng, Huizhen; Zhang, Fan; Tang, Bin; Wang, Shigui

    2011-06-01

    To gain insight into the comparative function in stress response of HSPs in insects, three HSP cDNAs were cloned from the fat body of the beet armyworm Spodoptera exigua (Lepidoptera, Noctuidae). SexHSP70, SexHSP74 and SexHSP83 cDNAs encoding the protein of 667, 685 and 717 amino acids, with the pI of 5.52, 5.75 and 5.02, respectively. Northern blotting revealed that all three SexHSP mRNAs are expressed in the fat body, mid-gut, spermary and tracheae. SexHSP70, SexHSP74and SexHSP83 mRNAs were expressed in the fat body and whole body at different levels during different developmental stages. The three SexHSP transcripts were highly expressed in the fat body on the first day of fifth instar larvae, on the fourth and seventh days of the pupa stage, and in the whole body on the initial stages of larvae. Under heat and cold shock conditions, SexHSP70 and SexHSP83 mainly functioned during heat shock and cooling and SexHSP83 also had a function in the recovery stage. SexHSP74 had important functions in short-term heat shock and recovery, as well as long-term cooling. The results revealed that long-term shocking can affect SexHSP74 and SexHSP83 expression and long-term cooling can influence SexHSP83 expression during the recovery stage.

  20. A Positive Feedback Loop between HEAT SHOCK PROTEIN101 and HEAT STRESS-ASSOCIATED 32-KD PROTEIN Modulates Long-Term Acquired Thermotolerance Illustrating Diverse Heat Stress Responses in Rice Varieties1[W][OPEN

    PubMed Central

    Lin, Meng-yi; Chai, Kuo-hsing; Ko, Swee-suak; Kuang, Lin-yun; Lur, Huu-Sheng; Charng, Yee-yung

    2014-01-01

    Heat stress is an important factor that has a negative impact on rice (Oryza sativa) production. To alleviate this problem, it is necessary to extensively understand the genetic basis of heat tolerance and adaptability to heat stress in rice. Here, we report the molecular mechanism underlying heat acclimation memory that confers long-term acquired thermotolerance (LAT) in this monocot plant. Our results showed that a positive feedback loop formed by two heat-inducible genes, HEAT SHOCK PROTEIN101 (HSP101) and HEAT STRESS-ASSOCIATED 32-KD PROTEIN (HSA32), at the posttranscriptional level prolongs the effect of heat acclimation in rice seedlings. The interplay between HSP101 and HSA32 also affects basal thermotolerance of rice seeds. These findings are similar to those reported for the dicot plant Arabidopsis (Arabidopsis thaliana), suggesting a conserved function in plant heat stress response. Comparison between two rice cultivars, japonica Nipponbare and indica N22 showed opposite performance in basal thermotolerance and LAT assays. ‘N22’ seedlings have a higher basal thermotolerance level than cv Nipponbare and vice versa at the LAT level, indicating that these two types of thermotolerance can be decoupled. The HSP101 and HSA32 protein levels were substantially higher in cv Nipponbare than in cv N22 after a long recovery following heat acclimation treatment, at least partly explaining the difference in the LAT phenotype. Our results point out the complexity of thermotolerance diversity in rice cultivars, which may need to be taken into consideration when breeding for heat tolerance for different climate scenarios. PMID:24520156

  1. Proteomic and Physiological Analysis of the Response of Oat (Avena sativa) Seeds to Heat Stress under Different Moisture Conditions

    PubMed Central

    Chen, Lingling; Chen, Quanzhu; Kong, Lingqi; Xia, Fangshan; Yan, Huifang; Zhu, Yanqiao; Mao, Peisheng

    2016-01-01

    Seeds lose their viability when they are exposed to high temperature and moisture content (MC) during storage. The expression and metabolism of proteins plays a critical role in seed resistance to heat stress. However, the proteome response to heat stress in oat (Avena sativa) seeds during storage has not been revealed. To understand mechanisms of heat stress acclimation and tolerance in oat seeds, an integrated physiological and comparative proteomic analysis was performed on oat seeds with different MC during heat stress. Oat seeds with 10% and 16% MC were subjected to high temperatures (35, 45, and 50°C) for 24 and 2 days, respectively, and changes in physiological and biochemical characteristics were analyzed. The results showed that seed vigor decreased significantly with temperature increase from 35 to 50°C. Also, the proline content in 10% MC seeds decreased significantly (p < 0.05) whereas that in 16% MC seeds increased significantly (p < 0.05) during heat treatment from 35 to 50°C. There were no significant differences in malondialdehyde content in 10% MC seeds with temperature from 35 to 50°C, but a significant (p < 0.05) decline occurred in 16% MC seeds at 45°C. Proteome analysis revealed 21 significantly different proteins, including 19 down-regulated and two up-regulated proteins. The down-regulated proteins, notably six heat shock proteins and two ATP synthases, have important roles in the mobilization of carbohydrates and energy, and in the balance between synthesis and degradation of other proteins during seed deterioration. The up-regulation of argininosuccinate synthase participated in proline biosynthesis at 16% MC, which is important for maintaining reactive oxygen species homeostasis for the resistance of heat stress. In summary, heat-responsive protein species and mitochondrial respiratory metabolism were sensitive to high temperature and MC treatment. These studies provide a new insight into acclimation and tolerance to heat stress in

  2. Proteomic and Physiological Analysis of the Response of Oat (Avena sativa) Seeds to Heat Stress under Different Moisture Conditions.

    PubMed

    Chen, Lingling; Chen, Quanzhu; Kong, Lingqi; Xia, Fangshan; Yan, Huifang; Zhu, Yanqiao; Mao, Peisheng

    2016-01-01

    Seeds lose their viability when they are exposed to high temperature and moisture content (MC) during storage. The expression and metabolism of proteins plays a critical role in seed resistance to heat stress. However, the proteome response to heat stress in oat (Avena sativa) seeds during storage has not been revealed. To understand mechanisms of heat stress acclimation and tolerance in oat seeds, an integrated physiological and comparative proteomic analysis was performed on oat seeds with different MC during heat stress. Oat seeds with 10% and 16% MC were subjected to high temperatures (35, 45, and 50°C) for 24 and 2 days, respectively, and changes in physiological and biochemical characteristics were analyzed. The results showed that seed vigor decreased significantly with temperature increase from 35 to 50°C. Also, the proline content in 10% MC seeds decreased significantly (p < 0.05) whereas that in 16% MC seeds increased significantly (p < 0.05) during heat treatment from 35 to 50°C. There were no significant differences in malondialdehyde content in 10% MC seeds with temperature from 35 to 50°C, but a significant (p < 0.05) decline occurred in 16% MC seeds at 45°C. Proteome analysis revealed 21 significantly different proteins, including 19 down-regulated and two up-regulated proteins. The down-regulated proteins, notably six heat shock proteins and two ATP synthases, have important roles in the mobilization of carbohydrates and energy, and in the balance between synthesis and degradation of other proteins during seed deterioration. The up-regulation of argininosuccinate synthase participated in proline biosynthesis at 16% MC, which is important for maintaining reactive oxygen species homeostasis for the resistance of heat stress. In summary, heat-responsive protein species and mitochondrial respiratory metabolism were sensitive to high temperature and MC treatment. These studies provide a new insight into acclimation and tolerance to heat stress in

  3. Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit.

    PubMed

    Rienth, Markus; Torregrosa, Laurent; Luchaire, Nathalie; Chatbanyong, Ratthaphon; Lecourieux, David; Kelly, Mary T; Romieu, Charles

    2014-04-28

    Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. This first day - night study on heat stress adaption of the

  4. Different stress responsive strategies to drought and heat in two durum wheat cultivars with contrasting water use efficiency.

    PubMed

    Aprile, Alessio; Havlickova, Lenka; Panna, Riccardo; Marè, Caterina; Borrelli, Grazia M; Marone, Daniela; Perrotta, Carla; Rampino, Patrizia; De Bellis, Luigi; Curn, Vladislav; Mastrangelo, Anna M; Rizza, Fulvia; Cattivelli, Luigi

    2013-11-22

    Durum wheat often faces water scarcity and high temperatures, two events that usually occur simultaneously in the fields. Here we report on the stress responsive strategy of two durum wheat cultivars, characterized by different water use efficiency, subjected to drought, heat and a combination of both stresses. The cv Ofanto (lower water use efficiency) activated a large set of well-known drought-related genes after drought treatment, while Cappelli (higher water use efficiency) showed the constitutive expression of several genes induced by drought in Ofanto and a modulation of a limited number of genes in response to stress. At molecular level the two cvs differed for the activation of molecular messengers, genes involved in the regulation of chromatin condensation, nuclear speckles and stomatal closure. Noteworthy, the heat response in Cappelli involved also the up-regulation of genes belonging to fatty acid β-oxidation pathway, glyoxylate cycle and senescence, suggesting an early activation of senescence in this cv. A gene of unknown function having the greatest expression difference between the two cultivars was selected and used for expression QTL analysis, the corresponding QTL was mapped on chromosome 6B. Ofanto and Cappelli are characterized by two opposite stress-responsive strategies. In Ofanto the combination of drought and heat stress led to an increased number of modulated genes, exceeding the simple cumulative effects of the two single stresses, whereas in Cappelli the same treatment triggered a number of differentially expressed genes lower than those altered in response to heat stress alone. This work provides clear evidences that the genetic system based on Cappelli and Ofanto represents an ideal tool for the genetic dissection of the molecular response to drought and other abiotic stresses.

  5. The response of contrasting tomato genotypes to combined heat and drought stress.

    PubMed

    Nankishore, Alliea; Farrell, Aidan D

    2016-09-01

    Efforts to maximize yields of food crops can be undermined by abiotic stress factors, particularly those related to climate change. Here, we use a range of physiological methods to detect the individual and combined effects of heat and drought stress on three contrasting varieties of tomato: Hybrid 61, Moskvich, and Nagcarlang. Seedlings were acclimated under the following treatment regimes: CONTROL (25-36°C; well-watered), DRY (25-36°C; 20% field capacity), HOT (25-42°C; well-watered) and HOT+DRY (25-42°C; 20% field capacity). In each treatment, stomatal conductance, leaf temperature, chlorophyll content, and several chlorophyll fluorescence variables (both in situ and in vitro following a heat shock treatment) were measured. Plants from the HOT treatment remained statistically similar to the CONTROL plants in most of the measured parameters, while those from the DRY treatment and especially the HOT+DRY treatment showed clear effects of abiotic stress. Hybrid 61 showed considerable resilience to heat and drought stress compared to the other varieties, with significantly cooler leaves (one day after treatments imposed) and significantly higher Fv/Fm values both in situ and in vitro. The genotypic differences in resilience to heat stress were only apparent under water-limited conditions, highlighting the need to consider leaf temperature rather than air temperature when testing for tolerance to heat stress. The most effective parameters for discriminating genotypic variation in heat and drought stress were in vitro Fv/Fm and chlorophyll content. Copyright © 2016 Elsevier GmbH. All rights reserved.

  6. Perspectives on deciphering mechanisms underlying plant heat stress response and thermotolerance

    PubMed Central

    Bokszczanin, Kamila L.; Fragkostefanakis, Sotirios

    2013-01-01

    Global warming is a major threat for agriculture and food safety and in many cases the negative effects are already apparent. The current challenge of basic and applied plant science is to decipher the molecular mechanisms of heat stress response (HSR) and thermotolerance in detail and use this information to identify genotypes that will withstand unfavorable environmental conditions. Nowadays X-omics approaches complement the findings of previous targeted studies and highlight the complexity of HSR mechanisms giving information for so far unrecognized genes, proteins and metabolites as potential key players of thermotolerance. Even more, roles of epigenetic mechanisms and the involvement of small RNAs in thermotolerance are currently emerging and thus open new directions of yet unexplored areas of plant HSR. In parallel it is emerging that although the whole plant is vulnerable to heat, specific organs are particularly sensitive to elevated temperatures. This has redirected research from the vegetative to generative tissues. The sexual reproduction phase is considered as the most sensitive to heat and specifically pollen exhibits the highest sensitivity and frequently an elevation of the temperature just a few degrees above the optimum during pollen development can have detrimental effects for crop production. Compared to our knowledge on HSR of vegetative tissues, the information on pollen is still scarce. Nowadays, several techniques for high-throughput X-omics approaches provide major tools to explore the principles of pollen HSR and thermotolerance mechanisms in specific genotypes. The collection of such information will provide an excellent support for improvement of breeding programs to facilitate the development of tolerant cultivars. The review aims at describing the current knowledge of thermotolerance mechanisms and the technical advances which will foster new insights into this process. PMID:23986766

  7. H2O2 mediates the crosstalk of brassinosteroid and abscisic acid in tomato responses to heat and oxidative stresses

    PubMed Central

    Zhou, Jie; Wang, Jian; Li, Xin; Xia, Xiao-Jian; Zhou, Yan-Hong; Shi, Kai; Chen, Zhixiang; Yu, Jing-Quan

    2014-01-01

    The production of H2O2 is critical for brassinosteroid (BR)- and abscisic acid (ABA)-induced stress tolerance in plants. In this study, the relationship between BR and ABA in the induction of H2O2 production and their roles in response to heat and paraquat (PQ) oxidative stresses were studied in tomato. Both BR and ABA induced increases in RBOH1 gene expression, NADPH oxidase activity, apoplastic H2O2 accumulation, and heat and PQ stress tolerance in wild-type plants. BR could only induced transient increases in these responses in the ABA biosynthetic mutant notabilis (not), whereas ABA induced strong and prolonged increases in these responses in the BR biosynthetic mutant d ^im compared with wild-type plants. ABA levels were reduced in the BR biosynthetic mutant but could be elevated by exogenous BR. Silencing of RBOH1 compromised BR-induced apoplastic H2O2 production, ABA accumulation, and PQ stress responses; however, ABA-induced PQ stress responses were largely unchanged in the RBOH1-silenced plants. BR induces stress tolerance involving a positive feedback mechanism in which BR induces a rapid and transient H2O2 production by NADPH oxidase. The process in turn triggers increased ABA biosynthesis, leading to further increases in H2O2 production and prolonged stress tolerance. ABA induces H2O2 production in both the apoplastic and chloroplastic compartments. PMID:24899077

  8. Dissecting the proteome dynamics of the early heat stress response leading to plant survival or death in Arabidopsis.

    PubMed

    Echevarría-Zomeño, Sira; Fernández-Calvino, Lourdes; Castro-Sanz, Ana B; López, Juan Antonio; Vázquez, Jesús; Castellano, M Mar

    2016-06-01

    In many plant species, an exposure to a sublethal temperature triggers an adaptative response called acclimation. This response involves an extensive molecular reprogramming that allows the plant to further survive to an otherwise lethal increase of temperature. A related response is also launched under an abrupt and lethal heat stress that, in this case, is unable to successfully promote thermotolerance and therefore ends up in plant death. Although these molecular programmes are expected to have common players, the overlapping degree and the specific regulators of each process are currently unknown. We have carried out a high-throughput comparative proteomics analysis during acclimation and during the early stages of the plant response to a severe heat stress that lead Arabidopsis seedlings either to survival or death. This analysis dissects these responses, unravels the common players and identifies the specific proteins associated with these different fates. Thermotolerance assays of mutants in genes with an uncharacterized role in heat stress demonstrate the relevance of this study to uncover both positive and negative heat regulators and pinpoint a pivotal role of JR1 and BAG6 in heat tolerance.

  9. Seed set, pollen morphology and pollen surface composition response to heat stress in field pea.

    PubMed

    Jiang, Yunfei; Lahlali, Rachid; Karunakaran, Chithra; Kumar, Saroj; Davis, Arthur R; Bueckert, Rosalind A

    2015-11-01

    Pea (Pisum sativum L.) is a major legume crop grown in a semi-arid climate in Western Canada, where heat stress affects pollination, seed set and yield. Seed set and pod growth characteristics, along with in vitro percentage pollen germination, pollen tube growth and pollen surface composition, were measured in two pea cultivars (CDC Golden and CDC Sage) subjected to five maximum temperature regimes ranging from 24 to 36 °C. Heat stress reduced percentage pollen germination, pollen tube length, pod length, seed number per pod, and the seed-ovule ratio. Percentage pollen germination of CDC Sage was greater than CDC Golden at 36 °C. No visible morphological differences in pollen grains or the pollen surface were observed between the heat and control-treated pea. However, pollen wall (intine) thickness increased due to heat stress. Mid-infrared attenuated total reflectance (MIR-ATR) spectra revealed that the chemical composition (lipid, proteins and carbohydrates) of each cultivar's pollen grains responded differently to heat stress. The lipid region of the pollen coat and exine of CDC Sage was more stable compared with CDC Golden at 36 °C. Secondary derivatives of ATR spectra indicated the presence of two lipid types, with different amounts present in pollen grains from each cultivar. © 2015 John Wiley & Sons Ltd.

  10. Thermotolerance and heat stress responses of Douglas-fir and ponderosa pine seedling populations from contrasting climates.

    PubMed

    Marias, Danielle E; Meinzer, Frederick C; Woodruff, David R; McCulloh, Katherine A

    2016-12-21

    Temperature and the frequency and intensity of heat waves are predicted to increase throughout the 21st century. Germinant seedlings are expected to be particularly vulnerable to heat stress because they are in the boundary layer close to the soil surface where intense heating occurs in open habitats. We quantified leaf thermotolerance and whole-plant physiological responses to heat stress in first-year germinant seedlings in two populations each of Pinus ponderosa P. and C. Lawson (PIPO) and Pseudotsuga menziesii (Mirb.) Franco (PSME) from climates with contrasting precipitation and temperature regimes. Thermotolerance of detached needles was evaluated using chlorophyll fluorescence (FV/FM, FO) and electrolyte leakage. PSME was more heat tolerant than PIPO according to both independent assessments of thermotolerance. Following exposure of whole seedlings to a simulated heat wave at 45 °C for 1 h in a growth chamber, we monitored FV/FM, photosynthesis, stomatal conductance, non-structural carbohydrates (NSCs) and carbon isotope ratios (δ(13)C) for 14 days. Heat treatment induced significant reductions in FV/FM in both species and a transient reduction in photosynthetic gas exchange only in PIPO 1 day after treatment. Heat treatment induced an increase in glucose + fructose concurrent with a decrease in starch in both species, whereas total NSC and sucrose were not affected by heat treatment. The negative relationship between glucose + fructose and starch observed in treated plants may be due to the conversion of starch to glucose + fructose to aid recovery from heat-induced damage. Populations from drier sites displayed greater δ(13)C values than those from wetter sites, consistent with higher intrinsic water-use efficiency and drought resistance of populations from drier climates. Thermotolerance and heat stress responses appeared to be phenotypically plastic and representative of the environment in which plants were grown, whereas intrinsic water

  11. The oxygen reduction pathway and heat shock stress response are both required for Entamoeba histolytica pathogenicity.

    PubMed

    Olivos-García, Alfonso; Saavedra, Emma; Nequiz, Mario; Santos, Fabiola; Luis-García, Erika Rubí; Gudiño, Marco; Pérez-Tamayo, Ruy

    2016-05-01

    Several species belonging to the genus Entamoeba can colonize the mouth or the human gut; however, only Entamoeba histolytica is pathogenic to the host, causing the disease amoebiasis. This illness is responsible for one hundred thousand human deaths per year worldwide, affecting mainly underdeveloped countries. Throughout its entire life cycle and invasion of human tissues, the parasite is constantly subjected to stress conditions. Under in vitro culture, this microaerophilic parasite can tolerate up to 5 % oxygen concentrations; however, during tissue invasion the parasite has to cope with the higher oxygen content found in well-perfused tissues (4-14 %) and with reactive oxygen and nitrogen species derived from both host and parasite. In this work, the role of the amoebic oxygen reduction pathway (ORP) and heat shock response (HSP) are analyzed in relation to E. histolytica pathogenicity. The data suggest that in contrast with non-pathogenic E. dispar, the higher level of ORP and HSPs displayed by E. histolytica enables its survival in tissues by diminishing and detoxifying intracellular oxidants and repairing damaged proteins to allow metabolic fluxes, replication and immune evasion.

  12. Inhomogeneous vasodilatory responses of rat tail arteries to heat stress: evaluation by synchrotron radiation microangiography.

    PubMed

    Kuwabara, Eriko; Furuyama, Fujiya; Ito, Kunihisa; Tanaka, Etsuro; Hattan, Naoichiro; Fujikura, Hisanori; Kimura, Koji; Goto, Takako; Hayashi, Takashi; Taira, Hiroyuki; Shinozaki, Yoshiro; Umetani, Keiji; Hyodo, Kazuyuki; Tanioka, Kenkichi; Mochizuki, Ryo; Kawai, Toshiaki; Koide, Shirosaku; Mori, Hidezo

    2002-10-01

    Tail blood flow is crucial for dissipating body heat in rats. Angiographies are convenient tools to evaluate tail circulation. However, conventional angiographies do not have sufficient sensitivity or spatial resolution for small vessels. Recently, we developed a novel microangiographic system using monochromatic synchrotron radiation and a high-definition video camera system. Here, we report an evaluation of rat tail circulation under heat stress using the synchrotron radiation microangiographic system. We performed an experiment using the microangiography of the caudal artery before and after heating up WKAH/HkmSlc rats to rectal temperature of 39 degrees C. The images were digitized and temporal subtraction was performed, and the diameters of caudal arteries were evaluated. After heating, the medial caudal artery was markedly dilated (320 +/- 53 to 853 +/- 243 micro m in diameter, p<0.001), while no significant change was observed in the lateral caudal arteries (139 +/- 42 to 167 +/- 73 micro m) and segmental anastomosing vessels. The heat stress allowed for visualization of the superficial caudal arteries with a diameter of approximately 60 micro m, not visible prior to heating. Thus, synchrotron radiation microangiography demonstrated that the rat tail possessed dual sets of arteries; one set was highly sensitive to heat-induced vasodilation (medial caudal artery and superficial caudal arteries) and the other set was less sensitive (lateral caudal arteries and segmental anastomosing vessels).

  13. Cross-omics comparison of stress responses in mesothelial cells exposed to heat- versus filter-sterilized peritoneal dialysis fluids.

    PubMed

    Kratochwill, Klaus; Bender, Thorsten O; Lichtenauer, Anton M; Herzog, Rebecca; Tarantino, Silvia; Bialas, Katarzyna; Jörres, Achim; Aufricht, Christoph

    2015-01-01

    Recent research suggests that cytoprotective responses, such as expression of heat-shock proteins, might be inadequately induced in mesothelial cells by heat-sterilized peritoneal dialysis (PD) fluids. This study compares transcriptome data and multiple protein expression profiles for providing new insight into regulatory mechanisms. Two-dimensional difference gel electrophoresis (2D-DIGE) based proteomics and topic defined gene expression microarray-based transcriptomics techniques were used to evaluate stress responses in human omental peritoneal mesothelial cells in response to heat- or filter-sterilized PD fluids. Data from selected heat-shock proteins were validated by 2D western-blot analysis. Comparison of proteomics and transcriptomics data discriminated differentially regulated protein abundance into groups depending on correlating or noncorrelating transcripts. Inadequate abundance of several heat-shock proteins following exposure to heat-sterilized PD fluids is not reflected on the mRNA level indicating interference beyond transcriptional regulation. For the first time, this study describes evidence for posttranscriptional inadequacy of heat-shock protein expression by heat-sterilized PD fluids as a novel cytotoxic property. Cross-omics technologies introduce a novel way of understanding PDF bioincompatibility and searching for new interventions to reestablish adequate cytoprotective responses.

  14. Cross-Omics Comparison of Stress Responses in Mesothelial Cells Exposed to Heat- versus Filter-Sterilized Peritoneal Dialysis Fluids

    PubMed Central

    Kratochwill, Klaus; Bender, Thorsten O.; Lichtenauer, Anton M.; Herzog, Rebecca; Tarantino, Silvia; Bialas, Katarzyna; Jörres, Achim; Aufricht, Christoph

    2015-01-01

    Recent research suggests that cytoprotective responses, such as expression of heat-shock proteins, might be inadequately induced in mesothelial cells by heat-sterilized peritoneal dialysis (PD) fluids. This study compares transcriptome data and multiple protein expression profiles for providing new insight into regulatory mechanisms. Two-dimensional difference gel electrophoresis (2D-DIGE) based proteomics and topic defined gene expression microarray-based transcriptomics techniques were used to evaluate stress responses in human omental peritoneal mesothelial cells in response to heat- or filter-sterilized PD fluids. Data from selected heat-shock proteins were validated by 2D western-blot analysis. Comparison of proteomics and transcriptomics data discriminated differentially regulated protein abundance into groups depending on correlating or noncorrelating transcripts. Inadequate abundance of several heat-shock proteins following exposure to heat-sterilized PD fluids is not reflected on the mRNA level indicating interference beyond transcriptional regulation. For the first time, this study describes evidence for posttranscriptional inadequacy of heat-shock protein expression by heat-sterilized PD fluids as a novel cytotoxic property. Cross-omics technologies introduce a novel way of understanding PDF bioincompatibility and searching for new interventions to reestablish adequate cytoprotective responses. PMID:26495307

  15. Genetic Variations of Physiological Responses Following Heat Stress in Laying Hens

    USDA-ARS?s Scientific Manuscript database

    Heat stress (HS), also known as hyperthermia, is a major problem experienced by poultry during high-temperature conditions. The ability to manage the detrimental effects of HS can be attributed to many factors, including genetics. The objective of the present study was to determine the variation of ...

  16. Effects of dietary antioxidant on performance and physiological responses following heat stress in laying hens

    USDA-ARS?s Scientific Manuscript database

    Heat stress (HS) causes oxidative damage, increasing mortality and reducing productivity in chickens. The objective of this study was to determine the benefits of antioxidant supplementation in laying hens during HS. Eighty 32-wk-old W-36 White Leghorn hens were used in this study. Hens were randoml...

  17. Molecular responses of Escherichia coli caused by heat stress and recombinant protein production during temperature induction.

    PubMed

    Valdez-Cruz, Norma A; Ramírez, Octavio T; Trujillo-Roldán, Mauricio A

    2011-01-01

    In a recent review, we discussed the extensively used temperature-inducible expression system, based on the pL and/or pR phage lambda promoters that are finely regulated by the thermo-labile cI857 repressor. In this system, an increase in temperature induces the heterologous protein production and activates the heat shock response, as well as the stringent and SOS responses. The same responses are activated just by the overproduction of recombinant protein. All such responses result in a metabolic burden to the cells, a decrease in the specific growth rate, and alterations in the central carbon metabolism. Altogether, these effects can alter the quantity and quality of the produced foreign protein. Here, we compare and discuss the transcription of selected genes, and the concomitant synthesis of heat-shock proteins (hsp) soon after thermal induction, in relation to the responses that occur in other expression systems that also trigger the heat-shock response.

  18. Effectiveness of cold water immersion for treating exertional heat stress when immediate response is not possible.

    PubMed

    Flouris, A D; Friesen, B J; Carlson, M J; Casa, D J; Kenny, G P

    2015-06-01

    Immediate treatment with cold water immersion (CWI) is the gold standard for exertional heatstroke. In the field, however, treatment is often delayed due to delayed paramedic response and/or inaccurate diagnosis. We examined the effect of treatment (reduction of rectal temperature to 37.5 °C) delays of 5, 20, and 40 min on core cooling rates in eight exertionally heat-stressed (40.0 °C rectal temperature) individuals. We found that rectal temperature was elevated above baseline (P < 0.05) at the end of all delay periods (5 min: 40.08 ± 0.32; 20 min: 39.92 ± 0.40; 40 min: 39.57 ± 0.29 °C). Mean arterial pressure was reduced (P < 0.05) below baseline (92 ± 1.8 mm Hg) after all delay periods (5 min: 75 ± 2.6; 20 min: 74 ± 1.7; 40 min: 70 ± 2.1 mm Hg; P > 0.05). Rectal core cooling rates were similar among conditions (5 min: 0.20 ± 0.01; 20 min: 0.17 ± 0.02; 40 min: 0.17 ± 0.01 °C/min; P > 0.05). The rectal temperature afterdrop following CWI was similar across conditions (5 min: 35.95; 20 min: 35.61; 40 min: 35.87 °C; P > 0.05). We conclude that the effectiveness of 2 °C CWI as a treatment for exertional heat stress remains high even when applied with a delay of 40 min. Therefore, our results support that CWI is the most appropriate treatment for exertional heatstroke as it is capable of quickly reversing hyperthermia even when treatment is commenced with a significant delay.

  19. Short communication: Maternal heat stress during the dry period alters postnatal whole-body insulin response of calves.

    PubMed

    Tao, S; Monteiro, A P A; Hayen, M J; Dahl, G E

    2014-02-01

    Heat stress during the dry period not only negatively affects a cow's performance but also affects her offspring. Previous studies indicate that calves born to cows heat-stressed during late gestation have lower birth weight but similar overall weight gain during the prepubertal period compared with those cooled in utero. However, it is unclear if whole-body insulin response, and thus metabolism, of calves is altered in their postnatal life after in utero heat stress. The aim of the present study was to examine the effects of maternal heat stress during the dry period on whole-body insulin response of calves after weaning. Calves (10/treatment) were born to cows exposed to heat stress (HT) or cooling (CL) when dry. Calves were immediately separated from their dams and fed 3.8L of high-quality colostrum within 1h after birth and then 1.9L 12h later. All calves were fed 1.9 to 3.8L of pasteurized milk in the morning and afternoon from 2 to 42 d of age and then only in the morning until weaning at 49 d. Calf starter and water were offered ad libitum starting at 2 d of age. All calves were managed in the same manner throughout the study. All calves were subjected to a glucose tolerance test (GTT) and an insulin challenge (IC) at 55 d of age. Calves heat-stressed in utero were born lighter (40 ± 1.4 vs. 45 ± 1.4 kg) compared with CL calves. Both groups of calves had similar weaning weights (HT: 68 ± 3.2 kg; CL: 71 ± 3.3 kg) and body weight gain from birth to weaning (HT: 28 ± 2.2 kg; CL: 26 ± 2.3 kg). Compared with those cooled in utero, HT calves had a similar insulin response to GTT and insulin clearance during IC but faster glucose clearance during GTT and IC. In conclusion, in addition to impaired fetal growth, maternal heat stress during the dry period enhances the whole-body insulin response of calves after weaning, which suggests the possibility of accelerated lipogenesis and fat deposition in early life.

  20. Strong, sudden cooling alleviates the inflammatory responses in heat-stressed dairy cows based on iTRAQ proteomic analysis

    NASA Astrophysics Data System (ADS)

    Cheng, Jianbo; Min, Li; Zheng, Nan; Fan, Caiyun; Zhao, Shengguo; Zhang, Yangdong; Wang, Jiaqi

    2017-09-01

    This study was designed to investigate the effects of sudden cooling on the physiological responses of 12 heat-stressed Holstein dairy cows using an isobaric tags for relative and absolute quantification (iTRAQ) labeling approach. Plasma samples were collected from these cows during heat stress (HS), and after strong, sudden cooling in the summer (16 days later). We compared plasma proteomic data before and after sudden cooling to identify the differentially abundant proteins. The results showed that sudden cooling in summer effectively alleviated the negative consequences of HS on body temperature and production variables. Expressions of plasma hemoglobin alpha and hemoglobin beta were upregulated, whereas lipopolysaccharide-binding protein (LBP) and haptoglobin were downregulated in this process. The increase of hemoglobin after cooling may improve oxygen transport and alleviate the rise in respiration rates in heat-stressed dairy cows. The decrease of LBP and haptoglobin suggests that the inflammatory responses caused by HS are relieved after cooling. Our findings provide new insight into the physiological changes that occur when heat-stressed dairy cows experience strong, sudden cooling.

  1. Impact of short-term heat stress on physiological responses and expression profile of HSPs in Barbari goats

    NASA Astrophysics Data System (ADS)

    Dangi, Satyaveer Singh; Gupta, Mahesh; Nagar, Vimla; Yadav, Vijay Pratap; Dangi, Saroj K.; Shankar, Om; Chouhan, Vikrant Singh; Kumar, Puneet; Singh, Gyanendra; Sarkar, Mihir

    2014-12-01

    Six, nonpregnant, Barbari goats aged 4-5 years were selected for the study. For the first 6 days, the animals were kept in psychrometric chamber at thermoneutral temperature for 6 h each day to make them acclimated to climatic chamber. On the 7th day, the animals were exposed to 41 °C temperature for 3 h and then to 45 °C for the next 3 h. Cardinal physiological responses were measured, and blood samples (3 ml) were collected at 1-h interval during the heat exposure period and then once after 6 h of the heat exposure. The rectal temperature (RT) and respiratory rate (RR) increased significantly ( P < 0.05) during the heat exposure compared to pre- and postexposure. The relative messenger RNA (mRNA) expression of heat shock protein (HSP)60, HSP70, and HSP90 increased significantly ( P < 0.05) within 1 h after exposure to heat stress at 41 and 45 °C and decreased significantly ( P < 0.05) in next 2 h but remain significantly ( P < 0.05) elevated from preexposure. HSP105/110 relative mRNA expression level remained unchanged during the first 4 h, and thereafter, it increased significantly ( P < 0.05) and reached the peak at 6 h. Relative protein expression pattern of HSPs during exposure to heat stress showed similar trend as observed for the relative mRNA expression. Given the response sensitivity and intensity of HSP genes to environmental stresses, HSP70 was found to be the most sensitive to temperature fluctuation, and it could be used as an important molecular biomarker to heat stress in animals.

  2. Differential physiological response of the grapevine varieties Touriga Nacional and Trincadeira to combined heat, drought and light stresses.

    PubMed

    Carvalho, L C; Coito, J L; Gonçalves, E F; Chaves, M M; Amâncio, S

    2016-01-01

    Worldwide, extensive agricultural losses are attributed to drought, often in combination with heat in Mediterranean climate regions, where grapevine traditionally grows. The available scenarios for climate change suggest increases in aridity in these regions. Under natural conditions plants are affected by a combination of stresses, triggering synergistic or antagonistic physiological, metabolic or transcriptomic responses unique to the combination. However the study of such stresses in a controlled environment can elucidate important mechanisms by allowing the separation of the effects of individual stresses. To gather those effects, cuttings of two grapevine varieties, Touriga Nacional (TN) and Trincadeira (TR), were grown under controlled conditions and subjected to three abiotic stresses (drought - WS, heat - HS and high light - LS) individually and in combination two-by-two (WSHS, WSLS, HSLS) or all three (WSHSLS). Photosynthesis, water status, contents of H2 O2 , abscisic acid and metabolites of the ascorbate-glutathione cycle were measured in the leaves. Common and distinct response features were identified in the different stress combinations. Photosynthesis was not hindered in TN by LS, while even individual stresses severely affect photosynthesis in TR. Abscisic acid may be implicated in grapevine osmotic responses since it is correlated with tolerance parameters, especially in combined stresses involving drought. Overall, the responses to drought-including treatments were clearly distinct to those without drought. From the specific behaviours of the varieties, it can be concluded that TN shows a higher capacity for heat dissipation and for withstanding high light intensities, indicating better adjustment to warm conditions, provided that water supply is plentiful.

  3. Thermal stress response of General Purpose Heat Source (GPHS) aeroshell material

    NASA Technical Reports Server (NTRS)

    Grinberg, I. M.; Hulbert, L. E.; Luce, R. G.

    1980-01-01

    A thermal stress test was conducted to determine the ability of the GPHS aeroshell 3 D FWPF material to maintain physical integrity when exposed to a severe heat flux such as would occur from prompt reentry of GPHS modules. The test was performed in the Giant Planetary Facility at NASA's Ames Research Center. Good agreement was obtained between the theoretical and experimental results for both temperature and strain time histories. No physical damage was observed in the test specimen. These results provide initial corroboration both of the analysis techniques and that the GPHS reentry member will survive the reentry thermal stress levels expected.

  4. The Transcriptional Cascade in the Heat Stress Response of Arabidopsis Is Strictly Regulated at the Level of Transcription Factor Expression.

    PubMed

    Ohama, Naohiko; Kusakabe, Kazuya; Mizoi, Junya; Zhao, Huimei; Kidokoro, Satoshi; Koizumi, Shinya; Takahashi, Fuminori; Ishida, Tetsuya; Yanagisawa, Shuichi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2016-01-01

    Group A1 heat shock transcription factors (HsfA1s) are the master regulators of the heat stress response (HSR) in plants. Upon heat shock, HsfA1s trigger a transcriptional cascade that is composed of many transcription factors. Despite the importance of HsfA1s and their downstream transcriptional cascade in the acquisition of thermotolerance in plants, the molecular basis of their activation remains poorly understood. Here, domain analysis of HsfA1d, one of several HsfA1s in Arabidopsis thaliana, demonstrated that the central region of HsfA1d is a key regulatory domain that represses HsfA1d transactivation activity through interaction with HEAT SHOCK PROTEIN70 (HSP70) and HSP90. We designated this region as the temperature-dependent repression (TDR) domain. We found that HSP70 dissociates from HsfA1d in response to heat shock and that the dissociation is likely regulated by an as yet unknown activation mechanism, such as HsfA1d phosphorylation. Overexpression of constitutively active HsfA1d that lacked the TDR domain induced expression of heat shock proteins in the absence of heat stress, thereby conferring potent thermotolerance on the overexpressors. However, transcriptome analysis of the overexpressors demonstrated that the constitutively active HsfA1d could not trigger the complete transcriptional cascade under normal conditions, thereby indicating that other factors are necessary to fully induce the HSR. These complex regulatory mechanisms related to the transcriptional cascade may enable plants to respond resiliently to various heat stress conditions.

  5. Heat-shock and stress response of the parasitic nematode Haemonchus contortus.

    PubMed

    van Leeuwen, M A

    1995-01-01

    Before and after a stress treatment, larval stages and adult worms of Haemonchus contortus were tested for the induction and expression of heat-shock proteins (HSPs) using immunoblot analysis with HSP70-and HSP65-specific monoclonal antibodies. Stress treatment or heat shock did not alter the signals obtained with these antibodies, but the amount of HSP70 differed between the successive stages. In addition, the different stages were metabolically labeled with [35S]-methionine during a temperature-shock or chemical treatment and proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The shocks resulted in an altered protein pattern. New was the de novo expression of a 20-kDa protein of adult worms after anthelmintic treatment.

  6. Stress and heat flow

    SciTech Connect

    Lachenbrunch, A.H.; McGarr, A.

    1990-01-01

    As the Pacific plate slides northward past the North American plate along the San Andreas fault, the frictional stress that resists plate motion there is overcome to cause earthquakes. However, the frictional heating predicted for the process has never been detected. Thus, in spite of its importance to an understanding of both plate motion and earthquakes, the size of this frictional stress is still uncertain, even in order of magnitude.

  7. The Transcriptional Heat Shock Response of Salmonella Typhimurium Shows Hysteresis and Heated Cells Show Increased Resistance to Heat and Acid Stress

    PubMed Central

    Pin, Carmen; Hansen, Trine; Muñoz-Cuevas, Marina; de Jonge, Rob; Rosenkrantz, Jesper T.; Löfström, Charlotta; Aarts, Henk; Olsen, John E.

    2012-01-01

    We investigated if the transcriptional response of Salmonella Typhimurium to temperature and acid variations was hysteretic, i.e. whether the transcriptional regulation caused by environmental stimuli showed memory and remained after the stimuli ceased. The transcriptional activity of non-replicating stationary phase cells of S. Typhimurium caused by the exposure to 45°C and to pH 5 for 30 min was monitored by microarray hybridizations at the end of the treatment period as well as immediately and 30 minutes after conditions were set back to their initial values, 25°C and pH 7. One hundred and two out of 120 up-regulated genes during the heat shock remained up-regulated 30 minutes after the temperature was set back to 25°C, while only 86 out of 293 down regulated genes remained down regulated 30 minutes after the heat shock ceased. Thus, the majority of the induced genes exhibited hysteresis, i.e., they remained up-regulated after the environmental stress ceased. At 25°C the transcriptional regulation of genes encoding for heat shock proteins was determined by the previous environment. Gene networks constructed with up-regulated genes were significantly more modular than those of down-regulated genes, implying that down-regulation was significantly less synchronized than up-regulation. The hysteretic transcriptional response to heat shock was accompanied by higher resistance to inactivation at 50°C as well as cross-resistance to inactivation at pH 3; however, growth rates and lag times at 43°C and at pH 4.5 were not affected. The exposure to pH 5 only caused up-regulation of 12 genes and this response was neither hysteretic nor accompanied of increased resistance to inactivation conditions. Cellular memory at the transcriptional level may represent a mechanism of adaptation to the environment and a deterministic source of variability in gene regulation. PMID:23236453

  8. Global crop yield response to extreme heat stress under multiple climate change futures

    NASA Astrophysics Data System (ADS)

    Deryng, Delphine; Conway, Declan; Ramankutty, Navin; Price, Jeff; Warren, Rachel

    2014-03-01

    Extreme heat stress during the crop reproductive period can be critical for crop productivity. Projected changes in the frequency and severity of extreme climatic events are expected to negatively impact crop yields and global food production. This study applies the global crop model PEGASUS to quantify, for the first time at the global scale, impacts of extreme heat stress on maize, spring wheat and soybean yields resulting from 72 climate change scenarios for the 21st century. Our results project maize to face progressively worse impacts under a range of RCPs but spring wheat and soybean to improve globally through to the 2080s due to CO2 fertilization effects, even though parts of the tropic and sub-tropic regions could face substantial yield declines. We find extreme heat stress at anthesis (HSA) by the 2080s (relative to the 1980s) under RCP 8.5, taking into account CO2 fertilization effects, could double global losses of maize yield (ΔY = -12.8 ± 6.7% versus - 7.0 ± 5.3% without HSA), reduce projected gains in spring wheat yield by half (ΔY = 34.3 ± 13.5% versus 72.0 ± 10.9% without HSA) and in soybean yield by a quarter (ΔY = 15.3 ± 26.5% versus 20.4 ± 22.1% without HSA). The range reflects uncertainty due to differences between climate model scenarios; soybean exhibits both positive and negative impacts, maize is generally negative and spring wheat generally positive. Furthermore, when assuming CO2 fertilization effects to be negligible, we observe drastic climate mitigation policy as in RCP 2.6 could avoid more than 80% of the global average yield losses otherwise expected by the 2080s under RCP 8.5. We show large disparities in climate impacts across regions and find extreme heat stress adversely affects major producing regions and lower income countries.

  9. Global crop yield response to extreme heat stress under multiple climate change futures

    NASA Astrophysics Data System (ADS)

    Deryng, D.; Conway, D.; Ramankutty, N.; Price, J.; Warren, R.

    2014-12-01

    Extreme heat stress during the crop reproductive period can be critical for crop productivity. Projected changes in the frequency and severity of extreme climatic events are expected to negatively impact crop yields and global food production. This study applies the global crop model PEGASUS to quantify, for the first time at the global scale, impacts of extreme heat stress on maize, spring wheat and soybean yields resulting from 72 climate change scenarios for the 21st century. Our results project maize to face progressively worse impacts under a range of RCPs but spring wheat and soybean to improve globally through to the 2080s due to CO2 fertilization effects, even though parts of the tropic and sub-tropic regions could face substantial yield declines. We find extreme heat stress at anthesis (HSA) by the 2080s (relative to the 1980s) under RCP 8.5, taking into account CO2 fertilization effects, could double global losses of maize yield (dY = -12.8 ± 6.7% versus -7.0 ± 5.3% without HSA), reduce projected gains in spring wheat yield by half (dY = 34.3 ± 13.5% versus 72.0 ± 10.9% without HSA) and in soybean yield by a quarter (dY = 15.3 ± 26.5% versus 20.4 ± 22.1% without HSA). The range reflects uncertainty due to differences between climate model scenarios; soybean exhibits both positive and negative impacts, maize is generally negative and spring wheat generally positive. Furthermore, when assuming CO2 fertilization effects to be negligible, we observe drastic climate mitigation policy as in RCP 2.6 could avoid more than 80% of the global average yield losses otherwise expected by the 2080s under RCP 8.5. We show large disparities in climate impacts across regions and find extreme heat stress adversely affects major producing regions and lower income countries.

  10. Day and night heat stress trigger different transcriptomic responses in green and ripening grapevine (vitis vinifera) fruit

    PubMed Central

    2014-01-01

    Background Global climate change will noticeably affect plant vegetative and reproductive development. The recent increase in temperatures has already impacted yields and composition of berries in many grapevine-growing regions. Physiological processes underlying temperature response and tolerance of the grapevine fruit have not been extensively investigated. To date, all studies investigating the molecular regulation of fleshly fruit response to abiotic stress were only conducted during the day, overlooking possible critical night-specific variations. The present study explores the night and day transcriptomic response of grapevine fruit to heat stress at several developmental stages. Short heat stresses (2 h) were applied at day and night to vines bearing clusters sequentially ordered according to the developmental stages along their vertical axes. The recently proposed microvine model (DRCF-Dwarf Rapid Cycling and Continuous Flowering) was grown in climatic chambers in order to circumvent common constraints and biases inevitable in field experiments with perennial macrovines. Post-véraison berry heterogeneity within clusters was avoided by constituting homogenous batches following organic acids and sugars measurements of individual berries. A whole genome transcriptomic approach was subsequently conducted using NimbleGen 090818 Vitis 12X (30 K) microarrays. Results Present work reveals significant differences in heat stress responsive pathways according to day or night treatment, in particular regarding genes associated with acidity and phenylpropanoid metabolism. Precise distinction of ripening stages led to stage-specific detection of malic acid and anthocyanin-related transcripts modulated by heat stress. Important changes in cell wall modification related processes as well as indications for heat-induced delay of ripening and sugar accumulation were observed at véraison, an effect that was reversed at later stages. Conclusions This first day - night

  11. Delayed-type hypersensitivity, contact sensitivity, and phytohemagglutinin skin-test responses of heat- and cold-stressed calves.

    PubMed

    Kelley, K W; Greenfield, R E; Evermann, J F; Parish, S M; Perryman, L E

    1982-05-01

    Three-week-old Holstein bull calves were used to investigate the effect of a 2-week chronic heat (35 C) or cold (-5 C) exposure on delayed-type hypersensitivity (DTH) reactions to purified protein derivative after sensitization with heat-killed Mycobacterium tuberculosis, contact sensitivity (CS) reactions to 1-fluoro-2,4-dinitrobenzene, and phytohemagglutinin (PHA) skin tests. Heat exposure reduced expression of DTH reactions by 42% and CS reactions by 38% at 24 hours after elicitation of the responses. The PHA-induced skin tests were not affected after 1 week of heat exposure, but this reaction was reduced by 20% after 2 weeks of heat exposure. The immune response of calves exposed to cold air temperatures was more complex. Cold exposure suppressed CS reactions by 39% at the end of both the 1st and 2nd weeks. The PHA response was reduced by 39% after 2 weeks of cold exposure. The DTH response depended on duration of cold exposure. The DTH reaction was increased by 42% after 1 week, but was reduced by 14% after 2 weeks. These data are consistent with the hypothesis that environmental stressors alter host resistance by affecting the immune system. Furthermore, these stress-induced changes in immune events depend on the type of immune response, the nature of the environmental stressor, and the length of time that calves are exposed to the stressor.

  12. Impact of Moderate Heat, Carvacrol, and Thymol Treatments on the Viability, Injury, and Stress Response of Listeria monocytogenes

    PubMed Central

    Guevara, L.; Antolinos, V.; Palop, A.; Periago, P. M.

    2015-01-01

    The microbial safety and stability of minimally processed foods are based on the application of combined preservative factors. Since microorganisms are able to develop adaptive networks to survive under conditions of stress, food safety may be affected, and therefore understanding of stress adaptive mechanisms plays a key role in designing safe food processing conditions. In the present study, the viability and the sublethal injury of Listeria monocytogenes exposed to moderate heat (55°C) and/or essential oil compounds (carvacrol and thymol, 0.3 mM) treatments were studied. Synergistic effects were obtained when combining mild heat (55°C) with one or both essential oil compounds, leading to inactivation kinetics values three to four times lower than when using heat alone. All the treatments applied caused some injury in the population. The injury levels ranged from around 20% of the surviving population under the mildest conditions to more than 99.99% under the most stringent conditions. Protein extracts of cells exposed to these treatments were analysed by two-dimensional gel electrophoresis. The results obtained revealed that stressed cells exhibited differential protein expression to control cells. The proteins upregulated under these stressing conditions were implicated, among other functions, in stress response, metabolism, and protein refolding. PMID:26539510

  13. Identification and bioinformatics analysis of microRNAs associated with stress and immune response in serum of heat-stressed and normal Holstein cows.

    PubMed

    Zheng, Yue; Chen, Kun-lin; Zheng, Xiao-min; Li, Hui-xia; Wang, Gen-lin

    2014-11-01

    MicroRNAs (miRNAs) are small single-stranded non-coding RNAs that have an important regulatory function in animal growth and developmental processes. However, the differential expression of miRNA and the role of these miRNAs in heat-stressed Holstein cows are still unknown. In this study, the profile of differentially expressed miRNAs and the target genes analysis in the serum of heat-stressed and normal Holstein cows were investigated by a Solexa deep-sequencing approach and bioinformatics. The data identified 52 differentially expressed miRNAs in 486 known miRNAs which were changed significantly between heat-stressed and normal Holstein cows (fold change >2, P < 0.001). Target genes analysis showed that at least 7 miRNAs (miR-19a, miR-19b, miR-146a, miR-30a-5p, miR-345-3p, miR-199a-3p, and miR-1246) were involved in the response to stress, oxidative stress, development of the immune system, and immune response among the identified 52 differentially expressed miRNAs. Five miRNAs (miR-27b, miR-181a, miR-181b, miR-26a, and miR-146b) were involved in stress and immune responses and the expression of five miRNAs was striking (P < 0.001). In addition, RT-qPCR and deep-sequencing methods showed that 8 miRNAs among the 12 selected miRNAs (miR-19a, miR-19b, miR-27b, miR-30a-5p, miR-181a, miR-181b, miR-345-3p, and miR-1246) were highly expressed in the serum of heat-stressed Holstein cows. GO and KEGG pathway analysis showed that these differentially expressed miRNAs were involved in a pathway that may differentially regulate the expression of stress response and immune response genes. Our study provides an overview of miRNAs expression profile and the interaction between miRNAs and their target genes, which will lead to further understanding of the important roles of miRNAs in heat-stressed Holstein cows.

  14. Long-Term Acclimation to Different Thermal Regimes Affects Molecular Responses to Heat Stress in a Freshwater Clam Corbicula Fluminea

    PubMed Central

    Falfushynska, Halina I.; Phan, Tuan; Sokolova, Inna M.

    2016-01-01

    Global climate change (GCC) can negatively affect freshwater ecosystems. However, the degree to which freshwater populations can acclimate to long-term warming and the underlying molecular mechanisms are not yet fully understood. We used the cooling water discharge (CWD) area of a power plant as a model for long-term warming. Survival and molecular stress responses (expression of molecular chaperones, antioxidants, bioenergetic and protein synthesis biomarkers) to experimental warming (20–41 °C, +1.5 °C per day) were assessed in invasive clams Corbicula fluminea from two pristine populations and a CWD population. CWD clams had considerably higher (by ~8–12 °C) lethal temperature thresholds than clams from the pristine areas. High thermal tolerance of CWD clams was associated with overexpression of heat shock proteins HSP70, HSP90 and HSP60 and activation of protein synthesis at 38 °C. Heat shock response was prioritized over the oxidative stress response resulting in accumulation of oxidative lesions and ubiquitinated proteins during heat stress in CWD clams. Future studies should determine whether the increase in thermal tolerance in CWD clams are due to genetic adaptation and/or phenotypic plasticity. Overall, our findings indicate that C. fluminea has potential to survive and increase its invasive range during warming such as expected during GCC. PMID:27995990

  15. Long-Term Acclimation to Different Thermal Regimes Affects Molecular Responses to Heat Stress in a Freshwater Clam Corbicula Fluminea.

    PubMed

    Falfushynska, Halina I; Phan, Tuan; Sokolova, Inna M

    2016-12-20

    Global climate change (GCC) can negatively affect freshwater ecosystems. However, the degree to which freshwater populations can acclimate to long-term warming and the underlying molecular mechanisms are not yet fully understood. We used the cooling water discharge (CWD) area of a power plant as a model for long-term warming. Survival and molecular stress responses (expression of molecular chaperones, antioxidants, bioenergetic and protein synthesis biomarkers) to experimental warming (20-41 °C, +1.5 °C per day) were assessed in invasive clams Corbicula fluminea from two pristine populations and a CWD population. CWD clams had considerably higher (by ~8-12 °C) lethal temperature thresholds than clams from the pristine areas. High thermal tolerance of CWD clams was associated with overexpression of heat shock proteins HSP70, HSP90 and HSP60 and activation of protein synthesis at 38 °C. Heat shock response was prioritized over the oxidative stress response resulting in accumulation of oxidative lesions and ubiquitinated proteins during heat stress in CWD clams. Future studies should determine whether the increase in thermal tolerance in CWD clams are due to genetic adaptation and/or phenotypic plasticity. Overall, our findings indicate that C. fluminea has potential to survive and increase its invasive range during warming such as expected during GCC.

  16. Long-Term Acclimation to Different Thermal Regimes Affects Molecular Responses to Heat Stress in a Freshwater Clam Corbicula Fluminea

    NASA Astrophysics Data System (ADS)

    Falfushynska, Halina I.; Phan, Tuan; Sokolova, Inna M.

    2016-12-01

    Global climate change (GCC) can negatively affect freshwater ecosystems. However, the degree to which freshwater populations can acclimate to long-term warming and the underlying molecular mechanisms are not yet fully understood. We used the cooling water discharge (CWD) area of a power plant as a model for long-term warming. Survival and molecular stress responses (expression of molecular chaperones, antioxidants, bioenergetic and protein synthesis biomarkers) to experimental warming (20–41 °C, +1.5 °C per day) were assessed in invasive clams Corbicula fluminea from two pristine populations and a CWD population. CWD clams had considerably higher (by ~8–12 °C) lethal temperature thresholds than clams from the pristine areas. High thermal tolerance of CWD clams was associated with overexpression of heat shock proteins HSP70, HSP90 and HSP60 and activation of protein synthesis at 38 °C. Heat shock response was prioritized over the oxidative stress response resulting in accumulation of oxidative lesions and ubiquitinated proteins during heat stress in CWD clams. Future studies should determine whether the increase in thermal tolerance in CWD clams are due to genetic adaptation and/or phenotypic plasticity. Overall, our findings indicate that C. fluminea has potential to survive and increase its invasive range during warming such as expected during GCC.

  17. Changes in antioxidants are critical in determining cell responses to short- and long-term heat stress.

    PubMed

    Sgobba, Alessandra; Paradiso, Annalisa; Dipierro, Silvio; De Gara, Laura; de Pinto, Maria Concetta

    2015-01-01

    Heat stress can have deleterious effects on plant growth by impairing several physiological processes. Plants have several defense mechanisms that enable them to cope with high temperatures. The synthesis and accumulation of heat shock proteins (HSPs), as well as the maintenance of an opportune redox balance play key roles in conferring thermotolerance to plants. In this study changes in redox parameters, the activity and/or expression of reactive oxygen species (ROS) scavenging enzymes and the expression of two HSPs were studied in tobacco Bright Yellow-2 (TBY-2) cells subjected to moderate short-term heat stress (SHS) and long-term heat stress (LHS). The results indicate that TBY-2 cells subjected to SHS suddenly and transiently enhance antioxidant systems, thus maintaining redox homeostasis and avoiding oxidative damage. The simultaneous increase in HSPs overcomes the SHS and maintains the metabolic functionality of cells. In contrast the exposure of cells to LHS significantly reduces cell growth and increases cell death. In the first phase of LHS, cells enhance antioxidant systems to prevent the formation of an oxidizing environment. Under prolonged heat stress, the antioxidant systems, and particularly the enzymatic ones, are inactivated. As a consequence, an increase in H2 O2 , lipid peroxidation and protein oxidation occurs. This establishment of oxidative stress could be responsible for the increased cell death. The rescue of cell growth and cell viability, observed when TBY-2 cells were pretreated with galactone-γ-lactone, the last precursor of ascorbate, and glutathione before exposure to LHS, highlights the crucial role of antioxidants in the acquisition of basal thermotolerance.

  18. Beneficial effect of Oligonol supplementation on sweating response under heat stress in humans.

    PubMed

    Lee, Jeong Beom; Shin, Young Oh

    2014-10-01

    Oligonol is a low-molecular weight polyphenol that possesses antioxidant and anti-inflammatory properties. However, nothing is known regarding the impact of Oligonol on sudomotor activity. This study investigated the effects of Oligonol supplementation on sudomotor activity during heat load in humans. Initially, we conducted a placebo-controlled, cross-over trial where participants took a daily dose of Oligonol 200 mg or placebo for one week. After a 2 week washout period, the subjects were switched to the other study arm. As a heat load, half-body immersion into hot water (42 ± 0.5 °C for 30 min) was performed in an automated climate chamber. Tympanic and skin temperatures were measured. Sudomotor activity, including onset time, sweat rate (SR) and volume (SV), active sweat gland density (ASGD), and sweat gland output (SGO), was tested in four or eight areas of skin. When compared with placebo, Oligonol attenuated increases in tympanic and skin temperatures after the heat load. There was an increasing trend in local sweat onset time, but there was a decrease in local SR, SV, ASGD, and SGO for Oligonol compared to placebo. The mean ASGD was significantly higher in the Oligonol group than in the placebo group for 10, 20, and 30 min. This study demonstrates that Oligonol appears to be worthy of consideration as a natural supplement to support more economical use of body fluids against heat stress.

  19. Gene expression profiles of four heat shock proteins in response to different acute stresses in shrimp, Litopenaeus vannamei.

    PubMed

    Qian, Zhaoying; Liu, Xiaolin; Wang, Lijun; Wang, Xianzong; Li, Yang; Xiang, Jianhai; Wang, Ping

    2012-11-01

    Heat shock proteins (HSPs) are a suite of highly conserved proteins well known for their quick responses to environmental stresses. However, the respective roles of different HSPs in response to a particular environmental stress have not received adequate scientific attentions to date. In this study, the expression profiles of four HSP genes (Lvhsp60, Lvhsp70, Lvhsc70, and Lvhsp90) of the Pacific white shrimp, Litopenaeus vannamei under acute thermal stress, pH challenge, and heavy metal exposure were investigated, respectively, using the quantitative real-time reverse transcription polymerase chain reaction technique. Results showed that the four genes exhibited quite different expression profiles when the shrimp were subjected to each of the above stressors. Under acute thermal stress, the messenger RNA (mRNA) levels of all the four genes were significantly induced, and the transcription level of Lvhsp70 was the most sensitive to temperature fluctuations. Under acute pH challenge, the relative mRNA expression of the four genes was shown to be time and pH dependent, and the strongest response occurred in Lvhsp60. Under acute heavy metal exposure, transcripts of each of the four genes varied depending on metal type and exposure time. Lvhsp60 displayed particularly high sensitivity to cadmium and manganese exposure, while Lvhsp70 showed the most sensitive response to iron and zinc treatments. The results obtained suggest that different LvHSP genes may play different roles in mediating cell stress caused by a specific environmental stressor. Given the response sensitivity and intensity of LvHSP genes to environmental stresses, Lvhsp70 may be most suitable to act as a biomarker indicating thermal stress, iron and zinc stimulation, while Lvhsp60 may be a promising candidate marker of pH stress, cadmium and manganese exposure in shrimp. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Physiological and production responses to feeding schedule in lactating dairy cows exposed to short-term, moderate heat stress.

    PubMed

    Ominski, K H; Kennedy, A D; Wittenberg, K M; Moshtaghi Nia, S A

    2002-04-01

    The objective of this research was to characterize the production responses of lactating dairy cows during and after short-term, moderate heat exposure, and to determine whether evening (p.m.) feeding would alleviate the associated production losses. In a two-period, cross-over design, eight mature lactating cows were fed a total mixed ration at either 0830 or 2030 h. Each 15-d period consisted of a 5-d thermoneutral phase, a 5-d heat stress phase and a 5-d thermoneutral recovery phase. Mean daily vaginal temperature and respiration rate increased by 0.6 +/- 0.04 degrees C and 27 +/- 1.3 breaths/min, respectively, during short-term heat exposure. Daily dry matter intake, milk yield and solids-not-fat were depressed by 1.4 +/- 0.13 kg, 1.7 +/- 0.32 kg and 0.07 +/- 0.023%, respectively, during heat exposure. During the recovery phase, dry matter intake remained depressed, milk protein declined by 0.05 +/- 0.020%, and daily milk yield exhibited a further decline of 1.2 +/- 0.32 kg. Time of feeding had no effect on vaginal temperature, respiration rate, dry matter intake, water intake, milk yield, fat-corrected milk, protein percent, solids-non-fat percent or somatic cell count during heat exposure or during the recovery period that followed. Fat percent was, however, significantly lower in p.m.-fed animals. These data indicate that short-term, moderate heat stress, which occurs during the spring and summer months in Canada and the Northern United States, will significantly decrease production in the lactating cow. Shifting from morning to evening feeding did not alleviate production losses associated with this type of heat stress.

  1. Production and physiological responses of heat-stressed lactating dairy cattle to conductive cooling.

    PubMed

    Perano, Kristen M; Usack, Joseph G; Angenent, Largus T; Gebremedhin, Kifle G

    2015-08-01

    The objective of this research was to test the effectiveness of conductive cooling in alleviating heat stress of lactating dairy cows. A conductive cooling system was built with waterbeds (Dual Chamber Cow Waterbeds, Advanced Comfort Technology Inc., Reedsburg, WI) modified to circulate chilled water. The experiment lasted 7 wk. Eight first-lactation Holstein cows producing 34.4±3.7kg/d of milk at 166±28 d in milk were used in the study. Milk yield, dry matter intake (DMI), and rectal temperature were recorded twice daily, and respiration rate was recorded 5 times per day. During wk 1, the cows were not exposed to experimental heat stress or conductive cooling. For the remaining 6 wk, the cows were exposed to heat stress from 0900 to 1700h each day. During these 6 wk, 4 of the 8 cows were cooled with conductive cooling (experimental cows), and the other 4 were not cooled (control cows). The study consisted of 2 thermal environment exposures (temperature-humidity index mean ± standard deviation of 80.7±0.9 and 79.0±1.0) and 2 cooling water temperatures (circulating water through the water mattresses at temperatures of 4.5°C and 10°C). Thus, a total of 4 conductive cooling treatments were tested, with each treatment lasting 1 wk. During wk 6, the experimental and control cows were switched and the temperature-humidity index of 79.0±1.0 with 4.5°C cooling water treatment was repeated. During wk 7, waterbeds were placed directly on concrete stalls without actively cooling the water. Least squares means and P-values for the different treatments were calculated with multivariate mixed models. Conductively cooling the cows with 4.5°C water decreased rectal temperature by 1.0°C, decreased respiration rate by 18 breaths/min, increased milk yield by 5%, and increased DMI by 14% compared with the controls. When the results from the 2 cooling water temperatures (4.5°C and 10°C circulating water) were compared, we found that the rectal temperature from 4.5

  2. Heat shock transcription factors in banana: genome-wide characterization and expression profile analysis during development and stress response

    PubMed Central

    Wei, Yunxie; Hu, Wei; Xia, Feiyu; Zeng, Hongqiu; Li, Xiaolin; Yan, Yu; He, Chaozu; Shi, Haitao

    2016-01-01

    Banana (Musa acuminata) is one of the most popular fresh fruits. However, the rapid spread of fungal pathogen Fusarium oxysporum f. sp. cubense (Foc) in tropical areas severely affected banana growth and production. Thus, it is very important to identify candidate genes involved in banana response to abiotic stress and pathogen infection, as well as the molecular mechanism and possible utilization for genetic breeding. Heat stress transcription factors (Hsfs) are widely known for their common involvement in various abiotic stresses and plant-pathogen interaction. However, no MaHsf has been identified in banana, as well as its possible role. In this study, genome-wide identification and further analyses of evolution, gene structure and conserved motifs showed closer relationship of them in every subgroup. The comprehensive expression profiles of MaHsfs revealed the tissue- and developmental stage-specific or dependent, as well as abiotic and biotic stress-responsive expressions of them. The common regulation of several MaHsfs by abiotic and biotic stress indicated the possible roles of them in plant stress responses. Taken together, this study extended our understanding of MaHsf gene family and identified some candidate MaHsfs with specific expression profiles, which may be used as potential candidates for genetic breeding in banana. PMID:27857174

  3. Linear ubiquitination by LUBEL has a role in Drosophila heat stress response.

    PubMed

    Asaoka, Tomoko; Almagro, Jorge; Ehrhardt, Christine; Tsai, Isabella; Schleiffer, Alexander; Deszcz, Luiza; Junttila, Sini; Ringrose, Leonie; Mechtler, Karl; Kavirayani, Anoop; Gyenesei, Attila; Hofmann, Kay; Duchek, Peter; Rittinger, Katrin; Ikeda, Fumiyo

    2016-11-01

    The HOIP ubiquitin E3 ligase generates linear ubiquitin chains by forming a complex with HOIL-1L and SHARPIN in mammals. Here, we provide the first evidence of linear ubiquitination induced by a HOIP orthologue in Drosophila We identify Drosophila CG11321, which we named Linear Ubiquitin E3 ligase (LUBEL), and find that it catalyzes linear ubiquitination in vitro We detect endogenous linear ubiquitin chain-derived peptides by mass spectrometry in Drosophila Schneider 2 cells and adult flies. Furthermore, using CRISPR/Cas9 technology, we establish linear ubiquitination-defective flies by mutating residues essential for the catalytic activity of LUBEL Linear ubiquitination signals accumulate upon heat shock in flies. Interestingly, flies with LUBEL mutations display reduced survival and climbing defects upon heat shock, which is also observed upon specific LUBEL depletion in muscle. Thus, LUBEL is involved in the heat response by controlling linear ubiquitination in flies.

  4. Proteomic analysis of Potentilla fruticosa L. leaves by iTRAQ reveals responses to heat stress

    PubMed Central

    Guan, Xuelian; Hu, Zenghui; Zhang, Ze; Lu, Yizeng

    2017-01-01

    High temperature is an important environmental factor that affects plant growth and crop yield. Potentilla fruticosa L. has a developed root system and characteristics of resistance to several stresses (e.g., high temperature, cold, drought) that are shared by native shrubs in the north and west of China. To investigate thermotolerance mechanisms in P. fruticosa, 3-year-old plants were subjected to a high temperature of 42°C for 1, 2, and 3 days respectively before analysis. Then, we studied changes in cell ultrastructure using electron microscopy and investigated physiological changes in the leaves of P. fruticosa. Additionally, we used isobaric tags for relative and absolute quantification (iTRAQ) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) to study proteomic changes in P. fruticosa leaves after 3 d of 42°C heat stress. we found that the cell membrane and structure of chloroplasts, especially the thylakoids in P. fruticosa leaves, was destroyed by a high temperature stress, which might affect the photosynthesis in this species. We identified 35 up-regulated and 23 down-regulated proteins after the heat treatment. Gene Ontology (GO) analysis indicated that these 58 differentially abundant proteins were involved mainly in protein synthesis, protein folding and degradation, abiotic stress defense, photosynthesis, RNA process, signal transduction, and other functions. The 58 proteins fell into different categories based on their subcellular localization mainly in the chloroplast envelope, cytoplasm, nucleus, cytosol, chloroplast, mitochondrion and cell membrane. Five proteins were selected for analysis at the mRNA level; this analysis showed that gene transcription levels were not completely consistent with protein abundance. These results provide valuable information for Potentilla thermotolerance breeding. PMID:28829780

  5. Transcriptional profiling of maturing tomato (Solanum lycopersicum L.) microspores reveals the involvement of heat shock proteins, ROS scavengers, hormones, and sugars in the heat stress response

    PubMed Central

    Frank, Gil; Pressman, Etan; Ophir, Ron; Althan, Levia; Shaked, Rachel; Freedman, Moshe; Shen, Shmuel; Firon, Nurit

    2009-01-01

    Above-optimal temperatures reduce yield in tomato largely because of the high heat stress (HS) sensitivity of the developing pollen grains. The high temperature response, especially at this most HS-sensitive stage of the plant, is poorly understood. To obtain an overview of molecular mechanisms underlying the HS response (HSR) of microspores, a detailed transcriptomic analysis of heat-stressed maturing tomato microspores was carried out using a combination of Affymetrix Tomato Genome Array and cDNA-amplified fragment length polymorphism (AFLP) techniques. The results were corroborated by reverse transcription-PCR (RT-PCR) and immunoblot analyses. The data obtained reveal the involvement of specific members of the small heat shock protein (HSP) gene family, HSP70 and HSP90, in addition to the HS transcription factors A2 (HSFA2) and HSFA3, as well as factors other than the classical HS-responsive genes. The results also indicate HS regulation of reactive oxygen species (ROS) scavengers, sugars, plant hormones, and regulatory genes that were previously implicated in other types of stress. The use of cDNA-AFLP enabled the detection of genes representing pollen-specific functions that are missing from the tomato Affymetrix chip, such as those involved in vesicle-mediated transport and a pollen-specific, calcium-dependent protein kinase (CDPK2). For several genes, including LeHSFA2, LeHSP17.4-CII, as well as homologues of LeHSP90 and AtVAMP725, higher basal expression levels were detected in microspores of cv. Hazera 3042 (a heat-tolerant cultivar) compared with microspores of cv. Hazera 3017 (a heat-sensitive cultivar), marking these genes as candidates for taking part in microspore thermotolerance. This work provides a comprehensive analysis of the molecular events underlying the HSR of maturing microspores of a crop plant, tomato. PMID:19628571

  6. Transcriptional profiling of maturing tomato (Solanum lycopersicum L.) microspores reveals the involvement of heat shock proteins, ROS scavengers, hormones, and sugars in the heat stress response.

    PubMed

    Frank, Gil; Pressman, Etan; Ophir, Ron; Althan, Levia; Shaked, Rachel; Freedman, Moshe; Shen, Shmuel; Firon, Nurit

    2009-01-01

    Above-optimal temperatures reduce yield in tomato largely because of the high heat stress (HS) sensitivity of the developing pollen grains. The high temperature response, especially at this most HS-sensitive stage of the plant, is poorly understood. To obtain an overview of molecular mechanisms underlying the HS response (HSR) of microspores, a detailed transcriptomic analysis of heat-stressed maturing tomato microspores was carried out using a combination of Affymetrix Tomato Genome Array and cDNA-amplified fragment length polymorphism (AFLP) techniques. The results were corroborated by reverse transcription-PCR (RT-PCR) and immunoblot analyses. The data obtained reveal the involvement of specific members of the small heat shock protein (HSP) gene family, HSP70 and HSP90, in addition to the HS transcription factors A2 (HSFA2) and HSFA3, as well as factors other than the classical HS-responsive genes. The results also indicate HS regulation of reactive oxygen species (ROS) scavengers, sugars, plant hormones, and regulatory genes that were previously implicated in other types of stress. The use of cDNA-AFLP enabled the detection of genes representing pollen-specific functions that are missing from the tomato Affymetrix chip, such as those involved in vesicle-mediated transport and a pollen-specific, calcium-dependent protein kinase (CDPK2). For several genes, including LeHSFA2, LeHSP17.4-CII, as well as homologues of LeHSP90 and AtVAMP725, higher basal expression levels were detected in microspores of cv. Hazera 3042 (a heat-tolerant cultivar) compared with microspores of cv. Hazera 3017 (a heat-sensitive cultivar), marking these genes as candidates for taking part in microspore thermotolerance. This work provides a comprehensive analysis of the molecular events underlying the HSR of maturing microspores of a crop plant, tomato.

  7. Hypohydration and Acclimation: Effects on Hormone Responses to Excercise/Heat Stress.

    DTIC Science & Technology

    1983-03-15

    increased rectal temperature and heart rate and decreased sweat rate (19). Gaebelein and Senay (9) also demonstrated an increased physiological cost ( heart ... increased plasma volume associated with heat acclimation (21), assuming that the increased plasma volume would permit an elevated sweat rate and more...AD-A127 855 HYPOHYDRATION AND ACCLIMATION: EFFECTS ON HORMONE i/I RESPONSES TO EXCERCISE /..(U) ARMY RESEARCH INST OF ENVIRONMENTAL MEDICINE NATICK MR

  8. Acquired thermotolerance independent of heat shock factor A1 (HsfA1), the master regulator of the heat stress response.

    PubMed

    Liu, Hsiang-chin; Charng, Yee-yung

    2012-05-01

    The heat stress (HS) response in eukaryotes is mainly regulated by heat shock factors (HSFs). Genetic disruption of the master HSF gene leads to dramatically reduced HS response and thermotolerance in several model organisms. However, it is not clear whether organisms devoid of the master regulator can still acclimate to heat. Previously, we showed that Arabidopsis HsfA1a, HsfA1b, and HsfA1d act as master regulators in the HS response. In this study, we examined the heat acclimation capacity of the Arabidopsis quadruple and triple T-DNA knockout mutants of HsfA1a, HsfA1b, HsfA1d, and HsfA1e. Our data showed that in the absence of the master regulators, a minimal but significant level of acquired thermotolerance could be attained in the Arabidopsis mutants after acclimation. The optimum acclimation temperature for the HsfA1 quadruple mutant was lower than that for the wild type plants, suggesting that plant cells have two HS-sensing mechanisms that can be distinguished genetically. The acquired thermotolerance of the quadruple mutant was likely due to the induction of a small number of HsfA1-independent HS response genes regulated by other transcription factors. Here, we discuss the possible candidates and propose a working model of the transcription network of the HS response by including the HsfA1-dependent and -independent pathways.

  9. Differential response of aspen and birch trees to heat stress under elevated carbon dioxide.

    PubMed

    Darbah, Joseph N T; Sharkey, Thomas D; Calfapietra, Carlo; Karnosky, David F

    2010-04-01

    The effect of high temperature on photosynthesis of isoprene-emitting (aspen) and non-isoprene-emitting (birch) trees were measured under elevated CO(2) and ambient conditions. Aspen trees tolerated heat better than birch trees and elevated CO(2) protected photosynthesis of both species against moderate heat stress. Elevated CO(2) increased carboxylation capacity, photosynthetic electron transport capacity, and triose phosphate use in both birch and aspen trees. High temperature (36-39 degrees C) decreased all of these parameters in birch regardless of CO(2) treatment, but only photosynthetic electron transport and triose phosphate use at ambient CO(2) were reduced in aspen. Among the two aspen clones tested, 271 showed higher thermotolerance than 42E possibly because of the higher isoprene-emission, especially under elevated CO(2). Our results indicate that isoprene-emitting trees may have a competitive advantage over non-isoprene emitting ones as temperatures rise, indicating that biological diversity may be affected in some ecosystems because of heat tolerance mechanisms. Published by Elsevier Ltd.

  10. SpiE interacts with Corynebacterium glutamicum WhcE and is involved in heat and oxidative stress responses.

    PubMed

    Park, Jung Chul; Park, Joon-Song; Kim, Younhee; Kim, Pil; Kim, Eung Soo; Lee, Heung-Shick

    2016-05-01

    The gene whcE in Corynebacterium glutamicum positively responds to oxidative and heat stress. To search for proteins that interact with WhcE, we employed a two-hybrid system with WhcE as the bait. Sequencing analysis of the isolated clones revealed peptide sequences, one of which showed high sequence identity to a hydrophobe/amphiphile efflux-1 family transporter encoded by NCgl1497. The interaction of the NCgl1497-encoded protein with WhcE in vivo was verified using reporter gene expression by real-time quantitative PCR (RT-qPCR). The WhcE protein strongly interacted with the NCgl1497-encoded protein in the presence of oxidative and heat stress. Furthermore, purified WhcE and NCgl1497-encoded proteins interacted in vitro, especially in the presence of the oxidant diamide, and the protein-protein interaction was disrupted in the presence of the reductant dithiothreitol. In addition, the transcription of NCgl1497 was activated approximately twofold in diamide- or heat-treated cells. To elucidate the function of the NCgl497 gene, an NCgl1497-deleted mutant strain was constructed. The mutant showed decreased viability in the presence of diamide and heat stress. The mutant strain also exhibited reduced transcription of the thioredoxin reductase gene, which is known to be regulated by whcE. Based on the results, NCgl1497 was named spiE (stress protein interacting with WhcE). Collectively, our data suggest that spiE is involved in the whcE-mediated oxidative stress response pathway of C. glutamicum.

  11. Dissecting the heat stress response in Chlamydomonas by pharmaceutical and RNAi approaches reveals conserved and novel aspects.

    PubMed

    Schmollinger, Stefan; Schulz-Raffelt, Miriam; Strenkert, Daniela; Veyel, Daniel; Vallon, Olivier; Schroda, Michael

    2013-11-01

    To study how conserved fundamental concepts of the heat stress response (HSR) are in photosynthetic eukaryotes, we applied pharmaceutical and antisense/amiRNA approaches to the unicellular green alga Chlamydomonas reinhardtii. The Chlamydomonas HSR appears to be triggered by the accumulation of unfolded proteins, as it was induced at ambient temperatures by feeding cells with the arginine analog canavanine. The protein kinase inhibitor staurosporine strongly retarded the HSR, demonstrating the importance of phosphorylation during activation of the HSR also in Chlamydomonas. While the removal of extracellular calcium by the application of EGTA and BAPTA inhibited the HSR in moss and higher plants, only the addition of BAPTA, but not of EGTA, retarded the HSR and impaired thermotolerance in Chlamydomonas. The addition of cycloheximide, an inhibitor of cytosolic protein synthesis, abolished the attenuation of the HSR, indicating that protein synthesis is necessary to restore proteostasis. HSP90 inhibitors induced a stress response when added at ambient conditions and retarded attenuation of the HSR at elevated temperatures. In addition, we detected a direct physical interaction between cytosolic HSP90A/HSP70A and heat shock factor 1, but surprisingly this interaction persisted after the onset of stress. Finally, the expression of antisense constructs targeting chloroplast HSP70B resulted in a delay of the cell's entire HSR, thus suggesting the existence of a retrograde stress signaling cascade that is desensitized in HSP70B-antisense strains.

  12. Combination of two oxidant stressors suppresses the oxidative stress and enhances the heat shock protein 27 response in healthy humans.

    PubMed

    Brerro-Saby, Christelle; Delliaux, Stephane; Steinberg, Jean Guillaume; Boussuges, Alain; Gole, Yoann; Jammes, Yves

    2010-06-01

    We tested the hypothesis that the combination of 2 oxidant stressors (hyperoxia and fatiguing exercise) might reduce or suppress the oxidative stress. We concomitantly measured the plasma concentration of heat shock proteins (Hsp) that protect the cells against the deleterious effects of reactive oxygen species. Healthy humans breathed pure oxygen under normobaric condition for 50-minute periods during which they stayed at rest or executed maximal static handgrip sustained until exhaustion. They also repeated handgrip bouts in normoxic condition. We performed venous blood measurements of 2 markers of the oxidative stress (thiobarbituric acid reactive substances and reduced ascorbic acid) and Hsp27. Under normoxic condition, the handgrip elicited an oxidative stress and a modest increase in plasma Hsp27 level (+7.1 +/- 5.4 ng/mL). Under hyperoxic condition, (1) at rest, compared with the same time schedule in normoxic condition, we measured an oxidative stress (increased thiobarbituric acid reactive substances and decreased reduced ascorbic acid levels) and the plasma Hsp27 level increased (maximal variation, +12.5 +/- 6.0 ng/mL); and (2) after the handgrip, the oxidative stress rapidly disappeared. The combination of both hyperoxia and handgrip bout doubled the Hsp27 response (maximal variation, +24.8 +/- 9.2 ng/mL). Thus, the combination of 2 hits eliciting an oxidative stress seems to induce an adaptive Hsp27 response that might counterbalance an excessive production of reactive oxygen species. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Response of heat shock protein genes of the oriental fruit moth under diapause and thermal stress reveals multiple patterns dependent on the nature of stress exposure.

    PubMed

    Zhang, Bo; Peng, Yu; Zheng, Jincheng; Liang, Lina; Hoffmann, Ary A; Ma, Chun-Sen

    2016-07-01

    Heat shock protein gene (Hsp) families are thought to be important in thermal adaptation, but their expression patterns under various thermal stresses have still been poorly characterized outside of model systems. We have therefore characterized Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta, a widespread global orchard pest, and compared patterns of expression in this species to that of other insects. Genes from four Hsp families showed variable expression levels among tissues and developmental stages. Members of the Hsp40, 70, and 90 families were highly expressed under short exposures to heat and cold. Expression of Hsp40, 70, and Hsc70 family members increased in OFM undergoing diapause, while Hsp90 was downregulated. We found that there was strong sequence conservation of members of large Hsp families (Hsp40, Hsp60, Hsp70, Hsc70) across taxa, but this was not always matched by conservation of expression patterns. When the large Hsps as well as small Hsps from OFM were compared under acute and ramping heat stress, two groups of sHsps expression patterns were apparent, depending on whether expression increased or decreased immediately after stress exposure. These results highlight potential differences in conservation of function as opposed to sequence in this gene family and also point to Hsp genes potentially useful as bioindicators of diapause and thermal stress in OFM.

  14. Environmental heat stress modulates thyroid status and its response to repeated endotoxin challenge in steers.

    PubMed

    Kahl, S; Elsasser, T H; Rhoads, R P; Collier, R J; Baumgard, L H

    2015-07-01

    The objective of this study was to evaluate in cattle, the effects of acute exposure to a heat stress (HS) environment on the status of the pituitary (thyrotropin, TSH)-thyroid (thyroxine, T4)-peripheral tissue T4 deiodination (type 1 5'-deiodinase [D1]; triiodothyronine [T3]; reverse-triiodothyronine [rT3]) axis, and the further response of this pituitary-thyroid-peripheral tissue axis (PTTA) to perturbation caused by the induction of the proinflammatory innate immune state provoked by the administration of gram-negative bacteria endotoxin (lipopolysaccharide [LPS]). Ten steers (318 ± 49 kg body weight) housed in controlled environment chambers were subjected to either a thermoneutral (TN: constant 19°C) or HS temperature conditions (cyclical daily temperatures: 32.2°C-40.0°C) for a total period of 9 d. To minimize the effects of altered plane of nutrition due to HS, steers in TN were pair-fed to animals in HS conditions. Steers received 2 LPS challenges 3 d apart (LPS1 and LPS2; 0.2 μg/kg body weight, intravenously, Escherichia coli 055:B5) with the first challenge administered on day 4 relative to the start of the environmental conditioning. Jugular blood samples were collected at 0, 1, 2, 4, 7, and 24 h relative to the start of each LPS challenge. Plasma TSH, T4, T3, and rT3 were measured by radioimmunoassay. Liver D1 activity was measured in biopsy samples collected before the LPS1 (0 h) and 24 h after LPS2. Before the start of LPS1, HS decreased (P < 0.01 vs TN) plasma TSH (40%), T4 (45.4%), and T3 (25.9%), but did not affect rT3 concentrations. In TN steers, the LPS1 challenge decreased (P < 0.01 vs 0 h) plasma concentrations of TSH between 1 and 7 h and T4 and T3 at 7 and 24 h. In HS steers, plasma TSH concentrations were decreased at 2 h only (P < 0.05), whereas plasma T3 was decreased at 7 and 24 h (P < 0.01). Whereas plasma T4 concentrations were already depressed in HS steers at 0 h, LPS1 did not further affect the levels. Plasma rT3 concentrations

  15. Channel catfish hemoglobin genes: identification, phylogenetic and syntenic analysis, and specific induction in response to heat stress.

    PubMed

    Feng, Jianbin; Liu, Shikai; Wang, Xiuli; Wang, Ruijia; Zhang, Jiaren; Jiang, Yanliang; Li, Chao; Kaltenboeck, Ludmilla; Li, Jiale; Liu, Zhanjiang

    2014-03-01

    Hemoglobins transport oxygen from gill to inner organs in fish, and this process is affected by temperature, one of the major environmental factors for fish. The hemoglobin gene clusters have been well studied in humans and several model fish species, but remain largely unknown in catfish. Here, eight α- and six β-hemoglobin genes were identified and characterized in channel catfish. Genomic synteny analysis showed that these hemoglobin genes were separated into two unlinked clusters, the MN cluster containing six α- and six β-hemoglobin genes, and the LA cluster consisting of two α-hemoglobin genes. Channel catfish hemoglobin genes were ubiquitously expressed in all the 10 tested tissues from healthy fish, but exhibited higher expression level in spleen, head kidney, and trunk kidney. In response to heat stress, hemoglobin genes, especially MN Hbα4, MN Hbα5, MN Hbα6, MN Hbβ4, MN Hbβ5, MN Hbβ6, LA Hbα1, and LA Hbα2, presumably the embryonic hemoglobin genes, were drastically up-regulated in the gill and head kidney of heat-tolerant fishes, but not in these tissues of the heat-intolerant fish, suggesting the importance of the embryonic hemoglobin genes in coping with the low oxygen conditions under heat stress.

  16. Nicotinamide Mononucleotide Adenylyltransferase Is a Stress Response Protein Regulated by the Heat Shock Factor/Hypoxia-inducible Factor 1α Pathway*

    PubMed Central

    Ali, Yousuf O.; McCormack, Ryan; Darr, Andrew; Zhai, R. Grace

    2011-01-01

    Stress responses are cellular processes essential for maintenance of cellular integrity and defense against environmental and intracellular insults. Neurodegenerative conditions are linked with inadequate stress responses. Several stress-responsive genes encoding neuroprotective proteins have been identified, and among them, the heat shock proteins comprise an important group of molecular chaperones that have neuroprotective functions. However, evidence for other critical stress-responsive genes is lacking. Recent studies on the NAD synthesis enzyme nicotinamide mononucleotide adenylyltransferase (NMNAT) have uncovered a novel neuronal maintenance and protective function against activity-, injury-, or misfolded protein-induced degeneration in Drosophila and in mammalian neurons. Here, we show that NMNAT is also a novel stress response protein required for thermotolerance and mitigation of oxidative stress-induced shortened lifespan. NMNAT is transcriptionally regulated during various stress conditions including heat shock and hypoxia through heat shock factor (HSF) and hypoxia-inducible factor 1α in vivo. HSF binds to nmnat promoter and induces NMNAT expression under heat shock. In contrast, under hypoxia, HIF1α up-regulates NMNAT indirectly through the induction of HSF. Our studies provide an in vivo mechanism for transcriptional regulation of NMNAT under stress and establish an essential role for this neuroprotective factor in cellular stress response. PMID:21478149

  17. Heat Stress Response in Pea Involves Interaction of Mitochondrial Nucleoside Diphosphate Kinase with a Novel 86-Kilodalton Protein1

    PubMed Central

    Escobar Galvis, Martha L.; Marttila, Salla; Håkansson, Gunilla; Forsberg, Jens; Knorpp, Carina

    2001-01-01

    In this work we have further characterized the first mitochondrial nucleoside diphosphate kinase (mtNDPK) isolated from plants. The mitochondrial isoform was found to be especially abundant in reproductive and young tissues. Expression of the pea (Pisum sativum L. cv Oregon sugarpod) mtNDPK was not affected by different stress conditions. However, the pea mtNDPK was found to interact with a novel 86-kD protein, which is de novo synthesized in pea leaves upon exposure to heat. Thus, we have evidence for the involvement of mtNDPK in mitochondrial heat response in pea in vivo. Studies on oligomerization revealed that mtNDPK was found in complexes of various sizes, corresponding to the sizes of e.g. hexamers, tetramers, and dimers, indicating flexibility in oligomerization. This flexibility, also found for other NDPK isoforms, has been correlated with the ability of this enzyme to interact with other proteins. We believe that the mtNDPK is involved in heat stress response in pea, possibly as a modulator of the 86-kD protein. PMID:11351071

  18. Rapid IV versus oral rehydration: responses to subsequent exercise heat stress.

    PubMed

    Kenefick, Robert W; O'Moore, Kathleen M; Mahood, Nicholas V; Castellani, John W

    2006-12-01

    This study sought to determine the effect of rapid intravenous (IV) versus oral (ORAL) rehydration immediately after dehydration, on cardiovascular, thermoregulatory, and perceptual responses during subsequent exercise in the heat. Eight males (21.4 +/- 0.7 yr; 176.2 +/- 1.6 cm; 75.2 +/- 3.7 kg; 63.7 +/- 3.6 mL.kg.min VO2max, 9.0 +/- 1.7% fat) participated in three randomized trials. Each trial consisted of a 75-min dehydration phase (36 degrees C; 42.5% rh, 47 +/- 0.9% VO2max) where subjects lost 1.7 L (IV and no-fluid (NF) trials) to 1.8 L of fluid (ORAL trial). In the heat, fluid lost was matched with 0.45% saline in 20 min by either IV or ORAL rehydration; no fluid was given in the NF trial. Subjects then performed a heat-tolerance test (HTT; 37.0 degrees C, 45% rh, treadmill speed of 2.4 m.s, 2.3% grade) for 75 min or until exhaustion (Tre of 39.5 degrees C). During the HTT, thermal and thirst sensations, RPE, rectal temperature (Tre), heart rate (HR), and mean weighted skin temperature (Tsk) were measured. Plasma volume in the IV treatment was greater (P < 0.05) after rehydration compared with ORAL and NF. However, during the HTT there were no overall differences (P > 0.05) in HR, Tre, Tsk, RPE, thermal sensations, or HTT time (ORAL, 71 +/- 8 min; IV, 73 +/- 5 min; NF, 39 +/- 29 min) between the ORAL and IV treatments. Sensations of thirst were lower (P < 0.05) in ORAL compared with IV and NF, likely because of oropharyngeal stimuli. Despite a more rapid restoration of plasma volume, IV rehydration was not advantageous over ORAL rehydration in regards to physiological strain, heat tolerance, RPE, or thermal sensations.

  19. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa.

    PubMed

    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

    2015-01-01

    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5- 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included 'response to heat', 'response to reactive oxygen species (ROS)', 'response to temperature stimulus', 'response to abiotic stimulus', and 'MAPKKK cascade'. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data could also provide a

  20. The effects of vitamin C and E supplementation on heat shock protein 70 response of ovary and brain in heat-stressed quail.

    PubMed

    Sahin, N; Tuzcu, M; Orhan, C; Onderci, M; Eroksuz, Y; Sahin, K

    2009-03-01

    1. The effects of vitamin C (L-ascorbic acid) and vitamin E (alpha-tocopherol acetate) supplementation on egg production and heat shock protein 70 (Hsp70) response of ovary and brain in the Japanese quail (Coturnix coturnix japonica) exposed to high ambient temperature were evaluated. 2. The birds (n = 540; 55 d old) were randomly assigned to 18 groups consisting of 3 replicates of 10 birds each in a 2 x 3 x 3 factorial arrangement of treatments. Birds were kept in wire cages in a temperature-controlled room at either 22 degrees C (thermo-neutral, TN) or 34 degrees C (heat stress, HS) for 8 h/d (09:00 to 17:00 h; until the end of the study) and fed on a basal diet or the basal diet supplemented with either three levels of vitamin C (0, 250 and 500 mg of L-ascorbic acid/kg of diet) or three levels of vitamin E (0, 250 and 500 mg of dl-alpha-tocopheryl acetate/kg of diet). 3. Feed intake and egg production were not affected by vitamin C and E supplementation under thermo-neutral conditions. However, feed intake and egg production were increased with the vitamin C or E supplementation either singly or in combination in heat-stressed quail. When vitamin was added, feed intake and egg production of quails under TN were different from those raised under HS. However, in the absence of supplemental vitamins, feed intake and egg production at TN and HS were no different. 4. Heat exposure increased serum corticosterone levels and Hsp70 expression. Serum corticosterone level was significantly decreased by vitamin C or E supplementation in HS groups for quail. Ovary and brain Hsp70 expression linearly decreased as dietary vitamin C or vitamin E supplementation increased in heat-stressed groups. However, Hsp70 expression of ovary and brain was not affected by vitamin C or E supplementation under thermo-neutral conditions. 5. The present study showed that a combination of dietary vitamin C (500 mg) and E supplementation (500 mg) may alleviate some heat stress effects of heat

  1. Growth, immune, antioxidant, and bone responses of heat stress-exposed broilers fed diets supplemented with tomato pomace

    NASA Astrophysics Data System (ADS)

    Hosseini-Vashan, S. J.; Golian, A.; Yaghobfar, A.

    2016-08-01

    A study was conducted to investigate the effects of supplementation of dried tomato pomace (DTP) on growth performance, relative weights of viscera, serum biological parameters, antioxidant status, immune response, and bone composition of broilers exposed to a high ambient temperature. A total of 352 one-day-old male broiler chickens were randomly divided into four groups consisting of four replicates with 22 birds each. One group was reared under the thermoneutral zone and fed a corn-soybean meal basal diet. The other three groups were subjected to a cyclic heat stress from 29 to 42 days of age (34 ± 1 °C, 55 % RH, 5 h/day). These birds were fed corn-soybean meal basal diet or the same diet supplemented with 3 % DTP (420 mg lycopene/kg diet) or 5 % (708 mg lycopene/kg diet) of DTP. Blood samples were collected on days 28 and 42, and the birds were slaughtered at the same times. Supplementation of 5 % of DTP increased body weight and production index and decreased feed conversion ratio during 1-28 days of age. On day 28, the broilers supplemented with 5 % DTP had lower serum triglycerides and higher high-density lipoprotein (HDL) cholesterol concentration than those on the other dietary treatments. The activities of glutathione peroxidase (GPx) and superoxide dismutase (SOD) were higher and the concentration of malondialdehyde (MDA) was lower in the broilers fed 5 % TP than those of the broilers fed other diets at 28 days of age. The effects of heat stress (HS) were impaired body weight, enhanced serum activities of alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, lipase, and MDA concentration while reducing the activities of GPx and SOD. Dried tomato pomace supplementation did not influence growth performance under HS but ameliorated the negative effects of HS on the serum enzyme activities, GPx activity, and lipid peroxidation. Heat stress did not change the relative weights of the lymphoid organs but reduced the total and IgG titers

  2. Ensuring Reproduction at High Temperatures: The Heat Stress Response during Anther and Pollen Development

    PubMed Central

    Giorno, Filomena; Wolters-Arts, Mieke; Mariani, Celestina; Rieu, Ivo

    2013-01-01

    Sexual reproduction in flowering plants is very sensitive to environmental stresses, particularly to thermal insults which frequently occur when plants grow in field conditions in the warm season. Although abnormalities in both male and female reproductive organs due to high temperatures have been described in several crops, the failure to set fruits has mainly been attributed to the high sensitivity of developing anthers and pollen grains, particularly at certain developmental stages. A global view of the molecular mechanisms involved in the response to high temperatures in the male reproductive organs will be presented in this review. In addition, transcriptome and proteomic data, currently available, will be discussed in the light of physiological and metabolic changes occurring during anther and pollen development. A deep understanding of the molecular mechanisms involved in the stress response to high temperatures in flowers and, particularly, in the male reproductive organs will be a major step towards development of effective breeding strategies for high and stable production in crop plants. PMID:27137389

  3. Heat shock factors in carrot: genome-wide identification, classification, and expression profiles response to abiotic stress.

    PubMed

    Huang, Ying; Li, Meng-Yao; Wang, Feng; Xu, Zhi-Sheng; Huang, Wei; Wang, Guang-Long; Ma, Jing; Xiong, Ai-Sheng

    2015-05-01

    Heat shock factors (HSFs) play key roles in the response to abiotic stress in eukaryotes. In this study, 35 DcHSFs were identified from carrot (Daucus carota L.) based on the carrot genome database. All 35 DcHSFs were divided into three classes (A, B, and C) according to the structure and phylogenetic relationships of four different plants, namely, Arabidopsis thaliana, Vitis vinifera, Brassica rapa, and Oryza sativa. Comparative analysis of algae, gymnosperms, and angiosperms indicated that the numbers of HSF transcription factors were related to the plant's evolution. The expression profiles of five DcHsf genes (DcHsf 01, DcHsf 02, DcHsf 09, DcHsf 10, and DcHsf 16), which selected from each subfamily (A, B, and C), were detected by quantitative real-time PCR under abiotic stresses (cold, heat, high salinity, and drought) in two carrot cultivars, D. carota L. cvs. Kurodagosun and Junchuanhong. The expression levels of DcHsfs were markedly increased by heat stress, except that of DcHsf 10, which was down regulated. The expression profiles of different DcHsfs in the same class also differed under various stress treatments. The expression profiles of these DcHsfs were also different in tissues of two carrot cultivars. This study is the first to identify and characterize the DcHSF family transcription factors in plants of Apiaceae using whole-genome analysis. The results of this study provide an in-depth understanding of the DcHSF family transcription factors' structure, function, and evolution in carrot.

  4. Involvement of ERK1/2 signalling and growth-related molecules' expression in response to heat stress-induced damage in rat jejunum and IEC-6 cells.

    PubMed

    Yu, Jin; Yin, Peng; Yin, Jingdong; Liu, Fenghua; Zhu, Xiaoyu; Cheng, Guiling; Guo, Kaijun; Yin, Yulong; Xu, Jianqin

    2010-01-01

    Our previous studies found small intestine epithelial tissues from several different animals (including rats, pigs and chickens) became significantly damaged following exposure to extreme heat. However, damaged tissue was rapidly repaired or regenerated in the following few days. Growth-related molecules are critical for cellular survival and promote endothelial cell proliferation and migration. The ERK1/2 signalling pathway is reported to regulate the growth and adaptation of endothelial cells to both physiological and pathological stimuli. However, little information is available concerning both growth-related molecules and ERK1/2 in response to heat stress. Herein, we employed both live rats and rat IEC-6 cells to investigate growth-related molecule expression and ERK1/2 activation in heat stress. Heat stress caused significant morphological damage to rat intestinal tissue and IEC-6 cells, reduced cell growth and proliferation, induced apoptosis, altered growth-related molecule mRNA expression and increased ERK1/2 phosphorylation. Addition of U0126 (a selective inhibitor of MEK kinase responsible for ERK phosphorylation) combined with heat stress exacerbated the morphological damage and apoptosis. With the addition of U0126, further up- or down-regulation of Egfr, Ctgf, Tgif, Vegfa, Okl38 and Gdf15 in response to heat stress was observed. In conclusion, extreme heat stress caused obvious damage to rat jejunum and IEC-6 cells. Both growth-related molecule expression and ERK1/2 phosphorylation were involved in response to heat stress. ERK1/2 inhibition exacerbated apoptosis and affected growth factor mRNA expression in heat stress.

  5. Thermotolerance and heat stress responses of Douglas-fir and ponderosa pine seedling populations from contrasting climates

    Treesearch

    Danielle E. Marias; Frederick C. Meinzer; David R. Woodruff; Katherine A. McCulloh; David Tissue

    2016-01-01

    Temperature and the frequency and intensity of heat waves are predicted to increase throughout the 21st century. Germinant seedlings are expected to be particularly vulnerable to heat stress because they are in the boundary layer close to the soil surface where intense heating occurs in open habitats. We quantified leaf thermotolerance and whole-plant physiological...

  6. Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

    PubMed Central

    Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

    2015-01-01

    Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data

  7. Stress Responses of Small Heat Shock Protein Genes in Lepidoptera Point to Limited Conservation of Function across Phylogeny

    PubMed Central

    Zhang, Bo; Zheng, Jincheng; Peng, Yu; Liu, Xiaoxia; Hoffmann, Ary A.; Ma, Chun-Sen

    2015-01-01

    The small heat shock protein (sHsp) family is thought to play an important role in protein refolding and signal transduction, and thereby protect organisms from stress. However little is known about sHsp function and conservation across phylogenies. In the current study, we provide a comprehensive assessment of small Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta. Fourteen small heat shock proteins of OFM clustered with related Hsps in other Lepidoptera despite a high level of variability among them, and in contrast to the highly conserved Hsp11.1. The only known lepidopteran sHsp ortholog (Hsp21.3) was consistently unaffected under thermal stress in Lepidoptera where it has been characterized. However the phylogenetic position of the sHsps within the Lepidoptera was not associated with conservation of induction patterns under thermal extremes or diapause. These findings suggest that the sHsps have evolved rapidly to develop new functions within the Lepidoptera. PMID:26196395

  8. Protecting Workers from Heat Stress

    MedlinePlus

    ... temperatures are high and the job involves physical work. Risk Factors for Heat Illness • High temperature and humidity, ... heat or those that have been away from work to adapt to working in the heat (acclimatization). • Routinely check workers who are at risk of heat stress due to protective clothing and ...

  9. Heat Stress Effects on Growing-Finishing Swine

    USDA-ARS?s Scientific Manuscript database

    Understanding the factors that create heat stress, the response of the animals while under heat stress, and the signs of heat-stressed swine are essential to making rational decisions for the selection, design, and management of their environments. Heat stressors include combinations of environment...

  10. Estrogen deprivation does not affect vascular heat shock response in female rats: a comparison with oxidative stress markers.

    PubMed

    Miragem, Antônio Azambuja; Ludwig, Mirna Stela; Heck, Thiago Gomes; Baldissera, Fernanda Giesel; dos Santos, Analu Bender; Frizzo, Matias Nunes; Homem de Bittencourt, Paulo Ivo

    2015-09-01

    Hot flashes, which involve a tiny rise in core temperature, are the most common complaint of peri- and post-menopausal women, being tightly related to decrease in estrogen levels. On the other hand, estradiol (E2) induces the expression of HSP72, a member of the 70 kDa family of heat shock proteins (HSP70), which are cytoprotective, cardioprotective, and heat inducible. Since HSP70 expression is compromised in age-related inflammatory diseases, we argued whether the capacity of triggering a robust heat shock (HS) response would be still present after E2 withdrawal. Hence, we studied the effects of HS treatment (hot tub) in female Wistar rats subjected to bilateral ovariectomy (OVX) after a 7-day washout period. Twelve h after HS, the animals were killed and aortic arches were surgically excised for molecular analyses. The results were compared with oxidative stress markers in the plasma (superoxide dismutase, catalase, and lipoperoxidation) because HSP70 expression is also sensitive to redox regulation. Extracellular (plasma) to intracellular HSP70 ratio, an index of systemic inflammatory status, was also investigated. The results showed that HS response was preserved in OVX animals, as inferred from HSP70 expression (up to 40% rise, p < 0.01) in the aortas, which was accompanied by no further alterations in oxidative stress, hematological parameters, and glycemic control either. This suggests that the lack of estrogen per se could not be solely ascribed as the unique source of low HSP70 expression as observed in long-term post-menopausal individuals. As a consequence, periodic evaluation of HSP70 status (iHSP70 vs. eHSP70) may be of clinical relevance because decreased HS response capacity is at the center of the onset of menopause-related dysfunctions.

  11. Heat stress in pigs is accompanied by adipose tissue-specific responses that favor increased triglyceride storage.

    PubMed

    Qu, H; Yan, H; Lu, H; Donkin, S S; Ajuwon, K M

    2016-05-01

    Heat stress (HS) negatively affects all aspects of performance in pigs. Although certain tissue-specific responses in the liver, skeletal muscle, and intestine are known, there is paucity of information on responses within the adipose tissue. Therefore, the objective of this study was to delineate adipose tissue responses during HS in pigs. Thirty crossbred (Ossabaw × Duroc × Landrace) pigs were assigned to 3 treatments for 7 d. Treatments were 1) control and libitum fed (CON) with room temperature set at 20°C ± 1°C, 2) pair fed (PF) with room temperature as the CON treatment but pair fed to HS pigs, and 3) HS with room temperature 35°C ± 1°C and ad libitum access to feed. Compared with CON pigs, HS pigs had decreased feed intake and elevated skin temperature and respiration rate ( < 0.01). Blood urea nitrogen was higher ( = 0.01) in HS pigs compared with CON pigs only in males. In both subcutaneous and mesenteric adipose tissue, mRNA abundance of phosphoenolpyruvate carboxykinase (PCK1) was more elevated ( < 0.01) in HS groups compared with the CON and PF groups. Heat stress also caused increased heat shock protein 70 (HSP70; = 0.067) and CCAT/enhancer-binding homologous protein (CHOP) content ( < 0.05) in the mesenteric fat compared with the CON treatment. In conclusion, induction of PCK1 expression in adipose tissue by HS suggests elevated glyceroneogenesis might be involved in the increased fat storage in pigs under HS.

  12. Interleukin-6 responses to water immersion therapy after acute exercise heat stress: a pilot investigation.

    PubMed

    Lee, Elaine C; Watson, Greig; Casa, Douglas; Armstrong, Lawrence E; Kraemer, William; Vingren, Jakob L; Spiering, Barry A; Maresh, Carl M

    2012-01-01

    Cold-water immersion is the criterion standard for treatment of exertional heat illness. Cryotherapy and water immersion also have been explored as ergogenic or recovery aids. The kinetics of inflammatory markers, such as interleukin-6 (IL-6), during cold-water immersion have not been characterized. To characterize serum IL-6 responses to water immersion at 2 temperatures and, therefore, to initiate further research into the multidimensional benefits of immersion and the evidence-based selection of specific, optimal immersion conditions by athletic trainers. Controlled laboratory study. Human performance laboratory Patients or Other Participants: Eight college-aged men (age = 22 ± 3 years, height = 1.76 ± 0.08 m, mass = 77.14 ± 9.77 kg, body fat = 10% ± 3%, and maximal oxygen consumption = 50.48 ± 4.75 mL·kg(-1) min(-1)). Participants were assigned randomly to receive either cold (11.70°C ± 2.02°C, n = 4) or warm (23.50°C ± 1.00°C, n = 4) water-bath conditions after exercise in the heat (temperature = 37°C, relative humidity = 52%) for 90 minutes or until volitional cessation. Whole-body cooling rates were greater in the cold water-bath condition for the first 6 minutes of water immersion, but during the 90-minute, postexercise recovery, participants in the warm and cold water-bath conditions experienced similar overall whole-body cooling. Heart rate responses were similar for both groups. Participants in the cold water-bath condition experienced an overall slight increase (30.54% ± 77.37%) in IL-6 concentration, and participants in the warm water-bath condition experienced an overall decrease (-69.76% ± 15.23%). We have provided seed evidence that cold-water immersion is related to subtle IL-6 increases from postexercise values and that warmer water-bath temperatures might dampen this increase. Further research will elucidate any anti-inflammatory benefit associated with water-immersion treatment and possible multidimensional uses of cooling

  13. Relevance of individual characteristics for human heat stress response is dependent on exercise intensity and climate type.

    PubMed

    Havenith, G; Coenen, J M; Kistemaker, L; Kenney, W L

    1998-02-01

    %-58%) the variance explained in Tre differed markedly for relative intensities: 72% for the WH climate with its limited evaporative capacity, and only 10%-26% for the HD and CO climates. The results showed that individual characteristics play a significant role in determining the responses of body core temperature in all conditions tested, but their contribution was low for relative exercise intensities when evaporative heat loss was not restricted. This study demonstrated that effects of individual characteristics on human responses to heat stress cannot be interpreted without taking into consideration both the heat transfer properties of the environment and the metabolic heat production resulting from the exercise type and intensity chosen. Their impact varies substantially among conditions.

  14. Transcriptomic analysis of oyster Crassostrea gigas larvae illustrates the response patterns regulated by catecholaminergic system upon acute heat and bacterial stress.

    PubMed

    Liu, Zhaoqun; Wang, Lingling; Zhou, Zhi; Liu, Yu; Dong, Miren; Wang, Weilin; Song, Xiaorui; Wang, Mengqiang; Gao, Qiang; Song, Linsheng

    2017-03-07

    Bacterial infection and heat stress, as two major environmental threats of marine molluscs, could affect larval development and dramatically promote mortality of oysters. In the present study, next-generation sequencing, together with determinations of mRNA expression and measurements of enzyme activities, were employed to understand the response patterns of oyster larvae under acute heat and bacterial stress. After RNA-seq, a total of 9472 differentially expressed genes including 4895 significantly up-regulated ones and 4577 significantly down-regulated ones were obtained from 12 transcriptome libraries. GO overrepresentation analysis of the up-regulated genes revealed that the neuroendocrine immunomodulation pathway was activated after acute heat and bacterial stimulation, in which the catecholaminergic regulation played an important role. GO overrepresentation analysis of the down-regulated genes suggested that the immune capacity of Crassostrea gigas larvae was suppressed under stress, which was further validated since superoxide dismutase (SOD) and phenoloxidase (PO) activities in the total protein extract of larvae decreased dramatically after stress. Moreover, the shell formation of trochophore was inhibited and severe mortality was caused after acute heat and bacterial stress. These results collectively indicated that acute heat and bacterial stress could significantly inhibit larval development and suppress immune response of oyster C. gigas larvae. And the neuroendocrine immunomodulation, especially the catecholaminergic regulation, played an indispensable role in the stress response of molluscan larvae.

  15. Cloning and expression pattern of heat shock protein genes from the endoparasitoid wasp, Pteromalus puparum in response to environmental stresses.

    PubMed

    Wang, Huan; Li, Kai; Zhu, Jia-Ying; Fang, Qi; Ye, Gong-Yin; Wang, Huan; Li, Kai; Zhu, Jia-Ying

    2012-04-01

    Six heat shock protein (HSP) genes from five HSP families in the parasitoid, Pteromalus puparum, were evaluated for their response to temperature (-15 ~ 3°C , and 30 ~ 42°C for 1 h), heavy metals (0.5 ~ 5 mM Cd(2+) and Cu(2+) for 24 h and 60 h), and starvation (24 h). Compared with other insect HSPs, all conserved motifs are found in P. puparum HSPs, and they are very similar to those of the recently sequenced ectoparasitoid Nasonia vitripennis. The temporal gene expression patterns indicated that these six HSP genes were all heat-inducible, of which hsp40 was the most inducible. The temperatures for maximal HSP induction at high and low temperature zone were 36 or 39°C and -3°C, respectively. In the hot zone, all HSP genes have the same initial temperature (33°C) for up-regulation. Low concentrations of Cd(2+) for a short-term promoted the expression of all HSP genes, but not high concentrations or long-term treatments. Cu(2+) stress for 24 h increased expression of nearly all HSP. Four HSP genes changed after starvation. We infer that all six HSP genes are sensitive to heat. This may help understand the absence of P. puparum during the summer and winter. The expression profiles of six HSP genes in P. puparum under heavy metal stress indicates that HSP is a short-term response to cellular distress or injury induced by Cd(2+) and Cu(2+).

  16. Regional differences in sweat rate response of steers to short-term heat stress.

    PubMed

    Scharf, B; Wax, L E; Aiken, G E; Spiers, D E

    2008-11-01

    Six Angus steers (319 +/- 8.5 kg) were assigned to one of two groups (hot or cold exposure) of three steers each, and placed into two environmental chambers initially maintained at 16.5-18.8 degrees C air temperature (Ta). Cold chamber Ta was lowered to 8.4 degrees C, while Ta within the hot chamber was increased to 32.7 degrees C over a 24-h time period. Measurements included respiration rate, and air and body (rectal and skin) temperatures. Skin temperature was measured at shoulder and rump locations, with determination of sweat rate using a calibrated moisture sensor. Rectal temperature did not change in cold or hot chambers. However, respiration rate nearly doubled in the heat (P < 0.05), increasing when Ta was above 24 degrees C. Skin temperatures at the two locations were highly correlated (P < 0.05) with each other and with Ta. In contrast, sweat rate showed differences at rump and shoulder sites. Sweat rate of the rump exhibited only a small increase with Ta. However, sweat rate at the shoulder increased more than four-fold with increasing Ta. Increased sweat rate in this region is supported by an earlier report of a higher density of sweat glands in the shoulder compared to rump regions. Sweat rate was correlated with several thermal measurements to determine the best predictor. Fourth-order polynomial expressions of short-term rectal and skin temperature responses to hot and cold exposures produced r values of 0.60, 0.84, and 0.98, respectively. These results suggest that thermal inputs other than just rectal or skin temperature drive the sweat response in cattle.

  17. Regional differences in sweat rate response of steers to short-term heat stress

    NASA Astrophysics Data System (ADS)

    Scharf, B.; Wax, L. E.; Aiken, G. E.; Spiers, D. E.

    2008-11-01

    Six Angus steers (319 ± 8.5 kg) were assigned to one of two groups (hot or cold exposure) of three steers each, and placed into two environmental chambers initially maintained at 16.5-18.8°C air temperature ( T a). Cold chamber T a was lowered to 8.4°C, while T a within the hot chamber was increased to 32.7°C over a 24-h time period. Measurements included respiration rate, and air and body (rectal and skin) temperatures. Skin temperature was measured at shoulder and rump locations, with determination of sweat rate using a calibrated moisture sensor. Rectal temperature did not change in cold or hot chambers. However, respiration rate nearly doubled in the heat ( P < 0.05), increasing when T a was above 24°C. Skin temperatures at the two locations were highly correlated ( P < 0.05) with each other and with T a. In contrast, sweat rate showed differences at rump and shoulder sites. Sweat rate of the rump exhibited only a small increase with T a. However, sweat rate at the shoulder increased more than four-fold with increasing T a. Increased sweat rate in this region is supported by an earlier report of a higher density of sweat glands in the shoulder compared to rump regions. Sweat rate was correlated with several thermal measurements to determine the best predictor. Fourth-order polynomial expressions of short-term rectal and skin temperature responses to hot and cold exposures produced r values of 0.60, 0.84, and 0.98, respectively. These results suggest that thermal inputs other than just rectal or skin temperature drive the sweat response in cattle.

  18. Grape seed extract supplementation attenuates the heat stress-induced responses of jejunum epithelial cells in Simmental × Qinchuan steers.

    PubMed

    Li, Xiaomin; Yang, You; Liu, Shimin; Yang, Jing; Chen, Cheng; Sun, Zhihong

    2014-08-14

    Grape seed extract (GSE), a rich source of polyphenols, is reported to possess antioxidant, anti-inflammatory and immunomodulatory properties. The objective of the present study was to determine whether GSE could attenuate the heat stress-induced responses of jejunum epithelial cells (JEC) in cattle. The JEC of a steer (Simmental × Qinchuan) were exposed to heat stress for 2 h in the absence (0 μg/ml) or presence (10, 20, 40 and 80 μg/ml) of GSE in the culture medium. When cultured at 40°C, JEC supplemented with GSE exhibited increased glutathione peroxidase activity (P= 0·04), viability (P= 0·004), and mRNA expression of epidermal growth factor (EGF; P= 0·03) and EGF receptor (EGFR; P = 0·01). Under the same conditions, the cells exhibited decreased mRNA expression of IL-8 (P= 0·01) and TNF-α (P= 0·03) and decreased protein concentrations of IL-1β (P= 0·02), Toll-like receptor 4 (TLR4; P= 0·04) and heat shock protein 70 (HSP70; P< 0·001). When cultured at 43°C, JEC supplemented with GSE exhibited increased catalase activity (P= 0·04), viability (P< 0·001), and mRNA expression of EGF (P< 0·001) and EGFR (P< 0·001) and decreased protein concentrations of IL-1β (P< 0·001), TLR4 (P= 0·03) and HSP70 (P< 0·001), as well as mRNA expression of IL-8 (P< 0·001), TLR4 (P= 0·002) and TNF-α (P< 0·001). Temperature × GSE concentration interactions were also observed for the concentrations of IL-1β (P< 0·001), IL-8 (P< 0·001), TNF-α (P= 0·01) and HSP70 (P= 0·04) and viability (P< 0·001) of JEC. The results of the present study indicate that GSE can attenuate the responses of JEC induced by heat stress within a certain range of temperatures.

  19. Acetylsalicylic acid does not alter thermo-effector responses during mild whole-body passive heat stress in young men.

    PubMed

    Carter, Stephen J; Herron, Robert L; Akers, S Zeb; Bishop, Phillip A

    2015-06-01

    Acetylsalicylic acid (ASA), aspirin, exerts potent systemic effects that may interfere with normal thermo-effector responses. We investigated the influence of commonly ingested ASA doses on measures of skin blood flow (SkBF) and local sweat rate (SR) during whole-body, passive heat stress. Seven male participants completed counter-balanced trials to compare ASA treatments (single dose 325 mg or 4 consecutive days 81 mg (4-d 81 mg)) to control (no ASA). Laser-Doppler flowmetry provided an index of SkBF. A ventilated capsule measured local sweat rate via capacitance hygrometry. Mean body temperature ([Formula: see text]) was increased by 1 °C above baseline using a water-perfused suit. [Formula: see text] was similar at the onset of cutaneous vasodilation among trials. Cutaneous vascular conductance, expressed as a percentage change from baseline, was not different among trials. Additionally, [Formula: see text] at the onset of local SR and SR sensitivity did not differ among trials. While ASA has previously been shown to influence SkBF during heat stress, it is possible our cohort's relatively young age may have contributed to our dissimilar results.

  20. Feeding is inhibited by sublethal concentrations of toxicants and by heat stress in the nematode Caenorhabditis elegans: relationship to the cellular stress response.

    PubMed

    Jones, D; Candido, E P

    1999-07-01

    We report that the free-living nematode Caenorhabditis elegans can respond to a variety of stressors (compounds known to induce the production of cellular stress proteins in model biological systems), by ceasing pharyngeal pumping. This phenomenon results in both a reduction in intake of the stressor and a cessation of feeding. The effect of stressors can therefore be conveniently assayed by monitoring the decrease in the density of the bacterial food in liquid cultures of nematodes. A great range of stressors induced this response including alcohols, heavy metals, sulfhydryl-reactive compounds, salicylate, and heat. For several of these stressors, inhibition of pharyngeal pumping occurred at stressor concentrations below the threshold required for the induction of the 16-kDa heat shock proteins. Salicylate, which did not induce 16-kDa heat shock proteins at any concentration, nevertheless inhibited pharyngeal pumping. Heat was also inhibitory, at a temperature where 16-kDa heat shock protein production was near maximal. Some compounds caused only a partial inhibition of feeding while with others the effect was complete. Upon removal of the stressor, the nematodes resumed pharyngeal pumping with a residual inhibitory effect that depended on the concentration and type of stressor that had been applied. A number of C. elegans neurosensory mutant strains also exhibited a cessation of pharyngeal pumping when exposed to stressors suggesting that the mechanism underlying this inhibition was not entirely neurosensory and may be intrinsic to the pharynx. In C. elegans and other invertebrates, stress-induced inhibition of feeding may be an important survival mechanism that limits the intake of toxic solutes.

  1. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens.

    PubMed

    Liu, L L; He, J H; Xie, H B; Yang, Y S; Li, J C; Zou, Y

    2014-01-01

    This study investigated the effects of dietary resveratrol at 0, 200, 400, or 600 mg/kg of diet on the performance, immune organ growth index, serum parameters, and expression levels of heat shock protein (Hsp) 27, Hsp70, and Hsp90 mRNA in the bursa of Fabricius, thymus, and spleen of 42-d-old female black-boned chickens exposed to heat stress at 37 ± 2°C for 15 d. The results showed that heat stress reduced daily feed intake and BW gain; decreased serum glutathione (GSH), growth hormone, and insulin-like growth factor-1 levels; and inhibited GSH peroxidase (GSH-Px), superoxide dismutase (SOD), and catalase (CAT) activities compared with birds subjected to thermo-neutral circumstances. Chickens that were fed diets supplemented with resveratrol exhibited a linear increase in feed intake and BW gain (P < 0.001); serum GSH, growth hormone, and insulin-like growth factor-1 levels (P ≤ 0.01); and GSH-Px, SOD, and CAT activities (P < 0.001) compared with chickens that were fed diets without resveratrol during heat stress. In contrast, serum malonaldehyde concentrations were decreased (P < 0.001) in the chickens fed a resveratrol-supplemented diet. Heat stress also reduced (P < 0.05) the growth index of the bursa of Fabricus and spleen; however, it had no effect on the growth index of the thymus. The growth index of the bursa of Fabricius and spleen increased (P < 0.05) upon heat stress and coincided with an increase in supplemental resveratrol levels. The expression of Hsp27, Hsp70, and Hsp90 mRNA in the bursa of Fabricius and spleen were increased (P < 0.01), but those of Hsp27 and Hsp90 mRNA in thymus were decreased (P < 0.01) under heat stress compared with no heat stress. Resveratrol attenuated the heat stress-induced overexpression of Hsp27, Hsp70, and Hsp90 mRNA in the bursa of Fabricius and spleen and increased the low expression of Hsp27 and Hsp90 mRNA in thymus upon heat stress. The results suggest that supplemental resveratrol improves growth performance

  2. Expression profiles of the heat shock protein 70 gene in response to heat stress in Agrotis c-nigrum (Lepidoptera: Noctuidae).

    PubMed

    Wang, Ling; Yang, Shuai; Zhao, Kuijun; Han, Lanlan

    2015-01-01

    Heat shock proteins (HSPs) are molecular chaperones, and their overexpression enhances the survivability and stress tolerance of the cell. To understand the characteristics of HSP70 in Agrotis c-nigrum Linnaeus larvae, the coding sequence of this protein was cloned, and the effect of heat stress on transcription and protein properties was assessed. The obtained cDNA sequence of HSP70 was 2,213 bp, which contained an ORF of 1,965 bp and encoded 654 amino acid residues. Isolated HSP70 cDNA demonstrated more than 80% identity with the sequences of other known insect HSP70s. Next, HSP70 was expressed in Escherichia coli BL21 (DE3) cells and identified using SDS-PAGE and western blotting analyses. In addition, anti-HSP70-specific antisera were prepared using a recombinant HSP70 protein, and the results showed that this antisera was very specific to AcHSP70. Real-time quantitative polymerase chain reaction detected the relative transcription of the HSP70 gene in larvae and the transcription of A. c-nigrum in response to high temperatures. Induction of HSP70 was up-regulated to peak expression at 36°C.

  3. Expression Profiles of the Heat Shock Protein 70 Gene in Response to Heat Stress in Agrotis c-nigrum (Lepidoptera: Noctuidae)

    PubMed Central

    Wang, Ling; Yang, Shuai; Zhao, Kuijun; Han, Lanlan

    2015-01-01

    Heat shock proteins (HSPs) are molecular chaperones, and their overexpression enhances the survivability and stress tolerance of the cell. To understand the characteristics of HSP70 in Agrotis c-nigrum Linnaeus larvae, the coding sequence of this protein was cloned, and the effect of heat stress on transcription and protein properties was assessed. The obtained cDNA sequence of HSP70 was 2,213 bp, which contained an ORF of 1,965 bp and encoded 654 amino acid residues. Isolated HSP70 cDNA demonstrated more than 80% identity with the sequences of other known insect HSP70s. Next, HSP70 was expressed in Escherichia coli BL21 (DE3) cells and identified using SDS-PAGE and western blotting analyses. In addition, anti-HSP70-specific antisera were prepared using a recombinant HSP70 protein, and the results showed that this antisera was very specific to AcHSP70. Real-time quantitative polymerase chain reaction detected the relative transcription of the HSP70 gene in larvae and the transcription of A. c-nigrum in response to high temperatures. Induction of HSP70 was up-regulated to peak expression at 36°C. PMID:25688087

  4. Effects of Hydration Level and Heat Stress on Thermoregulatory Responses, Hematological and Blood Rheological Properties in Growing Pigs

    PubMed Central

    Connes, Philippe; Bocage, Bruno; Renaudeau, David

    2014-01-01

    Heat stress is one of the major limiting factors of production efficiency in the swine industry. The aims of the present study were 1) to observe if hemorheological and hematological parameters could be associated to physiological acclimation during the first days of heat stress exposure and 2) to determine if water restriction could modulate the effect of thermal heat stress on physiological, hematological and hemorheological parameters. Twelve Large White male pigs were divided into an ad libitum and a water restricted group. All pigs were submitted to one week at 24°C (D-7 to D-1). Then, at D0, temperature was progressively increased until 32°C and maintained during one week (D1 to D7). We performed daily measurements of water and feed intake. Physiological (i.e., skin temperature, rectal temperature, respiratory rate), hematological and hemorheological parameters were measured on D-6, D-5, D0, D1, D2 and D7. Water restriction had no effect on physiological, hematological and hemorheological parameters. The first days of heat stress caused an increase in the three physiological parameters followed by a reduction of these parameters suggesting a successful acclimation of pigs to heat stress. We showed an increase in hematocrit, red blood cell aggregation and red blood cell aggregation strength during heat stress. Further, we observed an important release of reticulocytes, an increase of red blood cell deformability and a reduction of feed intake and blood viscosity under heat stress. This study suggests that physiological acute adaptation to heat stress is accompanied by large hematological and hemorheological changes. PMID:25013960

  5. Digital-analog hybrid control model for eukaryotic heat shock response illustrating the dynamics of heat shock protein 70 on exposure to thermal stress.

    PubMed

    Dwivedi, Anjana; Karan, Bhuwan Mohan; Das, Barda Nand; Sinha, Rakesh Kumar

    2008-04-01

    We are introducing in this paper a digital-analog hybrid model approach for the study of a complete gene regulatory network; the heat shock response (HSR) network of eukaryotes. HSR is a crucial and widely studied cellular phenomenon occurring due to various stresses on the cell, and is characterised by the induction of heat shock genes resulting in the production of heat shock proteins (HSPs) which restores cellular homeostasis by maintaining protein integrity. We are proposing a model which incorporates simple digital and analog components which mimic the functioning of biological molecules involved in HSR and model their dynamics and behaviour. The simulation result of the circuit for the production of HSP70 has been found to be consistent with published experimental results. The qualitative behaviour of the HSR is expressed through a truth table. Through this novel approach, the authors have tried to develop a level of understanding of the interactions of the parts of the HSR system and of this system as a whole.

  6. Response of Lactobacillus helveticus PR4 to Heat Stress during Propagation in Cheese Whey with a Gradient of Decreasing Temperatures

    PubMed Central

    Di Cagno, Raffaella; De Angelis, Maria; Limitone, Antonio; Fox, Patrick F.; Gobbetti, Marco

    2006-01-01

    The heat stress response was studied in Lactobacillus helveticus PR4 during propagation in cheese whey with a gradient of naturally decreasing temperature (55 to 20°C). Growth under a gradient of decreasing temperature was compared to growth at a constant temperature of 42°C. Proteinase, peptidase, and acidification activities of L. helveticus PR4 were found to be higher in cells harvested when 40°C was reached by a gradient of decreasing temperature than in cells grown at constant temperature of 42°C. When cells grown under a temperature gradient were harvested after an initial exposure of 35 min to 55°C followed by decreases in temperature to 40 (3 h), 30 (5 h 30 min), or 20°C (13 h 30 min) and were then compared with cells grown for the same time at a constant temperature of 42°C, a frequently transient induction of the levels of expression of 48 proteins was found by two-dimensional electrophoresis analysis. Expression of most of these proteins increased following cooling from 55 to 40°C (3 h). Sixteen of these proteins were subjected to N-terminal and matrix-assisted laser desorption ionization-time of flight mass spectrometry analyses. They were identified as stress proteins (e.g., DnaK and GroEL), glycolysis-related machinery (e.g., enolase and glyceraldehyde-3-phosphate dehydrogenase), and other regulatory proteins or factors (e.g., DNA-binding protein II and ATP-dependent protease). Most of these proteins have been found to play a role in the mechanisms of heat stress adaptation in other bacteria. PMID:16820437

  7. Metabolic Response to Heat Stress in Late-Pregnant and Early Lactation Dairy Cows: Implications to Liver-Muscle Crosstalk

    PubMed Central

    Eslamizad, Mehdi; Weitzel, Joachim; Kuhla, Björn

    2016-01-01

    Climate changes lead to rising temperatures during summer periods and dramatic economic losses in dairy production. Modern high-yielding dairy cows experience severe metabolic stress during the transition period between late gestation and early lactation to meet the high energy and nutrient requirements of the fetus or the mammary gland, and additional thermal stress during this time has adverse implications on metabolism and welfare. The mechanisms enabling metabolic adaptation to heat apart from the decline in feed intake and milk yield are not fully elucidated yet. To distinguish between feed intake and heat stress related effects, German Holstein dairy cows were first kept at thermoneutral conditions at 15°C followed by exposure to heat-stressed (HS) at 28°C or pair-feeding (PF) at 15°C for 6 days; in late-pregnancy and again in early lactation. Liver and muscle biopsies and plasma samples were taken to assess major metabolic pathway regulation using real-time PCR and Western Blot. The results indicate that during heat stress, late pregnant cows activate Cahill but reduce Cori cycling, prevent increase in skeletal muscle fatty acid oxidation, and utilize increased amounts of pyruvate for gluconeogenesis, without altering ureagenesis despite reduced plane of nutrition. These homeorhetic adaptations are employed to reduce endogenous heat production while diverting amino acids to the growing fetus. Metabolic adaptation to heat stress in early lactation involves increased long-chain fatty acid degradation in muscle peroxisomes, allowance for muscle glucose utilization but diminished hepatic use of amino acid-derived pyruvate for gluconeogenesis and reduced peroxisomal fatty acid oxidation and ATP production in liver of HS compared to PF cows in early lactation. Consequently, metabolic adaptation to heat stress and reduced feed intake differ between late pregnancy and early lactation of dairy cows to maintain energy supply for fetus development or milk production

  8. Growth, immune, antioxidant, and bone responses of heat stress-exposed broilers fed diets supplemented with tomato pomace.

    PubMed

    Hosseini-Vashan, S J; Golian, A; Yaghobfar, A

    2016-08-01

    A study was conducted to investigate the effects of supplementation of dried tomato pomace (DTP) on growth performance, relative weights of viscera, serum biological parameters, antioxidant status, immune response, and bone composition of broilers exposed to a high ambient temperature. A total of 352 one-day-old male broiler chickens were randomly divided into four groups consisting of four replicates with 22 birds each. One group was reared under the thermoneutral zone and fed a corn-soybean meal basal diet. The other three groups were subjected to a cyclic heat stress from 29 to 42 days of age (34 ± 1 °C, 55 % RH, 5 h/day). These birds were fed corn-soybean meal basal diet or the same diet supplemented with 3 % DTP (420 mg lycopene/kg diet) or 5 % (708 mg lycopene/kg diet) of DTP. Blood samples were collected on days 28 and 42, and the birds were slaughtered at the same times. Supplementation of 5 % of DTP increased body weight and production index and decreased feed conversion ratio during 1-28 days of age. On day 28, the broilers supplemented with 5 % DTP had lower serum triglycerides and higher high-density lipoprotein (HDL) cholesterol concentration than those on the other dietary treatments. The activities of glutathione peroxidase (GPx) and superoxide dismutase (SOD) were higher and the concentration of malondialdehyde (MDA) was lower in the broilers fed 5 % TP than those of the broilers fed other diets at 28 days of age. The effects of heat stress (HS) were impaired body weight, enhanced serum activities of alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, lipase, and MDA concentration while reducing the activities of GPx and SOD. Dried tomato pomace supplementation did not influence growth performance under HS but ameliorated the negative effects of HS on the serum enzyme activities, GPx activity, and lipid peroxidation. Heat stress did not change the relative weights of the lymphoid organs but reduced the

  9. The International Heat Stress Genotype Experiment for modeling wheat response to heat: field experiments and AgMIP-Wheat multi-model simulations

    USDA-ARS?s Scientific Manuscript database

    The data set contains a portion of the International Heat Stress Genotype Experiment (IHSGE) data used in the AgMIP-Wheat project to analyze the uncertainty of 30 wheat crop models and quantify the impact of heat on global wheat yield productivity. It includes two spring wheat cultivars grown during...

  10. Impact of Heat Stress on Poultry Production.

    PubMed

    Lara, Lucas J; Rostagno, Marcos H

    2013-04-24

    Understanding and controlling environmental conditions is crucial to successful poultry production and welfare. Heat stress is one of the most important environmental stressors challenging poultry production worldwide. The detrimental effects of heat stress on broilers and laying hens range from reduced growth and egg production to decreased poultry and egg quality and safety. Moreover, the negative impact of heat stress on poultry welfare has recently attracted increasing public awareness and concern. Much information has been published on the effects of heat stress on productivity and immune response in poultry. However, our knowledge of basic mechanisms associated to the reported effects, as well as related to poultry behavior and welfare under heat stress conditions is in fact scarce. Intervention strategies to deal with heat stress conditions have been the focus of many published studies. Nevertheless, effectiveness of most of the interventions has been variable or inconsistent. This review focuses on the scientific evidence available on the importance and impact of heat stress in poultry production, with emphasis on broilers and laying hens.

  11. Profiling of differential gene expression in the hypothalamus of broiler-type Taiwan country chickens in response to acute heat stress.

    PubMed

    Tu, Wei-Lin; Cheng, Chuen-Yu; Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

    2016-02-01

    Acute heat stress severely impacts poultry production. The hypothalamus acts as a crucial center to regulate body temperature, detect temperature changes, and modulate the autonomic nervous system and endocrine loop for heat retention and dissipation. The purpose of this study was to investigate global gene expression in the hypothalamus of broiler-type B strain Taiwan country chickens after acute heat stress. Twelve 30-week-old hens were allocated to four groups. Three heat-stressed groups were subjected to acute heat stress at 38 °C for 2 hours without recovery (H2R0), with 2 hours of recovery (H2R2), and with 6 hours of recovery (H2R6). The control hens were maintained at 25 °C. At the end, hypothalamus samples were collected for gene expression analysis. The results showed that 24, 11, and 25 genes were upregulated and 41, 15, and 42 genes were downregulated in H2R0, H2R2, and H2R6 treatments, respectively. The expressions of gonadotropin-releasing hormone 1 (GNRH1), heat shock 27-kDa protein 1 (HSPB1), neuropeptide Y (NPY), and heat shock protein 25 (HSP25) were upregulated at all recovery times after heat exposure. Conversely, the expression of TPH2 was downregulated at all recovery times. A gene ontology analysis showed that most of the differentially expressed genes were involved in biological processes including cellular processes, metabolic processes, localization, multicellular organismal processes, developmental processes, and biological regulation. A functional annotation analysis showed that the differentially expressed genes were related to the gene networks of responses to stress and reproductive functions. These differentially expressed genes might be essential and unique key factors in the heat stress response of the hypothalamus in chickens.

  12. Interactions between 2-Cys peroxiredoxins and ascorbate in autophagosome formation during the heat stress response in Solanum lycopersicum.

    PubMed

    Cheng, Fei; Yin, Ling-Ling; Zhou, Jie; Xia, Xiao-Jian; Shi, Kai; Yu, Jing-Quan; Zhou, Yan-Hong; Foyer, Christine Helen

    2016-03-01

    2-Cys peroxiredoxins (2-CPs) function in the removal of hydrogen peroxide and lipid peroxides but their precise roles in the induction of autophagy have not been characterized. Here we show that heat stress, which is known to induce oxidative stress, leads to the simultaneous accumulation of transcripts encoding 2-CPs and autophagy proteins, as well as autophagosomes, in tomato (Solanum lycopersicum) plants. Virus-induced gene silencing of the tomato peroxiredoxin genes 2-CP1, 2-CP2, and 2-CP1/2 resulted in an increased sensitivity of tomato plants to heat stress. Silencing 2-CP2 or 2-CP1/2 increased the levels of transcripts associated with ascorbate biosynthesis but had no effect on the glutathione pool in the absence of stress. However, the heat-induced accumulation of transcripts associated with the water-water cycle was compromised by the loss of 2-CP1/2 functions. The transcript levels of autophagy-related genes ATG5 and ATG7 were higher in plants with impaired 2-CP1/2 functions, and the formation of autophagosomes increased, together with an accumulation of oxidized and insoluble proteins. Silencing of ATG5 or ATG7 increased the levels of 2-CP transcripts and protein but decreased heat stress tolerance. These results demonstrate that 2-CPs fulfil a pivotal role in heat stress tolerance in tomato, via interactions with ascorbate-dependent pathways and autophagy.

  13. Comparison of the heat stress induced variations in DNA methylation between heat-tolerant and heat-sensitive rapeseed seedlings

    PubMed Central

    Gao, Guizhen; Li, Jun; Li, Hao; Li, Feng; Xu, Kun; Yan, Guixin; Chen, Biyun; Qiao, Jiangwei; Wu, Xiaoming

    2014-01-01

    DNA methylation is responsive to various biotic and abiotic stresses. Heat stress is a serious threat to crop growth and development worldwide. Heat stress results in an array of morphological, physiological and biochemical changes in plants. The relationship between DNA methylation and heat stress in crops is relatively unknown. We investigated the differences in methylation levels and changes in the cytosine methylation patterns in seedlings of two rapeseed genotypes (heat-sensitive and heat-tolerant) under heat stress. Our results revealed that the methylation levels were different between a heat-tolerant genotype and a heat-sensitive one under control conditions. Under heat treatment, methylation increased more in the heat-sensitive genotype than in the heat-tolerant genotype. More DNA demethylation events occurred in the heat-tolerant genotype, while more DNA methylation occurred in the heat-sensitive genotype. A large and diverse set of genes were affected by heat stress via cytosine methylation changes, suggesting that these genes likely play important roles in the response and adaption to heat stress in Brassica napus L. This study indicated that the changes in DNA methylation differed between heat-tolerant and heat-sensitive genotypes of B. napus in response to heat stress, which further illuminates the molecular mechanisms of the adaption to heat stress in B. napus. PMID:24987298

  14. Gene expression profiles of cytosolic heat shock proteins Hsp70 and Hsp90 from symbiotic dinoflagellates in response to thermal stress: possible implications for coral bleaching.

    PubMed

    Rosic, Nedeljka N; Pernice, Mathieu; Dove, Sophie; Dunn, Simon; Hoegh-Guldberg, Ove

    2011-01-01

    Unicellular photosynthetic dinoflagellates of the genus Symbiodinium are the most common endosymbionts of reef-building scleractinian corals, living in a symbiotic partnership known to be highly susceptible to environmental changes such as hyperthermic stress. In this study, we identified members of two major heat shock proteins (HSPs) families, Hsp70 and Hsp90, in Symbiodinium sp. (clade C) with full-length sequences that showed the highest similarity and evolutionary relationship with other known HSPs from dinoflagellate protists. Regulation of HSPs gene expression was examined in samples of the scleractinian coral Acropora millepora subjected to elevated temperatures progressively over 18 h (fast) and 120 h (gradual thermal stress). Moderate to severe heat stress at 26°C and 29°C (+3°C and +6°C above average sea temperature) resulted in an increase in algal Hsp70 gene expression from 39% to 57%, while extreme heat stress (+9°C) reduced Hsp70 transcript abundance by 60% (after 18 h) and 70% (after 120 h). Elevated temperatures decreased an Hsp90 expression under both rapid and gradual heat stress scenarios. Comparable Hsp70 and Hsp90 gene expression patterns were observed in Symbiodinium cultures and in hospite, indicating their independent regulation from the host. Differential gene expression profiles observed for Hsp70 and Hsp90 suggests diverse roles of these molecular chaperones during heat stress response. Reduced expression of the Hsp90 gene under heat stress can indicate a reduced role in inhibiting the heat shock transcription factor which may lead to activation of heat-inducible genes and heat acclimation.

  15. Gene expression profiles of cytosolic heat shock proteins Hsp70 and Hsp90 from symbiotic dinoflagellates in response to thermal stress: possible implications for coral bleaching

    PubMed Central

    Pernice, Mathieu; Dove, Sophie; Dunn, Simon; Hoegh-Guldberg, Ove

    2010-01-01

    Unicellular photosynthetic dinoflagellates of the genus Symbiodinium are the most common endosymbionts of reef-building scleractinian corals, living in a symbiotic partnership known to be highly susceptible to environmental changes such as hyperthermic stress. In this study, we identified members of two major heat shock proteins (HSPs) families, Hsp70 and Hsp90, in Symbiodinium sp. (clade C) with full-length sequences that showed the highest similarity and evolutionary relationship with other known HSPs from dinoflagellate protists. Regulation of HSPs gene expression was examined in samples of the scleractinian coral Acropora millepora subjected to elevated temperatures progressively over 18 h (fast) and 120 h (gradual thermal stress). Moderate to severe heat stress at 26°C and 29°C (+3°C and +6°C above average sea temperature) resulted in an increase in algal Hsp70 gene expression from 39% to 57%, while extreme heat stress (+9°C) reduced Hsp70 transcript abundance by 60% (after 18 h) and 70% (after 120 h). Elevated temperatures decreased an Hsp90 expression under both rapid and gradual heat stress scenarios. Comparable Hsp70 and Hsp90 gene expression patterns were observed in Symbiodinium cultures and in hospite, indicating their independent regulation from the host. Differential gene expression profiles observed for Hsp70 and Hsp90 suggests diverse roles of these molecular chaperones during heat stress response. Reduced expression of the Hsp90 gene under heat stress can indicate a reduced role in inhibiting the heat shock transcription factor which may lead to activation of heat-inducible genes and heat acclimation. PMID:20821176

  16. Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing

    PubMed Central

    2011-01-01

    Background Biotic and abiotic stresses, such as powdery mildew infection and high temperature, are important limiting factors for yield and grain quality in wheat production. Emerging evidences suggest that long non-protein coding RNAs (npcRNAs) are developmentally regulated and play roles in development and stress responses of plants. However, identification of long npcRNAs is limited to a few plant species, such as Arabidopsis, rice and maize, no systematic identification of long npcRNAs and their responses to abiotic and biotic stresses is reported in wheat. Results In this study, by using computational analysis and experimental approach we identified 125 putative wheat stress responsive long npcRNAs, which are not conserved among plant species. Among them, some were precursors of small RNAs such as microRNAs and siRNAs, two long npcRNAs were identified as signal recognition particle (SRP) 7S RNA variants, and three were characterized as U3 snoRNAs. We found that wheat long npcRNAs showed tissue dependent expression patterns and were responsive to powdery mildew infection and heat stress. Conclusion Our results indicated that diverse sets of wheat long npcRNAs were responsive to powdery mildew infection and heat stress, and could function in wheat responses to both biotic and abiotic stresses, which provided a starting point to understand their functions and regulatory mechanisms in the future. PMID:21473757

  17. The effect of selenium and polysaccharide of Atractylodes macrocephala Koidz. (PAMK) on immune response in chicken spleen under heat stress.

    PubMed

    Xu, Danning; Li, Wanyan; Huang, Yunmao; He, Jianhua; Tian, Yunbo

    2014-08-01

    The aim of the present study was to investigate the effect of selenium (Se), polysaccharide of Atractylodes macrocephala Koidz. (PAMK), and the combination of Se and PAMK on the immune response, heat shock protein (HSP) levels under heat stress (HS) condition in chicken spleen. Two hundred chickens were randomly divided into two groups, the HS group and the control (Con) group. Then these chickens were treated with Se (0.3 mg/kg), PAMK (200 mg/kg) alone, and the combination of Se (0.3 mg/kg) and PAMK (200 mg/kg). The antioxidative enzymes, cytokines contents, and expression levels of HSP27 and HSP70 were examined in chicken spleen. The results indicated that HS induced higher levels of TNF-α, IL-4, HSP27, HSP70, and MDA levels but lower level of IFN-γ, IL-2, Gpx, and SOD in spleen (P < 0.05). These responses were ameliorated by the treatment of Se, PAMK alone, and the combination of Se and PAMK (P < 0.05 or not) The results showed that under common condition, Se and PAMK could improve the immune response by enhancing the levels of some cytokines to proper levels; however, under HS condition, Se and PAMK could change the abnormal levels of cytokines and oxidative damages to ameliorate the injury induced by HS. In addition, there existed synergistic effect on the modulation of these biomarkers in chicken spleen between Se and PAMK. So both Se and PAMK play important roles in regulating the immune function in chicken. Considering the synergistic effect on immune regulation of PAMK, this herb deserves further investigation to evaluate its role in improving the effect of traditional immune regulators.

  18. Drivers and barriers to heat stress resilience.

    PubMed

    Hatvani-Kovacs, Gertrud; Belusko, Martin; Skinner, Natalie; Pockett, John; Boland, John

    2016-11-15

    Heatwaves are the most dangerous natural hazard to health in Australia. The frequency and intensity of heatwaves will increase due to climate change and urban heat island effects in cities, aggravating the negative impacts of heatwaves. Two approaches exist to develop population heat stress resilience. Firstly, the most vulnerable social groups can be identified and public health services can prepare for the increased morbidity. Secondly, the population level of adaptation and the heat stress resistance of the built environment can be increased. The evaluation of these measures and their efficiencies has been fragmented across research disciplines. This study explored the relationships between the elements of heat stress resilience and their potential demographic and housing drivers and barriers. The responses of a representative online survey (N=393) about heat stress resilience at home and work from Adelaide, South Australia were analysed. The empirical findings demonstrate that heat stress resistant buildings increased adaptation capacity and decreased the number of health problems. Air-conditioning increased dependence upon it, limited passive adaptation and only people living in homes with whole-house air-conditioning had less health problems during heatwaves. Tenants and respondents with pre-existing health conditions were the most vulnerable, particularly as those with health conditions were not aware of their vulnerability. The introduction of an Energy Performance Certificate is proposed and discussed as an effective incentive to increase the heat stress resistance of and the general knowledge about the built environment. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Endogenous Hormones Subtly Alter Women’s Response to Heat Stress

    DTIC Science & Technology

    1988-01-01

    P. WEINMAN. Eccrine sweat gland activity FRYtDMAN. Time relationships between basal body temperature during the menstrual cycle. J. Appl. Physiol. 21...in the heat. Rectal (T,,) and mean the literature. skin (Tnk) temperatures, heart rate (HR), and sweat rate on the Our study was designed to test for...possible effects of chest and thigh were recorded continuously. Total sweat loss the normal hormone changes associated with the men- MN,, 1. as

  20. Effects of selenium and vitamin E on performance, physiological response, and selenium balance in heat-stressed sheep.

    PubMed

    Alhidary, I A; Shini, S; Al Jassim, R A M; Abudabos, A M; Gaughan, J B

    2015-02-01

    Forty-two 7-mo-old Australian Merino wethers were used in a 50-d trial to investigate the effects of Se and vitamin E on the performance and physiological responses of heat-stressed sheep. Sheep were exposed to thermoneutral conditions (maximum = 24°C and minimum = 20°C) for 28 d followed by heat (maximum = 38°C and minimum = 28°C) for 22 d. Hot conditions were imposed between 0700 and 1800 h. Sheep were randomly allocated to diets containing 0.8 mg/kg Se (Sel-Plex), 150 mg/kg vitamin E, or 0.8 mg/kg Se and 150 mg/kg vitamin E for either the duration of the study (50 d) or from d 1 of the hot period until the end of the study. A control group that received no supplemental Se and vitamin E for the duration of the study was included. Feed intake was measured daily and sheep were weighed weekly. Blood samples were collected from all sheep before feeding on d 1, 21, and 49 for measurement of biochemical and enzymatic variables. The concentration of Se was determined in offered and refused feed, feces, urine, water, plasma, liver, and kidneys. Exposure to heat reduced ( < 0.05) DMI by 11.9%, ADG by 198 g, serum concentration of urea nitrogen and Se by 17.8%, and plasma total antioxidant status by 26.4%. During hot conditions, sheep receiving Se and vitamin E supplements for 50 d had reduced ( < 0.05) BW loss and elevated G:F compared to control sheep. Serum Se concentration and the plasma total antioxidant status were greatest in sheep receiving Se and vitamin E supplements for 50 d ( < 0.05). These results indicate that dietary supplementation with Se and vitamin E reduces the adverse effects of a high heat load. Additional studies are warranted to elucidate the mechanisms responsible for these effects.

  1. AsHSP17, a creeping bentgrass small heat shock protein modulates plant photosynthesis and ABA-dependent and independent signalling to attenuate plant response to abiotic stress.

    PubMed

    Sun, Xinbo; Sun, Chunyu; Li, Zhigang; Hu, Qian; Han, Liebao; Luo, Hong

    2016-06-01

    Heat shock proteins (HSPs) are molecular chaperones that accumulate in response to heat and other abiotic stressors. Small HSPs (sHSPs) belong to the most ubiquitous HSP subgroup with molecular weights ranging from 12 to 42 kDa. We have cloned a new sHSP gene, AsHSP17 from creeping bentgrass (Agrostis stolonifera) and studied its role in plant response to environmental stress. AsHSP17 encodes a protein of 17 kDa. Its expression was strongly induced by heat in both leaf and root tissues, and by salt and abscisic acid (ABA) in roots. Transgenic Arabidopsis plants constitutively expressing AsHSP17 exhibited enhanced sensitivity to heat and salt stress accompanied by reduced leaf chlorophyll content and decreased photosynthesis under both normal and stressed conditions compared to wild type. Overexpression of AsHSP17 also led to hypersensitivity to exogenous ABA and salinity during germination and post-germinative growth. Gene expression analysis indicated that AsHSP17 modulates expression of photosynthesis-related genes and regulates ABA biosynthesis, metabolism and ABA signalling as well as ABA-independent stress signalling. Our results suggest that AsHSP17 may function as a protein chaperone to negatively regulate plant responses to adverse environmental stresses through modulating photosynthesis and ABA-dependent and independent signalling pathways.

  2. Leaf proteome alterations in the context of physiological and morphological responses to drought and heat stress in barley (Hordeum vulgare L.)

    PubMed Central

    von Korff, M.

    2013-01-01

    The objective of this study was to identify barley leaf proteins differentially regulated in response to drought and heat and the combined stresses in context of the morphological and physiological changes that also occur. The Syrian landrace Arta and the Australian cultivar Keel were subjected to drought, high temperature, or a combination of both treatments starting at heading. Changes in the leaf proteome were identified using differential gel electrophoresis and mass spectrometry. The drought treatment caused strong reductions of biomass and yield, while photosynthetic performance and the proteome were not significantly changed. In contrast, the heat treatment and the combination of heat and drought reduced photosynthetic performance and caused changes of the leaf proteome. The proteomic analysis identified 99 protein spots differentially regulated in response to heat treatment, 14 of which were regulated in a genotype-specific manner. Differentially regulated proteins predominantly had functions in photosynthesis, but also in detoxification, energy metabolism, and protein biosynthesis. The analysis indicated that de novo protein biosynthesis, protein quality control mediated by chaperones and proteases, and the use of alternative energy resources, i.e. glycolysis, play important roles in adaptation to heat stress. In addition, genetic variation identified in the proteome, in plant growth and photosynthetic performance in response to drought and heat represent stress adaption mechanisms to be exploited in future crop breeding efforts. PMID:23918963

  3. Leaf proteome alterations in the context of physiological and morphological responses to drought and heat stress in barley (Hordeum vulgare L.).

    PubMed

    Rollins, J A; Habte, E; Templer, S E; Colby, T; Schmidt, J; von Korff, M

    2013-08-01

    The objective of this study was to identify barley leaf proteins differentially regulated in response to drought and heat and the combined stresses in context of the morphological and physiological changes that also occur. The Syrian landrace Arta and the Australian cultivar Keel were subjected to drought, high temperature, or a combination of both treatments starting at heading. Changes in the leaf proteome were identified using differential gel electrophoresis and mass spectrometry. The drought treatment caused strong reductions of biomass and yield, while photosynthetic performance and the proteome were not significantly changed. In contrast, the heat treatment and the combination of heat and drought reduced photosynthetic performance and caused changes of the leaf proteome. The proteomic analysis identified 99 protein spots differentially regulated in response to heat treatment, 14 of which were regulated in a genotype-specific manner. Differentially regulated proteins predominantly had functions in photosynthesis, but also in detoxification, energy metabolism, and protein biosynthesis. The analysis indicated that de novo protein biosynthesis, protein quality control mediated by chaperones and proteases, and the use of alternative energy resources, i.e. glycolysis, play important roles in adaptation to heat stress. In addition, genetic variation identified in the proteome, in plant growth and photosynthetic performance in response to drought and heat represent stress adaption mechanisms to be exploited in future crop breeding efforts.

  4. Protective Response Mechanisms to Heat Stress in Interaction with High [CO2] Conditions in Coffea spp.

    PubMed

    Martins, Madlles Q; Rodrigues, Weverton P; Fortunato, Ana S; Leitão, António E; Rodrigues, Ana P; Pais, Isabel P; Martins, Lima D; Silva, Maria J; Reboredo, Fernando H; Partelli, Fábio L; Campostrini, Eliemar; Tomaz, Marcelo A; Scotti-Campos, Paula; Ribeiro-Barros, Ana I; Lidon, Fernando J C; DaMatta, Fábio M; Ramalho, José C

    2016-01-01

    Modeling studies have predicted that coffee crop will be endangered by future global warming, but recent reports highlighted that high [CO2] can mitigate heat impacts on coffee. This work aimed at identifying heat protective mechanisms promoted by CO2 in Coffea arabica (cv. Icatu and IPR108) and Coffea canephora cv. Conilon CL153. Plants were grown at 25/20°C (day/night), under 380 or 700 μL CO2 L(-1), and then gradually submitted to 31/25, 37/30, and 42/34°C. Relevant heat tolerance up to 37/30°C for both [CO2] and all coffee genotypes was observed, likely supported by the maintenance or increase of the pools of several protective molecules (neoxanthin, lutein, carotenes, α-tocopherol, HSP70, raffinose), activities of antioxidant enzymes, such as superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione reductase (GR), catalase (CAT), and the upregulated expression of some genes (ELIP, Chaperonin 20). However, at 42/34°C a tolerance threshold was reached, mostly in the 380-plants and Icatu. Adjustments in raffinose, lutein, β-carotene, α-tocopherol and HSP70 pools, and the upregulated expression of genes related to protective (ELIPS, HSP70, Chape 20, and 60) and antioxidant (CAT, CuSOD2, APX Cyt, APX Chl) proteins were largely driven by temperature. However, enhanced [CO2] maintained higher activities of GR (Icatu) and CAT (Icatu and IPR108), kept (or even increased) the Cu,Zn-SOD, APX, and CAT activities, and promoted a greater upregulation of those enzyme genes, as well as those related to HSP70, ELIPs, Chaperonins in CL153, and Icatu. These changes likely favored the maintenance of reactive oxygen species (ROS) at controlled levels and contributed to mitigate of photosystem II photoinhibition at the highest temperature. Overall, our results highlighted the important role of enhanced [CO2] on the coffee crop acclimation and sustainability under predicted future global warming scenarios.

  5. Protective Response Mechanisms to Heat Stress in Interaction with High [CO2] Conditions in Coffea spp.

    PubMed Central

    Martins, Madlles Q.; Rodrigues, Weverton P.; Fortunato, Ana S.; Leitão, António E.; Rodrigues, Ana P.; Pais, Isabel P.; Martins, Lima D.; Silva, Maria J.; Reboredo, Fernando H.; Partelli, Fábio L.; Campostrini, Eliemar; Tomaz, Marcelo A.; Scotti-Campos, Paula; Ribeiro-Barros, Ana I.; Lidon, Fernando J. C.; DaMatta, Fábio M.; Ramalho, José C.

    2016-01-01

    Modeling studies have predicted that coffee crop will be endangered by future global warming, but recent reports highlighted that high [CO2] can mitigate heat impacts on coffee. This work aimed at identifying heat protective mechanisms promoted by CO2 in Coffea arabica (cv. Icatu and IPR108) and Coffea canephora cv. Conilon CL153. Plants were grown at 25/20°C (day/night), under 380 or 700 μL CO2 L−1, and then gradually submitted to 31/25, 37/30, and 42/34°C. Relevant heat tolerance up to 37/30°C for both [CO2] and all coffee genotypes was observed, likely supported by the maintenance or increase of the pools of several protective molecules (neoxanthin, lutein, carotenes, α-tocopherol, HSP70, raffinose), activities of antioxidant enzymes, such as superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione reductase (GR), catalase (CAT), and the upregulated expression of some genes (ELIP, Chaperonin 20). However, at 42/34°C a tolerance threshold was reached, mostly in the 380-plants and Icatu. Adjustments in raffinose, lutein, β-carotene, α-tocopherol and HSP70 pools, and the upregulated expression of genes related to protective (ELIPS, HSP70, Chape 20, and 60) and antioxidant (CAT, CuSOD2, APX Cyt, APX Chl) proteins were largely driven by temperature. However, enhanced [CO2] maintained higher activities of GR (Icatu) and CAT (Icatu and IPR108), kept (or even increased) the Cu,Zn-SOD, APX, and CAT activities, and promoted a greater upregulation of those enzyme genes, as well as those related to HSP70, ELIPs, Chaperonins in CL153, and Icatu. These changes likely favored the maintenance of reactive oxygen species (ROS) at controlled levels and contributed to mitigate of photosystem II photoinhibition at the highest temperature. Overall, our results highlighted the important role of enhanced [CO2] on the coffee crop acclimation and sustainability under predicted future global warming scenarios. PMID:27446174

  6. Marine microbial symbiosis heats up: the phylogenetic and functional response of a sponge holobiont to thermal stress.

    PubMed

    Fan, Lu; Liu, Michael; Simister, Rachel; Webster, Nicole S; Thomas, Torsten

    2013-05-01

    Large-scale mortality of marine invertebrates is a major global concern for ocean ecosystems and many sessile, reef-building animals, such as sponges and corals, are experiencing significant declines through temperature-induced disease and bleaching. The health and survival of marine invertebrates is often dependent on intimate symbiotic associations with complex microbial communities, yet we have a very limited understanding of the detailed biology and ecology of both the host and the symbiont community in response to environmental stressors, such as elevated seawater temperatures. Here, we use the ecologically important sponge Rhopaloeides odorabile as a model to explore the changes in symbiosis during the development of temperature-induced necrosis. Expression profiling of the sponge host was examined in conjunction with the phylogenetic and functional structure and the expression profile of the symbiont community. Elevated temperature causes an immediate stress response in both the host and symbiont community, including reduced expression of functions that mediate their partnership. Disruption to nutritional interdependence and molecular interactions during early heat stress further destabilizes the holobiont, ultimately leading to the loss of archetypal sponge symbionts and the introduction of new microorganisms that have functional and expression profiles consistent with a scavenging lifestyle, a lack virulence functions and a high growth rate. Previous models have postulated various mechanisms of mortality and disease in marine invertebrates. Our study suggests that interruption of symbiotic interactions is a major determinant for mortality in marine sessile invertebrates. High symbiont specialization and low functional redundancy, thus make these holobionts extremely vulnerable to environmental perturbations, including climate change.

  7. Transcriptional response of abscisic acid (ABA) metabolism and transport to cold and heat stress applied at the reproductive stage of development in Arabidopsis thaliana.

    PubMed

    Baron, Kevin N; Schroeder, Dana F; Stasolla, Claudio

    2012-06-01

    The phytohormone abscisic acid (ABA) plays an important role in developmental processes in addition to mediating plant adaptation to stress. In the current study, transcriptional response of 17 genes involved in ABA metabolism and transport has been examined in vegetative and reproductive organs exposed to cold and heat stress. Temperature stress activated numerous genes involved in ABA biosynthesis, catabolism and transport; however, several ABA biosynthesis genes (ABA1, ABA2, ABA4, AAO3, NCED3) were differentially expressed (up- or down-regulated) in an organ-specific manner. Key genes (CYP707As) involved in ABA catabolism responded differentially to temperature stress. Cold stress strongly activated ABA catabolism in all organs examined, whereas heat stress triggered more subtle activation and repression of select CYP707A genes. Genes involved in conjugation (UGT71B6), hydrolysis (AtBG1), and transport (ABCG25, ABCG40) of ABA or ABA glucose ester responded to temperature stress and displayed unique organ-specific expression patterns. Comparing the transcriptional response of vegetative and reproductive organs revealed ABA homeostasis is differentially regulated at the whole plant level. Taken together our findings indicate organs in close physical proximity undergo vastly different transcriptional programs in response to abiotic stress and developmental cues. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  8. Plasma-based proteomics reveals immune response, complement and coagulation cascades pathway shifts in heat-stressed lactating dairy cows.

    PubMed

    Min, Li; Cheng, Jianbo; Zhao, Shengguo; Tian, He; Zhang, Yangdong; Li, Songli; Yang, Hongjian; Zheng, Nan; Wang, Jiaqi

    2016-09-02

    Heat stress (HS) has an enormous economic impact on the dairy industry. In recent years, many researchers have investigated changes in the gene expression and metabolomics profiles in dairy cows caused by HS. However, the proteomics profiles of heat-stressed dairy cows have not yet been completely elucidated. We compared plasma proteomics from HS-free and heat-stressed dairy cows using an iTRAQ labeling approach. After the depletion of high abundant proteins in the plasma, 1472 proteins were identified. Of these, 85 proteins were differentially abundant in cows exposed to HS relative to HS-free. Database searches combined with GO and KEGG pathway enrichment analyses revealed that many components of the complement and coagulation cascades were altered in heat-stressed cows compared with HS-free cows. Of these, many factors in the complement system (including complement components C1, C3, C5, C6, C7, C8, and C9, complement factor B, and factor H) were down-regulated by HS, while components of the coagulation system (including coagulation factors, vitamin K-dependent proteins, and fibrinogens) were up-regulated by HS. In conclusion, our results indicate that HS decreases plasma levels of complement system proteins, suggesting that immune function is impaired in dairy cows exposed to HS. Though many aspects of heat stress (HS) have been extensively researched, relatively little is known about the proteomics profile changes that occur during heat exposure. In this work, we employed a proteomics approach to investigate differential abundance of plasma proteins in HS-free and heat-stressed dairy cows. Database searches combined with GO and KEGG pathway enrichment analyses revealed that HS resulted in a decrease in complement components, suggesting that heat-stressed dairy cows have impaired immune function. In addition, through integrative analyses of proteomics and previous metabolomics, we showed enhanced glycolysis, lipid metabolic pathway shifts, and nitrogen

  9. Improved Heat-Stress Algorithm

    NASA Technical Reports Server (NTRS)

    Teets, Edward H., Jr.; Fehn, Steven

    2007-01-01

    NASA Dryden presents an improved and automated site-specific algorithm for heat-stress approximation using standard atmospheric measurements routinely obtained from the Edwards Air Force Base weather detachment. Heat stress, which is the net heat load a worker may be exposed to, is officially measured using a thermal-environment monitoring system to calculate the wet-bulb globe temperature (WBGT). This instrument uses three independent thermometers to measure wet-bulb, dry-bulb, and the black-globe temperatures. By using these improvements, a more realistic WBGT estimation value can now be produced. This is extremely useful for researchers and other employees who are working on outdoor projects that are distant from the areas that the Web system monitors. Most importantly, the improved WBGT estimations will make outdoor work sites safer by reducing the likelihood of heat stress.

  10. Assessment of Male Anthropometric Trends and the Effects on Simulated Heat Stress Responses

    DTIC Science & Technology

    2008-01-01

    by comparing 2004 and 1988 databases. Anthropometric somatotypes were identified and physiological responses of different somatotypes to simulated...databases and identified five primary somatotypes : "tall-fat", "tall-lean", "average", "short-lean" and "short-fat". anthropometry, thermal regulatory

  11. Nanoselenium Supplementation of Heat-Stressed Broilers: Effects on Performance, Carcass Characteristics, Blood Metabolites, Immune Response, Antioxidant Status, and Jejunal Morphology.

    PubMed

    Safdari-Rostamabad, Morteza; Hosseini-Vashan, Seyyed Javad; Perai, Ali Hossein; Sarir, Hadi

    2016-11-22

    An experiment was conducted to investigate the effects of dietary nanoselenium supplementation at 0, 0.6 and 1.2 mg/kg of diet on growth performance, serum biochemical parameters, immune response, antioxidant capacity, and jejunal morphology of 29-d-old male broilers subjected to heat stress at 37 ± 1°C for 14 d. Broilers were fed for 42 d on the experimental diets. The results showed that nanoselenium supplementation had no effect on growth performance, but it supplementation at the rate of 1.2 mg/kg diet decreased the serum concentration of cholesterol prior to the heat exposure. Further, dietary nanoselenium supplementation linearly increased the high-density lipoprotein cholesterol concentration, while linearly decreased those of low-density lipoprotein cholesterol and aspartate aminotransferase in the serum before applying heat stress. Compared with thermoneutral temperature, heat stress reduced body mass gain, feed intake, percentages of carcass, breast, leg, abdominal fat, bursa of Fabricius, thymus, antibody response against sheep red blood cells, serum concentration of protein, erythrocyte activities of glutathione peroxidase and superoxide dismutase, jejunal villus height, and villus height to crypt depth ratio, while increased feed conversion ratio, percentages of liver, gizzard, pancreas, gallbladder, heart, and the concentrations of aspartate aminotransferase and malondialdehyde. Dietary supplementation of nanoselenium linearly reduced the abdominal fat and liver percentages, while linearly increased the activity of glutathione peroxidase and villus height in heat-stressed broilers. Furthermore, the lower level of nanoselenium decreased the percentages of gizzard and heart in broilers under heat stress. The diet supplemented with 1.2 mg/kg nanoselenium improved feed conversion ratio and increased antibody response against sheep red blood cells, activity of superoxide dismutase, and villus height to crypt depth ratio, but decreased the serum

  12. A stress-responsive NAC transcription factor SNAC3 confers heat and drought tolerance through modulation of reactive oxygen species in rice

    PubMed Central

    Fang, Yujie; Liao, Kaifeng; Du, Hao; Xu, Yan; Song, Huazhi; Li, Xianghua; Xiong, Lizhong

    2015-01-01

    Adverse environmental conditions such as high temperature and drought stress greatly limit the growth and production of crops worldwide. Several NAC (NAM, ATAF1/2, and CUC2) proteins have been documented as important regulators in stress responses, but the molecular mechanisms are largely unknown. Here, a stress-responsive NAC gene, SNAC3 (ONAC003, LOC_Os01g09550), conferring drought and heat tolerance in rice is reported. SNAC3 was ubiquitously expressed and its transcript level was induced by drought, high temperature, salinity stress, and abscisic acid (ABA) treatment. Overexpression (OE) of SNAC3 in rice resulted in enhanced tolerance to high temperature, drought, and oxidative stress caused by methyl viologen (MV), whereas suppression of SNAC3 by RNAi resulted in increased sensitivity to these stresses. The SNAC3-OE transgenic plants exhibited significantly lower levels of H2O2, malondiadehyde (MDA), and relative electrolyte leakage than the wild-type control under heat stress conditions, implying that SNAC3 may confer stress tolerance by modulating reactive oxygen species (ROS) homeostasis. Quantitative PCR experiments showed that the expression of a large number of ROS-scavenging genes was dramatically increased in the SNAC3-OE plants, but significantly decreased in the SNAC3-RNAi transgenic plants. Five ROS-associated genes which were up-regulated in SNAC3-OE plants showed co-expression patterns with SNAC3, and three of the co-expressed ROS-associated enzyme genes were verified to be direct target genes of SNAC3. These results suggest that SNAC3 plays important roles in stress responses, and it is likely to be useful for engineering crops with improved tolerance to heat and drought stress. PMID:26261267

  13. Impacts of individual animal response to heat and handling stresses on Escherichia coli and E. coli O157:H7 fecal shedding by feedlot cattle.

    PubMed

    Brown-Brandl, Tami M; Berry, Elaine D; Wells, James E; Arthur, Terrance M; Nienaber, John A

    2009-09-01

    The reduction of foodborne pathogens in cattle destined for human consumption will require knowledge of the factors that impact the carriage and shedding of these organisms. The objective of this work was to investigate the effects of heat and handling stress levels on the fecal shedding of Escherichia coli O157:H7 and generic E. coli by feedlot cattle. In year 1, 128 feedlot heifers were evaluated for heat tolerance five times per week during the 84-day finishing period from May through August. Heat stress measurements included respiration rate, panting score, and visual assessments. In year 2, panting scores were taken for a group of 256 finishing feedlot heifers on days in July and August for which the temperature humidity index (THI) was predicted to be in the "emergency" category (THI > or = 84). For both years, animals were weighed and temperament scored to assess handling stress on a 28-day schedule. At the same time, rectal fecal samples were collected from each animal individually. The presence and concentrations of E. coli O157:H7 and concentrations of generic E. coli in feces were determined. There were no clear trends between the heat stress levels or temperament scores (as an indicator of response to handling) with either fecal generic E. coli concentrations or E. coli O157:H7 concentrations or prevalence in feces, indicating that neither heat nor handling stress contributes to the food safety risk associated with E. coli O157:H7-positive cattle.

  14. Gastric Fluid and Heat Stress Response of Listeria monocytogenes Inoculated on Frankfurters Formulated with 10%, 20%, and 30% Fat Content

    PubMed Central

    Kim, Hack-Youn; Kim, Cheon-Jei; Han, Sung Gu; Choi, Kyoung-Hee

    2014-01-01

    This study evaluated the effects of frankfurter fat content on Listeria monocytogenes resistance to heat stress and gastric fluid, and the Caco-2 cell invasion efficiency of the pathogen. A 10-strain mixture of L. monocytogenes was inoculated on frankfurters formulated with 10%, 20%, and 30% fat content (10%: F10, 20%: F20, 30%: F30) and stored at 10℃ for 30 d. The samples were analyzed for L. monocytogenes resistance to heat stress and a simulated gastric fluid challenge. The total bacteria and L. monocytogenes survival rates were measured on tryptic soy agar plus 0.6% yeast extract and Palcam agar, respectively. L. monocytogenes colonies inoculated on F10, F20, and F30 samples were used for a Caco-2 cell invasion assay. In general, no obvious differences were observed between the survival rates of total bacteria and L. monocytogenes grown on different fat contents under heat stress and gastric fluid challenge. However, L. monocytogenes obtained from the F30 samples had a significantly higher Caco-2 cell invasion efficiency than those in the F10 and F20 samples (p<0.05). These results indicate that although high fat content in food may not be related to L. monocytogenes resistance to heat stress and gastric fluid, it may increase the Caco-2 cell invasion efficiency of the pathogen. PMID:26760741

  15. Withaferin A Induces Proteasome Inhibition, Endoplasmic Reticulum Stress, the Heat Shock Response and Acquisition of Thermotolerance

    PubMed Central

    Heikkila, John J.

    2012-01-01

    In the present study, withaferin A (WA), a steroidal lactone with anti-inflammatory and anti-tumor properties, inhibited proteasome activity and induced endoplasmic reticulum (ER) and cytoplasmic HSP accumulation in Xenopus laevis A6 kidney epithelial cells. Proteasomal inhibition by WA was indicated by an accumulation of ubiquitinated protein and a decrease in chymotrypsin-like activity. Additionally, immunoblot analysis revealed that treatment of cells with WA induced the accumulation of HSPs including ER chaperones, BiP and GRP94, as well as cytoplasmic/nuclear HSPs, HSP70 and HSP30. Furthermore, WA-induced an increase in the relative levels of the protein kinase, Akt, while the levels of actin were unchanged compared to control. Northern blot experiments determined that WA induced an accumulation in bip, hsp70 and hsp30 mRNA but not eIF-1α mRNA. Interestingly, WA acted synergistically with mild heat shock to enhance HSP70 and HSP30 accumulation to a greater extent than the sum of both stressors individually. This latter phenomenon was not observed with BiP or GRP94. Immunocytochemical analysis indicated that WA-induced BiP accumulation occurred mainly in the perinuclear region in a punctate pattern, while HSP30 accumulation occurred primarily in a granular pattern in the cytoplasm with some staining in the nucleus. Prolonged exposure to WA resulted in disorganization of the F-actin cytoskeleton as well as the production of relatively large HSP30 staining structures that co-localized with F-actin. Finally, prior exposure of cells to WA treatment, which induced the accumulation of HSPs conferred a state of thermal protection since it protected the F-actin cytoskeleton against a subsequent cytotoxic thermal challenge. PMID:23226310

  16. The Quinone Methide Aurin Is a Heat Shock Response Inducer That Causes Proteotoxic Stress and Noxa-dependent Apoptosis in Malignant Melanoma Cells*

    PubMed Central

    Davis, Angela L.; Qiao, Shuxi; Lesson, Jessica L.; Rojo de la Vega, Montserrat; Park, Sophia L.; Seanez, Carol M.; Gokhale, Vijay; Cabello, Christopher M.; Wondrak, Georg T.

    2015-01-01

    Pharmacological induction of proteotoxic stress is rapidly emerging as a promising strategy for cancer cell-directed chemotherapeutic intervention. Here, we describe the identification of a novel drug-like heat shock response inducer for the therapeutic induction of proteotoxic stress targeting malignant human melanoma cells. Screening a focused library of compounds containing redox-directed electrophilic pharmacophores employing the Stress & Toxicity PathwayFinderTM PCR Array technology as a discovery tool, a drug-like triphenylmethane-derivative (aurin; 4-[bis(p-hydroxyphenyl)methylene]-2,5-cyclohexadien-1-one) was identified as an experimental cell stress modulator that causes (i) heat shock factor transcriptional activation, (ii) up-regulation of heat shock response gene expression (HSPA6, HSPA1A, DNAJB4, HMOX1), (iii) early unfolded protein response signaling (phospho-PERK, phospho-eIF2α, CHOP (CCAAT/enhancer-binding protein homologous protein)), (iv) proteasome impairment with increased protein-ubiquitination, and (v) oxidative stress with glutathione depletion. Fluorescence polarization-based experiments revealed that aurin displays activity as a geldanamycin-competitive Hsp90α-antagonist, a finding further substantiated by molecular docking and ATPase inhibition analysis. Aurin exposure caused caspase-dependent cell death in a panel of human malignant melanoma cells (A375, G361, LOX-IMVI) but not in non-malignant human skin cells (Hs27 fibroblasts, HaCaT keratinocytes, primary melanocytes) undergoing the aurin-induced heat shock response without impairment of viability. Aurin-induced melanoma cell apoptosis depends on Noxa up-regulation as confirmed by siRNA rescue experiments demonstrating that siPMAIP1-based target down-regulation suppresses aurin-induced cell death. Taken together, our data suggest feasibility of apoptotic elimination of malignant melanoma cells using the quinone methide-derived heat shock response inducer aurin. PMID:25477506

  17. The quinone methide aurin is a heat shock response inducer that causes proteotoxic stress and Noxa-dependent apoptosis in malignant melanoma cells.

    PubMed

    Davis, Angela L; Qiao, Shuxi; Lesson, Jessica L; Rojo de la Vega, Montserrat; Park, Sophia L; Seanez, Carol M; Gokhale, Vijay; Cabello, Christopher M; Wondrak, Georg T

    2015-01-16

    Pharmacological induction of proteotoxic stress is rapidly emerging as a promising strategy for cancer cell-directed chemotherapeutic intervention. Here, we describe the identification of a novel drug-like heat shock response inducer for the therapeutic induction of proteotoxic stress targeting malignant human melanoma cells. Screening a focused library of compounds containing redox-directed electrophilic pharmacophores employing the Stress & Toxicity PathwayFinder(TM) PCR Array technology as a discovery tool, a drug-like triphenylmethane-derivative (aurin; 4-[bis(p-hydroxyphenyl)methylene]-2,5-cyclohexadien-1-one) was identified as an experimental cell stress modulator that causes (i) heat shock factor transcriptional activation, (ii) up-regulation of heat shock response gene expression (HSPA6, HSPA1A, DNAJB4, HMOX1), (iii) early unfolded protein response signaling (phospho-PERK, phospho-eIF2α, CHOP (CCAAT/enhancer-binding protein homologous protein)), (iv) proteasome impairment with increased protein-ubiquitination, and (v) oxidative stress with glutathione depletion. Fluorescence polarization-based experiments revealed that aurin displays activity as a geldanamycin-competitive Hsp90α-antagonist, a finding further substantiated by molecular docking and ATPase inhibition analysis. Aurin exposure caused caspase-dependent cell death in a panel of human malignant melanoma cells (A375, G361, LOX-IMVI) but not in non-malignant human skin cells (Hs27 fibroblasts, HaCaT keratinocytes, primary melanocytes) undergoing the aurin-induced heat shock response without impairment of viability. Aurin-induced melanoma cell apoptosis depends on Noxa up-regulation as confirmed by siRNA rescue experiments demonstrating that siPMAIP1-based target down-regulation suppresses aurin-induced cell death. Taken together, our data suggest feasibility of apoptotic elimination of malignant melanoma cells using the quinone methide-derived heat shock response inducer aurin.

  18. Effects of obesity and mild hypohydration on local sweating and cutaneous vascular responses during passive heat stress in females.

    PubMed

    Moyen, Nicole E; Burchfield, Jenna M; Butts, Cory L; Glenn, Jordan M; Tucker, Matthew A; Treece, Keeley; Smith, Amber J; McDermott, Brendon P; Ganio, Matthew S

    2016-08-01

    The purpose of this study was to evaluate the effect of obesity and mild hypohydration on local sweating (LSR) and cutaneous vascular conductance (CVC) responses during passive heat stress in females. Thirteen obese (age, 24 ± 4 years; 45.4% ± 5.2% body fat) and 12 nonobese (age, 22 ± 2 years; 25.1% ± 3.9% body fat) females were passively heated (1.0 °C rectal temperature increase) while either euhydrated (EUHY) or mildly hypohydrated (HYPO; via fluid restriction). Chest and forearm LSR (ventilated capsule) and CVC (Laser Doppler flowmetry) onset, sensitivity, and plateau/steady state were recorded as mean body temperature increased (ΔTb). Participants began trials EUHY (urine specific gravity, Usg = 1.009 ± 0.006) or HYPO (Usg = 1.025 ± 0.004; p < 0.05), and remained EUHY or HYPO. Independent of obesity, HYPO decreased sweat sensitivity at the chest (HYPO = 0.79 ± 0.35, EUHY = 0.95 ± 0.39 Δmg·min(-1)·cm(-2)/°C ΔTb) and forearm (HYPO = 0.82 ± 0.39, EUHY = 1.06 ± 0.34 Δmg·min(-1)·cm(-2)/°C ΔTb); forearm LSR plateau was also decreased (HYPO = 0.66 ± 0.19, EUHY = 0.78 ± 0.23 mg·min(-1)·cm(-2); all p < 0.05). Overall, obese females had lower chest-sweat sensitivity (0.72 ± 0.35 vs. 1.01 ± 0.33 Δmg·min(-1)·cm(-2)/°C ΔTb) and plateau (0.55 ± 0.27 vs. 0.80 ± 0.25 mg·min(-1)·cm(-2); p < 0.05). While hypohydrated, obese females had a lower chest LSR (p < 0.05) versus nonobese females midway (0.45 ± 0.26 vs. 0.73 ± 0.23 mg·min(-1)·cm(-2)) and at the end (0.53 ± 0.27 vs. 0.81 ± 0.24 mg·min(-1)·cm(-2)) of heating. Furthermore, HYPO (relative to the EUHY trials) led to a greater decrease in CVC sensitivity in obese (-28 ± 27 Δ% maximal CVC/°C ΔTb) versus nonobese females (+9.2 ± 33 Δ% maximal CVC/°C ΔTb; p < 0.05). In conclusion, mild hypohydration impairs females' sweating responses during passive heat stress, and this effect is exacerbated when obese.

  19. Translational control in the stress adaptive response of cancer cells: a novel role for the heat shock protein TRAP1

    PubMed Central

    Matassa, D S; Amoroso, M R; Agliarulo, I; Maddalena, F; Sisinni, L; Paladino, S; Romano, S; Romano, M F; Sagar, V; Loreni, F; Landriscina, M; Esposito, F

    2013-01-01

    TNF receptor-associated protein 1 (TRAP1), the main mitochondrial member of the heat shock protein (HSP) 90 family, is induced in most tumor types and is involved in the regulation of proteostasis in the mitochondria of tumor cells through the control of folding and stability of selective proteins, such as Cyclophilin D and Sorcin. Notably, we have recently demonstrated that TRAP1 also interacts with the regulatory protein particle TBP7 in the endoplasmic reticulum (ER), where it is involved in a further extra-mitochondrial quality control of nuclear-encoded mitochondrial proteins through the regulation of their ubiquitination/degradation. Here we show that TRAP1 is involved in the translational control of cancer cells through an attenuation of global protein synthesis, as evidenced by an inverse correlation between TRAP1 expression and ubiquitination/degradation of nascent stress-protective client proteins. This study demonstrates for the first time that TRAP1 is associated with ribosomes and with several translation factors in colon carcinoma cells and, remarkably, is found co-upregulated with some components of the translational apparatus (eIF4A, eIF4E, eEF1A and eEF1G) in human colorectal cancers, with potential new opportunities for therapeutic intervention in humans. Moreover, TRAP1 regulates the rate of protein synthesis through the eIF2α pathway either under basal conditions or under stress, favoring the activation of GCN2 and PERK kinases, with consequent phosphorylation of eIF2α and attenuation of cap-dependent translation. This enhances the synthesis of selective stress-responsive proteins, such as the transcription factor ATF4 and its downstream effectors BiP/Grp78, and the cystine antiporter system xCT, thereby providing protection against ER stress, oxidative damage and nutrient deprivation. Accordingly, TRAP1 silencing sensitizes cells to apoptosis induced by novel antitumoral drugs that inhibit cap-dependent translation, such as ribavirin or 4EGI

  20. Heat stress and the photosynthetic electron transport chain of the lichen Parmelina tiliacea (Hoffm.) Ach. in the dry and the wet state: differences and similarities with the heat stress response of higher plants.

    PubMed

    Oukarroum, Abdallah; Strasser, Reto J; Schansker, Gert

    2012-03-01

    Thalli of the foliose lichen species Parmelina tiliacea were studied to determine responses of the photosynthetic apparatus to high temperatures in the dry and wet state. The speed with which dry thalli were activated by water following a 24 h exposure at different temperatures decreased as the temperature was increased. But even following a 24 h exposure to 50 °C the fluorescence induction kinetics OJIP reflecting the reduction kinetics of the photosynthetic electron transport chain had completely recovered within 128 min. Exposure of dry thalli to 50 °C for 24 h did not induce a K-peak in the fluorescence rise suggesting that the oxygen evolving complex had remained intact. This contrasted strongly with wet thalli were submergence for 40 s in water of 45 °C inactivated most of the photosystem II reaction centres. In wet thalli, following the destruction of the Mn-cluster, the donation rate to photosystem II by alternative donors (e.g. ascorbate) was lower than in higher plants. This is associated with the near absence of a secondary rise peak (~1 s) normally observed in higher plants. Analysing the 820 nm and prompt fluorescence transients suggested that the M-peak (occurs around 2-5 s) in heat-treated wet lichen thalli is related to cyclic electron transport around photosystem I. Normally, heat stress in lichen thalli leads to desiccation and as consequence lichens may lack the heat-stress-tolerance-increasing mechanisms observed in higher plants. Wet lichen thalli may, therefore, represent an attractive reference system for the evaluation of processes related with heat stress in higher plants. © Springer Science+Business Media B.V. 2012

  1. Plastid casein kinase 2 knockout reduces abscisic acid (ABA) sensitivity, thermotolerance, and expression of ABA- and heat-stress-responsive nuclear genes

    PubMed Central

    Wang, Yu; Chang, Hongping; Hu, Shuai; Lu, Xiutao; Yuan, Congying; Zhang, Chen; Wang, Ping; Xiao, Wenjun; Xiao, Langtao; Xue, Gang-Ping; Guo, Xinhong

    2014-01-01

    Plastid casein kinase 2 (CK2) is a major Ser/Thr-specific enzyme for protein phosphorylation in the chloroplast stroma and its kinase activity is regulated by redox signals. To understand the role of CK2 phosphorylation of chloroplast proteins in abiotic stress signalling, an Arabidopsis plastid CK2 (CKA4) knockout mutant was investigated in terms of the plant response to abscisic acid (ABA) and heat stress. CKA4 expression was upregulated by ABA and heat treatment. The cka4 mutant showed reduced sensitivity to ABA during seed germination and seedling growth, and increased stomatal aperture and leaf water loss with a slightly reduced leaf ABA level. The cka4 mutant was more sensitive to heat stress than the wild-type Columbia-0. The expression levels of a number of genes in the ABA regulatory network were reduced in the cka4 mutant. Many heat-upregulated genes (heat-shock factors and heat-shock proteins) were also reduced in the cka4 mutant. The cka4 mutant showed reduced expression levels of plastid-encoded RNA polymerase target genes (atpB and psbA). CKA4 knockout mutation also resulted in a reduction in expression of some critical genes (PTM, ABI4, and PRS1) involved in retrograde signalling from the chloroplast to the nucleus. Similar results were observed in mutant plants with the knockout mutation in both CKA4 and CKA3, which encodes a nuclear CK2 α3 subunit. CKA3 expression was not responsive to ABA and heat stress. These results suggest that CKA4 is an enhancing factor in abiotic stress signalling through modulating the expression of some molecular players in retrograde signalling. PMID:24803505

  2. Common and distinct functions of Arabidopsis class A1 and A2 heat shock factors in diverse abiotic stress responses and development.

    PubMed

    Liu, Hsiang-chin; Charng, Yee-yung

    2013-09-01

    There are 21 heat shock factor (HSF) homologs in Arabidopsis (Arabidopsis thaliana), of which members of class A1 (HSFA1a/HSFA1b/HSFA1d/HSFA1e) play the major role in activating the transcription of heat-induced genes, including HSFA2. Once induced, HSFA2 becomes the dominant HSF and is able to form heterooligomeric complexes with HSFA1. However, whether HSFA2 could function independently as a transcription regulator in the absence of the HSFA1s was undetermined. To address this question, we introduced a Cauliflower mosaic virus 35S promoter:HSFA2 construct into hsfa1a/hsfa1b/hsfa1d/hsfa1e quadruple knockout (QK) and wild-type (Wt) backgrounds to yield transgenic lines A2QK and A2Wt, respectively. Constitutive expression of HSFA2 rescued the developmental defects of the QK mutant and promoted callus formation in A2QK, but not in A2Wt, after heat treatment. Transcriptome analysis showed that heat stress response genes are differentially regulated by the HSFA1s and HSFA2; the genes involved in metabolism and redox homeostasis are preferentially regulated by HSFA2, while HSFA1-preferring genes are enriched in transcription function. Ectopic expression of HSFA2 complemented the defects of QK in tolerance to different heat stress regimes, and to hydrogen peroxide, but not to salt and osmotic stresses. Furthermore, we showed that HSFA1a/HSFA1b/HSFA1d are involved in thermotolerance to mild heat stress at temperatures as low as 27°C. We also noticed subfunctionalization of the four Arabidopsis A1-type HSFs in diverse abiotic stress responses. Overall, this study reveals the overlapping and distinct functions of class A1 and A2 HSFs and may enable more precise use of HSFs in engineering stress tolerance in the future.

  3. Heat shock protein 70 gene family in the Glanville fritillary butterfly and their response to thermal stress.

    PubMed

    Luo, Shiqi; Ahola, Virpi; Shu, Chang; Xu, Chongren; Wang, Rongjiang

    2015-02-10

    Temperature variation in the environment is a great challenge to organisms. Induction of heat shock protein 70 (HSP70) is a common genetic mechanism to cope with thermal stress. The Glanville fritillary butterfly (Melitaea cinxia) is a model species in population and evolutionary biology, and its behavior and life history are greatly influenced by ambient temperature. We cloned and sequenced the full coding sequences of seven hsp70 genes from the Glanville fritillary. Of those genes, McHsc70-1 and McHsc70-2 were identified as heat shock cognate 70 (hsc70), of which the latter located in endoplasmic reticulum. We analyzed the expression patterns of different hsp70s under various thermal stresses using quantitative PCR. Heat shock at 40°C for 2h induced high expression of McHsp70-1, McHsp70-2 and McHsc70-2. Only McHsc70-2 had a small increase after cold shock at 0°C for 2h. Acclimation at 35°C for three days before heat shock reduced expression of McHsp70 after heat shock. The maximum mRNA level of McHsp70s was reached in the first 2h after the heat shock. This study uncovers the complexity of the hsp70 system, and provides the valuable information for further temperature-related research in the Glanville fritillary butterfly.

  4. Systematic Analysis of Hsf Family Genes in the Brassica napus Genome Reveals Novel Responses to Heat, Drought and High CO2 Stresses

    PubMed Central

    Zhu, Xiaoyi; Huang, Chunqian; Zhang, Liang; Liu, Hongfang; Yu, Jinhui; Hu, Zhiyong; Hua, Wei

    2017-01-01

    Drought and heat stress are major causes of lost plant crop yield. In the future, high levels of CO2, in combination of other abiotic stress factors, will become a novel source of stress. Little is known of the mechanisms involved in the acclimation responses of plants to this combination of abiotic stress factors, though it has been demonstrated that heat shock transcription factors (Hsfs) are involved in plant response to various abiotic stresses. In this study, we performed a genome-wide identification and a systematic analysis of genes in the Hsf gene family in Brassica napus. A total of 64 genes encoding Hsf proteins were identified and classified into 3 major classes: A, B and C. We found that, unlike in other eudicots, the A9 subclass is absent in rapeseed. Further gene structure analysis revealed a loss of the only intron in the DBD domain for BnaHsf63 and -64 within class C, which is evolutionarily conserved in all Hsf genes. Transcription profile results demonstrated that most BnaHsf family genes are upregulated by both drought and heat conditions, while some are responded to a high CO2 treatment. According to the combined RNA-seq and qRT-PCR analysis, the A1E/A4A/A7 subclasses were upregulated by both drought and heat treatments. Members in class C seemed to be predominantly induced only by drought. Among BnaHsf genes, the A2/A3/B2 subclasses were regulated by all three abiotic stresses. Members in A2/B2 subclasses were upregulated by drought and heat treatments, but were downregulated under high CO2 conditions. While the A3 subclass was upregulated by all the three abiotic stresses. Various stress-related cis-acting elements, enriched in promoter regions, were correlated with the transcriptional response of BnaHsfs to these abiotic stresses. Further study of these novel groups of multifunctional BnaHsf genes will improve our understanding of plant acclimation response to abiotic stresses, and may be useful for improving the abiotic stress resistance of

  5. Systematic Analysis of Hsf Family Genes in the Brassica napus Genome Reveals Novel Responses to Heat, Drought and High CO2 Stresses.

    PubMed

    Zhu, Xiaoyi; Huang, Chunqian; Zhang, Liang; Liu, Hongfang; Yu, Jinhui; Hu, Zhiyong; Hua, Wei

    2017-01-01

    Drought and heat stress are major causes of lost plant crop yield. In the future, high levels of CO2, in combination of other abiotic stress factors, will become a novel source of stress. Little is known of the mechanisms involved in the acclimation responses of plants to this combination of abiotic stress factors, though it has been demonstrated that heat shock transcription factors (Hsfs) are involved in plant response to various abiotic stresses. In this study, we performed a genome-wide identification and a systematic analysis of genes in the Hsf gene family in Brassica napus. A total of 64 genes encoding Hsf proteins were identified and classified into 3 major classes: A, B and C. We found that, unlike in other eudicots, the A9 subclass is absent in rapeseed. Further gene structure analysis revealed a loss of the only intron in the DBD domain for BnaHsf63 and -64 within class C, which is evolutionarily conserved in all Hsf genes. Transcription profile results demonstrated that most BnaHsf family genes are upregulated by both drought and heat conditions, while some are responded to a high CO2 treatment. According to the combined RNA-seq and qRT-PCR analysis, the A1E/A4A/A7 subclasses were upregulated by both drought and heat treatments. Members in class C seemed to be predominantly induced only by drought. Among BnaHsf genes, the A2/A3/B2 subclasses were regulated by all three abiotic stresses. Members in A2/B2 subclasses were upregulated by drought and heat treatments, but were downregulated under high CO2 conditions. While the A3 subclass was upregulated by all the three abiotic stresses. Various stress-related cis-acting elements, enriched in promoter regions, were correlated with the transcriptional response of BnaHsfs to these abiotic stresses. Further study of these novel groups of multifunctional BnaHsf genes will improve our understanding of plant acclimation response to abiotic stresses, and may be useful for improving the abiotic stress resistance of

  6. The temperature response of CO2 assimilation, photochemical activities and Rubisco activation in Camelina sativa, a potential bioenergy crop with limited capacity for acclimation to heat stress.

    PubMed

    Carmo-Silva, A Elizabete; Salvucci, Michael E

    2012-11-01

    The temperature optimum of photosynthesis coincides with the average daytime temperature in a species' native environment. Moderate heat stress occurs when temperatures exceed the optimum, inhibiting photosynthesis and decreasing productivity. In the present study, the temperature response of photosynthesis and the potential for heat acclimation was evaluated for Camelina sativa, a bioenergy crop. The temperature optimum of net CO(2) assimilation rate (A) under atmospheric conditions was 30-32 °C and was only slightly higher under non-photorespiratory conditions. The activation state of Rubisco was closely correlated with A at supra-optimal temperatures, exhibiting a parallel decrease with increasing leaf temperature. At both control and elevated temperatures, the modeled response of A to intercellular CO(2) concentration was consistent with Rubisco limiting A at ambient CO(2). Rubisco activation and photochemical activities were affected by moderate heat stress at lower temperatures in camelina than in the warm-adapted species cotton and tobacco. Growth under conditions that imposed a daily interval of moderate heat stress caused a 63 % reduction in camelina seed yield. Levels of cpn60 protein were elevated under the higher growth temperature, but acclimation of photosynthesis was minimal. Inactivation of Rubisco in camelina at temperatures above 35 °C was consistent with the temperature response of Rubisco activase activity and indicated that Rubisco activase was a prime target of inhibition by moderate heat stress in camelina. That photosynthesis exhibited no acclimation to moderate heat stress will likely impact the development of camelina and other cool season Brassicaceae as sources of bioenergy in a warmer world.

  7. Silver nanoparticles and dissolved silver activate contrasting immune responses and stress-induced heat shock protein expression in sea urchin.

    PubMed

    Magesky, Adriano; de Oliveira Ribeiro, Ciro A; Beaulieu, Lucie; Pelletier, Émilien

    2017-07-01

    Using immune cells of sea urchin Strongylocentrotus droebachiensis in early development as a model, the cellular protective mechanisms against ionic and poly(allylamine)-coated silver nanoparticle (AgNPs; 14 ± 6 nm) treatments at 100 μg L(-1) were investigated. Oxidative stress, heat shock protein expression, and pigment production by spherulocytes were determined as well as AgNP translocation pathways and their multiple effects on circulating coelomocytes. Sea urchins showed an increasing resilience to Ag over time because ionic Ag is accumulated in a steady way, although nanoAg levels dropped between 48 h and 96 h. A clotting reaction emerged on tissues injured by dissolved Ag (present as chloro-complexes in seawater) between 12 h and 48 h. Silver contamination and nutritional state influenced the production of reactive oxygen species. After passing through coelomic sinuses and gut, AgNPs were found in coelomocytes. Inside blood vessels, apoptosis-like processes appeared in coelomocytes highly contaminated by poly(allylamine)-coated AgNPs. Increasing levels of Ag accumulated by urchins once exposed to AgNPs pointed to a Trojan-horse mechanism operating over 12-d exposure. However, under short-term treatments, physical interactions of poly(allylamine)-coated AgNPs with cell structures might be, at some point, predominant and responsible for the highest levels of stress-related proteins detected. The present study is the first report detailing nano-translocation in a marine organism and multiple mechanisms by which sea urchin cells can deal with toxic AgNPs. Environ Toxicol Chem 2017;36:1872-1886. © 2016 SETAC. © 2016 SETAC.

  8. Annotation of Differential Gene Expression in Small Yellow Follicles of a Broiler-Type Strain of Taiwan Country Chickens in Response to Acute Heat Stress.

    PubMed

    Cheng, Chuen-Yu; Tu, Wei-Lin; Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

    2015-01-01

    This study investigated global gene expression in the small yellow follicles (6-8 mm diameter) of broiler-type B strain Taiwan country chickens (TCCs) in response to acute heat stress. Twelve 30-wk-old TCC hens were divided into four groups: control hens maintained at 25°C and hens subjected to 38°C acute heat stress for 2 h without recovery (H2R0), with 2-h recovery (H2R2), and with 6-h recovery (H2R6). Small yellow follicles were collected for RNA isolation and microarray analysis at the end of each time point. Results showed that 69, 51, and 76 genes were upregulated and 58, 15, 56 genes were downregulated after heat treatment of H2R0, H2R2, and H2R6, respectively, using a cutoff value of two-fold or higher. Gene ontology analysis revealed that these differentially expressed genes are associated with the biological processes of cell communication, developmental process, protein metabolic process, immune system process, and response to stimuli. Upregulation of heat shock protein 25, interleukin 6, metallopeptidase 1, and metalloproteinase 13, and downregulation of type II alpha 1 collagen, discoidin domain receptor tyrosine kinase 2, and Kruppel-like factor 2 suggested that acute heat stress induces proteolytic disintegration of the structural matrix and inflamed damage and adaptive responses of gene expression in the follicle cells. These suggestions were validated through gene expression, using quantitative real-time polymerase chain reaction. Functional annotation clarified that interleukin 6-related pathways play a critical role in regulating acute heat stress responses in the small yellow follicles of TCC hens.

  9. Annotation of Differential Gene Expression in Small Yellow Follicles of a Broiler-Type Strain of Taiwan Country Chickens in Response to Acute Heat Stress

    PubMed Central

    Wang, Shih-Han; Tang, Pin-Chi; Chen, Chih-Feng; Chen, Hsin-Hsin; Lee, Yen-Pai; Chen, Shuen-Ei; Huang, San-Yuan

    2015-01-01

    This study investigated global gene expression in the small yellow follicles (6–8 mm diameter) of broiler-type B strain Taiwan country chickens (TCCs) in response to acute heat stress. Twelve 30-wk-old TCC hens were divided into four groups: control hens maintained at 25°C and hens subjected to 38°C acute heat stress for 2 h without recovery (H2R0), with 2-h recovery (H2R2), and with 6-h recovery (H2R6). Small yellow follicles were collected for RNA isolation and microarray analysis at the end of each time point. Results showed that 69, 51, and 76 genes were upregulated and 58, 15, 56 genes were downregulated after heat treatment of H2R0, H2R2, and H2R6, respectively, using a cutoff value of two-fold or higher. Gene ontology analysis revealed that these differentially expressed genes are associated with the biological processes of cell communication, developmental process, protein metabolic process, immune system process, and response to stimuli. Upregulation of heat shock protein 25, interleukin 6, metallopeptidase 1, and metalloproteinase 13, and downregulation of type II alpha 1 collagen, discoidin domain receptor tyrosine kinase 2, and Kruppel-like factor 2 suggested that acute heat stress induces proteolytic disintegration of the structural matrix and inflamed damage and adaptive responses of gene expression in the follicle cells. These suggestions were validated through gene expression, using quantitative real-time polymerase chain reaction. Functional annotation clarified that interleukin 6-related pathways play a critical role in regulating acute heat stress responses in the small yellow follicles of TCC hens. PMID:26587838

  10. Gene Expression Profiles of Heat Shock Proteins 70 and 90 From Empoasca onukii (Hemiptera: Cicadellidae) in Response to Temperature Stress

    PubMed Central

    Qiao, Li; Wu, Jun X.; Qin, Dao Z.; Liu, Xiang C.; Lu, Zhao C.; Lv, Li Z.; Pan, Zi L.; Chen, Hao; Li, Guang W.

    2015-01-01

    Empoasca onukii Matsuda is a worldwide pest that causes great economic loss in tea growing areas and is significantly affected by temperatures. Heat shock protein (Hsp) genes are important in insects’ response to temperature stress. In this study, two full-length Hsp genes, Eohsp90 and Eohsp70, were cloned from E. onukii using rapid amplification of complementary DNA ends. The open reading frames of Eohsp90 and Eohsp70 were 2,172 bp and 2,016 bp in length, respectively. Their deduced amino acid sequences of Eohsp90 and Eohsp70 showed high homology with other species. Subsequently, the transcriptional expression of Eohsp90 and Eohsp70 in E. onukii adults exposed to various temperatures (−5, 0, 10, 15, 20, 25, 30, 35, 38, 41 and 44°C) for 1 h, and at extreme temperatures (0°C and 41°C) for various time duration (0, 20, 40, 60, 80, 100, and 120 min) were investigated via real-time quantitative polymerase chain reaction. The relative expression levels of both Eohsp90 and Eohsp70 in E. onukii adults were upregulated as the temperature rises or falls over time, except in the −5°C or 44°C temperature groups. Moreover, the expression level in the temperature elevated groups was higher than that of the lower temperature groups. In addition, the Eohsp70 generally demonstrated a higher transcriptional level than Eohsp90, and both genes had a higher expression profile in female adults compared with the males. The expression profiles indicated that Eohsp90 and Eohsp70 may play important roles in E. onukii adult responses to ecologically relevant environmental temperature threat. PMID:25888707

  11. Response of Urban Systems to Climate Change in Europe: Heat Stress Exposure and the Effect on Human Health

    NASA Astrophysics Data System (ADS)

    Stevens, Catherine; Thomas, Bart; Grommen, Mart

    2015-04-01

    Climate change is driven by global processes such as the global ocean circulation and its variability over time leading to changing weather patterns on regional scales as well as changes in the severity and occurrence of extreme events such as heavy rain- and windstorms, floods, drought, heat waves, etc. The summer 2003 European heat wave was the hottest summer on record in Europe over the past centuries leading to health crises in several countries like France and caused up to 70.000 excess deaths over four months in Central and Western Europe. The main risks induced by global climate change in urbanised areas are considered to be overheating and resulting health effects, increased exposure to flood events, increased damage losses from extreme weather conditions but also shortages in the provision of life-sustaining services. Moreover, the cities themselves create specific or inherent risks and urban adaptation is often very demanding. As most of Europe's inhabitants live in cities, it is of particular relevance to examine the impact of climate variability on urban areas and their populations. The present study focusses on the identification of heat stress variables related to human health and the extraction of this information by processing daily temperature statistics of local urban climate simulations over multiple timeframes of 20 years and three different European cities based on recent, near future and far future global climate predictions. The analyses have been conducted in the framework of the NACLIM FP7 project funded by the European Commission involving local stakeholders such as the cities of Antwerp (Belgium), Berlin (Germany) and Almada (Portugal) represented by different climate and urban characteristics. Apart from the urban-rural temperature increment (urban heat island effect), additional heat stress parameters such as the average number of heat wave days together with their duration and intensities have been covered during this research. In a

  12. Harnessing Next Generation Sequencing in Climate Change: RNA-Seq Analysis of Heat Stress-Responsive Genes in Wheat (Triticum aestivum L.)

    PubMed Central

    Goswami, Suneha; Sharma, Sushil K.; Kala, Yugal K.; Rai, Gyanendra K.; Mishra, Dwijesh C.; Grover, Monendra; Singh, Gyanendra P.; Pathak, Himanshu; Rai, Anil; Chinnusamy, Viswanathan; Rai, Raj D.

    2015-01-01

    Abstract Wheat is a staple food worldwide and provides 40% of the calories in the diet. Climate change and global warming pose a threat to wheat production, however, and demand a deeper understanding of how heat stress might impact wheat production and wheat biology. However, it is difficult to identify novel heat stress associated genes when the genomic information is not available. Wheat has a very large and complex genome that is about 37 times the size of the rice genome. The present study sequenced the whole transcriptome of the wheat cv. HD2329 at the flowering stage, under control (22° ± 3°C) and heat stress (42°C, 2 h) conditions using Illumina HiSeq and Roche GS-FLX 454 platforms. We assembled more than 26.3 and 25.6 million high-quality reads from the control and HS-treated tissues transcriptome sequences respectively. About 76,556 (control) and 54,033 (HS-treated) contigs were assembled and annotated de novo using different assemblers and a total of 21,529 unigenes were obtained. Gene expression profile showed significant differential expression of 1525 transcripts under heat stress, of which 27 transcripts showed very high (>10) fold upregulation. Cellular processes such as metabolic processes, protein phosphorylation, oxidations-reductions, among others were highly influenced by heat stress. In summary, these observations significantly enrich the transcript dataset of wheat available on public domain and show a de novo approach to discover the heat-responsive transcripts of wheat, which can accelerate the progress of wheat stress-genomics as well as the course of wheat breeding programs in the era of climate change. PMID:26406536

  13. Harnessing Next Generation Sequencing in Climate Change: RNA-Seq Analysis of Heat Stress-Responsive Genes in Wheat (Triticum aestivum L.).

    PubMed

    Kumar, Ranjeet R; Goswami, Suneha; Sharma, Sushil K; Kala, Yugal K; Rai, Gyanendra K; Mishra, Dwijesh C; Grover, Monendra; Singh, Gyanendra P; Pathak, Himanshu; Rai, Anil; Chinnusamy, Viswanathan; Rai, Raj D

    2015-10-01

    Wheat is a staple food worldwide and provides 40% of the calories in the diet. Climate change and global warming pose a threat to wheat production, however, and demand a deeper understanding of how heat stress might impact wheat production and wheat biology. However, it is difficult to identify novel heat stress associated genes when the genomic information is not available. Wheat has a very large and complex genome that is about 37 times the size of the rice genome. The present study sequenced the whole transcriptome of the wheat cv. HD2329 at the flowering stage, under control (22°±3°C) and heat stress (42°C, 2 h) conditions using Illumina HiSeq and Roche GS-FLX 454 platforms. We assembled more than 26.3 and 25.6 million high-quality reads from the control and HS-treated tissues transcriptome sequences respectively. About 76,556 (control) and 54,033 (HS-treated) contigs were assembled and annotated de novo using different assemblers and a total of 21,529 unigenes were obtained. Gene expression profile showed significant differential expression of 1525 transcripts under heat stress, of which 27 transcripts showed very high (>10) fold upregulation. Cellular processes such as metabolic processes, protein phosphorylation, oxidations-reductions, among others were highly influenced by heat stress. In summary, these observations significantly enrich the transcript dataset of wheat available on public domain and show a de novo approach to discover the heat-responsive transcripts of wheat, which can accelerate the progress of wheat stress-genomics as well as the course of wheat breeding programs in the era of climate change.

  14. A Critical Role of Lyst-Interacting Protein5, a Positive Regulator of Multivesicular Body Biogenesis, in Plant Responses to Heat and Salt Stresses1

    PubMed Central

    Wang, Fei; Yang, Yan; Wang, Zhe; Zhou, Jie; Fan, Baofang; Chen, Zhixiang

    2015-01-01

    Multivesicular bodies (MVBs) are unique endosomes containing vesicles in the lumen and play critical roles in many cellular processes. We have recently shown that Arabidopsis (Arabidopsis thaliana) Lyst-Interacting Protein5 (LIP5), a positive regulator of the Suppressor of K+ Transport Growth Defect1 (SKD1) AAA ATPase in MVB biogenesis, is a critical target of the mitogen-activated protein kinases MPK3 and MPK6 and plays an important role in the plant immune system. In this study, we report that the LIP5-regulated MVB pathway also plays a critical role in plant responses to abiotic stresses. Disruption of LIP5 causes compromised tolerance to both heat and salt stresses. The critical role of LIP5 in plant tolerance to abiotic stresses is dependent on its ability to interact with Suppressor of K+ Transport Growth Defect1. When compared with wild-type plants, lip5 mutants accumulate increased levels of ubiquitinated protein aggregates and NaCl under heat and salt stresses, respectively. Further analysis using fluorescent dye and MVB markers reveals that abiotic stress increases the formation of endocytic vesicles and MVBs in a largely LIP5-dependent manner. LIP5 is also required for the salt-induced increase of intracellular reactive oxygen species, which have been implicated in signaling of salt stress responses. Basal levels of LIP5 phosphorylation by MPKs and the stability of LIP5 are elevated by salt stress, and mutation of MPK phosphorylation sites in LIP5 reduces the stability and compromises the ability to complement the lip5 salt-sensitive mutant phenotype. These results collectively indicate that the MVB pathway is positively regulated by pathogen/stress-responsive MPK3/6 through LIP5 phosphorylation and plays a critical role in broad plant responses to biotic and abiotic stresses. PMID:26229051

  15. Soybean DREB1/CBF-type transcription factors function in heat and drought as well as cold stress-responsive gene expression.

    PubMed

    Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2015-02-01

    Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions.

  16. Effects of heat stress on baroreflex function in humans

    NASA Technical Reports Server (NTRS)

    Crandall, Craig G.; Cui, Jian; Wilson, Thad E.

    2003-01-01

    INTRODUCTION: Heat stress significantly reduces orthostatic tolerance in humans. The mechanism(s) causing this response remain unknown. The purpose of this review article is to present data pertaining to the hypothesis that reduced orthostatic tolerance in heat stressed individuals is a result of heat stress induced alterations in baroflex function. METHODS: In both normothermic and heat stressed conditions baroreflex responsiveness was assessed via pharmacological and non-pharmacological methods. In addition, the effects of heat stress on post-synaptic vasoconstrictor responsiveness were assessed. RESULTS: Generally, whole body heating did not alter baroreflex sensitivity defined as the gain of the linear portion of the baroreflex curve around the operating point. However, whole body heating shifted the baroreflex curve to the prevailing (i.e. elevated) heart rate and muscle sympathetic nerve activity. Finally, the heat stress impaired vasoconstrictor responses to exogenous administration of adrenergic agonists. CONCLUSION: Current data do not support the hypothesis that reduced orthostatic tolerance associated with heat stress in humans is due to impaired baroreflex responsiveness. This phenomenon may be partially due to the effects of heat stress on reducing vasoconstrictor responsiveness.

  17. Effects of heat stress on baroreflex function in humans

    NASA Technical Reports Server (NTRS)

    Crandall, Craig G.; Cui, Jian; Wilson, Thad E.

    2003-01-01

    INTRODUCTION: Heat stress significantly reduces orthostatic tolerance in humans. The mechanism(s) causing this response remain unknown. The purpose of this review article is to present data pertaining to the hypothesis that reduced orthostatic tolerance in heat stressed individuals is a result of heat stress induced alterations in baroflex function. METHODS: In both normothermic and heat stressed conditions baroreflex responsiveness was assessed via pharmacological and non-pharmacological methods. In addition, the effects of heat stress on post-synaptic vasoconstrictor responsiveness were assessed. RESULTS: Generally, whole body heating did not alter baroreflex sensitivity defined as the gain of the linear portion of the baroreflex curve around the operating point. However, whole body heating shifted the baroreflex curve to the prevailing (i.e. elevated) heart rate and muscle sympathetic nerve activity. Finally, the heat stress impaired vasoconstrictor responses to exogenous administration of adrenergic agonists. CONCLUSION: Current data do not support the hypothesis that reduced orthostatic tolerance associated with heat stress in humans is due to impaired baroreflex responsiveness. This phenomenon may be partially due to the effects of heat stress on reducing vasoconstrictor responsiveness.

  18. The heat-inducible essential response regulator WalR positively regulates transcription of sigI, mreBH and lytE in Bacillus subtilis under heat stress.

    PubMed

    Huang, Wan-Zhen; Wang, Jyun-Jhih; Chen, Hui-Ju; Chen, Jung-Tze; Shaw, Gwo-Chyuan

    2013-12-01

    The actin homolog MreBH governs cell morphogenesis of Bacillus subtilis through localization of the cell wall hydrolase LytE. The alternative sigma factor SigI of B. subtilis coordinately regulates transcription of mreBH and lytE. Transcription of sigI, mreBH and lytE is heat-inducible. The essential response regulator WalR (YycF) plays a key role in coordinating cell wall metabolism with cell proliferation. We now demonstrate that mreBH is a new member of the WalR regulon. We also found that WalR can positively and directly regulate sigI transcription under heat stress through a binding site located upstream of the σ(I) promoter of sigI. In addition, we found that a WalR binding site located upstream of the SigI binding site in the regulatory region of lytE is important for lytE expression under heat stress. Moreover, we found that walR is a new member of the heat shock stimulon of B. subtilis. WalR appears to coordinately and positively regulate transcription of sigI, mreBH and lytE under heat stress. Finally, our work shows for the first time that WalR can stimulate activities of σ(I) promoters under heat stress.

  19. Genome-Wide Transcriptome Analysis During Anthesis Reveals New Insights into the Molecular Basis of Heat Stress Responses in Tolerant and Sensitive Rice Varieties.

    PubMed

    González-Schain, Nahuel; Dreni, Ludovico; Lawas, Lovely M F; Galbiati, Massimo; Colombo, Lucia; Heuer, Sigrid; Jagadish, Krishna S V; Kater, Martin M

    2016-01-01

    Rice is one of the main food crops in the world. In the near future, yield is expected to be under pressure due to unfavorable climatic conditions, such as increasing temperatures. Therefore, improving rice germplasm in order to guarantee rice production under harsh environmental conditions is of top priority. Although many physiological studies have contributed to understanding heat responses during anthesis, the most heat-sensitive stage, molecular data are still largely lacking. In this study, an RNA-sequencing approach of heat- and control-treated reproductive tissues during anthesis was carried out using N22, one of the most heat-tolerant rice cultivars known to date. This analysis revealed that expression of genes encoding a number of transcription factor families, together with signal transduction and metabolic pathway genes, is repressed. On the other hand, expression of genes encoding heat shock factors and heat shock proteins was highly activated. Many of these genes are predominantly expressed at late stages of anther development. Further physiological experiments using heat-tolerant N22 and two sensitive cultivars suggest that reduced yield in heat-sensitive plants may be associated with poor pollen development or production in anthers prior to anthesis. In parallel, induction levels of a set of heat-responsive genes in these tissues correlated well with heat tolerance. Altogether, these findings suggest that proper expression of protective chaperones in anthers is needed before anthesis to overcome stress damage and to ensure fertilization. Genes putatively controlling this process were identified and are valuable candidates to consider for molecular breeding of highly productive heat-tolerant cultivars. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Expression analysis of nine small heat shock protein genes from Tamarix hispida in response to different abiotic stresses and abscisic acid treatment.

    PubMed

    Yang, Guiyan; Wang, Yucheng; Zhang, Kaimin; Gao, Caiqiu

    2014-03-01

    Heat shock proteins (HSPs) play important roles in protecting plants against environmental stresses. Furthermore, small heat shock proteins (sHSPs) are the most ubiquitous HSP subgroup with molecular weights ranging from 15 to 42 kDa. In this study, nine sHSP genes (designated as ThsHSP1-9) were cloned from Tamarix hispida. Their expression patterns in response to cold, heat shock, NaCl, PEG and abscisic acid (ABA) treatments were investigated in the roots and leaves of T. hispida by real-time RT-PCR analysis. The results showed that most of the nine ThsHSP genes were expressed at higher levels in roots than in leaves under normal growth condition. All of ThsHSP genes were highly induced under conditions of cold (4 °C) and different heat shocks (36, 40, 44, 48 and 52 °C). Under NaCl stress, all nine ThsHSPs genes were up-regulated at least one stress time-point in both roots and leaves. Under PEG and ABA treatments, the nine ThsHSPs showed various expression patterns, indicating a complex regulation pathway among these genes. This study represents an important basis for the elucidation of ThsHSP gene function and provides essential information that can be used for stress tolerance genetic engineering in future studies.

  1. Heat and Osmotic Stress Responses of Probiotic Lactobacillus rhamnosus HN001 (DR20) in Relation to Viability after Drying

    PubMed Central

    Prasad, Jaya; McJarrow, Paul; Gopal, Pramod

    2003-01-01

    The viability of lactic acid bacteria in frozen, freeze-dried, and air-dried forms is of significant commercial interest to both the dairy and food industries. In this study we observed that when prestressed with either heat (50°C) or salt (0.6 M NaCl), Lactobacillus rhamnosus HN001 (also known as DR20) showed significant (P < 0.05) improvement in viability compared with the nonstressed control culture after storage at 30°C in the dried form. To investigate the mechanisms underlying this stress-related viability improvement in L. rhamnosus HN001, we analyzed protein synthesis in cultures subjected to different growth stages and stress conditions, using two-dimensional gel electrophoresis and N-terminal sequencing. Several proteins were up- or down-regulated after either heat or osmotic shock treatments. Eleven proteins were positively identified, including the classical heat shock proteins GroEL and DnaK and the glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase, lactate dehydrogenase, enolase, phosphoglycerate kinase, and triose phosphate isomerase, as well as tagatose 1,6-diphosphate aldolase of the tagatose pathway. The phosphocarrier protein HPr (histidine-containing proteins) was up-regulated in cultures after the log phase irrespective of the stress treatments used. The relative synthesis of an ABC transport-related protein was also up-regulated after shock treatments. Carbohydrate analysis of cytoplasmic contents showed higher levels (20 ± 3 μg/mg of protein) in cell extracts (CFEs) derived from osmotically stressed cells than in the unstressed control (15 ± 3 μg/mg of protein). Liquid chromatography of these crude carbohydrate extracts showed significantly different profiles. Electrospray mass spectrometry analysis of CFEs revealed, in addition to normal mono-, di-, tri-, and tetrasaccharides, the presence of saccharides modified with glycerol. PMID:12571012

  2. Heat and osmotic stress responses of probiotic Lactobacillus rhamnosus HN001 (DR20) in relation to viability after drying.

    PubMed

    Prasad, Jaya; McJarrow, Paul; Gopal, Pramod

    2003-02-01

    The viability of lactic acid bacteria in frozen, freeze-dried, and air-dried forms is of significant commercial interest to both the dairy and food industries. In this study we observed that when prestressed with either heat (50 degrees C) or salt (0.6 M NaCl), Lactobacillus rhamnosus HN001 (also known as DR20) showed significant (P < 0.05) improvement in viability compared with the nonstressed control culture after storage at 30 degrees C in the dried form. To investigate the mechanisms underlying this stress-related viability improvement in L. rhamnosus HN001, we analyzed protein synthesis in cultures subjected to different growth stages and stress conditions, using two-dimensional gel electrophoresis and N-terminal sequencing. Several proteins were up- or down-regulated after either heat or osmotic shock treatments. Eleven proteins were positively identified, including the classical heat shock proteins GroEL and DnaK and the glycolytic enzymes glyceraldehyde-3-phosphate dehydrogenase, lactate dehydrogenase, enolase, phosphoglycerate kinase, and triose phosphate isomerase, as well as tagatose 1,6-diphosphate aldolase of the tagatose pathway. The phosphocarrier protein HPr (histidine-containing proteins) was up-regulated in cultures after the log phase irrespective of the stress treatments used. The relative synthesis of an ABC transport-related protein was also up-regulated after shock treatments. Carbohydrate analysis of cytoplasmic contents showed higher levels (20 +/- 3 microg/mg of protein) in cell extracts (CFEs) derived from osmotically stressed cells than in the unstressed control (15 +/- 3 microg/mg of protein). Liquid chromatography of these crude carbohydrate extracts showed significantly different profiles. Electrospray mass spectrometry analysis of CFEs revealed, in addition to normal mono-, di-, tri-, and tetrasaccharides, the presence of saccharides modified with glycerol.

  3. cDNA cloning of heat shock protein 90 gene and protein expression pattern in response to heavy metal exposure and thermal stress in planarian Dugesia japonica.

    PubMed

    Ma, Ke-Xue; Chen, Guang-Wen; Liu, De-Zeng

    2012-06-01

    Heat shock protein 90 (HSP90) is an abundant and highly conserved molecular chaperone, playing important roles in multiple cellular stress responses. The full-length cDNA of planarian Dugesia japonica Hsp90 (designated DjHsp90) was firstly cloned using rapid amplification of cDNA ends (RACE) techniques. It is 2,354 bp, including an open reading frame (ORF) of 2,148 bp encoding a polypeptide of 715 amino acids with all five HSP90 family signatures. We sequenced the ORF sequences from genomic DNA, and found only one intron (48 bp) existed in Djhsp90 gene structure. We used western blot and immunohistochemistry to analyze the expression pattern of DjHsp90 in response to heavy metal exposure and thermal stress at the protein level. Our results show that low doses of heavy metals and elevated culture temperature induced, but high doses of heavy metals and severe heat shock inhibited DjHsp90 expression. In response to heavy metals and thermal stress, DjHsp90-positive cells only appeared in the parenchymal tissue under epidermis cells along the bilateral from head to tail. These positive cells are presumably sensor cells that can detect external environment changes. Our work provides basic data for the study of stress responses in planarians.

  4. Sensing the Heat Stress by Mammalian Cells

    PubMed Central

    2011-01-01

    Background The heat-shock response network controls the adaptation and survival of the cell against environmental stress. This network is highly conserved and is connected with many other signaling pathways. A key element of the heat-shock network is the heat-shock transcription factor-1 (HSF), which is transiently activated by elevated temperatures. HSF translocates to the nucleus upon elevated temperatures, forming homotrimeric complexes. The HSF homotrimers bind to the heat shock element on the DNA and control the expression of the hsp70 gene. The Hsp70 proteins protect cells from thermal stress. Thermal stress causes the unfolding of proteins, perturbing thus the pathways under their control. By binding to these proteins, Hsp70 allows them to refold and prevents their aggregation. The modulation of the activity of the hsp70-promoter by the intensity of the input stress is thus critical for cell's survival. The promoter activity starts from a basal level and rapidly increases once the stress is applied, reaches a maximum level and attenuates slowely back to the basal level. This phenomenon is the hallmark of many experimental studies and of all computational network analysis. Results The molecular construct used as a measure of the response to thermal stress is a Hsp70-GFP fusion gene transfected in Chinese hamster ovary (CHO) cells. The time profile of the GFP protein depends on the transient activity, Transient(t), of the heat shock system. The function Transient(t) depends on hsp70 promoter activity, transcriptional regulation and the translation initiation effects elicited by the heat stress. The GFP time profile is recorded using flow cytometry measurements, a technique that allows a quantitative measurement of the fluorescence of a large number of cells (104). The GFP responses to one and two heat shocks were measured for 261 conditions of different temperatures and durations. We found that: (i) the response of the cell to two consecutive shocks (i.e., no

  5. Comparative proteomic analysis of the hepatic response to heat stress in Muscovy and Pekin ducks: insight into thermal tolerance related to energy metabolism.

    PubMed

    Zeng, Tao; Jiang, Xueyuan; Li, Jinjun; Wang, Deqian; Li, Guoqin; Lu, Lizhi; Wang, Genlin

    2013-01-01

    The Pekin duck, bred from the mallard (Anas platyrhynchos) in china, is one of the most famous meat duck species in the world. However, it is more sensitive to heat stress than Muscovy duck, which is believed to have originated in South America. With temperature raising, mortality, laying performance, and meat quality of the Pekin duck are severely affected. This study aims to uncover the temperature-dependent proteins of two duck species using comparative proteomic approach. Duck was cultured under 39°C ± 0.5°C for 1 h, and then immediately returned to 20°C for a 3 h recovery period, the liver proteins were extracted and electrophoresed in two-dimensional mode. After analysis of gel images, 61 differentially expressed proteins were detected, 54 were clearly identified by MALDI TOF/TOF MS. Of the 54 differentially expressed protein spots identified, 7 were found in both species, whereas 47 were species specific (25 in Muscovy duck and 22 in Pekin duck). As is well known, chaperone proteins, such as heat shock protein (HSP) 70 and HSP10, were abundantly up-regulated in both species in response to heat stress. However, we also found that several proteins, such as α-enolase, and S-adenosylmethionine synthetase, showed different expression patterns in the 2 duck species. The enriched biological processes were grouped into 3 main categories according to gene ontology analysis: cell death and apoptosis (20.93%), amino acid metabolism (13.95%) and oxidation reduction (20.93%). The mRNA levels of several differentially expressed protein were investigated by real-time RT-PCR. To our knowledge, this study is the first to provide insights into the differential expression of proteins following heat stress in ducks and enables better understanding of possible heat stress response mechanisms in animals.

  6. Comparative Proteomic Analysis of the Hepatic Response to Heat Stress in Muscovy and Pekin Ducks: Insight into Thermal Tolerance Related to Energy Metabolism

    PubMed Central

    Zeng, Tao; Jiang, Xueyuan; Li, Jinjun; Wang, Deqian; Li, Guoqin; Lu, Lizhi; Wang, Genlin

    2013-01-01

    The Pekin duck, bred from the mallard (Anas platyrhynchos) in china, is one of the most famous meat duck species in the world. However, it is more sensitive to heat stress than Muscovy duck, which is believed to have originated in South America. With temperature raising, mortality, laying performance, and meat quality of the Pekin duck are severely affected. This study aims to uncover the temperature-dependent proteins of two duck species using comparative proteomic approach. Duck was cultured under 39°C ± 0.5°C for 1 h, and then immediately returned to 20°C for a 3 h recovery period, the liver proteins were extracted and electrophoresed in two-dimensional mode. After analysis of gel images, 61 differentially expressed proteins were detected, 54 were clearly identified by MALDI TOF/TOF MS. Of the 54 differentially expressed protein spots identified, 7 were found in both species, whereas 47 were species specific (25 in Muscovy duck and 22 in Pekin duck). As is well known, chaperone proteins, such as heat shock protein (HSP) 70 and HSP10, were abundantly up-regulated in both species in response to heat stress. However, we also found that several proteins, such as α-enolase, and S-adenosylmethionine synthetase, showed different expression patterns in the 2 duck species. The enriched biological processes were grouped into 3 main categories according to gene ontology analysis: cell death and apoptosis (20.93%), amino acid metabolism (13.95%) and oxidation reduction (20.93%). The mRNA levels of several differentially expressed protein were investigated by real-time RT-PCR. To our knowledge, this study is the first to provide insights into the differential expression of proteins following heat stress in ducks and enables better understanding of possible heat stress response mechanisms in animals. PMID:24116183

  7. RNA-Seq reveals expression signatures of genes involved in oxygen transport, protein synthesis, folding, and degradation in response to heat stress in catfish.

    PubMed

    Liu, Shikai; Wang, Xiuli; Sun, Fanyue; Zhang, Jiaren; Feng, Jianbin; Liu, Hong; Rajendran, K V; Sun, Luyang; Zhang, Yu; Jiang, Yanliang; Peatman, Eric; Kaltenboeck, Ludmilla; Kucuktas, Huseyin; Liu, Zhanjiang

    2013-06-17

    Temperature is one of the most prominent abiotic factors affecting ectotherms. Most fish species, as ectotherms, have extraordinary ability to deal with a wide range of temperature changes. While the molecular mechanism underlying temperature adaptation has long been of interest, it is still largely unexplored with fish. Understanding of the fundamental mechanisms conferring tolerance to temperature fluctuations is a topic of increasing interest as temperature may continue to rise as a result of global climate change. Catfish have a wide natural habitat and possess great plasticity in dealing with environmental variations in temperature. However, no studies have been conducted at the transcriptomic level to determine heat stress-induced gene expression. In the present study, we conducted an RNA-Seq analysis to identify heat stress-induced genes in catfish at the transcriptome level. Expression analysis identified a total of 2,260 differentially expressed genes with a cutoff of twofold change. qRT-PCR validation suggested the high reliability of the RNA-Seq results. Gene ontology, enrichment, and pathway analyses were conducted to gain insight into physiological and gene pathways. Specifically, genes involved in oxygen transport, protein folding and degradation, and metabolic process were highly induced, while general protein synthesis was dramatically repressed in response to the lethal temperature stress. This is the first RNA-Seq-based expression study in catfish in response to heat stress. The candidate genes identified should be valuable for further targeted studies on heat tolerance, thereby assisting the development of heat-tolerant catfish lines for aquaculture.

  8. De novo assembly and characterization of Muscovy duck liver transcriptome and analysis of differentially regulated genes in response to heat stress.

    PubMed

    Zeng, Tao; Zhang, Liping; Li, Jinjun; Wang, Deqian; Tian, Yong; Lu, Lizhi

    2015-05-01

    High temperature is a major abiotic stress limiting animal growth and productivity worldwide. The Muscovy duck (Cairina moschata), sometimes called the Barbary drake, is a type of duck with a fairly unusual domestication history. In Southeast Asia, duck meat is one of the top meats consumed, and as such, the production of the meat is an important topic of research. The transcriptomic and genomic data presently available are insufficient to understanding the molecular mechanism underlying the heat tolerance of Muscovy ducks. Thus, transcriptome and expression profiling data for this species are required as important resource for identifying genes and developing molecular marker. In this study, de novo transcriptome assembly and gene expression analysis using Illumina sequencing technology were performed. More than 225 million clean reads were generated and assembled into 36,903 unique transcripts with an average length of 1,135 bp. A total of 21,221 (57.50 %) unigenes were annotated. Gene Ontology (GO) analysis of the annotated unigenes revealed that the majority of sequenced genes were associated with transcription, signal transduction, and apoptosis. We also performed gene expression profiling analysis upon heat treatment in Muscovy ducks and identified 470 heat-response unique transcripts. GO term enrichment showed that protein folding and chaperone binding were significant enrichment, whereas KEGG pathway analyses showed that Ras and MAPKs were activated after heat stress in Muscovy ducks. Our research enriched sequences information of Muscovy duck, provided novel insights into responses to heat stress in these ducks, and serve as candidate genes or markers that can be used to guide future efforts to breed heat-tolerant duck strains.

  9. Performance traits and immune response of broiler chicks treated with zinc and ascorbic acid supplementation during cyclic heat stress

    NASA Astrophysics Data System (ADS)

    Chand, Naila; Naz, Shabana; Khan, Ajab; Khan, Sarzamin; Khan, Rifat Ullah

    2014-12-01

    This research was conducted to investigate the effect of supplementation of zinc (Zn) and ascorbic acid (AA) in heat-stressed broilers. A total of 160-day-old broiler chicks of approximately the same weight and appearance were divided into four treatment groups (control, T1, T2, and T3). Control group was fed a standard diet without any supplementation. T1 was supplemented with Zn at the rate of 60 mg/kg of feed, T2 was supplemented with 300 mg/kg of feed AA, and T3 was supplemented with combination of Zn and AA. From week 3 to 5, heat stress environment was provided at the rate of 12 h at 25 °C, 3 h at 25 to 34 °C, 6 h at 34 °C, and 3 h at 34 to 25 °C daily. The results revealed that feed intake, body weight and feed conversion ratio (FCR), and weight of thymus, spleen, and bursa of Fabricius improved significantly ( P < 0.05) in T3 compared to the other treatments. Antibody titer against Newcastle disease (ND), infectious bursal disease (IBD), and infectious bronchitis (IB) increased significantly ( P < 0.05) in T2 and T3 groups. However, total leucocytes count, lymphocytes, and monocytes increased ( P < 0.05) in all treated groups compared to control. The results indicated that the supplementation of Zn or AA alone or in combination improved the performance and immune status of broilers reared under heat stress.

  10. Effect of "heat shock" treatments on QPX disease and stress response in the hard clam, Mercenaria mercenaria.

    PubMed

    Wang, Kailai; Pales Espinosa, Emmanuelle; Allam, Bassem

    2016-07-01

    The hard clam, Mercenaria mercenaria, is one of the most valuable commercial mollusk species along the eastern coast of the United States. Throughout the past 2 decades, the hard clam industry in the Northeast was significantly impacted by disease outbreaks caused by a lethal protistan parasite known as Quahog Parasite Unknown (QPX). QPX is an opportunistic pathogen and the infection has been shown to be a cold water disease, where warmer conditions (above 21°C) lead to disease reduction and clam healing. In vitro studies also showed a sharp reduction in parasite growth and survivorship at temperatures exceeding 27°C. In this study, we evaluated the effect of short-term exposures to high temperatures on QPX disease dynamic and clam recovery. Infected clams were collected from an enzootic site and subsequently submitted to one of ten "heat shock" treatments involving a gradient of temperatures and exposure times. QPX prevalence was compared before and 10weeks after heat shock to assess the effect of each treatment on disease progress. Expression of several stress-related genes was measured 1 and 7days after heat shock using qPCR to evaluate the effect of each treatment on clam physiology. Anti-QPX activity in clam plasma was also measured in an attempt to link changes in defense factors to thermal stress and disease progress. Our results suggest that brief exposures to moderate high temperatures promote the greatest remission while imposing the mildest stress to clams. These results are discussed with the aim of providing the industry with possible strategies to mitigate QPX disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Important role of class I heat shock genes hrcA and dnaK in the heat shock response and the response to pH and NaCl stress of group I Clostridium botulinum strain ATCC 3502.

    PubMed

    Selby, Katja; Lindström, Miia; Somervuo, Panu; Heap, John T; Minton, Nigel P; Korkeala, Hannu

    2011-05-01

    Class I heat shock genes (HSGs) code for molecular chaperones which play a major role in the bacterial response to sudden increases of environmental temperature by assisting protein folding. Quantitative reverse transcriptase real-time PCR gene expression analysis of the food-borne pathogen Clostridium botulinum grown at 37°C showed that the class I HSGs grpE, dnaK, dnaJ, groEL, and groES and their repressor, hrcA, were expressed at constant levels in the exponential and transitional growth phases, whereas strong downregulation of all six genes was observed during stationary phase. After heat shock from 37 to 45°C, all HSGs were transiently upregulated. A mutant with insertionally inactivated hrcA expressed higher levels of class I HSGs during exponential growth than the wild type, followed by upregulation of only groES and groES after heat shock. Inactivation of hrcA or of dnaK encoding a major chaperone resulted in lower maximum growth temperatures than for the wild type and reduced growth rates under optimal conditions compared to the wild type. The dnaK mutant showed growth inhibition under all tested temperature, pH, and NaCl stress conditions. In contrast, the growth of an hrcA mutant was unaffected by mild temperature or acid stress compared to the wild-type strain, indicating that induced class I HSGs support growth under moderately nonoptimal conditions. We show that the expression of class I HSGs plays a major role for survival and growth of C. botulinum under the stressful environmental conditions that may be encountered during food processing or growth in food products, in the mammalian intestine, or in wounds.

  12. The International Heat Stress Genotype Experiment for Modeling Wheat Response to Heat: Field Experiments and AgMIP-Wheat Multi-Model Simulations

    NASA Technical Reports Server (NTRS)

    Martre, Pierre; Reynolds, Matthew P.; Asseng, Senthold; Ewert, Frank; Alderman, Phillip D.; Cammarano, Davide; Maiorano, Andrea; Ruane, Alexander C.; Aggarwal, Pramod K.; Anothai, Jakarat; hide

    2017-01-01

    The data set contains a portion of the International Heat Stress Genotype Experiment (IHSGE) data used in the AgMIP-Wheat project to analyze the uncertainty of 30 wheat crop models and quantify the impact of heat on global wheat yield productivity. It includes two spring wheat cultivars grown during two consecutive winter cropping cycles at hot, irrigated, and low latitude sites in Mexico (Ciudad Obregon and Tlaltizapan), Egypt (Aswan), India (Dharwar), the Sudan (Wad Medani), and Bangladesh (Dinajpur). Experiments in Mexico included normal (November-December) and late (January-March) sowing dates. Data include local daily weather data, soil characteristics and initial soil conditions, crop measurements (anthesis and maturity dates, anthesis and final total above ground biomass, final grain yields and yields components), and cultivar information. Simulations include both daily in-season and end-of-season results from 30 wheat models.

  13. Glutathionylation of the Bacterial Hsp70 Chaperone DnaK Provides a Link between Oxidative Stress and the Heat Shock Response.

    PubMed

    Zhang, Hong; Yang, Jie; Wu, Si; Gong, Weibin; Chen, Chang; Perrett, Sarah

    2016-03-25

    DnaK is the major bacterial Hsp70, participating in DNA replication, protein folding, and the stress response. DnaK cooperates with the Hsp40 co-chaperone DnaJ and the nucleotide exchange factor GrpE. Under non-stress conditions, DnaK binds to the heat shock transcription factor σ(32)and facilitates its degradation. Oxidative stress results in temporary inactivation of DnaK due to depletion of cellular ATP and thiol modifications such as glutathionylation until normal cellular ATP levels and a reducing environment are restored. However, the biological significance of DnaK glutathionylation remains unknown, and the mechanisms by which glutathionylation may regulate the activity of DnaK are also unclear. We investigated the conditions under which Escherichia coli DnaK undergoesS-glutathionylation. We observed glutathionylation of DnaK in lysates of E. coli cells that had been subjected to oxidative stress. We also obtained homogeneously glutathionylated DnaK using purified DnaK in the apo state. We found that glutathionylation of DnaK reversibly changes the secondary structure and tertiary conformation, leading to reduced nucleotide and peptide binding ability. The chaperone activity of DnaK was reversibly down-regulated by glutathionylation, accompanying the structural changes. We found that interaction of DnaK with DnaJ, GrpE, or σ(32)becomes weaker when DnaK is glutathionylated, and the interaction is restored upon deglutathionylation. This study confirms that glutathionylation down-regulates the functions of DnaK under oxidizing conditions, and this down-regulation may facilitate release of σ(32)from its interaction with DnaK, thus triggering the heat shock response. Such a mechanism provides a link between oxidative stress and the heat shock response in bacteria. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Glutathionylation of the Bacterial Hsp70 Chaperone DnaK Provides a Link between Oxidative Stress and the Heat Shock Response*

    PubMed Central

    Zhang, Hong; Yang, Jie; Wu, Si; Gong, Weibin; Chen, Chang; Perrett, Sarah

    2016-01-01

    DnaK is the major bacterial Hsp70, participating in DNA replication, protein folding, and the stress response. DnaK cooperates with the Hsp40 co-chaperone DnaJ and the nucleotide exchange factor GrpE. Under non-stress conditions, DnaK binds to the heat shock transcription factor σ32 and facilitates its degradation. Oxidative stress results in temporary inactivation of DnaK due to depletion of cellular ATP and thiol modifications such as glutathionylation until normal cellular ATP levels and a reducing environment are restored. However, the biological significance of DnaK glutathionylation remains unknown, and the mechanisms by which glutathionylation may regulate the activity of DnaK are also unclear. We investigated the conditions under which Escherichia coli DnaK undergoes S-glutathionylation. We observed glutathionylation of DnaK in lysates of E. coli cells that had been subjected to oxidative stress. We also obtained homogeneously glutathionylated DnaK using purified DnaK in the apo state. We found that glutathionylation of DnaK reversibly changes the secondary structure and tertiary conformation, leading to reduced nucleotide and peptide binding ability. The chaperone activity of DnaK was reversibly down-regulated by glutathionylation, accompanying the structural changes. We found that interaction of DnaK with DnaJ, GrpE, or σ32 becomes weaker when DnaK is glutathionylated, and the interaction is restored upon deglutathionylation. This study confirms that glutathionylation down-regulates the functions of DnaK under oxidizing conditions, and this down-regulation may facilitate release of σ32 from its interaction with DnaK, thus triggering the heat shock response. Such a mechanism provides a link between oxidative stress and the heat shock response in bacteria. PMID:26823468

  15. Heat shock response and homeostatic plasticity

    PubMed Central

    Karunanithi, Shanker; Brown, Ian R.

    2015-01-01

    Heat shock response and homeostatic plasticity are mechanisms that afford functional stability to cells in the face of stress. Each mechanism has been investigated independently, but the link between the two has not been extensively explored. We explore this link. The heat shock response enables cells to adapt to stresses such as high temperature, metabolic stress and reduced oxygen levels. This mechanism results from the production of heat shock proteins (HSPs) which maintain normal cellular functions by counteracting the misfolding of cellular proteins. Homeostatic plasticity enables neurons and their target cells to maintain their activity levels around their respective set points in the face of stress or disturbances. This mechanism results from the recruitment of adaptations at synaptic inputs, or at voltage-gated ion channels. In this perspective, we argue that heat shock triggers homeostatic plasticity through the production of HSPs. We also suggest that homeostatic plasticity is a form of neuroprotection. PMID:25814928

  16. A dose-response evaluation of rumen-protected niacin in thermoneutral or heat-stressed lactating Holstein cows.

    PubMed

    Rungruang, S; Collier, J L; Rhoads, R P; Baumgard, L H; de Veth, M J; Collier, R J

    2014-01-01

    Twenty-four multiparous high-producing dairy cows (40.0±1.4kg/d) were used in a factorial design to evaluate effects of 2 environments [thermoneutral (TN) and heat stress (HS)] and a dose range of dietary rumen-protected niacin (RPN; 0, 4, 8, or 12g/d) on body temperature, sweating rate, feed intake, water intake, production parameters, and blood niacin concentrations. Temperature-humidity index values during TN never exceeded 68 (stress threshold), whereas temperature-humidity index values during HS were above 68 for 24h/d. The HS environment increased hair coat and skin, rectal, and vaginal temperatures; respiration rate; skin and hair coat evaporative heat loss; and water intake and decreased DMI (3.5kg/d), milk yield (4.1kg/d), 4% fat-corrected milk (2.7kg/d), and milk protein yield (181.7g/d). Sweating rate increased during HS (12.7g/m(2) per h) compared with TN, but this increase was only 10% of that reported in summer-acclimated cattle. Niacin supplementation did not affect sweating rate, dry-matter intake, or milk yield in either environment. Rumen-protected niacin increased plasma and milk niacin concentrations in a linear manner. Heat stress reduced niacin concentration in whole blood (7.86 vs. 6.89μg/mL) but not in milk. Reduced blood niacin concentration was partially corrected by dietary RPN. An interaction existed between dietary RPN and environment; dietary RPN linearly increased water intake in both environments, but the increase was greater during HS conditions. Increasing dietary RPN did not influence skin temperatures. During TN, supplementing 12g/d of RPN increased hair coat (unshaved skin; 30.3 vs. 31.3°C at 1600h) but not shaved skin (32.8 vs. 32.9°C at 1600h) temperature when compared with 0g/d at all time points, whereas the maximum temperature (18°C) of the room was lower than skin temperature. These data suggest that dietary RPN increased water intake during both TN and HS and hair coat temperature during TN; however, core body

  17. Nutritional interventions to alleviate the negative consequences of heat stress.

    PubMed

    Rhoads, Robert P; Baumgard, Lance H; Suagee, Jessica K; Sanders, Sara R

    2013-05-01

    Energy metabolism is a highly coordinated process, and preferred fuel(s) differ among tissues. The hierarchy of substrate use can be affected by physiological status and environmental factors including high ambient temperature. Unabated heat eventually overwhelms homeothermic mechanisms resulting in heat stress, which compromises animal health, farm animal production, and human performance. Various aspects of heat stress physiology have been extensively studied, yet a clear understanding of the metabolic changes occurring at the cellular, tissue, and whole-body levels in response to an environmental heat load remains ill-defined. For reasons not yet clarified, circulating nonesterified fatty acid levels are reduced during heat stress, even in the presence of elevated stress hormones (epinephrine, glucagon, and cortisol), and heat-stressed animals often have a blunted lipolytic response to catabolic signals. Either directly because of or in coordination with this, animals experiencing environmental hyperthermia exhibit a shift toward carbohydrate use. These metabolic alterations occur coincident with increased circulating basal and stimulated plasma insulin concentrations. Limited data indicate that proper insulin action is necessary to effectively mount a response to heat stress and minimize heat-induced damage. Consistent with this idea, nutritional interventions targeting increased insulin action may improve tolerance and productivity during heat stress. Further research is warranted to uncover the effects of heat on parameters associated with energy metabolism so that more appropriate and effective treatment methodologies can be designed.

  18. Role of heat shock protein Hsp25 in the response of the orofacial nuclei motor system to physiological stress

    NASA Technical Reports Server (NTRS)

    Murashov, A. K.; Talebian, S.; Wolgemuth, D. J.

    1998-01-01

    Although expression of the small heat shock protein family member Hsp25 has been previously observed in the central nervous system (CNS), both constitutively and upon induction, its function in the CNS remains far from clear. In the present study we have characterized the spatial pattern of expression of Hsp25 in the normal adult mouse brain as well as the changes in expression patterns induced by subjecting mice to experimental hyperthermia or hypoxia. Immunohistochemical analysis revealed a surprisingly restricted pattern of constitutive expression of Hsp25 in the brain, limited to the facial, trigeminal, ambiguus, hypoglossal and vagal motor nuclei of the brainstem. After hyperthermia or hypoxia treatment, significant increases in the levels of Hsp25 were observed in these same areas and also in fibers of the facial and trigeminal nerve tracts. Immunoblot analysis of protein lysates from brainstem also showed the same pattern of induction of Hsp25. Surprisingly, no other area in the brain showed expression of Hsp25, in either control or stressed animals. The highly restricted expression of Hsp25 implies that this protein may have a specific physiological role in the orofacial motor nuclei, which govern precise coordination between muscles of mastication and the pharynx, larynx, and face. Its rapid induction after stress further suggests that Hsp25 may serve as a specific molecular chaperone in the lower cholinergic motor neurons and along their fibers under conditions of stress or injury. Copyright 1998 Elsevier Science B.V.

  19. Role of heat shock protein Hsp25 in the response of the orofacial nuclei motor system to physiological stress

    NASA Technical Reports Server (NTRS)

    Murashov, A. K.; Talebian, S.; Wolgemuth, D. J.

    1998-01-01

    Although expression of the small heat shock protein family member Hsp25 has been previously observed in the central nervous system (CNS), both constitutively and upon induction, its function in the CNS remains far from clear. In the present study we have characterized the spatial pattern of expression of Hsp25 in the normal adult mouse brain as well as the changes in expression patterns induced by subjecting mice to experimental hyperthermia or hypoxia. Immunohistochemical analysis revealed a surprisingly restricted pattern of constitutive expression of Hsp25 in the brain, limited to the facial, trigeminal, ambiguus, hypoglossal and vagal motor nuclei of the brainstem. After hyperthermia or hypoxia treatment, significant increases in the levels of Hsp25 were observed in these same areas and also in fibers of the facial and trigeminal nerve tracts. Immunoblot analysis of protein lysates from brainstem also showed the same pattern of induction of Hsp25. Surprisingly, no other area in the brain showed expression of Hsp25, in either control or stressed animals. The highly restricted expression of Hsp25 implies that this protein may have a specific physiological role in the orofacial motor nuclei, which govern precise coordination between muscles of mastication and the pharynx, larynx, and face. Its rapid induction after stress further suggests that Hsp25 may serve as a specific molecular chaperone in the lower cholinergic motor neurons and along their fibers under conditions of stress or injury. Copyright 1998 Elsevier Science B.V.

  20. Effects of heat stress on mammalian reproduction

    PubMed Central

    Hansen, Peter J.

    2009-01-01

    Heat stress can have large effects on most aspects of reproductive function in mammals. These include disruptions in spermatogenesis and oocyte development, oocyte maturation, early embryonic development, foetal and placental growth and lactation. These deleterious effects of heat stress are the result of either the hyperthermia associated with heat stress or the physiological adjustments made by the heat-stressed animal to regulate body temperature. Many effects of elevated temperature on gametes and the early embryo involve increased production of reactive oxygen species. Genetic adaptation to heat stress is possible both with respect to regulation of body temperature and cellular resistance to elevated temperature. PMID:19833646

  1. Heat stress-induced life span extension in yeast.

    PubMed

    Shama, S; Lai, C Y; Antoniazzi, J M; Jiang, J C; Jazwinski, S M

    1998-12-15

    The yeast Saccharomyces cerevisiae has a limited life span that can be measured by the number of times individual cells divide. Several genetic manipulations have been shown to prolong the yeast life span. However, environmental effects that extend longevity have been largely ignored. We have found that mild, nonlethal heat stress extended yeast life span when it was administered transiently early in life. The increased longevity was due to a reduction in the mortality rate that persisted over many cell divisions (generations) but was not permanent. The genes RAS1 and RAS2 were necessary to observe this effect of heat stress. The RAS2 gene is consistently required for maintenance of life span when heat stress is chronic or in its extension when heat stress is transient or absent altogether. RAS1, on the other hand, appears to have a role in signaling life extension induced by transient, mild heat stress, which is distinct from its life-span-curtailing effect in the absence of stress and its lack of involvement in the response to chronic heat stress. This distinction between the RAS genes may be partially related to their different effects on growth-promoting genes and stress-responsive genes. The ras2 mutation clearly hindered resumption of growth and recovery from stress, while the ras1 mutation did not. The HSP104 gene, which is largely responsible for induced thermotolerance in yeast, was necessary for life extension induced by transient heat stress. An interaction between mitochondrial petite mutations and heat stress was found, suggesting that mitochondria may be necessary for life extension by transient heat stress. The results raise the possibility that the RAS genes and mitochondria may play a role in the epigenetic inheritance of reduced mortality rate afforded by transient, mild heat stress.

  2. Occupational heat stress in Australian workplaces

    PubMed Central

    Jay, Ollie; Brotherhood, John R.

    2016-01-01

    ABSTRACT The aim of this review was to summarize the current state of knowledge on heat stress risk within typical Australian occupational settings. We assessed identified occupations (mining, agriculture, construction, emergency services) for heat production and heat loss potential, and resultant levels of physiological heat strain. A total of 29 reports were identified that assessed in-situ work settings in Northern Territory, South Australia, Western Australia, Queensland, New South Wales and Victoria, that measured physiological responses and characterized the thermal environment. Despite workers across all industries being regularly exposed to high ambient temperatures (32–42°C) often coupled with high absolute humidity (max: 33 hPa), physiological strain is generally low in terms of core temperature (<38°C) and dehydration (<1 % reduction in mass) by virtue of the low energy demands of many tasks, and self-regulated pacing of work possible in most jobs. Heat stress risk is higher in specific jobs in agriculture (e.g. sheep shearing), deep underground mining, and emergency services (e.g., search/rescue and bushfire fighting). Heat strain was greatest in military-related activities, particularly externally-paced marching with carried loads which resulted in core temperatures often exceeding 39.5°C despite being carried out in cooler environments. The principal driver of core temperature elevations in most jobs is the rate of metabolic heat production. A standardized approach to evaluating the risk of occupational heat strain in Australian workplaces is recommended defining the individual parameters that alter human heat balance. Future research should also more closely examine female workers and occupational activities within the forestry and agriculture/horticulture sector. PMID:28349081

  3. Occupational heat stress in Australian workplaces.

    PubMed

    Jay, Ollie; Brotherhood, John R

    2016-01-01

    The aim of this review was to summarize the current state of knowledge on heat stress risk within typical Australian occupational settings. We assessed identified occupations (mining, agriculture, construction, emergency services) for heat production and heat loss potential, and resultant levels of physiological heat strain. A total of 29 reports were identified that assessed in-situ work settings in Northern Territory, South Australia, Western Australia, Queensland, New South Wales and Victoria, that measured physiological responses and characterized the thermal environment. Despite workers across all industries being regularly exposed to high ambient temperatures (32-42°C) often coupled with high absolute humidity (max: 33 hPa), physiological strain is generally low in terms of core temperature (<38°C) and dehydration (<1 % reduction in mass) by virtue of the low energy demands of many tasks, and self-regulated pacing of work possible in most jobs. Heat stress risk is higher in specific jobs in agriculture (e.g. sheep shearing), deep underground mining, and emergency services (e.g., search/rescue and bushfire fighting). Heat strain was greatest in military-related activities, particularly externally-paced marching with carried loads which resulted in core temperatures often exceeding 39.5°C despite being carried out in cooler environments. The principal driver of core temperature elevations in most jobs is the rate of metabolic heat production. A standardized approach to evaluating the risk of occupational heat strain in Australian workplaces is recommended defining the individual parameters that alter human heat balance. Future research should also more closely examine female workers and occupational activities within the forestry and agriculture/horticulture sector.

  4. The effect of heating rate on Escherichia coli metabolism, physiological stress, transcriptional response, and production of temperature-induced recombinant protein: a scale-down study.

    PubMed

    Caspeta, Luis; Flores, Noemí; Pérez, Néstor O; Bolívar, Francisco; Ramírez, Octavio T

    2009-02-01

    At the laboratory scale, sudden step increases from 30 to 42 degrees C can be readily accomplished when expressing heterologous proteins in heat-inducible systems. However, for large scale-cultures only slow ramp-type increases in temperature are possible due to heat transfer limitations, where the heating rate decreases as the scale increases. In this work, the transcriptional and metabolic responses of a recombinant Escherichia coli strain to temperature-induced synthesis of pre-proinsulin in high cell density cultures were examined at different heating rates. Heating rates of 6, 1.7, 0.8, and 0.4 degrees C/min were tested in a scale-down approach to mimic fermentors of 0.1, 5, 20, and 100 m(3), respectively. The highest yield and concentration of recombinant protein was obtained for the slowest heating rate. As the heating rate increased, the yield and maximum recombinant protein concentration decreased, whereas a larger fraction of carbon skeletons was lost as acetate, lactate, and formate. Compared to 30 degrees C, the mRNA levels of selected heat-shock genes at 38 and 42 degrees C, as quantified by qRT-PCR, increased between 2- to over 42-fold when cultures were induced at 6, 1.7, and 0.8 degrees C/min, but no increase was observed at 0.4 degrees C/min. Only small increases (between 1.5- and 4-fold) in the expression of the stress genes spoT and relA were observed at 42 degrees C for cultures induced at 1.7 and 6 degrees C/min, suggesting that cells subjected to slow temperature increases can adapt to stress. mRNA levels of genes from the transcription-translation machinery (tufB, rpoA, and tig) decreased between 40% and 80% at 6, 1.7 and 0.8 degrees C/min, whereas a transient increase occurred for 0.4 degrees C/min at 42 degrees C. mRNA levels of the gene coding for pre-proinsulin showed a similar profile to transcripts of heat-shock genes, reflecting a probable analogous induction mechanism. Altogether, the results obtained indicate that slow heating rates

  5. Prompt protein glycosylation during acute heat stress.

    PubMed

    Henle, K J; Kaushal, G P; Nagle, W A; Nolen, G T

    1993-08-01

    Constitutive patterns of protein synthesis and protein glycosylation are severely disrupted by acute heat stress. Stressed cells respond by preferential synthesis of specific proteins, e.g., the well-known family of heat shock proteins. We observed another response that rapidly occurs during heating periods as short as 10 min at 45 degrees C. During that period, CHO cells began to glycosylate specific proteins, designated as "prompt" stress glycoproteins (P-SG), while constitutive protein glycosylation ceased. Labeling of P-SGs showed a dose response with time and with temperature and appeared regardless of the label used (D-[3H]mannose or D-[3H]glucose). On SDS-PAGE, the major P-SG was characterized by M(r) approximately 67 kDa (P-SG67) and pI = 5.1. Other less prominent P-SGs appeared at M(r) 160, 100, 64, 60, and 47 kDa; incorporated label showed little turnover during 24 h at 37 degrees C. Prompt glycosylation was inhibited by tunicamycin, and label incorporated into P-SGs was sensitive to N-glycosidase F, but not to O-glycosidase. Analysis of enzymatically digested P-SG67 indicated that label had been incorporated into both high-mannose (Man9GlcNAc) and complex-type oligosaccharides. Brefeldin A did not eliminate P-SG67 labeling, but caused the further appearance of novel, Brefeldin-associated P-SGs. Labeling of P-SG67 oligosaccharides occurred without significant concomitant protein synthesis, suggesting that addition of labeled oligosaccharides largely occurred on mature, rather than nascent proteins. The functional significance of prompt glycosylation remains to be defined, but we propose that this novel phenomenon is an integral part of the cellular heat stress response.

  6. The proteomic response of sea squirts (genus Ciona) to acute heat stress: a global perspective on the thermal stability of proteins.

    PubMed

    Serafini, Loredana; Hann, Jay B; Kültz, Dietmar; Tomanek, Lars

    2011-09-01

    Congeners belonging to the genus Ciona have disparate distributions limited by temperature. Ciona intestinalis is more widespread with a cosmopolitan distribution ranging from tropical to sub-arctic zones, while Ciona savignyi is limited to temperate-latitudes of the northern Pacific Ocean. To compare the heat stress response between congeners, we quantified changes in protein expression using proteomics. Animals were exposed to 22°C, 25°C, and 28°C for 6h, then recovered at a control temperature (13°C) for 16h (high heat stress experiment). In a second experiment we exposed animals to lower levels of heat stress at 18°C, 20°C, and 23°C, with a 16°C control. A quantitative analysis, using 2D gel electrophoresis and MALDI-TOF/TOF mass spectrometry (with a 69% and 93% identification rate for Ciona intestinalis and Ciona savignyi, respectively), showed changes in a number of protein functional groups, including molecular chaperones, extracellular matrix proteins, calcium-binding proteins, cytoskeletal proteins and proteins involved in energy metabolism. Our results indicate that C. intestinalis maintains higher constitutive levels of molecular chaperones than C. savignyi, suggesting that it is prepared to respond faster to thermal stress. Systematic discrepancies between estimated versus predicted molecular masses of identified proteins differed between protein families and were more pronounced under high heat conditions, suggesting that thermal sensitivities are lower for cytoskeletal proteins and ATP-synthase than for any other protein group represented on 2D gels. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Heat shock factor 2 is a stress-responsive mediator of neuronal migration defects in models of fetal alcohol syndrome

    PubMed Central

    El Fatimy, Rachid; Miozzo, Federico; Le Mouël, Anne; Abane, Ryma; Schwendimann, Leslie; Sabéran-Djoneidi, Délara; de Thonel, Aurélie; Massaoudi, Illiasse; Paslaru, Liliana; Hashimoto-Torii, Kazue; Christians, Elisabeth; Rakic, Pasko; Gressens, Pierre; Mezger, Valérie

    2014-01-01

    Fetal alcohol spectrum disorder (FASD) is a frequent cause of mental retardation. However, the molecular mechanisms underlying brain development defects induced by maternal alcohol consumption during pregnancy are unclear. We used normal and Hsf2-deficient mice and cell systems to uncover a pivotal role for heat shock factor 2 (HSF2) in radial neuronal migration defects in the cortex, a hallmark of fetal alcohol exposure. Upon fetal alcohol exposure, HSF2 is essential for the triggering of HSF1 activation, which is accompanied by distinctive post-translational modifications, and HSF2 steers the formation of atypical alcohol-specific HSF1–HSF2 heterocomplexes. This perturbs the in vivo binding of HSF2 to heat shock elements (HSEs) in genes that control neuronal migration in normal conditions, such as p35 or the MAPs (microtubule-associated proteins, such as Dclk1 and Dcx), and alters their expression. In the absence of HSF2, migration defects as well as alterations in gene expression are reduced. Thus, HSF2, as a sensor for alcohol stress in the fetal brain, acts as a mediator of the neuronal migration defects associated with FASD. Subject Categories Development & Differentiation; Neuroscience PMID:25027850

  8. Heat shock factor 2 is a stress-responsive mediator of neuronal migration defects in models of fetal alcohol syndrome.

    PubMed

    El Fatimy, Rachid; Miozzo, Federico; Le Mouël, Anne; Abane, Ryma; Schwendimann, Leslie; Sabéran-Djoneidi, Délara; de Thonel, Aurélie; Massaoudi, Illiasse; Paslaru, Liliana; Hashimoto-Torii, Kazue; Christians, Elisabeth; Rakic, Pasko; Gressens, Pierre; Mezger, Valérie

    2014-08-01

    Fetal alcohol spectrum disorder (FASD) is a frequent cause of mental retardation. However, the molecular mechanisms underlying brain development defects induced by maternal alcohol consumption during pregnancy are unclear. We used normal and Hsf2-deficient mice and cell systems to uncover a pivotal role for heat shock factor 2 (HSF2) in radial neuronal migration defects in the cortex, a hallmark of fetal alcohol exposure. Upon fetal alcohol exposure, HSF2 is essential for the triggering of HSF1 activation, which is accompanied by distinctive post-translational modifications, and HSF2 steers the formation of atypical alcohol-specific HSF1-HSF2 heterocomplexes. This perturbs the in vivo binding of HSF2 to heat shock elements (HSEs) in genes that control neuronal migration in normal conditions, such as p35 or the MAPs (microtubule-associated proteins, such as Dclk1 and Dcx), and alters their expression. In the absence of HSF2, migration defects as well as alterations in gene expression are reduced. Thus, HSF2, as a sensor for alcohol stress in the fetal brain, acts as a mediator of the neuronal migration defects associated with FASD.

  9. Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress.

    PubMed

    Huang, Li-Hua; Kang, Le

    2007-08-01

    Studies have demonstrated differences in temperature tolerance between two Liriomyza species, L. huidobrensis and L. sativae. To investigate whether the heat shock proteins (Hsps) in the two species have different expression profiles during temperature stress, we cloned hsp90, 70, 60, 40 and 20, and analysed their expression profiles across temperature gradients by real-time quantitative PCR and Western blotting. The results revealed that the number of TATA-box-like elements and A/T-rich insertion/deletions within the 5' UTRs of the hsps are different in the two species. The temperatures for onset (T(on)) or maximal (T(max)) induction of hsp expression in L. huidobrensis were generally 2.5-10 degrees C lower than those in L. sativae, and the T(on) were highly consistent with the temperature limits of the northern boundary of the range of these two leafminer species. These studies confirmed, in terms of gene expression levels, that L. huidobrensis is more cold tolerant than L. sativae, which is more heat tolerant, and suggest that the T(on) (or T(max)) of hsps can represent the differences in temperature tolerance of these two leafminer species, and may be used to determine their natural geographical distribution limits.

  10. Reactive oxygen species may influence the heat shock response and stress tolerance in the yeast Saccharomyces cerevisiae.

    PubMed

    Moraitis, Christos; Curran, Brendan P G

    2004-03-01

    Moderate levels of reactive oxygen species (ROS) have been implicated as second messengers in a number of biochemical pathways, and in animal cells have been associated with the activation of the heat shock response (HSR). Here, using an intracellular probe, we demonstrate that differential accumulation of ROS in the yeast Saccharomyces cerevisiae is strongly associated with differential induction of an HS reporter gene over a range of heat shock temperatures. There was a good correlation between cellular ROS levels and the levels of HS-induced reporter gene expression between 37 degrees C and 44 degrees C, both reaching maximal values at 41 degrees C. Furthermore, the addition of 150 microM H2O2 to the yeast cells during heat treatment resulted in a 3 degrees C decrease in the temperature required for maximal induction of the HS expression vector--an increased HS sensitivity that corresponded to a concomitant increase in ROS levels at these lower HS temperatures. Conversely, cells treated with 10 mM of the antioxidant ascorbic acid required a temperature that was 2 degrees C above that required in untreated controls for maximal induction of the HS expression vector. This decreased HS sensitivity corresponded to a decrease in ROS levels at these higher HS temperatures. Finally, cell viability assays reveal that intrinsic thermotolerance remains high in control cells despite concomitant decreases in HS-reporter gene expression and ROS accumulation between 41 degrees C and 44 degrees C. We conclude that the sensitivity of the yeast HSR is strongly associated with ROS accumulation, and suggest that ROS-mediated signalling ensures cooperation between the HS and the antioxidant responses.

  11. Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in response to high-temperature stress.

    PubMed

    Wang, Hua; Fang, Yan; Bao, Zhongzan; Jin, Xing; Zhu, Wenjuan; Wang, Lipeng; Liu, Teng; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu

    2014-03-15

    Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Effect of anaerobic and stationary phase growth conditions on the heat shock and oxidative stress responses in Escherichia coli K-12.

    PubMed

    Díaz-Acosta, Alondra; Sandoval, María L; Delgado-Olivares, Luis; Membrillo-Hernández, Jorge

    2006-06-01

    The natural living style of Escherichia coli occurs in the gastrointestinal tract, where most of its existence is spent under anaerobic conditions and in stationary phase of growth. Here we report on the heat shock response of E. coli K-12 cells growing in the presence or absence of oxygen. An rpoH mutant (impaired in the synthesis of the sigma(32) transcriptional factor) exhibited an increased sensitivity to heat shock but only in the exponential phase of aerobic growth, suggesting that in anaerobic growth conditions, and in aerobic stationary phase, sigma(32)-independent mechanisms are playing a prime role in protecting cells from heat stress. Our results demonstrated that sigma(S) is not involved in this protection system. Studies on the kinetics of synthesis of Heat shock proteins (Hsp) after an abrupt rise in temperature demonstrated that in the absence of oxygen, the synthesis of Hsp is triggered faster and is sustained for a longer period of time compared to aerobic growth conditions. Finally, the heated cells in the exponential phase of aerobic growth displayed a high concentration of oxidatively damaged proteins in the presence of 4 mM H(2)O(2), in sharp contrast to cultures of stationary phase or anaerobic growth.

  13. QsMYB1 expression is modulated in response to heat and drought stresses and during plant recovery in Quercus suber.

    PubMed

    Almeida, Tânia; Pinto, Glória; Correia, Barbara; Santos, Conceição; Gonçalves, Sónia

    2013-12-01

    Cork oak is an economically important forest species showing a great tolerance to high temperatures and shortage of water. However, the mechanisms underlying this plasticity are still poorly understood. Among the stress regulators, transcription factors (TFs) are especially important since they can control a wide range of stress-inducible genes, which make them powerful targets for genetic engineering of stress tolerance. Here we evaluated the influence of increasing temperatures (up to 55 °C) or drought (18% field capacity, FC) on the expression profile of an R2R3-MYB transcription factor of cork oak, the QsMYB1. QsMYB1 was previously identified as being preferentially expressed in cork tissues and as having an associated alternative splicing mechanism, which results in two different transcripts (QsMYB1.1 and QsMYB1.2). Expression analysis by reverse transcription quantitative PCR (RT-qPCR) revealed that increasing temperatures led to a gradual down-regulation of QsMYB1 transcripts with more effect on QsMYB1.1 abundance. On the other hand, under drought condition, expression of QsMYB1 variants, mainly the QsMYB1.2, was transiently up-regulated shortly after the stress imposition. Recovery from each stress has also resulted in a differential response by both QsMYB1 transcripts. Several physiological and biochemical parameters (plant water status, chlorophyll fluorescence, lipid peroxidation and proline content) were determined in order to monitor the plant performance under stress and recovery. In conclusion, this report provides the first evidence that QsMYB1 TF may have a putative function in the regulatory network of cork oak response to heat and drought stresses and during plant recovery.

  14. Incubation temperature alters thermal preference and response to heat stress of broiler chickens along the rearing phase.

    PubMed

    Morita, V S; Almeida, V R; Matos Junior, J B; Vicentini, T I; van den Brand, H; Boleli, I C

    2016-08-01

    The current study aimed to investigate whether embryonic temperature manipulation may alter thermal preference throughout the rearing phase of broiler chickens and how this manipulation may affect response to thermal challenge, metabolism, growth rate and feed intake rate. Eggs were exposed to a constant incubation temperature [machine temperatures: 36°C (Low), 37.5°C (Control), and 39°C (High); eggshell temperature of 37.4 ± 0.08°C, 37.8 ± 0.15°C, and 38.8 ± 0.33°C, respectively] from d 13 till hatching. Low treatment chickens showed lower plasma T3 and GH levels at d 1 of age and lower T3 level at d 42 of age compared to the Control treatment. Preferred ambient, rectal temperature, T4 level, growth rate, food intake rate, and response to thermal challenge were not altered in these chickens. On the other hand, High-treatment chickens exhibited high preferred ambient temperature and rectal temperature during the first 2 wk post-hatch, lower plasma T3 level at d 21 and 42 and a delayed increase in respiratory movement in response to thermal challenge compared to the Control treatment. However, chickens subjected to the Control and High treatments did not differ in T4 and GH level and performance. We conclude that exposure to high temperature during late embryonic development has long-lasting effects on the thermoregulatory system of broiler chickens by affecting the heat tolerance of these chickens. Moreover, the preferred ambient temperature of the chickens from heat-treated eggs correspond to those recommended for the strain under study, whereas for the cold-treated and control-chickens it was 1°C below, indicating that incubation temperature might have consequences on the ambient temperature chickens require during the rearing phase. © 2016 Poultry Science Association Inc.

  15. The effects of floor heating on body temperature, water consumption, stress response and immune competence around parturition in loose-housed sows.

    PubMed

    Damgaard, B M; Malmkvist, J; Pedersen, L J; Jensen, K H; Thodberg, K; Jørgensen, E; Juul-Madsen, H R

    2009-02-01

    The aim of the present study was to study whether floor heating from 12h after onset of nest building until 48 h after birth of the first piglet had any effect on measures related to body temperature, water consumption, stress response and immune competence in loose-housed sows (n=23). In conclusion, the present results indicate that floor heating for a limited period around parturition did not compromise physiological and immunological parameters, water intake and body temperature in loose-housed sows. The water intake peaked the day before parturition and the body temperature peaked on the day of parturition. A cortisol peak at parturition, a transient rise in the number of leucocytes and neutrophils and a transient reduction in the number of lymphocytes, erythrocytes and in the PCV value were observed. Around and after parturition some non-specific immunological variables seemed to be stimulated while others seemed to be compromised.

  16. Water Replacement Schedules in Heat Stress

    ERIC Educational Resources Information Center

    Londeree, Ben R.; and others

    1969-01-01

    Although early ingestion of cold water appears to lead to greater relief from heat stress during physical exertion than late ingestion, this difference is reduced toward the end of an hour's work in high heat and humidity. (CK)

  17. Water Replacement Schedules in Heat Stress

    ERIC Educational Resources Information Center

    Londeree, Ben R.; and others

    1969-01-01

    Although early ingestion of cold water appears to lead to greater relief from heat stress during physical exertion than late ingestion, this difference is reduced toward the end of an hour's work in high heat and humidity. (CK)

  18. Heat stress interaction with shade and cooling.

    PubMed

    Armstrong, D V

    1994-07-01

    Hot weather causes heat stress in dairy cattle. Although effects are more severe in hot climates, dairy cattle in areas with relatively moderate climates also are exposed to periods of heat stress. The resultant decrease in milk production and reproductive efficiency can be offset by implementation of a program consisting of cooling through shades, ventilation and spray, and fans. The economic benefit should be determined before installation of equipment to reduce heat stress.

  19. Osmotic and Heat Stress Effects on Segmentation

    PubMed Central

    Weiss, Julian

    2016-01-01

    During vertebrate embryonic development, early skin, muscle, and bone progenitor populations organize into segments known as somites. Defects in this conserved process of segmentation lead to skeletal and muscular deformities, such as congenital scoliosis, a curvature of the spine caused by vertebral defects. Environmental stresses such as hypoxia or heat shock produce segmentation defects, and significantly increase the penetrance and severity of vertebral defects in genetically susceptible individuals. Here we show that a brief exposure to a high osmolarity solution causes reproducible segmentation defects in developing zebrafish (Danio rerio) embryos. Both osmotic shock and heat shock produce border defects in a dose-dependent manner, with an increase in both frequency and severity of defects. We also show that osmotic treatment has a delayed effect on somite development, similar to that observed in heat shocked embryos. Our results establish osmotic shock as an alternate experimental model for stress, affecting segmentation in a manner comparable to other known environmental stressors. The similar effects of these two distinct environmental stressors support a model in which a variety of cellular stresses act through a related response pathway that leads to disturbances in the segmentation process. PMID:28006008

  20. Proteomic analysis of acidic chaperones, and stress proteins in extreme halophile Halobacterium NRC-1: a comparative proteomic approach to study heat shock response

    PubMed Central

    Shukla, Hem D

    2006-01-01

    Background Halobacterium sp. NRC-1 is an extremely halophilic archaeon and has adapted to optimal growth under conditions of extremely high salinity. Its proteome is highly acidic with a median pI of 4.9, a unique characteristic which helps the organism to adapt high saline environment. In the natural growth environment, Halobacterium NRC-1 encounters a number of stressful conditions including high temperature and intense solar radiation, oxidative and cold stress. Heat shock proteins and chaperones play indispensable roles in an organism's survival under many stress conditions. The aim of this study was to develop an improved method of 2-D gel electrophoresis with enhanced resolution of the acidic proteome, and to identify proteins with diverse cellular functions using in-gel digestion and LC-MS/MS and MALDI-TOF approach. Results A modified 2-D gel electrophoretic procedure, employing IPG strips in the range of pH 3–6, enabled improved separation of acidic proteins relative to previous techniques. Combining experimental data from 2-D gel electrophoresis with available genomic information, allowed the identification of at least 30 cellular proteins involved in many cellular functions: stress response and protein folding (CctB, PpiA, DpsA, and MsrA), DNA replication and repair (DNA polymerase A α subunit, Orc4/CDC6, and UvrC), transcriptional regulation (Trh5 and ElfA), translation (ribosomal proteins Rps27ae and Rphs6 of the 30 S ribosomal subunit; Rpl31eand Rpl18e of the 50 S ribosomal subunit), transport (YufN), chemotaxis (CheC2), and housekeeping (ThiC, ThiD, FumC, ImD2, GapB, TpiA, and PurE). In addition, four gene products with undetermined function were also identified: Vng1807H, Vng0683C, Vng1300H, and Vng6254. To study the heat shock response of Halobacterium NRC-1, growth conditions for heat shock were determined and the proteomic profiles under normal (42°C), and heat shock (49°C) conditions, were compared. Using a differential proteomic approach in

  1. Differential response of cell-cycle and cell-expansion regulators to heat stress in apple (Malus domestica) fruitlets.

    PubMed

    Flaishman, Moshe A; Peles, Yuval; Dahan, Yardena; Milo-Cochavi, Shira; Frieman, Aviad; Naor, Amos

    2015-04-01

    Temperature is one of the most significant factors affecting physiological and biochemical aspects of fruit development. Current and progressing global warming is expected to change climate in the traditional deciduous fruit tree cultivation regions. In this study, 'Golden Delicious' trees, grown in a controlled environment or commercial orchard, were exposed to different periods of heat treatment. Early fruitlet development was documented by evaluating cell number, cell size and fruit diameter for 5-70 days after full bloom. Normal activities of molecular developmental and growth processes in apple fruitlets were disrupted under daytime air temperatures of 29°C and higher as a result of significant temporary declines in cell-production and cell-expansion rates, respectively. Expression screening of selected cell cycle and cell expansion genes revealed the influence of high temperature on genetic regulation of apple fruitlet development. Several core cell-cycle and cell-expansion genes were differentially expressed under high temperatures. While expression levels of B-type cyclin-dependent kinases and A- and B-type cyclins declined moderately in response to elevated temperatures, expression of several cell-cycle inhibitors, such as Mdwee1, Mdrbr and Mdkrps was sharply enhanced as the temperature rose, blocking the cell-cycle cascade at the G1/S and G2/M transition points. Moreover, expression of several expansin genes was associated with high temperatures, making them potentially useful as molecular platforms to enhance cell-expansion processes under high-temperature regimes. Understanding the molecular mechanisms of heat tolerance associated with genes controlling cell cycle and cell expansion may lead to the development of novel strategies for improving apple fruit productivity under global warming. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Heat shock protein 90 (HSP90) inhibitors activate the heat shock factor 1 (HSF1) stress response pathway and improve glucose regulation in diabetic mice.

    PubMed

    Lee, Jee-Hyung; Gao, Jiaping; Kosinski, Penelope A; Elliman, Stephen J; Hughes, Thomas E; Gromada, Jesper; Kemp, Daniel M

    2013-01-18

    The cytoprotective stress response factor HSF1 regulates the transcription of the chaperone HSP70, which exhibits anti-inflammatory effects and improves insulin sensitivity. We tested the therapeutic potential of this pathway in rodent models of diabetes using pharmacological tools. Activation of the HSF1 pathway was achieved using potent inhibitors of the upstream regulatory protein, HSP90. Treatment with AUY922, a selective HSP90 inhibitor led to robust inhibition of JNK1 phosphorylation, cytoprotection and improved insulin signaling in cells, consistent with effects observed with HSP70 treatment. Chronic dosing with HSP90 inhibitors reversed hyperglycemia in the diabetic db/db mouse model, and improved insulin sensitivity in the diet-induced obese mouse model of insulin resistance, further supporting the concept that the HSF1 pathway is a potentially viable anti-diabetes target.

  3. Identification of heat shock cognate protein 70 gene (Alhsc70) of Apolygus lucorum and its expression in response to different temperature and pesticide stresses.

    PubMed

    Sun, Yang; Zhao, Jing; Sheng, Yang; Xiao, Ying-Fang; Zhang, Yong-Jun; Bai, Li-Xin; Tan, Yongan; Xiao, Liu-Bin; Xu, Guang-Chun

    2016-02-01

    Heat shock cognate protein 70 (Hsc70) is a very important stress-resistance protein of insects against environmental stresses. We employed fluorescent real-time quantitative polymerase chain reaction and Western-blot techniques to analyze the transcriptional and translational expression profiles of AlHSC70 under extreme temperature (4°C and 40°C) or 4 pesticide stresses in Apolygus lucorum. The results showed that the expression of AlHSC70 were significantly induced by cyhalothrin or extremely high temperature (40°C) in both transcriptional and translational levels (P < 0.05), while the transcriptional and translational level of AlHSC70 decreased significantly in treatments of chlorpyrifos or extreme cold temperature (4°C) (P < 0.05). Moreover, after Apolygus lucorum treated by imidacloprid or emamectin benzoate, the expression of AlHSC70 was only up-regulated significantly at the transcriptional level (P < 0.05), although obviously up-regulated at the translational level of AlHSC70. Therefore, this study confirmed that the Alhsc70 gene played important roles in response to both temperature and pesticide stresses, especially for cyhalothrin or extremely high temperature (40°C). In addition, the significant polynomial regression correlations between temperature and the Alhsc70 expression level were shown in all the nymph and adult stages (P < 0.01), indicating temperature was an important factor to affect the relative expression of Alhsc70.

  4. The myocardial heat shock response following sodium salicylate treatment

    PubMed Central

    Locke, Marius; Atance, Joel

    2000-01-01

    In cultured cells, salicylate has been shown to potentiate the induction of Hsp72 so that a mild heat stress (40°C) in the presence of salicylate induces an Hsp72 response that is similar to a severe heat stress (42°C). To determine whether salicylate can potentiate the myocardial Hsp70 response in vivo and confer protection from an ischemic stress, male Sprague-Dawley rats (250–300 g) were placed into 5 groups: (1) control, (2) salicylate only (400 mg/kg), (3) mild heat stress (40°C for 15 minutes), (4) mild heat stress plus salicylate, and (5) severe heat stress (42°C for 15 minutes). Twenty-four hours following salicylate treatment and/or heat stress, animals were anesthetized, their hearts rapidly isolated, and hemodynamic function evaluated using the Langendorff technique. Hsp72 content was subsequently assessed by Western blotting. Although salicylate in combination with a mild heat stress induced heat shock factor activation, only the hearts from severely heat-stressed animals (42°C) demonstrated a significantly elevated myocardial Hsp72 content and a significantly enhanced postischemic recovery of left ventricular developed pressure and rates of contraction and relaxation. These results support the role for Hsp72 as a protective protein and suggest that neither salicylate treatment alone nor salicylate in combination with a mild heat stress potentiates the myocardial Hsp72 response. PMID:11048658

  5. Anaerobic respiration and antioxidant responses of Corythucha ciliata (Say) adults to heat-induced oxidative stress under laboratory and field conditions.

    PubMed

    Ju, Rui-Ting; Wei, He-Ping; Wang, Feng; Zhou, Xu-Hui; Li, Bo

    2014-03-01

    High temperature often induces oxidative stress and antioxidant response in insects. This phenomenon has been well documented under controlled laboratory conditions, but whether it happens under fluctuating field conditions is largely unknown. In this study, we used an invasive lace bug (Corythucha ciliata) as a model species to compare the effects of controlled thermal treatments (2 h at 33-43 °C with 2 °C intervals in the laboratory) and naturally fluctuating thermal conditions (08:00-14:00 at 2-h intervals (29.7-37.2 °C) on a hot summer day in a field in Shanghai, China) on lipid peroxidation (malondialdehyde (MDA) was the marker) and anaerobic respiration (lactate dehydrogenase (LDH) was the marker), as well as superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), and glutathione reductase (GR). The results show that MDA concentration increased significantly in response to heat stresses with similar trend in the laboratory and field. LDH activities did not significantly vary across temperatures in the laboratory-exposed individuals, but they significantly increased by rising temperature in the field. The activities or concentrations of SOD, CAT, GSH, and GR all significantly increased with increasing temperature in the two populations. These findings indicate that high temperature induces oxidative stress, resulting in high anaerobic respiration and antioxidant defenses in C. ciliata under both the laboratory and field conditions, which likely provide a defense mechanism against oxidative damage due to the accumulation of ROS.

  6. Heat pipe transient response approximation.

    SciTech Connect

    Reid, R. S.

    2001-01-01

    A simple and concise routine that approximates the response of an alkali metal heat pipe to changes in evaporator heat transfer rate is described. This analytically based routine is compared with data from a cylindrical heat pipe with a crescent-annular wick that undergoes gradual (quasi-steady) transitions through the viscous and condenser boundary heat transfer limits. The sonic heat transfer limit can also be incorporated into this routine for heat pipes with more closely coupled condensers. The advantages and obvious limitations of this approach are discussed. For reference, a source code listing for the approximation appears at the end of this paper.

  7. Expression of heat shock proteins (HSPs) in Aedes aegypti (L) and Aedes albopictus (Skuse) (Diptera: Culicidae) larvae in response to thermal stress.

    PubMed

    Sivan, Arun; Shriram, Ananganallur Nagarajan; Muruganandam, Nagarajan; Thamizhmani, Ramanathan

    2017-03-01

    Climatic changes are responsible, to a certain extent for the occurrence and spread of arboviral pathogens world over. Temperature is one of the important abiotic factors influencing the physiological processes of mosquitoes. Several genes of heat shock protein (HSP) families are known to be expressed in mosquitoes, which aid in overcoming stress induced by elevated temperature. In order to understand expression of HSP family genes in the Andaman population of Aedes aegypti and Aedes albopictus, we used quantitative real-time polymerase chain reaction (qPCR) to examine expression levels of HSPs in response to thermal stress under laboratory and in actual field conditions. HSP genes AeaHsp26, AeaHsp83 and AeaHsc70 were examined by comparing relative transcript expression levels at 31°C, 33°C, 34°C, 37°C and 39°C respectively. Enhanced up-regulation of HSPs was evident in third instar larvae of Ae. aegypti with rise in water temperatures (31°C, 33°C, 34°C) in the containers in the nature and thermally stressed (37°C and 39°C) in laboratory conditions. In Ae. albopictus up-regulation of HSPs was observed in field conditions at 34°C only and when thermally treated at 37°C, while down regulation was evident in larvae subjected to thermal stress in laboratory at 39°C. Data on expression levels revealed that larvae of Ae. aegypti was tolerant to thermal stress, while Ae. albopictus larvae was sensitive to heat shock treatment. Statistical analysis indicated that AeaHsp83 genes were significantly up-regulated in Ae. aegypti larvae after 360min exposure to high temperature (39°C). The difference in expression levels of AeaHsp26, AeaHsc70 and AeaHsp83 genes in Ae. albopictus larvae was statistically significant between different exposure temperatures. All of these genes were significantly up-regulated at 37°C. These results indicate that AeaHsp26, AeaHsc70 and AeaHsp83 are important markers of stress and perhaps function as proteins conferring protection and

  8. Antioxidant and photoprotective responses to elevated CO(2) and heat stress during holm oak regeneration by resprouting, evaluated with NIRS (near-infrared reflectance spectroscopy).

    PubMed

    Pintó-Marijuan, M; Joffre, R; Casals, I; De Agazio, M; Zacchini, M; García-Plazaola, J-I; Esteban, R; Aranda, X; Guàrdia, M; Fleck, I

    2013-01-01

    Photosynthetic, photoprotective and antioxidant responses during high temperature stress were determined in leaves of evergreen holm oak (Quercus ilex L.), the main species in Mediterranean forests, during resprouting under elevated CO(2) (750 μl·l(-1) ). Leaf chemicals, chloroplast pigments and non-enzymatic antioxidants were quantified in a single measurement using NIRS (near-infrared spectroscopy), a rapid and suitable method for ecophysiological purposes. Resprouts from plants grown under elevated CO(2) (RE) showed photosynthetic down-regulation, higher starch content and lower stomatal conductance, but similar stomatal density, than plants grown under current CO(2) concentrations (350 μl·l(-1) ) (RA). The photosynthetic sink reduction and need for more antioxidants and photoprotection in RE were reflected in an increased concentration of ascorbate (Asc) and phenolic compounds and in the contribution of the xanthophyll (Z/VAZ) and lutein epoxide cycles to excess energy dissipation as heat, and also reflected in chlorophyll fluorescence measurements. CO(2) assimilation parameters were stable from 25 to 35 °C in RE and RA, declining thereafter in RA in spite of a 2.3 °C lower leaf temperature. RE showed a more marked decline in photorespiration above 35 °C and less sensitive stomatal responses to high temperature stress than RA. During heat stress, RE had higher Asc, Z/VAZ and phenolics content, together with delayed enhancement of chloroplast lipophilic antioxidant compounds (carotenes and tocopherols). The high contribution of photoprotective systems and high temperature tolerance in resprouts developed under elevated CO(2) would mitigate the effect of photosynthesis acclimation during the regeneration of Q. ilex plants under climate change.

  9. Oxidative stress in deep scattering layers: Heat shock response and antioxidant enzymes activities of myctophid fishes thriving in oxygen minimum zones

    NASA Astrophysics Data System (ADS)

    Lopes, Ana Rita; Trübenbach, Katja; Teixeira, Tatiana; Lopes, Vanessa M.; Pires, Vanessa; Baptista, Miguel; Repolho, Tiago; Calado, Ricardo; Diniz, Mário; Rosa, Rui

    2013-12-01

    Diel vertical migrators, such as myctophid fishes, are known to encounter oxygen minimum zones (OMZ) during daytime in the Eastern Pacific Ocean and, therefore, have to cope with temperature and oxidative stress that arise while ascending to warmer, normoxic surface waters at night-time. The aim of this study was to investigate the antioxidant defense strategies and heat shock response (HSR) in two myctophid species, namely Triphoturus mexicanus and Benthosema panamense, at shallow and warm surface waters (21 kPa, 20-25 °C) and at hypoxic, cold (≤1 kPa, 10 °C) mesopelagic depths. More specifically, we quantified (i) heat shock protein concentrations (HSP70/HSC70) (ii) antioxidant enzyme activities [including superoxide dismutase (SOD), catalase (CAT) and glutathione-S-transferase (GST)], and (iii) lipid peroxidation [malondialdehyde (MDA) levels]. HSP70/HSC70 levels increased in both myctophid species at warmer, well-oxygenated surface waters probably to prevent cellular damage (oxidative stress) due to increased oxygen demand under elevated temperatures and reactive oxygen species (ROS) formation. On the other hand, CAT and GST activities were augmented under hypoxic conditions, probably as preparatory response to a burst of oxyradicals during the reoxygenation phase (while ascending). SOD activity decreased under hypoxia in B. panamense, but was kept unchanged in T. mexicanus. MDA levels in B. panamense did not change between the surface and deep-sea conditions, whereas T. mexicanus showed elevated MDA and HSP70/HSC70 concentrations at warmer surface waters. This indicated that T. mexicanus seems to be not so well tuned to temperature and oxidative stress associated to diel vertical migrations. The understanding of such physiological strategies that are linked to oxygen deprivation and reoxygenation phases may provide valuable information about how different species might respond to the impacts of environmental stressors (e.g. expanding mesopelagic hypoxia

  10. Characterizing heat shock protein 90 gene of Apolygus lucorum (Meyer-Dür) and its expression in response to different temperature and pesticide stresses.

    PubMed

    Sun, Yang; Sheng, Yang; Bai, Lixin; Zhang, Yongjun; Xiao, Yingfang; Xiao, Liubin; Tan, Yongan; Shen, Youmi

    2014-09-01

    In this study, we cloned a full-length cDNA of heat shock protein (HSP) gene of Apolygus lucorum (Meyer-Dür) [AlHSP90, KC109781] and investigated its expression in response to temperature and pesticide stresses. The open reading frame (ORF) of AlHSP90 is 2,169 bp in length, encoding a 722 amino acid polypeptide with a predicted molecular weight of 82.99 kDa. Transcriptional and translational expression profiles of AlHSP90 under extreme temperature or pesticide stresses were examined by fluorescent real-time quantitative PCR and Western blot. Results showed that the expression profiles of AlHSP90 protein were in high agreement with those of AlHSP90 RNA and indicated that AlHSP90 was not only an important gene for A. lucorum adults in response to extremely high temperature, but also involved in the resistance or tolerance to cyhalothrin, imidacloprid, chlorpyrifos, and emamectin benzoate, especially for female adults to emamectin benzoate and for male adults to cyhalothrin. Transcriptional results of AlHSP90 also confirmed that AlHSP90 was an important gene involved in the resistance or tolerance to both temperature and pesticide stresses. In addition, our study also revealed that ∼24 °C may be the suitable temperature range for A. lucorum survival, which is also confirmed by the results of the expression of AlHSP90, the nymph mortality, and the intrinsic rate of increase (r m) when A. lucorum is reared at six different temperatures. Therefore, these studies are significant in elucidating the AlHSP90 in response to temperature and pesticide stresses and would provide guidance for A. lucorum management with different pesticides or temperatures in fields.

  11. Stress response physiology of thermophiles.

    PubMed

    Ranawat, Preeti; Rawat, Seema

    2017-04-01

    Thermo (or hyperthermo) philic microorganisms are ubiquitous having a wide range of habitats from freshly fallen snow to pasteurized milk to geothermal areas like hot springs. The variations in physicochemical conditions, viz., temperature, pH, nutrient availability and light intensity in the habitats always pose stress conditions for the inhabitants leading to slow growth or cell death. The industrial processes used for harvesting secondary metabolites such as enzymes, toxins and organic acids also create stressed environments for thermophiles. The production of DNA-binding proteins, activation of reactive oxygen species detoxification system, compatible solute accumulation, expression of heat shock proteins and alterations in morphology are a few examples of physiological changes demonstrated by these microscopic lifeforms in stress. These microorganisms exhibit complex genetic and physiological changes to minimize, adapt to and repair damage caused by extreme environmental disturbances. These changes are termed as 'stress responses' which enable them to stabilize their homeostasis. The exploration of important thermophilic factors would pave the way in engineering the microbial strains for various biotechnological applications. This review article presents a picture of physiological responses of thermophiles against various stress conditions as their mechanisms to respond to stress make them model organisms to further explore them for basic and applied biology purposes.

  12. Regulation of Heat Stress by HSF1 and GR

    DTIC Science & Technology

    2016-09-01

    thermogenesis and mitochondria -derived reactive oxygen species, which likely play a role in heat stress response. Both HSF1 and GR may directly or indirectly...control, n = 3 per group. Furthermore, we examined GR and HSF1 contents in the cytosol, mitochondria , and nucleus of the skeletal muscles. We...are indeed sensitive to heat stress as well as HA. Mitochondria in skeletal muscles are likely the target organelle of acute severe and repeated

  13. Effects of dietary selenium and vitamin E on immune response and biological blood parameters of broilers reared under thermoneutral or heat stress conditions

    NASA Astrophysics Data System (ADS)

    Habibian, Mahmood; Ghazi, Shahab; Moeini, Mohammad Mehdi; Abdolmohammadi, Alireza

    2014-07-01

    A study was conducted using 360 broiler chickens to evaluate the effects of dietary vitamin E (0, 125 and 250 mg/kg), selenium (Se, 0, 0.5 and 1 mg/kg), or their different combinations on immune response and blood biological parameters of broilers raised under either thermoneutral (TN, 23.9 °C constant) or heat stress (HS, 23.9 to 37 °C cycling) conditions. Humoral immunity was assessed by intravenous injection of 7 % sheep red blood cell (SRBC) followed by evaluation of serum for antibody titers in primary and secondary responses. Heterophil to lymphocyte (H/L) ratio also determined as an indicator of stress. Furthermore, at the end of the experiment, birds were bled for determination of some biological parameters. There was a significant reduction in body weight and feed intake, but the feed conversion ratio increased when the birds were exposed to HS ( P < 0.05). Body weight and feed intake were not influenced significantly by dietary vitamin E and Se ( P > 0.05), whereas feed conversion was improved significantly by 125 mg/kg vitamin E ( P < 0.05). The liver and lymphoid organ weights as well as IgM and IgG, antibody titers for primary and secondary antibody responses to SRBC were reduced significantly under HS ( P < 0.05). Heat stress also resulted in a significant increase in H/L ratio ( P < 0.05). Dietary vitamin E resulted in improvement of primary and secondary antibody responses both in TN and HS broilers ( P < 0.05). The HS birds also showed an improved antibody titer in secondary response with high concentration of Se ( P < 0.05). Vitamin E and Se had interactive effects on anti-SRBC titers; however, no consistent differences were found between dietary levels during the study. The H/L ratio decreased by feeding vitamin E at both levels either under HS or TN conditions ( P < 0.05). The serum concentrations of glucose, triglycerides, total cholesterol, and LDL-cholesterol were increased but serum HDL-cholesterol decreased in HS broilers ( P < 0.05).

  14. Drought stress had a predominant effect over heat stress on three tomato cultivars subjected to combined stress.

    PubMed

    Zhou, Rong; Yu, Xiaqing; Ottosen, Carl-Otto; Rosenqvist, Eva; Zhao, Liping; Wang, Yinlei; Yu, Wengui; Zhao, Tongmin; Wu, Zhen

    2017-01-25

    Abiotic stresses due to environmental factors could adversely affect the growth and development of crops. Among the abiotic stresses, drought and heat stress are two critical threats to crop growth and sustainable agriculture worldwide. Considering global climate change, incidence of combined drought and heat stress is likely to increase. The aim of this study was to shed light on plant growth performance and leaf physiology of three tomatoes cultivars ('Arvento', 'LA1994' and 'LA2093') under control, drought, heat and combined stress. Shoot fresh and dry weight, leaf area and relative water content of all cultivars significantly decreased under drought and combined stress as compared to control. The net photosynthesis and starch content were significantly lower under drought and combined stress than control in the three cultivars. Stomata and pore length of the three cultivars significantly decreased under drought and combined stress as compared to control. The tomato 'Arvento' was more affected by heat stress than 'LA1994' and 'LA2093' due to significant decreases in shoot dry weight, chlorophyll a and carotenoid content, starch content and NPQ (non-photochemical quenching) only in 'Arvento' under heat treatment. By comparison, the two heat-tolerant tomatoes were more affected by drought stress compared to 'Arvento' as shown by small stomatal and pore area, decreased sucrose content, ΦPSII (quantum yield of photosystem II), ETR (electron transport rate) and qL (fraction of open PSII centers) in 'LA1994' and 'LA2093'. The three cultivars showed similar response when subjected to the combination of drought and heat stress as shown by most physiological parameters, even though only 'LA1994' and 'LA2093' showed decreased Fv/Fm (maximum potential quantum efficiency of photosystem II), ΦPSII, ETR and qL under combined stress. The cultivars differing in heat sensitivity did not show difference in the combined stress sensitivity, indicating that selection for tomatoes

  15. Response to Hyperosmotic Stress

    PubMed Central

    Saito, Haruo; Posas, Francesc

    2012-01-01

    An appropriate response and adaptation to hyperosmolarity, i.e., an external osmolarity that is higher than the physiological range, can be a matter of life or death for all cells. It is especially important for free-living organisms such as the yeast Saccharomyces cerevisiae. When exposed to hyperosmotic stress, the yeast initiates a complex adaptive program that includes temporary arrest of cell-cycle progression, adjustment of transcription and translation patterns, and the synthesis and retention of the compatible osmolyte glycerol. These adaptive responses are mostly governed by the high osmolarity glycerol (HOG) pathway, which is composed of membrane-associated osmosensors, an intracellular signaling pathway whose core is the Hog1 MAP kinase (MAPK) cascade, and cytoplasmic and nuclear effector functions. The entire pathway is conserved in diverse fungal species, while the Hog1 MAPK cascade is conserved even in higher eukaryotes including humans. This conservation is illustrated by the fact that the mammalian stress-responsive p38 MAPK can rescue the osmosensitivity of hog1Δ mutations in response to hyperosmotic challenge. As the HOG pathway is one of the best-understood eukaryotic signal transduction pathways, it is useful not only as a model for analysis of osmostress responses, but also as a model for mathematical analysis of signal transduction pathways. In this review, we have summarized the current understanding of both the upstream signaling mechanism and the downstream adaptive responses to hyperosmotic stress in yeast. PMID:23028184

  16. ChIP-seq analysis of the σE regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response

    DOE PAGES

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...

    2015-09-21

    The alternative sigma factor σE functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σE in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σE–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σE–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cell division factor, and amore » signal transduction modulator. The consensus sequence identified for σE in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σE–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σE modulates transcription. By dissecting direct and indirect modes of σE-mediated regulation, we found that σE activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σE regulated genes (greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  17. ChIP-Seq Analysis of the σE Regulon of Salmonella enterica Serovar Typhimurium Reveals New Genes Implicated in Heat Shock and Oxidative Stress Response

    SciTech Connect

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; Jones, Marcus B.; McDermott, Jason E.; Heffron, Fred; Adkins, Joshua N.; Cambronne, Eric D.; Hensel, Michael

    2015-09-21

    The alternative sigma factor σE functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σE in Salmonella and E. colihas been examined using microarray, however a genome-wide analysis of σE–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σE–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cell division factor, and a signal transduction modulator. The consensus sequence identified for σE in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σE–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σE modulates transcription. By dissecting direct and indirect modes of σE-mediated regulation, we found that σE activates gene expression through recognition of both canonical and reversed consensus sequence. New σEregulated genes (greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.

  18. Unraveling regulation of the small heat shock proteins by the heat shock factor HvHsfB2c in barley: its implications in drought stress response and seed development.

    PubMed

    Reddy, Palakolanu Sudhakar; Kavi Kishor, Polavarapu B; Seiler, Christiane; Kuhlmann, Markus; Eschen-Lippold, Lennart; Lee, Justin; Reddy, Malireddy K; Sreenivasulu, Nese

    2014-01-01

    The rapid increase in heat shock proteins upon exposure to damaging stresses and during plant development related to desiccation events reveal their dual importance in plant development and stress tolerance. Genome-wide sequence survey identified 20 non-redundant small heat shock proteins (sHsp) and 22 heat shock factor (Hsf) genes in barley. While all three major classes (A, B, C) of Hsfs are localized in nucleus, the 20 sHsp gene family members are localized in different cell organelles like cytoplasm, mitochondria, plastid and peroxisomes. Hsf and sHsp members are differentially regulated during drought and at different seed developmental stages suggesting the importance of chaperone role under drought as well as seed development. In silico cis-regulatory motif analysis of Hsf promoters showed an enrichment with abscisic acid responsive cis-elements (ABRE), implying regulatory role of ABA in mediating transcriptional response of HvsHsf genes. Gene regulatory network analysis identified HvHsfB2c as potential central regulator of the seed-specific expression of several HvsHsps including 17.5CI sHsp. These results indicate that HvHsfB2c is co-expressed in the central hub of small Hsps and therefore it may be regulating the expression of several HvsHsp subclasses HvHsp16.88-CI, HvHsp17.5-CI and HvHsp17.7-CI. The in vivo relevance of binding specificity of HvHsfB2C transcription factor to HSE-element present in the promoter of HvSHP17.5-CI under heat stress exposure is confirmed by gel shift and LUC-reporter assays. Further, we isolated 477 bp cDNA from barley encoding a 17.5 sHsp polypeptide, which was predominantly upregulated under drought stress treatments and also preferentially expressed in developing seeds. Recombinant HvsHsp17.5-CI protein was expressed in E. coli and purified to homogeneity, which displayed in vitro chaperone activity. The predicted structural model of HvsHsp-17.5-CI protein suggests that the α-crystallin domain is evolutionarily highly

  19. Real-time cell analysis and heat shock protein gene expression in the TcA Tribolium castaneum cell line in response to environmental stress conditions.

    PubMed

    García-Reina, Andrés; Rodríguez-García, María Juliana; Ramis, Guillermo; Galián, José

    2017-06-01

    The rust red flour beetle, Tribolium castaneum (Herbst, 1797) (Coleoptera: Tenebrionidae), is a pest of stored grain and one of the most studied insect model species. Some of the previous studies involved heat response studies in terms of survival and heat shock protein expression, which are regulated to protect other proteins against environmental stress conditions. In the present study, we characterize the impedance profile with the xCELLigence Real-Time Cell Analyzer and study the effect of increased temperature in cell growth and viability in the cell line BCIRL-TcA-CLG1 (TcA) of T. castaneum. This novel system measures cells behavior in real time and is applied for the first time to insect cells. Additionally, cells are exposed to heat shock, increased salinity, acidic pH and UV-A light with the aim of measuring the expression levels of Hsp27, Hsp68a, and Hsp83 genes. Results show a high thermotolerance of TcA in terms of cell growth and viability. This result is likely related to gene expression results in which a significant up-regulation of all studied Hsp genes is observed after 1 h of exposure to 40 °C and UV light. All 3 genes show similar expression patterns, but Hsp27 seems to be the most affected. The results of this study validate the RTCA method and reveal the utility of insect cell lines, real-time analysis and gene expression studies to better understand the physiological response of insect cells, with potential applications in different fields of biology such as conservation biology and pest management. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  20. Mechanisms of orthostatic intolerance during heat stress.

    PubMed

    Schlader, Zachary J; Wilson, Thad E; Crandall, Craig G

    2016-04-01

    Heat stress profoundly and unanimously reduces orthostatic tolerance. This review aims to provide an overview of the numerous and multifactorial mechanisms by which this occurs in humans. Potential causal factors include changes in arterial and venous vascular resistance and blood distribution, and the modulation of cardiac output, all of which contribute to the inability to maintain cerebral perfusion during heat and orthostatic stress. A number of countermeasures have been established to improve orthostatic tolerance during heat stress, which alleviate heat stress induced central hypovolemia (e.g., volume expansion) and/or increase peripheral vascular resistance (e.g., skin cooling). Unfortunately, these countermeasures can often be cumbersome to use with populations prone to syncopal episodes. Identifying the mechanisms of inter-individual differences in orthostatic intolerance during heat stress has proven elusive, but could provide greater insights into the development of novel and personalized countermeasures for maintaining or improving orthostatic tolerance during heat stress. This development will be especially impactful in occuational settings and clinical situations that present with orthostatic intolerance and/or central hypovolemia. Such investigations should be considered of vital importance given the impending increased incidence of heat events, and associated cardiovascular challenges that are predicted to occur with the ensuing changes in climate. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Mechanisms of orthostatic intolerance during heat stress

    PubMed Central

    Schlader, Zachary J.; Wilson, Thad E.; Crandall, Craig G.

    2017-01-01

    Heat stress profoundly and unanimously reduces orthostatic tolerance. This review aims to provide an overview of the numerous and multifactorial mechanisms by which this occurs in humans. Potential causal factors include changes in arterial and venous vascular resistance and blood distribution, and the modulation of cardiac output, all of which contribute to the inability to maintain cerebral perfusion during heat and orthostatic stress. A number of countermeasures have been established to improve orthostatic tolerance during heat stress, which alleviate heat stress induced central hypovolemia (e.g., volume expansion) and/or increase peripheral vascular resistance (e.g., skin cooling). Unfortunately, these countermeasures can often be cumbersome to use with populations prone to syncopal episodes. Identifying the mechanisms of inter-individual differences in orthostatic intolerance during heat stress has proven elusive, but could provide greater insights into the development of novel and personalized countermeasures for maintaining or improving orthostatic tolerance during heat stress. This development will be especially impactful in occuational settings and clinical situations that present with orthostatic intolerance and/or central hypovolemia. Such investigations should be considered of vital importance given the impending increased incidence of heat events, and associated cardiovascular challenges that are predicted to occur with the ensuing changes in climate. PMID:26723547

  2. Molecular cloning of heat shock protein 60 (PtHSP60) from Portunus trituberculatus and its expression response to salinity stress.

    PubMed

    Xu, Qianghua; Qin, Ye

    2012-09-01

    Heat shock protein 60 (HSP60) is a highly conserved and multi-functional molecular chaperone that plays an essential role in both cellular metabolism and stress response. Portunus trituberculatus is an important marine fishery and aquaculture species, and water salinity condition influenced its artificial propagations significantly. In order to investigate the function of P. trituberculatus HSP60 against osmotic stress, P. trituberculatus HSP60 gene was firstly cloned. The full-length cDNA of PtHSP60 contains 1,743 nucleotides encoding 577 amino acids with a calculated molecular weight of 61.25 kDa. Multiple alignments indicated that the deduced amino acid sequences of PtHSP60 shared a high level of identity with invertebrate and vertebrate HSP60 sequence including shrimp, fruit fly, zebrafish, and human. The expression profiles of PtHSP60 at mRNA and protein levels under salinity treatment were investigated by semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blot analysis, respectively. It was found that the mRNA transcripts of PtHSP60 gene varied among different tissues under normal salinity conditions, and the antennal gland showed the highest expression level among the tissues tested. As for low salinity challenge, the mRNA expression of PtHSP60 gene was higher in the gill and appendicular muscle compared with other tissues, and gill and hypodermis represented the higher gene expressions during the hyperosmotic stress, which indicated that those tissues were salinity-sensitive tissues. In addition, salinity challenges significantly altered the expression of PtHSP60 at mRNA and protein level in a salinity- and time-dependent manner in P. trituberculatus gill tissue. The results indicate that PtHSP60 played important roles in mediating the salinity stress in P. trituberculatus.

  3. Biophysical aspects of human thermoregulation during heat stress.

    PubMed

    Cramer, Matthew N; Jay, Ollie

    2016-04-01

    Humans maintain a relatively constant core temperature through the dynamic balance between endogenous heat production and heat dissipation to the surrounding environment. In response to metabolic or environmental disturbances to heat balance, the autonomic nervous system initiates cutaneous vasodilation and eccrine sweating to facilitate higher rates of dry (primarily convection and radiation) and evaporative transfer from the body surface; however, absolute heat losses are ultimately governed by the properties of the skin and the environment. Over the duration of a heat exposure, the cumulative imbalance between heat production and heat dissipation leads to body heat storage, but the consequent change in core temperature, which has implications for health and safety in occupational and athletic settings particularly among certain clinical populations, involves a complex interaction between changes in body heat content and the body's morphological characteristics (mass, surface area, and tissue composition) that collectively determine the body's thermal inertia. The aim of this review is to highlight the biophysical aspects of human core temperature regulation by outlining the principles of human energy exchange and examining the influence of body morphology during exercise and environmental heat stress. An understanding of the biophysical factors influencing core temperature will enable researchers and practitioners to better identify and treat individuals/populations most vulnerable to heat illness and injury during exercise and extreme heat events. Further, appropriate guidelines may be developed to optimize health, safety, and work performance during heat stress.

  4. Identification of multiple small heat-shock protein genes in Plutella xylostella (L.) and their expression profiles in response to abiotic stresses.

    PubMed

    Chen, Xi'en; Zhang, Yalin

    2015-01-01

    We identify and characterize 14 small heat-shock protein (sHSP) genes from the diamondback moth (DBM), Plutella xylostella (L.), a destructive pest. Phylogenetic analyses indicate that, except for sHSP18.8 and sHSP19.22, the other 12 DBM sHSPs belong to five known insect sHSP groups. Developmental expression analysis revealed that most sHSPs peaked in the pupal and adult stages. The transcripts of sHSPs display tissue specificity with two exhibiting constitutive expression in four tested tissues. Expression of sHSP18.8 in fourth instar larvae is not induced by the tested abiotic stressors, and unless sHSP21.8 is not sensitive to thermal stress, 12 sHSPs are significantly up-regulated. The messenger RNA (mRNA) levels of all sHSPs are reduced under oxidative stress. Food deprivation leads to significant down-regulation of three sHSPs. The majority of sHSPs show expression variation to various heavy metals, whereas mRNA abundances of sHSP22.1 and sHSP 28.9 are reduced by four heavy metals. The responses of sHSPs to indoxacarb and cantharidin are varied. Beta-cypermethrin and chlorfenapyr exposure results in an increase of 13 sHSP transcripts and a reduction of 12 sHSP transcripts, respectively. These results show that different sHSPs might play distinct roles in the development and regulation of physiological activities, as well as in response to various abiotic stresses of DBM.

  5. Heat stress protects against mechanical ventilation-induced diaphragmatic atrophy.

    PubMed

    Ichinoseki-Sekine, Noriko; Yoshihara, Toshinori; Kakigi, Ryo; Sugiura, Takao; Powers, Scott K; Naito, Hisashi

    2014-09-01

    Mechanical ventilation (MV) is a life-saving intervention in patients who are incapable of maintaining adequate pulmonary gas exchange due to respiratory failure or other disorders. However, prolonged MV is associated with the development of respiratory muscle weakness. We hypothesized that a single exposure to whole body heat stress would increase diaphragm expression of heat shock protein 72 (HSP72) and that this treatment would protect against MV-induced diaphragmatic atrophy. Adult male Wistar rats (n = 38) were randomly assigned to one of four groups: an acutely anesthetized control group (CON) with no MV; 12-h controlled MV group (CMV); 1-h whole body heat stress (HS); or 1-h whole body heat stress 24 h prior to 12-h controlled MV (HSMV). Compared with CON animals, diaphragmatic HSP72 expression increased significantly in the HS and HSMV groups (P < 0.05). Prolonged MV resulted in significant atrophy of type I, type IIa, and type IIx fibers in the costal diaphragm (P < 0.05). Whole body heat stress attenuated this effect. In contrast, heat stress did not protect against MV-induced diaphragm contractile dysfunction. The mechanisms responsible for this heat stress-induced protection remain unclear but may be linked to increased expression of HSP72 in the diaphragm. Copyright © 2014 the American Physiological Society.

  6. Proteasome stress responses in Schistosoma mansoni.

    PubMed

    de Paula, Renato Graciano; de Magalhães Ornelas, Alice Maria; Morais, Enyara Rezende; de Souza Gomes, Matheus; de Paula Aguiar, Daniela; Magalhães, Lizandra Guidi; Rodrigues, Vanderlei

    2015-05-01

    The proteasome proteolytic system is the major ATP-dependent protease in eukaryotic cells responsible for intracellular protein turnover. Schistosoma mansoni has been reported to contain an ubiquitin-proteasome proteolytic pathway, and many studies have suggested a biological role of proteasomes in the development of this parasite. Additionally, evidence has suggested diversity in proteasome composition under several cellular conditions, and this might contribute to the regulation of its function in this parasite. The proteasomal system has been considered important to support the protein homeostasis during cellular stress. In this study, we described in vitro effects of oxidative stress, heat shock, and chemical stress on S. mansoni adults. Our findings showed that chemical stress induced with curcumin, IBMX, and MG132 modified the gene expression of the proteasomal enzymes SmHul5 and SmUbp6. Likewise, the expression of these genes was upregulated during oxidative stress and heat shock. Analyses of the S. mansoni life cycle showed differential gene expression in sporocysts, schistosomulae, and miracidia. These results suggested that proteasome accessory proteins participate in stress response during the parasite development. The expression level of SmHul5 and SmUbp6 was decreased by 16-fold and 9-fold, respectively, by the chemical stress induced with IBMX, which suggests proteasome disassembly. On the other hand, curcumin, MG132, oxidative stress, and heat shock increased the expression of these genes. Furthermore, the gene expression of maturation proteasome protein (SmPOMP) was increased in stress conditions induced by curcumin, MG132, and H₂O₂, which could be related to the synthesis of new proteasomes. S. mansoni adult worms were found to utilize similar mechanisms to respond to different conditions of stress. Our results demonstrated that oxidative stress, heat shock, and chemical stress modified the expression profile of genes related to the ubiquitin

  7. Invited review: Effects of heat stress on dairy cattle welfare.

    PubMed

    Polsky, Liam; von Keyserlingk, Marina A G

    2017-09-13

    The effects of high ambient temperatures on production animals, once thought to be limited to tropical areas, has extended into northern latitudes in response to the increasing global temperature. The number of days where the temperature-humidity index (THI) exceeds the comfort threshold (>72) is increasing in the northern United States, Canada, and Europe. Compounded by the increasing number of dairy animals and the intensification of production, heat stress has become one of the most important challenges facing the dairy industry today. The objectives of this review were to present an overview of the effects of heat stress on dairy cattle welfare and highlight important research gaps in the literature. We will also briefly discuss current heat abatement strategies, as well as the sustainability of future heat stress management. Heat stress has negative effects on the health and biological functioning of dairy cows through depressed milk production and reduced reproductive performance. Heat stress can also compromise the affective state of dairy cows by inducing feelings of hunger and thirst, and we have highlighted the need for research efforts to examine the potential relationship between heat stress, frustration, aggression, and pain. Little work has examined how heat stress affects an animal's natural coping behaviors, as well as how the animal's evolutionary adaptations for thermoregulation are managed in modern dairy systems. More research is needed to identify improved comprehensive cow-side measurements that can indicate real-time responses to elevated ambient temperatures and that could be incorporated into heat abatement management decisions. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

  8. A virtual rat for simulating environmental and exertional heat stress.

    PubMed

    Rakesh, Vineet; Stallings, Jonathan D; Reifman, Jaques

    2014-12-01

    Severe cases of environmental or exertional heat stress can lead to varying degrees of organ dysfunction. To understand heat-injury progression and develop efficient management and mitigation strategies, it is critical to determine the thermal response in susceptible organs under different heat-stress conditions. To this end, we used our previously published virtual rat, which is capable of computing the spatiotemporal temperature distribution in the animal, and extended it to simulate various heat-stress scenarios, including 1) different environmental conditions, 2) exertional heat stress, 3) circadian rhythm effect on the thermal response, and 4) whole body cooling. Our predictions were consistent with published in vivo temperature measurements for all cases, validating our simulations. We observed a differential thermal response in the organs, with the liver experiencing the highest temperatures for all environmental and exertional heat-stress cases. For every 3°C rise in the external temperature from 40 to 46°C, core and organ temperatures increased by ∼0.8°C. Core temperatures increased by 2.6 and 4.1°C for increases in exercise intensity from rest to 75 and 100% of maximal O2 consumption, respectively. We also found differences as large as 0.8°C in organ temperatures for the same heat stress induced at different times during the day. Even after whole body cooling at a relatively low external temperature (1°C for 20 min), average organ temperatures were still elevated by 2.3 to 2.5°C compared with normothermia. These results can be used to optimize experimental protocol designs, reduce the amount of animal experimentation, and design and test improved heat-stress prevention and management strategies.

  9. Heat stress in grapevine: the pros and cons of acclimation.

    PubMed

    Carvalho, Luísa C; Coito, João L; Colaço, Silvana; Sangiogo, Maurício; Amâncio, Sara

    2015-04-01

    Heat stress is a major limiting factor of grapevine production and quality. Acclimation and recovery are essential to ensure plant survival, and the recovery mechanisms can be independent of the heat response mechanisms. An experimental set up with and without acclimation to heat followed by recovery [stepwise acclimation and recovery (SAR) and stepwise recovery (SR), respectively] was applied to two grapevine varieties, Touriga Nacional (TN), and Trincadeira (TR), with different tolerance to abiotic stress. Major differences were found between leaves of SAR and SR, especially after recovery; in SAR, almost all parameters returned to basal levels while in SR they remained altered. Acclimation led to a swifter and short-term antioxidative response, affecting the plant to a lesser extent than SR. Significant differences were found among varieties: upon stress, TN significantly increased ascorbate and glutathione reduction levels, boosting the cell's redox-buffering capacity, while TR needed to synthesize both metabolites, its response being insufficient to keep the redox state at working levels. TR was affected by stress for a longer period and the up-regulation pattern of antioxidative stress genes was more obvious. In TN, heat shock proteins were significantly induced, but the canonical heat-stress gene signature was not evident probably because no shutdown of the housekeeping metabolism was needed.

  10. Heat Stress and Baroreflex Regulation of Blood Pressure

    PubMed Central

    CRANDALL, CRAIG G.

    2010-01-01

    In healthy, noninjured, individuals, passive (i.e., nonexercising) whole-body heating has the potential to cause significant cardiovascular stress that may be second only to the cardiovascular stress associated with exercise. For example, such a heat stress can increase heart rate to well over 100 beats·min−1 with cardiac output increasing upward to 13 L·min−1. This increase in cardiac output is necessary to maintain blood pressure due to profound reductions in total vascular conductance associated with cutaneous vasodilation. These responses are accompanied with elevations in sympathetic activity and reductions in vascular conductance (i.e., increased vascular resistance) from noncutaneous beds. While heat-stressed, blood pressure control is compromised resulting in orthostatic intolerance. A plausible explanation for such an event is that heat stress impairs baroreflex responsiveness perhaps due to the reduced range by which baroreflexes can increase heart rate, cardiac output, sympathetic activity, and vascular resistance during a hypotensive challenge. Given that dynamic exercise has the potential to cause large increases in internal temperature, possibly a component of the response to exercise, with respect to baroreflex control of blood pressure, may be affected by the thermal load during the exercise bout. Within this context, the purpose of this review was to summarize findings investigating the effects of heat stress on baroreflex regulation of blood pressure. PMID:18981943

  11. Heat stress and baroreflex regulation of blood pressure.

    PubMed

    Crandall, Craig G

    2008-12-01

    In healthy, noninjured, individuals, passive (i.e., nonexercising) whole-body heating has the potential to cause significant cardiovascular stress that may be second only to the cardiovascular stress associated with exercise. For example, such a heat stress can increase heart rate to well over 100 beats min(-1) with cardiac output increasing upward to 13 L min(-1). This increase in cardiac output is necessary to maintain blood pressure due to profound reductions in total vascular conductance associated with cutaneous vasodilation. These responses are accompanied with elevations in sympathetic activity and reductions in vascular conductance (i.e., increased vascular resistance) from noncutaneous beds. While heat-stressed, blood pressure control is compromised resulting in orthostatic intolerance. A plausible explanation for such an event is that heat stress impairs baroreflex responsiveness perhaps due to the reduced range by which baroreflexes can increase heart rate, cardiac output, sympathetic activity, and vascular resistance during a hypotensive challenge. Given that dynamic exercise has the potential to cause large increases in internal temperature, possibly a component of the response to exercise, with respect to baroreflex control of blood pressure, may be affected by the thermal load during the exercise bout. Within this context, the purpose of this review was to summarize findings investigating the effects of heat stress on baroreflex regulation of blood pressure.

  12. Effect of prenatal temperature conditioning of laying hen embryos: Hatching, live performance and response to heat and cold stress during laying period.

    PubMed

    Kamanli, S; Durmuş, I; Yalçın, S; Yıldırım, U; Meral, Ö

    2015-07-01

    This study was designed to determine the effect of prenatal temperature conditioning on hatching and live performance of laying chickens, and response to heat and cold stress during laying period. A total of 3600 eggs obtained from ATAK-S brown parent stock were incubated at control (37.5°C, CONT-Inc), cyclic low (36.5°C/6h/d from 10 to 18d of incubation, LOW-Inc) or high (38.5°C/6h/d from 10-18d of incubation, HIGH-Inc) incubation temperatures. Hatched chicks per incubation temperature were reared under standard rearing conditions up to 26wk. From 27 to 30wk, hens from each incubation temperature were divided into 3 environmentally controlled rooms and reared at control (20±2°C, CONT-Room), low (12±2°C, COLDS) or high (32±2°C, HEATS) temperatures. Hatching performance, body weight, egg production, and plasma triiodothyronine (T3) and thyroxine (T4) levels and oxidant and antioxidant activities were evaluated. The highest hatchability was for LOW-Inc chicks while HIGH-Inc chick had similar hatchability to CONT-Inc. There was no effect of incubation temperatures on plasma MDA, GSH-Px, activities and T4 concentrations on day of hatch. LOW- Inc chicks had higher SOD activities and T3 concentrations compared to the other groups. Although chick weight was similar among incubation temperature groups, CONT-Inc chicks were heavier than those cyclic incubation temperature groups until 12wk of age. Incubation temperature had no effect on sexual maturity age and weight and egg production of laying hens. From 27 to 30wk, regardless of incubation temperature, HEATS hens lost weight from day 0 to 10, had the highest cloacal temperatures and lowest feed consumption and egg production while COLDS hens had the lowest cloacal temperatures. At day 5, T4 level was higher in LOW-Inc hens at COLDS but it was higher in HIGH-Inc hens at HEATS compared to CONT-Inc. These data may suggest a modification in thyroid activity of hens that were conditioned during the incubation period

  13. Systems-Wide Analysis of Acclimation Responses to Long-Term Heat Stress and Recovery in the Photosynthetic Model Organism Chlamydomonas reinhardtii[W][OPEN

    PubMed Central

    Hemme, Dorothea; Veyel, Daniel; Mühlhaus, Timo; Sommer, Frederik; Jüppner, Jessica; Unger, Ann-Katrin; Sandmann, Michael; Fehrle, Ines; Schönfelder, Stephanie; Steup, Martin; Geimer, Stefan; Kopka, Joachim; Giavalisco, Patrick; Schroda, Michael

    2014-01-01

    We applied a top-down systems biology approach to understand how Chlamydomonas reinhardtii acclimates to long-term heat stress (HS) and recovers from it. For this, we shifted cells from 25 to 42°C for 24 h and back to 25°C for ≥8 h and monitored abundances of 1856 proteins/protein groups, 99 polar and 185 lipophilic metabolites, and cytological and photosynthesis parameters. Our data indicate that acclimation of Chlamydomonas to long-term HS consists of a temporally ordered, orchestrated implementation of response elements at various system levels. These comprise (1) cell cycle arrest; (2) catabolism of larger molecules to generate compounds with roles in stress protection; (3) accumulation of molecular chaperones to restore protein homeostasis together with compatible solutes; (4) redirection of photosynthetic energy and reducing power from the Calvin cycle to the de novo synthesis of saturated fatty acids to replace polyunsaturated ones in membrane lipids, which are deposited in lipid bodies; and (5) when sinks for photosynthetic energy and reducing power are depleted, resumption of Calvin cycle activity associated with increased photorespiration, accumulation of reactive oxygen species scavengers, and throttling of linear electron flow by antenna uncoupling. During recovery from HS, cells appear to focus on processes allowing rapid resumption of growth rather than restoring pre-HS conditions. PMID:25415976

  14. Cytotoxicity of withaferin A in glioblastomas involves induction of an oxidative stress-mediated heat shock response while altering Akt/mTOR and MAPK signaling pathways.

    PubMed

    Grogan, Patrick T; Sleder, Kristina D; Samadi, Abbas K; Zhang, Huaping; Timmermann, Barbara N; Cohen, Mark S

    2013-06-01

    Withaferin A (WA), a steroidal lactone derived from the plant Vassobia breviflora, has been reported to have anti-proliferative, pro-apoptotic, and anti-angiogenic properties against cancer growth. In this study, we identified several key underlying mechanisms of anticancer action of WA in glioblastoma cells. WA was found to inhibit proliferation by inducing a dose-dependent G2/M cell cycle arrest and promoting cell death through both intrinsic and extrinsic apoptotic pathways. This was accompanied by an inhibitory shift in the Akt/mTOR signaling pathway which included diminished expression and/or phosphorylation of Akt, mTOR, p70 S6K, and p85 S6K with increased activation of AMPKα and the tumor suppressor tuberin/TSC2. Alterations in proteins of the MAPK pathway and cell surface receptors like EGFR, Her2/ErbB2, and c-Met were also observed. WA induced an N-acetyl-L-cysteine-repressible enhancement in cellular oxidative potential/stress with subsequent induction of a heat shock stress response primarily through HSP70, HSP32, and HSP27 upregulation and HSF1 downregulation. Taken together, we suggest that WA may represent a promising chemotherapeutic candidate in glioblastoma therapy warranting further translational evaluation.

  15. Increased extracellular heat shock protein 90α in severe sepsis and SIRS associated with multiple organ failure and related to acute inflammatory-metabolic stress response in children

    PubMed Central

    Fitrolaki, Michaela-Diana; Dimitriou, Helen; Venihaki, Maria; Katrinaki, Marianna; Ilia, Stavroula; Briassoulis, George

    2016-01-01

    Abstract Mammalian heat-shock-protein (HSP) 90α rapidly responses to environmental insults. We examined the hypothesis that not only serum HSP72 but also HSP90α is increased in the systemic inflammatory response syndrome (SIRS), severe-sepsis (SS), and/or sepsis (S) compared to healthy children (H); we assessed HSP90α relation to (a) multiple organ system failure (MOSF) and (b) inflammatory-metabolic response and severity of illness. A total of 65 children with S, SS, or SIRS and 25 H were included. ELISA was used to evaluate extracellular HSP90α and HSP72, chemiluminescence interleukins (ILs), flow-cytometry neutrophil-CD64 (nCD64)-expression. HSP90α, along with HSP72, were dramatically increased among MOSF patients. Patients in septic groups and SIRS had elevated HSP90α compared to H (P < 0.01). HSP90α was independently related to predicted death rate and severity of illness; positively to HSP72, nCD64, ILs, length of stay, days on ventilator, and fever; negatively to HDL and LDL (P < 0.05). The HSP72 was increased in SS/S and related negatively to HDL and LDL (P < 0.05). Serum HSP90α is markedly elevated in children with severe sepsis and is associated with MOSF. Better than the HSP72, also increased in SS, SIRS, and MOSF, HSP90α is related to the inflammatory stress, fever, outcome endpoints, and predicted mortality and inversely related to the low-LDL/low-HDL stress metabolic pattern. PMID:27583886

  16. Increased extracellular heat shock protein 90α in severe sepsis and SIRS associated with multiple organ failure and related to acute inflammatory-metabolic stress response in children.

    PubMed

    Fitrolaki, Michaela-Diana; Dimitriou, Helen; Venihaki, Maria; Katrinaki, Marianna; Ilia, Stavroula; Briassoulis, George

    2016-08-01

    Mammalian heat-shock-protein (HSP) 90α rapidly responses to environmental insults. We examined the hypothesis that not only serum HSP72 but also HSP90α is increased in the systemic inflammatory response syndrome (SIRS), severe-sepsis (SS), and/or sepsis (S) compared to healthy children (H); we assessed HSP90α relation to (a) multiple organ system failure (MOSF) and (b) inflammatory-metabolic response and severity of illness.A total of 65 children with S, SS, or SIRS and 25 H were included. ELISA was used to evaluate extracellular HSP90α and HSP72, chemiluminescence interleukins (ILs), flow-cytometry neutrophil-CD64 (nCD64)-expression.HSP90α, along with HSP72, were dramatically increased among MOSF patients. Patients in septic groups and SIRS had elevated HSP90α compared to H (P < 0.01). HSP90α was independently related to predicted death rate and severity of illness; positively to HSP72, nCD64, ILs, length of stay, days on ventilator, and fever; negatively to HDL and LDL (P < 0.05). The HSP72 was increased in SS/S and related negatively to HDL and LDL (P < 0.05).Serum HSP90α is markedly elevated in children with severe sepsis and is associated with MOSF. Better than the HSP72, also increased in SS, SIRS, and MOSF, HSP90α is related to the inflammatory stress, fever, outcome endpoints, and predicted mortality and inversely related to the low-LDL/low-HDL stress metabolic pattern.

  17. Stress Responses of Shewanella

    PubMed Central

    Yin, Jianhua; Gao, Haichun

    2011-01-01

    The shewanellae are ubiquitous in aquatic and sedimentary systems that are chemically stratified on a permanent or seasonal basis. In addition to their ability to utilize a diverse array of terminal electron acceptors, the microorganisms have evolved both common and unique responding mechanisms to cope with various stresses. This paper focuses on the response and adaptive mechanism of the shewanellae, largely based on transcriptional data. PMID:21912550

  18. Heat Stress in Older Adults

    MedlinePlus

    ... Centers Extreme Heat PSAs Related Links MMWR Bibliography Floods Flood Readiness Personal Hygiene After a Disaster Reentering Your Flooded Home Cleanup of Flood Water After a Flood Worker Safety Educational Materials ...

  19. Thermometry, calorimetry, and mean body temperature during heat stress.

    PubMed

    Kenny, Glen P; Jay, Ollie

    2013-10-01

    Heat balance in humans is maintained at near constant levels through the adjustment of physiological mechanisms that attain a balance between the heat produced within the body and the heat lost to the environment. Heat balance is easily disturbed during changes in metabolic heat production due to physical activity and/or exposure to a warmer environment. Under such conditions, elevations of skin blood flow and sweating occur via a hypothalamic negative feedback loop to maintain an enhanced rate of dry and evaporative heat loss. Body heat storage and changes in core temperature are a direct result of a thermal imbalance between the rate of heat production and the rate of total heat dissipation to the surrounding environment. The derivation of the change in body heat content is of fundamental importance to the physiologist assessing the exposure of the human body to environmental conditions that result in thermal imbalance. It is generally accepted that the concurrent measurement of the total heat generated by the body and the total heat dissipated to the ambient environment is the most accurate means whereby the change in body heat content can be attained. However, in the absence of calorimetric methods, thermometry is often used to estimate the change in body heat content. This review examines heat exchange during challenges to heat balance associated with progressive elevations in environmental heat load and metabolic rate during exercise. Further, we evaluate the physiological responses associated with heat stress and discuss the thermal and nonthermal influences on the body's ability to dissipate heat from a heat balance perspective.

  20. Heat Shock Protein 70 and 90 Genes in the Harmful Dinoflagellate Cochlodinium polykrikoides: Genomic Structures and Transcriptional Responses to Environmental Stresses

    PubMed Central

    Guo, Ruoyu; Youn, Seok Hyun; Ki, Jang-Seu

    2015-01-01

    The marine dinoflagellate Cochlodinium polykrikoides is responsible for harmful algal blooms in aquatic environments and has spread into the world's oceans. As a microeukaryote, it seems to have distinct genomic characteristics, like gene structure and regulation. In the present study, we characterized heat shock protein (HSP) 70/90 of C. polykrikoides and evaluated their transcriptional responses to environmental stresses. Both HSPs contained the conserved motif patterns, showing the highest homology with those of other dinoflagellates. Genomic analysis showed that the CpHSP70 had no intron but was encoded by tandem arrangement manner with separation of intergenic spacers. However, CpHSP90 had one intron in the coding genomic regions, and no intergenic region was found. Phylogenetic analyses of separate HSPs showed that CpHSP70 was closely related with the dinoflagellate Crypthecodinium cohnii and CpHSP90 with other Gymnodiniales in dinoflagellates. Gene expression analyses showed that both HSP genes were upregulated by the treatments of separate algicides CuSO4 and NaOCl; however, they displayed downregulation pattern with PCB treatment. The transcription of CpHSP90 and CpHSP70 showed similar expression patterns under the same toxicant treatment, suggesting that both genes might have cooperative functions for the toxicant induced gene regulation in the dinoflagellate. PMID:26064872

  1. Ameliorative effect of synthetic γ-aminobutyric acid (GABA) on performance traits, antioxidant status and immune response in broiler exposed to cyclic heat stress.

    PubMed

    Chand, Naila; Muhammad, Sher; Khan, Rifat Ullah; Alhidary, Ibrahim Abdullah; Rehman, Zia Ur

    2016-12-01

    The aim of this study was to find the effect of synthetic γ-aminobutyric acid (GABA) on the performance, antioxidant status, and immune response in broiler exposed to summer stress. A total of 400-day-old male broiler chickens (Ross 308) was randomly distributed into five treatments (5 replicates). One group served as a control (basal diet only) while the others were supplemented with GABA at the rate of 25 (GABA-25), 50 (GABA 50), 75 (GABA-75), and 100 (GABA-100) mg/kg feed. The experiment was continued for 35 days. Feed intake during the third week was significantly higher (P < 0.05) in GABA-75 and GABA-100, however, it increased significantly (P < 0.05) in GABA-100 during the fourth and fifth week. Overall mean feed intake was significantly (P < 0.05) high in GABA-75 and GABA-100. From the results, we found that body weight improved significantly (P < 0.05) in GABA-50 in week-3. During the fourth, fifth, and overall, body weight increased significantly (P < 0.05) in GABA-100. Significantly, high (P < 0.05) feed conversion ratio (FCR) was found in GABA-100 during the third, fourth, fifth, and on an overall basis. Mean Malondialdehyde (MDA) decreased significantly (P < 0.05) in GABA-100 while Paraoxonase (PON1) and Newcastle disease (ND) titer increased significantly (P < 0.05) in the same group. We concluded that performance traits, antioxidant status, and immune response improved in broiler supplemented 100 mg/kg GABA, exposed to cyclic heat stress.

  2. Immune responses and stress resistance in red sea bream, Pagrus major, after oral administration of heat-killed Lactobacillus plantarum and vitamin C.

    PubMed

    Dawood, Mahmoud A O; Koshio, Shunsuke; Ishikawa, Manabu; Yokoyama, Saichiro

    2016-07-01

    The present study evaluated the interactive benefits of dietary administration of heat-killed Lactobacillus plantarum (LP) and vitamin C (VC) on the growth, oxidative status and immune response of red sea bream (Pagrus major). A diet without LP and VC supplements was employed as a control diet. Four other test diets with 0 or 1 g LP kg(-1) combined with 0.5 or 1 g VC kg(-1) (2 × 2 factorial design) were fed to red sea bream (2 ± 0.01 g) for 56 days. A significant interaction was found between LP and VC on final body weight (FNW), weight gain (WG), hematocrit (HCT), serum bactericidal (BA) and lysozyme (LZY) activities, mucus LZY and peroxidase (PA) activities, nitro blue tetrazolium (NBT), catalase, mucus secretion and tolerance against low salinity stress test (LT50) (P < 0.05). In addition, FNW, WG, specific growth rate, feed and protein efficiency ratio, serum (BA, LZY, PA and NBT), mucus (LZY and PA), superoxide dismutase, malondialdehyde and mucus secretion were significantly affected by either LP or VC (P < 0.05). Furthermore, only LP was a significant factor on survival, plasma total cholesterol, mucus BA and alternative complement pathway (P < 0.05). However, VC supplementation affected on HCT and LT50. Interestingly, fish fed with both LP at 1 g kg(-1) diet with VC at 0.5 or 1 g kg(-1) diet showed higher growth, humoral and mucosal immune responses, anti-oxidative status, mucus secretion and LT50 as well as decreased plasma, triglyceride and total cholesterol levels than the fish fed control diet (P < 0.05). These results demonstrated that dietary LP and VC had a significant interaction for red sea bream with the capability of improving growth performance and enhancing stress resistance by immunomodulation.

  3. Expression of AeaHsp26 and AeaHsp83 in Aedes aegypti (Diptera: Culicidae) Larvae and Pupae in Response to Heat Shock Stress

    DTIC Science & Technology

    2010-05-01

    toprotect and enhance survival of Ae. aegypti larvae and pupae . KEY WORDS heat shock, Aedes aegypti, gene expression, larvae, development Temperatures...MOLECULAR BIOLOGY/GENOMICS Expression of AeaHsp26 and AeaHsp83 in Aedes aegypti (Diptera: Culicidae) Larvae and Pupae in Response to Heat Shock...how heat shock proteins are developmentally expressed in mosquitoes, we subjected Þrst instar larvae, 16-h old pupae and female of Aedes aegypti (L

  4. Heat Stress and Cardiovascular, Hormonal, and Heat Shock Proteins in Humans

    PubMed Central

    Iguchi, Masaki; Littmann, Andrew E.; Chang, Shuo-Hsiu; Wester, Lydia A.; Knipper, Jane S.; Shields, Richard K.

    2012-01-01

    Context: Conditions such as osteoarthritis, obesity, and spinal cord injury limit the ability of patients to exercise, preventing them from experiencing many well-documented physiologic stressors. Recent evidence indicates that some of these stressors might derive from exercise-induced body temperature increases. Objective: To determine whether whole-body heat stress without exercise triggers cardiovascular, hormonal, and extra-cellular protein responses of exercise. Design: Randomized controlled trial. Setting: University research laboratory. Patients or Other Participants: Twenty-five young, healthy adults (13 men, 12 women; age = 22.1 ± 2.4 years, height = 175.2 ± 11.6 cm, mass = 69.4 ± 14.8 kg, body mass index = 22.6 ± 4.0) volunteered. Intervention(s): Participants sat in a heat stress chamber with heat (73°C) and without heat (26°C) stress for 30 minutes on separate days. We obtained blood samples from a subset of 13 participants (7 men, 6 women) before and after exposure to heat stress. Main Outcome Measure(s): Extracellular heat shock protein (HSP72) and catecholamine plasma concentration, heart rate, blood pressure, and heat perception. Results: After 30 minutes of heat stress, body temperature measured via rectal sensor increased by 0.8°C. Heart rate increased linearly to 131.4 ± 22.4 beats per minute (F6,24 = 186, P < .001) and systolic and diastolic blood pressure decreased by 16 mm Hg (F6,24 = 10.1, P < .001) and 5 mm Hg (F6,24 = 5.4, P < .001), respectively. Norepinephrine (F1,12 = 12.1, P = .004) and prolactin (F1,12 = 30.2, P < .001) increased in the plasma (58% and 285%, respectively) (P < .05). The HSP72 (F1,12 = 44.7, P < .001) level increased with heat stress by 48.7% ± 53.9%. No cardiovascular or blood variables showed changes during the control trials (quiet sitting in the heat chamber with no heat stress), resulting in differences between heat and control trials. Conclusions: We found that whole-body heat stress triggers some of the

  5. Heat stress and cardiovascular, hormonal, and heat shock proteins in humans.

    PubMed

    Iguchi, Masaki; Littmann, Andrew E; Chang, Shuo-Hsiu; Wester, Lydia A; Knipper, Jane S; Shields, Richard K

    2012-01-01

    Conditions such as osteoarthritis, obesity, and spinal cord injury limit the ability of patients to exercise, preventing them from experiencing many well-documented physiologic stressors. Recent evidence indicates that some of these stressors might derive from exercise-induced body temperature increases. To determine whether whole-body heat stress without exercise triggers cardiovascular, hormonal, and extracellular protein responses of exercise. Randomized controlled trial. University research laboratory. Twenty-five young, healthy adults (13 men, 12 women; age = 22.1 ± 2.4 years, height = 175.2 ± 11.6 cm, mass = 69.4 ± 14.8 kg, body mass index = 22.6 ± 4.0) volunteered. Participants sat in a heat stress chamber with heat (73°C) and without heat (26°C) stress for 30 minutes on separate days. We obtained blood samples from a subset of 13 participants (7 men, 6 women) before and after exposure to heat stress. Extracellular heat shock protein (HSP72) and catecholamine plasma concentration, heart rate, blood pressure, and heat perception. After 30 minutes of heat stress, body temperature measured via rectal sensor increased by 0.8°C. Heart rate increased linearly to 131.4 ± 22.4 beats per minute (F₆,₂₄ = 186, P < .001) and systolic and diastolic blood pressure decreased by 16 mm Hg (F₆,₂₄ = 10.1, P < .001) and 5 mm Hg (F₆,₂₄ = 5.4, P < .001), respectively. Norepinephrine (F₁,₁₂ = 12.1, P = .004) and prolactin (F₁,₁₂ = 30.2, P < .001) increased in the plasma (58% and 285%, respectively) (P < .05). The HSP72 (F₁,₁₂ = 44.7, P < .001) level increased with heat stress by 48.7% ± 53.9%. No cardiovascular or blood variables showed changes during the control trials (quiet sitting in the heat chamber with no heat stress), resulting in differences between heat and control trials. We found that whole-body heat stress triggers some of the physiologic responses observed with exercise. Future studies are necessary to investigate whether

  6. Ideas and perspectives: Heat stress: more than hot air

    NASA Astrophysics Data System (ADS)

    De Boeck, Hans J.; Van De Velde, Helena; De Groote, Toon; Nijs, Ivan

    2016-10-01

    Climate models project an important increase in the frequency and intensity of heat waves. In gauging the impact on plant responses, much of the focus has been on air temperatures, while a critical analysis of leaf temperatures during heat extremes has not been conducted. Nevertheless, direct physiological consequences from heat depend primarily on leaf rather than on air temperatures. We discuss how the interplay between various environmental variables and the plants' stomatal response affects leaf temperatures and the potential for heat stress by making use of both an energy balance model and field data. The results demonstrate that this interplay between plants and environment can cause leaf temperature to vary substantially at the same air temperature. In general, leaves tended to heat up when radiation was high and when stomates were closed, as expected. But perhaps counterintuitively, high air humidity also raised leaf temperatures, while humid conditions are typically regarded as benign with respect to plant survival since they limit water loss. High wind speeds brought the leaf temperature closer to the air temperature, which can imply either cooling or warming (i.e. abating or reinforcing heat stress) depending on other prevailing conditions. The results thus indicate that heat waves characterized by similar extreme air temperatures may pose little danger under some atmospheric conditions but could be lethal in other cases. The trends illustrated here should give ecologists and agronomists a more informed indication about which circumstances are most conducive to the occurrence of heat stress.

  7. Impacts of Individual Animal Response to Heat and Handling Stresses on Escherichia coli and E. coli O157:H7 Fecal Shedding by Feedlot Cattle

    USDA-ARS?s Scientific Manuscript database

    The reduction of foodborne pathogens in cattle destined for human consumption will require knowledge of the factors that impact the carriage and shedding of these organisms. The effects of heat and handling stress levels on the fecal shedding of Escherichia coli O157:H7 and generic E. coli by feedl...

  8. Thermoregulatory responses of Holstein and Brown Swiss Heat-Stressed dairy cows to two different cooling systems

    NASA Astrophysics Data System (ADS)

    Correa-Calderon, Abelardo; Armstrong, Dennis; Ray, Donald; DeNise, Sue; Enns, Mark; Howison, Christine

    . Thirty-seven Holstein and 26 Brown Swiss dairy cows were used to evaluate the effect of two different cooling systems on physiological and hormonal responses during the summer. A control group of cows had access only to shade (C). A second group was cooled with spray and fans (S/F) and the third group was under an evaporative cooling system called Korral Kool (KK). The maximum temperature humidity index during the trial was from 73 to 85. Rectal temperatures and respiration rates of the C group were higher (P < 0.05) than those of the S/F and KK groups in both Holstein and Brown Swiss cows. Triiodothyronine levels in milk were higher (P < 0.05) in the KK group than in the S/F and C groups, while cortisol levels were lower (P < 0.05) in the C group than in S/F and KK. There was no significant difference in the hormonal response of the two breeds. These results demonstrate that both cooling systems may be used increase the comfort of Holstein and Brown Swiss cows during summer in hot, dry climates.

  9. Thermoregulatory responses of Holstein and Brown Swiss heat-stressed dairy cows to two different cooling systems.

    PubMed

    Correa-Calderon, Abelardo; Armstrong, Dennis; Ray, Donald; DeNise, Sue; Enns, Mark; Howison, Christine

    2004-02-01

    Thirty-seven Holstein and 26 Brown Swiss dairy cows were used to evaluate the effect of two different cooling systems on physiological and hormonal responses during the summer. A control group of cows had access only to shade (C). A second group was cooled with spray and fans (S/F) and the third group was under an evaporative cooling system called Korral Kool (KK). The maximum temperature humidity index during the trial was from 73 to 85. Rectal temperatures and respiration rates of the C group were higher (P<0.05) than those of the S/F and KK groups in both Holstein and Brown Swiss cows. Triiodothyronine levels in milk were higher (P<0.05) in the KK group than in the S/F and C groups, while cortisol levels were lower (P<0.05) in the C group than in S/F and KK. There was no significant difference in the hormonal response of the two breeds. These results demonstrate that both cooling systems may be used increase the comfort of Holstein and Brown Swiss cows during summer in hot, dry climates.

  10. Bruxism affects stress responses in stressed rats.

    PubMed

    Sato, Chikatoshi; Sato, Sadao; Takashina, Hirofumi; Ishii, Hidenori; Onozuka, Minoru; Sasaguri, Kenichi

    2010-04-01

    It has been proposed that suppression of stress-related emotional responses leads to the simultaneous activation of both sympathetic and parasympathetic divisions of the autonomic nervous system (ANS) and that the expression of these emotional states has a protective effect against ulcerogenesis. In the present study, we investigated whether stress-induced bruxism activity (SBA) has a physiological effect of on the stress-induced changes of the stomach, thymus, and spleen as well as blood leukocytes, cortisol, and adrenaline. This study demonstrated that SBA attenuated the stress-induced ulcer genesis as well as degenerative changes of thymus and spleen. SBA also attenuated increases of adrenaline, cortisol, and neutrophils in the blood. In conclusion, expression of aggression through SBA during stress exposure attenuates both stress-induced ANS response, including gastric ulcer formation.

  11. Patterns of Gene Expression Associated with Recovery and Injury in Heat-stressed Rats

    DTIC Science & Technology

    2014-12-03

    RESEARCH ARTICLE Open Access Patterns of gene expression associated with recovery and injury in heat-stressed rats Jonathan D Stallings1*, Danielle L...characterization of the gene response to heat stress using an in vivo conscious rat model. Results: We heated rats until implanted thermal probes indicated a maximal...all four organs at Tc,Max. Self-organizing maps identified gene-specific signatures corresponding to protein-folding disorders in heat-stressed rats

  12. Stress Response and Tolerance of Zea mays to CeO2 Nanoparticles: Cross Talk among H2O2, Heat Shock Protein and Lipid Peroxidation

    PubMed Central

    Zhao, Lijuan; Peng, Bo; Hernandez-Viezcas, Jose A.; Rico, Cyren; Sun, Youping; Peralta-Videa, Jose R.; Tang, Xiaolei; Niu, Genhua; Jin, Lixin; Varela-Ramirez, Armando; Zhang, Jian-ying; Gardea-Torresdey, Jorge L.

    2014-01-01

    The rapid development of nanotechnology will inevitably release nanoparticles (NPs) into the environment with unidentified consequences. In addition, the potential toxicity of CeO2 NPs to plants, and the possible transfer into the food chain, are still unknown. Corn plants (Zea mays) were germinated and grown in soil treated with CeO2 NPs at 400 or 800 mg/kg. Stress related parameters, such as: H2O2, catalase (CAT) and ascorbate peroxidase (APX) activity, heat shock protein 70 (HSP 70), lipid peroxidation, cell death and leaf gas exchange were analyzed at 10, 15, and 20 days post germination. Confocal laser scanning microscopy was used to image H2O2 distribution in corn leaves. Results showed that the CeO2 NP treatments increased accumulation of H2O2, up to day 15, in phloem, xylem, bundle sheath cells, and epidermal cells of shoots. The CAT and APX activities were also increased in the corn shoot, concomitant with the H2O2 levels. Both 400 and 800 mg/kg CeO2 NPs triggered the up regulation of the HSP 70 in roots, indicating a systemic stress response. None of the CeO2 NPs increased the level of thiobarbituric acid reacting substances, indicating that no lipid peroxidation occurred. CeO2 NPs, at both concentrations, did not induce ion leakage in either roots or shoots, suggesting membrane integrity was not compromised. Leaf net photosynthetic rate, transpiration, and stomatal conductance were not affected by CeO2 NPs. Our results suggest that the CAT, APX and HSP 70 might help the plants defend against CeO2 NPs induced oxidative injury and survive NP exposure. PMID:23050848

  13. Stress response and tolerance of Zea mays to CeO2 nanoparticles: cross talk among H2O2, heat shock protein, and lipid peroxidation.

    PubMed

    Zhao, Lijuan; Peng, Bo; Hernandez-Viezcas, Jose A; Rico, Cyren; Sun, Youping; Peralta-Videa, Jose R; Tang, Xiaolei; Niu, Genhua; Jin, Lixin; Varela-Ramirez, Armando; Zhang, Jian-ying; Gardea-Torresdey, Jorge L

    2012-11-27

    The rapid development of nanotechnology will inevitably release nanoparticles (NPs) into the environment with unidentified consequences. In addition, the potential toxicity of CeO(2) NPs to plants and the possible transfer into the food chain are still unknown. Corn plants (Zea mays) were germinated and grown in soil treated with CeO(2) NPs at 400 or 800 mg/kg. Stress-related parameters, such as H(2)O(2), catalase (CAT), and ascorbate peroxidase (APX) activity, heat shock protein 70 (HSP70), lipid peroxidation, cell death, and leaf gas exchange were analyzed at 10, 15, and 20 days post-germination. Confocal laser scanning microscopy was used to image H(2)O(2) distribution in corn leaves. Results showed that the CeO(2) NP treatments increased accumulation of H(2)O(2), up to day 15, in phloem, xylem, bundle sheath cells and epidermal cells of shoots. The CAT and APX activities were also increased in the corn shoot, concomitant with the H(2)O(2) levels. Both 400 and 800 mg/kg CeO(2) NPs triggered the up-regulation of the HSP70 in roots, indicating a systemic stress response. None of the CeO(2) NPs increased the level of thiobarbituric acid reacting substances, indicating that no lipid peroxidation occurred. CeO(2) NPs, at both concentrations, did not induce ion leakage in either roots or shoots, suggesting that membrane integrity was not compromised. Leaf net photosynthetic rate, transpiration, and stomatal conductance were not affected by CeO(2) NPs. Our results suggest that the CAT, APX, and HSP70 might help the plants defend against CeO(2) NP-induced oxidative injury and survive NP exposure.

  14. Synthesis and uptake of the compatible solutes ectoine and 5-hydroxyectoine by Streptomyces coelicolor A3(2) in response to salt and heat stresses.

    PubMed

    Bursy, Jan; Kuhlmann, Anne U; Pittelkow, Marco; Hartmann, Holger; Jebbar, Mohamed; Pierik, Antonio J; Bremer, Erhard

    2008-12-01

    Streptomyces coelicolor A3(2) synthesizes ectoine and 5-hydroxyectoine upon the imposition of either salt (0.5 M NaCl) or heat stress (39 degrees C). The cells produced the highest cellular levels of these compatible solutes when both stress conditions were simultaneously imposed. Protection against either severe salt (1.2 M NaCl) or heat stress (39 degrees C) or a combination of both environmental cues could be accomplished by adding low concentrations (1 mM) of either ectoine or 5-hydroxyectoine to S. coelicolor A3(2) cultures. The best salt and heat stress protection was observed when a mixture of ectoine and 5-hydroxyectoine (0.5 mM each) was provided to the growth medium. Transport assays with radiolabeled ectoine demonstrated that uptake was triggered by either salt or heat stress. The most effective transport and accumulation of [(14)C]ectoine by S. coelicolor A3(2) were achieved when both environmental cues were simultaneously applied. Our results demonstrate that the accumulation of the compatible solutes ectoine and 5-hydroxyectoine allows S. coelicolor A3(2) to fend off the detrimental effects of both high salinity and high temperature on cell physiology. We also characterized the enzyme (EctD) required for the synthesis of 5-hydroxyectoine from ectoine, a hydroxylase of the superfamily of the non-heme-containing iron(II)- and 2-oxoglutarate-dependent dioxygenases (EC 1.14.11). The gene cluster (ectABCD) encoding the enzymes for ectoine and 5-hydroxyectoine biosynthesis can be found in the genome of S. coelicolor A3(2), Streptomyces avermitilis, Streptomyces griseus, Streptomyces scabiei, and Streptomyces chrysomallus, suggesting that these compatible solutes play an important role as stress protectants in the genus Streptomyces.

  15. Body Temperature Versus Microclimate Selection in Heat Stressed Dairy Cows

    USDA-ARS?s Scientific Manuscript database

    The purpose of this study is to characterize the thermoregulatory responses of unrestrained heat-stressed dairy cows within a freestall environment using fan and spray configurations for cooling cows while lying or standing. An experimental treatment sprayed individual cows lying in freestalls from ...

  16. Body Temperature Versus Microclimate Selection in Heat Stressed Dairy Cows

    USDA-ARS?s Scientific Manuscript database

    The purpose of this study is to characterize the thermoregulatory responses of unrestrained heat-stressed dairy cows within a freestall environment using fan and spray configurations for cooling cows while lying or standing. An experimental treatment sprayed individual cows lying in freestalls from ...

  17. Sequence determinants of prokaryotic gene expression level under heat stress.

    PubMed

    Xiong, Heng; Yang, Yi; Hu, Xiao-Pan; He, Yi-Ming; Ma, Bin-Guang

    2014-11-01

    Prokaryotic gene expression is environment-dependent and temperature plays an important role in shaping the gene expression profile. Revealing the regulation mechanisms of gene expression pertaining to temperature has attracted tremendous efforts in recent years particularly owning to the yielding of transcriptome and proteome data by high-throughput techniques. However, most of the previous works concentrated on the characterization of the gene expression profile of individual organism and little effort has been made to disclose the commonality among organisms, especially for the gene sequence features. In this report, we collected the transcriptome and proteome data measured under heat stress condition from recently published literature and studied the sequence determinants for the expression level of heat-responsive genes on multiple layers. Our results showed that there indeed exist commonness and consistent patterns of the sequence features among organisms for the differentially expressed genes under heat stress condition. Some features are attributed to the requirement of thermostability while some are dominated by gene function. The revealed sequence determinants of bacterial gene expression level under heat stress complement the knowledge about the regulation factors of prokaryotic gene expression responding to the change of environmental conditions. Furthermore, comparisons to thermophilic adaption have been performed to reveal the similarity and dissimilarity of the sequence determinants for the response to heat stress and for the adaption to high habitat temperature, which elucidates the complex landscape of gene expression related to the same physical factor of temperature. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Reductions in labour capacity from heat stress under climate warming

    NASA Astrophysics Data System (ADS)

    Dunne, John P.; Stouffer, Ronald J.; John, Jasmin G.

    2013-06-01

    A fundamental aspect of greenhouse-gas-induced warming is a global-scale increase in absolute humidity. Under continued warming, this response has been shown to pose increasingly severe limitations on human activity in tropical and mid-latitudes during peak months of heat stress. One heat-stress metric with broad occupational health applications is wet-bulb globe temperature. We combine wet-bulb globe temperatures from global climate historical reanalysis and Earth System Model (ESM2M) projections with industrial and military guidelines for an acclimated individual's occupational capacity to safely perform sustained labour under environmental heat stress (labour capacity)--here defined as a global population-weighted metric temporally fixed at the 2010 distribution. We estimate that environmental heat stress has reduced labour capacity to 90% in peak months over the past few decades. ESM2M projects labour capacity reduction to 80% in peak months by 2050. Under the highest scenario considered (Representative Concentration Pathway 8.5), ESM2M projects labour capacity reduction to less than 40% by 2200 in peak months, with most tropical and mid-latitudes experiencing extreme climatological heat stress. Uncertainties and caveats associated with these projections include climate sensitivity, climate warming patterns, CO2 emissions, future population distributions, and technological and societal change.

  19. Deficiency of heat shock transcription factor 1 suppresses heat stress-associated increase in slow soleus muscle mass of mice.

    PubMed

    Ohno, Y; Egawa, T; Yokoyama, S; Nakai, A; Sugiura, T; Ohira, Y; Yoshioka, T; Goto, K

    2015-12-01

    Effects of heat shock transcription factor 1 (HSF1) deficiency on heat stress-associated increase in slow soleus muscle mass of mice were investigated. Both HSF1-null and wild-type mice were randomly assigned to control and heat-stressed groups. Mice in heat-stressed group were exposed to heat stress (41 °C for 60 min) in an incubator without anaesthesia. Significant increase in wet and dry weights, and protein content of soleus muscle in wild-type mice was observed seven days after the application of the heat stress. However, heat stress had no impact on soleus muscle mass in HSF1-null mice. Neither type of mice exhibited much effect of heat stress on HSF mRNA expression (HSF1, HSF2 and HSF4). On the other hand, heat stress upregulated heat shock proteins (HSPs) at the mRNA (HSP72) and protein (HSP72 and HSP110) levels in wild-type mice, but not in HSF1-null mice. The population of Pax7-positive nuclei relative to total myonuclei of soleus muscle in wild-type mice was significantly increased by heat stress, but not in HSF1-null mice. Furthermore, the absence of HSF1 gene suppressed heat stress-associated phosphorylation of Akt and p70 S6 kinase (p-p70S6K) in soleus muscle. Heat stress-associated increase in skeletal muscle mass may be induced by HSF1 and/or HSF1-mediated stress response that activates muscle satellite cells and Akt/p70S6K signalling pathway. © 2015 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  20. Arabidopsis HIT4, a regulator involved in heat-triggered reorganization of chromatin and release of transcriptional gene silencing, relocates from chromocenters to the nucleolus in response to heat stress.

    PubMed

    Wang, Lian-Chin; Wu, Jia-Rong; Hsu, Yi-Ju; Wu, Shaw-Jye

    2015-01-01

    Arabidopsis HIT4 is known to mediate heat-induced decondensation of chromocenters and release from transcriptional gene silencing (TGS) with no change in the level of DNA methylation. It is unclear whether HIT4 and MOM1, a well-known DNA methylation-independent transcriptional silencer, have overlapping regulatory functions. A hit4-1/mom1 double mutant strain was generated. Its nuclear morphology and TGS state were compared with those of wild-type, hit4-1, and mom1 plants. Fluorescent protein tagging was employed to track the fates of HIT4, hit4-1 and MOM1 in vivo under heat stress. HIT4- and MOM1-mediated TGS were distinguishable. Both HIT4 and MOM1 were localized normally to chromocenters. Under heat stress, HIT4 relocated to the nucleolus, whereas MOM1 dispersed with the chromocenters. hit4-1 was able to relocate to the nucleolus under heat stress, but its relocation was insufficient to trigger the decompaction of chromocenters. The hypersensitivity to heat associated with the impaired reactivation of TGS in hit4-1 was not alleviated by mom1-induced release from TGS. HIT4 delineates a novel and MOM1-independent TGS regulation pathway. The involvement of a currently unidentified component that links HIT4 relocation and the large-scale reorganization of chromatin, and which is essential for heat tolerance in plants is hypothesized.

  1. Association of heat shock protein 70 expression with rat myocardial cell damage during heat stress in vitro and in vivo.

    PubMed

    Chen, H B; Zhang, X C; Cheng, Y F; Abdelnasir, A; Tang, S; Kemper, N; Hartung, J; Bao, E D

    2015-03-20

    To investigate the mechanism of sudden death as a result of stress-induced damage to heart tissue and myocardial cells and to investigate the cardioprotective role of Hsp70 during heat stress, the distribution and expression of Hsp70 was evaluated in the heart cells of heat-stressed rats in vivo and heat-stressed H9c2 cells in vitro. After exposure to heat stress at 42°C for different durations, we observed a significant induction of CK, CK-MB, and LDH as well as pathologic lesions characterized by acute degeneration, suggesting that cell damage occurs from the onset of heat stress. Immunocytochemistry showed that Hsp70 was distributed mainly in the cytoplasm of myocardial cells in vivo and in vitro. Hsp70-positive signals in the cytoplasm were more prominent in intact areas than in degenerated areas after 60 min of heat stress. Hsp70 protein levels in myocardial cells in vitro decreased from the beginning to the end of heat stress. Hsp70 protein levels in rat heart tissues in vivo decreased gradually with prolonged heat stress, with a slight increase at the beginning of heat stress. These results indicate that Hsp70 plays a role in the response of cardiac cells to heat stress and that decreased Hsp70 levels are associated with damage to rat myocardial cells in vitro and in vivo. Significant differences were found in hsp70 mRNA, which began to increase after 20 min of heat stress in vitro and after 40 min in vivo. This indicates that hysteresis is involved in mRNA expression after heat stress in vivo.

  2. Heat Stress in Feedlot Cattle.

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to determine if supplementing the diet of near-finished beef cattle with a yeast product would mitigate the negative impact of a controlled HS on the physiological and endocrine responses. Crossbred beef heifers (n=111; BW=281.07 kg) were divided into 2 pens in a comm...

  3. Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress

    PubMed Central

    2012-01-01

    Background Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. Results We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. Conclusion The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated

  4. Transcriptomic analysis of grape (Vitis vinifera L.) leaves during and after recovery from heat stress.

    PubMed

    Liu, Guo-Tian; Wang, Jun-Fang; Cramer, Grant; Dai, Zhan-Wu; Duan, Wei; Xu, Hong-Guo; Wu, Ben-Hong; Fan, Pei-Ge; Wang, Li-Jun; Li, Shao-Hua

    2012-09-28

    Grapes are a major fruit crop around the world. Heat stress can significantly reduce grape yield and quality. Changes at the molecular level in response to heat stress and subsequent recovery are poorly understood. To elucidate the effect of heat stress and subsequent recovery on expression of genes by grape leaves representing the classic heat stress response and thermotolerance mechanisms, transcript abundance of grape (Vitis vinifera L.) leaves was quantified using the Affymetrix Grape Genome oligonucleotide microarray (15,700 transcripts), followed by quantitative Real-Time PCR validation for some transcript profiles. We found that about 8% of the total probe sets were responsive to heat stress and/or to subsequent recovery in grape leaves. The heat stress and recovery responses were characterized by different transcriptional changes. The number of heat stress-regulated genes was almost twice the number of recovery-regulated genes. The responsive genes identified in this study belong to a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, transcription factors, signal transduction, and development. We have identified some common genes and heat shock factors (HSFs) that were modulated differentially by heat stress and recovery. Most HSP genes were upregulated by heat stress but were downregulated by the recovery. On the other hand, some specific HSP genes or HSFs were uniquely responsive to heat stress or recovery. The effect of heat stress and recovery on grape appears to be associated with multiple processes and mechanisms including stress-related genes, transcription factors, and metabolism. Heat stress and recovery elicited common up- or downregulated genes as well as unique sets of responsive genes. Moreover, some genes were regulated in opposite directions by heat stress and recovery. The results indicated HSPs, especially small HSPs

  5. Genetic and epigenetic control of plant heat responses

    PubMed Central

    Liu, Junzhong; Feng, Lili; Li, Jianming; He, Zuhua

    2015-01-01

    Plants have evolved sophisticated genetic and epigenetic regulatory systems to respond quickly to unfavorable environmental conditions such as heat, cold, drought, and pathogen infections. In particular, heat greatly affects plant growth and development, immunity and circadian rhythm, and poses a serious threat to the global food supply. According to temperatures exposing, heat can be usually classified as warm ambient temperature (about 22–27°C), high temperature (27–30°C) and extremely high temperature (37–42°C, also known as heat stress) for the model plant Arabidopsis thaliana. The genetic mechanisms of plant responses to heat have been well studied, mainly focusing on elevated ambient temperature-mediated morphological acclimation and acceleration of flowering, modulation of circadian clock and plant immunity by high temperatures, and thermotolerance to heat stress. Recently, great progress has been achieved on epigenetic regulation of heat responses, including DNA methylation, histone modifications, histone variants, ATP-dependent chromatin remodeling, histone chaperones, small RNAs, long non-coding RNAs and other undefined epigenetic mechanisms. These epigenetic modifications regulate the expression of heat-responsive genes and function to prevent heat-related damages. This review focuses on recent progresses regarding the genetic and epigenetic control of heat responses in plants, and pays more attention to the role of the major epigenetic mechanisms in plant heat responses. Further research perspectives are also discussed. PMID:25964789

  6. Heat stress and sudden infant death syndrome--stress gene expression after exposure to moderate heat stress.

    PubMed

    Rohde, Marianne Cathrine; Corydon, Thomas Juhl; Hansen, Jakob; Pedersen, Christina Bak; Schmidt, Stinne P; Gregersen, Niels; Banner, Jytte

    2013-10-10

    The aim of the present study was to investigate stress gene expression in cultured primary fibroblasts established from Achilles tendons collected during autopsies from sudden infant death syndrome (SIDS) cases, and age-matched controls (infants dying in a traumatic event). Expression of 4 stress responsive genes, HSPA1B, HSPD1, HMOX1, and SOD2, was studied by quantitative reverse transcriptase PCR analysis of RNA purified from cells cultured under standard or various thermal stress conditions. The expression of all 4 genes was highly influenced by thermal stress in both SIDS and control cells. High interpersonal variance found in the SIDS group indicated that they represented a more heterogeneous group than controls. The SIDS group responded to thermal stress with a higher expression of the HSPA1B and HSPD1 genes compared to the control group, whereas no significant difference was observed in the expression of SOD2 and HMOX1 between the two groups. The differences were related to the heat shock treatment as none of the genes were expressed significantly different in SIDS at base levels at 37 °C. SOD2 and HMOX1 were up regulated in both groups, for SOD2 though the expression was lower in SIDS at all time points measured, and may be less related to heat stress. Being found dead in the prone position (a known risk factor for SIDS) was related to a lower HSPA1B up-regulation in SIDS compared to SIDS found on their side or back. The study demonstrates the potential usefulness of gene expression studies using cultured fibroblasts established from deceased individuals as a tool for molecular and pathological investigations in forensic and biomedical sciences. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  7. Staphylococcal response to oxidative stress

    PubMed Central

    Gaupp, Rosmarie; Ledala, Nagender; Somerville, Greg A.

    2012-01-01

    Staphylococci are a versatile genus of bacteria that are capable of causing acute and chronic infections in diverse host species. The success of staphylococci as pathogens is due in part to their ability to mitigate endogenous and exogenous oxidative and nitrosative stress. Endogenous oxidative stress is a consequence of life in an aerobic environment; whereas, exogenous oxidative and nitrosative stress are often due to the bacteria's interaction with host immune systems. To overcome the deleterious effects of oxidative and nitrosative stress, staphylococci have evolved protection, detoxification, and repair mechanisms that are controlled by a network of regulators. In this review, we summarize the cellular targets of oxidative stress, the mechanisms by which staphylococci sense oxidative stress and damage, oxidative stress protection and repair mechanisms, and regulation of the oxidative stress response. When possible, special attention is given to how the oxidative stress defense mechanisms help staphylococci control oxidative stress in the host. PMID:22919625

  8. Circulatory endotoxin concentration and cytokine profile in response to exertional-heat stress during a multi-stage ultra-marathon competition.

    PubMed

    Gill, Samantha K; Teixeira, Ana; Rama, Luis; Prestes, Jonato; Rosado, Fatima; Hankey, Joanne; Scheer, Volker; Hemmings, Krystal; Ansley-Robson, Paula; Costa, Ricardo J S

    2015-01-01

    Exertional-heat stress has the potential to disturb intestinal integrity, leading to enhanced permeability of enteric pathogenic micro-organisms and associated clinical manifestations. The study aimed to determine the circulatory endotoxin concentration and cytokine profile of ultra-endurance runners (UER, n=19) and a control group (CON, n=12) during a five stage 230km ultra-marathon (mean ± SD: 27h38min ± 3h55min) conducted in hot and dry environmental conditions (30ºC to 40ºC and 31% to 40% relative humidity). Body mass and tympanic temperature were measured, and venous blood samples were taken before (pre-stage) and immediately after (post-stage) each stage of the ultra-marathon for the analysis of gram-negative bacterial endotoxin, C-reactive protein, cytokine profile (IL-6, IL-1β, TNF-α, IFN-γ, IL-10, and IL- 1ra), and plasma osmolality. Gastrointestinal symptoms and perceptive thermal tolerance rating were also monitored throughout competition. Mean exercise-induced body mass loss over the five stages ranged 1.0% to 2.5%. Pre- and poststage plasma osmolality in UER ranged277 to 282mOsmol/kg and 286 to 297 mOsmol/kg, respectively. Pre-stage concentrations of endotoxin (peak: 21% at Stage 5), C-reactive protein (889% at Stage 3), IL-6 (152% at Stage 2), IL-1β (95% at Stage 5), TNF-α (168% at Stage 5), IFN-γ (102% at Stage 5),IL-10 (1271% at Stage 3), and IL-1ra (106% at Stage 5) increased as the ultra-marathon progressed in UER; while no changes in CON were observed (except for IL-1β, 71% at Stage 5). Pre- to post-stage increases were observed for endotoxin (peak: 22% at Stage 3), C-reactive protein (25% at Stage 1), IL-6 (238% at Stage 1), IL-1β (64% at Stage 1), TNF-α (101% at Stage 1), IFN-γ (39% at Stage 1), IL-10 (1100% at Stage 1), and IL-1ra(207% at Stage 1) concentrations in UER. Multi-stage ultra-marathon competition in the heat resulted in a modest circulatory endotoxaemia accompanied by a pronounced pro-inflammatory cytokinaemia by post

  9. Effect of heat stress on oxidative stress, lipid peroxidation and some stress parameters in broilers.

    PubMed

    Altan, O; Pabuçcuoğlu, A; Altan, A; Konyalioğlu, S; Bayraktar, H

    2003-09-01

    1. This study was conducted to determine the effects of heat stress on fearfulness, leucocyte components, oxidative stress and lipid peroxidation in two commercial broiler strains, Cobb (C) and Ross (R). 2. At 36 and 37 d of age birds were exposed to 38 +/- 1 degree C for 3 h. Rectal temperatures, duration of tonic immobility (TI), haematocrit values, proportions of leucocyte components (heterophil, lymphocyte, basophil, eosinophil, monocyte), malondialdehyde (MDA) concentrations and antioxidant enzyme activities (CAT, SOD, GPx) of all the birds were determined, before and after heat treatment. 3. Rectal temperatures increased and haematocrit values decreased in birds exposed to heat stress. Heat stress caused a significant increase in heterophil/lymphocyte and in basophil ratios. 4. Exposing birds to heat stress increased duration of TI, suggesting heat-stressed birds tended to be more fearful. 5. Heat stress resulted in a significant Genotype x Treatment interaction for MDA concentration. CAT, SOD and GPx activities; MDA concentrations in heat-stressed R strain birds were greater than in heat-stressed C strain birds.

  10. Stress responses in yeasts: what rules apply?

    PubMed

    González-Párraga, Pilar; Sánchez-Fresneda, Ruth; Martínez-Esparza, María; Argüelles, Juan-Carlos

    2008-04-01

    Living organisms have evolved a complex network of mechanisms to face the unforeseen nutritional and environmental circumstances imposed on their natural habitats, commonly termed "stress". To learn more about these mechanisms, several challenges are usually applied in the laboratory, namely nutrient starvation, heat shock, dehydration, oxidative exposures, etc. Yeasts are chosen as convenient models for studying stress phenomena because of their simple cellular organization and the amenability to genetic analysis. A vast scientific literature has recently appeared on the defensive cellular responses to stress. However, this plethora of studies covers quite different experimental conditions, making any conclusions open to dispute. In fact, the term "yeast stress" is rather confusing, since the same treatment may be very stressful or irrelevant, depending on the yeast. Customary expressions such as "gentle stress" (non-lethal) or "severe stress" (potentially lethal) should be precisely clarified. In turn, although prototypic yeasts share a common repertoire of signalling responsive pathways to stress, these are adapted to the specific ecological niche and biological activity of each particular species. What does "stress" really mean? Before we go any deeper, we have to define this uncertain meaning along with a proper explanation concerning the terms and conditions used in research on yeast stress.

  11. Aging causes decreased resistance to multiple stresses and a failure to activate specific stress response pathways

    PubMed Central

    Bergsma, Alexis L.; Senchuk, Megan M.; Van Raamsdonk, Jeremy M.

    2016-01-01

    In this work, we examine the relationship between stress resistance and aging. We find that resistance to multiple types of stress peaks during early adulthood and then declines with age. To dissect the underlying mechanisms, we use C. elegans transcriptional reporter strains that measure the activation of different stress responses including: the heat shock response, mitochondrial unfolded protein response, endoplasmic reticulum unfolded protein response, hypoxia response, SKN-1-mediated oxidative stress response, and the DAF-16-mediated stress response. We find that the decline in stress resistance with age is at least partially due to a decreased ability to activate protective mechanisms in response to stress. In contrast, we find that any baseline increase in stress caused by the advancing age is too mild to detectably upregulate any of the stress response pathways. Further exploration of how worms respond to stress with increasing age revealed that the ability to mount a hormetic response to heat stress is also lost with increasing age. Overall, this work demonstrates that resistance to all types of stress declines with age. Based on our data, we speculate that the decrease in stress resistance with advancing age results from a genetically-programmed inactivation of stress response pathways, not accumulation of damage. PMID:27053445

  12. Aging causes decreased resistance to multiple stresses and a failure to activate specific stress response pathways.

    PubMed

    Dues, Dylan J; Andrews, Emily K; Schaar, Claire E; Bergsma, Alexis L; Senchuk, Megan M; Van Raamsdonk, Jeremy M

    2016-04-01

    In this work, we examine the relationship between stress resistance and aging. We find that resistance to multiple types of stress peaks during early adulthood and then declines with age. To dissect the underlying mechanisms, we use C. elegans transcriptional reporter strains that measure the activation of different stress responses including: the heat shock response, mitochondrial unfolded protein response, endoplasmic reticulum unfolded protein response, hypoxia response, SKN-1-mediated oxidative stress response, and the DAF-16-mediated stress response. We find that the decline in stress resistance with age is at least partially due to a decreased ability to activate protective mechanisms in response to stress. In contrast, we find that any baseline increase in stress caused by the advancing age is too mild to detectably upregulate any of the stress response pathways. Further exploration of how worms respond to stress with increasing age revealed that the ability to mount a hormetic response to heat stress is also lost with increasing age. Overall, this work demonstrates that resistance to all types of stress declines with age. Based on our data, we speculate that the decrease in stress resistance with advancing age results from a genetically-programmed inactivation of stress response pathways, not accumulation of damage.

  13. Protein carbonylation and heat shock response in Ruditapes decussatus following p,p'-dichlorodiphenyldichloroethylene (DDE) exposure: a proteomic approach reveals that DDE causes oxidative stress.

    PubMed

    Dowling, Vera; Hoarau, Pascal C; Romeo, Michèle; O'Halloran, John; van Pelt, Frank; O'Brien, Nora; Sheehan, David

    2006-04-20

    Protein carbonylation and levels of heat shock proteins (hsp; 60, 70 and 90 kDa) were measured in gill, mantle and digestive gland of Ruditapes decussatus following exposure to p,p'-dichlorodiphenyldichloroethylene (DDE). Heat shock response was measured by immunoblotting using antibodies specific to heat shock proteins (hsps). Densitometry analysis of individual bands revealed no difference between control and treated samples except appearance of hsp90 in DDE-treated mantle. Carbonylated protein content was determined following 2,4-dinitrophenylhydrazine derivatization and two-dimensional electrophoresis coupled with western blotting. Immunoblotting with dinitrophenol-specific antibody revealed extensive differences in both extent and number of carbonylated proteins in mantle and digestive gland in response to DDE while gill was unaffected. These results demonstrate for the first time that DDE causes tissue-specific formation of reactive oxygen species in clams.

  14. Response of Chloroplast NAD(P)H Dehydrogenase-Mediated Cyclic Electron Flow to a Shortage or Lack in Ferredoxin-Quinone Oxidoreductase-Dependent Pathway in Rice Following Short-Term Heat Stress

    PubMed Central

    Essemine, Jemaa; Qu, Mingnan; Mi, Hualing; Zhu, Xin-Guang

    2016-01-01

    Cyclic electron flow (CEF) around photosystem I (PSI) can protect photosynthetic electron carriers under conditions of stromal over-reduction. The goal of the research reported in this paper was to investigate the responses of both PSI and photosystem II (PSII) to a short-term heat stress in two rice lines with different capacities of cyclic electron transfer, i.e., Q4149 with a high capacity (hcef) and C4023 with a low capacity (lcef). The absorbance change at 820 nm (ΔA820) was used here to assess the charge separation in the PSI reaction center (P700). The results obtained show that short-term heat stress abolishes the ferredoxin-quinone oxidoreductase (FQR)-dependent CEF in rice and accelerates the initial rate of P700+ re-reduction. The P700+ amplitude was slightly increased at a moderate heat-stress (35°C) because of a partial restriction of FQR but it was decreased following high heat-stress (42°C). Assessment of PSI and PSII activities shows that PSI is more susceptible to heat stress than PSII. Under high temperature, FQR-dependent CEF was completely removed and NDH-dependent CEF was up-regulated and strengthened to a higher extent in C4023 than in Q4149. Specifically, under normal growth temperature, hcef (Q4149) was characterized by higher FQR- and chloroplast NAD(P)H dehydrogenase (NDH)-dependent CEF rates than lcef (C4023). Following thermal stress, the activation of NDH-pathway was 130 and 10% for C4023 and Q4149, respectively. Thus, the NDH-dependent CEF may constitute the second layer of plant protection and defense against heat stress after the main route, i.e., FQR-dependent CEF, reaches its capacity. We discuss the possibility that under high heat stress, the NDH pathway serves as a safety valve to dissipate excess energy by cyclic photophosphorylation and overcome the stroma over-reduction following inhibition of CO2 assimilation and any shortage or lack in the FQR pathway. The potential role of the NDH-dependent pathway during the evolution

  15. Characterization of heat shock cognate protein 70 gene and its differential expression in response to thermal stress between two wing morphs of Nilaparvata lugens (Stål).

    PubMed

    Lu, Kai; Chen, Xia; Liu, Wenting; Zhou, Qiang

    2016-09-01

    Previous studies have demonstrated differences in thermotolerance between two wing morphs of Nilaparvata lugens, the most serious pest of rice across the Asia. To reveal the molecular regulatory mechanisms underlying the differential thermal resistance abilities between two wing morphs, a full-length of transcript encoding heat shock cognate protein 70 (Hsc70) was cloned, and its expression patterns across temperature gradients were analyzed. The results showed that the expression levels of NlHsc70 in macropters increased dramatically after heat shock from 32 to 38°C, while NlHsc70 transcripts in brachypters remained constant under different temperature stress conditions. In addition, NlHsc70 expression in the macropters was significantly higher than that in brachypters at 1 and 2h recovery from 40°C heat shock. There was no significant difference in NlHsc70 mRNA expression between brachypters and macropters under cold shock conditions. Therefore, NlHsc70 was indeed a constitutively expressed member of the Hsp70 family in brachypters of N. lugens, while it was heat-inducible in macropters. Furthermore, the survival rates of both morphs injected with NlHsc70 dsRNA were significantly decreased following heat shock at 40°C or cold shock at 0°C for 1h. These results suggested that the up-regulation of NlHsc70 is possibly related to the thermal resistance, and the more effective inducement expression of NlHsc70 in macropters promotes a greater thermal tolerance under temperature stress conditions. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Heat stress proteins and myocardial protection: experimental model or potential clinical tool?

    PubMed

    Gray, C C; Amrani, M; Yacoub, M H

    1999-05-01

    Heat stress proteins (hsp) are induced by a variety of stimuli including elevated temperature, ischaemia, hypoxia, pressure overload and some chemicals. They help to maintain the metabolic and structural integrity of the cell, as a protective response to external stresses. They are known to protect the myocardium from the damaging effects of ischaemia and reperfusion. The heat stress response results in accumulation of heat stress proteins. The beneficial effects associated with their expression include improved endothelial and mechanical recovery of the ischaemic heart. In addition, preservation of high energy phosphates and reduction in infarct size. It has also been shown that critical amounts of hsp70 are necessary to ensure protection of the myocardium. However, questions remain regarding the biochemical mechanisms underlying this protective effect. Alterations in the cell metabolism and chaperone function of cells expressing heat shock proteins, are thought to be responsible. Despite the obvious clinical benefits related to the heat stress response in a clinical setting, the application of this phenomena remains limited. Heat, both quantitatively and qualitatively is one of the best inducers of heat stress proteins. However, the effects of heat stress are nonspecific and intracellular damage is a common occurrence. The search for alternative stimuli, particularly within the fields of pharmacotherapy or genetic manipulation may offer more viable options, if the heat stress response is take its place as an established strategy for myocardial protection.

  17. Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger.

    PubMed

    Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro

    2012-03-01

    The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses.

  18. Consequences of physiological heat shock beginning at the zygote stage on embryonic development and expression of stress response genes in cattle.

    PubMed

    Sakatani, M; Alvarez, N V; Takahashi, M; Hansen, P J

    2012-06-01

    The goal was to understand the role of heat shock at the zygote stage in causing infertility. Culture at 40°C reduced the percentage of inseminated oocytes that became a morula or blastocyst by d 6 or that were a blastocyst at d 8. An additional experiment was done to test whether effects of heat shock occur early in development or at the time of morula formation. Exposure to 40°C for 24 h decreased development to the blastocyst stage if exposure was at the zygote stage [8 to 32 h postinsemination (hpi)] but not if exposure occurred at the morula stage (116 to 140 hpi). To test effect of oxygen concentration, inseminat