Science.gov

Sample records for hedgehog gene family

  1. Evolutionary Genomics and Adaptive Evolution of the Hedgehog Gene Family (Shh, Ihh and Dhh) in Vertebrates

    PubMed Central

    Pereira, Joana; Johnson, Warren E.; O’Brien, Stephen J.; Jarvis, Erich D.; Zhang, Guojie; Gilbert, M. Thomas P.; Vasconcelos, Vitor; Antunes, Agostinho

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog – Shh; Indian hedgehog – Ihh; and Desert hedgehog – Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots. PMID:25549322

  2. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh) in vertebrates.

    PubMed

    Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  3. The Hedgehog gene family of the cnidarian, Nematostella vectensis, and implications for understanding metazoan Hedgehog pathway evolution

    PubMed Central

    Matus, David Q.; Magie, Craig; Pang, Kevin; Martindale, Mark Q; Thomsen, Gerald H.

    2008-01-01

    Hedgehog signaling is an important component of cell-cell communication during bilaterian development, and abnormal Hedgehog signaling contributes to disease and birth defects. Hedgehog genes are composed of a ligand (“hedge”) domain and an autocatalytic intein (“hog”) domain. Hedgehog (hh) ligands bind to a conserved set of receptors and activate downstream signal transduction pathways terminating with Gli/Ci transcription factors. We have identified five intein-containing genes in the anthozoan cnidarian Nematostella vectensis, two of which (NvHh1 and NvHh2) contain definitive hedgehog ligand domains, suggesting that to date, cnidarians are the earliest branching metazoan phylum to possess definitive Hh orthologs. Expression analysis of NvHh1 and NvHh2, the receptor NvPatched and a downstream transcription factor NvGli (a Gli3/Ci ortholog) indicate that these genes may have conserved roles in planar and trans-epithelial signaling during gut and germline development, while the three remaining intein-containing genes (NvHint1,2,3) are expressed in a cell-type specific manner in putative neural precursors. Metazoan intein-containing genes that lack a ligand domain have previously only been identified within nematodes. However, phylogenetic analyses suggest that these nematode inteins may be derived from an ancestral nematode true hedgehog gene, and that the non-bilaterian intein-containing genes identified here may represent an ancestral state prior to the domain swapping events that resulted in the formation of true hedgehog genes in the cnidarian-bilaterian ancestor. Genomic surveys of N. vectensis suggest that most of the components of both protostome and deuterostome Hh signaling pathways are present in anthozoans and that some appear to have been lost in ecdysozoan lineages. Cnidarians possess many bilaterian cell-cell signaling pathways (Wnt, TGFß, FGF and Hh) that appear to act in concert to pattern tissues along the oral-aboral axis of the polyp

  4. Positive and Negative Regulation of Muscle Cell Identity by Members of the hedgehog and TGF-β Gene Families

    PubMed Central

    Du, Shao Jun; Devoto, Stephen H.; Westerfield, Monte; Moon, Randall T.

    1997-01-01

    We have examined whether the development of embryonic muscle fiber type is regulated by competing influences between Hedgehog and TGF-β signals, as previously shown for development of neuronal cell identity in the neural tube. We found that ectopic expression of Hedgehogs or inhibition of protein kinase A in zebrafish embryos induces slow muscle precursors throughout the somite but muscle pioneer cells only in the middle of the somite. Ectopic expression in the notochord of Dorsalin-1, a member of the TGF-β superfamily, inhibits the formation of muscle pioneer cells, demonstrating that TGF-β signals can antagonize the induction of muscle pioneer cells by Hedgehog. We propose that a Hedgehog signal first induces the formation of slow muscle precursor cells, and subsequent Hedgehog and TGF-β signals exert competing positive and negative influences on the development of muscle pioneer cells. PMID:9314535

  5. Evolutionary analyses of hedgehog and Hoxd-10 genes in fish species closely related to the zebrafish

    PubMed Central

    Zardoya, Rafael; Abouheif, Ehab; Meyer, Axel

    1996-01-01

    The study of development has relied primarily on the isolation of mutations in genes with specific functions in development and on the comparison of their expression patterns in normal and mutant phenotypes. Comparative evolutionary analyses can complement these approaches. Phylogenetic analyses of Sonic hedgehog (Shh) and Hoxd-10 genes from 18 cyprinid fish species closely related to the zebrafish provide novel insights into the functional constraints acting on Shh. Our results confirm and extend those gained from expression and crystalline structure analyses of this gene. Unexpectedly, exon 1 of Shh is found to be almost invariant even in third codon positions among these morphologically divergent species suggesting that this exon encodes for a functionally important domain of the hedgehog protein. This is surprising because the main functional domain of Shh had been thought to be that encoded by exon 2. Comparisons of Shh and Hoxd-10 gene sequences and of resulting gene trees document higher evolutionary constraints on the former than on the latter. This might be indicative of more general evolutionary patterns in networks of developmental regulatory genes interacting in a hierarchical fashion. The presence of four members of the hedgehog gene family in cyprinid fishes was documented and their homologies to known hedgehog genes in other vertebrates were established. PMID:8917540

  6. Sonic hedgehog elevates N-myc gene expression in neural stem cells.

    PubMed

    Liu, Dongsheng; Wang, Shouyu; Cui, Yan; Shen, Lun; Du, Yanping; Li, Guilin; Zhang, Bo; Wang, Renzhi

    2012-08-05

    Proliferation of neural stem cells is regulated by the secreted signaling molecule sonic hedgehog. In this study, neural stem cells were infected with recombinant adeno-associated virus expressing sonic hedgehog-N-enhanced green fluorescent protein. The results showed that overexpression of sonic hedgehog in neural stem cells induced the increased expression of Gli1 and N-myc, a target gene of sonic hedgehog. These findings suggest that N-myc is a direct downstream target of the sonic hedgehog signal pathway in neural stem cells. Sonic hedgehog and N-myc are important mediators of sonic hedgehog-induced proliferation of neural stem cells.

  7. Hedgehog signaling regulates gene expression in planarian glia

    PubMed Central

    Wang, Irving E; Lapan, Sylvain W; Scimone, M Lucila; Clandinin, Thomas R; Reddien, Peter W

    2016-01-01

    Hedgehog signaling is critical for vertebrate central nervous system (CNS) development, but its role in CNS biology in other organisms is poorly characterized. In the planarian Schmidtea mediterranea, hedgehog (hh) is expressed in medial cephalic ganglia neurons, suggesting a possible role in CNS maintenance or regeneration. We performed RNA sequencing of planarian brain tissue following RNAi of hh and patched (ptc), which encodes the Hh receptor. Two misregulated genes, intermediate filament-1 (if-1) and calamari (cali), were expressed in a previously unidentified non-neural CNS cell type. These cells expressed orthologs of astrocyte-associated genes involved in neurotransmitter uptake and metabolism, and extended processes enveloping regions of high synapse concentration. We propose that these cells are planarian glia. Planarian glia were distributed broadly, but only expressed if-1 and cali in the neuropil near hh+ neurons. Planarian glia and their regulation by Hedgehog signaling present a novel tractable system for dissection of glia biology. DOI: http://dx.doi.org/10.7554/eLife.16996.001 PMID:27612382

  8. Two lamprey Hedgehog genes share non-coding regulatory sequences and expression patterns with gnathostome Hedgehogs.

    PubMed

    Kano, Shungo; Xiao, Jin-Hua; Osório, Joana; Ekker, Marc; Hadzhiev, Yavor; Müller, Ferenc; Casane, Didier; Magdelenat, Ghislaine; Rétaux, Sylvie

    2010-10-13

    Hedgehog (Hh) genes play major roles in animal development and studies of their evolution, expression and function point to major differences among chordates. Here we focused on Hh genes in lampreys in order to characterize the evolution of Hh signalling at the emergence of vertebrates. Screening of a cosmid library of the river lamprey Lampetra fluviatilis and searching the preliminary genome assembly of the sea lamprey Petromyzon marinus indicate that lampreys have two Hh genes, named Hha and Hhb. Phylogenetic analyses suggest that Hha and Hhb are lamprey-specific paralogs closely related to Sonic/Indian Hh genes. Expression analysis indicates that Hha and Hhb are expressed in a Sonic Hh-like pattern. The two transcripts are expressed in largely overlapping but not identical domains in the lamprey embryonic brain, including a newly-described expression domain in the nasohypophyseal placode. Global alignments of genomic sequences and local alignment with known gnathostome regulatory motifs show that lamprey Hhs share conserved non-coding elements (CNE) with gnathostome Hhs albeit with sequences that have significantly diverged and dispersed. Functional assays using zebrafish embryos demonstrate gnathostome-like midline enhancer activity for CNEs contained in intron2. We conclude that lamprey Hh genes are gnathostome Shh-like in terms of expression and regulation. In addition, they show some lamprey-specific features, including duplication and structural (but not functional) changes in the intronic/regulatory sequences.

  9. Cloning and bioinformatical analysis of the N-terminus of the sonic hedgehog gene.

    PubMed

    Zhang, Yi; Zhao, Shu; Dong, Weiren; He, Suifen; Wang, Haihong; Zhang, Lihua; Tang, Yinjuan; Guo, Jiasong; Guo, Suiqun

    2013-01-25

    The sonic hedgehog protein not only plays a key role in early embryonic development, but also has essential effects on the adult nervous system, including neural stem cell proliferation, differentiation, migration and neuronal axon guidance. The N-terminal fragment of sonic hedgehog is the key functional element in this process. Therefore, this study aimed to clone and analyze the N-terminal fragment of the sonic hedgehog gene. Total RNA was extracted from the notochord of a Sprague-Dawley rat at embryonic day 9 and the N-terminal fragment of sonic hedgehog was amplified by nested reverse transcription-PCR. The N-terminal fragment of the sonic hedgehog gene was successfully cloned. The secondary and tertiary structures of the N-terminal fragment of the sonic hedgehog protein were predicted using Jpred and Phyre online.

  10. NHR-23 dependent collagen and hedgehog-related genes required for molting

    SciTech Connect

    Kouns, Nathaniel A.; Nakielna, Johana; Behensky, Frantisek; Krause, Michael W.; Kostrouch, Zdenek; Kostrouchova, Marta

    2011-10-07

    Highlights: {yields} NHR-23 is a critical regulator of nematode development and molting. {yields} The manuscript characterizes the loss-of-function phenotype of an nhr-23 mutant. {yields} Whole genome expression analysis identifies new potential targets of NHR-23. {yields} Hedgehog-related genes are identified as NHR-23 dependent genes. {yields} New link between sterol mediated signaling and regulation by NHR-23 is found. -- Abstract: NHR-23, a conserved member of the nuclear receptor family of transcription factors, is required for normal development in Caenorhabditis elegans where it plays a critical role in growth and molting. In a search for NHR-23 dependent genes, we performed whole genome comparative expression microarrays on both control and nhr-23 inhibited synchronized larvae. Genes that decreased in response to nhr-23 RNAi included several collagen genes. Unexpectedly, several hedgehog-related genes were also down-regulated after nhr-23 RNAi. A homozygous nhr-23 deletion allele was used to confirm the RNAi knockdown phenotypes and the changes in gene expression. Our results indicate that NHR-23 is a critical co-regulator of functionally linked genes involved in growth and molting and reveal evolutionary parallels among the ecdysozoa.

  11. SOX18 Is a Novel Target Gene of Hedgehog Signaling in Cervical Carcinoma Cell Lines

    PubMed Central

    Popovic, Jelena; Schwirtlich, Marija; Rankovic, Branislava; Stevanovic, Milena

    2015-01-01

    Although there is much evidence showing functional relationship between Hedgehog pathway, in particular Sonic hedgehog, and SOX transcription factors during embryonic development, scarce data are available regarding their crosstalk in cancer cells. SOX18 protein plays an important role in promoting tumor angiogenesis and therefore emerged as a promising potential target in antiangiogenic tumor therapy. Recently it became evident that expression of SOX18 gene in tumors is not restricted to endothelium of accompanying blood and lymphatic vessels, but in tumor cells as well.In this paper we have identified human SOX18 gene as a novel target gene of Hedgehog signaling in cervical carcinoma cell lines. We have presented data showing that expression of SOX18 gene is regulated by GLI1 and GLI2 transcription factors, final effectors of Hedgehog signaling, and that modulation of Hedgehog signaling activity in considerably influence SOX18 expression. We consider important that Hedgehog pathway inhibitors reduced SOX18 expression, thus showing, for the first time, possibility for manipulationwith SOX18 gene expression. In addition, we analyzed the role of SOX18 in malignant potential of cervical carcinoma cell line, and showed that its overexpression has no influence on cells proliferation and viability, but substantially promotes migration and invasion of cells in vitro. Pro-migratory effect of SOX18 suggests its role in promoting malignant spreading, possibly in response to Hedgehog activation. PMID:26588701

  12. Sex and hedgehog: roles of genes in the hedgehog signaling pathway in mammalian sexual differentiation.

    PubMed

    Franco, Heather L; Yao, Humphrey H-C

    2012-01-01

    The chromosome status of the mammalian embryo initiates a multistage process of sexual development in which the bipotential reproductive system establishes itself as either male or female. These events are governed by intricate cell-cell and interorgan communication that is regulated by multiple signaling pathways. The hedgehog signaling pathway was originally identified for its key role in the development of Drosophila, but is now recognized as a critical developmental regulator in many species, including humans. In addition to its developmental roles, the hedgehog signaling pathway also modulates adult organ function, and misregulation of this pathway often leads to diseases, such as cancer. The hedgehog signaling pathway acts through its morphogenetic ligands that signal from ligand-producing cells to target cells over a specified distance. The target cells then respond in a graded manner based on the concentration of the ligands that they are exposed to. Through this unique mechanism of action, the hedgehog signaling pathway elicits cell fate determination, epithelial-mesenchymal interactions, and cellular homeostasis. Here, we review current findings on the roles of hedgehog signaling in the sexually dimorphic development of the reproductive organs with an emphasis on mammals and comparative evidence in other species.

  13. Desert hedgehog is a mammal-specific gene expressed during testicular and ovarian development in a marsupial

    PubMed Central

    2011-01-01

    Background Desert hedgehog (DHH) belongs to the hedgehog gene family that act as secreted intercellular signal transducers. DHH is an essential morphogen for normal testicular development and function in both mice and humans but is not present in the avian lineage. Like other hedgehog proteins, DHH signals through the patched (PTCH) receptors 1 and 2. Here we examine the expression and protein distribution of DHH, PTCH1 and PTCH2 in the developing testes of a marsupial mammal (the tammar wallaby) to determine whether DHH signalling is a conserved factor in gonadal development in all therian mammals. Results DHH, PTCH1 and PTCH2 were present in the marsupial genome and highly conserved with their eutherian orthologues. Phylogenetic analyses indicate that DHH has recently evolved and is a mammal-specific hedgehog orthologue. The marsupial PTCH2 receptor had an additional exon (exon 21a) not annotated in eutherian PTCH2 proteins. Interestingly we found evidence of this exon in humans and show that its translation would result in a truncated protein with functions similar to PTCH1. We also show that DHH expression was not restricted to the testes during gonadal development (as in mice), but was also expressed in the developing ovary. Expression of DHH, PTCH1 and PTCH2 in the adult tammar testis and ovary was consistent with findings in the adult mouse. Conclusions These data suggest that there is a highly conserved role for DHH signalling in the differentiation and function of the mammalian testis and that DHH may be necessary for marsupial ovarian development. The receptors PTCH1 and PTCH2 are highly conserved mediators of hedgehog signalling in both the developing and adult marsupial gonads. Together these findings indicate DHH is an essential therian mammal-specific morphogen in gonadal development and gametogenesis. PMID:22132805

  14. Evolution of hedgehog and hedgehog-related genes, their origin from Hog proteins in ancestral eukaryotes and discovery of a novel Hint motif

    PubMed Central

    Bürglin, Thomas R

    2008-01-01

    Background The Hedgehog (Hh) signaling pathway plays important roles in human and animal development as well as in carcinogenesis. Hh molecules have been found in both protostomes and deuterostomes, but curiously the nematode Caenorhabditis elegans lacks a bona-fide Hh. Instead a series of Hh-related proteins are found, which share the Hint/Hog domain with Hh, but have distinct N-termini. Results We performed extensive genome searches such as the cnidarian Nematostella vectensis and several nematodes to gain further insights into Hh evolution. We found six genes in N. vectensis with a relationship to Hh: two Hh genes, one gene with a Hh N-terminal domain fused to a Willebrand factor type A domain (VWA), and three genes containing Hint/Hog domains with distinct novel N-termini. In the nematode Brugia malayi we find the same types of hh-related genes as in C. elegans. In the more distantly related Enoplea nematodes Xiphinema and Trichinella spiralis we find a bona-fide Hh. In addition, T. spiralis also has a quahog gene like C. elegans, and there are several additional hh-related genes, some of which have secreted N-terminal domains of only 15 to 25 residues. Examination of other Hh pathway components revealed that T. spiralis - like C. elegans - lacks some of these components. Extending our search to all eukaryotes, we recovered genes containing a Hog domain similar to Hh from many different groups of protists. In addition, we identified a novel Hint gene family present in many eukaryote groups that encodes a VWA domain fused to a distinct Hint domain we call Vint. Further members of a poorly characterized Hint family were also retrieved from bacteria. Conclusion In Cnidaria and nematodes the evolution of hh genes occurred in parallel to the evolution of other genes that contain a Hog domain but have different N-termini. The fact that Hog genes comprising a secreted N-terminus and a Hog domain are found in many protists indicates that this gene family must have

  15. Complete mitochondrial genome of the Amur hedgehog Erinaceus amurensis (Erinaceidae) and higher phylogeny of the family Erinaceidae.

    PubMed

    Kim, N H; Lim, S J; Chae, H M; Park, Y C

    2017-02-08

    We sequenced and characterized the complete mitogenome (KX964606) of the Amur hedgehog Erinaceus amurensis to provide more data for comparative mitogenomics of the genus Erinaceus (Erinaceidae). The mitogenome of E. amurensis is a circular molecule 16,941 bp long, consisting of a control region and a conserved set of 37 genes containing 13 protein-coding genes, 22 tRNA genes, and two rRNA genes (12S rRNA and 16S rRNA). The mitogenome of E. amurensis is AT-biased, with a nucleotide composition of 33.9% A, 21.1% C, 32.6% T, and 12.4% G. The mitogenomes of E. amurensis and the closely related hedgehog species E. europaeus, excluding the control region (66.7%), share over 90% sequence similarity. According to the inter-generic relationship based on six mitogenomes described from five genera of Erinaceidae, the subfamilies Erinaceinae and Galericinae are strongly supported as monophyletic groups, with each genus well placed within its own subfamily. Within the subfamily Erinaceinae, E. amurensis is a sister species to E. europaeus, and the relationship between Hemiechinus and Erinaceus is strongly supported. Within the subfamily Galericinae, the clade of Hylomys + Neotetracus was sister to that of Echinosorex, with clades supported by high values. Our findings will help to understand the codon usage pattern and molecular evolution of E. amurensis, and provide insight into inter-generic relationships within the family Erinaceidae. In future studies, the inclusion of mitogenomes from other genera would greatly enhance our understanding of higher phylogeny within the Erinaceidae.

  16. Foxf genes integrate tbx5 and hedgehog pathways in the second heart field for cardiac septation.

    PubMed

    Hoffmann, Andrew D; Yang, Xinan Holly; Burnicka-Turek, Ozanna; Bosman, Joshua D; Ren, Xiaomeng; Steimle, Jeffrey D; Vokes, Steven A; McMahon, Andrew P; Kalinichenko, Vladimir V; Moskowitz, Ivan P

    2014-10-01

    The Second Heart Field (SHF) has been implicated in several forms of congenital heart disease (CHD), including atrioventricular septal defects (AVSDs). Identifying the SHF gene regulatory networks required for atrioventricular septation is therefore an essential goal for understanding the molecular basis of AVSDs. We defined a SHF Hedgehog-dependent gene regulatory network using whole genome transcriptional profiling and GLI-chromatin interaction studies. The Forkhead box transcription factors Foxf1a and Foxf2 were identified as SHF Hedgehog targets. Compound haploinsufficiency for Foxf1a and Foxf2 caused atrioventricular septal defects, demonstrating the biological relevance of this regulatory network. We identified a Foxf1a cis-regulatory element that bound the Hedgehog transcriptional regulators GLI1 and GLI3 and the T-box transcription factor TBX5 in vivo. GLI1 and TBX5 synergistically activated transcription from this cis-regulatory element in vitro. This enhancer drove reproducible expression in vivo in the posterior SHF, the only region where Gli1 and Tbx5 expression overlaps. Our findings implicate Foxf genes in atrioventricular septation, describe the molecular underpinnings of the genetic interaction between Hedgehog signaling and Tbx5, and establish a molecular model for the selection of the SHF gene regulatory network for cardiac septation.

  17. Sonic Hedgehog: A Good Gene Gone Bad? Detection and Treatment of Genetic Abnormalities.

    ERIC Educational Resources Information Center

    Yaich, Lauren E.

    2001-01-01

    Presents a case of a baby born with the genetic condition holoprosencephaly in which students explore the "Sonic hedgehog" gene, signal transduction, and the ethics of body and tissue donation. Presents a two-part assignment that features students writing an informed consent document that explains the science behind this congenital abnormality,…

  18. Foxf Genes Integrate Tbx5 and Hedgehog Pathways in the Second Heart Field for Cardiac Septation

    PubMed Central

    Hoffmann, Andrew D.; Yang, Xinan Holly; Burnicka-Turek, Ozanna; Bosman, Joshua D.; Ren, Xiaomeng; Steimle, Jeffrey D.; Vokes, Steven A.; McMahon, Andrew P.; Kalinichenko, Vladimir V.; Moskowitz, Ivan P.

    2014-01-01

    The Second Heart Field (SHF) has been implicated in several forms of congenital heart disease (CHD), including atrioventricular septal defects (AVSDs). Identifying the SHF gene regulatory networks required for atrioventricular septation is therefore an essential goal for understanding the molecular basis of AVSDs. We defined a SHF Hedgehog-dependent gene regulatory network using whole genome transcriptional profiling and GLI-chromatin interaction studies. The Forkhead box transcription factors Foxf1a and Foxf2 were identified as SHF Hedgehog targets. Compound haploinsufficiency for Foxf1a and Foxf2 caused atrioventricular septal defects, demonstrating the biological relevance of this regulatory network. We identified a Foxf1a cis-regulatory element that bound the Hedgehog transcriptional regulators GLI1 and GLI3 and the T-box transcription factor TBX5 in vivo. GLI1 and TBX5 synergistically activated transcription from this cis-regulatory element in vitro. This enhancer drove reproducible expression in vivo in the posterior SHF, the only region where Gli1 and Tbx5 expression overlaps. Our findings implicate Foxf genes in atrioventricular septation, describe the molecular underpinnings of the genetic interaction between Hedgehog signaling and Tbx5, and establish a molecular model for the selection of the SHF gene regulatory network for cardiac septation. PMID:25356765

  19. The expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats

    SciTech Connect

    Katayama, Seiichi . E-mail: katayama@ankaken.co.jp; Ashizawa, Koji; Gohma, Hiroshi; Fukuhara, Tadahiro; Narumi, Kazunori; Tsuzuki, Yasuhiro; Tatemoto, Hideki; Nakada, Tadashi; Nagai, Kenji

    2006-12-15

    The objective of this study was to investigate the effects of estrogen receptor (ER) agonists and an ER antagonist on the expression of Hedgehog genes (Indian hedgehog: Ihh; Desert hedgehog: Dhh) and Hedgehog target genes (Patched 1: Ptc1; glioma-associated oncogene homolog 1: Gli1; chicken ovalbumin upstream promoter transcription factor II: Coup-TfII) in the rat uterus. Immature female rats were administered once with 17{alpha}-ethynyl estradiol (EE, an ER agonist), propyl pyrazole triole (PPT, an ER{alpha}-selective agonist), diarylpropionitrile (DPN, an ER{beta}-selective agonist), or ICI 182,780 (an ER antagonist). Expression of mRNA for Ihh, Dhh, and Ptc1 was dose-dependently downregulated by EE in the uterus of immature rats, mediated by ER as confirmed by coadministration of ICI 182,780. The mRNA expression levels of Ptc1, Gli1, and Coup-TfII were simultaneously downregulated during the period in which the mRNA expression levels of Ihh and Dhh were downregulated in the uterus after administration of EE. PPT downregulated the transcription of Ihh, Dhh, Ptc1, Gli1, and Coup-TfII, indicating that expression of these genes was regulated by the ER{alpha}-dependent pathway. DPN also downregulated the transcription of Ihh and Dhh, although the effect was weaker than that of PPT, indicating that the regulation of uterine Ihh and Dhh transcription was also affected by the ER{beta}-dependent pathway. These results suggest that the expression of Hedgehog genes (Ihh, Dhh) and Hedgehog target genes (Ptc1, Gli1, Coup-TfII) is affected by estrogenic stimuli in the uterus of immature female rats.

  20. Hedgehog nanopackages ready for dispatch.

    PubMed

    Vincent, Jean-Paul

    2008-06-27

    Hedgehog proteins are intercellular long-range signaling molecules that spread within tissues and activate gene expression during development. Vyas et al. (2008) propose that Hedgehog forms nanometer-sized oligomers that localize in proteoglycan-rich clusters at the surface of cells expressing Hedgehog. This nanoscale organization and enrichment in clusters ensures that Hedgehog is able to spread and activate signaling over many cell diameters.

  1. Characterizing gene family evolution

    PubMed Central

    Liberles, David A.

    2008-01-01

    Gene families are widely used in comparative genomics, molecular evolution, and in systematics. However, they are constructed in different manners, their data analyzed and interpreted differently, with different underlying assumptions, leading to sometimes divergent conclusions. In systematics, concepts like monophyly and the dichotomy between homoplasy and homology have been central to the analysis of phylogenies. We critique the traditional use of such concepts as applied to gene families and give examples of incorrect inferences they may lead to. Operational definitions that have emerged within functional genomics are contrasted with the common formal definitions derived from systematics. Lastly, we question the utility of layers of homology and the meaning of homology at the character state level in the context of sequence evolution. From this, we move forward to present an idealized strategy for characterizing gene family evolution for both systematic and functional purposes, including recent methodological improvements. PMID:19461954

  2. The sulfatase gene family.

    PubMed

    Parenti, G; Meroni, G; Ballabio, A

    1997-06-01

    During the past few years, molecular analyses have provided important insights into the biochemistry and genetics of the sulfatase family of enzymes, identifying the molecular bases of inherited diseases caused by sulfatase deficiencies. New members of the sulfatase gene family have been identified in man and other species using a genomic approach. These include the gene encoding arylsulfatase E, which is involved in X-linked recessive chondrodysplasia punctata, a disorder of cartilage and bone development. Another important breakthrough has been the discovery of the biochemical basis of multiple sulfatase deficiency, an autosomal recessive disorder characterized by a severe of all sulfatase activities. These discoveries, together with the resolution of the crystallographic structure of sulfatases, have improved our understanding of the function and evolution of this fascinating family of enzymes.

  3. Hedgehog pathway-regulated gene networks in cerebellum development and tumorigenesis.

    PubMed

    Lee, Eunice Y; Ji, Hongkai; Ouyang, Zhengqing; Zhou, Baiyu; Ma, Wenxiu; Vokes, Steven A; McMahon, Andrew P; Wong, Wing H; Scott, Matthew P

    2010-05-25

    Many genes initially identified for their roles in cell fate determination or signaling during development can have a significant impact on tumorigenesis. In the developing cerebellum, Sonic hedgehog (Shh) stimulates the proliferation of granule neuron precursor cells (GNPs) by activating the Gli transcription factors. Inappropriate activation of Shh target genes results in unrestrained cell division and eventually medulloblastoma, the most common pediatric brain malignancy. We find dramatic differences in the gene networks that are directly driven by the Gli1 transcription factor in GNPs and medulloblastoma. Gli1 binding location analysis revealed hundreds of genomic loci bound by Gli1 in normal and cancer cells. Only one third of the genes bound by Gli1 in GNPs were also bound in tumor cells. Correlation with gene expression levels indicated that 116 genes were preferentially transcribed in tumors, whereas 132 genes were target genes in both GNPs and medulloblastoma. Quantitative PCR and in situ hybridization for some putative target genes support their direct regulation by Gli. The results indicate that transformation of normal GNPs into deadly tumor cells is accompanied by a distinct set of Gli-regulated genes and may provide candidates for targeted therapies.

  4. Interaction of sonic hedgehog (SHH) pathway with cancer stem cell genes in gastric cancer.

    PubMed

    Samadani, Ali Akbar; Akhavan-Niaki, Haleh

    2015-03-01

    Gastric cancer may appear by frequent genetic or epigenetic changes in oncogenes, tumor suppressor or DNA mismatch repair genes. Molecular studies show the possibility of involvement of certain cancer pathways in gastric cancer. In this respect, DNA methylation is one of the most important epigenetic alterations in gastric cancer and identifying the signaling mechanism and also methylation of some genes that are involved in gastric cancer can help to improve treatment strategies. Relatively, there are many reported methylation alteration of genes in stem cells in all kinds of tumors with some of these genes having a key role in tumor development. Correspondingly, KLF5, CDX1/2, WNT1 and FEM1A are considerable genes in gastric cancer, although many researches and studies have illustrated that sonic hedgehog and expression of its signaling cascade proteins are related in gastric cancer. Relatively, modification in these genes causes many eclectic cancers such as rhabdomyosarcoma and diverse kinds of digestive system tumor development. Conspicuously, these master genes have a noticeable role in stem cell's growth regulation as well as other kinds of cancer such as breast cancer and leukemia. Hence, we concluded that research and studies on methylation and expression of these genes and also the investigation of molecular signaling in gastric cancer can acquire impressive conclusions in order to control and treat this common place and serious problem.

  5. Role of the hedgehog/patched signaling pathway in oncogenesis: a new polymorphism in the PTCH gene in ovarian fibroma.

    PubMed

    Levanat, Sonja; Musani, Vesna; Komar, Arijana; Oreskovic, S

    2004-12-01

    We compared the expression of target genes of Hedgehog/Patched signaling in ovarian fibromas and ovarian dermoids. We noted that high levels of SHH appear almost regularly, especially in dermoids, usually accompanied by increased expression of SMO. GLI overexpression does not coincide with that of PTCH. Loss of heterozygosity findings in the PTCH locus and increased expression of several genes in the pathway strongly suggest that the pathway is involved in both ovarian fibroma and dermoids.

  6. Occurrence and molecular characterization of Cryptosporidium spp. genotypes in European hedgehogs (Erinaceus europaeus L.) in Germany.

    PubMed

    Dyachenko, V; Kuhnert, Y; Schmaeschke, R; Etzold, M; Pantchev, N; Daugschies, A

    2010-02-01

    Juvenile hedgehogs having insufficient body weight are often brought for overwintering to hedgehog rehabilitation centres. Faecal samples of juvenile hedgehogs and overwintering hedgehogs (n=188) collected prior to releasing them back into the wilderness were examined for the presence of Cryptosporidium coproantigen and oocysts. Altogether 56 (29.8%) submitted samples were positive for coproantigen. Forty-five (39.5%, n=114) of the positive samples originated from newly rescued hedgehogs, while 11 (14.8%, n=74) positive samples were from animals that spent several months at the station. Fifteen samples subjected to PCR-RFLP analysis on the partial 18S rRNA locus suggested the presence of C. parvum. Multilocus sequence typing on partial 60 kDa glycoprotein gene, 18S rRNA, actin gene, 70 kDa heat shock protein gene sequences revealed 3 different subtype families: IIa, IIc and a new, proposed as VIIa subtype family. Cryptosporidium sp. genotype belonging to VIIa subtype family is closely related to C. parvum but is genetically distinct being probably a hedgehog-specific Cryptosporidium sp. genotype with unknown zoonotical potential. Hedgehogs excreting Cryptosporidium oocysts represent a potential source for human infections, but also an anthroponotic nature of the IIc subtype family should be reviewed.

  7. An integrated approach identifies Nhlh1 and Insm1 as Sonic Hedgehog-regulated genes in developing cerebellum and medulloblastoma.

    PubMed

    De Smaele, Enrico; Fragomeli, Caterina; Ferretti, Elisabetta; Pelloni, Marianna; Po, Agnese; Canettieri, Gianluca; Coni, Sonia; Di Marcotullio, Lucia; Greco, Azzura; Moretti, Marta; Di Rocco, Concezio; Pazzaglia, Simona; Maroder, Marella; Screpanti, Isabella; Giannini, Giuseppe; Gulino, Alberto

    2008-01-01

    Medulloblastoma (MB) is the most common malignant brain tumor of childhood arising from deregulated cerebellar development. Sonic Hedgehog (Shh) pathway plays a critical role in cerebellar development and its aberrant expression has been identified in MB. Gene expression profiling of cerebella from 1- to 14-day-old mice unveiled a cluster of genes whose expression correlates with the levels of Hedgehog (HH) activity. From this cluster, we identified Insm1 and Nhlh1/NSCL1 as novel HH targets induced by Shh treatment in cultured cerebellar granule cell progenitors. Nhlh1 promoter was found to be bound and activated by Gli1 transcription factor. Remarkably, the expression of these genes is also upregulated in mouse and human HH-dependent MBs, suggesting that they may be either a part of the HH-induced tumorigenic process or a specific trait of HH-dependent tumor cells.

  8. Hedgehog signaling pathway regulated the target genes for adipogenesis in silkworm Bombyx mori.

    PubMed

    Liang, Shuang; Chen, Rui-Ting; Zhang, Deng-Pan; Xin, Hu-Hu; Lu, Yan; Wang, Mei-Xian; Miao, Yun-Gen

    2015-10-01

    Hedgehog (Hh) signals regulate invertebrate and vertebrate development, yet the role of the pathway in adipose development remains poorly understood. In this report, we found that Hh pathway components are expressed in the fat body of silkworm larvae. Functional analysis of these components in a BmN cell line model revealed that activation of the Hh gene stimulated transcription of Hh pathway components, but inhibited the expression of the adipose marker gene AP2. Conversely, specific RNA interference-mediated knockdown of Hh resulted in increased AP2 expression. This further showed the regulation of Hh signal on the adipose marker gene. In silkworm larval models, enhanced adipocyte differentiation and an increase in adipocyte cell size were observed in silkworms that had been treated with a specific Hh signaling pathway antagonist, cyclopamine. The fat-body-specific Hh blockade tests were consistent with Hh signaling inhibiting silkworm adipogenesis. Our results indicate that the role of Hh signaling in inhibiting fat formation is conserved in vertebrates and invertebrates.

  9. Deletion of Indian hedgehog gene causes dominant semi-lethal Creeper trait in chicken

    PubMed Central

    Jin, Sihua; Zhu, Feng; Wang, Yanyun; Yi, Guoqiang; Li, Junying; Lian, Ling; Zheng, Jiangxia; Xu, Guiyun; Jiao, Rengang; Gong, Yu; Hou, Zhuocheng; Yang, Ning

    2016-01-01

    The Creeper trait, a classical monogenic phenotype of chicken, is controlled by a dominant semi-lethal gene. This trait has been widely cited in the genetics and molecular biology textbooks for illustrating autosomal dominant semi-lethal inheritance over decades. However, the genetic basis of the Creeper trait remains unknown. Here we have utilized ultra-deep sequencing and extensive analysis for targeting causative mutation controlling the Creeper trait. Our results indicated that the deletion of Indian hedgehog (IHH) gene was only found in the whole-genome sequencing data of lethal embryos and Creeper chickens. Large scale segregation analysis demonstrated that the deletion of IHH was fully linked with early embryonic death and the Creeper trait. Expression analysis showed a much lower expression of IHH in Creeper than wild-type chickens. We therefore suggest the deletion of IHH to be the causative mutation for the Creeper trait in chicken. Our findings unravel the genetic basis of the longstanding Creeper phenotype mystery in chicken as the same gene also underlies bone dysplasia in human and mouse, and thus highlight the significance of IHH in animal development and human haploinsufficiency disorders. PMID:27439785

  10. Identification of sonic hedgehog as a candidate gene responsible for the polydactylous mouse mutant Sasquatch.

    PubMed

    Sharpe, J; Lettice, L; Hecksher-Sorensen, J; Fox, M; Hill, R; Krumlauf, R

    1999-01-28

    The mouse mutants of the hemimelia-luxate group (lx, lu, lst, Dh, Xt, and the more recently identified Hx, Xpl and Rim4; [1] [2] [3] [4] [5]) have in common preaxial polydactyly and longbone abnormalities. Associated with the duplication of digits are changes in the regulation of development of the anterior limb bud resulting in ectopic expression of signalling components such as Sonic hedgehog (Shh) and fibroblast growth factor-4 (Fgf4), but little is known about the molecular causes of this misregulation. We generated, by a transgene insertion event, a new member of this group of mutants, Sasquatch (Ssq), which disrupted aspects of both anteroposterior (AP) and dorsoventral (DV) patterning. The mutant displayed preaxial polydactyly in the hindlimbs of heterozygous embryos, and in both hindlimbs and forelimbs of homozygotes. The Shh, Fgf4, Fgf8, Hoxd12 and Hoxd13 genes were all ectopically expressed in the anterior region of affected limb buds. The insertion site was found to lie close to the Shh locus. Furthermore, expression from the transgene reporter has come under the control of a regulatory element that directs a pattern mirroring the endogenous expression pattern of Shh in limbs. In abnormal limbs, both Shh and the reporter were ectopically induced in the anterior region, whereas in normal limbs the reporter and Shh were restricted to the zone of polarising activity (ZPA). These data strongly suggest that Ssq is caused by direct interference with the cis regulation of the Shh gene.

  11. Indian hedgehog gene transfer is a chondrogenic inducer of human mesenchymal stem cells

    PubMed Central

    2012-01-01

    Introduction To date, no single most-appropriate factor or delivery method has been identified for the purpose of mesenchymal stem cell (MSC)-based treatment of cartilage injury. Therefore, in this study we tested whether gene delivery of the growth factor Indian hedgehog (IHH) was able to induce chondrogenesis in human primary MSCs, and whether it was possible by such an approach to modulate the appearance of chondrogenic hypertrophy in pellet cultures in vitro. Methods First-generation adenoviral vectors encoding the cDNA of the human IHH gene were created by cre-lox recombination and used alone or in combination with adenoviral vectors, bone morphogenetic protein-2 (Ad.BMP-2), or transforming growth factor beta-1 (Ad.TGF-β1) to transduce human bone-marrow derived MSCs at 5 × 102 infectious particles/cell. Thereafter, 3 × 105 cells were seeded into aggregates and cultured for 3 weeks in serum-free medium, with untransduced or marker gene transduced cultures as controls. Transgene expressions were determined by ELISA, and aggregates were analysed histologically, immunohistochemically, biochemically and by RT-PCR for chondrogenesis and hypertrophy. Results IHH, TGF-β1 and BMP-2 genes were equipotent inducers of chondrogenesis in primary MSCs, as evidenced by strong staining for proteoglycans, collagen type II, increased levels of glycosaminoglycan synthesis, and expression of mRNAs associated with chondrogenesis. IHH-modified aggregates, alone or in combination, also showed a tendency to progress towards hypertrophy, as judged by the expression of alkaline phosphatase and stainings for collagen type X and Annexin 5. Conclusion As this study provides evidence for chondrogenic induction of MSC aggregates in vitro via IHH gene delivery, this technology may be efficiently employed for generating cartilaginous repair tissues in vivo. PMID:22817660

  12. Relation between sonic hedgehog pathway gene polymorphisms and basal cell carcinoma development in the Polish population.

    PubMed

    Lesiak, Aleksandra; Sobolewska-Sztychny, Dorota; Majak, Paweł; Sobjanek, Michał; Wodz, Karolina; Sygut, Karolina Przybyłowska-; Majsterek, Ireneusz; Wozniacka, Anna; Narbutt, Joanna

    2016-01-01

    In recent decades, increases have been observed in the incidence of nonmelanoma skin cancers, including basal cell carcinoma (BCC) and squamous cell carcinoma. BCC is the most common neoplasm in Caucasian populations. Sonic hedgehog (Shh) pathway impairment plays a key role in BCC pathogenesis, and there is evidence that Shh pathway genetic variations may predispose to BCC development. We genotyped 22 single-nucleotide polymorphisms (SNPs) in 4 Shh pathway genes: SHH, GLI, SMO, and PTCH. The study group consisted of 142 BCC patients and 142 age-matched, sex-matched healthy subjects (controls). SNPs were assessed using the PCR-RFLP method. The genotype distribution for the polymorphisms in the rs104894049 331 A/T SHH, rs104894040 349 T/C SHH, and rs41303402 385 G/A SMO genes differed significantly between the BCC patients and the controls. The presence of CC genotype in the SHH rs104894040 349 T/C polymorphism was linked to the highest risk of BCC development (OR 87.9, p < 0.001). Other genotypes, such as the TT in SHH rs104894049 331 A/T and the GG in SMO rs41303402 385 G/A also statistically raised the risk of BCC, but these associations were weaker. Other investigated polymorphisms showed no statistical differences between patients and controls. The results obtained testify to the importance of the SHH and SMO gene polymorphisms in skin cancerogenesis. These results mainly underline the potential role of SHH3 rs104894040 349 T/C gene polymorphism in the development of skin basal cell carcinomas in patients of Polish origin.

  13. Genetic variation in mitochondrial genes of the tick Haemaphysalis flava collected from wild hedgehogs in China.

    PubMed

    Li, Zhong-Bo; Cheng, Tian-Yin; Xu, Xing-Li; Song, Lu-Lin; Liu, Guo-Hua

    2017-02-01

    The tick Haemaphysalis flava (Acari: Ixodidae) is an important ectoparasite, which causes direct damage to their hosts and also acts as a vector of various infectious disease agents in China. Despite its significance, the epidemiology, genetics and biology of H. flava has not been studied in detail. In the present study, the genetic variation in three mitochondrial (mt) DNA regions, namely cytochrome c oxidase subunit 1 (cox1) and NADH dehydrogenase subunit 1 and 4 (nad1 and nad4), was examined in H. flava ticks collected from wild hedgehogs in China. A portion of cox1 (pcox1), nad1 (pnad1) and nad4 (pnad4) genes were PCR amplified from individual H. flava ticks and the amplicons were sequenced. The length of the sequences of pcox1, pnad1 and pnad4 were 849, 285 and 626 bp, respectively. The intra-specific sequence variation within H. flava was 0-0.4% for pcox1, 0-0.4% for pnad1 and 0-0.3% for pnad4. However, the inter-specific variation was significantly higher, 12.5-14.3%, 13.6-24.8% and 14.8-19% for pcox1, pnad1 and pnad4, respectively. Phylogenetic analysis based on Maximum likelihood (ML) method using the combined target mt gene sequences confirmed that all isolates of Haemaphysalis were H. flava. The molecular approach employed in this study provides a tool for further elucidating the molecular diversity of H. flava in China and elsewhere in Asia.

  14. Synergism between Hedgehog-GLI and EGFR signaling in Hedgehog-responsive human medulloblastoma cells induces downregulation of canonical Hedgehog-target genes and stabilized expression of GLI1.

    PubMed

    Götschel, Frank; Berg, Daniela; Gruber, Wolfgang; Bender, Christian; Eberl, Markus; Friedel, Myriam; Sonntag, Johanna; Rüngeler, Elena; Hache, Hendrik; Wierling, Christoph; Nietfeld, Wilfried; Lehrach, Hans; Frischauf, Annemarie; Schwartz-Albiez, Reinhard; Aberger, Fritz; Korf, Ulrike

    2013-01-01

    Aberrant activation of Hedgehog (HH) signaling has been identified as a key etiologic factor in many human malignancies. Signal strength, target gene specificity, and oncogenic activity of HH signaling depend profoundly on interactions with other pathways, such as epidermal growth factor receptor-mediated signaling, which has been shown to cooperate with HH/GLI in basal cell carcinoma and pancreatic cancer. Our experimental data demonstrated that the Daoy human medulloblastoma cell line possesses a fully inducible endogenous HH pathway. Treatment of Daoy cells with Sonic HH or Smoothened agonist induced expression of GLI1 protein and simultaneously prevented the processing of GLI3 to its repressor form. To study interactions between HH- and EGF-induced signaling in greater detail, time-resolved measurements were carried out and analyzed at the transcriptomic and proteomic levels. The Daoy cells responded to the HH/EGF co-treatment by downregulating GLI1, PTCH, and HHIP at the transcript level; this was also observed when Amphiregulin (AREG) was used instead of EGF. We identified a novel crosstalk mechanism whereby EGFR signaling silences proteins acting as negative regulators of HH signaling, as AKT- and ERK-signaling independent process. EGFR/HH signaling maintained high GLI1 protein levels which contrasted the GLI1 downregulation on the transcript level. Conversely, a high-level synergism was also observed, due to a strong and significant upregulation of numerous canonical EGF-targets with putative tumor-promoting properties such as MMP7, VEGFA, and IL-8. In conclusion, synergistic effects between EGFR and HH signaling can selectively induce a switch from a canonical HH/GLI profile to a modulated specific target gene profile. This suggests that there are more wide-spread, yet context-dependent interactions, between HH/GLI and growth factor receptor signaling in human malignancies.

  15. Synergism between Hedgehog-GLI and EGFR Signaling in Hedgehog-Responsive Human Medulloblastoma Cells Induces Downregulation of Canonical Hedgehog-Target Genes and Stabilized Expression of GLI1

    PubMed Central

    Götschel, Frank; Berg, Daniela; Gruber, Wolfgang; Bender, Christian; Eberl, Markus; Friedel, Myriam; Sonntag, Johanna; Rüngeler, Elena; Hache, Hendrik; Wierling, Christoph; Nietfeld, Wilfried; Lehrach, Hans; Frischauf, Annemarie; Schwartz-Albiez, Reinhard; Aberger, Fritz; Korf, Ulrike

    2013-01-01

    Aberrant activation of Hedgehog (HH) signaling has been identified as a key etiologic factor in many human malignancies. Signal strength, target gene specificity, and oncogenic activity of HH signaling depend profoundly on interactions with other pathways, such as epidermal growth factor receptor-mediated signaling, which has been shown to cooperate with HH/GLI in basal cell carcinoma and pancreatic cancer. Our experimental data demonstrated that the Daoy human medulloblastoma cell line possesses a fully inducible endogenous HH pathway. Treatment of Daoy cells with Sonic HH or Smoothened agonist induced expression of GLI1 protein and simultaneously prevented the processing of GLI3 to its repressor form. To study interactions between HH- and EGF-induced signaling in greater detail, time-resolved measurements were carried out and analyzed at the transcriptomic and proteomic levels. The Daoy cells responded to the HH/EGF co-treatment by downregulating GLI1, PTCH, and HHIP at the transcript level; this was also observed when Amphiregulin (AREG) was used instead of EGF. We identified a novel crosstalk mechanism whereby EGFR signaling silences proteins acting as negative regulators of HH signaling, as AKT- and ERK-signaling independent process. EGFR/HH signaling maintained high GLI1 protein levels which contrasted the GLI1 downregulation on the transcript level. Conversely, a high-level synergism was also observed, due to a strong and significant upregulation of numerous canonical EGF-targets with putative tumor-promoting properties such as MMP7, VEGFA, and IL-8. In conclusion, synergistic effects between EGFR and HH signaling can selectively induce a switch from a canonical HH/GLI profile to a modulated specific target gene profile. This suggests that there are more wide-spread, yet context-dependent interactions, between HH/GLI and growth factor receptor signaling in human malignancies. PMID:23762360

  16. The hedgehog signaling network, mammary stem cells, and breast cancer: connections and controversies.

    PubMed

    Lewis, M T; Visbal, A P

    2006-01-01

    Several signal transduction networks have been implicated in the regulation of mammary epithelial stem cell self-renewal and maintenance (Kalirai and Clarke 2006; Liu et al. 2005). These signaling networks include those of the Wnt, Notch, TGFO, EGF, FGF, IGF, and most recently, the Hedgehog (Hh) families of secreted ligands. However, we currently know very little about the cellular and molecular mechanisms by which these signaling pathways function to regulate normal epithelial stem/progenitor cells. What is clear is that the regulatory signaling networks thought to control normal stem/progenitor cell self-renewal and maintenance are, with the current sole exception of the hedgehog network, well-documented to have contributory roles in mammary cancer development and disease progression when misregulated. In this review, genetic regulation of mammary gland development by hedgehog network genes is outlined, highlighting a developing controversy as to whether activated hedgehog signaling regulates normal regenerative mammary epithelial stem cells or, indeed, whether activated hedgehog signaling functions at all in ductal development. In addition, the question of whether inappropriate hedgehog network activation influences breast cancer development is addressed, with emphasis on the prospects for using hedgehog signaling antagonists clinically for breast cancer treatment or prevention.

  17. B4GALT family mediates the multidrug resistance of human leukemia cells by regulating the hedgehog pathway and the expression of p-glycoprotein and multidrug resistance-associated protein 1

    PubMed Central

    Zhou, H; Ma, H; Wei, W; Ji, D; Song, X; Sun, J; Zhang, J; Jia, L

    2013-01-01

    β-1, 4-Galactosyltransferase gene (B4GALT) family consists of seven members, which encode corresponding enzymes known as type II membrane-bound glycoproteins. These enzymes catalyze the biosynthesis of different glycoconjugates and saccharide structures, and have been recognized to be involved in various diseases. In this study, we sought to determine the expressional profiles of B4GALT family in four pairs of parental and chemoresistant human leukemia cell lines and in bone marrow mononuclear cells (BMMC) of leukemia patients with multidrug resistance (MDR). The results revealed that B4GALT1 and B4GALT5 were highly expressed in four MDR cells and patients, altered levels of B4GALT1 and B4GALT5 were responsible for changed drug-resistant phenotype of HL60 and HL60/adriamycin-resistant cells. Further data showed that manipulation of these two gene expression led to increased or decreased activity of hedgehog (Hh) signaling and proportionally mutative expression of p-glycoprotein (P-gp) and MDR-associated protein 1 (MRP1) that are both known to be related to MDR. Thus, we propose that B4GALT1 and B4GALT5, two members of B4GALT gene family, are involved in the development of MDR of human leukemia cells, probably by regulating the activity of Hh signaling and the expression of P-gp and MRP1. PMID:23744354

  18. The Insect SNMP Gene Family

    DTIC Science & Technology

    2009-01-01

    The insect SNMP gene family Richard G. Vogt a,*,1, Natalie E. Miller a, Rachel Litvack a, Richard A. Fandino a, Jackson Sparks a, Jon Staples a...Wallace Beltsville Agricultural Research Center Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Bldg. 007, Rm. 030...keywords: Pheromone Receptors Olfactory Gustatory Chemosensory Gustatory Mosquito Fly a b s t r a c t SNMPs are membrane proteins observed to associate with

  19. Habenular Neurogenesis in Zebrafish Is Regulated by a Hedgehog, Pax6 Proneural Gene Cascade

    PubMed Central

    Naye, François; Peers, Bernard; Roussigné, Myriam; Blader, Patrick

    2016-01-01

    The habenulae are highly conserved nuclei in the dorsal diencephalon that connect the forebrain to the midbrain and hindbrain. These nuclei have been implicated in a broad variety of behaviours in humans, primates, rodents and zebrafish. Despite this, the molecular mechanisms that control the genesis and differentiation of neural progenitors in the habenulae remain relatively unknown. We have previously shown that, in zebrafish, the timing of habenular neurogenesis is left-right asymmetric and that in the absence of Nodal signalling this asymmetry is lost. Here, we show that habenular neurogenesis requires the homeobox transcription factor Pax6a and the redundant action of two proneural bHLH factors, Neurog1 and Neurod4. We present evidence that Hedgehog signalling is required for the expression of pax6a, which is in turn necessary for the expression of neurog1 and neurod4. Finally, we demonstrate by pharmacological inhibition that Hedgehog signalling is required continuously during habenular neurogenesis and by cell transplantation experiments that pathway activation is required cell autonomously. Our data sheds light on the mechanism underlying habenular development that may provide insights into how Nodal signalling imposes asymmetry on the timing of habenular neurogenesis. PMID:27387288

  20. Deregulation of the hedgehog signalling pathway: a possible role for the PTCH and SUFU genes in human rhabdomyoma and rhabdomyosarcoma development.

    PubMed

    Tostar, Ulrica; Malm, Carl Johan; Meis-Kindblom, Jeanne M; Kindblom, Lars-Gunnar; Toftgård, Rune; Undén, Anne Birgitte

    2006-01-01

    The naevoid basal cell carcinoma syndrome (NBCCS) is caused by mutations in the hedgehog receptor PTCH gene. It is characterized by developmental defects and a predisposition to the development of certain tumours, such as basal cell carcinoma, medulloblastoma and meningioma, and potentially fetal rhabdomyomas and embryonal rhabdomyosarcomas. This study aimed to analyse PTCH status in an NBCCS patient with fetal rhabdomyoma and to investigate whether deregulation of hedgehog signalling, as shown by altered expression of hedgehog pathway components and/or genetic imbalances, is a general finding in sporadic rhabdomyomas and rhabdomyosarcomas. The NBCCS patient had a novel PTCH germ-line mutation, 1370insT, and developed a fetal rhabdomyoma that harboured a 30 bp in-frame deletion in the second allele resulting in homozygous inactivation of PTCH. Sporadic rhabdomyomas and rhabdomyosarcomas showed overexpression of PTCH (43/43) and GLI1 (41/43) mRNA, as determined by in situ hybridization, indicating ongoing active hedgehog signalling. Immunohistochemical staining revealed a subgroup of fetal rhabdomyomas and embryonal rhabdomyosarcomas (12/34) lacking PTCH immunoreactivity. Four of nine informative fetal rhabdomyomas and embryonal rhabdomyosarcomas showed loss of heterozygosity (LOH) in the PTCH region with two of these (one fetal rhabdomyoma and one embryonal rhabdomyosarcoma) also showing LOH in the SUFU region. These findings suggest that haploinsufficiency for the two tumour suppressor genes PTCH and SUFU, which are both active in the same signalling pathway, may be important for tumour development. Based on our results we propose that the pathogenesis of rhabdomyoblastic tumours, particularly fetal rhabdomyomas and embryonal rhabdomyosarcomas, involves deregulation of the hedgehog signalling pathway.

  1. Familial aggregation analysis of gene expressions

    PubMed Central

    Rao, Shao-Qi; Xu, Liang-De; Zhang, Guang-Mei; Li, Xia; Li, Lin; Shen, Gong-Qing; Jiang, Yang; Yang, Yue-Ying; Gong, Bin-Sheng; Jiang, Wei; Zhang, Fan; Xiao, Yun; Wang, Qing K

    2007-01-01

    Traditional studies of familial aggregation are aimed at defining the genetic (and non-genetic) causes of a disease from physiological or clinical traits. However, there has been little attempt to use genome-wide gene expressions, the direct phenotypic measures of genes, as the traits to investigate several extended issues regarding the distributions of familially aggregated genes on chromosomes or in functions. In this study we conducted a genome-wide familial aggregation analysis by using the in vitro cell gene expressions of 3300 human autosome genes (Problem 1 data provided to Genetic Analysis Workshop 15) in order to answer three basic genetics questions. First, we investigated how gene expressions aggregate among different types (degrees) of relative pairs. Second, we conducted a bioinformatics analysis of highly familially aggregated genes to see how they are distributed on chromosomes. Third, we performed a gene ontology enrichment test of familially aggregated genes to find evidence to support their functional consensus. The results indicated that 1) gene expressions did aggregate in families, especially between sibs. Of 3300 human genes analyzed, there were a total of 1105 genes with one or more significant (empirical p < 0.05) familial correlation; 2) there were several genomic hot spots where highly familially aggregated genes (e.g., the chromosome 6 HLA genes cluster) were clustered; 3) as we expected, gene ontology enrichment tests revealed that the 1105 genes were aggregating not only in families but also in functional categories. PMID:18466548

  2. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    PubMed

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion.

  3. The insect SNMP gene family.

    PubMed

    Vogt, Richard G; Miller, Natalie E; Litvack, Rachel; Fandino, Richard A; Sparks, Jackson; Staples, Jon; Friedman, Robert; Dickens, Joseph C

    2009-07-01

    SNMPs are membrane proteins observed to associate with chemosensory neurons in insects; in Drosophila melanogaster, SNMP1 has been shown to be essential for the detection of the pheromone cis-vaccenyl acetate (CVA). SNMPs are one of three insect gene clades related to the human fatty acid transporter CD36. We previously characterized the CD36 gene family in 4 insect Orders that effectively cover the Holometabola, or some 80% of known insect species and the 300 million years of evolution since this lineage emerged: Lepidoptera (e.g. Bombyx mori, Antheraea polyphemus, Manduca sexta, Heliothis virescens, Helicoverpa assulta, Helicoverpa armigera, Mamestra brassicae); Diptera (D. melanogaster, Drosophila pseudoobscura, Aedes aegypti, Anopheles gambiae, Culex pipiens quinquefasciatus); Hymenoptera (Apis mellifera); and Coleoptera (Tribolium castaneum). This previous study suggested a complex topography within the SNMP clade including a strongly supported SNMP1 sub-clade plus additional SNMP genes. To further resolve the SNMP clade here, we used cDNA sequences of SNMP1 and SNMP2 from various Lepidoptera species, D. melanogaster and Ae. aegypti, as well as BAC derived genomic sequences from Ae. aegypti as models for proposing corrected sequences of orthologues in the D. pseudoobscura and An. gambiae genomes, and for identifying orthologues in the B. mori and C. pipiens q. genomes. We then used these sequences to analyze the SNMP clade of the insect CD36 gene family, supporting the existence of two well supported sub-clades, SNMP1 and SNMP2, throughout the dipteran and lepidopteran lineages, and plausibly throughout the Holometabola and across a broad evolutionary time scale. We present indirect evidence based on evolutionary selection (dN/dS) that the dipteran SNMPs are expressed as functional proteins. We observed expansions of the SNMP1 sub-clade in C. pipiens q. and T. castaneum suggesting that the SNMP1s may have an expanded functional role in these species.

  4. Developmental hypothyroidism abolishes bilateral differences in sonic hedgehog gene control in the rat hippocampal dentate gyrus.

    PubMed

    Tanaka, Takeshi; Wang, Liyun; Kimura, Masayuki; Abe, Hajime; Mizukami, Sayaka; Yoshida, Toshinori; Shibutani, Makoto

    2015-03-01

    Both developmental and adult-stage hypothyroidism disrupt rat hippocampal neurogenesis. We previously showed that exposing mouse offspring to manganese permanently disrupts hippocampal neurogenesis and abolishes the asymmetric distribution of cells expressing Mid1, a molecule regulated by sonic hedgehog (Shh) signaling. The present study examined the involvement of Shh signaling on the disruption of hippocampal neurogenesis in rats with hypothyroidism. Pregnant rats were treated with methimazole (MMI) at 0 or 200 ppm in the drinking water from gestation day 10-21 days after delivery (developmental hypothyroidism). Adult male rats were treated with MMI in the same manner from postnatal day (PND) 46 to PND 77 (adult-stage hypothyroidism). Developmental hypothyroidism reduced the number of Mid1(+) cells within the subgranular zone of the dentate gyrus of offspring on PND 21, and consequently abolished the normal asymmetric predominance of Mid1(+) cells on the right side through the adult stage. In control animals, Shh was expressed in a subpopulation of hilar neurons, showing asymmetric distribution with left side predominance on PND 21; however, this asymmetry did not continue through the adult stage. Developmental hypothyroidism increased Shh(+) neurons bilaterally and abolished the asymmetric distribution pattern on PND 21. Adult hypothyroidism also disrupted the asymmetric distribution of Mid1(+) cells but did not affect the distribution of Shh(+) hilar neurons. The results suggest that the hippocampal neurogenesis disruption seen in hypothyroidism involves changes in asymmetric Shh(+) neuron distribution in developmental hypothyroidism and altered Mid1 expression in both developmental and adult-stage hypothyroidism.

  5. Expression of Indian hedgehog is negatively correlated with APC gene mutation in colorectal tumors

    PubMed Central

    Fu, Xiangsheng; Shi, Lei; Zhang, Wei; Zhang, Xiaoyan; Peng, Yan; Chen, Xia; Tang, Chuankang; Li, Xiaoyun; Zhou, Xian

    2014-01-01

    The regulatory mechanism of Indian hedgehog (IHH) in colorectal carcinogenesis has not been elucidated. In the current study, the expression of IHH were investigated in 7 digestive tract cancer cell lines, and in 10 normal colorectal mucosas (NCs), 30 hyperplastic polyps (HPs), 35 colorectal adenomas (ADs), and 40 colorectal adenocarcinomas (CAs) by semi-quantitative RT-PCR and immunohistochemical staining. Moreover, the mutational status of adenomatous polyposis coli (APC) and β-catenin in these tumors were analyzed by direct sequencing. IHH mRNA was lost in the 4 colon cancer cell lines harboring APC mutation. IHH mRNA was significantly decreased in CAs (0.17 ± 0.22), compared with that in ADs (0.38 ± 0.35) and HPs (0.56 ± 0.38, P < 0.05). IHH protein was expressed at a very low level or absent in both ADs (7.51 ± 11.92) and CAs (5.15 ± 9.21) in comparison to that in HPs (19.47 ± 17.91) and NCs (42.40 ± 13.67, P < 0.05). Moreover, APC mutations were negatively correlated with IHH mRNA expression (Spearman’s R = -0.636, P < 0.01) and IHH protein expression (Spearman’s R = -0.426, P < 0.01). In conclusion, down-regulation of IHH expression might be an early event during the carcinogenesis of colorectal cancer. The activation of Wnt signaling by APC mutation might contribute to the down-regulation or loss of IHH expression in colorectal tumors. PMID:25232400

  6. Expression of Indian hedgehog is negatively correlated with APC gene mutation in colorectal tumors.

    PubMed

    Fu, Xiangsheng; Shi, Lei; Zhang, Wei; Zhang, Xiaoyan; Peng, Yan; Chen, Xia; Tang, Chuankang; Li, Xiaoyun; Zhou, Xian

    2014-01-01

    The regulatory mechanism of Indian hedgehog (IHH) in colorectal carcinogenesis has not been elucidated. In the current study, the expression of IHH were investigated in 7 digestive tract cancer cell lines, and in 10 normal colorectal mucosas (NCs), 30 hyperplastic polyps (HPs), 35 colorectal adenomas (ADs), and 40 colorectal adenocarcinomas (CAs) by semi-quantitative RT-PCR and immunohistochemical staining. Moreover, the mutational status of adenomatous polyposis coli (APC) and β-catenin in these tumors were analyzed by direct sequencing. IHH mRNA was lost in the 4 colon cancer cell lines harboring APC mutation. IHH mRNA was significantly decreased in CAs (0.17 ± 0.22), compared with that in ADs (0.38 ± 0.35) and HPs (0.56 ± 0.38, P < 0.05). IHH protein was expressed at a very low level or absent in both ADs (7.51 ± 11.92) and CAs (5.15 ± 9.21) in comparison to that in HPs (19.47 ± 17.91) and NCs (42.40 ± 13.67, P < 0.05). Moreover, APC mutations were negatively correlated with IHH mRNA expression (Spearman's R = -0.636, P < 0.01) and IHH protein expression (Spearman's R = -0.426, P < 0.01). In conclusion, down-regulation of IHH expression might be an early event during the carcinogenesis of colorectal cancer. The activation of Wnt signaling by APC mutation might contribute to the down-regulation or loss of IHH expression in colorectal tumors.

  7. Expression pattern of sonic hedgehog signaling and calcitonin gene-related peptide in the socket healing process after tooth extraction.

    PubMed

    Pang, Pai; Shimo, Tsuyoshi; Takada, Hiroyuki; Matsumoto, Kenichi; Yoshioka, Norie; Ibaragi, Soichiro; Sasaki, Akira

    2015-11-06

    Sonic Hedgehog (SHH), a neural development inducer, plays a significant role in the bone healing process. Calcitonin gene-related peptide (CGRP), a neuropeptide marker of sensory nerves, has been demonstrated to affect bone formation. The roles of SHH signaling and CGRP-positive sensory nerves in the alveolar bone formation process have been unknown. Here we examined the expression patterns of SHH signaling and CGRP in mouse socket by immunohistochemistry and immunofluorescence analysis. We found that the expression level of SHH peaked at day 3 and was then decreased at 5 days after tooth extraction. CGRP, PTCH1 and GLI2 were each expressed in a similar pattern with their highest expression levels at day 5 and day 7 after tooth extraction. CGRP and GLI2 were co-expressed in some inflammatory cells and bone forming cells. In some areas, CGRP-positive neurons expressed GLI2. In conclusion, SHH may affect alveolar bone healing by interacting with CGRP-positive sensory neurons and thus regulate the socket's healing process after tooth extraction.

  8. Tbx1, a DiGeorge syndrome candidate gene, is regulated by sonic hedgehog during pharyngeal arch development.

    PubMed

    Garg, V; Yamagishi, C; Hu, T; Kathiriya, I S; Yamagishi, H; Srivastava, D

    2001-07-01

    Appropriate interactions between the epithelium and adjacent neural crest-derived mesenchyme are necessary for normal pharyngeal arch development. Disruption of pharyngeal arch development in humans underlies many of the craniofacial defects observed in the 22q11.2 deletion syndrome (del22q11), but the genes responsible remain unknown. Tbx1 is a T-box transcription factor that lies in the 22q11.2 locus. Tbx1 transcripts were found to be localized to the pharyngeal endoderm and the mesodermal core of the pharyngeal arches, but were not present in the neural crest-derived mesenchyme of the pharyngeal arches. Sonic hedgehog (Shh) is also expressed in the pharyngeal arches and is necessary for normal craniofacial development. We found that Tbx1 expression was dependent upon Shh signaling in mouse embryos, consistent with their overlapping expression in the pharyngeal arches. Furthermore, Shh was sufficient to induce Tbx1 expression when misexpressed in selected regions of chick embryos. These studies reveal a Shh-mediated pathway that regulates Tbx1 during pharyngeal arch development.

  9. Insight from Frogs: Sonic Hedgehog Gene Expression and a Re-evaluation of the Vertebrate Odontogenic Band.

    PubMed

    Grieco, Theresa M; Hlusko, Leslea J

    2016-08-01

    While the identification of conserved processes across multiple taxa leads to an understanding of fundamental developmental mechanisms, the ways in which different animals fail to conform to common developmental processes can elucidate how evolution modifies development to result in the vast array of morphologies seen today-the developmental mechanisms that lead to anatomical variation. Odontogenesis-how teeth are initiated and formed-is well suited to the examination of both developmental conservation and phenotypic diversity. We suggest here that the study of early tooth development, the period of odontogenic band development, reveals departures from conserved mechanisms that question the role of players in the developmental process. In the earliest stages of odontogenesis, Sonic hedgehog (Shh) gene expression is interpreted as critical evidence of tooth initiation prior to any histological indication. However, a detailed examination of studies of tooth development across a wide range of taxa reveals that several vertebrate species fail to conform to the expectations of the Shh Consensus Model, calling for a reconsideration of the assumed causality of epithelial Shh in tooth initiation. We present new Shh gene expression data for an amphibian, the frog Silurana (Xenopus) tropicalis. In these animals, craniofacial and odontogenic developmental processes are more disjunct, and thereby provide a natural test of the hypothesis that Shh is immediately required for subsequent tooth development. Our results suggest that Shh expression may actually be related to the formation of the mouth rather than a required precursor to subsequent tooth formation. Anat Rec, 299:1099-1109, 2016. © 2016 Wiley Periodicals, Inc.

  10. Lineage-Specific Expansion of IFIT Gene Family: An Insight into Coevolution with IFN Gene Family

    PubMed Central

    Liu, Ying; Zhang, Yi-Bing; Liu, Ting-Kai; Gui, Jian-Fang

    2013-01-01

    In mammals, IFIT (Interferon [IFN]-induced proteins with Tetratricopeptide Repeat [TPR] motifs) family genes are involved in many cellular and viral processes, which are tightly related to mammalian IFN response. However, little is known about non-mammalian IFIT genes. In the present study, IFIT genes are identified in the genome databases from the jawed vertebrates including the cartilaginous elephant shark but not from non-vertebrates such as lancelet, sea squirt and acorn worm, suggesting that IFIT gene family originates from a vertebrate ancestor about 450 million years ago. IFIT family genes show conserved gene structure and gene arrangements. Phylogenetic analyses reveal that this gene family has expanded through lineage-specific and species-specific gene duplication. Interestingly, IFN gene family seem to share a common ancestor and a similar evolutionary mechanism; the function link of IFIT genes to IFN response is present early since the origin of both gene families, as evidenced by the finding that zebrafish IFIT genes are upregulated by fish IFNs, poly(I:C) and two transcription factors IRF3/IRF7, likely via the IFN-stimulated response elements (ISRE) within the promoters of vertebrate IFIT family genes. These coevolution features creates functional association of both family genes to fulfill a common biological process, which is likely selected by viral infection during evolution of vertebrates. Our results are helpful for understanding of evolution of vertebrate IFN system. PMID:23818968

  11. Metazoan Gene Families from Metazome

    DOE Data Explorer

    Metazome is a joint project of the Department of Energy's Joint Genome Institute and the Center for Integrative Genomics to facilitate comparative genomic studies amongst metazoans. Clusters of orthologous and paralogous genes that represent the modern descendents of ancestral gene sets are constructed at key phylogenetic nodes. These clusters allow easy access to clade specific orthology/paralogy relationships as well as clade specific genes and gene expansions. As of version 2.0.4, Metazome provides access to twenty-four sequenced and annotated metazoan genomes, clustered at nine evolutionarily significant nodes. Where possible, each gene has been annotated with PFAM, KOG, KEGG, and PANTHER assignments, and publicly available annotations from RefSeq, UniProt, Ensembl, and JGI are hyper-linked and searchable. The included organisms (by common name) are: Human, Mouse, Rat, Dog, Opossum, Chicken, Frog, Stickleback, Medaka, Fugu pufferfish; Zebrafish, Seasquirt - savignyi, Seasquirt - intestinalis, Amphioxus, Sea Urchin, Fruitfly, Mosquite, Yellow Fever Mosquito, Silkworm, Red Flour Beetle, Worm, Briggsae Worm, Owl limpet (snail), and Sea anemone. [Copied from Metazome Overview at http://www.metazome.net/Metazome_info.php

  12. Family reunion--the ZIP/prion gene family.

    PubMed

    Ehsani, Sepehr; Huo, Hairu; Salehzadeh, Ashkan; Pocanschi, Cosmin L; Watts, Joel C; Wille, Holger; Westaway, David; Rogaeva, Ekaterina; St George-Hyslop, Peter H; Schmitt-Ulms, Gerold

    2011-03-01

    Prion diseases are fatal neurodegenerative diseases of humans and animals which, in addition to sporadic and familial modes of manifestation, can be acquired via an infectious route of propagation. In disease, the prion protein (PrP(C)) undergoes a structural transition to its disease-causing form (PrP(Sc)) with profoundly different physicochemical properties. Surprisingly, despite intense interest in the prion protein, its function in the context of other cellular activities has largely remained elusive. We recently employed quantitative mass spectrometry to characterize the interactome of the prion protein in a murine neuroblastoma cell line (N2a), an established cell model for prion replication. Extensive bioinformatic analyses subsequently established an evolutionary link between the prion gene family and the family of ZIP (Zrt-, Irt-like protein) metal ion transporters. More specifically, sequence alignments, structural threading data and multiple additional pieces of evidence placed a ZIP5/ZIP6/ZIP10-like ancestor gene at the root of the PrP gene family. In this review we examine the biology of prion proteins and ZIP transporters from the viewpoint of a shared phylogenetic origin. We summarize and compare available data that shed light on genetics, function, expression, signaling, post-translational modifications and metal binding preferences of PrP and ZIP family members. Finally, we explore data indicative of retropositional origins of the prion gene founder and discuss a possible function for the prion-like (PL) domain within ZIP transporters. While throughout the article emphasis is placed on ZIP proteins, the intent is to highlight connections between PrP and ZIP transporters and uncover promising directions for future research.

  13. The human crystallin gene families

    PubMed Central

    2012-01-01

    Crystallins are the abundant, long-lived proteins of the eye lens. The major human crystallins belong to two different superfamilies: the small heat-shock proteins (α-crystallins) and the βγ-crystallins. During evolution, other proteins have sometimes been recruited as crystallins to modify the properties of the lens. In the developing human lens, the enzyme betaine-homocysteine methyltransferase serves such a role. Evolutionary modification has also resulted in loss of expression of some human crystallin genes or of specific splice forms. Crystallin organization is essential for lens transparency and mutations; even minor changes to surface residues can cause cataract and loss of vision. PMID:23199295

  14. Homeodomains, Hedgehogs, and Happiness.

    PubMed

    Scott, Matthew P

    2016-01-01

    Developmental biologists have had a spectacular quarter century of discoveries, building on many decades of work earlier, discovering molecular, cellular, and genetic mechanisms that underlie the magical process by which an egg becomes a plant or animal. Among the discoveries were homeodomains, DNA-binding domains that allow transcription factors to recognize their target genes, and the Hedgehog signaling pathway, which is used in many organs and tissues for communication among cells. The experience of unveiling the mechanisms and molecules connected to both of these findings has been remarkable, joyful, difficult, and a time of great teamwork and collaboration within and between laboratory groups. More than ever it is possible to discern the evolutionary processes, and their mechanisms, that led to the diversity of life on earth. A huge amount of work remains to be done to obtain a broad understanding of what happened and how development works.

  15. Gene-Family Extension Measures and Correlations

    PubMed Central

    Carmi, Gon; Bolshoy, Alexander

    2016-01-01

    The existence of multiple copies of genes is a well-known phenomenon. A gene family is a set of sufficiently similar genes, formed by gene duplication. In earlier works conducted on a limited number of completely sequenced and annotated genomes it was found that size of gene family and size of genome are positively correlated. Additionally, it was found that several atypical microbes deviated from the observed general trend. In this study, we reexamined these associations on a larger dataset consisting of 1484 prokaryotic genomes and using several ranking approaches. We applied ranking methods in such a way that genomes with lower numbers of gene copies would have lower rank. Until now only simple ranking methods were used; we applied the Kemeny optimal aggregation approach as well. Regression and correlation analysis were utilized in order to accurately quantify and characterize the relationships between measures of paralog indices and genome size. In addition, boxplot analysis was employed as a method for outlier detection. We found that, in general, all paralog indexes positively correlate with an increase of genome size. As expected, different groups of atypical prokaryotic genomes were found for different types of paralog quantities. Mycoplasmataceae and Halobacteria appeared to be among the most interesting candidates for further research of evolution through gene duplication. PMID:27527218

  16. Sonic hedgehog increases the skin wound-healing ability of mouse embryonic stem cells through the microRNA 200 family

    PubMed Central

    Suh, Han Na; Han, Ho Jae

    2015-01-01

    Background and Purpose To use stem cell therapy effectively, it is important to enhance the therapeutic potential of stem cells with soluble factors. Although sonic hedgehog (shh) is important in maintaining the stem cell, the recovery effect of mouse embryonic stem cells (mESCs) with shh has not yet been elucidated. The present study investigated the effect of mESCs with shh in skin recovery in vivo as well as the related intracellular signal pathways in vitro. Experimental Approach The healing effect of mESCs with shh on skin wounds was examined in vivo in ICR mice. The involvement of Smads, the microRNA (miR)-200 family, zinc finger E-box-binding homeobox (ZEBs) and E-cadherin on shh-induced mESC migration and self-renewal was determined in vitro. Key Results The mESCs with shh increased re-epithelialization and VEGF expression in skin wounds. Shh-treated mESCs increased both secreted and intracellular levels of VEGF. Shh induced dephosphorylation of glycogen synthase kinase 3β through the Smoothened receptor and increased the phosphorylation of Smad1 and Smad2/3 in mESCs. Shh-induced decrease of the mmu-miR-141, -200c, -200a, -200b and -429 expression levels was significantly reversed by Smad4 siRNA. Shh increased nuclear expression of ZEB1/ZEB2 and decreased E-cadherin expression while increasing cell migration and skin wound healing. Both these effects were reversed by mmu-miR-141 and -200b mimics. Conclusions and Implications Mouse ESCs accelerated skin wound healing by shh through down-regulating E-cadherin, an effect dependent on mmu-miR-141 and -200b. Our data provides evidence for the effectiveness of shh in stem cell-based therapy in vivo. PMID:25257936

  17. Novel neutralizing hedgehog antibody MEDI-5304 exhibits antitumor activity by inhibiting paracrine hedgehog signaling.

    PubMed

    Michaud, Neil R; Wang, Youzhen; McEachern, Kristen A; Jordan, Jerold J; Mazzola, Anne Marie; Hernandez, Axel; Jalla, Sanjoo; Chesebrough, Jon W; Hynes, Mark J; Belmonte, Matthew A; Wang, Lidong; Kang, Jaspal S; Jovanovic, Jelena; Laing, Naomi; Jenkins, David W; Hurt, Elaine; Liang, Meina; Frantz, Christopher; Hollingsworth, Robert E; Simeone, Diane M; Blakey, David C; Bedian, Vahe

    2014-02-01

    The hedgehog pathway has been implicated in the tumorigenesis, tumor progression, and metastasis of numerous human cancers. We generated the first fully human hedgehog antibody MEDI-5304 and characterized its antitumor activity and preclinical toxicology. MEDI-5304 bound sonic hedgehog (SHH) and Indian hedgehog (IHH) with low picomolar affinity and neutralized SHH and IHH activity in cellular mGLI1 reporter assays. The antibody inhibited transcription of hedgehog target genes and osteoblast differentiation of C3H10T1/2 cells. We evaluated the activity of MEDI-5304 in vivo in model systems that allowed us to evaluate two primary hypotheses of hedgehog function in human cancer, paracrine signaling between tumor and stromal cells and cancer stem cell (CSC) self-renewal. MEDI-5304 displayed robust pharmacodynamic effects in stromal cells that translated to antitumor efficacy as a single agent in an HT-29/MEF coimplantation model of paracrine hedgehog signaling. MEDI-5304 also improved responses to carboplatin in the HT-29/MEF model. The antibody, however, had no effect as a single agent or in combination with gemcitabine on the CSC frequency or growth of several primary pancreatic cancer explant models. These findings support the conclusion that hedgehog contributes to tumor biology via paracrine tumor-stromal signaling but not via CSC maintenance or propagation. Finally, the only safety study finding associated with MEDI-5304 was ondontodysplasia in rats. Thus, MEDI-5304 represents a potent dual hedgehog inhibitor suitable for continued development to evaluate efficacy and safety in human patients with tumors harboring elevated levels of SHH or IHH.

  18. The glutamine synthetase gene family in Populus

    PubMed Central

    2011-01-01

    Background Glutamine synthetase (GS; EC: 6.3.1.2, L-glutamate: ammonia ligase ADP-forming) is a key enzyme in ammonium assimilation and metabolism of higher plants. The current work was undertaken to develop a more comprehensive understanding of molecular and biochemical features of GS gene family in poplar, and to characterize the developmental regulation of GS expression in various tissues and at various times during the poplar perennial growth. Results The GS gene family consists of 8 different genes exhibiting all structural and regulatory elements consistent with their roles as functional genes. Our results indicate that the family members are organized in 4 groups of duplicated genes, 3 of which code for cytosolic GS isoforms (GS1) and 1 which codes for the choroplastic GS isoform (GS2). Our analysis shows that Populus trichocarpa is the first plant species in which it was observed the complete GS family duplicated. Detailed expression analyses have revealed specific spatial and seasonal patterns of GS expression in poplar. These data provide insights into the metabolic function of GS isoforms in poplar and pave the way for future functional studies. Conclusions Our data suggest that GS duplicates could have been retained in order to increase the amount of enzyme in a particular cell type. This possibility could contribute to the homeostasis of nitrogen metabolism in functions associated to changes in glutamine-derived metabolic products. The presence of duplicated GS genes in poplar could also contribute to diversification of the enzymatic properties for a particular GS isoform through the assembly of GS polypeptides into homo oligomeric and/or hetero oligomeric holoenzymes in specific cell types. PMID:21867507

  19. Outfoxing the Hedgehog

    ERIC Educational Resources Information Center

    Barbieri, Richard

    2011-01-01

    Jim Collins's "Good to Great" has attained near-scriptural status in organizations, including nonprofits, which Collins says constitute a third of his readers. The pivot point in "Good to Great" is the Hedgehog Concept. The "Hedgehog Concept" (HC), this author claims, is dangerous for schools because it distorts the nature of education. As Collins…

  20. Regulation of Patched by Sonic Hedgehog in the Developing Neural Tube

    NASA Astrophysics Data System (ADS)

    Marigo, Valeria; Tabin, Clifford J.

    1996-09-01

    Ventral cell fates in the central nervous system are induced by Sonic hedgehog, a homolog of hedgehog, a secreted Drosophila protein. In the central nervous system, Sonic hedgehog has been identified as the signal inducing floor plate, motor neurons, and dopaminergic neurons. Sonic hedgehog is also involved in the induction of ventral cell type in the developing somites. ptc is a key gene in the Drosophila hedgehog signaling pathway where it is involved in transducing the hedgehog signal and is also a transcriptional target of the signal. PTC, a vertebrate homolog of this Drosophila gene, is genetically downstream of Sonic hedgehog (Shh) in the limb bud. We analyze PTC expression during chicken neural and somite development and find it expressed in all regions of these tissues known to be responsive to Sonic hedgehog signal. As in the limb bud, ectopic expression of Sonic hedgehog leads to ectopic induction of PTC in the neural tube and paraxial mesoderm. This conservation of regulation allows us to use PTC as a marker for Sonic hedgehog response. The pattern of PTC expression suggests that Sonic hedgehog may play an inductive role in more dorsal regions of the neural tube than have been previously demonstrated. Examination of the pattern of PTC expression also suggests that PTC may act in a negative feedback loop to attenuate hedgehog signaling.

  1. Evolutionary history of the Asr gene family.

    PubMed

    Frankel, Nicolás; Carrari, Fernando; Hasson, Esteban; Iusem, Norberto D

    2006-08-15

    The Asr gene family is widespread in higher plants. Most Asr genes are up-regulated under different environmental stress conditions and during fruit ripening. ASR proteins are localized in the nucleus and their likely function is transcriptional regulation. In cultivated tomato, we identified a novel fourth family member, named Asr4, which maps close to its sibling genes Asr1-Asr2-Asr3 and displays an unshared region coding for a domain containing a 13-amino acid repeat. In this work we were able to expand our previous analysis for Asr2 and investigated the coding regions of the four known Asr paralogous genes in seven tomato species from different geographic locations. In addition, we performed a phylogenetic analysis on ASR proteins. The first conclusion drawn from this work is that tomato ASR proteins cluster together in the tree. This observation can be explained by a scenario of concerted evolution or birth and death of genes. Secondly, our study showed that Asr1 is highly conserved at both replacement and synonymous sites within the genus Lycopersicon. ASR1 protein sequence conservation might be associated with its multiple functions in different tissues while the low rate of synonymous substitutions suggests that silent variation in Asr1 is selectively constrained, which is probably related to its high expression levels. Finally, we found that Asr1 activation under water stress is not conserved between Lycopersicon species.

  2. NFAT Gene Family in Inflammation and Cancer

    PubMed Central

    Pan, M.-G.; Xiong, Y.; Chen, F.

    2013-01-01

    Calcineurin-NFAT signaling is critical for numerous aspects of vertebrate function during and after embryonic development. Initially discovered in T cells, the NFAT gene family, consisting of five members, regulates immune system, inflammatory response, angiogenesis, cardiac valve formation, myocardial development, axonal guidance, skeletal muscle development, bone homeostasis, development and metastasis of cancer, and many other biological processes. In this review we will focus on the NFAT literature relevant to the two closely related pathological systems: inflammation and cancer. PMID:22950383

  3. Hedgehog Cholesterolysis: Specialized Gatekeeper to Oncogenic Signaling

    PubMed Central

    Callahan, Brian P.; Wang, Chunyu

    2015-01-01

    Discussions of therapeutic suppression of hedgehog (Hh) signaling almost exclusively focus on receptor antagonism; however, hedgehog’s biosynthesis represents a unique and potentially targetable aspect of this oncogenic signaling pathway. Here, we review a key biosynthetic step called cholesterolysis from the perspectives of structure/function and small molecule inhibition. Cholesterolysis, also called cholesteroylation, generates cholesterol-modified Hh ligand via autoprocessing of a hedgehog precursor protein. Post-translational modification by cholesterol appears to be restricted to proteins in the hedgehog family. The transformation is essential for Hh biological activity and upstream of signaling events. Despite its decisive role in generating ligand, cholesterolysis remains conspicuously unexplored as a therapeutic target. PMID:26473928

  4. [The role of sonic hedgehog pathway in skin carcinogenesis].

    PubMed

    Lesiak, Aleksandra; Sysa-Jedrzejowska, Anna; Narbutt, Joanna

    2010-08-01

    Non melanoma skin cancers (NMSC) involving basal (BCC)--and squamosus cell carcinomas (SCC) and are the most frequent skin cancers in Caucasians. Ultraviolet radiation is the main environmental risk factor for NMSC development. The aim of this paper is to review the latest opinions concerning the role of sonic hedgehog pathway in non-melanoma skin cancers development. Experimental data indicate that sonic hedgehog pathway might be involved in skin carcinogenesis. Under physiological conditions sonic hedgehog pathway is responsible for normal embryogenesis, regeneration of damaged tissues and for regulation of cell proliferation. It was revealed that UVR caused inactivated mutation in PATCHED gene encoding Ptch1 protein. These events lead to deregulation of sonic hedgehog pathway trough activation of Smo protein and Gli transcriptional factors what stimulates cell proliferation and in consequence NMSC development. Literature data indicate that understanding of molecular background of skin cancers might be a reason for introduction of new therapeutic approaches including sonic hedgehog pathway inhibitors.

  5. Metastable nematic hedgehogs

    NASA Astrophysics Data System (ADS)

    Rosso, Riccardo; Virga, Epifanio G.

    1996-07-01

    For nematic liquid crystals, we study the local stability of a radial hedgehog against biaxial perturbations. Our analysis employs the Landau - de Gennes functional to describe the free energy stored in a ball, whose radius is a parameter of the model. We find that a radial hedgehog may be either unstable or metastable, depending on the values of the elastic constants. For unstable hedgehogs, we give an explicit expression for the radius of the ball within which the instability manifests itself: it can be interpreted as the size of the biaxial core of the defect; it is of the same order of magnitude as the radius of the disclination ring predicted by Penzenstadler and Trebin's model. The metastable hedgehogs predicted by our model are the major novelty of the paper. They tell us that we may also expect truly uniaxial point defects, whose core contains no biaxial structure.

  6. The Pax gene family: Highlights from cephalopods

    PubMed Central

    Baratte, Sébastien; Andouche, Aude; Bonnaud-Ponticelli, Laure

    2017-01-01

    Pax genes play important roles in Metazoan development. Their evolution has been extensively studied but Lophotrochozoa are usually omitted. We addressed the question of Pax paralog diversity in Lophotrochozoa by a thorough review of available databases. The existence of six Pax families (Pax1/9, Pax2/5/8, Pax3/7, Pax4/6, Paxβ, PoxNeuro) was confirmed and the lophotrochozoan Paxβ subfamily was further characterized. Contrary to the pattern reported in chordates, the Pax2/5/8 family is devoid of homeodomain in Lophotrochozoa. Expression patterns of the three main pax classes (pax2/5/8, pax3/7, pax4/6) during Sepia officinalis development showed that Pax roles taken as ancestral and common in metazoans are modified in S. officinalis, most likely due to either the morphological specificities of cephalopods or to their direct development. Some expected expression patterns were missing (e.g. pax6 in the developing retina), and some expressions in unexpected tissues have been found (e.g. pax2/5/8 in dermal tissue and in gills). This study underlines the diversity and functional plasticity of Pax genes and illustrates the difficulty of using probable gene homology as strict indicator of homology between biological structures. PMID:28253300

  7. Rubisco small subunit gene family in cassava.

    PubMed

    Yeo, T W; Mak, Y M; Ho, K K

    1999-01-01

    Cassava leaves of two different cultivars, Brazil and Buloh, were used to isolate mRNA. The mRNA isolated was successfully used in the construction of cDNA libraries for each of the cultivars. The cDNA libraries were screened for members of ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit gene family and positive clones were sequenced. A total of seven different SSU genes, of which five were from cultivar Brazil and two were from cultivar Buloh, were isolated. Comparison results show that even though all the sequences are highly similar, they can be classified into three subfamilies. Homology between members of the same subfamily is higher than homology between members from the same cultivar.

  8. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  9. Tumor suppressor genes in familial adenomatous polyposis

    PubMed Central

    Eshghifar, Nahal; Farrokhi, Naser; Naji, Tahereh; Zali, Mohammadreza

    2017-01-01

    Colorectal cancer (CRC) is mostly due to a series of genetic alterations that are being greatly under the influence of the environmental factors. These changes, mutational or epigenetic modifications at transcriptional forefront and/or post-transcriptional effects via miRNAs, include inactivation and the conversion of proto-oncogene to oncogenes, and/or inactivation of tumor suppressor genes (TSG). Here, a thorough review was carried out on the role of TSGs with the focus on the APC as the master regulator, mutated genes and mal-/dysfunctional pathways that lead to one type of hereditary form of the CRC; namely familial adenomatous polyposis (FAP). This review provides a venue towards defining candidate genes that can be used as new PCR-based markers for early diagnosis of FAP. In addition to diagnosis, defining the modes of genetic alterations will open door towards genome editing to either suppress the disease or reduce its progression during the course of action. PMID:28331559

  10. 46,XY Gonadal Dysgenesis due to a Homozygous Mutation in Desert Hedgehog (DHH) Identified by Exome Sequencing

    PubMed Central

    Merz, Hartmut; Birnbaum, Wiebke; Marshall, Louise; Schröder, Tatjana; Reiz, Benedikt; Kavran, Jennifer M.; Bäumer, Tobias; Capetian, Philipp; Hiort, Olaf

    2015-01-01

    Background: 46,XY disorders of sex development (DSD) comprise a heterogeneous group of congenital conditions. Mutations in a variety of genes can affect gonadal development or androgen biosynthesis/action and thereby influence the development of the internal and external genital organs. Objective: The objective of the study was to identify the genetic cause in two 46,XY sisters of a consanguineous family with DSD and gonadal tumor formation. Methods: We used a next-generation sequencing approach by exome sequencing. Electrophysiological and high-resolution ultrasound examination of peripheral nerves as well as histopathological examination of the gonads were performed. Results: We identified a novel homozygous R124Q mutation in the desert hedgehog gene (DHH), which alters a conserved residue among the three mammalian Hedgehog ligands sonic hedgehog, Indian hedgehog, and desert hedgehog. No other relevant mutations in DSD-related genes were encountered. The gonads of one patient showed partial gonadal dysgenesis with loss of Leydig cells in tubular areas with seminoma in situ and a hyperplasia of Leydig cell-like cells expressing CYP17A1 in more dysgenetic parts of the gonad. In addition, both patients suffer from a polyneuropathy. High-resolution ultrasound revealed a structural change of peripheral nerve structure that fits well to a minifascicle formation of peripheral nerves. Conclusion: Mutations in DHH play a role in 46,XY gonadal dysgenesis and are associated with seminoma formation and a neuropathy with minifascicle formation. Gonadal dysgenesis in these cases may be due to impairment of Sertoli cell-Leydig cell interaction during gonadal development. PMID:25927242

  11. The Arabidopsis Cyclophilin Gene Family1

    PubMed Central

    Romano, Patrick G.N.; Horton, Peter; Gray, Julie E.

    2004-01-01

    Database searching has allowed the identification of a number of previously unreported single and multidomain isoform members of the Arabidopsis cyclophilin gene family. In addition to the cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, the latter contain a variety of other domains with characterized functions. Transcriptional analysis showed they are expressed throughout the plant, and different isoforms are present in all parts of the cell including the cytosol, nucleus, mitochondria, secretory pathway, and chloroplast. The abundance and diversity of cyclophilin isoforms suggests that, like their animal counterparts, plant cyclophilins are likely to be important proteins involved in a wide variety of cellular processes. As well as fulfilling the basic role of protein folding, they may also play important roles in mRNA processing, protein degradation, and signal transduction and thus may be crucial during both development and stress responsiveness. PMID:15051864

  12. Spontaneous neoplasia in four captive greater hedgehog tenrecs (Setifer setosus).

    PubMed

    Khoii, Mina K; Howerth, Elizabeth W; Burns, Roy B; Carmichael, K Paige; Gyimesi, Zoltan S

    2008-09-01

    Little information is available about diseases and pathology of species within the family Tenrecidae, including the greater hedgehog tenrec (Setifer setosus), a Madagascan insectivore. This report summarizes necropsy and histopathologic findings of neoplasia in four captive greater hedgehog tenrecs. Although only four animals are included in this report, neoplasia seems to be a common and significant source of morbidity and mortality in greater hedgehog tenrecs. Types of neoplasia identified include a thyroid follicular-solid carcinoma, two urinary bladder transitional cell carcinomas, uterine endometrial polyps, and multicentric B-cell lymphoma. Due to small sample size, no etiology could be determined, but genetics, viral infection, pesticide treatment, nutrition, or other environmental factors might contribute to the development of neoplasia in this species. This is the first report of neoplasia in greater hedgehog tenrecs.

  13. Modelling the evolution of multi-gene families.

    PubMed

    Nye, Tom M W

    2009-10-01

    A number of biological processes can lead to genes being copied within the genome of some given species. Duplicate genes of this form are called paralogs and such genes share a high degree sequence similarity as well as often having closely related functions. Some genes have become widely duplicated to form multigene families in which the copies are distributed both within the genomes of individual species and across different species. Statistical modelling of gene duplication and the evolution of multi-gene families currently lags behind well-established models of DNA sequence evolution despite an increasing volume of available data, but the analysis of multi-gene families is important as part of a wider effort to understand evolution at the genomic level. This article reviews existing approaches to modelling multi-gene families and presents various challenges and possibilities for this exciting area of research.

  14. Transcriptional regulation of WNT2B based on the balance of Hedgehog, Notch, BMP and WNT signals.

    PubMed

    Katoh, Masuko; Katoh, Masaru

    2009-05-01

    We cloned and characterized human WNT2B in 1996, and then others cloned and characterized mouse, chicken, and zebrafish WNT2B orthologs. WNT2B is expressed in several types of human cancer, such as basal cell carcinoma, gastric cancer, breast cancer, head/neck squamous cell carcinoma, cervical cancer and leukemia. WNT2B is one of canonical WNTs transducing signals through Frizzled (FZD) and LRP5/LRP6 receptors to beta-catenin-TCF/LEF signaling cascade. Here, refined integrative genomic analyses on WNT2B orthologs were carried out to elucidate its transcriptional mechanisms. GLI-, double FOX-, HES/HEY-, bHLH-, and Sp1-binding sites within mammalian WNT2B promoter were well conserved. Because GLI1, FOXA2, FOXC2, FOXE1, FOXF1 and FOXL1 are direct target genes of Hedgehog-GLI2 signaling cascade, Hedgehog signals should induce WNT2B upregulation through GLI family members as well as FOX family members. Notch, BMP and Hedgehog signals inhibit WNT2B expression via HES/HEY-binding to N-box, whereas BMP and WNT signals inhibit bHLH transcription factor-induced WNT2B expression via ID1, ID2, ID3, MSX1 or MSX2. Together these facts indicate that Hedgehog signals and bHLH transcription factors are involved in WNT2B upregulation, which is counteracted by BMP, WNT and Notch signals. Mesenchymal BMP induces IHH expression in gastrointestinal epithelial cells, and then epithelial Hedgehog induces WNT2B and BMP4 expression in mesenchymal cells. NF-kappaB signals induce SHH upregulation, and WNT2B is upregulated in inflammatory bowel disease (IBD). BMP-IHH and inflammation-SHH signaling loops are involved in WNT2B up-regulation during embryogenesis, adult tissue homeostasis, and carcinogenesis.

  15. Androgenic regulation of hedgehog signaling pathway components in prostate cancer cells.

    PubMed

    Chen, Mengqian; Tanner, Matthew; Levine, Alice C; Levina, Elina; Ohouo, Patrice; Buttyan, Ralph

    2009-01-01

    Hedgehog signaling is thought to play a role in several human cancers including prostate cancer. Although prostate cancer cells express many of the gene products involved in hedgehog signaling, these cells are refractory to the canonical signaling effects of exogenous hedgehog ligands or to activated Smoothened, the hedgehog-regulated mediator of Gli transcriptional activation. Here, we show that the expression of hedgehog ligands and some hedgehog target genes are regulated by androgen in the human prostate cancer cell line, LNCaP and its more metastatic variants (C4-2 and C4-2B). Androgen (R1881) strongly suppressed the expression of hedgehog ligands in these cells and their prolonged maintenance in androgen-deficient medium upregulated Sonic and Indian hedgehog mRNA and protein levels by up to 30,000-fold. Hedgehogs were released into the conditioned medium of androgen-deprived LNCaP cells and this medium was able to increase hedgehog target gene expression in hedgehog-responsive mouse fibroblasts (MC3T3-E1). Moreover, this activity was accompanied by increased expression of Gli target genes, Patched 1 and Gli2, in LNCaP that could be suppressed by cyclopamine, indicating that chronic androgen-deprivation also re-awakens the autocrine responsiveness of the cancer cells to hedgehog. In contrast to the suppressive effects of R1881 on hedgehog ligand and Gli2 expression, we found that Gli1 expression in LNCaP cells was induced by R1881. Given the ability of androgen to modulate the expression and release of hedgehog ligands and the activity of the autocrine hedgehog signaling pathway in these prostate cancer cells, our results imply that chronic androgen deprivation therapy (ADT) for prostate cancer might create a hedgehog signaling environment in the region of the tumor that could ultimately impact on the long term effectiveness of this treatment. This consideration supports the idea of clinically testing hedgehog-blocking drugs in conjunction with ADT in patients

  16. Planarian Hedgehog/Patched establishes anterior–posterior polarity by regulating Wnt signaling

    PubMed Central

    Yazawa, Shigenobu; Umesono, Yoshihiko; Hayashi, Tetsutaro; Tarui, Hiroshi; Agata, Kiyokazu

    2009-01-01

    Despite long-standing interest, the molecular mechanisms underlying the establishment of anterior–posterior (AP) polarity remain among the unsolved mysteries in metazoans. In the planarians (a family of flatworms), canonical Wnt/β-catenin signaling is required for posterior specification, as it is in many animals. However, the molecular mechanisms regulating the posterior-specific induction of Wnt genes according to the AP polarity have remained unclear. Here, we demonstrate that Hedgehog (Hh) signaling is responsible for the establishment of AP polarity via its regulation of the transcription of Wnt family genes during planarian regeneration. We found that RNAi gene knockdown of Dugesia japonica patched (Djptc) caused ectopic tail formation in the anterior blastema of body fragments, resulting in bipolar-tails regeneration. In contrast, RNAi of hedgehog (Djhh) and gli (Djgli) caused bipolar-heads regeneration. We show that Patched-mediated Hh signaling was crucial for posterior specification, which is established by regulating the transcription of Wnt genes via downstream Gli activity. Moreover, differentiated cells were responsible for the posterior specification of undifferentiated stem cells through Wnt/β-catenin signaling. Surprisingly, Djhh was expressed in neural cells all along the ventral nerve cords (along the AP axis), but not in the posterior blastema of body fragments, where the expression of Wnt genes was induced for posteriorization. We therefore propose that Hh signals direct head or tail regeneration according to the AP polarity, which is established by Hh signaling activity along the body's preexisting nervous system. PMID:20018728

  17. Greased hedgehogs: new links between hedgehog signaling and cholesterol metabolism.

    PubMed

    Breitling, Rainer

    2007-11-01

    The close link between signaling by the developmental regulators of the Hedgehog family and cholesterol biochemistry has been known for some time. The morphogen is covalently attached to cholesterol in a peculiar autocatalytic reaction and embryonal disruption of cholesterol synthesis leads to malformations that mimic Hh signaling defects. Recently, it was furthermore shown that secreted Hh could hitchhike on lipoprotein particles to establish its morphogenic gradient in the developing embryo. Additionally, there is new evidence that the Hh-receptor Patched transmits the Hh signal by modulating the secretion of an inhibitory sterol molecule from the receiving cells. Here we present some of the most recent discoveries on the Hh-sterol link and discuss their implications from a systems design perspective. We predict that a robust functioning of the Hh pathway will require the involvement of more sterol metabolites, and these should be the subject of future research.

  18. The Role of the Sonic Hedgehog Pathway for Prostate Cancer Progression

    DTIC Science & Technology

    2005-02-01

    junctions so as not to detect genomic DNA and the primers and probe sequences were Additional material searched against the Celera database to confirm...searching existing data sources, gathering and maintaining the data needed, and completing and reviewing this collection of information. Send...activation of the hedgehog pathway occurs frequently in advanced human prostate cancer. We find that high levels of hedgehog target genes, PTCHI and hedgehog

  19. The Role of the Sonic Hedgehog Pathway for Prostate Cancer Progression

    DTIC Science & Technology

    2005-02-01

    junctions so as not to detect genomic DNA and the primers and probe sequences were Additional material searched against the Celera database to confirm...instructions. searching existing data sources, gathenng and maintaining the data needed, and completing and reviewing this collection of information. Send...activation of the hedgehog pathway occurs frequently in advanced human prostate cancer. We find that high levels of hedgehog target genes, PTCH1 and hedgehog

  20. The hedgehog system in ovarian follicles of cattle selected for twin ovulations and births: evidence of a link between the IGF and hedgehog systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The hedgehog system is involved in the regulation of ovarian function in drosophila, but its role in regulating ovarian follicular function in mammals is unclear. Therefore, gene expression of Indian hedgehog ligand (Ihh), its type 1 receptor (patched 1; Patch1), and IGF type 2 receptor (IGF2R) were...

  1. The hedgehog system in ovarian follicles of cattle selected for twin ovulations and births: evidence of a link between the IGF and hedgehog systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hedgehog signaling is involved in regulation of ovarian function in Drosophila but its role in regulating mammalian ovarian folliculogenesis is less clear. Therefore, gene expression of Indian hedgehog (IHH) and its type 1 receptor, patched 1 (PTCH1), were quantified in bovine granulosa (GC) or the...

  2. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-01-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94 000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae wide, angiosperm specific, monocot specific, dicot specific, and those that were species specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both lowcopy- number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g. photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  3. Evolutionary analyses of non-family genes in plants

    SciTech Connect

    Ye, Chuyu; Li, Ting; Yin, Hengfu; Weston, David; Tuskan, Gerald A; Tschaplinski, Timothy J; Yang, Xiaohan

    2013-03-01

    There are a large number of non-family (NF) genes that do not cluster into families with three or more members per genome. While gene families have been extensively studied, a systematic analysis of NF genes has not been reported. We performed comparative studies on NF genes in 14 plant species. Based on the clustering of protein sequences, we identified ~94,000 NF genes across these species that were divided into five evolutionary groups: Viridiplantae-wide, angiosperm-specific, monocot-specific, dicot-specific, and those that were species-specific. Our analysis revealed that the NF genes resulted largely from less frequent gene duplications and/or a higher rate of gene loss after segmental duplication relative to genes in both low-copy-number families (LF; 3 10 copies per genome) and high-copy-number families (HF; >10 copies). Furthermore, we identified functions enriched in the NF gene set as compared with the HF genes. We found that NF genes were involved in essential biological processes shared by all plant lineages (e.g., photosynthesis and translation), as well as gene regulation and stress responses associated with phylogenetic diversification. In particular, our analysis of an Arabidopsis protein-protein interaction network revealed that hub proteins with the top 10% most connections were over-represented in the NF set relative to the HF set. This research highlights the roles that NF genes may play in evolutionary and functional genomics research.

  4. Suppression of hedgehog signaling regulates hepatic stellate cell activation and collagen secretion.

    PubMed

    Li, Tao; Leng, Xi-Sheng; Zhu, Ji-Ye; Wang, Gang

    2015-01-01

    Hepatic stellate cells (HSCs) play an important role in liver fibrosis. This study investigates the expression of hedgehog in HSC and the role of hedgehog signaling on activation and collagen secretion of HSC. Liver ex vivo perfusion with collagenase IV and density gradient centrifugation were used to isolate HSC. Expression of hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 in HSC were detected by RT-PCR. Hedgehog siRNA vectors targeting Ihh, Smo and Gli2 were constructed and transfected into HSC respectively. Suppression of hedgehog signaling were detected by SYBR Green fluorescence quantitative RT-PCR. Effects of hedgehog signaling inhibition on HSC activation and collagen I secretion were analyzed. Hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 were expressed in HSC. siRNA vectors targeting Ihh, Smo and Gli2 were successfully constructed and decreased target gene expression. Suppression of hedgehog signaling significantly decreased the expression of α-SMA in HSC (P<0.01). Collagen type I secretion of HSC were also significantly decreased (P<0.01). In summary, HSC activation and collagen secretion can be regulated by hedgehog signaling. Hedgehog may play a role in the pathogenesis of liver fibrosis.

  5. The yeast ubiquitin genes: a family of natural gene fusions.

    PubMed Central

    Ozkaynak, E; Finley, D; Solomon, M J; Varshavsky, A

    1987-01-01

    Ubiquitin is a 76-residue protein highly conserved among eukaryotes. Conjugation of ubiquitin to intracellular proteins mediates their selective degradation in vivo. We describe a family of four ubiquitin-coding loci in the yeast Saccharomyces cerevisiae. UB11, UB12 and UB13 encode hybrid proteins in which ubiquitin is fused to unrelated ('tail') amino acid sequences. The ubiquitin coding elements of UB11 and UB12 are interrupted at identical positions by non-homologous introns. UB11 and UB12 encode identical 52-residue tails, whereas UB13 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding, nucleic acid-binding domain of the form Cys-X2-4-Cys-X2-15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UB14, encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells, while in stationary-phase cells the expression of UB11 and UB12 is repressed. The UB14 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region strong homologies to the consensus 'heat shock box' nucleotide sequence. Elsewhere we show that the essential function of the UB14 gene is to provide ubiquitin to cells under stress. Images Fig. 1. Fig. 7. PMID:3038523

  6. Regulation of DNA damage following termination of Hedgehog (HH) survival signaling at the level of the GLI genes in human colon cancer.

    PubMed

    Agyeman, Akwasi; Mazumdar, Tapati; Houghton, Janet A

    2012-08-01

    Transcriptional regulation of the Hedgehog (HH) signaling response is mediated by GLI genes (GLI1, GLI2) downstream of SMO, that are also activated by oncogenic signaling pathways. We have demonstrated the importance of targeting GLI downstream of SMO in the induction of cell death in human colon carcinoma cells. In HT29 cells inhibition of GLI1/GLI2 by the small molecule inhibitor GANT61 induced DNA double strand breaks (DSBs) and activation of ATM, MDC1 and NBS1; γH2AX and MDC1, NBS1 and MDC1 co-localized in nuclear foci. Early activation of ATM was decreased by 24 hr, when p-NBS1(Ser343), activated by ATM, was significantly reduced in cell extracts. Bound γH2AX was detected in isolated chromatin fractions or nuclei during DNA damage but not during DNA repair. MDC1 was tightly bound to chromatin at 32 hr as cells accumulated in early S-phase prior to becoming subG1, and during DNA repair. Limited binding of NBS1 was detected at all times during DNA damage but was strongly bound during DNA repair. Transient overexpression of NBS1 protected HT29 cells from GANT61-induced cell death, while knockdown of H2AX by H2AXshRNA delayed DNA damage signaling. Data demonstrate following GLI1/GLI2 inhibition: 1) induction of DNA damage in cells that are also resistant to SMO inhibitors, 2) dynamic interactions between γH2AX, MDC1 and NBS1 in single cell nuclei and in isolated chromatin fractions, 3) expression and chromatin binding properties of key mediator proteins that mark DNA damage or DNA repair, and 4) the importance of NBS1 in the DNA damage response mechanism.

  7. Hedgehog signaling and gastrointestinal cancer

    PubMed Central

    Saqui-Salces, Milena; Merchant, Juanita L.

    2017-01-01

    Hedgehog (Hh) signaling is critical for embryonic development and in differentiation, proliferation, and maintenance of multiple adult tissues. De-regulation of the Hh pathway is associated with birth defects and cancer. In the gastrointestinal tract, Hh ligands Sonic (Shh) and Indian (Ihh), as well as the receptor Patched (Ptch1), and transcription factors of Glioblastoma family (Gli) are all expressed during development. In the adult, Shh expression is restricted to the stomach and colon, while Ihh expression occurs throughout the luminal gastrointestinal tract, its expression being highest in the proximal duodenum. Several studies have demonstrated a requirement for Hh signaling during gastrointestinal tract development. However to date, the specific role of the Hh pathway in the adult stomach and intestine is not completely understood. The current review will place into context the implications of recent published data related to the biochemistry and cell biology of Hh signaling on the luminal gastrointestinal tract during development, normal physiology and subsequently carcinogenesis. PMID:20307590

  8. Functional divergence in the Arabidopsis LOB-domain gene family

    PubMed Central

    Mangeon, Amanda; Lin, Wan-ching; Springer, Patricia S.

    2012-01-01

    The Arabidopsis LOB-domain (LBD) gene family is composed by 43 members divided in two classes based on amino acid conservation within the LOB-domain. The LOB domain is known to be responsible for DNA binding and protein-protein interactions. There is very little functional information available for most genes in the LBD family and many lbd single mutants do not exhibit conspicuous phenotypes. One plausible explanation for the limited loss-of-function phenotypes observed in this family is that LBD genes exhibit significant functional redundancy. Here we discuss an example of one phylogenetic subgroup of the LBD family, in which genes that are closely related based on phylogeny exhibit distinctly different expression patterns and do not have overlapping functions. We discuss the challenges of using phylogenetic analyses to predict redundancy in gene families. PMID:23073009

  9. Complexity of the MSG gene family of Pneumocystis carinii

    PubMed Central

    Keely, Scott P; Stringer, James R

    2009-01-01

    Background The relationship between the parasitic fungus Pneumocystis carinii and its host, the laboratory rat, presumably involves features that allow the fungus to circumvent attacks by the immune system. It is hypothesized that the major surface glycoprotein (MSG) gene family endows Pneumocystis with the capacity to vary its surface. This gene family is comprised of approximately 80 genes, which each are approximately 3 kb long. Expression of the MSG gene family is regulated by a cis-dependent mechanism that involves a unique telomeric site in the genome called the expression site. Only the MSG gene adjacent to the expression site is represented by messenger RNA. Several P. carinii MSG genes have been sequenced, which showed that genes in the family can encode distinct isoforms of MSG. The vast majority of family members have not been characterized at the sequence level. Results The first 300 basepairs of MSG genes were subjected to analysis herein. Analysis of 581 MSG sequence reads from P. carinii genomic DNA yielded 281 different sequences. However, many of the sequence reads differed from others at only one site, a degree of variation consistent with that expected to be caused by error. Accounting for error reduced the number of truly distinct sequences observed to 158, roughly twice the number expected if the gene family contains 80 members. The size of the gene family was verified by PCR. The excess of distinct sequences appeared to be due to allelic variation. Discounting alleles, there were 73 different MSG genes observed. The 73 genes differed by 19% on average. Variable regions were rich in nucleotide differences that changed the encoded protein. The genes shared three regions in which at least 16 consecutive basepairs were invariant. There were numerous cases where two different genes were identical within a region that was variable among family members as a whole, suggesting recombination among family members. Conclusion A set of sequences that

  10. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A

    1987-01-01

    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  11. Targeting hedgehog in hematologic malignancy.

    PubMed

    Irvine, David A; Copland, Mhairi

    2012-03-08

    The Hedgehog pathway is a critical mediator of embryonic patterning and organ development, including hematopoiesis. It influences stem cell fate, differentiation, proliferation, and apoptosis in responsive tissues. In adult organisms, hedgehog pathway activity is required for aspects of tissue maintenance and regeneration; however, there is increasing awareness that abnormal hedgehog signaling is associated with malignancy. Hedgehog signaling is critical for early hematopoietic development, but there is controversy over its role in normal hematopoiesis in adult organisms where it may be dispensable. Conversely, hedgehog signaling appears to be an important survival and proliferation signal for a spectrum of hematologic malignancies. Furthermore, hedgehog signaling may be critical for the maintenance and expansion of leukemic stem cells and therefore provides a possible mechanism to selectively target these primitive cell subpopulations, which are resistant to conventional chemotherapy. Indeed, phase 1 clinical trials of hedgehog pathway inhibitors are currently underway to test this hypothesis in myeloid leukemias. This review covers: (1) the hedgehog pathway and its role in normal and malignant hematopoiesis, (2) the recent development of clinical grade small molecule inhibitors of the pathway, and (3) the potential utility of hedgehog pathway inhibition as a therapeutic strategy in hemato-oncology.

  12. The Expansion of the PRAME Gene Family in Eutheria

    PubMed Central

    Chang, Ti-Cheng; Yang, Yang; Yasue, Hiroshi; Bharti, Arvind K.; Retzel, Ernest F.; Liu, Wan-Sheng

    2011-01-01

    The PRAME gene family belongs to the group of cancer/testis genes whose expression is restricted primarily to the testis and a variety of cancers. The expansion of this gene family as a result of gene duplication has been observed in primates and rodents. We analyzed the PRAME gene family in Eutheria and discovered a novel Y-linked PRAME gene family in bovine, PRAMEY, which underwent amplification after a lineage-specific, autosome-to-Y transposition. Phylogenetic analyses revealed two major evolutionary clades. Clade I containing the amplified PRAMEYs and the unamplified autosomal homologs in cattle and other eutherians is under stronger functional constraints; whereas, Clade II containing the amplified autosomal PRAMEs is under positive selection. Deep-sequencing analysis indicated that eight of the identified 16 PRAMEY loci are active transcriptionally. Compared to the bovine autosomal PRAME that is expressed predominantly in testis, the PRAMEY gene family is expressed exclusively in testis and is up-regulated during testicular maturation. Furthermore, the sense RNA of PRAMEY is expressed specifically whereas the antisense RNA is expressed predominantly in spermatids. This study revealed that the expansion of the PRAME family occurred in both autosomes and sex chromosomes in a lineage-dependent manner. Differential selection forces have shaped the evolution and function of the PRAME family. The positive selection observed on the autosomal PRAMEs (Clade II) may result in their functional diversification in immunity and reproduction. Conversely, selective constraints have operated on the expanded PRAMEYs to preserve their essential function in spermatogenesis. PMID:21347312

  13. [Regulatory functions of Pax gene family in Drosophila development].

    PubMed

    Li, Li; Yang, Yang; Xue, Lei

    2010-02-01

    The Pax gene family encodes a group of important transcription factors that have been evolutionary conserved from Drosophila to human. Pax genes play pivotal roles in regulating diverse signal transduction pathways and organogenesis during embryonic development through modulating cell proliferation and self-renewal, embryonic precursor cell migration, and the coordination of specific differentiation programs. Ten members of the Pax gene family, which perform crucial regulatory functions during embryonic and postembryonic development, have been identified in Drosophila. In this report, we described the protein structures, expression patterns, and main functions of Drosophila Pax genes.

  14. Expression of ets family genes in hematopoietic-cells.

    PubMed

    Romanospica, V; Suzuki, H; Georgiou, P; Chen, S; Ascione, R; Papas, T; Bhat, N

    1994-03-01

    We have examined the expression of the ets family of transcription factors in different types of hematopoietic cells. Our results demonstrate that several members of the ets gene family are expressed differentially in hematopoietic cells. During phorbol ester induced differentiation of HL60 cells, ETS2, PEA3, as well as GABPalpha and GABPbeta mRNAs are coordinately induced. During the activation of T-cells, ETS2 proteins are induced; however, the expression of the ETS1 and ERGB gene products are reduced. These results demonstrate that the regulation of ets family of genes is complex and depends on cell type. This observation leads to the conclusion that the regulation of ets target genes, will be dependent, in part, upon the type of ets genes expressed in each particular cell type.

  15. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    NASA Astrophysics Data System (ADS)

    Yanai, Itai; Camacho, Carlos J.; Delisi, Charles

    2000-09-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications.

  16. Evolutionary History of the Cancer Immunity Antigen MAGE Gene Family

    PubMed Central

    Katsura, Yukako; Satta, Yoko

    2011-01-01

    The evolutionary mode of a multi-gene family can change over time, depending on the functional differentiation and local genomic environment of family members. In this study, we demonstrate such a change in the melanoma antigen (MAGE) gene family on the mammalian X chromosome. The MAGE gene family is composed of ten subfamilies that can be categorized into two types. Type I genes are of relatively recent origin, and they encode epitopes for human leukocyte antigen (HLA) in cancer cells. Type II genes are relatively ancient and some of their products are known to be involved in apoptosis or cell proliferation. The evolutionary history of the MAGE gene family can be divided into four phases. In phase I, a single-copy state of an ancestral gene and the evolutionarily conserved mode had lasted until the emergence of eutherian mammals. In phase II, eight subfamily ancestors, with the exception for MAGE-C and MAGE-D subfamilies, were formed via retrotransposition independently. This would coincide with a transposition burst of LINE elements at the eutherian radiation. However, MAGE-C was generated by gene duplication of MAGE-A. Phase III is characterized by extensive gene duplication within each subfamily and in particular the formation of palindromes in the MAGE-A subfamily, which occurred in an ancestor of the Catarrhini. Phase IV is characterized by the decay of a palindrome in most Catarrhini, with the exception of humans. Although the palindrome is truncated by frequent deletions in apes and Old World monkeys, it is retained in humans. Here, we argue that this human-specific retention stems from negative selection acting on MAGE-A genes encoding epitopes of cancer cells, which preserves their ability to bind to highly divergent HLA molecules. These findings are interpreted with consideration of the biological factors shaping recent human MAGE-A genes. PMID:21695252

  17. The CBF gene family in apple (malus x domestica Borkh.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many vascular plants have evolved mechanisms for protecting themselves from freeze damage. One of the key pathways controlling higher plant responses to low temperature involves a family of genes which belong to the AP2 domain class of transcription factors. The promoters of many genes involved in...

  18. Recommended nomenclature for five mammalian carboxylesterase gene families: human, mouse, and rat genes and proteins.

    PubMed

    Holmes, Roger S; Wright, Matthew W; Laulederkind, Stanley J F; Cox, Laura A; Hosokawa, Masakiyo; Imai, Teruko; Ishibashi, Shun; Lehner, Richard; Miyazaki, Masao; Perkins, Everett J; Potter, Phillip M; Redinbo, Matthew R; Robert, Jacques; Satoh, Tetsuo; Yamashita, Tetsuro; Yan, Bingfan; Yokoi, Tsuyoshi; Zechner, Rudolf; Maltais, Lois J

    2010-10-01

    Mammalian carboxylesterase (CES or Ces) genes encode enzymes that participate in xenobiotic, drug, and lipid metabolism in the body and are members of at least five gene families. Tandem duplications have added more genes for some families, particularly for mouse and rat genomes, which has caused confusion in naming rodent Ces genes. This article describes a new nomenclature system for human, mouse, and rat carboxylesterase genes that identifies homolog gene families and allocates a unique name for each gene. The guidelines of human, mouse, and rat gene nomenclature committees were followed and "CES" (human) and "Ces" (mouse and rat) root symbols were used followed by the family number (e.g., human CES1). Where multiple genes were identified for a family or where a clash occurred with an existing gene name, a letter was added (e.g., human CES4A; mouse and rat Ces1a) that reflected gene relatedness among rodent species (e.g., mouse and rat Ces1a). Pseudogenes were named by adding "P" and a number to the human gene name (e.g., human CES1P1) or by using a new letter followed by ps for mouse and rat Ces pseudogenes (e.g., Ces2d-ps). Gene transcript isoforms were named by adding the GenBank accession ID to the gene symbol (e.g., human CES1_AB119995 or mouse Ces1e_BC019208). This nomenclature improves our understanding of human, mouse, and rat CES/Ces gene families and facilitates research into the structure, function, and evolution of these gene families. It also serves as a model for naming CES genes from other mammalian species.

  19. Mutation in δ-Sg Gene in Familial Dilated Cardiomyopathy

    PubMed Central

    Asadi, Marzieh; Foo, Roger; Salehi, Ahmad Reza; Salehi, Rasoul; Samienasab, Mohammad Reza

    2017-01-01

    Background: Mutations in different genes including dystrophin-associated glycoprotein complex caused familial dilated cardiomyopathy which is a genetically heterogeneous disease. The δ-SG gene contains nine exons spanning a 433-kb region of genomic DNA. It encodes a 35-kDa, singlepass, and type II transmembrane glycoprotein. Materials and Methods: In this study for the first time in Iran we screened 6 patients of a large family that they had positive family history of MI or sudden death by next generation sequencing method. Results: By employing NGS method we found missense mutation (p.R97Q) of δ-SG gene in 2 of 6 patients. Conclusions: The missense mutation (p.R97Q) in familial DCM patients is reported for the first time in Iranian patients with cardiac disease. Although this mutation is already known in other populations in Iran, it is not reported before.

  20. Complexity, polymorphism, and connectivity of mouse Vk gene families.

    PubMed

    Kofler, R; Duchosal, M A; Dixon, F J

    1989-01-01

    To define the polymorphism and extent of the mouse immunoglobulin kappa (Igk) gene complex, we have analyzed restriction-enzyme digested genomic DNA from 33 inbred strains of mice with labeled DNA probes corresponding to 16 Vk protein groups (1 of them previously undescribed) and the Jk/Ck region (V, variable; J, joining; C, constant). These probes detected between 1 and 25 distinct restriction enzyme fragments (REF) that appeared in up to eight polymorphic patterns, thus defining eight mouse Igk haplotypes. The investigated portion of the Vk repertoire was estimated to encompass between 60 and 120 discernable Vk gene-containing REFs. In contrast to mouse VH gene families, several Vk gene families defined by these probes appeared to overlap. This observation has implications for Vk gene analyses by nucleic acid hybridization and raises the possibility that the Vk gene complex is a continuum of related sequences.

  1. Characterizations of 9p21 candidate genes in familial melanoma

    SciTech Connect

    Walker, G.J.; Flores, J.F.; Glendening, J.M.

    1994-09-01

    We have previously collected and characterized 16 melanoma families for the inheritance of a familial melanoma predisposition gene on 9p21. Clear evidence for genetic linkage has been detected in 8 of these families with the 9p21 markers D9S126 and 1FNA, while linkage of the remaining families to this region is less certain. A candidate for the 9p21 familial melanoma gene, the cyclin kinase inhibitor gene p16 (also known as the multiple tumor suppressor 1 (MTS1) gene), has been recently indentified. Notably, a nonsense mutation within the p16 gene has been detected in the lymphoblastoid cell line DNA from a dysplastic nevus syndrome (DNS), or familial melanoma, patient. The p16 gene is also known to be frequently deleted or mutated in a variety of tumor cell lines (including melanoma) and resides within a region that has been defined as harboring the 9p21 melanoma predisposition locus. This region is delineated on the distal side by the marker D9S736 (which resides just distal to the p16 gene) and extends in a proximal direction to the marker D9S171. Overall, the entire distance between these two loci is estimated at 3-5Mb. Preliminary analysis of our two largest 9p21-linked melanoma kindreds (by direct sequencing of PCR products) has not yet revealed mutations within the coding region of the p16 gene. Others have reported that 8/11 unrelated 9p21-linked melanoma families do not appear to carry p16 mutations; thus the possibility exists that p16 is not a melanoma susceptibility gene per se, although it appears to play some role in melanoma tumor progression. Our melanoma kindred DNAs are currently being analyzed by SSCP using primers that amplify exons of other candidate genes from the 9p21 region implicated in familial melanoma. These novel genes reside within a distinct critical region of homozygous loss in melanoma which is located >2 Mb from the p16 gene on 9p21.

  2. Identification of a family of muscarinic acetylcholine receptor genes

    SciTech Connect

    Bonner, T.I.; Buckley, N.J.; Young, A.C.; Brann, M.R.

    1987-07-31

    Complementary DNAs for three different muscarinic acetylcholine receptors were isolated from a rat cerebral cortex library, and the cloned receptors were expressed in mammalian cells. Analysis of human and rat genomic clones indicates that there are at least four functional muscarinic receptor genes and that these genes lack introns in the coding sequence. This gene family provides a new basis for evaluating the diversity of muscarinic mechanisms in the nervous system.

  3. Identification and Functional Analysis of Light-Responsive Unique Genes and Gene Family Members in Rice

    PubMed Central

    Jung, Ki-Hong; Lee, Jinwon; Dardick, Chris; Seo, Young-Su; Cao, Peijian; Canlas, Patrick; Phetsom, Jirapa; Xu, Xia; Ouyang, Shu; An, Kyungsook; Cho, Yun-Ja; Lee, Geun-Cheol; Lee, Yoosook; An, Gynheung; Ronald, Pamela C.

    2008-01-01

    Functional redundancy limits detailed analysis of genes in many organisms. Here, we report a method to efficiently overcome this obstacle by combining gene expression data with analysis of gene-indexed mutants. Using a rice NSF45K oligo-microarray to compare 2-week-old light- and dark-grown rice leaf tissue, we identified 365 genes that showed significant 8-fold or greater induction in the light relative to dark conditions. We then screened collections of rice T-DNA insertional mutants to identify rice lines with mutations in the strongly light-induced genes. From this analysis, we identified 74 different lines comprising two independent mutant lines for each of 37 light-induced genes. This list was further refined by mining gene expression data to exclude genes that had potential functional redundancy due to co-expressed family members (12 genes) and genes that had inconsistent light responses across other publicly available microarray datasets (five genes). We next characterized the phenotypes of rice lines carrying mutations in ten of the remaining candidate genes and then carried out co-expression analysis associated with these genes. This analysis effectively provided candidate functions for two genes of previously unknown function and for one gene not directly linked to the tested biochemical pathways. These data demonstrate the efficiency of combining gene family-based expression profiles with analyses of insertional mutants to identify novel genes and their functions, even among members of multi-gene families. PMID:18725934

  4. Evolution of the Sox gene family within the chordate phylum.

    PubMed

    Heenan, Phoebe; Zondag, Lisa; Wilson, Megan J

    2016-01-10

    The ancient Sox gene family is a group of related transcription factors that perform a number of essential functions during embryonic development. During evolution, this family has undergone considerable expansion, particularly within the vertebrate lineage. In vertebrates SOX proteins are required for the specification, development and/or morphogenesis of most vertebrate innovations. Tunicates and lancelets are evolutionarily positioned as the closest invertebrate relatives to the vertebrate group. By identifying their Sox gene complement we can begin to reconstruct the gene set of the last common chordate ancestor before the split into invertebrates and vertebrate groups. We have identified core SOX family members from the genomes of six invertebrate chordates. Using phylogenetic analysis we determined their evolutionary relationships. We propose that the last common ancestor of chordates had at least seven Sox genes, including the core suite of SoxB, C, D, E and F as well as SoxH.

  5. Antiferromagnetic hedgehogs with superconducting cores

    SciTech Connect

    Goldbart, P.M.; Sheehy, D.E.

    1998-09-01

    Excitations of the antiferromagnetic state that resemble antiferromagnetic hedgehogs at large distances but are predominantly superconducting inside a core region are discussed within the context of Zhang{close_quote}s SO(5)-symmetry-based approach to the physics of high-temperature superconducting materials. Nonsingular, in contrast with their hedgehog cousins in pure antiferromagnetism, these texture excitations are what hedgehogs become when the antiferromagnetic order parameter is permitted to {open_quotes}escape{close_quotes} into superconducting directions. The structure of such excitations is determined in a simple setting, and a number of their experimental implications are examined. {copyright} {ital 1998} {ital The American Physical Society}

  6. Antiferromagnetic hedgehogs with superconducting cores

    NASA Astrophysics Data System (ADS)

    Goldbart, Paul M.; Sheehy, Daniel E.

    1998-09-01

    Excitations of the antiferromagnetic state that resemble antiferromagnetic hedgehogs at large distances but are predominantly superconducting inside a core region are discussed within the context of Zhang's SO(5)-symmetry-based approach to the physics of high-temperature superconducting materials. Nonsingular, in contrast with their hedgehog cousins in pure antiferromagnetism, these texture excitations are what hedgehogs become when the antiferromagnetic order parameter is permitted to ``escape'' into superconducting directions. The structure of such excitations is determined in a simple setting, and a number of their experimental implications are examined.

  7. Gene turnover and differential retention in the relaxin/insulin-like gene family in primates.

    PubMed

    Arroyo, José Ignacio; Hoffmann, Federico G; Opazo, Juan C

    2012-06-01

    The relaxin/insulin-like gene family is related to the insulin gene family, and includes two separate types of peptides: relaxins (RLNs) and insulin-like peptides (INSLs) that perform a variety of physiological roles including testicular descent, growth and differentiation of the mammary glands, trophoblast development, and cell differentiation. In vertebrates, these genes are found on three separate genomic loci, and in mammals, variation in the number and nature of genes in this family is mostly restricted to the Relaxin Family Locus B. For example, this locus contains a single copy of RLN in platypus and opossum, whereas it contains copies of the INSL6, INSL4, RLN2 and RLN1 genes in human and chimp. The main objective of this research is to characterize changes in the size and membership composition of the RLN/INSL gene family in primates, reconstruct the history of the RLN/INSL genes of primates, and test competing evolutionary scenarios regarding the origin of INSL4 and of the duplicated copies of the RLN gene of apes. Our results show that the relaxin/INSL-like gene family of primates has had a more dynamic evolutionary history than previously thought, including several examples of gene duplications and losses which are consistent with the predictions of the birth-and-death model of gene family evolution. In particular, we found that the differential retention of relatively old paralogs played a key role in shaping the gene complement of this family in primates. Two examples of this phenomenon are the origin of the INSL4 gene of catarrhines (the group that includes Old World monkeys and apes), and of the duplicate RLN1 and RLN2 paralogs of apes. In the case of INSL4, comparative genomics and phylogenetic analyses indicate that the origin of this gene, which was thought to represent a catarrhine-specific evolutionary innovation, is as old as the split between carnivores and primates, which took place approximately 97 million years ago. In addition, in the case

  8. Inhibitors of Hedgehog acyltransferase block Sonic Hedgehog signaling.

    PubMed

    Petrova, Elissaveta; Rios-Esteves, Jessica; Ouerfelli, Ouathek; Glickman, J Fraser; Resh, Marilyn D

    2013-04-01

    Inhibition of Sonic hedgehog (Shh) signaling is of great clinical interest. Here we exploit Hedgehog acyltransferase (Hhat)-mediated Shh palmitoylation, a modification critical for Shh signaling, as a new target for Shh pathway inhibition. A target-oriented high-throughput screen was used to identify small-molecule inhibitors of Hhat. In cells, these Hhat inhibitors specifically block Shh palmitoylation and inhibit autocrine and paracrine Shh signaling.

  9. The ubiquilin gene family: evolutionary patterns and functional insights

    PubMed Central

    2014-01-01

    Background Ubiquilins are proteins that function as ubiquitin receptors in eukaryotes. Mutations in two ubiquilin-encoding genes have been linked to the genesis of neurodegenerative diseases. However, ubiquilin functions are still poorly understood. Results In this study, evolutionary and functional data are combined to determine the origin and diversification of the ubiquilin gene family and to characterize novel potential roles of ubiquilins in mammalian species, including humans. The analysis of more than six hundred sequences allowed characterizing ubiquilin diversity in all the main eukaryotic groups. Many organisms (e. g. fungi, many animals) have single ubiquilin genes, but duplications in animal, plant, alveolate and excavate species are described. Seven different ubiquilins have been detected in vertebrates. Two of them, here called UBQLN5 and UBQLN6, had not been hitherto described. Significantly, marsupial and eutherian mammals have the most complex ubiquilin gene families, composed of up to 6 genes. This exceptional mammalian-specific expansion is the result of the recent emergence of four new genes, three of them (UBQLN3, UBQLN5 and UBQLNL) with precise testis-specific expression patterns that indicate roles in the postmeiotic stages of spermatogenesis. A gene with related features has independently arisen in species of the Drosophila genus. Positive selection acting on some mammalian ubiquilins has been detected. Conclusions The ubiquilin gene family is highly conserved in eukaryotes. The infrequent lineage-specific amplifications observed may be linked to the emergence of novel functions in particular tissues. PMID:24674348

  10. Yin-Yang strands of PCAF/Hedgehog axis in cancer control.

    PubMed

    Infante, Paola; Canettieri, Gianluca; Gulino, Alberto; Di Marcotullio, Lucia

    2014-08-01

    PCAF (p300/CBP associated factor) harbors acetyltransferase and a recently identified ubiquitylation activity that regulates gene expression in response to genotoxic stress or mitogenic signals. We highlight the dual role of PCAF in the control of Hedgehog signaling, a master regulator of tissue development, stemness, and tumorigenesis. By promoting histone acetylation at Hedgehog/GLI1 target gene promoters or direct ubiquitylation and proteolysis of GLI1, the PCAF/GLI1 axis stands as a promising therapeutic target for Hedgehog-dependent tumors.

  11. BranchClust: a phylogenetic algorithm for selecting gene families

    PubMed Central

    Poptsova, Maria S; Gogarten, J Peter

    2007-01-01

    Background Automated methods for assembling families of orthologous genes include those based on sequence similarity scores and those based on phylogenetic approaches. The first are easy to automate but usually they do not distinguish between paralogs and orthologs or have restriction on the number of taxa. Phylogenetic methods often are based on reconciliation of a gene tree with a known rooted species tree; a limitation of this approach, especially in case of prokaryotes, is that the species tree is often unknown, and that from the analyses of single gene families the branching order between related organisms frequently is unresolved. Results Here we describe an algorithm for the automated selection of orthologous genes that recognizes orthologous genes from different species in a phylogenetic tree for any number of taxa. The algorithm is capable of distinguishing complete (containing all taxa) and incomplete (not containing all taxa) families and recognizes in- and outparalogs. The BranchClust algorithm is implemented in Perl with the use of the BioPerl module for parsing trees and is freely available at . Conclusion BranchClust outperforms the Reciprocal Best Blast hit method in selecting more sets of putatively orthologous genes. In the test cases examined, the correctness of the selected families and of the identified in- and outparalogs was confirmed by inspection of the pertinent phylogenetic trees. PMID:17425803

  12. Identification and characterization of TIFY family genes in Brachypodium distachyon.

    PubMed

    Zhang, Lihua; You, Jun; Chan, Zhulong

    2015-11-01

    The TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses. In this study, 21 BdTIFYs were identified in Brachypodium distachyon through genome-wide analysis, including 15 JAZ and 6 ZML genes. Analysis of the distribution of conserved domains showed that there are three additional domains (CCT domain, GATA domain and Jas domain) in the BdTIFY proteins besides the TIFY domain. Phylogenetic analysis indicated that these 21 proteins were classified into two major groups. Expression profile of BdTIFY genes in response to abiotic stresses and phytohormones was analyzed using quantitative real-time RT-PCR. Among 21 BdTIFY genes, 12 of them were induced by JA treatment, and 4 of them were induced by ABA treatment. Most of BdTIFY genes were responsive to one or more abiotic stresses including drought, salinity, low temperature and heat. Especially, BdTIFY5, 9a, 9b, 10c and 11a were significantly up-regulated by multiple abiotic stresses. These results provided important clues for functional analysis of TIFY family genes in B. distachyon.

  13. Evolution of the YABBY gene family in seed plants.

    PubMed

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants.

  14. The Hedgehog receptor patched functions in multidrug transport and chemotherapy resistance.

    PubMed

    Bidet, Michel; Tomico, Amandine; Martin, Patrick; Guizouarn, Hélène; Mollat, Patrick; Mus-Veteau, Isabelle

    2012-11-01

    Most anticancer drugs fail to eradicate tumors, leading to the development of drug resistance and disease recurrence. The Hedgehog signaling plays a crucial role during embryonic development, but is also involved in cancer development, progression, and metastasis. The Hedgehog receptor Patched (Ptc) is a Hedgehog signaling target gene that is overexpressed in many cancer cells. Here, we show a link between Ptc and resistance to chemotherapy, and provide new insight into Ptc function. Ptc is cleared from the plasma membrane upon interaction with its ligand Hedgehog, or upon treatment of cells with the Hedgehog signaling antagonist cyclopamine. In both cases, after incubation of cells with doxorubicin, a chemotherapeutic agent that is used for the clinical management of recurrent cancers, we observed an inhibition of the efflux of doxorubicin from Hedgehog-responding fibroblasts, and an increase of doxorubicin accumulation in two different cancer cell lines that are known to express aberrant levels of Hedgehog signaling components. Using heterologous expression system, we stringently showed that the expression of human Ptc conferred resistance to growth inhibition by several drugs from which chemotherapeutic agents such as doxorubicin, methotrexate, temozolomide, and 5-fluorouracil. Resistance to doxorubicin correlated with Ptc function, as shown using mutations from Gorlin's syndrome patients in which the Ptc-mediated effect on Hedgehog signaling is lost. Our results show that Ptc is involved in drug efflux and multidrug resistance, and suggest that Ptc contributes to chemotherapy resistance of cancer cells.

  15. The role of CCN family genes in haematological malignancies.

    PubMed

    Wells, J E; Howlett, M; Cheung, L C; Kees, Ursula R

    2015-09-01

    Haematological malignancies, although a broad range of specific disease types, continue to show considerable overlap in classification, and patients are treated using similar chemotherapy regimes. In this review we look at the role of the CCN family of matricellular proteins and indicate their role in nine haematological malignancies including both myeloid and lymphoid neoplasms. The potential for further haematological neoplasms with CCN family associations is argued by summarising the demonstrated role of CCN family genes in the differentiation of haematopoietic stem cells (HSC) and mesenchymal stem cells. The expanding field of knowledge encompassing CCN family genes and cancers of the HSC-lineage highlights the importance of extracellular matrix-interactions in both normal physiology and tumorigenesis of the blood, bone marrow and lymph nodes.

  16. Application of sonic hedgehog to the developing chick limb.

    PubMed

    Tiecke, Eva; Tickle, Cheryll

    2007-01-01

    Here, we describe methods for applying Sonic hedgehog (Shh) to developing chick limbs. The Sonic hedgehog gene is expressed in the polarizing region, a signaling region at the posterior margin of the limb bud and application of Shh-expressing cells or Shh protein to early limb buds mimics polarizing region signaling. The polarizing region (or zone of polarizing activity) is involved in one of the best known cell-cell interactions in vertebrate embryos and is pivotal in controlling digit number and pattern. At later stages of limb development, the application of Shh protein to the regions between digit primordia can induce changes in digit morphogenesis.

  17. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    PubMed Central

    Mendonça-Mattos, Patricia Jeanne de Souza; Harada, Maria Lúcia

    2016-01-01

    Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i) the selective pressure on the GT6 paralogs genes in primates; (ii) the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii) the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions. PMID:28044107

  18. Exploiting Gene Families for Phylogenomic Analysis of Myzostomid Transcriptome Data

    PubMed Central

    Hartmann, Stefanie; Helm, Conrad; Nickel, Birgit; Meyer, Matthias; Struck, Torsten H.; Tiedemann, Ralph; Selbig, Joachim; Bleidorn, Christoph

    2012-01-01

    Background In trying to understand the evolutionary relationships of organisms, the current flood of sequence data offers great opportunities, but also reveals new challenges with regard to data quality, the selection of data for subsequent analysis, and the automation of steps that were once done manually for single-gene analyses. Even though genome or transcriptome data is available for representatives of most bilaterian phyla, some enigmatic taxa still have an uncertain position in the animal tree of life. This is especially true for myzostomids, a group of symbiotic (or parasitic) protostomes that are either placed with annelids or flatworms. Methodology Based on similarity criteria, Illumina-based transcriptome sequences of one myzostomid were compared to protein sequences of one additional myzostomid and 29 reference metazoa and clustered into gene families. These families were then used to investigate the phylogenetic position of Myzostomida using different approaches: Alignments of 989 sequence families were concatenated, and the resulting superalignment was analyzed under a Maximum Likelihood criterion. We also used all 1,878 gene trees with at least one myzostomid sequence for a supertree approach: the individual gene trees were computed and then reconciled into a species tree using gene tree parsimony. Conclusions Superalignments require strictly orthologous genes, and both the gene selection and the widely varying amount of data available for different taxa in our dataset may cause anomalous placements and low bootstrap support. In contrast, gene tree parsimony is designed to accommodate multilocus gene families and therefore allows a much more comprehensive data set to be analyzed. Results of this supertree approach showed a well-resolved phylogeny, in which myzostomids were part of the annelid radiation, and major bilaterian taxa were found to be monophyletic. PMID:22276131

  19. Hedgehogs in the dowser state.

    PubMed

    Pieranski, Pawel; Čopar, Simon; Godinho, Maria Helena; Dazza, Mallory

    2016-12-01

    We show how to easily generate point defects called hedgehogs, in the so-called quasi-planar texture --the dowser state-- of a nematic layer confined between surfaces with homeotropic anchoring conditions. We point out that the dowser texture can be preserved infinitely in spite of its higher energy with respect to the homogeneous homeotropic texture. For topological reasons the dowser state in a squeezed droplet must contain at least one hedgehog. We submitted this hedgehog to a rotating magnetic field and controlled the continuous evolution, transitioning continuously between radial, hyperbolic and circular hedgehogs, which, just as in previous experiments by Lavrentovich et al., are topologically equivalent states. The dynamics of this transformation is shown to be directly sensitive to energy costs of different geometric configurations of the hedgehog defect and therefore can be used as a rough probe for elastic constants; knowing the principal elastic constants K1,2,3, one can retrieve information about the K24 constant. We propose also a method of generation of hedgehog pairs by application of a Poiseuille flow to a dowser state wound by a rotating magnetic field.

  20. Runx Family Genes in Tissue Stem Cell Dynamics.

    PubMed

    Wang, Chelsia Qiuxia; Mok, Michelle Meng Huang; Yokomizo, Tomomasa; Tergaonkar, Vinay; Osato, Motomi

    2017-01-01

    The Runx family genes play important roles in development and cancer, largely via their regulation of tissue stem cell behavior. Their involvement in two organs, blood and skin, is well documented. This review summarizes currently known Runx functions in the stem cells of these tissues. The fundamental core mechanism(s) mediated by Runx proteins has been sought; however, it appears that there does not exist one single common machinery that governs both tissue stem cells. Instead, Runx family genes employ multiple spatiotemporal mechanisms in regulating individual tissue stem cell populations. Such specific Runx requirements have been unveiled by a series of cell type-, developmental stage- or age-specific gene targeting studies in mice. Observations from these experiments revealed that the regulation of stem cells by Runx family genes turned out to be far more complex than previously thought. For instance, although it has been reported that Runx1 is required for the endothelial-to-hematopoietic cell transition (EHT) but not thereafter, recent studies clearly demonstrated that Runx1 is also needed during the period subsequent to EHT, namely at perinatal stage. In addition, Runx1 ablation in the embryonic skin mesenchyme eventually leads to complete loss of hair follicle stem cells (HFSCs) in the adult epithelium, suggesting that Runx1 facilitates the specification of skin epithelial stem cells in a cell extrinsic manner. Further in-depth investigation into how Runx family genes are involved in stem cell regulation is warranted.

  1. Expansion of transducin subunit gene families in early vertebrate tetraploidizations.

    PubMed

    Lagman, David; Sundström, Görel; Ocampo Daza, Daniel; Abalo, Xesús M; Larhammar, Dan

    2012-10-01

    Hundreds of gene families expanded in the early vertebrate tetraploidizations including many gene families in the phototransduction cascade. We have investigated the evolution of the heterotrimeric G-proteins of photoreceptors, the transducins, in relation to these events using both phylogenetic analyses and synteny comparisons. Three alpha subunit genes were identified in amniotes and the coelacanth, GNAT1-3; two of these were identified in amphibians and teleost fish, GNAT1 and GNAT2. Most tetrapods have four beta genes, GNB1-4, and teleosts have additional duplicates. Finally, three gamma genes were identified in mammals, GNGT1, GNG11 and GNGT2. Of these, GNGT1 and GNGT2 were found in the other vertebrates. In frog and zebrafish additional duplicates of GNGT2 were identified. Our analyses show all three transducin families expanded during the early vertebrate tetraploidizations and the beta and gamma families gained additional copies in the teleost-specific genome duplication. This suggests that the tetraploidizations contributed to visual specialisations.

  2. Hedgehog Pathway Inhibition Radiosensitizes Non-Small Cell Lung Cancers

    SciTech Connect

    Zeng, Jing; Aziz, Khaled; Chettiar, Sivarajan T.; Aftab, Blake T.; Armour, Michael; Gajula, Rajendra; Gandhi, Nishant; Salih, Tarek; Herman, Joseph M.; Wong, John; Rudin, Charles M.; Tran, Phuoc T.; Hales, Russell K.

    2013-05-01

    Purpose: Despite improvements in chemoradiation, local control remains a major clinical problem in locally advanced non-small cell lung cancer. The Hedgehog pathway has been implicated in tumor recurrence by promoting survival of tumorigenic precursors and through effects on tumor-associated stroma. Whether Hedgehog inhibition can affect radiation efficacy in vivo has not been reported. Methods and Materials: We evaluated the effects of a targeted Hedgehog inhibitor (HhAntag) and radiation on clonogenic survival of human non-small cell lung cancer lines in vitro. Using an A549 cell line xenograft model, we examined tumor growth, proliferation, apoptosis, and gene expression changes after concomitant HhAntag and radiation. In a transgenic mouse model of Kras{sup G12D}-induced and Twist1-induced lung adenocarcinoma, we assessed tumor response to radiation and HhAntag by serial micro-computed tomography (CT) scanning. Results: In 4 human lung cancer lines in vitro, HhAntag showed little or no effect on radiosensitivity. By contrast, in both the human tumor xenograft and murine inducible transgenic models, HhAntag enhanced radiation efficacy and delayed tumor growth. By use of the human xenograft model to differentiate tumor and stromal effects, mouse stromal cells, but not human tumor cells, showed significant and consistent downregulation of Hedgehog pathway gene expression. This was associated with increased tumor cell apoptosis. Conclusions: Targeted Hedgehog pathway inhibition can increase in vivo radiation efficacy in lung cancer preclinical models. This effect is associated with pathway suppression in tumor-associated stroma. These data support clinical testing of Hedgehog inhibitors as a component of multimodality therapy for locally advanced non-small cell lung cancer.

  3. Evolution of an expanded mannose receptor gene family.

    PubMed

    Staines, Karen; Hunt, Lawrence G; Young, John R; Butter, Colin

    2014-01-01

    Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens.

  4. Hedgehog signaling is synergistically enhanced by nutritional deprivation and ligand stimulation in human fibroblasts of Gorlin syndrome.

    PubMed

    Mizuochi, Hiromi; Fujii, Katsunori; Shiohama, Tadashi; Uchikawa, Hideki; Shimojo, Naoki

    2015-02-13

    Hedgehog signaling is a pivotal developmental pathway that comprises hedgehog, PTCH1, SMO, and GLI proteins. Mutations in PTCH1 are responsible for Gorlin syndrome, which is characterized by developmental defects and tumorigenicity. Although the hedgehog pathway has been investigated extensively in Drosophila and mice, its functional roles have not yet been determined in human cells. In order to elucidate the mechanism by which transduction of the hedgehog signal is regulated in human tissues, we employed human fibroblasts derived from three Gorlin syndrome patients and normal controls. We investigated GLI1 transcription, downstream of hedgehog signaling, to assess native signal transduction, and then treated fibroblasts with a recombinant human hedgehog protein with or without serum deprivation. We also examined the transcriptional levels of hedgehog-related genes under these conditions. The expression of GLI1 mRNA was significantly higher in Gorlin syndrome-derived fibroblasts than in control cells. Hedgehog stimulation and nutritional deprivation synergistically enhanced GLI1 transcription levels, and this was blocked more efficiently by vismodegib, a SMO inhibitor, than by the natural compound, cyclopamine. Messenger RNA profiling revealed the increased expression of Wnt signaling and morphogenetic molecules in these fibroblasts. These results indicated that the hedgehog stimulation and nutritional deprivation synergistically activated the hedgehog signaling pathway in Gorlin syndrome fibroblasts, and this was associated with increments in the transcription levels of hedgehog-related genes such as those involved in Wnt signaling. These fibroblasts may become a significant tool for predicting the efficacies of hedgehog molecular-targeted therapies such as vismodegib.

  5. Structure and regulation of the Asr gene family in banana.

    PubMed

    Henry, Isabelle M; Carpentier, Sebastien C; Pampurova, Suzana; Van Hoylandt, Anais; Panis, Bart; Swennen, Rony; Remy, Serge

    2011-10-01

    Abscisic acid, stress, ripening proteins (ASR) are a family of plant-specific small hydrophilic proteins. Studies in various plant species have highlighted their role in increased resistance to abiotic stress, including drought, but their specific function remains unknown. As a first step toward their potential use in crop improvement, we investigated the structure and regulation of the Asr gene family in Musa species (bananas and plantains). We determined that the Musa Asr gene family contained at least four members, all of which exhibited the typical two exons, one intron structure of Asr genes and the "ABA/WDS" (abscisic acid/water deficit stress) domain characteristic of Asr genes. Phylogenetic analyses determined that the Musa Asr genes were closely related to each other, probably as the product of recent duplication events. For two of the four members, two versions corresponding to the two sub-genomes of Musa, acuminata and balbisiana were identified. Gene expression and protein analyses were performed and Asr expression could be detected in meristem cultures, root, pseudostem, leaf and cormus. In meristem cultures, mAsr1 and mAsr3 were induced by osmotic stress and wounding, while mAsr3 and mAsr4 were induced by exposure to ABA. mASR3 exhibited the most variation both in terms of amino acid sequence and expression pattern, making it the most promising candidate for further functional study and use in crop improvement.

  6. The d4 gene family in the human genome

    SciTech Connect

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at low stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.

  7. An evolutionary screen highlights canonical and noncanonical candidate antiviral genes within the primate TRIM gene family.

    PubMed

    Malfavon-Borja, Ray; Sawyer, Sara L; Wu, Lily I; Emerman, Michael; Malik, Harmit S

    2013-01-01

    Recurrent viral pressure has acted on host-encoded antiviral genes during primate and mammalian evolution. This selective pressure has resulted in dramatic episodes of adaptation in host antiviral genes, often detected via positive selection. These evolutionary signatures of adaptation have the potential to highlight previously unrecognized antiviral genes (also called restriction factors). Although the TRIM multigene family is recognized for encoding several bona fide restriction factors (e.g., TRIM5alpha), most members of this expansive gene family remain uncharacterized. Here, we investigated the TRIM multigene family for signatures of positive selection to identify novel candidate antiviral genes. Our analysis reveals previously undocumented signatures of positive selection in 17 TRIM genes, 10 of which represent novel candidate restriction factors. These include the unusual TRIM52 gene, which has evolved under strong positive selection despite its encoded protein lacking a putative viral recognition (B30.2) domain. We show that TRIM52 arose via gene duplication from the TRIM41 gene. Both TRIM52 and TRIM41 have dramatically expanded RING domains compared with the rest of the TRIM multigene family, yet this domain has evolved under positive selection only in primate TRIM52, suggesting that it represents a novel host-virus interaction interface. Our evolutionary-based screen not only documents positive selection in known TRIM restriction factors but also highlights candidate novel restriction factors, providing insight into the interfaces of host-pathogen interactions mediated by the TRIM multigene family.

  8. Analysis of the Prefoldin Gene Family in 14 Plant Species

    PubMed Central

    Cao, Jun

    2016-01-01

    Prefoldin is a hexameric molecular chaperone complex present in all eukaryotes and archaea. The evolution of this gene family in plants is unknown. Here, I identified 140 prefoldin genes in 14 plant species. These prefoldin proteins were divided into nine groups through phylogenetic analysis. Highly conserved gene organization and motif distribution exist in each prefoldin group, implying their functional conservation. I also observed the segmental duplication of maize prefoldin gene family. Moreover, a few functional divergence sites were identified within each group pairs. Functional network analyses identified 78 co-expressed genes, and most of them were involved in carrying, binding and kinase activity. Divergent expression profiles of the maize prefoldin genes were further investigated in different tissues and development periods and under auxin and some abiotic stresses. I also found a few cis-elements responding to abiotic stress and phytohormone in the upstream sequences of the maize prefoldin genes. The results provided a foundation for exploring the characterization of the prefoldin genes in plants and will offer insights for additional functional studies. PMID:27014333

  9. Sucrose metabolism gene families and their biological functions

    PubMed Central

    Jiang, Shu-Ye; Chi, Yun-Hua; Wang, Ji-Zhou; Zhou, Jun-Xia; Cheng, Yan-Song; Zhang, Bao-Lan; Ma, Ali; Vanitha, Jeevanandam; Ramachandran, Srinivasan

    2015-01-01

    Sucrose, as the main product of photosynthesis, plays crucial roles in plant development. Although studies on general metabolism pathway were well documented, less information is available on the genome-wide identification of these genes, their expansion and evolutionary history as well as their biological functions. We focused on four sucrose metabolism related gene families including sucrose synthase, sucrose phosphate synthase, sucrose phosphate phosphatase and UDP-glucose pyrophosphorylase. These gene families exhibited different expansion and evolutionary history as their host genomes experienced differentiated rates of the whole genome duplication, tandem and segmental duplication, or mobile element mediated gene gain and loss. They were evolutionarily conserved under purifying selection among species and expression divergence played important roles for gene survival after expansion. However, we have detected recent positive selection during intra-species divergence. Overexpression of 15 sorghum genes in Arabidopsis revealed their roles in biomass accumulation, flowering time control, seed germination and response to high salinity and sugar stresses. Our studies uncovered the molecular mechanisms of gene expansion and evolution and also provided new insight into the role of positive selection in intra-species divergence. Overexpression data revealed novel biological functions of these genes in flowering time control and seed germination under normal and stress conditions. PMID:26616172

  10. New Genes Originated via Multiple Recombinational Pathways in the β-Globin Gene Family of Rodents

    PubMed Central

    Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

    2008-01-01

    Species differences in the size or membership composition of multigene families can be attributed to lineage-specific additions of new genes via duplication, losses of genes via deletion or inactivation, and the creation of chimeric genes via domain shuffling or gene fusion. In principle, it should be possible to infer the recombinational pathways responsible for each of these different types of genomic change by conducting detailed comparative analyses of genomic sequence data. Here, we report an attempt to unravel the complex evolutionary history of the β-globin gene family in a taxonomically diverse set of rodent species. The main objectives were: 1) to characterize the genomic structure of the β-globin gene cluster of rodents; 2) to assign orthologous and paralogous relationships among duplicate copies of β-like globin genes; and 3) to infer the specific recombinational pathways responsible for gene duplications, gene deletions, and the creation of chimeric fusion genes. Results of our comparative genomic analyses revealed that variation in gene family size among rodent species is mainly attributable to the differential gain and loss of later expressed β-globin genes via unequal crossing-over. However, two distinct recombinational mechanisms were implicated in the creation of chimeric fusion genes. In muroid rodents, a chimeric γ/ε fusion gene was created by unequal crossing-over between the embryonic ε- and γ-globin genes. Interestingly, this γ/ε fusion gene was generated in the same fashion as the “anti-Lepore” 5′-δ-(β/δ)-β-3′ duplication mutant in humans (the reciprocal exchange product of the pathological hemoglobin Lepore deletion mutant). By contrast, in the house mouse, Mus musculus, a chimeric β/δ fusion pseudogene was created by a β-globin → δ-globin gene conversion event. Although the γ/ε and β/δ fusion genes share a similar chimeric gene structure, they originated via completely different recombinational pathways. PMID

  11. Evolutionary Dynamics of the wnt Gene Family: A Lophotrochozoan Perspective

    PubMed Central

    Cho, Sung-Jin; Vallès, Yvonne; Giani, Vincent C.; Seaver, Elaine C.; Weisblat, David A.

    2010-01-01

    The wnt gene family encodes a set of secreted glycoproteins involved in key developmental processes, including cell fate specification and regulation of posterior growth (Cadigan KM, Nusse R. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286–3305.; Martin BL, Kimelman D. 2009. Wnt signaling and the evolution of embryonic posterior development. Curr Biol. 19:R215–R219.). As for many other gene families, evidence for expansion and/or contraction of the wnt family is available from deuterostomes (e.g., echinoderms and vertebrates [Nusse R, Varmus HE. 1992. Wnt genes. Cell. 69:1073–1087.; Schubert M, Holland LZ, Holland ND, Jacobs DK. 2000. A phylogenetic tree of the Wnt genes based on all available full-length sequences, including five from the cephalochordate amphioxus. Mol Biol Evol. 17:1896–1903.; Croce JC, Wu SY, Byrum C, Xu R, Duloquin L, Wikramanayake AH, Gache C, McClay DR. 2006. A genome-wide survey of the evolutionarily conserved Wnt pathways in the sea urchin Strongylocentrotus purpuratus. Dev Biol. 300:121–131.]) and ecdysozoans (e.g., arthropods and nematodes [Eisenmann DM. 2005. Wnt signaling. WormBook. 1–17.; Bolognesi R, Farzana L, Fischer TD, Brown SJ. 2008. Multiple Wnt genes are required for segmentation in the short-germ embryo of Tribolium castaneum. Curr Biol. 18:1624–1629.]), but little is known from the third major bilaterian group, the lophotrochozoans (e.g., mollusks and annelids [Prud'homme B, Lartillot N, Balavoine G, Adoutte A, Vervoort M. 2002. Phylogenetic analysis of the Wnt gene family. Insights from lophotrochozoan members. Curr Biol. 12:1395.]). To obtain a more comprehensive scenario of the evolutionary dynamics of this gene family, we exhaustively mined wnt gene sequences from the whole genome assemblies of a mollusk (Lottia gigantea) and two annelids (Capitella teleta and Helobdella robusta) and examined them by phylogenetic, genetic linkage, intron–exon structure, and embryonic

  12. Genome-Wide Analysis of Homeobox Gene Family in Legumes: Identification, Gene Duplication and Expression Profiling

    PubMed Central

    Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development. PMID:25745864

  13. Genome-wide analysis of homeobox gene family in legumes: identification, gene duplication and expression profiling.

    PubMed

    Bhattacharjee, Annapurna; Ghangal, Rajesh; Garg, Rohini; Jain, Mukesh

    2015-01-01

    Homeobox genes encode transcription factors that are known to play a major role in different aspects of plant growth and development. In the present study, we identified homeobox genes belonging to 14 different classes in five legume species, including chickpea, soybean, Medicago, Lotus and pigeonpea. The characteristic differences within homeodomain sequences among various classes of homeobox gene family were quite evident. Genome-wide expression analysis using publicly available datasets (RNA-seq and microarray) indicated that homeobox genes are differentially expressed in various tissues/developmental stages and under stress conditions in different legumes. We validated the differential expression of selected chickpea homeobox genes via quantitative reverse transcription polymerase chain reaction. Genome duplication analysis in soybean indicated that segmental duplication has significantly contributed in the expansion of homeobox gene family. The Ka/Ks ratio of duplicated homeobox genes in soybean showed that several members of this family have undergone purifying selection. Moreover, expression profiling indicated that duplicated genes might have been retained due to sub-functionalization. The genome-wide identification and comprehensive gene expression profiling of homeobox gene family members in legumes will provide opportunities for functional analysis to unravel their exact role in plant growth and development.

  14. Origin and evolution of laminin gene family diversity.

    PubMed

    Fahey, Bryony; Degnan, Bernard M

    2012-07-01

    Laminins are a family of multidomain glycoproteins that are important contributors to the structure of metazoan extracellular matrices. To investigate the origin and evolution of the laminin family, we characterized the full complement of laminin-related genes in the genome of the sponge, Amphimedon queenslandica. As a representative of the Demospongiae, a group consistently placed within the earliest diverging branch of animals by molecular phylogenies, Amphimedon is uniquely placed to provide insight into early steps in the evolution of metazoan gene families. Five Amphimedon laminin-related genes possess the conserved molecular features, and most of the domains found in bilaterian laminins, but all display domain architectures distinct from those of the canonical laminin chain types known from model bilaterians. This finding prompted us to perform a comparative genomic analysis of laminins and related genes from a choanoflagellate and diverse metazoans and to conduct phylogenetic analyses using the conserved Laminin N-terminal domain in order to explore the relationships between genes with distinct architectures. Laminin-like genes appear to have originated in the holozoan lineage (choanoflagellates + metazoans + several other unicellular opisthokont taxa), with several laminin domains originating later and appearing only in metazoan (animal) or eumetazoan (placozoans + ctenophores + cnidarians + bilaterians) laminins. Typical bilaterian α, β, and γ laminin chain forms arose in the eumetazoan stem and another chain type that is conserved in Amphimedon, the cnidarian, Nematostella vectensis, and the echinoderm, Strongylocentrotus purpuratus, appears to have been lost independently from the placozoan, Trichoplax adhaerens, and from multiple bilaterians. Phylogenetic analysis did not clearly reconstruct relationships between the distinct laminin chain types (with the exception of the α chains) but did reveal how several members of the netrin family were

  15. The FT/TFL1 gene family in grapevine.

    PubMed

    Carmona, María José; Calonje, Myriam; Martínez-Zapater, José Miguel

    2007-03-01

    The FT/TFL1 gene family encodes proteins with similarity to phosphatidylethanolamine binding proteins which function as flowering promoters and repressors. We show here that the FT/TFL1 gene family in Vitis vinifera is composed of at least five genes. Sequence comparisons with homologous genes identified in other dicot species group them in three major clades, the FT, MFT and TFL1 subfamilies, the latter including three of the Vitis sequences. Gene expression patterns are in agreement with a role of VvFT and VvMFT as flowering promoters; while VvTFL1A, VvTFL1B and VvTFL1C could be associated with vegetative development and maintenance of meristem indetermination. Overexpression of VvFT in transgenic Arabidopsis plants generates early flowering phenotypes similar to those produced by FT supporting a role for this gene in flowering promotion. Overexpression of VvTFL1A does not affect flowering time but the determination of flower meristems, strongly altering inflorescence structure, which is consistent with the biological roles assigned to similar genes in other species.

  16. CHD7 Gene Polymorphisms and Familial Idiopathic Scoliosis

    PubMed Central

    Tilley, Mera K.; Justice, Cristina M.; Swindle, Kandice; Marosy, Beth; Wilson, Alexander F.; Miller, Nancy H.

    2013-01-01

    Study Design Model-independent linkage analysis and tests of association were performed for 22 single nucleotide polymorphisms (SNPs) in the CHD7 gene in 244 families of European descent with familial idiopathic scoliosis (FIS). Objective To replicate an association between FIS and the CHD7 gene on 8q12.2 in an independent sample of families of European descent. Summary of Background Data The CHD7 gene on chromosome 8, responsible for the CHARGE syndrome, was previously associated with FIS in an independent study that included 52 families of European descent. Methods Model-independent linkage analysis and intra-familial tests of association were performed on the degree of lateral curvature considered as a qualitative trait (with thresholds of ≥10°, ≥15°, ≥20° and ≥30°) and as a quantitative trait (degree of lateral curvature). Results from the tests of associations from this study and the previous study were combined in a weighted meta-analysis. Results No significant results (P< 0.01) were found for linkage analysis or tests of association between genetic variants of the CHD7 and FIS in this study sample, failing to replicate the findings from the previous study. Furthermore, no significant results (P< 0.01) were found from meta-analysis of the results from the tests of association from this sample and from the previous sample. Conclusion No association between the 22 genotyped SNPs in the CHD7 gene and FIS within this study sample was found, failing to replicate the earlier findings. Further investigation of the CHD7 gene and its potential association to FIS may be required. PMID:23883829

  17. The European hedgehog (Erinaceus europaeus)--a suitable reservoir for variants of Anaplasma phagocytophilum?

    PubMed

    Silaghi, Cornelia; Skuballa, Jasmin; Thiel, Claudia; Pfister, Kurt; Petney, Trevor; Pfäffle, Miriam; Taraschewski, Horst; Passos, Lygia M F

    2012-02-01

    The European hedgehog (Erinaceus europaeus) is a common insectivore in most parts of Europe and is frequently infested by the ticks Ixodes ricinus and I. hexagonus. I. ricinus ticks have been found infected with Anaplasma phagocytophilum, an obligate intracellular bacterium, but little is known about the potential of the hedgehog as a reservoir host. In this study, the infection with A. phagocytophilum and the genetic variants involved were investigated in a captive hedgehog population which was kept in a fenced, natural grass and bush garden habitat, and also in its ticks. Additionally hedgehogs from hedgehog caretaking stations were investigated. EDTA blood and ticks were collected from the captive hedgehog population once a month from March to October 2007 and in March and April 2008. All 3 developmental stages of I. ricinus and I. hexagonus occurred on the hedgehogs. After DNA extraction, the samples were screened for A. phagocytophilum with a real-time PCR, and selected samples were further investigated with a nested PCR targeting the partial 16S rRNA gene, followed by sequencing. One hundred thirty-six out of 220 hedgehog blood samples (61.8%) from altogether 48 individuals, 413 out of 563 I. ricinus samples and 90 out of 338 I. hexagonus samples were PCR-positive. Thirty-two hedgehogs were positive more than once, most frequently twice or 3 times, but also up to 9 times. Sequencing of the partial 16S rRNA gene resulted in 6 variants, but one variant ('A') was the most frequent which appeared in 93.8% of the positive hedgehogs. This variant (equaling Frankonia II, GenBank AF136712) has recently been reported from human, equine, and canine granulocytic anaplasmosis cases and thus, its specific association with hedgehogs is an important finding in the epidemiology of A. phagocytophilum in Europe. The high infection rate of both hedgehogs and ticks with A. phagocytophilum and the simultaneous infestation with 2 tick species of all developmental stages suggest

  18. Differential Gene Expression in the Laccase Gene Family from Basidiomycete I-62 (CECT 20197)

    PubMed Central

    Mansur, Mariana; Suárez, Teresa; González, Aldo E.

    1998-01-01

    A family of genes encoding laccases has recently been described for the basidiomycete I-62 (CECT 20197). Transcript levels of genes lcc1, lcc2, and lcc3 were analyzed under four different culture conditions to study their expression patterns. Two of the laccase genes were clearly inducible by veratryl alcohol: the lcc1 gene is inducible in early stages of growth, and the lcc2 gene is also inducible but only when the organism reaches the stationary phase. Transcript levels for the third gene, lcc3, were uninduced by veratryl alcohol and repressed by glucose. PMID:16349507

  19. Effects of the Family Environment: Gene-Environment Interaction and Passive Gene-Environment Correlation

    ERIC Educational Resources Information Center

    Price, Thomas S.; Jaffee, Sara R.

    2008-01-01

    The classical twin study provides a useful resource for testing hypotheses about how the family environment influences children's development, including how genes can influence sensitivity to environmental effects. However, existing statistical models do not account for the possibility that children can inherit exposure to family environments…

  20. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    SciTech Connect

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  1. Population- and Family-Based Studies Associate the "MTHFR" Gene with Idiopathic Autism in Simplex Families

    ERIC Educational Resources Information Center

    Liu, Xudong; Solehdin, Fatima; Cohen, Ira L.; Gonzalez, Maripaz G.; Jenkins, Edmund C.; Lewis, M. E. Suzanne; Holden, Jeanette J. A.

    2011-01-01

    Two methylenetetrahydrofolate reductase gene ("MTHFR") functional polymorphisms were studied in 205 North American simplex (SPX) and 307 multiplex (MPX) families having one or more children with an autism spectrum disorder. Case-control comparisons revealed a significantly higher frequency of the low-activity 677T allele, higher prevalence of the…

  2. A Combinatorial Approach to Detecting Gene-Gene and Gene-Environment Interactions in Family Studies

    PubMed Central

    Lou, Xiang-Yang; Chen, Guo-Bo; Yan, Lei; Ma, Jennie Z.; Mangold, Jamie E.; Zhu, Jun; Elston, Robert C.; Li, Ming D.

    2008-01-01

    Widespread multifactor interactions present a significant challenge in determining risk factors of complex diseases. Several combinatorial approaches, such as the multifactor dimensionality reduction (MDR) method, have emerged as a promising tool for better detecting gene-gene (G × G) and gene-environment (G × E) interactions. We recently developed a general combinatorial approach, namely the generalized multifactor dimensionality reduction (GMDR) method, which can entertain both qualitative and quantitative phenotypes and allows for both discrete and continuous covariates to detect G × G and G × E interactions in a sample of unrelated individuals. In this article, we report the development of an algorithm that can be used to study G × G and G × E interactions for family-based designs, called pedigree-based GMDR (PGMDR). Compared to the available method, our proposed method has several major improvements, including allowing for covariate adjustments and being applicable to arbitrary phenotypes, arbitrary pedigree structures, and arbitrary patterns of missing marker genotypes. Our Monte Carlo simulations provide evidence that the PGMDR method is superior in performance to identify epistatic loci compared to the MDR-pedigree disequilibrium test (PDT). Finally, we applied our proposed approach to a genetic data set on tobacco dependence and found a significant interaction between two taste receptor genes (i.e., TAS2R16 and TAS2R38) in affecting nicotine dependence. PMID:18834969

  3. The genetics of alcoholism: identifying specific genes through family studies.

    PubMed

    Edenberg, Howard J; Foroud, Tatiana

    2006-09-01

    Alcoholism is a complex disorder with both genetic and environmental risk factors. Studies in humans have begun to elucidate the genetic underpinnings of the risk for alcoholism. Here we briefly review strategies for identifying individual genes in which variations affect the risk for alcoholism and related phenotypes, in the context of one large study that has successfully identified such genes. The Collaborative Study on the Genetics of Alcoholism (COGA) is a family-based study that has collected detailed phenotypic data on individuals in families with multiple alcoholic members. A genome-wide linkage approach led to the identification of chromosomal regions containing genes that influenced alcoholism risk and related phenotypes. Subsequently, single nucleotide polymorphisms (SNPs) were genotyped in positional candidate genes located within the linked chromosomal regions, and analyzed for association with these phenotypes. Using this sequential approach, COGA has detected association with GABRA2, CHRM2 and ADH4; these associations have all been replicated by other researchers. COGA has detected association to additional genes including GABRG3, TAS2R16, SNCA, OPRK1 and PDYN, results that are awaiting confirmation. These successes demonstrate that genes contributing to the risk for alcoholism can be reliably identified using human subjects.

  4. Plant Ion Channels: Gene Families, Physiology, and Functional Genomics Analyses

    PubMed Central

    Ward, John M.; Mäser, Pascal; Schroeder, Julian I.

    2016-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization-and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide–gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport. PMID:18842100

  5. GJB2 gene mutations causing familial hereditary deafness in Turkey.

    PubMed

    Bayazit, Yildirim A; Cable, Benjamin B; Cataloluk, Osman; Kara, Cengiz; Chamberlin, Parker; Smith, Richard J H; Kanlikama, Muzaffer; Ozer, Enver; Cakmak, Ecir Ali; Mumbuc, Semih; Arslan, Ahmet

    2003-12-01

    Mutations in Connexin 26 (Cx26) play an important role in autosomal non-syndromic hereditary hearing loss. In this study, our objective was to find out the significance of Cx26 mutations in Turkish families who had hereditary deafness. Fourteen families who had at least two prelingually deaf children per family were included in the study. One affected child from each of the 14 families was selected for single-stranded conformational polymorphism SSCP analysis. Three PCR reactions were used for each subject to amplify the entire Cx26 coding region with overlap. PCR products were sequenced on an Applied Biosystems (ABI) model 3700 automated sequencer. Six of the 14 representative family members (42.9%) demonstrated shifts on SSCP and were subsequently sequenced for Exons 1 and 2 of GJB2 and were tested for the 432 kb upstream deletion. No mutations were found in Exon 1 and no 432 kb deletions were noted. Three different GJB2 mutations were found in Exon 2 of the probands, which were 35delG, 299-300delAT, and 487G > A (M163V). GJB2 mutations were detected in 21.4% of the families. Two patients were homozygous for 35delG and 299-300delAT mutations, and were given a diagnosis of DFNB1 deafness (14.3%). Two different polymorphisms, 457G > A (V153I) and 380G > AG (R127H) were also found. In conclusion, although GJB2 mutations were detected in 21.4% of the families tested, only 14.3% of subject representatives were homozygous and therefore deafness caused by Cx26 mutation segregated with DFNB1. Thus, contribution of GJB2 mutations appears less significant in familial deafness. This necessitates further assessment for the other known gene regions as well as a search for new genetic factors in familial type of genetic deafness.

  6. Early evolution of the LIM homeobox gene family

    SciTech Connect

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  7. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease.

    PubMed

    He, Ya-Chao; Huang, Pei; Li, Qiong-Qiong; Sun, Qian; Li, Dun-Hui; Wang, Tian; Shen, Jun-Yi; Du, Juan-Juan; Cui, Shi-Shuang; Gao, Chao; Fu, Rao; Chen, Sheng-Di

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China.

  8. Mutation Analysis of HTRA2 Gene in Chinese Familial Essential Tremor and Familial Parkinson's Disease

    PubMed Central

    Li, Qiong-Qiong; Fu, Rao

    2017-01-01

    Background. HTRA2 has already been nominated as PARK13 which may cause Parkinson's disease, though there are still discrepancies among these results. Recently, Gulsuner et al.'s study found that HTRA2 p.G399S is responsible for hereditary essential tremor and homozygotes of this allele develop Parkinson's disease by examining a six-generation family segregating essential tremor and essential tremor coexisting with Parkinson's disease. We performed this study to validate the condition of HTRA2 gene in Chinese familial essential tremor and familial Parkinson's disease patients, especially essential tremor. Methods. We directly sequenced all eight exons, exon-intron boundaries, and part of the introns in 101 familial essential tremor patients, 105 familial Parkinson's disease patients, and 100 healthy controls. Results. No exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected, both with no clinical significance and uncertain function. There was no difference in allele, genotype, and haplotype between groups. Conclusions. HTRA2 exonic variant might be rare among Chinese Parkinson's disease and essential tremor patients with family history, and HTRA2 may not be the cause of familial Parkinson's disease and essential tremor in China. PMID:28243480

  9. A Candida albicans CRISPR system permits genetic engineering of essential genes and gene families.

    PubMed

    Vyas, Valmik K; Barrasa, M Inmaculada; Fink, Gerald R

    Candida albicans is a pathogenic yeast that causes mucosal and systematic infections with high mortality. The absence of facile molecular genetics has been a major impediment to analysis of pathogenesis. The lack of meiosis coupled with the absence of plasmids makes genetic engineering cumbersome, especially for essential functions and gene families. We describe a C. albicans CRISPR system that overcomes many of the obstacles to genetic engineering in this organism. The high frequency with which CRISPR-induced mutations can be directed to target genes enables easy isolation of homozygous gene knockouts, even without selection. Moreover, the system permits the creation of strains with mutations in multiple genes, gene families, and genes that encode essential functions. This CRISPR system is also effective in a fresh clinical isolate of undetermined ploidy. Our method transforms the ability to manipulate the genome of Candida and provides a new window into the biology of this pathogen.

  10. Tumor-Derived Suppressor of Fused Mutations Reveal Hedgehog Pathway Interactions.

    PubMed

    Urman, Nicole M; Mirza, Amar; Atwood, Scott X; Whitson, Ramon J; Sarin, Kavita Y; Tang, Jean Y; Oro, Anthony E

    2016-01-01

    The Hedgehog pathway is a potent regulator of cellular growth and plays a central role in the development of many cancers including basal cell carcinoma (BCC). The majority of BCCs arise from mutations in the Patched receptor resulting in constitutive activation of the Hedgehog pathway. Secondary driver mutations promote BCC oncogenesis and occur frequently due to the high mutational burden resulting from sun exposure of the skin. Here, we uncover novel secondary mutations in Suppressor of Fused (SUFU), the major negative regulator of the Hedgehog pathway. SUFU normally binds to a Hedgehog transcriptional activator, GLI1, in order to prevent it from initiating transcription of Hedgehog target genes. We sequenced tumor-normal pairs from patients with early sporadic BCCs. This resulted in the discovery of nine mutations in SUFU, which were functionally investigated to determine whether they help drive BCC formation. Our results show that four of the SUFU mutations inappropriately activate the Hedgehog pathway, suggesting they may act as driver mutations for BCC development. Indeed, all four of the loss of function SUFU variants were found to disrupt its binding to GLI, leading to constitutive pathway activation. Our results from functional characterization of these mutations shed light on SUFU's role in Hedgehog signaling, tumor progression, and highlight a way in which BCCs can arise.

  11. Tumor-Derived Suppressor of Fused Mutations Reveal Hedgehog Pathway Interactions

    PubMed Central

    Urman, Nicole M.; Mirza, Amar; Atwood, Scott X.; Whitson, Ramon J.; Sarin, Kavita Y.; Tang, Jean Y.; Oro, Anthony E.

    2016-01-01

    The Hedgehog pathway is a potent regulator of cellular growth and plays a central role in the development of many cancers including basal cell carcinoma (BCC). The majority of BCCs arise from mutations in the Patched receptor resulting in constitutive activation of the Hedgehog pathway. Secondary driver mutations promote BCC oncogenesis and occur frequently due to the high mutational burden resulting from sun exposure of the skin. Here, we uncover novel secondary mutations in Suppressor of Fused (SUFU), the major negative regulator of the Hedgehog pathway. SUFU normally binds to a Hedgehog transcriptional activator, GLI1, in order to prevent it from initiating transcription of Hedgehog target genes. We sequenced tumor-normal pairs from patients with early sporadic BCCs. This resulted in the discovery of nine mutations in SUFU, which were functionally investigated to determine whether they help drive BCC formation. Our results show that four of the SUFU mutations inappropriately activate the Hedgehog pathway, suggesting they may act as driver mutations for BCC development. Indeed, all four of the loss of function SUFU variants were found to disrupt its binding to GLI, leading to constitutive pathway activation. Our results from functional characterization of these mutations shed light on SUFU’s role in Hedgehog signaling, tumor progression, and highlight a way in which BCCs can arise. PMID:28030567

  12. Cryptosporidium erinacei and C. parvum in a group of overwintering hedgehogs.

    PubMed

    Hofmannová, Lada; Hauptman, Karel; Huclová, Kristýna; Květoňová, Dana; Sak, Bohumil; Kváč, Martin

    2016-10-01

    This study describes cryptosporidiosis in an overwintering group of 15 European hedgehogs (Erinaceus europaeus), comprising 3 adults and 12 juveniles. Four juvenile hedgehogs were hospitalised with anorexia, malodorous diarrhoea and dehydration. Immediate parasitological examinations revealed the presence of Cryptosporidium sp. in these animals and also in 5 other juveniles. All hedgehogs were coproscopically monitored for 4 months over the winter season. Shedding of Cryptosporidium oocysts persisted from 6 to 70 days. Repeated shedding of Cryptosporidium oocysts occurred in 3 animals after 4 months subsequent to the first outbreak. Clinical signs were observed only at the beginning of the outbreak (apathy, anorexia, general weakness, mild dehydration, and malodorous faeces with changed consistence - soft/diarrhoea) in the 4 hospitalised juveniles. Overall 11 hedgehogs were Cryptosporidium-positive, both microscopically and by PCR methods. Sequence analyses of SSU rRNA and gp60 genes revealed the presence of C. parvum IIdA18G1 subtype in all positive hedgehogs. Moreover, 3 hedgehogs had a mixed infection of the zoonotic C. parvum and C. erinacei XIIIaA19R13 subtype. Cryptosporidium infections can be rapidly spread among debilitated animals and the positive hedgehogs released back into the wild can be a source of the infection for individuals weakened after hibernation.

  13. MORC Family ATPases Required for Heterochromatin Condensation and Gene Silencing#

    PubMed Central

    Moissiard, Guillaume; Cokus, Shawn J.; Cary, Joshua; Feng, Suhua; Billi, Allison C.; Stroud, Hume; Husmann, Dylan; Zhan, Ye; Lajoie, Bryan R.; McCord, Rachel Patton; Hale, Christopher J.; Feng, Wei; Michaels, Scott D.; Frand, Alison R.; Pellegrini, Matteo; Dekker, Job; Kim, John K.; Jacobsen, Steve

    2012-01-01

    Transposable elements (TEs) and DNA repeats are commonly targeted by DNA and histone methylation to achieve epigenetic gene silencing. We isolated mutations in two Arabidopsis genes, AtMORC1 and AtMORC6, which cause de-repression of DNA-methylated genes and TEs, but no losses of DNA or histone methylation. AtMORC1 and AtMORC6 are members of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. The atmorc1 and atmorc6 mutants show decondensation of pericentromeric heterochromatin, increased interaction of pericentromeric regions with the rest of the genome, and transcriptional defects that are largely restricted to loci residing in pericentromeric regions. Knockdown of the single MORC homolog in Caenorhabditis elegans also impairs transgene silencing. We propose that the MORC ATPases are conserved regulators of gene silencing in eukaryotes. PMID:22555433

  14. Regulation of sonic hedgehog-GLI1 downstream target genes PTCH1, Cyclin D2, Plakoglobin, PAX6 and NKX2.2 and their epigenetic status in medulloblastoma and astrocytoma

    PubMed Central

    2010-01-01

    Background The Sonic hedgehog (Shh) signaling pathway is critical for cell growth and differentiation. Impairment of this pathway can result in both birth defects and cancer. Despite its importance in cancer development, the Shh pathway has not been thoroughly investigated in tumorigenesis of brain tumors. In this study, we sought to understand the regulatory roles of GLI1, the immediate downstream activator of the Shh signaling pathway on its downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6 in medulloblastoma and astrocytic tumors. Methods We silenced GLI1 expression in medulloblastoma and astrocytic cell lines by transfection of siRNA against GLI1. Subsequently, we performed RT-PCR and quantitative real time RT-PCR (qRT-PCR) to assay the expression of downstream target genes PTCH1, Cyclin D2, Plakoglobin, NKX2.2 and PAX6. We also attempted to correlate the pattern of expression of GLI1 and its regulated genes in 14 cell lines and 41 primary medulloblastoma and astrocytoma tumor samples. We also assessed the methylation status of the Cyclin D2 and PTCH1 promoters in these 14 cell lines and 58 primary tumor samples. Results Silencing expression of GLI1 resulted up-regulation of all target genes in the medulloblastoma cell line, while only PTCH1 was up-regulated in astrocytoma. We also observed methylation of the cyclin D2 promoter in a significant number of astrocytoma cell lines (63%) and primary astrocytoma tumor samples (32%), but not at all in any medulloblastoma samples. PTCH1 promoter methylation was less frequently observed than Cyclin D2 promoter methylation in astrocytomas, and not at all in medulloblastomas. Conclusions Our results demonstrate different regulatory mechanisms of Shh-GLI1 signaling. These differences vary according to the downstream target gene affected, the origin of the tissue, as well as epigenetic regulation of some of these genes. PMID:21059263

  15. Massive expansion of the calpain gene family in unicellular eukaryotes

    PubMed Central

    2012-01-01

    Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes. PMID:23020305

  16. Chromosomal evolution of the PKD1 gene family in primates

    PubMed Central

    2008-01-01

    Background The autosomal dominant polycystic kidney disease (ADPKD) is mostly caused by mutations in the PKD1 (polycystic kidney disease 1) gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative transposition of the PKD1 gene and

  17. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype.

  18. The Maize PIN Gene Family of Auxin Transporters.

    PubMed

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a-d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a-c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots.

  19. The Maize PIN Gene Family of Auxin Transporters

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Varotto, Serena

    2012-01-01

    Auxin is a key regulator of plant development and its differential distribution in plant tissues, established by a polar cell to cell transport, can trigger a wide range of developmental processes. A few members of the two families of auxin efflux transport proteins, PIN-formed (PIN) and P-glycoprotein (ABCB/PGP), have so far been characterized in maize. Nine new Zea mays auxin efflux carriers PIN family members and two maize PIN-like genes have now been identified. Four members of PIN1 (named ZmPIN1a–d) cluster, one gene homologous to AtPIN2 (ZmPIN2), three orthologs of PIN5 (ZmPIN5a–c), one gene paired with AtPIN8 (ZmPIN8), and three monocot-specific PINs (ZmPIN9, ZmPIN10a, and ZmPIN10b) were cloned and the phylogenetic relationships between early-land plants, monocots, and eudicots PIN proteins investigated, including the new maize PIN proteins. Tissue-specific expression patterns of the 12 maize PIN genes, 2 PIN-like genes and ZmABCB1, an ABCB auxin efflux carrier, were analyzed together with protein localization and auxin accumulation patterns in normal conditions and in response to drug applications. ZmPIN gene transcripts have overlapping expression domains in the root apex, during male and female inflorescence differentiation and kernel development. However, some PIN family members have specific tissue localization: ZmPIN1d transcript marks the L1 layer of the shoot apical meristem and inflorescence meristem during the flowering transition and the monocot-specific ZmPIN9 is expressed in the root endodermis and pericycle. The phylogenetic and gene structure analyses together with the expression pattern of the ZmPIN gene family indicate that subfunctionalization of some maize PINs can be associated to the differentiation and development of monocot-specific organs and tissues and might have occurred after the divergence between dicots and monocots. PMID:22639639

  20. Clock-associated genes in Arabidopsis: a family affair.

    PubMed Central

    Somers, D E

    2001-01-01

    The identification of components of the plant circadian clock has been advanced recently with the success of two forward genetics approaches. The ZEITLUPE and TOC1 loci were cloned and each was found to be part of two separate, larger gene families with intriguing domain structures. The ZTL family of proteins contains a subclass of the PAS domain coupled to an F box and kelch motifs, suggesting that they play a role in a novel light-regulated ubiquitination mechanism. TOC1 shares similarity to the receiver domain of the well-known two-component phosphorelay signalling systems, combined with a strong similarity to a region of the CONSTANS transcription factor, which is involved in controlling flowering time. When added to the repertoire of previously identified clock-associated genes, it is clear that both similarities and differences with other circadian systems will emerge in the coming years. PMID:11710981

  1. Epigenetic balance of gene expression by Polycomb and COMPASS families.

    PubMed

    Piunti, Andrea; Shilatifard, Ali

    2016-06-03

    Epigenetic regulation of gene expression in metazoans is central for establishing cellular diversity, and its deregulation can result in pathological conditions. Although transcription factors are essential for implementing gene expression programs, they do not function in isolation and require the recruitment of various chromatin-modifying and -remodeling machineries. A classic example of developmental chromatin regulation is the balanced activities of the Polycomb group (PcG) proteins within the PRC1 and PRC2 complexes, and the Trithorax group (TrxG) proteins within the COMPASS family, which are highly mutated in a large number of human diseases. In this review, we will discuss the latest findings regarding the properties of the PcG and COMPASS families and the insight they provide into the epigenetic control of transcription under physiological and pathological settings.

  2. Variation in the RAD51 gene and familial breast cancer

    PubMed Central

    Lose, Felicity; Lovelock, Paul; Chenevix-Trench, Georgia; Mann, Graham J; Pupo, Gulietta M; Spurdle, Amanda B

    2006-01-01

    Introduction Human RAD51 is a homologue of the Escherichia coli RecA protein and is known to function in recombinational repair of double-stranded DNA breaks. Mutations in the lower eukaryotic homologues of RAD51 result in a deficiency in the repair of double-stranded DNA breaks. Loss of RAD51 function would therefore be expected to result in an elevated mutation rate, leading to accumulation of DNA damage and, hence, to increased cancer risk. RAD51 interacts directly or indirectly with a number of proteins implicated in breast cancer, such as BRCA1 and BRCA2. Similar to BRCA1 mice, RAD51-/- mice are embryonic lethal. The RAD51 gene region has been shown to exhibit loss of heterozygosity in breast tumours, and deregulated RAD51 expression in breast cancer patients has also been reported. Few studies have investigated the role of coding region variation in the RAD51 gene in familial breast cancer, with only one coding region variant – exon 6 c.449G>A (p.R150Q) – reported to date. Methods All nine coding exons of the RAD51 gene were analysed for variation in 46 well-characterised, BRCA1/2-negative breast cancer families using denaturing high-performance liquid chromatography. Genotyping of the exon 6 p.R150Q variant was performed in an additional 66 families. Additionally, lymphoblastoid cell lines from breast cancer patients were subjected to single nucleotide primer extension analysis to assess RAD51 expression. Results No coding region variation was found, and all intronic variation detected was either found in unaffected controls or was unlikely to have functional consequences. Single nucleotide primer extension analysis did not reveal any allele-specific changes in RAD51 expression in all lymphoblastoid cell lines tested. Conclusion Our study indicates that RAD51 is not a major familial breast cancer predisposition gene. PMID:16762046

  3. Disturbed MEK/ERK signaling increases osteoclast activity via the Hedgehog-Gli pathway in postmenopausal osteoporosis.

    PubMed

    Li, Xiaojie; Jie, Qiang; Zhang, Hongyang; Zhao, Yantao; Lin, Yangjing; Du, Junjie; Shi, Jun; Wang, Long; Guo, Kai; Li, Yong; Wang, Chunhui; Gao, Bo; Huang, Qiang; Liu, Jian; Yang, Liu; Luo, Zhuojing

    2016-11-01

    Postmenopausal osteoporosis is a worldwide health problem and is characterized by increased and activated osteoclasts. However, the mechanism by which osteoclasts are dysregulated in postmenopausal osteoporosis is not fully understood. In this study, we found that the Hedgehog-Gli pathway was upregulated in postmenopausal osteoporotic osteoclasts and that 17β-estradiol both inhibited osteoclastogenesis and induced osteoclast apoptosis by downregulating Hedgehog-Gli signaling. Furthermore, we demonstrated that the Hedgehog-Gli pathway was negatively regulated by MEK/ERK signaling and that this effect was Sonic Hedgehog (SHH)-dependent and was partially blocked by an anti-SHH antibody. Moreover, we found that the stimulatory effect of Hedgehog signaling on osteoclastogenesis and the inhibitory effect on osteoclast apoptosis were dependent on the Gli family of transcription factors. The pathways and molecules that contribute to the regulation of osteoclastogenesis and apoptosis represent potential new strategies for designing molecular drugs for the treatment of postmenopausal osteoporosis.

  4. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    NASA Technical Reports Server (NTRS)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  5. The carboxylesterase/cholinesterase gene family in invertebrate deuterostomes.

    PubMed

    Johnson, Glynis; Moore, Samuel W

    2012-06-01

    Carboxylesterase/cholinesterase family members are responsible for controlling the nerve impulse, detoxification and various developmental functions, and are a major target of pesticides and chemical warfare agents. Comparative structural analysis of these enzymes is thus important. The invertebrate deuterostomes (phyla Echinodermata and Hemichordata and subphyla Urochordata and Cephalochordata) lie in the transition zone between invertebrates and vertebrates, and are thus of interest to the study of evolution. Here we have investigated the carboxylesterase/cholinesterase gene family in the sequenced genomes of Strongylocentrotus purpuratus (Echinodermata), Saccoglossus kowalevskii (Hemichordata), Ciona intestinalis (Urochordata) and Branchiostoma floridae (Cephalochordata), using sequence analysis of the catalytic apparatus and oligomerisation domains, and phylogenetic analysis. All four genomes show blurring of structural boundaries between cholinesterases and carboxylesterases, with many intermediate enzymes. Non-enzymatic proteins are well represented. The Saccoglossus and Branchiostoma genomes show evidence of extensive gene duplication and retention. There is also evidence of domain shuffling, resulting in multidomain proteins consisting either of multiple carboxylesterase domains, or of carboxylesterase/cholinesterase domains linked to other domains, including RING finger, chitin-binding, immunoglobulin, fibronectin type 3, CUB, cysteine-rich-Frizzled, caspase activation and 7tm-1, amongst others. Such gene duplication and domain shuffling in the carboxylesterase/cholinesterase family appears to be unique to the invertebrate deuterostomes, and we hypothesise that these factors may have contributed to the evolution of the morphological complexity, particularly of the nervous system and neural crest, of the vertebrates.

  6. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  7. Cryptosporidium erinacei n. sp. (Apicomplexa: Cryptosporidiidae) in hedgehogs.

    PubMed

    Kváč, Martin; Hofmannová, Lada; Hlásková, Lenka; Květoňová, Dana; Vítovec, Jiří; McEvoy, John; Sak, Bohumil

    2014-03-17

    The morphological, biological, and molecular characteristics of Cryptosporidium hedgehog genotype are described, and the species name Cryptosporidium erinacei n. sp. is proposed to reflect its specificity for hedgehogs under natural and experimental conditions. Oocysts of C. erinacei are morphologically indistinguishable from Cryptosporidium parvum, measuring 4.5-5.8 μm (mean=4.9 μm) × 4.0-4.8 μm (mean=4.4 μm) with a length to width ratio of 1.13 (1.02-1.35) (n=100). Oocysts of C. erinacei obtained from a naturally infected European hedgehog (Erinaceus europaeus) were infectious for naïve 8-week-old four-toed hedgehogs (Atelerix albiventris); the prepatent period was 4-5 days post infection (DPI) and the patent period was longer than 20 days. C. erinacei was not infectious for 8-week-old SCID and BALB/c mice (Mus musculus), Mongolian gerbils (Meriones unguiculatus), or golden hamsters (Mesocricetus auratus). Phylogenetic analyses based on small subunit rRNA, 60 kDa glycoprotein, actin, Cryptosporidium oocyst wall protein, thrombospondin-related adhesive protein of Cryptosporidium-1, and heat shock protein 70 gene sequences revealed that C. erinacei is genetically distinct from previously described Cryptosporidium species.

  8. Organization of the human lipoprotein lipase gene and evolution of the lipase gene family.

    PubMed Central

    Kirchgessner, T G; Chuat, J C; Heinzmann, C; Etienne, J; Guilhot, S; Svenson, K; Ameis, D; Pilon, C; d'Auriol, L; Andalibi, A

    1989-01-01

    The human lipoprotein lipase gene was cloned and characterized. It is composed of 10 exons spanning approximately equal to 30 kilobases. The first exon encodes the 5'-untranslated region, the signal peptide plus the first two amino acids of the mature protein. The next eight exons encode the remaining 446 amino acids, and the tenth exon encodes the long 3'-untranslated region of 1948 nucleotides. The lipoprotein lipase transcription start site and the sequence of the 5'-flanking region were also determined. We compared the organization of genes for lipoprotein lipase, hepatic lipase, pancreatic lipase, and Drosophila yolk protein 1, which are members of a family of related genes. A model for the evolution of the lipase gene family is presented that involves multiple rounds of gene duplication plus exon-shuffling and intron-loss events. Images PMID:2602366

  9. Detection and molecular characterisation of Cryptosporidium parvum in British European hedgehogs (Erinaceus europaeus).

    PubMed

    Sangster, Lucy; Blake, Damer P; Robinson, Guy; Hopkins, Timothy C; Sa, Ricardo C C; Cunningham, Andrew A; Chalmers, Rachel M; Lawson, Becki

    2016-02-15

    Surveillance was conducted for the occurrence of protozoan parasites of the genus Cryptosporidium in European hedgehogs (Erinaceus europaeus) in Great Britain. In total, 108 voided faecal samples were collected from hedgehogs newly admitted to eight wildlife casualty treatment and rehabilitation centres. Terminal large intestinal (LI) contents from three hedgehog carcasses were also analysed. Information on host and location variables, including faecal appearance, body weight, and apparent health status, was compiled. Polymerase Chain Reaction (PCR) targeting the 18S ribosomal RNA gene, confirmed by sequencing, revealed an 8% (9/111) occurrence of Cryptosporidium parvum in faeces or LI contents, with no significant association between the host or location variables and infection. Archived small intestinal (SI) tissue from a hedgehog with histological evidence of cryptosporidiosis was also positive for C. parvum by PCR and sequence analysis of the 18S rRNA gene. No other Cryptosporidium species were detected. PCR and sequencing of the glycoprotein 60 gene identified three known zoonotic C. parvum subtypes not previously found in hedgehogs: IIdA17G1 (n=4), IIdA19G1 (n=1) and IIdA24G1 (n=1). These subtypes are also known to infect livestock. Another faecal sample contained C. parvum IIcA5G3j which has been found previously in hedgehogs, and for which there is one published report in a human, but is not known to affect livestock. The presence of zoonotic subtypes of C. parvum in British hedgehogs highlights a potential public health concern. Further research is needed to better understand the epidemiology and potential impacts of Cryptosporidium infection in hedgehogs.

  10. The Evolution of Novelty in Conserved Gene Families

    PubMed Central

    Markov, Gabriel V.; Sommer, Ralf J.

    2012-01-01

    One of the major aims of contemporary evolutionary biology is the understanding of the current pattern of biological diversity. This involves, first, the description of character distribution at various nodes of the phylogenetic tree of life and, second, the functional explanation of such changes. The analysis of character distribution is a powerful tool at both the morphological and molecular levels. Recent high-throughput sequencing approaches provide new opportunities to study the genetic architecture of organisms at the genome-wide level. In eukaryotes, one overarching finding is the absence of simple correlations of gene count and biological complexity. Instead, the domain architecture of proteins is becoming a central focus for large-scale evolutionary innovations. Here, we review examples of the evolution of novelty in conserved gene families in insects and nematodes. We highlight how in the absence of whole-genome duplications molecular novelty can arise, how members of gene families have diversified at distinct mechanistic levels, and how gene expression can be maintained in the context of multiple innovations in regulatory mechanisms. PMID:22779028

  11. Natural infection of Algerian hedgehog, Atelerix algirus (Lereboullet 1842) with Leishmania parasites in Tunisia.

    PubMed

    Chemkhi, Jomaa; Souguir, Hejer; Ali, Insaf Bel Hadj; Driss, Mehdi; Guizani, Ikram; Guerbouj, Souheila

    2015-10-01

    In Tunisia, Leishmania parasites are responsible of visceral leishmaniasis, caused by Leishmania infantum species while three cutaneous disease forms are documented: chronic cutaneous leishmaniasis due to Leishmania killicki, sporadic cutaneous form (SCL) caused by L. infantum and the predominant zoonotic cutaneous leishmanaisis (ZCL) due to Leishmania major. ZCL reservoirs are rodents of the Psammomys and Meriones genera, while for SCL the dog is supposed to be a reservoir. Ctenodactylus gundii is involved in the transmission of L. killicki. However, other mammals could constitute potential reservoir hosts in Tunisia and other North African countries. In order to explore the role of hedgehogs as potential reservoirs of leishmaniasis, specimens (N=6) were captured during July-November period in 2011-2013 in an SCL endemic area in El Kef region, North-Western Tunisia. Using morphological characteristics, all specimens were described and measured. Biopsies from liver, heart, kidney and spleen of each animal were used to extract genomic DNA, which was further used in PCR assays to assess the presence of Leishmania parasites. Different PCRs targeting kinetoplast minicircles, ITS1, mini-exon genes and a repetitive Leishmania- specific sequence, were applied. To further identify Leishmania species involved, RFLP analysis of amplified fragments was performed with appropriate restriction enzymes. Using morphological characters, animals were identified as North African hedgehogs, also called Algerian hedgehogs, that belong to the Erinaceidae family, genus Atelerix Pomel 1848, and species algirus (Lereboullet, 1842). PCR results showed in total that all specimens were Leishmania infected, with different organs incriminated, mainly liver and spleen. Results were confirmed by direct sequencing of amplified fragments. Species identification showed that all specimens were infected with L. major, three of which were additionally co-infected with L. infantum. The present study

  12. Evolution of the tyrosinase gene family in bivalve molluscs: independent expansion of the mantle gene repertoire.

    PubMed

    Aguilera, Felipe; McDougall, Carmel; Degnan, Bernard M

    2014-09-01

    Tyrosinase is a copper-containing enzyme that mediates the hydroxylation of monophenols and oxidation of o-diphenols to o-quinones. This enzyme is involved in a variety of biological processes, including pigment production, innate immunity, wound healing, and exoskeleton fabrication and hardening (e.g. arthropod skeleton and mollusc shell). Here we show that the tyrosinase gene family has undergone large expansions in pearl oysters (Pinctada spp.) and the Pacific oyster (Crassostrea gigas). Phylogenetic analysis reveals that pearl oysters possess at least four tyrosinase genes that are not present in the Pacific oyster. Likewise, C. gigas has multiple tyrosinase genes that are not orthologous to the Pinctada genes, indicating that this gene family has expanded independently in these bivalve lineages. Many of the tyrosinase genes in these bivalves are expressed at relatively high levels in the mantle, the organ responsible for shell fabrication. Detailed comparisons of tyrosinase gene expression in different regions of the mantle in two closely related pearl oysters, P. maxima and P. margaritifera, reveals that recently evolved orthologous tyrosinase genes can have markedly different expression profiles. The expansion of tyrosinase genes in these oysters and their co-option into the mantle's gene regulatory network is consistent with mollusc shell formation being underpinned by a rapidly evolving transcriptome.

  13. PRODH gene is associated with executive function in schizophrenic families.

    PubMed

    Li, Tao; Ma, Xiaohong; Hu, Xun; Wang, Yingcheng; Yan, Chengying; Meng, Huaqing; Liu, Xiehe; Toulopoulou, Timothea; Murray, Robin M; Collier, David A

    2008-07-05

    The aim of this study was to investigate the relationship between polymorphisms in the PRODH and COMT genes and selected neurocognitive functions. Six SNPs in PRODH and two SNPs in COMT were genotyped in 167 first-episode schizophrenic families who had been assessed by a set of 14 neuropsychological tests. Neuropsychological measures were selected as quantitative traits for association analysis. The haplotype of SNPs PRODH 1945T/C and PRODH 1852G/A was associated with impaired performance on the Tower of Hanoi, a problem-solving task mainly reflecting planning capacity. There was no significant evidence for association with any other neuropsychological traits for other SNPs or haplotypes of paired SNPs in the two genes. This study takes previous findings of association between PRODH and schizophrenia further by associating variation within the gene with performance on a neurocognitive trait characteristic of the illness. It fails to confirm previous reports of an association between COMT and cognitive function.

  14. Biofuel Potential of Plants Transformed Genetically with NAC Family Genes

    PubMed Central

    Singh, Sadhana; Grover, Atul; Nasim, M.

    2016-01-01

    NAC genes contribute to enhance survivability of plants under conditions of environmental stress and in secondary growth of the plants, thereby building biomass. Thus, genetic transformation of plants using NAC genes provides a possibility to tailor biofuel plants. Over-expression studies have indicated that NAC family genes can provide tolerance to various biotic and abiotic stresses, either by physiological or biochemical changes at the cellular level, or by affecting visible morphological and anatomical changes, for example, by development of lateral roots in a number of plants. Over-expression of these genes also work as triggers for development of secondary cell walls. In our laboratory, we have observed a NAC gene from Lepidium latifolium contributing to both enhanced biomass as well as cold stress tolerance of model plants tobacco. Thus, we have reviewed all the developments of genetic engineering using NAC genes which could enhance the traits required for biofuel plants, either by enhancing the stress tolerance or by enhancing the biomass of the plants. PMID:26858739

  15. Gene Turnover in the Avian Globin Gene Families and Evolutionary Changes in Hemoglobin Isoform Expression

    PubMed Central

    Opazo, Juan C.; Hoffmann, Federico G.; Natarajan, Chandrasekhar; Witt, Christopher C.; Berenbrink, Michael; Storz, Jay F.

    2015-01-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the αD-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the αA-globin gene), recurrent losses of αD-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa. PMID:25502940

  16. Gene turnover in the avian globin gene families and evolutionary changes in hemoglobin isoform expression.

    PubMed

    Opazo, Juan C; Hoffmann, Federico G; Natarajan, Chandrasekhar; Witt, Christopher C; Berenbrink, Michael; Storz, Jay F

    2015-04-01

    The apparent stasis in the evolution of avian chromosomes suggests that birds may have experienced relatively low rates of gene gain and loss in multigene families. To investigate this possibility and to explore the phenotypic consequences of variation in gene copy number, we examined evolutionary changes in the families of genes that encode the α- and β-type subunits of hemoglobin (Hb), the tetrameric α2β2 protein responsible for blood-O2 transport. A comparative genomic analysis of 52 bird species revealed that the size and membership composition of the α- and β-globin gene families have remained remarkably constant during approximately 100 My of avian evolution. Most interspecific variation in gene content is attributable to multiple independent inactivations of the α(D)-globin gene, which encodes the α-chain subunit of a functionally distinct Hb isoform (HbD) that is expressed in both embryonic and definitive erythrocytes. Due to consistent differences in O2-binding properties between HbD and the major adult-expressed Hb isoform, HbA (which incorporates products of the α(A)-globin gene), recurrent losses of α(D)-globin contribute to among-species variation in blood-O2 affinity. Analysis of HbA/HbD expression levels in the red blood cells of 122 bird species revealed high variability among lineages and strong phylogenetic signal. In comparison with the homologous gene clusters in mammals, the low retention rate for lineage-specific gene duplicates in the avian globin gene clusters suggests that the developmental regulation of Hb synthesis in birds may be more highly conserved, with orthologous genes having similar stage-specific expression profiles and similar functional properties in disparate taxa.

  17. Molecular genetics of the aip gene in familial pituitary tumorigenesis.

    PubMed

    Tahir, Asil; Chahal, Harvinder S; Korbonits, Márta

    2010-01-01

    Pituitary adenomas usually occur as sporadic tumors, but familial cases are now increasingly identified. As opposed to multiple endocrine neoplasia type 1 and Carney complex, in familial isolated pituitary adenoma (FIPA) syndrome no other disease is associated with the familial occurrence of pituitary adenomas. It is an autosomal dominant disease with incomplete variable penetrance. Approximately 20% of patients with FIPA harbour germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene located on 11q13. Patients with AIP mutations have an overwhelming predominance of somatotroph and lactotroph adenomas, which often present in childhood or young adulthood. AIP, originally identified as a molecular co-chaperone of several nuclear receptors, is thought to act as a tumor suppressor gene; overexpression of wild-type, but not mutant AIP, reduces cell proliferation while knockdown of AIP stimulates it. AIP is shown to bind various proteins, including the aryl hydrocarbon receptor, Hsp90, phosphodiesterases, survivin, RET and the glucocorticoid receptor, but currently it is not clear which interaction has the leading role in pituitary tumorigenesis. This chapter summarizes the available clinical and molecular data regarding the role of AIP in the pituitary gland.

  18. Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family

    PubMed Central

    Paixão-Côrtes, Vanessa Rodrigues; Salzano, Francisco Mauro; Bortolini, Maria Cátira

    2013-01-01

    Paired box (PAX) genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory. PMID:24023886

  19. FoxO gene family evolution in vertebrates

    PubMed Central

    Wang, Minghui; Zhang, Xiangzhe; Zhao, Hongbo; Wang, Qishan; Pan, Yuchun

    2009-01-01

    Background Forkhead box, class O (FoxO) belongs to the large family of forkhead transcription factors that are characterized by a conserved forkhead box DNA-binding domain. To date, the FoxO group has four mammalian members: FoxO1, FoxO3a, FoxO4 and FoxO6, which are orthologs of DAF16, an insulin-responsive transcription factor involved in regulating longevity of worms and flies. The degree of homology between these four members is high, especially in the forkhead domain, which contains the DNA-binding interface. Yet, mouse FoxO knockouts have revealed that each FoxO gene has its unique role in the physiological process. Whether the functional divergences are primarily due to adaptive selection pressure or relaxed selective constraint remains an open question. As such, this study aims to address the evolutionary mode of FoxO, which may lead to the functional divergence. Results Sequence similarity searches have performed in genome and scaffold data to identify homologues of FoxO in vertebrates. Phylogenetic analysis was used to characterize the family evolutionary history by identifying two duplications early in vertebrate evolution. To determine the mode of evolution in vertebrates, we performed a rigorous statistical analysis with FoxO gene sequences, including relative rate ratio tests, branch-specific dN/dS ratio tests, site-specific dN/dS ratio tests, branch-site dN/dS ratio tests and clade level amino acid conservation/variation patterns analysis. Our results suggest that FoxO is constrained by strong purifying selection except four sites in FoxO6, which have undergone positive Darwinian selection. The functional divergence in this family is best explained by either relaxed purifying selection or positive selection. Conclusion We present a phylogeny describing the evolutionary history of the FoxO gene family and show that the genes have evolved through duplications followed by purifying selection except for four sites in FoxO6 fixed by positive selection lie

  20. Equine cryptosporidial infection associated with Cryptosporidium hedgehog genotype in Algeria.

    PubMed

    Laatamna, Abd Elkarim; Wagnerová, Pavla; Sak, Bohumil; Květoňová, Dana; Aissi, Miriem; Rost, Michael; Kváč, Martin

    2013-10-18

    Faecal samples from two horse farms in Algeria keeping Arabian, Thoroughbred, and Barb horses were examined for the presence of Cryptosporidium in 2010-2011. A total of 138 faecal samples (16 from a farm keeping 50 animals and 122 from a farm with 267 horses) were screened for Cryptosporidium spp. infection using molecular tools. DNA was extracted from all samples. Nested PCR was performed to amplify fragments of the SSU rDNA and gp60 genes to determine the presence of Cryptosporidium species and genotypes. Sequence analyses of SSU and gp60 genes revealed four animals positive for the presence of subtype XIIIa A22R9 of the Cryptosporidium hedgehog genotype. The infections were not associated with diarrhoea. This study reports, for the first time, the occurrence of Cryptosporidium in Algeria and the first occurrence of the hedgehog genotype in horses. These findings support the potential role of infected horses in sylvatic-domestic transmission of Cryptosporidium.

  1. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    PubMed

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis.

  2. The ANKH gene and familial calcium pyrophosphate dihydrate deposition disease.

    PubMed

    Netter, Patrick; Bardin, Thomas; Bianchi, Arnaud; Richette, Pascal; Loeuille, Damien

    2004-09-01

    Familial calcium pyrophosphate dihydrate deposition (CPPD) disease is a chronic condition in which CPPD microcrystals deposit in the joint fluid, cartilage, and periarticular tissues. Two forms of familial CPPD disease have been identified: CCAL1 and CCAL2. The CCAL1 locus is located on the long arm of chromosome 8 and is associated with CPPD and severe osteoarthritis. The CCAL2 locus has been mapped to the short arm of chromosome 5 and identified in families from the Alsace region of France and the United Kingdom. The ANKH protein is involved in pyrophosphate metabolism and, more specifically, in pyrophosphate transport from the intracellular to the extracellular compartment. Numerous ANKH gene mutations cause familial CCAL2; they enhance ANKH protein activity, thereby elevating extracellular pyrophosphate levels and promoting the formation of pyrophosphate crystals, which produce the manifestations of the disease. Recent studies show that growth factors and cytokines can modify the expression of the normal ANKH protein. These results suggest a role for ANKH in sporadic CPPD disease and in CPPD associated with degenerative disease.

  3. Multiple Inter-Kingdom Horizontal Gene Transfers in the Evolution of the Phosphoenolpyruvate Carboxylase Gene Family

    PubMed Central

    Wang, Wen; Su, Bing

    2012-01-01

    Pepcase is a gene encoding phosphoenolpyruvate carboxylase that exists in bacteria, archaea and plants,playing an important role in plant metabolism and development. Most plants have two or more pepcase genes belonging to two gene sub-families, while only one gene exists in other organisms. Previous research categorized one plant pepcase gene as plant-type pepcase (PTPC) while the other as bacteria-type pepcase (BTPC) because of its similarity with the pepcase gene found in bacteria. Phylogenetic reconstruction showed that PTPC is the ancestral lineage of plant pepcase, and that all bacteria, protistpepcase and BTPC in plants are derived from a lineage of pepcase closely related with PTPC in algae. However, their phylogeny contradicts the species tree and traditional chronology of organism evolution. Because the diversification of bacteria occurred much earlier than the origin of plants, presumably all bacterialpepcase derived from the ancestral PTPC of algal plants after divergingfrom the ancestor of vascular plant PTPC. To solve this contradiction, we reconstructed the phylogeny of pepcase gene family. Our result showed that both PTPC and BTPC are derived from an ancestral lineage of gamma-proteobacteriapepcases, possibly via an ancient inter-kingdom horizontal gene transfer (HGT) from bacteria to the eukaryotic common ancestor of plants, protists and cellular slime mold. Our phylogenetic analysis also found 48other pepcase genes originated from inter-kingdom HGTs. These results imply that inter-kingdom HGTs played important roles in the evolution of the pepcase gene family and furthermore that HGTsare a more frequent evolutionary event than previouslythought. PMID:23251445

  4. Family Size Evolution in Drosophila Chemosensory Gene Families: A Comparative Analysis with a Critical Appraisal of Methods

    PubMed Central

    Almeida, Francisca C.; Sánchez-Gracia, Alejandro; Campos, Jose Luis; Rozas, Julio

    2014-01-01

    Gene turnover rates and the evolution of gene family sizes are important aspects of genome evolution. Here, we use curated sequence data of the major chemosensory gene families from Drosophila—the gustatory receptor, odorant receptor, ionotropic receptor, and odorant-binding protein families—to conduct a comparative analysis among families, exploring different methods to estimate gene birth and death rates, including an ad hoc simulation study. Remarkably, we found that the state-of-the-art methods may produce very different rate estimates, which may lead to disparate conclusions regarding the evolution of chemosensory gene family sizes in Drosophila. Among biological factors, we found that a peculiarity of D. sechellia’s gene turnover rates was a major source of bias in global estimates, whereas gene conversion had negligible effects for the families analyzed herein. Turnover rates vary considerably among families, subfamilies, and ortholog groups although all analyzed families were quite dynamic in terms of gene turnover. Computer simulations showed that the methods that use ortholog group information appear to be the most accurate for the Drosophila chemosensory families. Most importantly, these results reveal the potential of rate heterogeneity among lineages to severely bias some turnover rate estimation methods and the need of further evaluating the performance of these methods in a more diverse sampling of gene families and phylogenetic contexts. Using branch-specific codon substitution models, we find further evidence of positive selection in recently duplicated genes, which attests to a nonneutral aspect of the gene birth-and-death process. PMID:24951565

  5. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy

    PubMed Central

    Barroso, Fabio; González‐Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-01-01

    ABSTRACT Transthyretin familial amyloid polyneuropathy (TTR‐FAP) is a rare, severe, and irreversible, adult‐onset, hereditary disorder caused by autosomal‐dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR‐FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease‐modifying treatment options for a wider spectrum of patients with TTR‐FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation‐specific predictive genetic testing in first‐degree relatives of index patients diagnosed with TTR‐FAP and the structured clinical follow‐up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353–360, 2016 PMID:27273296

  6. Management of asymptomatic gene carriers of transthyretin familial amyloid polyneuropathy.

    PubMed

    Schmidt, Hartmut H-J; Barroso, Fabio; González-Duarte, Alejandra; Conceição, Isabel; Obici, Laura; Keohane, Denis; Amass, Leslie

    2016-09-01

    Transthyretin familial amyloid polyneuropathy (TTR-FAP) is a rare, severe, and irreversible, adult-onset, hereditary disorder caused by autosomal-dominant mutations in the TTR gene that increase the intrinsic propensity of transthyretin protein to misfold and deposit systemically as insoluble amyloid fibrils in nerve tissues, the heart, and other organs. TTR-FAP is characterized by relentless, progressively debilitating polyneuropathy, and leads to death, on average, within 10 years of symptom onset without treatment. With increased availability of disease-modifying treatment options for a wider spectrum of patients with TTR-FAP, timely detection of the disease may offer substantial clinical benefits. This review discusses mutation-specific predictive genetic testing in first-degree relatives of index patients diagnosed with TTR-FAP and the structured clinical follow-up of asymptomatic gene carriers for prompt diagnosis and early therapeutic intervention before accumulation of substantial damage. Muscle Nerve 54: 353-360, 2016.

  7. Mammary gland tumors in captive African hedgehogs.

    PubMed

    Raymond, J T; Gerner, M

    2000-04-01

    From December 1995 to July 1999, eight mammary gland tumors were diagnosed in eight adult captive female African hedgehogs (Atelerix albiventris). The tumors presented as single or multiple subcutaneous masses along the cranial or caudal abdomen that varied in size for each hedgehog. Histologically, seven of eight (88%) mammary gland tumors were malignant. Tumors were classified as solid (4 cases), tubular (2 cases), and papillary (2 cases). Seven tumors had infiltrated into the surrounding stroma and three tumors had histologic evidence of neoplastic vascular invasion. Three hedgehogs had concurrent neoplasms. These are believed to be the first reported cases of mammary gland tumors in African hedgehogs.

  8. Identification and analysis of the metacaspase gene family in tomato.

    PubMed

    Liu, Hui; Liu, Jian; Wei, Yongxuan

    2016-10-21

    Metacaspases play critical roles in developmentally regulated and environmentally induced programmed cell death in plants. In this study, we systematically identified and analyzed metacaspase gene family in tomato (Solanum lycopersicum). The results illustrated that tomato possesses eight metacaspase genes (SlMC1-8) located on chromosomes 1, 3, 5, 9, and 10. SlMC1-6 belonged to type I metacaspases and had 5 exon/4 intron structures. SlMC7 and 8 were type II metacaspases and had 2 and 3 exons, respectively. Expression analysis revealed distinct expression patterns of SlMCs in various tomato tissues. Cis-regulatory element prediction showed that there were many hormone- and stress-related cis-regulatory elements in SlMCs promoter regions. Quantitative real-time PCR analysis further demonstrated that most of the SlMCs were regulated by drought, cold, salt, methyl viologen, and ethephon treatments. This study provides insights into the characteristics of SlMC genes and laid the foundation for further functional analysis of these genes in tomato.

  9. Babesia bovis expresses Bbo-6cys-E, a member of a novel gene family that is homologous to the 6-cys family of Plasmodium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A novel Babesia bovis gene family encoding proteins with similarities to the Plasmodium 6cys protein family was identified by TBLASTN searches of the Babesia bovis genome using the sequence of the P. falciparum PFS230 protein as query, and was termed Bbo-6cys gene family. The Bbo-cys6 gene family co...

  10. Identification, Phylogeny, and Transcript of Chitinase Family Genes in Sugarcane

    PubMed Central

    Su, Yachun; Xu, Liping; Wang, Shanshan; Wang, Zhuqing; Yang, Yuting; Chen, Yun; Que, Youxiong

    2015-01-01

    Chitinases are pathogensis-related proteins, which play an important role in plant defense mechanisms. The role of the sugarcane chitinase family genes remains unclear due to the highly heterozygous and aneuploidy chromosome genetic background of sugarcane. Ten differentially expressed chitinase genes (belonging to class I~VII) were obtained from RNA-seq analysis of both incompatible and compatible sugarcane genotypes during Sporisorium scitamineum challenge. Their structural properties and expression patterns were analyzed. Seven chitinases (ScChiI1, ScChiI2, ScChiI3, ScChiIII1, ScChiIII2, ScChiIV1 and ScChiVI1) showed more positive with early response and maintained increased transcripts in the incompatible interaction than those in the compatible one. Three (ScChiII1, ScChiV1 and ScChiVII1) seemed to have no significant difference in expression patterns between incompatible and compatible interactions. The ten chitinases were expressed differentially in response to hormone treatment as well as having distinct tissue specificity. ScChiI1, ScChiIV1 and ScChiVII1 were induced by various abiotic stresses (NaCl, CuCl2, PEG and 4 °C) and their involvement in plant immunity was demonstrated by over-expression in Nicotiana benthamiana. The results suggest that sugarcane chitinase family exhibit differential responses to biotic and abiotic stress, providing new insights into their function. PMID:26035173

  11. Genomics and evolution of the TRIM gene family.

    PubMed

    Meroni, Germana

    2012-01-01

    The TRIM family comprises proteins characterized by the presence of thetripartite motifthat is composed of a RING domain, one or two B-box domains and a Coiled-coil region. These proteins are implicated in a plethora of cellular processes such as apoptosis, cell cycle regulation, muscular physiology and innate immune response. Consistently, their alteration results in several pathological conditions emphasizing their medical relevance. The TRIM members domain structure underscores a common biochemical function as E3 ligases within the ubiquitylation cascade, which is then translated into diverse biological processes. The TRIM proteins represent one of the largest families in mammals counting in human almost 70 members. TRIM proteins are metazoan-specific and have been now identified in several species although the great increase in their number was generated in vertebrate species. The important expansion of the number of TRIM genes underlie the success of the tripartite module in ubiquitylation process. Furthermore, their massive diversification among species was achieved through fast evolution of the TRIM genes implicated in pathogen response.

  12. Hedgehog inhibition causes complete loss of limb outgrowth and transformation of digit identity in Xenopus tropicalis.

    PubMed

    Stopper, Geffrey F; Richards-Hrdlicka, Kathryn L; Wagner, Günter P

    2016-03-01

    The study of the tetrapod limb has contributed greatly to our understanding of developmental pathways and how changes to these pathways affect the evolution of morphology. Most of our understanding of tetrapod limb development comes from research on amniotes, with far less known about mechanisms of limb development in amphibians. To better understand the mechanisms of limb development in anuran amphibians, we used cyclopamine to inhibit Hedgehog signaling at various stages of development in the western clawed frog, Xenopus tropicalis, and observed resulting morphologies. We also analyzed gene expression changes resulting from similar experiments in Xenopus laevis. Inhibition of Hedgehog signaling in X. tropicalis results in limb abnormalities including reduced digit number, missing skeletal elements, and complete absence of limbs. In addition, posterior digits assume an anterior identity by developing claws that are usually only found on anterior digits, confirming Sonic hedgehog's role in digit identity determination. Thus, Sonic hedgehog appears to play mechanistically separable roles in digit number specification and digit identity specification as in other studied tetrapods. The complete limb loss observed in response to reduced Hedgehog signaling in X. tropicalis, however, is striking, as this functional role for Hedgehog signaling has not been found in any other tetrapod. This changed mechanism may represent a substantial developmental constraint to digit number evolution in frogs. J. Exp. Zool. (Mol. Dev. Evol.) 9999B:XX-XX, 2016. © 2016 Wiley Periodicals, Inc.

  13. Detection of Rickettsia helvetica in ticks collected from European hedgehogs (Erinaceus europaeus, Linnaeus, 1758).

    PubMed

    Speck, Stephanie; Perseke, Lea; Petney, Trevor; Skuballa, Jasmin; Pfäffle, Miriam; Taraschewski, Horst; Bunnell, Toni; Essbauer, Sandra; Dobler, Gerhard

    2013-04-01

    The role of wild mammals in the dissemination and maintenance of Rickettsia in nature is still under investigation. European hedgehogs (Erinaceus europaeus) are often heavily infested by tick and flea species that are known to harbor and transmit different Rickettsia spp. We investigated ixodid ticks sampled from European hedgehogs for the presence of Rickettsia. A total of 471 Ixodes ricinus and 755 I. hexagonus were collected from 26 German and 7 British European hedgehogs. These were tested by a genus-specific real-time PCR assay targeting the citrate synthase gene (gltA). The rickettsia minimum infection rate was 11.7% with an increase detected with each parasitic tick stage. No significant difference in Rickettsia prevalence in the 2 Ixodes species was detected. Using sequencing of partial ompB, Rickettsia helvetica was the only species identified. More than half of the hedgehogs carried Rickettsia-positive ticks. In addition, tissue samples from 2/5 hedgehogs (where tissue DNA was available) were PCR-positive. These results show that European hedgehogs are exposed to R. helvetica via infected ticks and might be involved in the natural transmission cycle of this Rickettsia species.

  14. REN(KCTD11) is a suppressor of Hedgehog signaling and is deleted in human medulloblastoma.

    PubMed

    Di Marcotullio, Lucia; Ferretti, Elisabetta; De Smaele, Enrico; Argenti, Beatrice; Mincione, Claudia; Zazzeroni, Francesca; Gallo, Rita; Masuelli, Laura; Napolitano, Maddalena; Maroder, Marella; Modesti, Andrea; Giangaspero, Felice; Screpanti, Isabella; Alesse, Edoardo; Gulino, Alberto

    2004-07-20

    Hedgehog signaling is suggested to be a major oncogenic pathway in medulloblastoma, which arises from aberrant development of cerebellar granule progenitors. Allelic loss of chromosome 17p has also been described as the most frequent genetic defect in this human neoplasia. This observation raises the question of a possible interplay between 17p deletion and the Hedgehog tumorigenic pathway. Here, we identify the human orthologue of mouse REN(KCTD11), previously reported to be expressed in differentiating and low proliferating neuroblasts. Human REN(KCTD11) maps to 17p13.2 and displays allelic deletion as well as significantly reduced expression in medulloblastoma. REN(KCTD11) inhibits medulloblastoma cell proliferation and colony formation in vitro and suppresses xenograft tumor growth in vivo. REN(KCTD11) seems to inhibit medulloblastoma growth by negatively regulating the Hedgehog pathway because it antagonizes the Gli-mediated transactivation of Hedgehog target genes, by affecting Gli1 nuclear transfer, and its growth inhibitory activity is impaired by Gli1 inactivation. Therefore, we identify REN(KCTD11) as a suppressor of Hedgehog signaling and suggest that its inactivation might lead to a deregulation of the tumor-promoting Hedgehog pathway in medulloblastoma.

  15. RENKCTD11 is a suppressor of Hedgehog signaling and is deleted in human medulloblastoma

    PubMed Central

    Di Marcotullio, Lucia; Ferretti, Elisabetta; De Smaele, Enrico; Argenti, Beatrice; Mincione, Claudia; Zazzeroni, Francesca; Gallo, Rita; Masuelli, Laura; Napolitano, Maddalena; Maroder, Marella; Modesti, Andrea; Giangaspero, Felice; Screpanti, Isabella; Alesse, Edoardo; Gulino, Alberto

    2004-01-01

    Hedgehog signaling is suggested to be a major oncogenic pathway in medulloblastoma, which arises from aberrant development of cerebellar granule progenitors. Allelic loss of chromosome 17p has also been described as the most frequent genetic defect in this human neoplasia. This observation raises the question of a possible interplay between 17p deletion and the Hedgehog tumorigenic pathway. Here, we identify the human orthologue of mouse RENKCTD11, previously reported to be expressed in differentiating and low proliferating neuroblasts. Human RENKCTD11 maps to 17p13.2 and displays allelic deletion as well as significantly reduced expression in medulloblastoma. RENKCTD11 inhibits medulloblastoma cell proliferation and colony formation in vitro and suppresses xenograft tumor growth in vivo. RENKCTD11 seems to inhibit medulloblastoma growth by negatively regulating the Hedgehog pathway because it antagonizes the Gli-mediated transactivation of Hedgehog target genes, by affecting Gli1 nuclear transfer, and its growth inhibitory activity is impaired by Gli1 inactivation. Therefore, we identify RENKCTD11 as a suppressor of Hedgehog signaling and suggest that its inactivation might lead to a deregulation of the tumor-promoting Hedgehog pathway in medulloblastoma. PMID:15249678

  16. The conserved barH-like homeobox-2 gene barhl2 acts downstream of orthodentricle-2 and together with iroquois-3 in establishment of the caudal forebrain signaling center induced by Sonic Hedgehog.

    PubMed

    Juraver-Geslin, Hugo A; Gómez-Skarmeta, José Luis; Durand, Béatrice C

    2014-12-01

    In this study, we investigated the gene regulatory network that governs formation of the Zona limitans intrathalamica (ZLI), a signaling center that secretes Sonic Hedgehog (Shh) to control the growth and regionalization of the caudal forebrain. Using loss- and gain-of-function, explants and grafting experiments in amphibians, we demonstrate that barhl2 acts downstream of otx2 and together with the iroquois (irx)-3 gene in establishment of the ZLI compartment initiated by Shh influence. We find that the presumptive (pre)-ZLI domain expresses barhl2, otx2 and irx3, whereas the thalamus territory caudally bordering the pre-ZLI expresses barhl2, otx2 and irx1/2 and early on irx3. We demonstrate that Barhl2 activity is required for determination of the ZLI and thalamus fates and that within the p2 alar plate the ratio of Irx3 to Irx1/2 contributes to ZLI specification and size determination. We show that when continuously exposed to Shh, neuroepithelial cells coexpressing barhl2, otx2 and irx3 acquire two characteristics of the ZLI compartment-the competence to express shh and the ability to segregate from anterior neural plate cells. In contrast, neuroepithelial cells expressing barhl2, otx2 and irx1/2, are not competent to express shh. Noteworthy in explants, under Shh influence, ZLI-like cells segregate from thalamic-like cells. Our study establishes that Barhl2 activity plays a key role in p2 alar plate patterning, specifically ZLI formation, and provides new insights on establishment of the signaling center of the caudal forebrain.

  17. Notochord-derived hedgehog is essential for tail regeneration in Xenopus tadpole

    PubMed Central

    2014-01-01

    Background Appendage regeneration in amphibians is regulated by the combinatorial actions of signaling molecules. The requirement of molecules secreted from specific tissues is reflected by the observation that the whole process of regeneration can be inhibited if a certain tissue is removed from the amputated stump. Interestingly, urodeles and anurans show different tissue dependencies during tail regeneration. The spinal cord is essential for tail regeneration in urodele but not in anuran larva, whereas the notochord but not the spinal cord is essential for tail regeneration in anuran tadpoles. Sonic hedgehog is one of the signaling molecules responsible for such phenomenon in axolotl, as hedgehog signaling is essential for overall tail regeneration and sonic hedgehog is exclusively expressed in the spinal cord. In order to know whether hedgehog signaling is involved in the molecular mechanism underlying the inconsistent tissue dependency for tail regeneration between anurans and urodeles, we investigated expression of hedgehog signal-related genes in the regenerating tail of Xenopus tadpole and examined the effect of the hedgehog signal inhibitor, cyclopamine, on the tail regeneration. Results In Xenopus, sonic hedgehog is expressed exclusively in the notochord but not in the spinal cord of the regenerate. Overall regeneration was severely impaired in cyclopamine-treated tadpoles. Notochord maturation in the regenerate, including cell alignment and vacuolation, and myofiber formation were inhibited. Proliferation of spinal cord cells in the neural ampulla and of mesenchymal cells was also impaired. Conclusion As in the axolotl, hedgehog signaling is required for multiple steps in tail regeneration in the Xenopus tadpole, although the location of the Shh source is quite different between the two species. This difference in Shh localization is the likely basis for the differing tissue requirement for tail regeneration between urodeles and anurans. PMID:24941877

  18. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  19. Transcriptional activation of hedgehog pathway components in aggressive hemangioma.

    PubMed

    Wendling-Keim, Danielle S; Wanie, Lynn; Grantzow, Rainer; Kappler, Roland

    2017-03-31

    Infantile hemangioma is a vascular neoplasm and is one of the most common tumors diagnosed in young children. Although most hemangiomas are harmless and involute spontaneously, some show severe progression, leading to serious complications, such as high output cardiac failure, ulcerations, compression of the trachea or deprivation amblyopia, depending on their size and localization. However, the pathogenesis and cause of hemangioma are largely unknown to date. The goal of this study was to identify markers that could predict hemangiomas with aggressive growth and severe progression that would benefit from early intervention. By using a PCR-based screening approach, we first confirmed that previously known markers of hemangioma, namely FGF2 and GLUT1, are highly expressed in hemangioma. Nevertheless, these genes did not show any differential expression between severely progressing tumors and mild tumors. However, transcriptional upregulation of several Hedgehog signaling components, comprising the ligand Sonic Hedgehog (SHH),the transcription factor GLI2 and its target gene FOXA2 were detected in extremely aggressive hemangioma specimens during the proliferation phase. Notably, GLI2 was even overexpressed in involuting hemangiomas if they showed an aggressive growth pattern. In conclusion, our data suggest that overexpression of the Hedgehog components SHH, GLI2 and FOXA2 might be used as markers of an aggressive hemangioma that would benefit from too early intervention, while FGF2 and GLUT1 are more general markers of hemangiomas. This article is protected by copyright. All rights reserved.

  20. Recent Developments in Gene Therapy for Homozygous Familial Hypercholesterolemia.

    PubMed

    Ajufo, Ezim; Cuchel, Marina

    2016-05-01

    Homozygous familial hypercholesterolemia (HoFH) is a life-threatening Mendelian disorder with a mean life expectancy of 33 years despite maximally tolerated standard lipid-lowering therapies. This disease is an ideal candidate for gene therapy, and in the last few years, a number of exciting developments have brought this approach closer to the clinic than ever before. In this review, we discuss in detail the most advanced of these developments, a recombinant adeno-associated virus (AAV) vector carrying a low-density lipoprotein receptor (LDLR) transgene which has recently entered phase 1/2a testing. We also review ongoing development of approaches to enhance transgene expression, improve the efficiency of hepatocyte transduction, and minimize the AAV capsid-specific adaptive immune response. We include a summary of key gene therapy approaches for HoFH in pre-clinical development, including RNA silencing of the gene encoding HMG-CoA reductase (HMGCR) and induced pluripotent stem cell transplant therapy.

  1. Gene expression patterns of invertase gene families and modulation of the inhibitor gene in tomato sucrose metabolism.

    PubMed

    Zhang, Y L; Zhang, A H; Jiang, J

    2013-01-24

    Patterns of gene expression in the different types of sucrose metabolism in the tomato are highly variable and heritable. This genetic variation causes considerable functional differences. We examined the patterns of expression of invertase (Inv) gene families and an invertase inhibitor (INH) gene involved in elongating roots, hypocotyls, and fruit of the tomato (Lycopersicon esculentum cv. Micro-Tom and L. chmielewskii) through a real-time quantitative PCR analysis. We found that the Lin6 gene plays an important role in the vegetative growth stage. Lin5 and Lin7 did not express in Micro-Tom, but did express in L. chmielewskii. Overall relative expression levels of sucrose Inv gene families were significantly lower in L. chmielewskii during the reproductive growth stage than in Micro-Tom, being up to hundreds of times lower. It was not expressed in the dissepiment in L. chmielewskii. We suggest that differences in sucrose accumulation in tomato fruit is mainly due to differentially expressed invertase gene families at the later fruit growth stages.

  2. Paracrine Hedgehog signaling in stomach and intestine: new roles for Hedgehog in gastrointestinal patterning

    PubMed Central

    Kolterud, Åsa; Grosse, Ann S.; Zacharias, William J.; Walton, Katherine D.; Kretovich, Katherine E.; Madison, Blair; Waghray, Meghna; Ferris, Jennifer E.; Hu, Chunbo; Merchant, Juanita L.; Dlugosz, Andrzej; Kottmann, Andreas H.; Gumucio, Deborah L.

    2009-01-01

    Background & Aims Hedgehog signaling is critical in gastrointestinal patterning. Mice deficient in Hedgehog signaling exhibit abnormalities that mirror deformities seen in the human VACTERL (vertebral, anal, cardiac, tracheal, esophageal, renal, limb) association. However, the direction of Hedgehog signal flow is controversial and the cellular targets of Hedgehog signaling change with time during development. We profiled cellular Hedgehog response patterns from embryonic day 10.5 (E10.5) to adult in murine antrum, pyloric region, small intestine and colon. Methods Hedgehog signaling was profiled using Hedgehog pathway reporter mice and in situ hybridization. Cellular targets were identified by immunostaining. Ihh-overexpressing transgenic animals were generated and analyzed. Results Hedgehog signaling is strictly paracrine from antrum to colon throughout embryonic and adult life. Novel findings include: mesothelial cells of the serosa transduce Hedgehog signals in fetal life; the hindgut epithelium expresses Ptch but not Gli1 at E10.5; the two layers of the muscularis externa respond differently to Hedgehog signals; organogenesis of the pyloric sphincter is associated with robust Hedgehog signaling; dramatically different Hedgehog responses characterize stomach and intestine at E16; after birth, the muscularis mucosa and villus smooth muscle (SM) consist primarily of Hedgehog responsive cells and Hh levels actively modulate villus core SM. Conclusions These studies reveal a previously unrecognized association of paracrine Hedgehog signaling with several gastrointestinal patterning events involving the serosa, pylorus and villus smooth muscle. The results may have implications for several human anomalies and could potentially expand the spectrum of the human VACTERL association. PMID:19445942

  3. Proteasome inhibition reverses hedgehog inhibitor and taxane resistance in ovarian cancer.

    PubMed

    Steg, Adam D; Burke, Mata R; Amm, Hope M; Katre, Ashwini A; Dobbin, Zachary C; Jeong, Dae Hoon; Landen, Charles N

    2014-08-30

    The goal of this study was to determine whether combined targeted therapies, specifically those against the Notch, hedgehog and ubiquitin-proteasome pathways, could overcome ovarian cancer chemoresistance. Chemoresistant ovarian cancer cells were exposed to gamma-secretase inhibitors (GSI-I, Compound E) or the proteasome inhibitor bortezomib, alone and in combination with the hedgehog antagonist, LDE225. Bortezomib, alone and in combination with LDE225, was evaluated for effects on paclitaxel efficacy. Cell viability and cell cycle analysis were assessed by MTT assay and propidium iodide staining, respectively. Proteasome activity and gene expression were determined by luminescence assay and qPCR, respectively. Studies demonstrated that GSI-I, but not Compound E, inhibited proteasome activity, similar to bortezomib. Proteasome inhibition decreased hedgehog target genes (PTCH1, GLI1 and GLI2) and increased LDE225 sensitivity in vitro. Bortezomib, alone and in combination with LDE225, increased paclitaxel sensitivity through apoptosis and G2/M arrest. Expression of the multi-drug resistance gene ABCB1/MDR1 was decreased and acetylation of α-tubulin, a marker of microtubule stabilization, was increased following bortezomib treatment. HDAC6 inhibitor tubastatin-a demonstrated that microtubule effects are associated with hedgehog inhibition and sensitization to paclitaxel and LDE225. These results suggest that proteasome inhibition, through alteration of microtubule dynamics and hedgehog signaling, can reverse taxane-mediated chemoresistance.

  4. A Polyamine Twist on Hedgehog Signaling.

    PubMed

    Zhao, Xuesong; Segal, Rosalind A

    2015-10-12

    The Hedgehog pathway plays important roles in embryonic development and oncogenesis, but how it affects metabolism is less clear. D'Amico et al. (2015) now demonstrate that the Hedgehog pathway regulates translation of ornithine decarboxylase, thereby enhancing polyamine biosynthesis and cell proliferation in neural precursor cells and in brain tumors.

  5. Cytologic diagnosis of diseases of hedgehogs.

    PubMed

    Juan-Sallés, Carles; Garner, Michael M

    2007-01-01

    This article focuses on neoplastic diseases because they may be the most frequent disease processes in captive hedgehogs according to the literature and authors' case files and the most common cases submitted for cytologic diagnosis in these species, particularly the African hedgehog (Atelerix albiventris).

  6. "Atypical" regulation of Hedgehog-dependent cancers.

    PubMed

    Atwood, Scott X; Oro, Anthony E

    2014-02-10

    Growing evidence indicates targeting PKCι may be effective in treating Hedgehog-dependent cancers. In this issue of Cancer Cell, Justilien and colleagues present the surprising finding that PKCι promotes Hedgehog ligand production and lung squamous cell carcinoma growth through SOX2, rather than the canonical transcription factor GLI.

  7. sm"FISH"ing for Hedgehog.

    PubMed

    Drummond, Michael L; Atwood, Scott X

    2017-01-01

    Patched (Ptch) receptors are critical negative regulators of Hedgehog signaling, where Ptch1 loss causes basal cell carcinoma and Ptch1;Ptch2 loss disrupts skin and hair follicle development. Adolphe et al. use single molecule fluorescent in situ hybridization to show quantitatively that Ptch receptors create a Hedgehog signaling gradient that may specify hair follicle development.

  8. Analysis of the Transcriptomes Downstream of Eyeless and the Hedgehog, Decapentaplegic and Notch Signaling Pathways in Drosophila melanogaster

    PubMed Central

    Nfonsam, Landry E.; Cano, Carlos; Mudge, Joann; Schilkey, Faye D.; Curtiss, Jennifer

    2012-01-01

    Tissue-specific transcription factors are thought to cooperate with signaling pathways to promote patterned tissue specification, in part by co-regulating transcription. The Drosophila melanogaster Pax6 homolog Eyeless forms a complex, incompletely understood regulatory network with the Hedgehog, Decapentaplegic and Notch signaling pathways to control eye-specific gene expression. We report a combinatorial approach, including mRNAseq and microarray analyses, to identify targets co-regulated by Eyeless and Hedgehog, Decapentaplegic or Notch. Multiple analyses suggest that the transcriptomes resulting from co-misexpression of Eyeless+signaling factors provide a more complete picture of eye development compared to previous efforts involving Eyeless alone: (1) Principal components analysis and two-way hierarchical clustering revealed that the Eyeless+signaling factor transcriptomes are closer to the eye control transcriptome than when Eyeless is misexpressed alone; (2) more genes are upregulated at least three-fold in response to Eyeless+signaling factors compared to Eyeless alone; (3) based on gene ontology analysis, the genes upregulated in response to Eyeless+signaling factors had a greater diversity of functions compared to Eyeless alone. Through a secondary screen that utilized RNA interference, we show that the predicted gene CG4721 has a role in eye development. CG4721 encodes a neprilysin family metalloprotease that is highly up-regulated in response to Eyeless+Notch, confirming the validity of our approach. Given the similarity between D. melanogaster and vertebrate eye development, the large number of novel genes identified as potential targets of Ey+signaling factors will provide novel insights to our understanding of eye development in D. melanogaster and humans. PMID:22952997

  9. Sortilin regulates sorting and secretion of Sonic hedgehog.

    PubMed

    Campbell, Charles; Beug, Shawn; Nickerson, Philip E B; Peng, Jimmy; Mazerolle, Chantal; Bassett, Erin A; Ringuette, Randy; Jama, Fadumo A; Morales, Carlos; Christ, Annabel; Wallace, Valerie A

    2016-10-15

    Sonic Hedgehog (Shh) is a secreted morphogen that is an essential regulator of patterning and growth. The Shh full-length protein undergoes autocleavage in the endoplasmic reticulum to generate the biologically active N-terminal fragment (ShhN), which is destined for secretion. We identified sortilin (Sort1), a member of the VPS10P-domain receptor family, as a new Shh trafficking receptor. We demonstrate that Sort-Shh interact by performing coimmunoprecipitation and proximity ligation assays in transfected cells and that they colocalize at the Golgi. Sort1 overexpression causes re-distribution of ShhN and, to a lesser extent, of full-length Shh to the Golgi and reduces Shh secretion. We show loss of Sort1 can partially rescue Hedgehog-associated patterning defects in a mouse model that is deficient in Shh processing, and we show that Sort1 levels negatively regulate anterograde Shh transport in axons in vitro and Hedgehog-dependent axon-glial interactions in vivo Taken together, we conclude that Shh and Sort1 can interact at the level of the Golgi and that Sort1 directs Shh away from the pathways that promote its secretion.

  10. Hedgehog Signaling in Pancreatic Fibrosis and Cancer.

    PubMed

    Bai, Yongyu; Bai, Yongheng; Dong, Jiaojiao; Li, Qiang; Jin, Yuepeng; Chen, Bicheng; Zhou, Mengtao

    2016-03-01

    The hedgehog signaling pathway was first discovered in the 1980s. It is a stem cell-related pathway that plays a crucial role in embryonic development, tissue regeneration, and organogenesis. Aberrant activation of hedgehog signaling leads to pathological consequences, including a variety of human tumors such as pancreatic cancer. Multiple lines of evidence indicate that blockade of this pathway with several small-molecule inhibitors can inhibit the development of pancreatic neoplasm. In addition, activated hedgehog signaling has been reported to be involved in fibrogenesis in many tissues, including the pancreas. Therefore, new therapeutic targets based on hedgehog signaling have attracted a great deal of attention to alleviate pancreatic diseases. In this review, we briefly discuss the recent advances in hedgehog signaling in pancreatic fibrogenesis and carcinogenesis and highlight new insights on their potential relationship with respect to the development of novel targeted therapies.

  11. Hedgehog Signaling in Pancreatic Fibrosis and Cancer

    PubMed Central

    Bai, Yongyu; Bai, Yongheng; Dong, Jiaojiao; Li, Qiang; Jin, Yuepeng; Chen, Bicheng; Zhou, Mengtao

    2016-01-01

    Abstract The hedgehog signaling pathway was first discovered in the 1980s. It is a stem cell-related pathway that plays a crucial role in embryonic development, tissue regeneration, and organogenesis. Aberrant activation of hedgehog signaling leads to pathological consequences, including a variety of human tumors such as pancreatic cancer. Multiple lines of evidence indicate that blockade of this pathway with several small-molecule inhibitors can inhibit the development of pancreatic neoplasm. In addition, activated hedgehog signaling has been reported to be involved in fibrogenesis in many tissues, including the pancreas. Therefore, new therapeutic targets based on hedgehog signaling have attracted a great deal of attention to alleviate pancreatic diseases. In this review, we briefly discuss the recent advances in hedgehog signaling in pancreatic fibrogenesis and carcinogenesis and highlight new insights on their potential relationship with respect to the development of novel targeted therapies. PMID:26962810

  12. Cardiac assessment of African hedgehogs (Atelerix albiventris).

    PubMed

    Black, Peter A; Marshall, Cecilia; Seyfried, Alice W; Bartin, Anne M

    2011-03-01

    Cardiomyopathy is a common finding in captive African hedgehogs (Atelerix albiventris) at postmortem exam. To date, treatment attempts have been mostly empirical and unrewarding. The objective of this study was to determine reference cardiac values for captive African hedgehogs based on echocardiogram, electrocardiogram (ECG), and radiographs. Adult African hedgehogs with no clinical signs of cardiac disease (n = 13) were selected. Each animal was anesthetized with isoflurane via facemask and an echocardiogram, ECG, and radiographs were performed. Standard measurements were taken and the descriptive statistics performed. Values were comparable to limited data available in other hedgehog species and other similar-sized exotic species. Two animals were removed from consideration of reference values due to valvular defects that were considered significant. These data are the first establishing cardiac parameters in normal African hedgehogs using radiographic cardiac measurement, echocardiogram, and ECG. Evaluating animals with possible cardiomyopathy may allow for earlier diagnosis and more successful treatment.

  13. Release and transportation of Hedgehog molecules.

    PubMed

    Thérond, Pascal P

    2012-04-01

    Secretion of the Hedgehog morphogen induces different cell fates over the short and long ranges during developmental patterning. Mature Hedgehog carries hydrophobic palmitic acid and cholesterol modifications essential for its correct spread. The long-range activity of Hedgehog raises questions about how a dually lipidated protein can spread in the hydrophilic environment of the extracellular space. There is compelling experimental evidence in favour of the existence of several different carriers for Hedgehog transportation, via very different routes. This suggests that different accessory proteins and cellular machineries may be involved in the specific release of Hedgehog. I suggest that Hh carriers may work in parallel within a given cell and that developmental context may condition the choice of Hh carrier in secreting cells.

  14. Hedgehog signaling is required at multiple stages of zebrafish tooth development

    PubMed Central

    2010-01-01

    Background The accessibility of the developing zebrafish pharyngeal dentition makes it an advantageous system in which to study many aspects of tooth development from early initiation to late morphogenesis. In mammals, hedgehog signaling is known to be essential for multiple stages of odontogenesis; however, potential roles for the pathway during initiation of tooth development or in later morphogenesis are incompletely understood. Results We have identified mRNA expression of the hedgehog ligands shha and the receptors ptc1 and ptc2 during zebrafish pharyngeal tooth development. We looked for, but did not detect, tooth germ expression of the other known zebrafish hedgehog ligands shhb, dhh, ihha, or ihhb, suggesting that as in mammals, only Shh participates in zebrafish tooth development. Supporting this idea, we found that morphological and gene expression evidence of tooth initiation is eliminated in shha mutant embryos, and that morpholino antisense oligonucleotide knockdown of shha, but not shhb, function prevents mature tooth formation. Hedgehog pathway inhibition with the antagonist compound cyclopamine affected tooth formation at each stage in which we applied it: arresting development at early stages and disrupting mature tooth morphology when applied later. These results suggest that hedgehog signaling is required continuously during odontogenesis. In contrast, over-expression of shha had no effect on the developing dentition, possibly because shha is normally extensively expressed in the zebrafish pharyngeal region. Conclusion We have identified previously unknown requirements for hedgehog signaling for early tooth initiation and later morphogenesis. The similarity of our results with data from mouse and other vertebrates suggests that despite gene duplication and changes in the location of where teeth form, the roles of hedgehog signaling in tooth development have been largely conserved during evolution. PMID:21118524

  15. Differential loss of ancestral gene families as a source of genomic divergence in animals.

    PubMed Central

    Hughes, Austin L; Friedman, Robert

    2004-01-01

    A phylogenetic approach was used to reconstruct the pattern of an apparent loss of 2106 ancestral gene families in four animal genomes (Caenorhabditis elegans, Drosophila melanogaster, human and fugu). Substantially higher rates of loss of ancestral gene families were found in the invertebrates than in the vertebrates. These results indicate that the differential loss of ancestral gene families can be a significant factor in the evolutionary diversification of organisms. PMID:15101434

  16. Dissimilar evolutionary histories of two resistance gene families in the genus Solanum.

    PubMed

    Segura, Diana María; Masuelli, Ricardo Williams; Sanchez-Puerta, M Virginia

    2017-01-01

    Genomic analyses have shown that most genes in eukaryotic lineages belong to families. Gene families vary in terms of number of members, nucleotide similarity, gene integrity, expression, and function. Often, the members of gene families are arranged in clusters, which contribute to maintaining similarity among gene copies and also to generate duplicates through replication errors. Gene families offer us an opportunity to examine the forces involved in the evolution of the genomes and to study recombination events and genomic rearrangements. In this work, we focused on the evolution of two plant resistance gene families, Sw5 and Mi-1, and analyzed the completely sequenced nuclear genomes of potato and tomato. We first noticed that the potato genome carries larger resistance gene families than tomato, but all gene copies are pseudogenes. Second, phylogenetic analyses indicated that Sw5 and Mi-1 gene families had dissimilar evolutionary histories. In contrast to Sw5, Mi-1 homologues suffered repeated gene conversion events among the gene copies, particularly in the tomato genome.

  17. Gene recruitment--a common mechanism in the evolution of transfer RNA gene families.

    PubMed

    Wang, Xiujuan; Lavrov, Dennis V

    2011-04-01

    The evolution of alloacceptor transfer RNAs (tRNAs) has been traditionally thought to occur vertically and reflect the evolution of the genetic code. Yet there have been several indications that a tRNA gene could evolve horizontally, from a copy of an alloacceptor tRNA gene in the same genome. Earlier, we provided the first unambiguous evidence for the occurrence of such "tRNA gene recruitment" in nature--in the mitochondrial (mt) genome of the demosponge Axinella corrugata. Yet the extent and the pattern of this process in the evolution of tRNA gene families remained unclear. Here we analyzed tRNA genes from 21 mt genomes of demosponges as well as nuclear genomes of rhesus macaque, chimpanzee and human. We found four new cases of alloacceptor tRNA gene recruitment in mt genomes and eleven cases in the nuclear genomes. In most of these cases we observed a single nucleotide substitution at the middle position of the anticodon, which resulted in the change of not only the tRNA's amino-acid identity but also the class of the amino-acyl tRNA synthetases (aaRSs) involved in amino-acylation. We hypothesize that the switch to a different class of aaRSs may have prevented the conflict between anticodon and amino-acid identities of recruited tRNAs. Overall our results suggest that gene recruitment is a common phenomenon in tRNA multigene family evolution and should be taken into consideration when tRNA evolutionary history is reconstructed.

  18. The Family of Crumbs Genes and Human Disease

    PubMed Central

    Slavotinek, Anne M.

    2016-01-01

    The family of vertebrate Crumbs proteins, homologous to Drosophila Crumbs (Crb), share large extracellular domains with epidermal growth factor-like repeats and laminin-globular domains, a single transmembrane domain, and a short intracellular C-terminus containing a single membrane proximal 4.1/ezrin/radixin/moesin-binding domain and PSD-95/Discs large/ZO-1-binding motifs. There are 3 Crb genes in humans - Crumbs homolog-1 (CRB1), Crumbs homolog-2 (CRB2), and Crumbs homolog-3 (CRB3). Bilallelic loss-of-function mutations in CRB1 cause visual impairment, with Leber's congenital amaurosis and retinitis pigmentosa, whereas CRB2 mutations are associated with raised maternal serum and amniotic fluid alpha feto-protein levels, ventriculomegaly/hydrocephalus, and renal disease, ranging from focal segmental glomerulosclerosis to congenital Finnish nephrosis. CRB3 has not yet been associated with human disease. In this review, we summarize the phenotypic findings associated with deleterious sequence variants in CRB1 and CRB2. We discuss the mutational spectrum, animal models of loss of function for both genes and speculate on the likely mechanisms of disease. PMID:27867342

  19. Gene family encoding the major toxins of lethal Amanita mushrooms.

    PubMed

    Hallen, Heather E; Luo, Hong; Scott-Craig, John S; Walton, Jonathan D

    2007-11-27

    Amatoxins, the lethal constituents of poisonous mushrooms in the genus Amanita, are bicyclic octapeptides. Two genes in A. bisporigera, AMA1 and PHA1, directly encode alpha-amanitin, an amatoxin, and the related bicyclic heptapeptide phallacidin, a phallotoxin, indicating that these compounds are synthesized on ribosomes and not by nonribosomal peptide synthetases. alpha-Amanitin and phallacidin are synthesized as proproteins of 35 and 34 amino acids, respectively, from which they are predicted to be cleaved by a prolyl oligopeptidase. AMA1 and PHA1 are present in other toxic species of Amanita section Phalloidae but are absent from nontoxic species in other sections. The genomes of A. bisporigera and A. phalloides contain multiple sequences related to AMA1 and PHA1. The predicted protein products of this family of genes are characterized by a hypervariable "toxin" region capable of encoding a wide variety of peptides of 7-10 amino acids flanked by conserved sequences. Our results suggest that these fungi have a broad capacity to synthesize cyclic peptides on ribosomes.

  20. Cloning and characterisation of JAZ gene family in Hevea brasiliensis.

    PubMed

    Hong, H; Xiao, H; Yuan, H; Zhai, J; Huang, X

    2015-05-01

    Mechanical wounding or treatment with exogenous jasmonates (JA) induces differentiation of the laticifer in Hevea brasiliensis. JA is a key signal for latex biosynthesis and wounding response in the rubber tree. Identification of JAZ (jasmonate ZIM-domain) family of proteins that repress JA responses has facilitated rapid progress in understanding how this lipid-derived hormone controls gene expression and related physiological processes in plants. In this work, the full-length cDNAs of six JAZ genes were cloned from H. brasiliensis (termed HbJAZ). These HbJAZ have different lengths and sequence diversity, but all of them contain Jas and ZIM domains, and two of them contain an ERF-associated amphiphilic repression (EAR) motif in the N-terminal. Real-time RT-PCR analyses revealed that HbJAZ have different expression patterns and tissue specificity. Four HbJAZ were up-regulated, one was down-regulated, while two were less effected by rubber tapping treatment, suggesting that they might play distinct roles in the wounding response. A yeast two-hybrid assay revealed that HbJAZ proteins interact with each other to form homologous or heterogeneous dimer complexes, indicating that the HbJAZ proteins may expand their function through diverse JAZ-JAZ interactions. This work lays a foundation for identification of the JA signalling pathway and molecular mechanisms of latex biosynthesis in rubber trees.

  1. A Comprehensive Family-Based Replication Study of Schizophrenia Genes

    PubMed Central

    Aberg, Karolina A.; Liu, Youfang; Bukszár, Jozsef; McClay, Joseph L.; Khachane, Amit N.; Andreassen, Ole A.; Blackwood, Douglas; Corvin, Aiden; Djurovic, Srdjan; Gurling, Hugh; Ophoff, Roel; Pato, Carlos N.; Pato, Michele T.; Riley, Brien; Webb, Todd; Kendler, Kenneth; O’Donovan, Mick; Craddock, Nick; Kirov, George; Owen, Mike; Rujescu, Dan; St Clair, David; Werge, Thomas; Hultman, Christina M.; Delisi, Lynn E.; Sullivan, Patrick; van den Oord, Edwin J.

    2017-01-01

    Importance Schizophrenia (SCZ) is a devastating psychiatric condition. Identifying the specific genetic variants and pathways that increase susceptibility to SCZ is critical to improve disease understanding and address the urgent need for new drug targets. Objective To identify SCZ susceptibility genes. Design We integrated results from a meta-analysis of 18 genome-wide association studies (GWAS) involving 1 085 772 single-nucleotide polymorphisms (SNPs) and 6 databases that showed significant informativeness for SCZ. The 9380 most promising SNPs were then specifically genotyped in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. Setting Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. Patients We included 11 185 cases and 10 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. Main Outcomes and Measures Case-control status for SCZ. Results Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs with replication values of P<.01, the proportion of SNPs that had the same direction of effects as in the GWAS meta-analysis was 89% in the combined ancestry group (sign test, P<2.20×10−16) and 93% in subjects of European ancestry only (P<2.20×10−16). Our results supported the major histocompatibility complex region showing a 3.7-fold overall enrichment of replication values of P<.01 in subjects from European ancestry. We replicated SNPs in TCF4 (P=2.53×10−10) and NOTCH4 (P=3.16×10−7) that are among the most robust SCZ findings. More novel findings included POM121L2 (P=3.51×10−7), AS3MT (P=9.01×10−7), CNNM2 (P=6.07×10−7), and NT5C2 (P=4.09×10−7). To explore the many small effects, we performed pathway analyses. The most significant pathways involved neuronal function

  2. Evolution of the multifaceted eukaryotic akirin gene family

    PubMed Central

    Macqueen, Daniel J; Johnston, Ian A

    2009-01-01

    Background Akirins are nuclear proteins that form part of an innate immune response pathway conserved in Drosophila and mice. This studies aim was to characterise the evolution of akirin gene structure and protein function in the eukaryotes. Results akirin genes are present throughout the metazoa and arose before the separation of animal, plant and fungi lineages. Using comprehensive phylogenetic analysis, coupled with comparisons of conserved synteny and genomic organisation, we show that the intron-exon structure of metazoan akirin genes was established prior to the bilateria and that a single proto-orthologue duplicated in the vertebrates, before the gnathostome-agnathan separation, producing akirin1 and akirin2. Phylogenetic analyses of seven vertebrate gene families with members in chromosomal proximity to both akirin1 and akirin2 were compatible with a common duplication event affecting the genomic neighbourhood of the akirin proto-orthologue. A further duplication of akirins occurred in the teleost lineage and was followed by lineage-specific patterns of paralogue loss. Remarkably, akirins have been independently characterised by five research groups under different aliases and a comparison of the available literature revealed diverse functions, generally in regulating gene expression. For example, akirin was characterised in arthropods as subolesin, an important growth factor and in Drosophila as bhringi, which has an essential myogenic role. In vertebrates, akirin1 was named mighty in mice and was shown to regulate myogenesis, whereas akirin2 was characterised as FBI1 in rats and promoted carcinogenesis, acting as a transcriptional repressor when bound to a 14-3-3 protein. Both vertebrate Akirins have evolved under comparably strict constraints of purifying selection, although a likelihood ratio test predicted that functional divergence has occurred between paralogues. Bayesian and maximum likelihood tests identified amino-acid positions where the rate of

  3. Characterization of the multicopper oxidase gene family in Anopheles gambiae

    PubMed Central

    Gorman, Maureen J.; Dittmer, Neal T.; Marshall, Jeremy L.; Kanost, Michael R.

    2008-01-01

    The multicopper oxidase (MCO) family of enzymes includes laccases, which oxidize a broad range of substrates including diphenols, and several oxidases with specific substrates such as iron, copper or ascorbic acid. We have identified five putative MCO genes in the genome of Anopheles gambiae and have cloned cDNAs encompassing the full coding region for each gene. MCO1 mRNA was detected in all developmental stages and in all of the larval and adult tissues tested. We observed an increase in MCO1 transcript abundance in the midguts and Malphighian tubules of adult females following a blood meal and in adult abdominal carcasses in response to an immune challenge. Two alternatively spliced isoforms of MCO2 mRNA were identified. The A isoform of MCO2 was previously detected in larval and pupal cuticle where it probably catalyzes sclerotization reactions (He et al., 2007). The B isoform was transcriptionally upregulated in ovaries in response to a blood meal. MCO3 mRNA was detected in the adult midgut, Malpighian tubules, and male reproductive tissues; like MCO1, it was upregulated in response to an immune challenge or a blood meal. MCO4 and MCO5 were observed primarily in eggs and in the abdominal carcass of larvae. A phylogenetic analysis of insect MCO genes identified putative orthologs of MCO1 and MCO2 in all of the insect genomes tested, whereas MCO3, MCO4 and MCO5 were found only in the two mosquito species analyzed. MCO2 orthologs have especially high sequence similarity, suggesting that they are under strong purifying selection; the A isoforms are more conserved than the B isoforms. The mosquito specific group shares a common ancestor with MCO2. This initial study of mosquito MCOs suggests that MCO2 may be required for egg development or eggshell tanning in addition to cuticle tanning, while MCO1 and MCO3 may be involved in metal metabolism or immunity. PMID:18675911

  4. Regulation of Smoothened Phosphorylation and High-Level Hedgehog Signaling Activity by a Plasma Membrane Associated Kinase.

    PubMed

    Li, Shuangxi; Li, Shuang; Han, Yuhong; Tong, Chao; Wang, Bing; Chen, Yongbin; Jiang, Jin

    2016-06-01

    Hedgehog (Hh) signaling controls embryonic development and adult tissue homeostasis through the G protein coupled receptor (GPCR)-family protein Smoothened (Smo). Upon stimulation, Smo accumulates on the cell surface in Drosophila or primary cilia in vertebrates, which is thought to be essential for its activation and function, but the underlying mechanisms remain poorly understood. Here we show that Hh stimulates the binding of Smo to a plasma membrane-associated kinase Gilgamesh (Gish)/CK1γ and that Gish fine-tunes Hh pathway activity by phosphorylating a Ser/Thr cluster (CL-II) in the juxtamembrane region of Smo carboxyl-terminal intracellular tail (C-tail). We find that CL-II phosphorylation is promoted by protein kinase A (PKA)-mediated phosphorylation of Smo C-tail and depends on cell surface localization of both Gish and Smo. Consistent with CL-II being critical for high-threshold Hh target gene expression, its phosphorylation appears to require higher levels of Hh or longer exposure to the same level of Hh than PKA-site phosphorylation on Smo. Furthermore, we find that vertebrate CK1γ is localized at the primary cilium to promote Smo phosphorylation and Sonic hedgehog (Shh) pathway activation. Our study reveals a conserved mechanism whereby Hh induces a change in Smo subcellular localization to promote its association with and activation by a plasma membrane localized kinase, and provides new insight into how Hh morphogen progressively activates Smo.

  5. Sonic hedgehog signaling in kidney fibrosis: a master communicator.

    PubMed

    Zhou, Dong; Tan, Roderick J; Liu, Youhua

    2016-09-01

    The hedgehog signaling cascade is an evolutionarily conserved pathway that regulates multiple aspects of embryonic development and plays a decisive role in tissue homeostasis. As the best studied member of three hedgehog ligands, sonic hedgehog (Shh) is known to be associated with kidney development and tissue repair after various insults. Recent studies uncover an intrinsic link between dysregulated Shh signaling and renal fibrogenesis. In various types of chronic kidney disease (CKD), Shh is upregulated specifically in renal tubular epithelium but targets interstitial fibroblasts, thereby mediating a dynamic epithelial- mesenchymal communication (EMC). Tubule-derived Shh acts as a growth factor for interstitial fibroblasts and controls a hierarchy of fibrosis-related genes, which lead to the excessive deposition of extracellular matrix in renal interstitium. In this review, we recapitulate the principle of Shh signaling, its activation and regulation in a variety of kidney diseases. We also discuss the potential mechanisms by which Shh promotes renal fibrosis and assess the efficacy of blocking this signaling in preclinical settings. Continuing these lines of investigations will provide novel opportunities for designing effective therapies to improve CKD prognosis in patients.

  6. The Sonic hedgehog gradient in the developing limb.

    PubMed

    Tickle, Cheryll; Barker, Heather

    2013-01-01

    A gradient of Sonic hedgehog (Shh) plays a major role in specifying the antero-posterior pattern of structures that develop in the distal part of the vertebrate limb, in particular, the antero-posterior pattern of the digits. Classical embryological experiments identified the polarizing region (or zone of polarizing activity, ZPA), a signaling region at the posterior margin of the early chick wing bud and, consistent with a model in which production of a diffusible morphogen specifies antero-posterior positional information, polarizing region signaling was shown to be dose dependent and long range. It is now well established that the vertebrate hedgehog gene, Sonic hedgehog (Shh), which encodes a secreted protein, is expressed in the polarizing region of the chick wing and that Shh signaling has the same characteristics as polarizing region signaling. Shh expression at the posterior of the early limb bud and the mechanism of Shh signal transduction are conserved among vertebrates including mammals. However, it is unlikely that a simple Shh gradient is responsible for digit pattern formation in mammalian limbs and there is still little understanding of how positional information specified by Shh signaling is encoded and translated into digit anatomy. Alterations in Shh signaling underlie some congenital limb abnormalities and also changes in timing and extent of Shh signaling appear to be related to the evolution of morphological diversity of vertebrate limbs.

  7. Functional Interaction between HEXIM and Hedgehog Signaling during Drosophila Wing Development

    PubMed Central

    Nguyen, Duy; Fayol, Olivier; Buisine, Nicolas; Lecorre, Pierrette; Uguen, Patricia

    2016-01-01

    Studying the dynamic of gene regulatory networks is essential in order to understand the specific signals and factors that govern cell proliferation and differentiation during development. This also has direct implication in human health and cancer biology. The general transcriptional elongation regulator P-TEFb regulates the transcriptional status of many developmental genes. Its biological activity is controlled by an inhibitory complex composed of HEXIM and the 7SK snRNA. Here, we examine the function of HEXIM during Drosophila development. Our key finding is that HEXIM affects the Hedgehog signaling pathway. HEXIM knockdown flies display strong phenotypes and organ failures. In the wing imaginal disc, HEXIM knockdown initially induces ectopic expression of Hedgehog (Hh) and its transcriptional effector Cubitus interuptus (Ci). In turn, deregulated Hedgehog signaling provokes apoptosis, which is continuously compensated by apoptosis-induced cell proliferation. Thus, the HEXIM knockdown mutant phenotype does not result from the apoptotic ablation of imaginal disc; but rather from the failure of dividing cells to commit to a proper developmental program due to Hedgehog signaling defects. Furthermore, we show that ci is a genetic suppressor of hexim. Thus, HEXIM ensures the integrity of Hedgehog signaling in wing imaginal disc, by a yet unknown mechanism. To our knowledge, this is the first time that the physiological function of HEXIM has been addressed in such details in vivo. PMID:27176767

  8. MicroSyn: a user friendly tool for detection of microsynteny in a gene family

    SciTech Connect

    Cai, Bin; Yang, Xiaohan; Tuskan, Gerald A; Cheng, Zong-Ming

    2011-01-01

    Background: The traditional phylogeny analysis within gene family is mainly based on DNA or amino acid sequence homologies. However, these phylogenetic tree analyses are not suitable for those non-traditional gene families like microRNA with very short sequences. For the normal protein-coding gene families, low bootstrap values are frequently encountered in some nodes, suggesting low confidence or likely inappropriateness of placement of those members in those nodes. Results: We introduce MicroSyn software as a means of detecting microsynteny in adjacent genomic regions surrounding genes in gene families. MicroSyn searches for conserved, flanking colinear homologous gene pairs between two genomic fragments to determine the relationship between two members in a gene family. The colinearity of homologous pairs is controlled by a statistical distance function. As a result, gene duplication history can be inferred from the output independent of gene sequences. MicroSyn was designed for both experienced and non-expert users with a user-friendly graphical-user interface. MicroSyn is available from: http://fcsb.njau.edu. cn/microsyn/. Conclusions: Case studies of the microRNA167 genes in plants and Xyloglucan ndotransglycosylase/Hydrolase family in Populus trichocarpa were presented to show the utility of the software. The easy using of MicroSyn in these examples suggests that the software is an additional valuable means to address the problem intrinsic in the computational methods and sequence qualities themselves in gene family analysis.

  9. Genome-wide identification and expression profiling of ankyrin-repeat gene family in maize.

    PubMed

    Jiang, Haiyang; Wu, Qingqing; Jin, Jing; Sheng, Lei; Yan, Hanwei; Cheng, Beijiu; Zhu, Suwen

    2013-09-01

    Members of the ankyrin repeats (ANK) gene family encode ANK domain that are common in diverse organisms and play important roles in cell growth and development, such as cell-cell signal transduction and cell cycle regulation. Recently, genome-wide identification and evolutionary analyses of the ANK gene family have been carried out in Arabidopsis and rice. However, little is known regarding the ANK genes in the entire maize genome. In this study, we described the identification and structural characterization of 71 ANK genes in maize (ZmANK). Then, comprehensive bioinformatics analyses of ZmANK genes family were performed including phylogenetic, domain and motif analysis, chromosomal localization, intron/exon structural patterns, gene duplications and expression profiling. Domain composition analyses showed that ZmANK genes formed ten subfamilies. Five tandem duplications and 14 segmental duplications were identified in ZmANK genes. Furthermore, we took comparative analysis of the total ANK gene family in Arabidopsis, rice and maize, ZmANKs were more closely paired with OsANKs than with AtANKs. At last, expression profile analyses were performed. Forty-one members of ZmANK genes held EST sequences records. Semi-quantitative expression and microarray data analysis of these 41 ZmANK genes demonstrated that ZmANK genes exhibit a various expression pattern, suggesting that functional diversification of ZmANK genes family. The results will present significant insights to explore ANK genes expression and function in future studies in maize.

  10. Cardiomyopathy in captive African hedgehogs (Atelerix albiventris).

    PubMed

    Raymond, J T; Garner, M M

    2000-09-01

    From 1994 to 1999, 16 captive African hedgehogs (Atelerix albiventris), from among 42 necropsy cases, were diagnosed with cardiomyopathy. The incidence of cardiomyopathy in this study population was 38%. Fourteen of 16 hedgehogs with cardiomyopathy were males and all hedgehogs were adult (>1 year old). Nine hedgehogs exhibited 1 or more of the following clinical signs before death: heart murmur, lethargy, icterus, moist rales, anorexia, dyspnea, dehydration, and weight loss. The remaining 7 hedgehogs died without premonitory clinical signs. Gross findings were cardiomegaly (6 cases), hepatomegaly (5 cases), pulmonary edema (5 cases), pulmonary congestion (4 cases), hydrothorax (3 cases), pulmonary infarct (1 case), renal infarcts (1 case), ascites (1 case), and 5 cases showed no changes. Histologic lesions were found mainly within the left ventricular myocardium and consisted primarily of myodegeneration, myonecrosis, atrophy, hypertrophy, and disarray of myofibers. All hedgehogs with cardiomyopathy had myocardial fibrosis, myocardial edema, or both. Other common histopathologic findings were acute and chronic passive congestion of the lungs, acute passive congestion of the liver, renal tubular necrosis, vascular thrombosis, splenic extramedullary hematopoiesis, and hepatic lipidosis. This is the first report of cardiomyopathy in African hedgehogs.

  11. Macrophage-derived Hedgehog Ligands Promotes Fibrogenic and Angiogenic Responses in Human Schistosomiasis mansoni

    PubMed Central

    Pereira, Thiago A.; Xie, Guanhua; Choi, Steve S.; Syn, Wing-Kin; Voieta, Izabela; Lu, Jiuyi; Chan, Isaac S.; Swiderska, Marzena; Amaral, Kirsten B.; Antunes, Carlos Maurício; Secor, William E.; Witek, Rafal P.; Lambertucci, José Roberto; Pereira, Fausto L.; Diehl, Anna Mae

    2012-01-01

    Background Schistosomiasis mansoni is a major cause of portal fibrosis and portal hypertension. The Hedgehog pathway regulates fibrogenic repair in some types of liver injury. Aims Determine if Hedgehog-pathway activation occurs during fibrosis progression in schistosomiasis and to determine if macrophage-related mechanisms are involved. Methods Immunohistochemistry was used to characterize the cells that generate and respond to Hedgehog ligands in 28 liver biopsies from patients with different grades of schistosomiasis fibrosis staged by ultrasound. Cultured macrophages (RAW264.7 and primary rat Kupffer cells) and primary rat liver sinusoidal endothelial cells (LSEC) were treated with schistosome egg antigen (SEA) and evaluated by qRT-PCR. Inhibition of the Hedgehog-pathway was used to investigate its role in alternative activation of macrophages (M2) and vascular tube formation. Results Patients with schistosomiasis expressed more ligands (Shh and Ihh) and target genes (Patched and Gli2) than healthy individuals. Activated LSEC and myofibroblasts were Hedgehog-responsive (Gli2(+)) and accumulated in parallel with fibrosis stage (p<0.05). Double IHC for Ihh/CD68 showed that Ihh(+) cells were macrophages. In vitro studies demonstrated that SEA stimulated macrophages to express Ihh and Shh mRNA (p<0.05). Conditioned media from such macrophages induced luciferase production by Shh-LightII cells (p<0.001) and Hedgehog inhibitors blocked this effect (p<0.001). SEA-treated macrophages also up-regulated their own expression of M2 markers, and Hh-pathway inhibitors abrogated this response (p<0.01). Inhibition of the Hedgehog pathway in LSEC blocked SEA-induced migration and tube formation. Conclusion SEA stimulates liver macrophages to produce Hh-ligands, which promote alternative activation of macrophages, fibrogenesis, and vascular remodeling in schistosomiasis. PMID:23121638

  12. Divergence pattern of animal gene families and relationship with the Cambrian explosion.

    PubMed

    Miyata, T; Suga, H

    2001-11-01

    There are many gene families that are specific to multicellular animals. These have either diverged from ancestral genes that are shared with fungi and/or plants or evolved from an ancestral gene unique to animals. The evolution of gene families involved in cell-cell communication and developmental control has been studied to establish whether the number of member genes increased dramatically immediately prior to or in concert with the Cambrian explosion. A molecular phylogeny-based analysis of several animal-specific gene families has revealed that gene diversification by duplication occurred during two active periods interrupted by a long intervening quiescent period. Intriguingly, the Cambrian explosion is situated in the silent period, indicating that there is no direct link between the first burst of gene diversification and the Cambrian explosion itself. The importance of gene recruitment as a possible molecular mechanism for morphological diversity, and its possible role for the Cambrian explosion, are discussed.

  13. Histopathologic study of eosinophilic bronchointerstitial pneumonia caused by Crenosoma striatum in the hedgehog.

    PubMed

    Hoseini, Seyed Mohammad; Youssefi, Mohammad Reza; Mousapour, Aliasghar; Dozouri, Rohollah; Eshkevari, Shahab Ramezanpour; Nikzad, Mohammad; Nikzad, Reza; Omidzahir, Shila

    2014-06-01

    Crenosoma striatum is a species of parasitic nematodes from the family Crenosomatidae responsible for pathologic lung lesions in the hedgehog (Erinaceus europaeus). Infection with C. striatum can cause weight loss, dry cough, and bronchitis. In the present study, hedgehogs killed by road accidents, or trapped and found dead on farms in different parts of Mazandaran province (Iran), were transferred to the laboratory. After dissection, parasite samples collected from the lung were placed into 70% alcohol. After clarification with lactophenol and subsequent staining, the nematodes were identified as C. striatum according to previously published guidelines. For histopathologic examination, lung samples were collected. The tissues were fixed and following routine processing, sections were stained with hematoxylin and eosin. Microscopic diagnoses included hyperemia, eosinophilic bronchointerstitial pneumonia, thickening of the interstitium, and eosinophilic microabscesses in bronchial airways. Eosinophilic pneumonia was characterized by eosinophil and other mononuclear leukocyte infiltration within the lung interstitium. Crenosoma striatum can lead to mortality in hedgehogs.

  14. Characterization of the p16 gene in the mouse: Evidence for a large gene family

    SciTech Connect

    Fountain, J.W.; Giendening, J.M.; Flores, J.F.

    1994-09-01

    The p16 gene product is an inhibitor of the cyclin-dependent kinase 4 (CDK4)/cyclin D complex. When uninhibited, the CDK4/cyclin D complex participates in the phosphorylation of the retinoblastoma (RB) protein and renders it inactive. Upon inactivation of the RB protein, transition from the G{sub 1} to the S phase of mitosis occurs and results in cellular proliferation. Thus, p16 is presumed to act as a negative regulator of cell growth by preventing the phosphorylation, and thereby subsequent inactivation, of RB by CDK4/cyclin D. Recently, the p16 gene (also known as the multiple tumor suppressor 1 (MTS1) gene) has been mapped to chromosome 9p21 and found to be deleted or mutated in a number of tumor cell lines. These findings support the role of p16 as a growth inhibitor or tumor suppressor gene and suggest that the mutation of this gene may have global implications in carcinogenesis. We have chosen to test the functional significance of p16 mutations in vivo through the generation of a mouse mutant for p16. In preparation for this undertaking, eight apparently independent (as judged by restriction enzyme digestion and differential hybridization) mouse genomic embryonic stem cell clones have been identified using exon 2 from the human p16 gene as a probe. The identification of these multiple nonoverlapping clones was not entirely surprising since the reduced stringency hybridization of a zoo blot with the same probe also revealed 10-15 positive EcoRI fragments in all species tested, including human, monkey, cow, dog, cat, rabbit, hamster, mouse, chicken and D. melanogaster. Taken together, these findings suggest that the p16 gene is a member of a large gene family. The location of these genomic clones, as well as their potential expression in the mouse, is currently under investigation.

  15. Hedgehogs and retinal ganglion cells: organizers of the mammalian retina.

    PubMed

    Dakubo, Gabriel D; Wallace, Valerie A

    2004-03-01

    The mature vertebrate retina develops from a population of multipotential neural progenitor cells that give rise to all of the retinal neurons and one glial cell type. Retinal histogenesis is regulated, in part, by cell extrinsic cues. A growing number of studies now implicate signaling by members of the Hedgehog (Hh) family of morphogens in vertebrate retinal development. In this review we will discuss the role of Hh signals from retinal ganglion cells (RGCs), the projection neurons of the retina, on proliferation, differentiation and lamination in the neural retina.

  16. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  17. Molecular characterization of edestin gene family in Cannabis sativa L.

    PubMed

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs.

  18. Anomalous dispersions of `hedgehog' particles

    NASA Astrophysics Data System (ADS)

    Bahng, Joong Hwan; Yeom, Bongjun; Wang, Yichun; Tung, Siu On; Hoff, J. Damon; Kotov, Nicholas

    2015-01-01

    Hydrophobic particles in water and hydrophilic particles in oil aggregate, but can form colloidal dispersions if their surfaces are chemically camouflaged with surfactants, organic tethers, adsorbed polymers or other particles that impart affinity for the solvent and increase interparticle repulsion. A different strategy for modulating the interaction between a solid and a liquid uses surface corrugation, which gives rise to unique wetting behaviour. Here we show that this topographical effect can also be used to disperse particles in a wide range of solvents without recourse to chemicals to camouflage the particles' surfaces: we produce micrometre-sized particles that are coated with stiff, nanoscale spikes and exhibit long-term colloidal stability in both hydrophilic and hydrophobic media. We find that these `hedgehog' particles do not interpenetrate each other with their spikes, which markedly decreases the contact area between the particles and, therefore, the attractive forces between them. The trapping of air in aqueous dispersions, solvent autoionization at highly developed interfaces, and long-range electrostatic repulsion in organic media also contribute to the colloidal stability of our particles. The unusual dispersion behaviour of our hedgehog particles, overturning the notion that like dissolves like, might help to mitigate adverse environmental effects of the use of surfactants and volatile organic solvents, and deepens our understanding of interparticle interactions and nanoscale colloidal chemistry.

  19. Astrocytoma in an African hedgehog (Atelerix albiventris) suspected wobbly hedgehog syndrome.

    PubMed

    Nakata, Makoto; Miwa, Yasutsugu; Itou, Takuya; Uchida, Kazuyuki; Nakayama, Hiroyuki; Sakai, Takeo

    2011-10-01

    A 28-month-old African hedgehog was referred to our hospital with progressive tetraparesis. On the first presentation, the hedgehog was suspected as having wobbly hedgehog syndrome (WHS) and the animal was treated with medication and rehabilitation. The animal died 22 days after onset. Pathological examination revealed that the animal was involved in astrocytoma between the medulla oblongata and the spinal cord (C1). This report indicates that a primary central nervous system tumor should be considered as one of the differential diagnoses for hedgehogs presenting with progressive paresis, together with WHS.

  20. Gene conversions in the growth hormone gene family of primates: stronger homogenizing effects in the Hominidae lineage.

    PubMed

    Petronella, Nicholas; Drouin, Guy

    2011-09-01

    In humans, the growth hormone/chorionic somatomammotropin gene family is composed of five highly similar genes. We characterized the gene conversions that occurred between the growth hormone genes of 11 primate species. We detected 48 conversions using GENECONV and others were only detected using phylogenetic analyses. Gene conversions were detected in all species analyzed, their average size (±standard deviation) is 197.8±230.4 nucleotides, the size of the conversions is correlated with sequence similarity and converted regions are significantly more GC-rich than non-converted regions. Gene conversions have a stronger homogenizing effect in Hominidae genes than in other primate species. They are also less frequent in conserved gene regions and towards functionally important genes. This suggests that the high degree of sequence similarity observed between the growth hormone genes of primate species is a consequence of frequent gene conversions in gene regions which are under little selective constraints.

  1. [The MDR3 gene mutation: a rare cause of progressive familial intrahepatic cholestasis (PFIC)].

    PubMed

    Maisonnette, F; Abita, T; Barriere, E; Pichon, N; Vincensini, J F; Descottes, B

    2005-10-01

    A 47-year old man complained about persistant pain and cholestasis 12-years after a cholescystectomy. In his family, all his brothers and sisters had cholecystectomy. Genetic explorations revealed a MDR3 gene mutation. All symptoms disappeared with a treatment by ursodesoxycholic acid. MDR3 gene mutation is to be researched in all cases of familial cholestasis.

  2. Diversity and linkage of genes in the self-incompatibility gene family in Arabidopsis lyrata.

    PubMed Central

    Charlesworth, Deborah; Mable, Barbara K; Schierup, Mikkel H; Bartolomé, Carolina; Awadalla, Philip

    2003-01-01

    We report studies of seven members of the S-domain gene family in Arabidopsis lyrata, a member of the Brassicaceae that has a sporophytic self-incompatibility (SI) system. Orthologs for five loci are identifiable in the self-compatible relative A. thaliana. Like the Brassica stigmatic incompatibility protein locus (SRK), some of these genes have kinase domains. We show that several of these genes are unlinked to the putative A. lyrata SRK, Aly13. These genes have much lower nonsynonymous and synonymous polymorphism than Aly13 in the S-domains within natural populations, and differentiation between populations is higher, consistent with balancing selection at the Aly13 locus. One gene (Aly8) is linked to Aly13 and has high diversity. No departures from neutrality were detected for any of the loci. Comparing different loci within A. lyrata, sites corresponding to hypervariable regions in the Brassica S-loci (SLG and SRK) and in comparable regions of Aly13 have greater replacement site divergence than the rest of the S-domain. This suggests that the high polymorphism in these regions of incompatibility loci is due to balancing selection acting on sites within or near these regions, combined with low selective constraints. PMID:12930757

  3. The Phaseolus vulgaris ZIP gene family: identification, characterization, mapping, and gene expression

    PubMed Central

    Astudillo, Carolina; Fernandez, Andrea C.; Blair, Matthew W.; Cichy, Karen A.

    2013-01-01

    Zinc is an essential mineral for humans and plants and is involved in many physiological and biochemical processes. In humans, Zn deficiency has been associated with retarded growth and reduction of immune response. In plants, Zn is an essential component of more than 300 enzymes including RNA polymerase, alkaline phosphatase, alcohol dehydrogenase, Cu/Zn superoxidase dismutase, and carbonic anhydrase. The accumulation of Zn in plants involves many genes and characterization of the role of these genes will be useful in biofortification. Here we report the identification and phlyogenetic and sequence characterization of the 23 members of the ZIP (ZRT, IRT like protein) family of metal transporters and three transcription factors of the bZIP family in Phaseolus vulgaris L. Expression patterns of seven of these genes were characterized in two bean genotypes (G19833 and DOR364) under two Zn treatments. Tissue analyzed included roots and leaves at vegetative and flowering stages, and pods at 20 days after flowering. Four of the genes, PvZIP12, PvZIP13, PvZIP16, and Pv bZIP1, showed differential expression based on tissue, Zn treatment, and/or genotype. PvZIP12 and PvZIP13 were both more highly expressed in G19833 than DOR364. PvZIP12 was most highly expressed in vegetative leaves under the Zn (−) treatment. PvZIP16 was highly expressed in leaf tissue, especially leaf tissue at flowering stage grown in the Zn (−) treatment. Pv bZIP1 was most highly expressed in leaf and pod tissue. The 23 PvZIP genes and three bZIP genes were mapped on the DOR364 × G19833 linkage map. PvZIP12, PvZIP13, and PvZIP18, Pv bZIP2, and Pv bZIP3 were located near QTLs for Zn accumulation in the seed. Based on the expression and mapping results, PvZIP12 is a good candidate gene for increasing seed Zn concentration and increase understanding of the role of ZIP genes in metal uptake, distribution, and accumulation of zinc in P. vulgaris. PMID:23908661

  4. Evolutionary diversification of the vertebrate transferrin multi-gene family.

    PubMed

    Hughes, Austin L; Friedman, Robert

    2014-11-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (a) S, the mammalian serotransferrins; (b) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (c) L, the mammalian lactoferrins; (d) O, the ovotransferrins of birds and reptiles; (e) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (f) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (a) in the common ancestor of the M subfamily, (b) in the common ancestor of the M-like subfamily, and (c) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed an unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense.

  5. Evolutionary Diversification of the Vertebrate Transferrin Multi-gene Family

    PubMed Central

    Hughes, Austin L.; Friedman, Robert

    2014-01-01

    In a phylogenetic analysis of vertebrate transferrins (TFs), six major clades (subfamilies) were identified: (1) S, the mammalian serotransferrins; (2) ICA, the mammalian inhibitor of carbonic anhydrase (ICA) homologs; (3) L, the mammalian lactoferrins; (4) O, the ovotransferrins of birds and reptiles; (4) M, the melanotransferrins of bony fishes, amphibians, reptiles, birds, and mammals; and (5) M-like, a newly identified TF subfamily found in bony fishes, amphibians, reptiles, and birds. A phylogenetic tree based on the joint alignment of N-lobes and C-lobes supported the hypothesis that three separate events of internal duplication occurred in vertebrate TFs: (1) in the common ancestor of the M subfamily; (2) in the common ancestor of the M-like subfamily; and (3) in the common ancestor of other vertebrate TFs. The S, ICA, and L subfamilies were found only in placental mammals, and the phylogenetic analysis supported the hypothesis that these three subfamilies arose by gene duplication after the divergence of placental mammals from marsupials. The M-like subfamily was unusual in several respects, including the presence of a uniquely high proportion of clade-specific conserved residues, including distinctive but conserved residues in the sites homologous to those functioning in carbonate binding of human serotransferrin. The M-like family also showed a unusually high proportion of cationic residues in the positively charged region corresponding to human lactoferrampin, suggesting a distinctive role of this region in the M-like subfamily, perhaps in antimicrobial defense. PMID:25142446

  6. Genome-wide analysis reveals diverged patterns of codon bias, gene expression, and rates of sequence evolution in picea gene families.

    PubMed

    De La Torre, Amanda R; Lin, Yao-Cheng; Van de Peer, Yves; Ingvarsson, Pär K

    2015-03-05

    The recent sequencing of several gymnosperm genomes has greatly facilitated studying the evolution of their genes and gene families. In this study, we examine the evidence for expression-mediated selection in the first two fully sequenced representatives of the gymnosperm plant clade (Picea abies and Picea glauca). We use genome-wide estimates of gene expression (>50,000 expressed genes) to study the relationship between gene expression, codon bias, rates of sequence divergence, protein length, and gene duplication. We found that gene expression is correlated with rates of sequence divergence and codon bias, suggesting that natural selection is acting on Picea protein-coding genes for translational efficiency. Gene expression, rates of sequence divergence, and codon bias are correlated with the size of gene families, with large multicopy gene families having, on average, a lower expression level and breadth, lower codon bias, and higher rates of sequence divergence than single-copy gene families. Tissue-specific patterns of gene expression were more common in large gene families with large gene expression divergence than in single-copy families. Recent family expansions combined with large gene expression variation in paralogs and increased rates of sequence evolution suggest that some Picea gene families are rapidly evolving to cope with biotic and abiotic stress. Our study highlights the importance of gene expression and natural selection in shaping the evolution of protein-coding genes in Picea species, and sets the ground for further studies investigating the evolution of individual gene families in gymnosperms.

  7. Ortho2ExpressMatrix—a web server that interprets cross-species gene expression data by gene family information

    PubMed Central

    2011-01-01

    Background The study of gene families is pivotal for the understanding of gene evolution across different organisms and such phylogenetic background is often used to infer biochemical functions of genes. Modern high-throughput experiments offer the possibility to analyze the entire transcriptome of an organism; however, it is often difficult to deduct functional information from that data. Results To improve functional interpretation of gene expression we introduce Ortho2ExpressMatrix, a novel tool that integrates complex gene family information, computed from sequence similarity, with comparative gene expression profiles of two pre-selected biological objects: gene families are displayed with two-dimensional matrices. Parameters of the tool are object type (two organisms, two individuals, two tissues, etc.), type of computational gene family inference, experimental meta-data, microarray platform, gene annotation level and genome build. Family information in Ortho2ExpressMatrix bases on computationally different protein family approaches such as EnsemblCompara, InParanoid, SYSTERS and Ensembl Family. Currently, respective all-against-all associations are available for five species: human, mouse, worm, fruit fly and yeast. Additionally, microRNA expression can be examined with respect to miRBase or TargetScan families. The visualization, which is typical for Ortho2ExpressMatrix, is performed as matrix view that displays functional traits of genes (differential expression) as well as sequence similarity of protein family members (BLAST e-values) in colour codes. Such translations are intended to facilitate the user's perception of the research object. Conclusions Ortho2ExpressMatrix integrates gene family information with genome-wide expression data in order to enhance functional interpretation of high-throughput analyses on diseases, environmental factors, or genetic modification or compound treatment experiments. The tool explores differential gene expression in

  8. Genome-wide identification and analysis of the MADS-box gene family in apple.

    PubMed

    Tian, Yi; Dong, Qinglong; Ji, Zhirui; Chi, Fumei; Cong, Peihua; Zhou, Zongshan

    2015-01-25

    The MADS-box gene family is one of the most widely studied families in plants and has diverse developmental roles in flower pattern formation, gametophyte cell division and fruit differentiation. Although the genome-wide analysis of this family has been performed in some species, little is known regarding MADS-box genes in apple (Malus domestica). In this study, 146 MADS-box genes were identified in the apple genome and were phylogenetically clustered into six subgroups (MIKC(c), MIKC*, Mα, Mβ, Mγ and Mδ) with the MADS-box genes from Arabidopsis and rice. The predicted apple MADS-box genes were distributed across all 17 chromosomes at different densities. Additionally, the MADS-box domain, exon length, gene structure and motif compositions of the apple MADS-box genes were analysed. Moreover, the expression of all of the apple MADS-box genes was analysed in the root, stem, leaf, flower tissues and five stages of fruit development. All of the apple MADS-box genes, with the exception of some genes in each group, were expressed in at least one of the tissues tested, which indicates that the MADS-box genes are involved in various aspects of the physiological and developmental processes of the apple. To the best of our knowledge, this report describes the first genome-wide analysis of the apple MADS-box gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  9. Tandem zinc-finger gene families in mammals: insights and unanswered questions.

    PubMed

    Shannon, M; Kim, J; Ashworth, L; Branscomb, E; Stubbs, L

    1998-01-01

    Evidence for the remarkable conservation of mammalian genomes, in both content and organization of resident genes, is rapidly emerging from comparative mapping studies. The frequent occurrence of familial gene clustering, presumably reflecting a history of tandem in situ duplications starting from a single ancestral gene, is also apparent from these analyses. Genes encoding Kruppel-type zinc-finger (ZNF) proteins, including those containing Kruppel-associated box (KRAB) motifs, are particularly prone to such clustered organization. Existing data suggest that genes in KRAB-ZNF gene clusters have diverged in sequence and expression patterns, possibly yielding families of proteins with distinct, yet related, functions. Comparative mapping studies indicate that at least some of the genes within these clusters in mammals were elaborated prior to the divergence of mammalian orders and, subsequently, have been conserved. These data suggest a possible role for these tandem KRAB-ZNF gene families in mammalian evolution.

  10. Structural, functional, and evolutionary analysis of the unusually large stilbene synthase gene family in grapevine.

    PubMed

    Parage, Claire; Tavares, Raquel; Réty, Stéphane; Baltenweck-Guyot, Raymonde; Poutaraud, Anne; Renault, Lauriane; Heintz, Dimitri; Lugan, Raphaël; Marais, Gabriel A B; Aubourg, Sébastien; Hugueney, Philippe

    2012-11-01

    Stilbenes are a small family of phenylpropanoids produced in a number of unrelated plant species, including grapevine (Vitis vinifera). In addition to their participation in defense mechanisms in plants, stilbenes, such as resveratrol, display important pharmacological properties and are postulated to be involved in the health benefits associated with a moderate consumption of red wine. Stilbene synthases (STSs), which catalyze the biosynthesis of the stilbene backbone, seem to have evolved from chalcone synthases (CHSs) several times independently in stilbene-producing plants. STS genes usually form small families of two to five closely related paralogs. By contrast, the sequence of grapevine reference genome (cv PN40024) has revealed an unusually large STS gene family. Here, we combine molecular evolution and structural and functional analyses to investigate further the high number of STS genes in grapevine. Our reannotation of the STS and CHS gene families yielded 48 STS genes, including at least 32 potentially functional ones. Functional characterization of nine genes representing most of the STS gene family diversity clearly indicated that these genes do encode for proteins with STS activity. Evolutionary analysis of the STS gene family revealed that both STS and CHS evolution are dominated by purifying selection, with no evidence for strong selection for new functions among STS genes. However, we found a few sites under different selection pressures in CHS and STS sequences, whose potential functional consequences are discussed using a structural model of a typical STS from grapevine that we developed.

  11. Twist transition of nematic hyperbolic hedgehogs.

    PubMed

    James, Richard; Fukuda, Jun-ichi

    2014-04-01

    Stability of an idealized hyperbolic hedgehog in a nematic liquid crystal against a twist transition is investigated by extending the methodology of Rüdinger and Stark [Liq. Cryst. 26, 753 (1999)], where the hedgehog is confined between two concentric spheres. In the ideal hyperbolic-hedgehog the molecular orientation is assumed to rotate proportionally with respect to the inclination angle, θ (and in the opposite sense). However, when splay, k11, and bend, k33, moduli differ this proportionality is lost and the liquid crystal deforms relative to the ideal with bend and splay. Although slight, these deformations are shown to significantly shift the transition if k11/k33 is small. By increasing the degree of confinement the twist transition can be inhibited, a characteristic both hyperbolic and radial hedgehogs have in common. The twist transition of a hyperbolic defect that accompanies a particle is found to be well predicted by the earlier stability analysis of a thick shell.

  12. Ectoparasites of hedgehogs (Erinaceus concolor) from Turkey.

    PubMed

    Girisgin, Ahmet Onur; Senlik, Bayram; Aydin, Levent; Cirak, Veli Y

    2015-01-01

    Hedgehogs are small, nocturnal, spiny-coated animals that have been growing in popularity as exotic pets. However, these animals are host to a wide variety of viruses, bacteria, fungi and parasites, some of which are of zoonotic character. Thus, because hedgehogs have a potential role to transmit zoonoses including arthropod-borne diseases, we examined them for their ectoparasites. The study was carried out on hedgehogs found dead mainly due to road casualties in the Bursa province of Turkey. The ectoparasites were collected by both insecticide spraying of the body and inspection on a white paper carefully. Totally three species of ticks (Rhipicephalus sanguineus, Hyalomma aegyptium, Haemophysalis parvo) and one flea species (Archeopsylla erinacei) were detected. The prevalence of mixed infestation with both ticks and fleas was 45.5%. Haemaphysalis parva was reported for the first time from hedgehogs (Erinaceus concolor) in Turkey. The occurrence of ectoparasites and their potential role as vectors of certain zoonotic diseases are briefly discussed.

  13. A novel heterozygous missense mutation in uromodulin gene in an Indian family with familial juvenile hyperuricemic nephropathy

    PubMed Central

    Saxena, D.; Srivastava, P.; Phadke, S. R.

    2016-01-01

    Familial juvenile hyperuricemic nephropathy (FJHN), characterized by early-onset hyperuricemia, reduced fractional excretion of uric acid, and chronic renal failure is caused due to mutation in uromodulin (UMOD) gene. We identified a novel mutation in a family with multiple members affected with FJHN. Ten coding exons of UMOD gene in three family members with clinical and biochemical features of FJHN and one unaffected family member were sequenced, and sequence variants were analyzed for the pathogenicity by bioinformatics studies. A heterozygous novel missense mutation (c. 949 T >G) in exon 5 leading to the replacement of cysteine by glycine at position 317 was identified in all three affected family members. This mutation has not been reported earlier in Human Gene Mutation Database, Human Genome Variation, Clinvar, and 1000 Genome. The mutation lies in the cysteine-rich 2 domain of the protein, and the affected residue is evolutionary conserved in other species. To our knowledge, this is the first report of the identification of UMOD mutation in an Indian family. PMID:27795632

  14. Streptococcus pyogenes Infection in a Free-Living European Hedgehog (Erinaceus europaeus).

    PubMed

    Franklinos, Lydia H V; Efstratiou, Androulla; Macgregor, Shaheed K; John, Shinto K; Hopkins, Timothy; Cunningham, Andrew A; Lawson, Becki

    2015-12-01

    Streptococcus pyogenes, a common pathogen of humans, was isolated from the carcass of a free-living European hedgehog (Erinaceus europaeus) found in northern England in June 2014. The animal had abscessation of the deep right cervical lymph node, mesenteric lymph nodes and liver. The S. pyogenes strain isolated from the lesions, peritoneal and pleural cavities was characterised as emm 28, which can be associated with invasive disease in humans. This is the first known report of S. pyogenes in a hedgehog and in any free-living wild animal that has been confirmed by gene sequencing. As close associations between wild hedgehogs and people in England are common, we hypothesise that this case might have resulted from anthroponotic infection.

  15. Inhibition of hedgehog signaling reduces the side population in human malignant mesothelioma cell lines.

    PubMed

    Kim, H-A; Kim, M-C; Kim, N-Y; Kim, Y

    2015-08-01

    Deregulation of crucial embryonic pathways, including hedgehog signaling, has been frequently implicated in a variety of human cancers and is emerging as an important target for anticancer therapy. This study evaluated the potential anticancer effects of cyclopamine, a chemical inhibitor of hedgehog signaling, in human malignant mesothelioma (HMM) cell lines. Cyclopamine treatment significantly decreased the proliferation of HMM cells by promoting apoptosis and shifting the cell cycle toward dormant phase. The clonogenicity and mobility of HMM cells were significantly decreased by cyclopamine treatment. Treatment of HMM cells with cyclopamine significantly reduced the abundance of side population cells, which were measured using an assay composed of Hoechst 33342 dye staining and subsequent flow cytometry. Furthermore, the expression levels of stemness-related genes were significantly affected by cyclopamine treatment. Taken together, the present study showed that targeting hedgehog signaling could reduce a more aggressive subpopulation of the cancer cells, suggesting an alternative approach for HMM therapy.

  16. Inhibition of hedgehog signaling reduces the side population in human malignant mesothelioma cell lines

    PubMed Central

    Kim, H-A; Kim, M-C; Kim, N-Y; Kim, Y

    2015-01-01

    Deregulation of crucial embryonic pathways, including hedgehog signaling, has been frequently implicated in a variety of human cancers and is emerging as an important target for anticancer therapy. This study evaluated the potential anticancer effects of cyclopamine, a chemical inhibitor of hedgehog signaling, in human malignant mesothelioma (HMM) cell lines. Cyclopamine treatment significantly decreased the proliferation of HMM cells by promoting apoptosis and shifting the cell cycle toward dormant phase. The clonogenicity and mobility of HMM cells were significantly decreased by cyclopamine treatment. Treatment of HMM cells with cyclopamine significantly reduced the abundance of side population cells, which were measured using an assay composed of Hoechst 33342 dye staining and subsequent flow cytometry. Furthermore, the expression levels of stemness-related genes were significantly affected by cyclopamine treatment. Taken together, the present study showed that targeting hedgehog signaling could reduce a more aggressive subpopulation of the cancer cells, suggesting an alternative approach for HMM therapy. PMID:26206198

  17. The Zn Finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis

    PubMed Central

    Glazer, Andrew; Wilkinson, Alex; Backer, Chelsea B.; Lapan, Sylvain; Gutzman, Jennifer H.; Cheeseman, Iain M.; Reddien, Peter W.

    2009-01-01

    Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and that utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian S. mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates. PMID:19852954

  18. The Zn finger protein Iguana impacts Hedgehog signaling by promoting ciliogenesis.

    PubMed

    Glazer, Andrew M; Wilkinson, Alex W; Backer, Chelsea B; Lapan, Sylvain W; Gutzman, Jennifer H; Cheeseman, Iain M; Reddien, Peter W

    2010-01-01

    Hedgehog signaling is critical for metazoan development and requires cilia for pathway activity. The gene iguana was discovered in zebrafish as required for Hedgehog signaling, and encodes a novel Zn finger protein. Planarians are flatworms with robust regenerative capacities and utilize epidermal cilia for locomotion. RNA interference of Smed-iguana in the planarian Schmidtea mediterranea caused cilia loss and failure to regenerate new cilia, but did not cause defects similar to those observed in hedgehog(RNAi) animals. Smed-iguana gene expression was also similar in pattern to the expression of multiple other ciliogenesis genes, but was not required for expression of these ciliogenesis genes. iguana-defective zebrafish had too few motile cilia in pronephric ducts and in Kupffer's vesicle. Kupffer's vesicle promotes left-right asymmetry and iguana mutant embryos had left-right asymmetry defects. Finally, human Iguana proteins (dZIP1 and dZIP1L) localize to the basal bodies of primary cilia and, together, are required for primary cilia formation. Our results indicate that a critical and broadly conserved function for Iguana is in ciliogenesis and that this function has come to be required for Hedgehog signaling in vertebrates.

  19. Improved Approximate Profile Function of Hedgehog Skyrmion

    NASA Astrophysics Data System (ADS)

    Ji, Yong-Lin; Jia, Duo-Jie; Xi, Guo-Zhu; Liu, Feng

    The profile function for Skyrme model is investigated in Hedgehog ansatz. An improved analytical solution to the Hedgehog Skyrmion is obtained by using tentative function method. It is found that ensuing calculated static energy is smaller than that in Ref. 13, and the isoscalar electric mean square radius √ {< r2>}I=0 and the isoscalar magnetic mean square radius √ {< r2>}M,I=0 well agree with experiment results.

  20. Out of the Water: Origin and Diversification of the LBD Gene Family.

    PubMed

    Chanderbali, Andre S; He, Fengmei; Soltis, Pamela S; Soltis, Douglas E

    2015-08-01

    LBD (lateral organ boundaries domain) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land.

  1. Out of the Water: Origin and Diversification of the LBD Gene Family

    PubMed Central

    Chanderbali, Andre S.; He, Fengmei; Soltis, Pamela S.; Soltis, Douglas E.

    2015-01-01

    LBD (LATERAL ORGAN BOUNDARIES DOMAIN) genes are essential to the developmental programs of many fundamental plant organs and function in some of the basic metabolic pathways of plants. However, our historical perspective on the roles of LBD genes during plant evolution has, heretofore, been fragmentary. Here, we show that the LBD gene family underwent an initial radiation that established five gene lineages in the ancestral genome of most charophyte algae and land plants. By inference, the LBD gene family originated after the emergence of the green plants (Viridiplantae), but prior to the diversification of most extant streptophytes. After this initial radiation, we find limited instances of gene family diversification in land plants until successive rounds of expansion in the ancestors of seed plants and flowering plants. The most dynamic phases of LBD gene evolution, therefore, trace to the aquatic ancestors of embryophytes followed by relatively recent lineage-specific expansions on land. PMID:25839188

  2. Glucocorticoid hedgehog agonists in neurogenesis.

    PubMed

    Wang, Jiangbo; Barak, Larry S; Mook, Robert A; Chen, Wei

    2011-01-01

    The process of neurogenesis in mammals, which is prolific and widespread at birth, gradually slows with aging and in humans becomes restricted to areas including the cerebellum and hippocampus. It has been reported that exposure to glucocorticoids can impair neurogenesis in both adults and children. Glucocorticoids are known to bind with high affinity to intracellular receptors. Glucocorticoid blood levels are normally regulated by environmental stresses, but because of their clinical utility, exogenous glucocorticoids are frequently administered in drug formulations. Consequently, concerns have arisen about the consequences of glucocorticoid use on neurogenesis and health, especially in the pediatric population. In this article, we will review recent findings that a select number of related glucocorticoids, halcinonide, fluticasone propionate, clobetasol propionate, and fluocinonide, also bind the hedgehog pathway receptor Smoothened. We will discuss their pharmacology and also a most surprising result; that this select group of compounds, which includes FDA approved drugs, unlike typical glucocorticoids such as dexamethasone, stimulate stem cell growth, and thus enhance neurogenesis.

  3. Transcriptional responses of zebrafish embryos exposed to potential sonic hedgehog pathway interfering compounds deviate from expression profiles of cyclopamine.

    PubMed

    Büttner, Anita; Busch, Wibke; Klüver, Nils; Giannis, Athanassios; Scholz, Stefan

    2012-04-01

    The molecular responses of two small molecules, SANT-2 and GANT-61, potentially interfering with the sonic hedgehog pathway (Shh) have been studied in zebrafish embryos by microarray analysis. For both compounds and the positive reference cyclopamine previous reporter gene assays for the transcription factor Gli1 have indicated an inhibition of the hedgehog signaling pathway. In zebrafish embryos a typical phenotype (cyclopia) associated with Shh interference was only observed for cyclopamine. Furthermore, only cyclopamine led to the repression of genes specifically associated with hedgehog signaling and confirmed published microarray data. In contrast to these data hspb11 was additionally identified as the most pronounced down-regulated genes for exposure to cyclopamine. No or different effects on gene expression patterns were provoked by SANT-2 or GANT-61, respectively. Reasons for the discrepancies between cellular reporter and the zebrafish embryo assay and potential implications for the identification of compounds interfering with specific developmental pathways are discussed.

  4. Genomic organization of the mouse T-cell receptor beta-chain gene family.

    PubMed Central

    Lai, E; Barth, R K; Hood, L

    1987-01-01

    We have combined three different methods, deletion mapping of T-cell lines, field-inversion gel electrophoresis, and the restriction mapping of a cosmid clone, to construct a physical map of the murine T-cell receptor beta-chain gene family. We have mapped 19 variable (V beta) gene segments and the two clusters of diversity (D beta) and joining (J beta) gene segments and constant (C beta) genes. These members of the beta-chain gene family span approximately equal to 450 kilobases of DNA, excluding one potential gap in the DNA fragment alignments. Images PMID:3035555

  5. dachshund Potentiates Hedgehog Signaling during Drosophila Retinogenesis

    PubMed Central

    Aerts, Stein; Casares, Fernando; Janody, Florence

    2016-01-01

    Proper organ patterning depends on a tight coordination between cell proliferation and differentiation. The patterning of Drosophila retina occurs both very fast and with high precision. This process is driven by the dynamic changes in signaling activity of the conserved Hedgehog (Hh) pathway, which coordinates cell fate determination, cell cycle and tissue morphogenesis. Here we show that during Drosophila retinogenesis, the retinal determination gene dachshund (dac) is not only a target of the Hh signaling pathway, but is also a modulator of its activity. Using developmental genetics techniques, we demonstrate that dac enhances Hh signaling by promoting the accumulation of the Gli transcription factor Cubitus interruptus (Ci) parallel to or downstream of fused. In the absence of dac, all Hh-mediated events associated to the morphogenetic furrow are delayed. One of the consequences is that, posterior to the furrow, dac- cells cannot activate a Roadkill-Cullin3 negative feedback loop that attenuates Hh signaling and which is necessary for retinal cells to continue normal differentiation. Therefore, dac is part of an essential positive feedback loop in the Hh pathway, guaranteeing the speed and the accuracy of Drosophila retinogenesis. PMID:27442438

  6. Different evolutionary histories of two cation/proton exchanger gene families in plants

    PubMed Central

    2013-01-01

    Background Gene duplication events have been proposed to be involved in the adaptation of plants to stress conditions; precisely how is unclear. To address this question, we studied the evolution of two families of antiporters. Cation/proton exchangers are important for normal cell function and in plants, Na+,K+/H+ antiporters have also been implicated in salt tolerance. Two well-known plant cation/proton antiporters are NHX1 and SOS1, which perform Na+ and K+ compartmentalization into the vacuole and Na+ efflux from the cell, respectively. However, our knowledge about the evolution of NHX and SOS1 stress responsive gene families is still limited. Results In this study we performed a comprehensive molecular evolutionary analysis of the NHX and SOS1 families. Using available sequences from a total of 33 plant species, we estimated gene family phylogenies and gene duplication histories, as well as examined heterogeneous selection pressure on amino acid sites. Our results show that, while the NHX family expanded and specialized, the SOS1 family remained a low copy gene family that appears to have undergone neofunctionalization during its evolutionary history. Additionally, we found that both families are under purifying selection although SOS1 is less constrained. Conclusions We propose that the different evolution histories are related with the proteins’ function and localization, and that the NHX and SOS1 families are examples of two different evolutionary paths through which duplication events may result in adaptive evolution of stress tolerance. PMID:23822194

  7. p63 sustains self-renewal of mammary cancer stem cells through regulation of Sonic Hedgehog signaling

    PubMed Central

    Memmi, Elisa Maria; Sanarico, Anna Giulia; Giacobbe, Arianna; Peschiaroli, Angelo; Frezza, Valentina; Cicalese, Angelo; Pisati, Federica; Tosoni, Daniela; Zhou, Huiqing; Tonon, Giovanni; Antonov, Alexey; Melino, Gerry; Pelicci, Pier Giuseppe; Bernassola, Francesca

    2015-01-01

    The predominant p63 isoform, ΔNp63, is a master regulator of normal epithelial stem cell (SC) maintenance. However, in vivo evidence of the regulation of cancer stem cell (CSC) properties by p63 is still limited. Here, we exploit the transgenic MMTV-ErbB2 (v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2) mouse model of carcinogenesis to dissect the role of p63 in the regulation of mammary CSC self-renewal and breast tumorigenesis. ErbB2 tumor cells enriched for SC-like properties display increased levels of ΔNp63 expression compared with normal mammary progenitors. Down-regulation of p63 in ErbB2 mammospheres markedly restricts self-renewal and expansion of CSCs, and this action is fully independent of p53. Furthermore, transplantation of ErbB2 progenitors expressing shRNAs against p63 into the mammary fat pads of syngeneic mice delays tumor growth in vivo. p63 knockdown in ErbB2 progenitors diminishes the expression of genes encoding components of the Sonic Hedgehog (Hh) signaling pathway, a driver of mammary SC self-renewal. Remarkably, p63 regulates the expression of Sonic Hedgehog (Shh), GLI family zinc finger 2 (Gli2), and Patched1 (Ptch1) genes by directly binding to their gene regulatory regions, and eventually contributes to pathway activation. Collectively, these studies highlight the importance of p63 in maintaining the self-renewal potential of mammary CSCs via a positive modulation of the Hh signaling pathway. PMID:25739959

  8. Identification and distribution of the NBS-LRR gene family in the cassava genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plant resistance genes (R genes) exist in large families and usually contain both a nucleotide-binding site domain and a leucine-rich repeat domain, denoted NBS-LRR. The genome sequence of cassava (Manihot esculenta) is a valuable resource for analyzing the genomic organization of resistance genes i...

  9. Evolution of the chitin synthase gene family correlates with fungal morphogenesis and adaption to ecological niches

    PubMed Central

    Liu, Ran; Xu, Chuan; Zhang, Qiangqiang; Wang, Shiyi; Fang, Weiguo

    2017-01-01

    The fungal kingdom potentially has the most complex chitin synthase (CHS) gene family, but evolution of the fungal CHS gene family and its diversification to fulfill multiple functions remain to be elucidated. Here, we identified the full complement of CHSs from 231 fungal species. Using the largest dataset to date, we characterized the evolution of the fungal CHS gene family using phylogenetic and domain structure analysis. Gene duplication, domain recombination and accretion are major mechanisms underlying the diversification of the fungal CHS gene family, producing at least 7 CHS classes. Contraction of the CHS gene family is morphology-specific, with significant loss in unicellular fungi, whereas family expansion is lineage-specific with obvious expansion in early-diverging fungi. ClassV and ClassVII CHSs with the same domain structure were produced by the recruitment of domains PF00063 and PF08766 and subsequent duplications. Comparative analysis of their functions in multiple fungal species shows that the emergence of ClassV and ClassVII CHSs is important for the morphogenesis of filamentous fungi, development of pathogenicity in pathogenic fungi, and heat stress tolerance in Pezizomycotina fungi. This work reveals the evolution of the fungal CHS gene family, and its correlation with fungal morphogenesis and adaptation to ecological niches. PMID:28300148

  10. Genomewide analysis of the lateral organ boundaries domain gene family in Vitis vinifera.

    PubMed

    Cao, Hui; Liu, Cai-Yun; Liu, Chun-Xiang; Zhao, Yue-Ling; Xu, Rui-Rui

    2016-09-01

    In plants, the transcription factor families have been implicated in many important biological processes. These processes include morphogenesis, signal transduction and environmental stress responses. Proteins containing the lateral organ boundaries domain (LBD), which encodes a zinc finger-like domain are only found in plants. This finding indicates that this unique gene family regulates only plant-specific biological processes. LBD genes play crucial roles in the growth and development of plants such as Arabidopsis, Oryza sativa, Zea mays, poplar, apple and tomato. However, relatively little is known about the LBD genes in grape (Vitis vinifera). In this study, we identified 40 LBD genes in the grape genome. A complete overview of the chromosomal locations, phylogenetic relationships, structures and expression profiles of this gene family during development in grape is presented here. Phylogenetic analysis showed that the LBD genes could be divided into classes I and II, together with LBDs from Arabidopsis. We mapped the 40 LBD genes on the grape chromosomes (chr1-chr19) and found that 37 of the predicted grape LBD genes were distributed in different densities across 12 chromosomes. Grape LBDs were found to share a similar intron/exon structure and gene length within the same class. The expression profiles of grape LBD genes at different developmental stages were analysed using microarray data. Results showed that 21 grape LBD genes may be involved in grape developmental processes, including preveraison, veraison and ripening. Finally, we analysed the expression patterns of six LBD genes through quantitative real-time polymerase chain reation analysis. The six LBD genes showed differential expression patterns among the three representative grape tissues, and five of these genes were found to be involved in responses to mannitol, sodium chloride, heat stress and low temperature treatments. To our knowledge, this is the first study to analyse the LBD gene family in

  11. Extensive and continuous duplication facilitates rapid evolution and diversification of gene families.

    PubMed

    Chang, Dan; Duda, Thomas F

    2012-08-01

    The origin of novel gene functions through gene duplication, mutation, and natural selection represents one of the mechanisms by which organisms diversify and one of the possible paths leading to adaptation. Nonetheless, the extent, role, and consequences of duplications in the origins of ecological adaptations, especially in the context of species interactions, remain unclear. To explore the evolution of a gene family that is likely linked to species associations, we investigated the evolutionary history of the A-superfamily of conotoxin genes of predatory marine cone snails (Conus species). Members of this gene family are expressed in the venoms of Conus species and are presumably involved in predator-prey associations because of their utility in prey capture. We recovered sequences of this gene family from genomic DNA of four closely related species of Conus and reconstructed the evolutionary history of these genes. Our study is the first to directly recover conotoxin genes from Conus genomes to investigate the evolution of conotoxin gene families. Our results revealed a phenomenon of rapid and continuous gene turnover that is coupled with heightened rates of evolution. This continuous duplication pattern has not been observed previously, and the rate of gene turnover is at least two times higher than estimates from other multigene families. Conotoxin genes are among the most rapidly evolving protein-coding genes in metazoans, a phenomenon that may be facilitated by extensive gene duplications and have driven changes in conotoxin functions through neofunctionalization. Together these mechanisms led to dramatically divergent arrangements of A-superfamily conotoxin genes among closely related species of Conus. Our findings suggest that extensive and continuous gene duplication facilitates rapid evolution and drastic divergence in venom compositions among species, processes that may be associated with evolutionary responses to predator-prey interactions.

  12. Inferring Hypotheses on Functional Relationships of Genes: Analysis of the Arabidopsis thaliana Subtilase Gene Family

    PubMed Central

    Büssis, Dirk; Stintzi, Annick; Schaller, Andreas; Kopka, Joachim; Altmann, Thomas

    2005-01-01

    The gene family of subtilisin-like serine proteases (subtilases) in Arabidopsis thaliana comprises 56 members, divided into six distinct subfamilies. Whereas the members of five subfamilies are similar to pyrolysins, two genes share stronger similarity to animal kexins. Mutant screens confirmed 144 T-DNA insertion lines with knockouts for 55 out of the 56 subtilases. Apart from SDD1, none of the confirmed homozygous mutants revealed any obvious visible phenotypic alteration during growth under standard conditions. Apart from this specific case, forward genetics gave us no hints about the function of the individual 54 non-characterized subtilase genes. Therefore, the main objective of our work was to overcome the shortcomings of the forward genetic approach and to infer alternative experimental approaches by using an integrative bioinformatics and biological approach. Computational analyses based on transcriptional co-expression and co-response pattern revealed at least two expression networks, suggesting that functional redundancy may exist among subtilases with limited similarity. Furthermore, two hubs were identified, which may be involved in signalling or may represent higher-order regulatory factors involved in responses to environmental cues. A particular enrichment of co-regulated genes with metabolic functions was observed for four subtilases possibly representing late responsive elements of environmental stress. The kexin homologs show stronger associations with genes of transcriptional regulation context. Based on the analyses presented here and in accordance with previously characterized subtilases, we propose three main functions of subtilases: involvement in (i) control of development, (ii) protein turnover, and (iii) action as downstream components of signalling cascades. Supplemental material is available in the Plant Subtilase Database (PSDB) (http://csbdb.mpimp-golm.mpg.de/psdb.html) , as well as from the CSB.DB (http

  13. Methuselah/Methuselah-like G protein-coupled receptors constitute an ancient metazoan gene family

    PubMed Central

    de Mendoza, Alexandre; Jones, Jeffery W.; Friedrich, Markus

    2016-01-01

    Inconsistent conclusions have been drawn regarding the phylogenetic age of the Methuselah/Methuselah-like (Mth/Mthl) gene family of G protein-coupled receptors, the founding member of which regulates development and lifespan in Drosophila. Here we report the results from a targeted homolog search of 39 holozoan genomes and phylogenetic analysis of the conserved seven transmembrane domain. Our findings reveal that the Mth/Mthl gene family is ancient, has experienced numerous extinction and expansion events during metazoan evolution, and acquired the current definition of the Methuselah ectodomain during its exceptional expansion in arthropods. In addition, our findings identify Mthl1, Mthl5, Mthl14, and Mthl15 as the oldest Mth/Mthl gene family paralogs in Drosophila. Future studies of these genes have the potential to define ancestral functions of the Mth/Mthl gene family. PMID:26915348

  14. Evolution of the RH gene family in vertebrates revealed by brown hagfish (Eptatretus atami) genome sequences.

    PubMed

    Suzuki, Akinori; Komata, Hidero; Iwashita, Shogo; Seto, Shotaro; Ikeya, Hironobu; Tabata, Mitsutoshi; Kitano, Takashi

    2017-02-01

    In vertebrates, there are four major genes in the RH (Rhesus) gene family, RH, RHAG, RHBG, and RHCG. These genes are thought to have been formed by the two rounds of whole-genome duplication (2R-WGD) in the common ancestor of all vertebrates. In our previous work, where we analyzed details of the gene duplications process of this gene family, three nucleotide sequences belonging to this family were identified in Far Eastern brook lamprey (Lethenteron reissneri), and the phylogenetic positions of the genes were determined. Lampreys, along with hagfishes, are cyclostomata (jawless fishes), which is a sister group of gnathostomata (jawed vertebrates). Although those results suggested that one gene was orthologous to the gnathostome RHCG genes, we did not identify clear orthologues for other genes. In this study, therefore, we identified three novel cDNA sequences that belong to the RH gene family using de novo transcriptome analysis of another cyclostome: the brown hagfish (Eptatretus atami). We also determined the nucleotide sequences for the RHBG and RHCG genes in a red stingray (Dasyatis akajei), which belongs to the cartilaginous fishes. The phylogenetic tree showed that two brown hagfish genes, which were probably duplicated in the cyclostome lineage, formed a cluster with the gnathostome RHAG genes, whereas another brown hagfish gene formed a cluster with the gnathostome RHCG genes. We estimated that the RH genes had a higher evolutionary rate than the RHAG, RHBG, and RHCG genes. Interestingly, in the RHBG genes, only the bird lineage showed a higher rate of nonsynonymous substitutions. It is likely that this higher rate was caused by a state of relaxed functional constraints rather than positive selection nor by pseudogenization.

  15. Massive Expansion of Ubiquitination-Related Gene Families within the Chlamydiae

    PubMed Central

    Domman, Daryl; Collingro, Astrid; Lagkouvardos, Ilias; Gehre, Lena; Weinmaier, Thomas; Rattei, Thomas; Subtil, Agathe; Horn, Matthias

    2014-01-01

    Gene loss, gain, and transfer play an important role in shaping the genomes of all organisms; however, the interplay of these processes in isolated populations, such as in obligate intracellular bacteria, is less understood. Despite a general trend towards genome reduction in these microbes, our phylogenomic analysis of the phylum Chlamydiae revealed that within the family Parachlamydiaceae, gene family expansions have had pronounced effects on gene content. We discovered that the largest gene families within the phylum are the result of rapid gene birth-and-death evolution. These large gene families are comprised of members harboring eukaryotic-like ubiquitination-related domains, such as F-box and BTB-box domains, marking the largest reservoir of these proteins found among bacteria. A heterologous type III secretion system assay suggests that these proteins function as effectors manipulating the host cell. The large disparity in copy number of members in these families between closely related organisms suggests that nonadaptive processes might contribute to the evolution of these gene families. Gene birth-and-death evolution in concert with genomic drift might represent a previously undescribed mechanism by which isolated bacterial populations diversify. PMID:25069652

  16. Cloning of novel rice blast resistance genes from two rapidly evolving NBS-LRR gene families in rice.

    PubMed

    Guo, Changjiang; Sun, Xiaoguang; Chen, Xiao; Yang, Sihai; Li, Jing; Wang, Long; Zhang, Xiaohui

    2016-01-01

    Most rice blast resistance genes (R-genes) encode proteins with nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. Our previous study has shown that more rice blast R-genes can be cloned in rapidly evolving NBS-LRR gene families. In the present study, two rapidly evolving R-gene families in rice were selected for cloning a subset of genes from their paralogs in three resistant rice lines. A total of eight functional blast R-genes were identified among nine NBS-LRR genes, and some of these showed resistance to three or more blast strains. Evolutionary analysis indicated that high nucleotide diversity of coding regions served as important parameters in the determination of gene resistance. We also observed that amino-acid variants (nonsynonymous mutations, insertions, or deletions) in essential motifs of the NBS domain contribute to the blast resistance capacity of NBS-LRR genes. These results suggested that the NBS regions might also play an important role in resistance specificity determination. On the other hand, different splicing patterns of introns were commonly observed in R-genes. The results of the present study contribute to improving the effectiveness of R-gene identification by using evolutionary analysis method and acquisition of novel blast resistance genes.

  17. Isolation of novel human and mouse genes of the recA/RAD51 recombination-repair gene family.

    PubMed Central

    Cartwright, R; Dunn, A M; Simpson, P J; Tambini, C E; Thacker, J

    1998-01-01

    Genes from the recA/RAD51 family play essential roles in homologous recombination in all organisms. Using sequence homologies from eukaryotic members of this family we have identified fragments of two additional mammalian genes with homology to RAD51. Cloning the full-length cDNAs for both human and mouse genes showed that the sequences are highly conserved, and that the predicted proteins have characteristic features of this gene family. One of the novel genes (R51H2) occurs in two forms in human cDNA, differing extensively at the 3' end, probably due to an unusual form of alternative splicing. The new genes (R51H2 and R51H3) were mapped to human chromosomes 14q23-24 and 17q1.2, respectively. Expression studies showed that R51H2 is expressed at lower levels than R51H3 , but that expression of both genes occurs at elevated levels in the testis compared with other tissues. The combination of gene structure conservation and the transcript expression patterns suggests that these new members of the recA/RAD51 family may also function in homologous recombination-repair pathways. PMID:9512535

  18. Temporal perturbations in sonic hedgehog signaling elicit the spectrum of holoprosencephaly phenotypes

    PubMed Central

    Cordero, Dwight; Marcucio, Ralph; Hu, Diane; Gaffield, William; Tapadia, Minal; Helms, Jill A.

    2004-01-01

    One of the most perplexing questions in clinical genetics is why patients with identical gene mutations oftentimes exhibit radically different clinical features. This inconsistency between genotype and phenotype is illustrated in the malformation spectrum of holoprosencephaly (HPE). Family members carrying identical mutations in sonic hedgehog (SHH) can exhibit a variety of facial features ranging from cyclopia to subtle midline asymmetries. Such intrafamilial variability may arise from environmental factors acting in conjunction with gene mutations that collectively reduce SHH activity below a critical threshold. We undertook a series of experiments to test the hypothesis that modifying the activity of the SHH signaling pathway at discrete periods of embryonic development could account for the phenotypic spectrum of HPE. Exposing avian embryos to cyclopamine during critical periods of craniofacial development recreated a continuum of HPE-related defects. The craniofacial malformations included hypotelorism, midfacial hypoplasia, and facial clefting and were not the result of excessive crest cell apoptosis. Rather, they resulted from molecular reprogramming of an organizing center whose activity controls outgrowth and patterning of the mid and upper face. Collectively, these data reveal one mechanism by which the variable expressivity of a disorder such as HPE can be produced through temporal disruption of a single molecular pathway. PMID:15314685

  19. The ankyrin repeat gene family in rice: genome-wide identification, classification and expression profiling.

    PubMed

    Huang, Jianyan; Zhao, Xiaobo; Yu, Huihui; Ouyang, Yidan; Wang, Lei; Zhang, Qifa

    2009-10-01

    Ankyrin repeat (ANK) containing proteins comprise a large protein family. Although many members of this family have been implicated in plant growth, development and signal transduction, only a few ANK genes have been reported in rice. In this study, we analyzed the structures, phylogenetic relationship, genome localizations and expression profiles of 175 ankyrin repeat genes identified in rice (OsANK). Domain composition analysis suggested OsANK proteins can be classified into ten subfamilies. Chromosomal localizations of OsANK genes indicated nine segmental duplication events involving 17 genes and 65 OsANK genes were involved in tandem duplications. The expression profiles of 158 OsANK genes were analyzed in 24 tissues covering the whole life cycle of two rice genotypes, Minghui 63 and Zhenshan 97. Sixteen genes showed preferential expression in given tissues compared to all the other tissues in Minghui 63 and Zhenshan 97. Nine genes were preferentially expressed in stamen of 1 day before flowering, suggesting that these genes may play important roles in pollination and fertilization. Expression data of OsANK genes were also obtained with tissues of seedlings subjected to three phytohormone (NAA, GA3 and KT) and light/dark treatments. Eighteen genes showed differential expression with at least one phytohormone treatment while under light/dark treatments, 13 OsANK genes showed differential expression. Our data provided a very useful reference for cloning and functional analysis of members of this gene family in rice.

  20. Holding blame at bay? ‘Gene talk' in family members' accounts of schizophrenia aetiology

    PubMed Central

    Callard, Felicity; Rose, Diana; Hanif, Emma-Louise; Quigley, Jody; Greenwood, Kathryn; Wykes, Til

    2012-01-01

    We provide the first detailed analysis of how, for what purposes and with what consequences people related to someone with a diagnosis of schizophrenia use ‘gene talk'. The article analyses findings from a qualitative interview study conducted in London and involving 19 participants (mostly women). We transcribed the interviews verbatim and analysed them using grounded theory methods. We analyse how and for what purposes participants mobilized ‘gene talk' in their affectively freighted encounter with an unknown interviewer. Gene talk served to (re)position blame and guilt, and was simultaneously used imaginatively to forge family history narratives. Family members used ‘gene talk' to recruit forebears with no psychiatric diagnosis into a family history of mental illness, and presented the origins of the diagnosed family member's schizophrenia as lying temporally before, and hence beyond the agency of the immediate family. Gene talk was also used in attempts to dislodge the distressing figure of the schizophrenia-inducing mother. ‘Gene talk', however, ultimately displaced, rather than resolved, the (self-)blame of many family members, particularly mothers. Our article challenges the commonly expressed view that genetic accounts will absolve family members' sense of (self-)blame in relation to their relative's/relatives' diagnosis. PMID:23227107

  1. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    PubMed

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  2. Familial isolated pituitary adenoma caused by a Aip gene mutation not described before in a family context.

    PubMed

    García-Arnés, J A; González-Molero, I; Oriola, J; Mazuecos, N; Luque, R; Castaño, J; Arraez, M A

    2013-12-01

    The cause of familial isolated pituitary adenomas (FIPA) remains unknown in a high percentage of cases, but the AIP gene plays an important role in the etiology. The aim of the study is to describe a family with FIPA syndrome and the results of genomic studies. A 16-year-old man had a giant prolactinoma resistant tomedical treatment with delayed growth and pubertal development. His mother had been previously diagnosed with a nonfunctioning pituitary macroadenoma. Transsphenoidal endoscopic resection was performed and a genetic study revealed a heterozygous mutation in exon 6: 974G>A (p.Arg325Gln). Because the AIP gene is a tumor suppressor gene, we searched for loss of heterozygosity within the AIP gene by amplifying exon 6 from tumor tissue of the patient. In the electropherogram, only the A allele was amplified (hemizygous state), indicating loss of the normal allele. We report a Spanish family with FIPA in whom a mutation in the AIP gene previously unreported in a familiar context was identified.

  3. Genome-wide analysis of the GRAS gene family in Chinese cabbage (Brassica rapa ssp. pekinensis).

    PubMed

    Song, Xiao-Ming; Liu, Tong-Kun; Duan, Wei-Ke; Ma, Qing-Hua; Ren, Jun; Wang, Zhen; Li, Ying; Hou, Xi-Lin

    2014-01-01

    The GRAS gene family is one of the most important families of transcriptional regulators. In this study, 48 GRAS genes are identified from Chinese cabbage, and they are classified into eight groups according to the classification of Arabidopsis. The characterization, classification, gene structure and phylogenetic construction of GRAS proteins are performed. Distribution mapping shows that GRAS proteins are nonrandomly localized in 10 chromosomes. Fifty-five orthologous gene pairs are shared by Chinese cabbage and Arabidopsis, and interaction networks of these orthologous genes are constructed. The expansion of GRAS genes in Chinese cabbage results from genome triplication. Among the 17 species examined, 14 higher plants carry the GRAS genes, whereas two lower plants and one fungi species do not. Furthermore, the expression patterns of GRAS genes exhibit differences in three tissues based on RNA-seq data. Taken together, this comprehensive analysis will provide rich resources for studying GRAS protein functions in Chinese cabbage.

  4. Development of anticancer agents targeting the Hedgehog signaling.

    PubMed

    Zhang, Xiangqian; Tian, Ye; Yang, Yanling; Hao, Jijun

    2017-03-17

    Hedgehog signaling is an evolutionarily conserved pathway which is essential in embryonic and postnatal development as well as adult organ homeostasis. Abnormal regulation of Hedgehog signaling is implicated in many diseases including cancer. Consequently, substantial efforts have made in the past to develop potential therapeutic agents that specifically target the Hedgehog signaling for cancer treatment. Here, we review the therapeutic agents for inhibition of the Hedgehog signaling and their clinical advances in cancer treatment.

  5. Hedgehog pathway dysregulation contributes to the pathogenesis of human gastrointestinal stromal tumors via GLI-mediated activation of KIT expression

    PubMed Central

    Burgoyne, Adam M.; Leonard, Stephanie Y.; Gao, Fei; Chan, Jonathan C.; Shi, Eileen; Chmielecki, Juliann; Morosini, Deborah; Wang, Kai; Ross, Jeffrey S.; Kendrick, Michael L.; Bardsley, Michael R.; De Siena, Martina; Mao, Junhao; Harismendy, Olivier

    2016-01-01

    Gastrointestinal stromal tumors (GIST) arise within the interstitial cell of Cajal (ICC) lineage due to activating KIT/PDGFRA mutations. Both ICC and GIST possess primary cilia (PC), which coordinate PDGFRA and Hedgehog signaling, regulators of gastrointestinal mesenchymal development. Therefore, we hypothesized that Hedgehog signaling may be altered in human GIST and controls KIT expression. Quantitative RT-PCR, microarrays, and next generation sequencing were used to describe Hedgehog/PC-related genes in purified human ICC and GIST. Genetic and pharmacologic approaches were employed to investigate the effects of GLI manipulation on KIT expression and GIST cell viability. We report that Hedgehog pathway and PC components are expressed in ICC and GIST and subject to dysregulation during GIST oncogenesis, irrespective of KIT/PDGFRA mutation status. Using genomic profiling, 10.2% of 186 GIST studied had potentially deleterious genomic alterations in 5 Hedgehog-related genes analyzed, including in the PTCH1 tumor suppressor (1.6%). Expression of the predominantly repressive GLI isoform, GLI3, was inversely correlated with KIT mRNA levels in GIST cells and non-KIT/non-PDGFRA mutant GIST. Overexpression of the 83-kDa repressive form of GLI3 or small interfering RNA-mediated knockdown of the activating isoforms GLI1/2 reduced KIT mRNA. Treatment with GLI1/2 inhibitors, including arsenic trioxide, significantly increased GLI3 binding to the KIT promoter, decreased KIT expression, and reduced viability in imatinib-sensitive and imatinib-resistant GIST cells. These data offer new evidence that genes necessary for Hedgehog signaling and PC function in ICC are dysregulated in GIST. Hedgehog signaling activates KIT expression irrespective of mutation status, offering a novel approach to treat imatinib-resistant GIST. PMID:27793025

  6. Saltatory evolution of the ectodermal neural cortex gene family at the vertebrate origin.

    PubMed

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates.

  7. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    PubMed Central

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  8. Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

    PubMed

    Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

    2016-12-01

    Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

  9. Sox11 Is Required to Maintain Proper Levels of Hedgehog Signaling during Vertebrate Ocular Morphogenesis

    PubMed Central

    Pillai-Kastoori, Lakshmi; Wen, Wen; Wilson, Stephen G.; Strachan, Erin; Lo-Castro, Adriana; Fichera, Marco; Musumeci, Sebastiano A.; Lehmann, Ordan J.; Morris, Ann C.

    2014-01-01

    Ocular coloboma is a sight-threatening malformation caused by failure of the choroid fissure to close during morphogenesis of the eye, and is frequently associated with additional anomalies, including microphthalmia and cataracts. Although Hedgehog signaling is known to play a critical role in choroid fissure closure, genetic regulation of this pathway remains poorly understood. Here, we show that the transcription factor Sox11 is required to maintain specific levels of Hedgehog signaling during ocular development. Sox11-deficient zebrafish embryos displayed delayed and abnormal lens formation, coloboma, and a specific reduction in rod photoreceptors, all of which could be rescued by treatment with the Hedgehog pathway inhibitor cyclopamine. We further demonstrate that the elevated Hedgehog signaling in Sox11-deficient zebrafish was caused by a large increase in shha transcription; indeed, suppressing Shha expression rescued the ocular phenotypes of sox11 morphants. Conversely, over-expression of sox11 induced cyclopia, a phenotype consistent with reduced levels of Sonic hedgehog. We screened DNA samples from 79 patients with microphthalmia, anophthalmia, or coloboma (MAC) and identified two novel heterozygous SOX11 variants in individuals with coloboma. In contrast to wild type human SOX11 mRNA, mRNA containing either variant failed to rescue the lens and coloboma phenotypes of Sox11-deficient zebrafish, and both exhibited significantly reduced transactivation ability in a luciferase reporter assay. Moreover, decreased gene dosage from a segmental deletion encompassing the SOX11 locus resulted in microphthalmia and related ocular phenotypes. Therefore, our study reveals a novel role for Sox11 in controlling Hedgehog signaling, and suggests that SOX11 variants contribute to pediatric eye disorders. PMID:25010521

  10. CRDB: Database of Chemosensory Receptor Gene Families in Vertebrate

    PubMed Central

    Wu, Xiaoli; Zhong, Yang

    2012-01-01

    Chemosensory receptors (CR) are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of ‘birth-and-death’ evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates. PMID:22393364

  11. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    PubMed

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  12. [Flea bites caused by Archaeopsylla erinacei, the hedgehog flea].

    PubMed

    Bork, K; Honomichl, K; Hoede, N

    1987-11-01

    A hedgehog flea was the cause of multiple flea bites in a 48-year-old patient. The main host of the hedgehog flea is the European hedgehog, but the flea was also found in different furry mammals, such as polecats, brown rats and foxes. It was not previously known that Archaeopsylla erinacei attacks man.

  13. Locus for a human hereditary cataract is closely linked to the. gamma. -crystallin gene family

    SciTech Connect

    Lubsen, N.H.; Renwick, J.H.; Tsui, L.C.; Breitman, M.L.; Schoenmakers, J.G.G.

    1987-01-01

    Within the human ..gamma..-crystallin gene cluster polymorphic Taq I sites are present. These give rise to three sets of allelic fragments from the ..gamma..-crystallin genes. Together these restriction fragment length polymorphisms define eight possible haplotypes, three of which (Q, R, and S) were found in the Dutch and English population. A fourth haplotype (P) was detected within a family in which a hereditary Coppock-like cataract of the embryonic lens nucleus occurs in heterozygotes. Haplotype P was found only in family members who suffered from cataract, and all family members who suffered from cataract had haplotype P. The absolute correlation between the presence of haplotype P and cataract within this family shows that the ..gamma..-crystallin gene cluster and the locus for the Coppock-like cataract are closely linked. This linkage provides genetic evidence that the primary cause of a cataract in humans could possibly be a lesion in a crystallin gene.

  14. Gene duplication event in family 12 glycosyl hydrolase from Phytophthora spp.

    PubMed

    Costanzo, Stefano; Ospina-Giraldo, M D; Deahl, K L; Baker, C J; Jones, Richard W

    2006-10-01

    A total of 18 paralogs of xyloglucan-specific endoglucanases (EGLs) from the glycosyl hydrolase family 12 were identified and characterized in Phytophthora sojae and Phytophthora ramorum. These genes encode predicted extracellular enzymes, with sizes ranging from 189 to 435 amino acid residues, that would be capable of hydrolyzing the xyloglucan component of the host cell wall. In two cases, four and six functional copies of these genes were found in tight succession within a region of 5 and 18 kb, respectively. The overall gene copy number and relative organization appeared well conserved between P. sojae and P. ramorum, with apparent synteny in this region of their respective genomes. Phylogenetic analyses of Phytophthora endoglucanases of family 12 and other known members of EGL 12, revealed a close relatedness with a fairly conserved gene sub-family containing, among others, sequences from the fungi Emericella desertorum and Aspergillus aculeatus. This is the first report of family 12 EGLs present in plant pathogenic eukaryotes.

  15. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    PubMed

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  16. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    PubMed Central

    Schiffer, Philipp H.; Gravemeyer, Jan; Rauscher, Martina; Wiehe, Thomas

    2016-01-01

    Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly) deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR)-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction. PMID:27509525

  17. Developmental expression of the N-myc downstream regulated gene (Ndrg) family during Xenopus tropicalis embryogenesis.

    PubMed

    Zhong, Chao; Zhou, Yan-Kuan; Yang, Shan-Shan; Zhao, Jun-Fang; Zhu, Xiao-Long; Chen, Hen-Huang; Chen, Pei-Chao; Huang, Li-Quan; Huang, Xiao

    2015-01-01

    The N-myc downstream regulated gene (Ndrg) family consists of four main members Ndrg1, 2, 3, and 4. The Ndrg genes are involved in many vital biological events including development. However, comprehensive expression patterns of this gene family during vertebrate embryogenesis remain largely unknown. Here, we analyzed the Ndrg family from the evolutionary perspective and examined the expression patterns of the Ndrg genes during Xenopus tropicalis embryogenesis. Different Ndrg family members of vertebrates are separated into different homology clusters which can be further classified into two groups and each Ndrg family member is well conserved during evolution. The temporal and spatial expression patterns of Ndrg1, 2, 3 and 4 are different during early Xenopus tropicalis development. Ndrg1, 2 and 4 are maternally expressed genes while Ndrg3 is a zygotically expressed gene. The Ndrg genes are differentially expressed in the developing central nervous system, the developing sensory organs, and the developing excretory organs. Moreover, they also show other specific expression domains. Our results indicate that the Ndrg genes exhibit specific expression patterns and may play different roles during vertebrate embryogenesis.

  18. Mouse T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    All mouse T-cell receptor {alpha}/{delta}, {beta}, and {gamma} variable (Tcra/d-, b-, and g-V) gene segments were aligned to compare the sequences with one another, to group them into subfamilies, and to derive a name which complies with the standard nomenclature. it was necessary to change the names of some V gene segments because they conflicted with those of other segments. The traditional classification into subfamilies was re-evaluated using a much larger pool of sequences. In the mouse, most V gene segments can be grouped into subfamilies of closely related genes with significantly less similarity between different subfamilies. 118 refs., 11 figs., 4 tabs.

  19. MS/MS networking guided analysis of molecule and gene cluster families.

    PubMed

    Nguyen, Don Duy; Wu, Cheng-Hsuan; Moree, Wilna J; Lamsa, Anne; Medema, Marnix H; Zhao, Xiling; Gavilan, Ronnie G; Aparicio, Marystella; Atencio, Librada; Jackson, Chanaye; Ballesteros, Javier; Sanchez, Joel; Watrous, Jeramie D; Phelan, Vanessa V; van de Wiel, Corine; Kersten, Roland D; Mehnaz, Samina; De Mot, René; Shank, Elizabeth A; Charusanti, Pep; Nagarajan, Harish; Duggan, Brendan M; Moore, Bradley S; Bandeira, Nuno; Palsson, Bernhard Ø; Pogliano, Kit; Gutiérrez, Marcelino; Dorrestein, Pieter C

    2013-07-09

    The ability to correlate the production of specialized metabolites to the genetic capacity of the organism that produces such molecules has become an invaluable tool in aiding the discovery of biotechnologically applicable molecules. Here, we accomplish this task by matching molecular families with gene cluster families, making these correlations to 60 microbes at one time instead of connecting one molecule to one organism at a time, such as how it is traditionally done. We can correlate these families through the use of nanospray desorption electrospray ionization MS/MS, an ambient pressure MS technique, in conjunction with MS/MS networking and peptidogenomics. We matched the molecular families of peptide natural products produced by 42 bacilli and 18 pseudomonads through the generation of amino acid sequence tags from MS/MS data of specific clusters found in the MS/MS network. These sequence tags were then linked to biosynthetic gene clusters in publicly accessible genomes, providing us with the ability to link particular molecules with the genes that produced them. As an example of its use, this approach was applied to two unsequenced Pseudoalteromonas species, leading to the discovery of the gene cluster for a molecular family, the bromoalterochromides, in the previously sequenced strain P. piscicida JCM 20779(T). The approach itself is not limited to 60 related strains, because spectral networking can be readily adopted to look at molecular family-gene cluster families of hundreds or more diverse organisms in one single MS/MS network.

  20. Comparative genomics of the Hedgehog loci in chordates and the origins of Shh regulatory novelties.

    PubMed

    Irimia, Manuel; Royo, Jose L; Burguera, Demian; Maeso, Ignacio; Gómez-Skarmeta, José L; Garcia-Fernandez, Jordi

    2012-01-01

    The origin and evolution of the complex regulatory landscapes of some vertebrate developmental genes, often spanning hundreds of Kbp and including neighboring genes, remain poorly understood. The Sonic Hedgehog (Shh) genomic regulatory block (GRB) is one of the best functionally characterized examples, with several discrete enhancers reported within its introns, vast upstream gene-free region and neighboring genes (Lmbr1 and Rnf32). To investigate the origin and evolution of this GRB, we sequenced and characterized the Hedgehog (Hh) loci from three invertebrate chordate amphioxus species, which share several early expression domains with Shh. Using phylogenetic footprinting within and between chordate lineages, and reporter assays in zebrafish probing >30 Kbp of amphioxus Hh, we report large sequence and functional divergence between both groups. In addition, we show that the linkage of Shh to Lmbr1 and Rnf32, necessary for the unique gnatostomate-specific Shh limb expression, is a vertebrate novelty occurred between the two whole-genome duplications.

  1. Mutation analysis in F9 gene of 17 families with haemophilia B from Iran.

    PubMed

    Enayat, M S; Karimi, M; Chana, G; Farjadian, S; Theophilus, B D M; Hill, F G H

    2004-11-01

    Seventeen haemophilia B families from Iran were investigated to determine the causative mutation. All the essential regions of the F9 gene were initially screened by conformational sensitive gel electrophoresis and exons with band shift were sequenced. Seven of the 15 mutations identified in these families were novel mutations. The mutations were authenticated in nine families as other affected members or heterozygous female carriers were available for verification.

  2. Cognitive Functioning in Affected Sibling Pairs with ADHD: Familial Clustering and Dopamine Genes

    ERIC Educational Resources Information Center

    Loo, Sandra K.; Rich, Erika Carpenter; Ishii, Janeen; McGough, James; McCracken, James; Nelson, Stanley; Smalley, Susan L.

    2008-01-01

    Background: This paper examines familiality and candidate gene associations of cognitive measures as potential endophenotypes in attention-deficit/hyperactivity disorder (ADHD). Methods: The sample consists of 540 participants, aged 6 to 18, who were diagnosed with ADHD from 251 families recruited for a larger genetic study of ADHD. All members of…

  3. Genome-wide analysis of the MADS-box gene family in Brachypodium distachyon.

    PubMed

    Wei, Bo; Zhang, Rong-Zhi; Guo, Juan-Juan; Liu, Dan-Mei; Li, Ai-Li; Fan, Ren-Chun; Mao, Long; Zhang, Xiang-Qi

    2014-01-01

    MADS-box genes are important transcription factors for plant development, especially floral organogenesis. Brachypodium distachyon is a model for biofuel plants and temperate grasses such as wheat and barley, but a comprehensive analysis of MADS-box family proteins in Brachypodium is still missing. We report here a genome-wide analysis of the MADS-box gene family in Brachypodium distachyon. We identified 57 MADS-box genes and classified them into 32 MIKC(c)-type, 7 MIKC*-type, 9 Mα, 7 Mβ and 2 Mγ MADS-box genes according to their phylogenetic relationships to the Arabidopsis and rice MADS-box genes. Detailed gene structure and motif distribution were then studied. Investigation of their chromosomal localizations revealed that Brachypodium MADS-box genes distributed evenly across five chromosomes. In addition, five pairs of type II MADS-box genes were found on synteny blocks derived from whole genome duplication blocks. We then performed a systematic expression analysis of Brachypodium MADS-box genes in various tissues, particular floral organs. Further detection under salt, drought, and low-temperature conditions showed that some MADS-box genes may also be involved in abiotic stress responses, including type I genes. Comparative studies of MADS-box genes among Brachypodium, rice and Arabidopsis showed that Brachypodium had fewer gene duplication events. Taken together, this work provides useful data for further functional studies of MADS-box genes in Brachypodium distachyon.

  4. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease

    PubMed Central

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family. PMID:26722532

  5. Genome-wide analysis of Aux/IAA and ARF gene families in Populus trichocarpa

    SciTech Connect

    Kalluri, Udaya C; DiFazio, Stephen P; Brunner, A.; Tuskan, Gerald A

    2007-01-01

    Auxin/Indole-3-Acetic Acid (Aux/IAA) and Auxin Response Factor (ARF) transcription factors are key regulators of auxin responses in plants. A total of 35 Aux/IAA and 39 ARF genes were identified in the Populus genome. Comparative phylogenetic analysis revealed that the subgroups PoptrARF2, 6, 9 and 16 and PoptrIAA3, 16, 27 and 29 have differentially expanded in Populus relative to Arabidopsis. Activator ARFs were found to be two fold-overrepresented in the Populus genome. PoptrIAA and PoptrARF gene families appear to have expanded due to high segmental and low tandem duplication events. Furthermore, expression studies showed that genes in the expanded PoptrIAA3 subgroup display differential expression. The gene-family analysis reported here will be useful in conducting future functional genomics studies to understand how the molecular roles of these large gene families translate into a diversity of biologically meaningful auxin effects.

  6. Mutational analysis of PKD1 gene in a Chinese family with autosomal dominant polycystic kidney disease.

    PubMed

    Liu, Jingyan; Li, Lanrong; Liu, Qingmin

    2015-01-01

    Autosomal dominant polycystic kidney disease (ADPKD) is a hereditary disease and common renal disease. Mutations of PKD genes are responsible for this disease. We analyzed a large Chinese family with ADPKD using Sanger sequencing to identify the mutation responsible for this disease. The family comprised 27 individuals including 10 ADPKD patients. These ADPKD patients had severe renal disease and most of them died very young. We analyzed 6 survival patients gene and found they all had C10529T mutation in exon 35 of PKD1 gene. We did not found gene mutation in any unaffected relatives or 300 unrelated controls. These findings suggested that the C10529T mutation in PKD1 gene might be the pathogenic mutation responsible for the disease in this family.

  7. Molecular Evolution and Expression Divergence of the Aconitase (ACO) Gene Family in Land Plants

    PubMed Central

    Wang, Yi-Ming; Yang, Qi; Liu, Yan-Jing; Yang, Hai-Ling

    2016-01-01

    Aconitase (ACO) is a key enzyme that catalyzes the isomerization of citrate to isocitrate in the tricarboxylic acid (TCA) and glyoxylate cycles. The function of ACOs has been well studied in model plants, such as Arabidopsis. In contrast, the evolutionary patterns of the ACO family in land plants are poorly understood. In this study, we systematically examined the molecular evolution and expression divergence of the ACO gene family in 12 land plant species. Thirty-six ACO genes were identified from the 12 land plant species representing the four major land plant lineages: Bryophytes, lycophytes, gymnosperms, and angiosperms. All of these ACOs belong to the cytosolic isoform. Three gene duplication events contributed to the expansion of the ACO family in angiosperms. The ancestor of angiosperms may have contained only one ACO gene. One gene duplication event split angiosperm ACOs into two distinct clades. Two clades showed a divergence in selective pressure and gene expression patterns. The cis-acting elements that function in light responsiveness were most abundant in the promoter region of the ACO genes, indicating that plant ACO genes might participate in light regulatory pathways. Our findings provide comprehensive insights into the ACO gene family in land plants. PMID:28018410

  8. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus.

    PubMed

    Zhou, S J; Jing, Z; Shi, J L

    2013-12-11

    Mildew resistance locus o (MLO) is a plant-specific seven-transmembrane (TM) gene family. Several studies have revealed that certain members of the MLO gene family mediate powdery mildew susceptibility in three plant species, namely, Arabidopsis, barley, and tomato. The sequenced cucumber genome provides an opportunity to conduct a comprehensive overview of the MLO gene family. Fourteen genes (designated CsMLO01 through CsMLO14) have been identified within the Cucumis sativus genome by using an in silico cloning method with the MLO amino acid sequences of Arabidopsis thaliana and rice as probes. Sequence alignment revealed that numerous features of the gene family, such as TMs, a calmodulin-binding domain, peptide domains I and II, and 30 important amino acid residues for MLO function, are well conserved. Phylogenetic analysis of the MLO genes from cucumber and other plant species reveals seven different clades (I through VII). Three of these clades comprised MLO genes from A. thaliana, rice, maize, and cucumber, suggesting that these genes may have evolved after the divergence of monocots and dicots. In silico mapping showed that these CsMLOs were located on chromosomes 1, 2, 3, 4, 5, and 6 without any obvious clustering, except CsMLO01. To our knowledge, this paper is the first comprehensive report on MLO genes in C. sativus. These findings will facilitate the functional characterization of the MLOs related to powdery mildew susceptibility and assist in the development of disease resistance in cucumber.

  9. Structure of the omega-gliadin gene family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The '-gliadins are one of the classes of wheat seed storage proteins, but are the least characterized. In this report, an analysis is made of all available '-gliadin DNA sequences including '-gliadins genes within a large genomic clone, previously reported gene sequences, and ESTs identified from th...

  10. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    ERIC Educational Resources Information Center

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  11. Characterization and Functional Analysis of PEBP Family Genes in Upland Cotton (Gossypium hirsutum L.)

    PubMed Central

    Wang, Congcong; Pang, Chaoyou; Wei, Hengling; Wang, Hantao; Song, Meizhen; Fan, Shuli; Yu, Shuxun

    2016-01-01

    Upland cotton (Gossypium hirsutum L.) is a naturally occurring photoperiod-sensitive perennial plant species. However, sensitivity to the day length was lost during domestication. The phosphatidylethanolamine-binding protein (PEBP) gene family, of which three subclades have been identified in angiosperms, functions to promote and suppress flowering in photoperiod pathway. Recent evidence indicates that PEBP family genes play an important role in generating mobile flowering signals. We isolated homologues of the PEBP gene family in upland cotton and examined their regulation and function. Nine PEBP-like genes were cloned and phylogenetic analysis indicated the genes belonged to four subclades (FT, MFT, TFL1 and PEBP). Cotton PEBP-like genes showed distinct expression patterns in relation to different cotton genotypes, photoperiod responsive and cultivar maturity. The GhFT gene expression of a semi-wild race of upland cotton were strongly induced under short day condition, whereas the GhPEBP2 gene expression was induced under long days. We also elucidated that GhFT but not GhPEBP2 interacted with FD-like bZIP transcription factor GhFD and promote flowering under both long- and short-day conditions. The present result indicated that GhPEBP-like genes may perform different functions. This work corroborates the involvement of PEBP-like genes in photoperiod response and regulation of flowering time in different cotton genotypes, and contributes to an improved understanding of the function of PEBP-like genes in cotton. PMID:27552108

  12. Familial migraine: Exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p

    SciTech Connect

    Hovatta, I.; Peltonen, L.; Kallela, M.; Faerkkilae, M.

    1994-10-01

    Genetic isolates are highly useful in analyses of the molecular background of complex diseases since the enrichment of a limited number of predisposing genes can be predicted in representative families or in specific geographical regions. It has been suggested that the pathophysiology and etiology of familial hemiplegic migraine (FHM) and typical migraine with aura are most probably the same. Recent assignment of FHM locus to chromosome 19p in two French families makes it now possible to test this hypothesis. We report here linkage data on four families with multiple cases of migraine disorder originating from the genetically isolated population of Finland. We were interested to discover whether the migraine in these families would also show linkage to the markers on 19p. We could exclude a region of 50 cM, flanking the reported FHM locus, as a site of migraine locus in our four families. It seems evident that locus heterogeneity exists between different diagnostic classes of migraine spectrum of diseases and also between different ethnic groups. 10 refs., 2 figs., 1 tab.

  13. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  14. Chylous ascites in a hedgehog (Atelerix albiventris).

    PubMed

    Roh, Yoon-Seok; Kim, Eun-Ju; Cho, Ara; Kim, Min-Su; Cho, Ho-Seong; Lim, Chae Woong; Kim, Bumseok

    2014-12-01

    An African pygmy hedgehog (Atelerix albiventris) was diagnosed as chylous ascites with biliary cirrhosis. Abdomenocentesis revealed a milky fluid with a 324 mg/dl triglyceride level. On serum biochemical examination, the hedgehog had hypoalbuminemia, hypoglycemia, and high blood urea nitrogen. There was no cytologic or genomic evidence of infection, and a blood culture was negative. Histopathologic examination revealed a liver with proliferative bile ducts that were often surrounded by prominent septa of fibrous connective tissue. In the area of ductular reaction, proliferative cells positive for CD66, an embryogenic antigen of epithelial cells, were revealed. The potential association between chylous ascites and liver cirrhosis is undetermined but could be an aspect of future study. This is the first description of chylous ascites in a hedgehog.

  15. Primary cilia and graded Sonic Hedgehog signaling.

    PubMed

    Sasai, Noriaki; Briscoe, James

    2012-01-01

    Cilia are evolutionary-conserved microtubule-containing organelles protruding from the surface of cells. They are classified into two types--primary and motile cilia. Primary cilia are nearly ubiquitous, at least in vertebrate cells, and it has become apparent that they play an essential role in the intracellular transduction of a range of stimuli. Most notable among these is Sonic Hedgehog. In this article we briefly summarize the structure and biogenesis of primary cilia. We discuss the evidence implicating cilia in the transduction of extrinsic signals. We focus on the involvement and molecular mechanism of cilia in signaling by Sonic Hedgehog in embryonic tissues, specifically the neural tube, and we discuss how cilia play an active role in the interpretation of gradients of Sonic Hedgehog (Shh) signaling.

  16. Hedgehog Signaling in Malignant Pleural Mesothelioma

    PubMed Central

    Felley-Bosco, Emanuela; Opitz, Isabelle; Meerang, Mayura

    2015-01-01

    Malignant pleural mesothelioma (MPM) is a cancer associated with exposure to asbestos fibers, which accumulate in the pleural space, damage tissue and stimulate regeneration. Hedgehog signaling is a pathway important during embryonic mesothelium development and is inactivated in adult mesothelium. The pathway is reactivated in some MPM patients with poor clinical outcome, mainly mediated by the expression of the ligands. Nevertheless, mutations in components of the pathway have been observed in a few cases. Data from different MPM animal models and primary culture suggest that both autocrine and paracrine Hedgehog signaling are important to maintain tumor growth. Drugs inhibiting the pathway at the level of the smoothened receptor (Smo) or glioma-associated protein transcription factors (Gli) have been used mostly in experimental models. For clinical development, biomarkers are necessary for the selection of patients who can benefit from Hedgehog signaling inhibition. PMID:26184317

  17. Hedgehog Signaling in Malignant Pleural Mesothelioma.

    PubMed

    Felley-Bosco, Emanuela; Opitz, Isabelle; Meerang, Mayura

    2015-07-08

    Malignant pleural mesothelioma (MPM) is a cancer associated with exposure to asbestos fibers, which accumulate in the pleural space, damage tissue and stimulate regeneration. Hedgehog signaling is a pathway important during embryonic mesothelium development and is inactivated in adult mesothelium. The pathway is reactivated in some MPM patients with poor clinical outcome, mainly mediated by the expression of the ligands. Nevertheless, mutations in components of the pathway have been observed in a few cases. Data from different MPM animal models and primary culture suggest that both autocrine and paracrine Hedgehog signaling are important to maintain tumor growth. Drugs inhibiting the pathway at the level of the smoothened receptor (Smo) or glioma-associated protein transcription factors (Gli) have been used mostly in experimental models. For clinical development, biomarkers are necessary for the selection of patients who can benefit from Hedgehog signaling inhibition.

  18. Duplication of OsHAP family genes and their association with heading date in rice.

    PubMed

    Li, Qiuping; Yan, Wenhao; Chen, Huaxia; Tan, Cong; Han, Zhongmin; Yao, Wen; Li, Guangwei; Yuan, Mengqi; Xing, Yongzhong

    2016-03-01

    Heterotrimeric Heme Activator Protein (HAP) family genes are involved in the regulation of flowering in plants. It is not clear how many HAP genes regulate heading date in rice. In this study, we identified 35 HAP genes, including seven newly identified genes, and performed gene duplication and candidate gene-based association analyses. Analyses showed that segmental duplication and tandem duplication are the main mechanisms of HAP gene duplication. Expression profiling and functional identification indicated that duplication probably diversifies the functions of HAP genes. A nucleotide diversity analysis revealed that 13 HAP genes underwent selection. A candidate gene-based association analysis detected four HAP genes related to heading date. An investigation of transgenic plants or mutants of 23 HAP genes confirmed that overexpression of at least four genes delayed heading date under long-day conditions, including the previously cloned Ghd8/OsHAP3H. Our results indicate that the large number of HAP genes in rice was mainly produced by gene duplication, and a few HAP genes function to regulate heading date. Selection of HAP genes is probably caused by their diverse functions rather than regulation of heading.

  19. Evolutionary Dynamics of the Interferon-Induced Transmembrane Gene Family in Vertebrates

    PubMed Central

    Zhang, Zhao; Liu, Jun; Li, Meng; Yang, Hui; Zhang, Chiyu

    2012-01-01

    Vertebrate interferon-induced transmembrane (IFITM) genes have been demonstrated to have extensive and diverse functions, playing important roles in the evolution of vertebrates. Despite observance of their functionality, the evolutionary dynamics of this gene family are complex and currently unknown. Here, we performed detailed evolutionary analyses to unravel the evolutionary history of the vertebrate IFITM family. A total of 174 IFITM orthologous genes and 112 pseudogenes were identified from 27 vertebrate genome sequences. The vertebrate IFITM family can be divided into immunity-related IFITM (IR-IFITM), IFITM5 and IFITM10 sub-families in phylogeny, implying origins from three different progenitors. In general, vertebrate IFITM genes are located in two loci, one containing the IFITM10 gene, and the other locus containing IFITM5 and various numbers of IR-IFITM genes. Conservation of evolutionary synteny was observed in these IFITM genes. Significant functional divergence was detected among the three IFITM sub-families. No gene duplication or positive selection was found in IFITM5 sub-family, implying the functional conservation of IFITM5 in vertebrate evolution, which is involved in bone formation. No IFITM5 locus was identified in the marmoset genome, suggesting a potential association with the tiny size of this monkey. The IFITM10 sub-family was divided into two groups: aquatic and terrestrial types. Functional divergence was detected between the two groups, and five IFITM10-like genes from frog were dispersed into the two groups. Both gene duplication and positive selection were observed in aquatic vertebrate IFITM10-like genes, indicating that IFITM10 might be associated with the adaptation to aquatic environments. A large number of lineage- and species-specific gene duplications were observed in IR-IFITM sub-family and positive selection was detected in IR-IFITM of primates and rodents. Because primates have experienced a long history of viral infection

  20. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    PubMed Central

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  1. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    PubMed

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  2. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    PubMed Central

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  3. Variation in the nucleotide sequence of a prolamin gene family in wild rice.

    PubMed

    Barbier, P; Ishihama, A

    1990-07-01

    Variation in the DNA sequence of the 10 kDa prolamin gene family within the wild rice species Oryza rufipogon was probed using the direct sequencing of PCR-amplified genes. A comparison of the nucleotide and deduced amino-acid sequences of eight Asian strains of O. rufipogon and one strain of the related African species O. longistaminata is presented.

  4. Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons.

    PubMed

    Ma, Y; Guo, J W; Bade, R; Men, Z H; Hasi, A

    2014-10-27

    The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants, including green algae, moss, silver birch, snapdragon, Arabidopsis, rice, and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in melon. Using the highly conserved sequence of the Arabidopsis thaliana SBP-box domain protein as a probe of information sequence, the genome-wide protein database of melon was explored to obtain 13 SBP-box protein sequences, which were further divided into 4 groups, based on phylogenetic analysis. A further analysis centered on the melon SBP-box genetic family's phylogenetic evolution, sequence similarities, gene structure, and miR156 target sequence was also conducted. Analysis of all the expression patterns of melon SBP-box family genes showed that the SBP-box genes were detected in 7 kinds of tissue, and fruit had the highest expression level. CmSBP11 tends to present its specific expression in melon fruit and root. CmSBP09 expression was the highest in flower. Overall, the molecular evolution and expression pattern of the melon SBP-box gene family, revealed by these results, suggest its function differentiation that followed gene duplication.

  5. Cloning and expression analysis of novel Aux/IAA family genes in Gossypium hirsutum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Members of the auxin/indole-3-acetic acid (Aux/IAA) gene family encode proteins to mediate the responses of auxin gene expression and to regulate various aspects of plant morphological development. In this paper, we report the identification of nine cDNAs that contain complete open reading frame (OR...

  6. Comparative Genome-Wide Analysis of the Malate Dehydrogenase Gene Families in Cotton

    PubMed Central

    Imran, Muhammad; Tang, Kai; Liu, Jin-Yuan

    2016-01-01

    Malate dehydrogenases (MDHs) play crucial roles in the physiological processes of plant growth and development. In this study, 13 and 25 MDH genes were identified from Gossypium raimondii and Gossypium hirsutum, respectively. Using these and 13 previously reported Gossypium arboretum MDH genes, a comparative molecular analysis between identified MDH genes from G. raimondii, G. hirsutum, and G. arboretum was performed. Based on multiple sequence alignments, cotton MDHs were divided into five subgroups: mitochondrial MDH, peroxisomal MDH, plastidial MDH, chloroplastic MDH and cytoplasmic MDH. Almost all of the MDHs within the same subgroup shared similar gene structure, amino acid sequence, and conserved motifs in their functional domains. An analysis of chromosomal localization suggested that segmental duplication played a major role in the expansion of cotton MDH gene families. Additionally, a selective pressure analysis indicated that purifying selection acted as a vital force in the evolution of MDH gene families in cotton. Meanwhile, an expression analysis showed the distinct expression profiles of GhMDHs in different vegetative tissues and at different fiber developmental stages, suggesting the functional diversification of these genes in cotton growth and fiber development. Finally, a promoter analysis indicated redundant but typical cis-regulatory elements for the potential functions and stress activity of many MDH genes. This study provides fundamental information for a better understanding of cotton MDH gene families and aids in functional analyses of the MDH genes in cotton fiber development. PMID:27829020

  7. Evolution of the insect desaturase gene family with an emphasis on social Hymenoptera.

    PubMed

    Helmkampf, Martin; Cash, Elizabeth; Gadau, Jürgen

    2015-02-01

    Desaturase genes are essential for biological processes, including lipid metabolism, cell signaling, and membrane fluidity regulation. Insect desaturases are particularly interesting for their role in chemical communication, and potential contribution to speciation, symbioses, and sociality. Here, we describe the acyl-CoA desaturase gene families of 15 insects, with a focus on social Hymenoptera. Phylogenetic reconstruction revealed that the insect desaturases represent an ancient gene family characterized by eight subfamilies that differ strongly in their degree of conservation and frequency of gene gain and loss. Analyses of genomic organization showed that five of these subfamilies are represented in a highly microsyntenic region conserved across holometabolous insect taxa, indicating an ancestral expansion during early insect evolution. In three subfamilies, ants exhibit particularly large expansions of genes. Despite these expansions, however, selection analyses showed that desaturase genes in all insect lineages are predominantly undergoing strong purifying selection. Finally, for three expanded subfamilies, we show that ants exhibit variation in gene expression between species, and more importantly, between sexes and castes within species. This suggests functional differentiation of these genes and a role in the regulation of reproductive division of labor in ants. The dynamic pattern of gene gain and loss of acyl-CoA desaturases in ants may reflect changes in response to ecological diversification and an increased demand for chemical signal variability. This may provide an example of how gene family expansions can contribute to lineage-specific adaptations through structural and regulatory changes acting in concert to produce new adaptive phenotypes.

  8. The Classical Arabinogalactan Protein Gene Family of Arabidopsis

    PubMed Central

    Schultz, Carolyn J.; Johnson, Kim L.; Currie, Graeme; Bacic, Antony

    2000-01-01

    Arabinogalactan proteins (AGPs) are extracellular proteoglycans implicated in plant growth and development. We searched for classical AGPs in Arabidopsis by identifying expressed sequence tags based on the conserved domain structure of the predicted protein backbone. To confirm that these genes encoded bona fide AGPs, we purified native AGPs and then deglycosylated and deblocked them for N-terminal protein sequencing. In total, we identified 15 genes encoding the protein backbones of classical AGPs, including genes for AG peptides—AGPs with very short backbones (10 to 13 amino acid residues). Seven of the AGPs were verified as AGPs by protein sequencing. A gene encoding a putative cell adhesion molecule with AGP-like domains was also identified. This work provides a firm foundation for beginning functional analysis by using a genetic approach. PMID:11006345

  9. Interferon induced IFIT family genes in host antiviral defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IF stimulated ...

  10. The Wall-associated Kinase gene family in rice genomes.

    PubMed

    de Oliveira, Luiz Felipe Valter; Christoff, Ana Paula; de Lima, Júlio Cesar; de Ross, Bruno Comparsi Feijó; Sachetto-Martins, Gilberto; Margis-Pinheiro, Marcia; Margis, Rogerio

    2014-12-01

    The environment is a dynamic system in which life forms adapt. Wall-Associated Kinases (WAK) are a subfamily of receptor-like kinases associated with the cell wall. These genes have been suggested as sensors of the extracellular environment and triggers of intracellular signals. They belong to the ePK superfamily with or without a conserved arginine before the catalytic subdomain VIB, which characterizes RD and non-RD WAKs. WAK is a large subfamily in rice. We performed an extensive comparison of WAK genes from A. thaliana (AtWAK), O. sativa japonica and indica subspecies (OsWAK). Phylogenetic studies and WAK domain characterization allowed for the identification of two distinct groups of WAK genes in Arabidopsis and rice. One group corresponds to a cluster containing only OsWAKs that most likely expanded after the monocot-dicot separation, which evolved into a non-RD kinase class. The other group comprises classical RD-kinases with both AtWAK and OsWAK representatives. Clusterization analysis using extracellular and kinase domains demonstrated putative functional redundancy for some genes, but also highlighted genes that could recognize similar extracellular stimuli and activate different cascades. The gene expression pattern of WAKs in response to cold suggests differences in the regulation of the OsWAK genes in the indica and japonica subspecies. Our results also confirm the hypothesis of functional diversification between A. thaliana and O. sativa WAK genes. Furthermore, we propose that plant WAKs constitute two evolutionarily related but independent subfamilies: WAK-RD and WAK-nonRD. Recognition of this structural division will further provide insights to understanding WAK functions and regulations.

  11. Atypical Protein Phosphatase 2A Gene Families Do Not Expand via Paleopolyploidization1[OPEN

    PubMed Central

    2017-01-01

    Protein phosphatase 2A (PP2A) presents unique opportunities for analyzing molecular mechanisms of functional divergence between gene family members. The canonical PP2A holoenzyme regulates multiple eukaryotic signaling pathways by dephosphorylating target proteins and contains a catalytic (C) subunit, a structural/scaffolding (A) subunit, and a regulatory (B) subunit. Genes encoding PP2A subunits have expanded into multigene families in both flowering plants and mammals, and the extent to which different isoform functions may overlap is not clearly understood. To gain insight into the diversification of PP2A subunits, we used phylogenetic analyses to reconstruct the evolutionary histories of PP2A gene families in Arabidopsis (Arabidopsis thaliana). Genes encoding PP2A subunits in mammals represent ancient lineages that expanded early in vertebrate evolution, while flowering plant PP2A subunit lineages evolved much more recently. Despite this temporal difference, our data indicate that the expansion of PP2A subunit gene families in both flowering plants and animals was driven by whole-genome duplications followed by nonrandom gene loss. Selection analysis suggests that the expansion of one B subunit gene family (B56/PPP2R5) was driven by functional diversification rather than by the maintenance of gene dosage. We also observed reduced expansion rates in three distinct B subunit subclades. One of these subclades plays a highly conserved role in cell division, while the distribution of a second subclade suggests a specialized function in supporting beneficial microbial associations. Thus, while whole-genome duplications have driven the expansion and diversification of most PP2A gene families, members of functionally specialized subclades quickly revert to singleton status after duplication events. PMID:28034953

  12. Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases

    PubMed Central

    Shiu, Shin-Han; Bleecker, Anthony B.

    2001-01-01

    Plant receptor-like kinases (RLKs) are proteins with a predicted signal sequence, single transmembrane region, and cytoplasmic kinase domain. Receptor-like kinases belong to a large gene family with at least 610 members that represent nearly 2.5% of Arabidopsis protein coding genes. We have categorized members of this family into subfamilies based on both the identity of the extracellular domains and the phylogenetic relationships between the kinase domains of subfamily members. Surprisingly, this structurally defined group of genes is monophyletic with respect to kinase domains when compared with the other eukaryotic kinase families. In an extended analysis, animal receptor kinases, Raf kinases, plant RLKs, and animal receptor tyrosine kinases form a well supported group sharing a common origin within the superfamily of serine/threonine/tyrosine kinases. Among animal kinase sequences, Drosophila Pelle and related cytoplasmic kinases fall within the plant RLK clade, which we now define as the RLK/Pelle family. A survey of expressed sequence tag records for land plants reveals that mosses, ferns, conifers, and flowering plants have similar percentages of expressed sequence tags representing RLK/Pelle homologs, suggesting that the size of this gene family may have been close to the present-day level before the diversification of land plant lineages. The distribution pattern of four RLK subfamilies on Arabidopsis chromosomes indicates that the expansion of this gene family is partly a consequence of duplication and reshuffling of the Arabidopsis genome and of the generation of tandem repeats. PMID:11526204

  13. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  14. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    PubMed Central

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.; Talvik, Inga; Talvik, Tiina; Vaher, Ulvi; Miranda, Maria J.; Farooq, Muhammad; Nielsen, Jens E.K.; Svendsen, Lene Lavard; Kjelgaard, Ditte B.; Linnet, Karen M.; Hao, Qin; Uldall, Peter; Frangu, Mimoza; Tommerup, Niels; Baig, Shahid M.; Abdullah, Uzma; Born, Alfred P.; Gellert, Pia; Nikanorova, Marina; Olofsson, Kern; Jepsen, Birgit; Marjanovic, Dragan; Al-Zehhawi, Lana I.K.; Peñalva, Sofia J.; Krag-Olsen, Bente; Brusgaard, Klaus; Hjalgrim, Helle; Rubboli, Guido; Pal, Deb K.; Dahl, Hans A.

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis of a wide spectrum of epilepsies with age of onset spanning from the neonatal period to adulthood. A gene panel targeting 46 epilepsy genes was used on a cohort of 216 patients consecutively referred for panel testing. The patients had a range of different epilepsies from benign neonatal seizures to epileptic encephalopathies (EEs). Potentially causative variants were evaluated by literature and database searches, submitted to bioinformatic prediction algorithms, and validated by Sanger sequencing. If possible, parents were included for segregation analysis. We identified a presumed disease-causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared to 17% among patients with generalized epilepsies and 16% in patients with focal or multifocal epilepsies. By the use of a gene panel consisting of 46 epilepsy genes, we were able to find a disease-causing genetic variation in 23% of the analyzed patients. The highest yield was found among patients with neonatal-onset epilepsies and EEs. PMID:27781031

  15. Identification of a new, unorthodox member of the MAGE gene family.

    PubMed

    Põld, M; Zhou, J; Chen, G L; Hall, J M; Vescio, R A; Berenson, J R

    1999-07-15

    Several tumor-associated antigen families, such as MAGE, GAGE/PAGE, PRAME, BAGE, and LAGE/NY-ESO-1, exist. These antigens are of particular interest in tumor immunology, because their expression, with exception of testis and fetal tissues, seems to be restricted to tumor cells only. We have identified a novel member of the MAGE gene family, MAGED1. Northern hybridization and RT-PCR demonstrated that the expression level of MAGED1 in different normal adult tissues is comparable to that in testis and fetal liver. Thus, MAGED1 does not possess an expression pattern characteristic of previously identified MAGE family genes, suggesting that the biology of the MAGE-family genes is more complex than previously thought. Chromosome mapping linked MAGED1 to marker AFM119xd6 (DXS1039) on chromosome Xp11.23.

  16. Sonic Hedgehog Signaling in Limb Development

    PubMed Central

    Tickle, Cheryll; Towers, Matthew

    2017-01-01

    The gene encoding the secreted protein Sonic hedgehog (Shh) is expressed in the polarizing region (or zone of polarizing activity), a small group of mesenchyme cells at the posterior margin of the vertebrate limb bud. Detailed analyses have revealed that Shh has the properties of the long sought after polarizing region morphogen that specifies positional values across the antero-posterior axis (e.g., thumb to little finger axis) of the limb. Shh has also been shown to control the width of the limb bud by stimulating mesenchyme cell proliferation and by regulating the antero-posterior length of the apical ectodermal ridge, the signaling region required for limb bud outgrowth and the laying down of structures along the proximo-distal axis (e.g., shoulder to digits axis) of the limb. It has been shown that Shh signaling can specify antero-posterior positional values in limb buds in both a concentration- (paracrine) and time-dependent (autocrine) fashion. Currently there are several models for how Shh specifies positional values over time in the limb buds of chick and mouse embryos and how this is integrated with growth. Extensive work has elucidated downstream transcriptional targets of Shh signaling. Nevertheless, it remains unclear how antero-posterior positional values are encoded and then interpreted to give the particular structure appropriate to that position, for example, the type of digit. A distant cis-regulatory enhancer controls limb-bud-specific expression of Shh and the discovery of increasing numbers of interacting transcription factors indicate complex spatiotemporal regulation. Altered Shh signaling is implicated in clinical conditions with congenital limb defects and in the evolution of the morphological diversity of vertebrate limbs. PMID:28293554

  17. Sonic hedgehog: restricted expression and limb dysmorphologies.

    PubMed

    Hill, Robert E; Heaney, Simon J H; Lettice, Laura A

    2003-01-01

    Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies.

  18. Sonic hedgehog: restricted expression and limb dysmorphologies

    PubMed Central

    Hill, Robert E; Heaney, Simon JH; Lettice, Laura A

    2003-01-01

    Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915

  19. Sonic Hedgehog Signaling in Limb Development.

    PubMed

    Tickle, Cheryll; Towers, Matthew

    2017-01-01

    The gene encoding the secreted protein Sonic hedgehog (Shh) is expressed in the polarizing region (or zone of polarizing activity), a small group of mesenchyme cells at the posterior margin of the vertebrate limb bud. Detailed analyses have revealed that Shh has the properties of the long sought after polarizing region morphogen that specifies positional values across the antero-posterior axis (e.g., thumb to little finger axis) of the limb. Shh has also been shown to control the width of the limb bud by stimulating mesenchyme cell proliferation and by regulating the antero-posterior length of the apical ectodermal ridge, the signaling region required for limb bud outgrowth and the laying down of structures along the proximo-distal axis (e.g., shoulder to digits axis) of the limb. It has been shown that Shh signaling can specify antero-posterior positional values in limb buds in both a concentration- (paracrine) and time-dependent (autocrine) fashion. Currently there are several models for how Shh specifies positional values over time in the limb buds of chick and mouse embryos and how this is integrated with growth. Extensive work has elucidated downstream transcriptional targets of Shh signaling. Nevertheless, it remains unclear how antero-posterior positional values are encoded and then interpreted to give the particular structure appropriate to that position, for example, the type of digit. A distant cis-regulatory enhancer controls limb-bud-specific expression of Shh and the discovery of increasing numbers of interacting transcription factors indicate complex spatiotemporal regulation. Altered Shh signaling is implicated in clinical conditions with congenital limb defects and in the evolution of the morphological diversity of vertebrate limbs.

  20. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns.

    PubMed

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  1. The SOD Gene Family in Tomato: Identification, Phylogenetic Relationships, and Expression Patterns

    PubMed Central

    Feng, Kun; Yu, Jiahong; Cheng, Yuan; Ruan, Meiying; Wang, Rongqing; Ye, Qingjing; Zhou, Guozhi; Li, Zhimiao; Yao, Zhuping; Yang, Yuejian; Zheng, Qingsong; Wan, Hongjian

    2016-01-01

    Superoxide dismutases (SODs) are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS) caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L.) is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants. PMID:27625661

  2. Characterization of three members of the ACC synthase gene family in Solanum tuberosum L.

    PubMed

    Destéfano-Beltrán, L J; van Caeneghem, W; Gielen, J; Richard, L; van Montagu, M; van der Straeten, D

    1995-02-20

    Two genomic clones corresponding to three members of the 1-aminocyclopropane-1-carboxylic acid (ACC) synthase gene family in potato (Solanum tuberosum L.) have been isolated and sequenced. Two highly homologous genes, ST-ACS1A and ST-ACS1B, transcribed in opposite directions were found in an 8.9 kb region. Their coding sequences are interrupted by two introns at identical positions. Their closest relative in tomato is the LE-ACS3 gene. The third gene in potato, ST-ACS2, was found in a 4 kb region and shows a gene structure similar to that of the tomato LE-ACS4 gene and to the mung bean VR-ACS4 and VR-ACS5 genes. Based on its lack of significant homology to the tomato gene family and its closeness to the VR-ACS4 and VR-ACS5 genes, we propose that LE-ACS7 represents an additional isoform in the tomato genome. Moreover, in a phylogenetic comparison of known ACC synthases, the ST-ACS2 isoform was grouped in a separate lineage together with the mung bean VR-ACS4 and VR-ACS5, and the moth orchid DS-ACS1A and DS-ACS1B gene products. Expression of the three potato genes was studied by reverse transcription-polymerase chain reaction on total RNA. The twin genes are positively regulated by indole-3-acetic acid in hypocotyls and expression is modulated by wounding in the leaves. The third gene is responsive to ethylene and wounding mainly in tubers. The roles of these three genes and of other members of the ACC synthase gene family in vegetative processes of potato such as tuberization, dormancy, and sprouting have yet to be determined.

  3. High Gene Family Turnover Rates and Gene Space Adaptation in the Compact Genome of the Carnivorous Plant Utricularia gibba.

    PubMed

    Carretero-Paulet, Lorenzo; Librado, Pablo; Chang, Tien-Hao; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Rozas, Julio; Albert, Victor A

    2015-05-01

    Utricularia gibba is an aquatic carnivorous plant with highly specialized morphology, featuring fibrous floating networks of branches and leaf-like organs, no recognizable roots, and bladder traps that capture and digest prey. We recently described the compressed genome of U. gibba as sufficient to control the development and reproduction of a complex organism. We hypothesized intense deletion pressure as a mechanism whereby most noncoding DNA was deleted, despite evidence for three independent whole-genome duplications (WGDs). Here, we explore the impact of intense genome fractionation in the evolutionary dynamics of U. gibba's functional gene space. We analyze U. gibba gene family turnover by modeling gene gain/death rates under a maximum-likelihood statistical framework. In accord with our deletion pressure hypothesis, we show that the U. gibba gene death rate is significantly higher than those of four other eudicot species. Interestingly, the gene gain rate is also significantly higher, likely reflecting the occurrence of multiple WGDs and possibly also small-scale genome duplications. Gene ontology enrichment analyses of U. gibba-specific two-gene orthogroups, multigene orthogroups, and singletons highlight functions that may represent adaptations in an aquatic carnivorous plant. We further discuss two homeodomain transcription factor gene families (WOX and HDG/HDZIP-IV) showing conspicuous differential expansions and contractions in U. gibba. Our results 1) reconcile the compactness of the U. gibba genome with its accommodation of a typical number of genes for a plant genome, and 2) highlight the role of high gene family turnover in the evolutionary diversification of U. gibba's functional gene space and adaptations to its unique lifestyle and highly specialized body plan.

  4. Hedgehog Signaling Pathway Database: a repository of current annotation efforts and resources for the Hh research community.

    PubMed

    Hervold, Kieran; Martin, Andrew; Kirkpatrick, Roger A; Mc Kenna, Paul F; Ramirez-Weber, F A

    2007-01-01

    The Hedgehog Signaling Pathway Database is a curated repository of information pertaining to the Hedgehog developmental pathway. It was designed to provide centralized access to a wide range of relevant information in an organism-agnostic manner. Data are provided for all genes and gene targets known to be involved in the Hh pathway across various organisms. The data provided include DNA and protein sequences as well as domain structure motifs. All known human diseases associated with the Hh pathway are indexed including experimental data on therapeutic agents and their molecular targets. Hh researchers will find useful information on relevant protocols, tissue cell lines and reagents used in current Hh research projects. Curated content is also provided for publications, grants and patents relating to the Hh pathway. The database can be accessed at http://www.hedgehog.sfsu.edu.

  5. The ZIC gene family encodes multi-functional proteins essential for patterning and morphogenesis.

    PubMed

    Houtmeyers, Rob; Souopgui, Jacob; Tejpar, Sabine; Arkell, Ruth

    2013-10-01

    The zinc finger of the cerebellum gene (ZIC) discovered in Drosophila melanogaster (odd-paired) has five homologs in Xenopus, chicken, mice, and humans, and seven in zebrafish. This pattern of gene copy expansion is accompanied by a divergence in gene and protein structure, suggesting that Zic family members share some, but not all, functions. ZIC genes are implicated in neuroectodermal development and neural crest cell induction. All share conserved regions encoding zinc finger domains, however their heterogeneity and specification remain unexplained. In this review, the evolution, structure, and expression patterns of the ZIC homologs are described; specific functions attributable to individual family members are supported. A review of data from functional studies in Xenopus and murine models suggest that ZIC genes encode multifunctional proteins operating in a context-specific manner to drive critical events during embryogenesis. The identification of ZIC mutations in congenital syndromes highlights the relevance of these genes in human development.

  6. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  7. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    PubMed

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  8. Detection of a pneumonia virus of mice (PVM) in an African hedgehog (Atelerix arbiventris) with suspected wobbly hedgehog syndrome (WHS).

    PubMed

    Madarame, Hiroo; Ogihara, Kikumi; Kimura, Moe; Nagai, Makoto; Omatsu, Tsutomu; Ochiai, Hideharu; Mizutani, Tetsyuya

    2014-09-17

    A pneumonia virus of mice (PVM) from an African hedgehog (Atelerix arbiventris) with suspected wobbly hedgehog syndrome (WHS) was detected and genetically characterized. The affected hedgehog had a nonsuppurative encephalitis with vacuolization of the white matter, and the brain samples yielded RNA reads highly homogeneous to PVM strain 15 (96.5% of full genomic sequence homology by analysis of next generation sequencing). PVM antigen was also detected in the brain and the lungs immunohistochemically. A PVM was strongly suggested as a causative agent of encephalitis of a hedgehog with suspected WHS. This is a first report of PVM infection in hedgehogs.

  9. From manual curation to visualization of gene families and networks across Solanaceae plant species.

    PubMed

    Pujar, Anuradha; Menda, Naama; Bombarely, Aureliano; Edwards, Jeremy D; Strickler, Susan R; Mueller, Lukas A

    2013-01-01

    High-quality manual annotation methods and practices need to be scaled to the increased rate of genomic data production. Curation based on gene families and gene networks is one approach that can significantly increase both curation efficiency and quality. The Sol Genomics Network (SGN; http://solgenomics.net) is a comparative genomics platform, with genetic, genomic and phenotypic information of the Solanaceae family and its closely related species that incorporates a community-based gene and phenotype curation system. In this article, we describe a manual curation system for gene families aimed at facilitating curation, querying and visualization of gene interaction patterns underlying complex biological processes, including an interface for efficiently capturing information from experiments with large data sets reported in the literature. Well-annotated multigene families are useful for further exploration of genome organization and gene evolution across species. As an example, we illustrate the system with the multigene transcription factor families, WRKY and Small Auxin Up-regulated RNA (SAUR), which both play important roles in responding to abiotic stresses in plants. Database URL: http://solgenomics.net/

  10. Duplications and losses in gene families of rust pathogens highlight putative effectors

    PubMed Central

    Pendleton, Amanda L.; Smith, Katherine E.; Feau, Nicolas; Martin, Francis M.; Grigoriev, Igor V.; Hamelin, Richard; Nelson, C. Dana; Burleigh, J. Gordon; Davis, John M.

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity. PMID:25018762

  11. Conservation and diversity of gene families explored using the CODEHOP strategy in higher plants

    PubMed Central

    Morant, Marc; Hehn, Alain; Werck-Reichhart, Danièle

    2002-01-01

    Background Availability of genomewide information on an increasing but still limited number of plants offers the possibility of identifying orthologues, or related genes, in species with major economical impact and complex genomes. In this paper we exploit the recently described CODEHOP primer design and PCR strategy for targeted isolation of homologues in large gene families. Results The method was tested with two different objectives. The first was to analyze the evolution of the CYP98 family of cytochrome P450 genes involved in 3-hydroxylation of phenolic compounds and lignification in a broad range of plant species. The second was to isolate an orthologue of the sorghum glucosyl transferase UGT85B1 and to determine the complexity of the UGT85 family in wheat. P450s of the CYP98 family or closely related sequences were found in all vascular plants. No related sequence was found in moss. Neither extensive duplication of the CYP98 genes nor an orthologue of UGT85B1 were found in wheat. The UGT85A subfamily was however found to be highly variable in wheat. Conclusions Our data are in agreement with the implication of CYP98s in lignification and the evolution of 3-hydroxylation of lignin precursors with vascular plants. High conservation of the CYP98 family strongly argues in favour of an essential function in plant development. Conversely, high duplication and diversification of the UGT85A gene family in wheat suggests its involvement in adaptative response and provides a valuable pool of genes for biotechnological applications. This work demonstrates the high potential of the CODEHOP strategy for the exploration of large gene families in plants. PMID:12153706

  12. Identification and expression of nor efflux family genes in Staphylococcus epidermidis that act against gatifloxacin.

    PubMed

    Juárez-Verdayes, Marco A; Parra-Ortega, Berenice; Hernández-Rodríguez, César; Betanzos-Cabrera, Gabriel; Rodríguez-Martínez, Sandra; Cancino-Diaz, Mario E; Cancino-Diaz, Juan C

    2012-06-01

    NorA, NorB, and NorC are efflux proteins in the Nor family that regulate the secretion of fluoroquinolones, and MgrA/NorR is a transcription factor of the Nor family. Overexpression of Nor family proteins provides fluoroquinolone resistance in Staphylococcus aureus. However, in coagulase-negative staphylococci (CNS), members of the Nor family had not been identified. In this work, the presence of Nor family proteins in Staphylococcus spp. and the expression of Nor family in gatifloxacin resistant S. epidermidis strains obtained from ocular infections (OI) were identified and analyzed. S. epidermidis strains from OIs (n = 44) and healthy skin (HS; n = 52) were isolated. The nor family genes were identified in CNS using PCR, sequencing and phylogenetic approaches. Nor family expression was determined by RT-PCR. NorA efflux activity was determined using the automated ethidium bromide method. In-silico analysis showed that norA, mgrA/norR, and "norB-like" and "norC-like" (norB/norC) genes are present in CNS. The nor family genes were distributed and constitutively expressed in all S. epidermidis strains studied. In one gatifloxacin resistant strain isolated from the endophthalmitis, treatment with gatifloxacin induced overexpression of the norA gene and resulted in high activity of NorA efflux. These results indicate that the Nor family of proteins is present in CNS, and the NorA efflux mechanism for gatifloxacin response occurs in at least one strain of S. epidermidis, contributing to gatifloxacin resistance.

  13. Comparative genome analysis of lignin biosynthesis gene families across the plant kingdom

    PubMed Central

    2009-01-01

    Background As a major component of plant cell wall, lignin plays important roles in mechanical support, water transport, and stress responses. As the main cause for the recalcitrance of plant cell wall, lignin modification has been a major task for bioenergy feedstock improvement. The study of the evolution and function of lignin biosynthesis genes thus has two-fold implications. First, the lignin biosynthesis pathway provides an excellent model to study the coordinative evolution of a biochemical pathway in plants. Second, understanding the function and evolution of lignin biosynthesis genes will guide us to develop better strategies for bioenergy feedstock improvement. Results We analyzed lignin biosynthesis genes from fourteen plant species and one symbiotic fungal species. Comprehensive comparative genome analysis was carried out to study the distribution, relatedness, and family expansion of the lignin biosynthesis genes across the plant kingdom. In addition, we also analyzed the comparative synteny map between rice and sorghum to study the evolution of lignin biosynthesis genes within the Poaceae family and the chromosome evolution between the two species. Comprehensive lignin biosynthesis gene expression analysis was performed in rice, poplar and Arabidopsis. The representative data from rice indicates that different fates of gene duplications exist for lignin biosynthesis genes. In addition, we also carried out the biomass composition analysis of nine Arabidopsis mutants with both MBMS analysis and traditional wet chemistry methods. The results were analyzed together with the genomics analysis. Conclusion The research revealed that, among the species analyzed, the complete lignin biosynthesis pathway first appeared in moss; the pathway is absent in green algae. The expansion of lignin biosynthesis gene families correlates with substrate diversity. In addition, we found that the expansion of the gene families mostly occurred after the divergence of monocots

  14. Evidence for Retrogene Origins of the Prion Gene Family

    PubMed Central

    Ehsani, Sepehr; Tao, Renzhu; Pocanschi, Cosmin L.; Ren, Hezhen; Harrison, Paul M.; Schmitt-Ulms, Gerold

    2011-01-01

    The evolutionary origin of prion genes, only known to exist in the vertebrate lineage, had remained elusive until recently. Following a lead from interactome investigations of the murine prion protein, our previous bioinformatic analyses revealed the evolutionary descent of prion genes from an ancestral ZIP metal ion transporter. However, the molecular mechanism of evolution remained unexplored. Here we present a computational investigation of this question based on sequence, intron-exon, synteny and pseudogene analyses. Our data suggest that during the emergence of metazoa, a cysteine-flanked core domain was modularly inserted, or arose de novo, in a preexisting ZIP ancestor gene to generate a prion-like ectodomain in a subbranch of ZIP genes. Approximately a half-billion years later, a genomic insertion of a spliced transcript coding for such a prion-like ZIP ectodomain may have created the prion founder gene. We document that similar genomic insertions involving ZIP transcripts, and probably relying on retropositional elements, have indeed occurred more than once throughout evolution. PMID:22046361

  15. Human T-cell receptor variable gene segment families

    SciTech Connect

    Arden, B.; Kabelitz, D.; Clark, S.P.; Mak, T.W.

    1995-10-01

    Multiple DNA and protein sequence alignments have been constructed for the human T-cell receptor {alpha}/{delta}, {beta}, and {gamma} (TCRA/D, B, and G) variable (V) gene segments. The traditional classification into subfamilies was confirmed using a much larger pool of sequences. For each sequence, a name was derived which complies with the standard nomenclature. The traditional numbering of V gene segments in the order of their discovery was continued and changed when in conflict with names of other segments. By discriminating between alleles at the same locus versus genes from different loci, we were able to reduce the number of more than 150 different TCRBV sequences in the database to a repertoire of only 47 functional TCRBV gene segments. An extension of this analysis to the over 100 TCRAV sequences results in a predicted repertoire of 42 functional TCRAV gene segments. Our alignment revealed two residues that distinguish between the highly homologous V{delta} and V{alpha}, one at a site that in V{sub H} contacts the constant region, the other at the interface between immunoglobulin V{sub H} and V{sub L}. This site may be responsible for restricted pairing between certain V{delta} and V{gamma} chains. On the other hand, V{beta} and V{gamma} appear to be related by the fact that their CDR2 length is increased by four residues as compared with that of V{alpha}/{delta} peptides. 150 refs., 12 figs., 5 tabs.

  16. Tandem repeat distribution of gene transcripts in three plant families

    PubMed Central

    2009-01-01

    Tandem repeats (microsatellites or SSRs) are molecular markers with great potential for plant genetic studies. Modern strategies include the transfer of these markers among widely studied and orphan species. In silico analyses allow for studying distribution patterns of microsatellites and predicting which motifs would be more amenable to interspecies transfer. Transcribed sequences (Unigene) from ten species of three plant families were surveyed for the occurrence of micro and minisatellites. Transcripts from different species displayed different rates of tandem repeat occurrence, ranging from 1.47% to 11.28%. Both similar and different patterns were found within and among plant families. The results also indicate a lack of association between genome size and tandem repeat fractions in expressed regions. The conservation of motifs among species and its implication on genome evolution and dynamics are discussed. PMID:21637460

  17. The Vertebrate RCAN Gene Family: Novel Insights into Evolution, Structure and Regulation

    PubMed Central

    Serrano-Candelas, Eva; Farré, Domènec; Aranguren-Ibáñez, Álvaro; Martínez-Høyer, Sergio; Pérez-Riba, Mercè

    2014-01-01

    Recently there has been much interest in the Regulators of Calcineurin (RCAN) proteins which are important endogenous modulators of the calcineurin-NFATc signalling pathway. They have been shown to have a crucial role in cellular programmes such as the immune response, muscle fibre remodelling and memory, but also in pathological processes such as cardiac hypertrophy and neurodegenerative diseases. In vertebrates, the RCAN family form a functional subfamily of three members RCAN1, RCAN2 and RCAN3 whereas only one RCAN is present in the rest of Eukarya. In addition, RCAN genes have been shown to collocate with RUNX and CLIC genes in ACD clusters (ACD21, ACD6 and ACD1). How the RCAN genes and their clustering in ACDs evolved is still unknown. After analysing RCAN gene family evolution using bioinformatic tools, we propose that the three RCAN vertebrate genes within the ACD clusters, which evolved from single copy genes present in invertebrates and lower eukaryotes, are the result of two rounds of whole genome duplication, followed by a segmental duplication. This evolutionary scenario involves the loss or gain of some RCAN genes during evolution. In addition, we have analysed RCAN gene structure and identified the existence of several characteristic features that can be involved in RCAN evolution and gene expression regulation. These included: several transposable elements, CpG islands in the 5′ region of the genes, the existence of antisense transcripts (NAT) associated with the three human genes, and considerable evidence for bidirectional promoters that regulate RCAN gene expression. Furthermore, we show that the CpG island associated with the RCAN3 gene promoter is unmethylated and transcriptionally active. All these results provide timely new insights into the molecular mechanisms underlying RCAN function and a more in depth knowledge of this gene family whose members are obvious candidates for the development of future therapies. PMID:24465593

  18. The banana E2 gene family: Genomic identification, characterization, expression profiling analysis.

    PubMed

    Dong, Chen; Hu, Huigang; Jue, Dengwei; Zhao, Qiufang; Chen, Hongliang; Xie, Jianghui; Jia, Liqiang

    2016-04-01

    The E2 is at the center of a cascade of Ub1 transfers, and it links activation of the Ub1 by E1 to its eventual E3-catalyzed attachment to substrate. Although the genome-wide analysis of this family has been performed in some species, little is known about analysis of E2 genes in banana. In this study, 74 E2 genes of banana were identified and phylogenetically clustered into thirteen subgroups. The predicted banana E2 genes were distributed across all 11 chromosomes at different densities. Additionally, the E2 domain, gene structure and motif compositions were analyzed. The expression of all of the banana E2 genes was analyzed in the root, stem, leaf, flower organs, five stages of fruit development and under abiotic stresses. All of the banana E2 genes, with the exception of few genes in each group, were expressed in at least one of the organs and fruit developments, which indicated that the E2 genes might involve in various aspects of the physiological and developmental processes of the banana. Quantitative RT-PCR (qRT-PCR) analysis identified that 45 E2s under drought and 33 E2s under salt were induced. To the best of our knowledge, this report describes the first genome-wide analysis of the banana E2 gene family, and the results should provide valuable information for understanding the classification, cloning and putative functions of this family.

  19. Analysis of the arabidopsis REM gene family predicts functions during flower development

    PubMed Central

    Mantegazza, Otho; Gregis, Veronica; Mendes, Marta Adelina; Morandini, Piero; Alves-Ferreira, Márcio; Patreze, Camila M.; Nardeli, Sarah M.; Kater, Martin M.; Colombo, Lucia

    2014-01-01

    Background and Aims The REM (Reproductive Meristem) gene family of Arabidopsis thaliana is part of the B3 DNA-binding domain superfamily. Despite the fact that several groups have worked on the REM genes for many years, little is known about the function of this transcription factor family. This study aims to identify a set of REM genes involved in flower development and to characterize their function. Methods In order to provide an overview of the REM gene family, a detailed expression analysis for all REM genes of A. thaliana was performed and combined with a meta-analysis of ChIP-sequencing and microarray experiments. Key Results Two sets of phylogenetically closely related REM genes, namely REM23, REM24 and REM25, and REM34, REM35 and REM36, were identified as possibly being involved in the early stages of flower development. Single- and double-mutant combinations were analysed for these genes, and no phenotypic effects were detected during flower development. Conclusions The data suggest that the REM34, REM35 and REM36 group is the most interesting one, as REM34 is co-expressed with the floral meristem identity (FMI) genes, they are bound by AP1, SVP, AP3 and PI, and they are expressed in the floral meristem and during the earliest stages of flower development. However, it appears that high levels of functional redundancy may conceal the exact function of these transcription factor genes. PMID:25002525

  20. The controversial role of the Hedgehog pathway in normal and malignant hematopoiesis

    PubMed Central

    Mar, BG; Amakye, D; Aifantis, I; Buonamici, S

    2015-01-01

    Hedgehog (Hh) is a developmental signaling pathway in which Hh ligands bind Patched (Ptch), which relieves its inhibition of Smoothened (Smo), allowing the Gli family of transcription factors to translocate to the nucleus and activate Hh target genes. The role of Hh signaling in hematopoiesis is controversial and ill defined. Although some groups observed self-renewal defects with decreased replating and reduced efficiency of secondary murine transplants, other groups reported no hematopoietic phenotypes, which may be related to the timing of Hh abrogation. In malignant hematopoiesis, most attention has been focused on the role of Hh signaling in chronic myeloid leukemia (CML), considered by many to be a stem cell disorder that bears the constitutively active BCR-ABL tyrosine kinase. Despite the elimination of most leukemia cells through BCR-ABL inhibition, most patients remain PCR positive, suggesting that the putative CML stem cell may be resistant to kinase antagonism. Groups are now exploring the Hh pathway as an alternate pathway supporting CML stem cell survival. Knockdown or inhibition of Smo abrogates or delays the appearance of CML in several in vitro and in vivo models. These data have lead to clinical trials using BCR-ABL kinase and novel Smo inhibitors in combination. PMID:21660044

  1. Structural insights into human Kif7, a kinesin involved in Hedgehog signalling

    SciTech Connect

    Klejnot, Marta Kozielski, Frank

    2012-02-01

    The human Kif7 motor domain structure provides insights into a kinesin of medical significance. Kif7, a member of the kinesin 4 superfamily, is implicated in a variety of diseases including Joubert, hydrolethalus and acrocallosal syndromes. It is also involved in primary cilium formation and the Hedgehog signalling pathway and may play a role in cancer. Its activity is crucial for embryonic development. Kif7 and Kif27, a closely related kinesin in the same subfamily, are orthologues of the Drosophila melano@@gaster kinesin-like protein Costal-2 (Cos2). In vertebrates, they work together to fulfil the role of the single Cos2 gene in Drosophila. Here, the high-resolution structure of the human Kif7 motor domain is reported and is compared with that of conventional kinesin, the founding member of the kinesin superfamily. These data are a first step towards structural characterization of a kinesin-4 family member and of this interesting molecular motor of medical significance.

  2. Hedgehog signaling: modulation of cancer properies and tumor mircroenvironment.

    PubMed

    Hanna, Ann; Shevde, Lalita A

    2016-03-18

    Cancer poses a serious health problem in society and is increasingly surpassing cardiovascular disease as the leading cause of mortality in the United States. Current therapeutic strategies for cancer are extreme and harsh to patients and often have limited success; the danger of cancer is intensified as it metastasizes to secondary locations such as lung, bone, and liver, posing a dire threat to patient treatment and survival. Hedgehog signaling is an important pathway for normal development. Initially identified in Drosophila, the vertebrate and mammalian equivalent of the pathway has been studied extensively for its role in cancer development and progression. As this pathway regulates key target genes involved in development, its action also allows for the modulation of the microenvironment to prepare a tumor-suitable niche by manipulating tumor cell growth, differentiation, and immune regulation, thus creating an enabling environment for progression and metastasis. In this review, we will summarize recent scientific discoveries reporting the impact of the Hedgehog signaling pathway on the tumor initiation process and metastatic cascade, shedding light on the ability of the tumor to take over a mechanism crucially intended for development and normal function.

  3. Characterization of the laminin gene family and evolution in zebrafish.

    PubMed

    Sztal, Tamar; Berger, Silke; Currie, Peter D; Hall, Thomas E

    2011-02-01

    Laminins are essential components of all basement membranes and are fundamental to tissue development and homeostasis. Humans possess at least 16 different heterotrimeric laminin complexes formed through different combinations of alpha, beta, and gamma chains. Individual chains appear to exhibit unique expression patterns, leading to the notion that overlap between expression domains governs the constitution of complexes found within particular tissues. However, the spatial and temporal expression of laminin genes has not been comprehensively analyzed in any vertebrate model to date. Here, we describe the tissue-specific expression patterns of all laminin genes in the zebrafish, throughout embryonic development and into the "post-juvenile" period, which is representative of the adult body form. In addition, we present phylogenetic and microsynteny analyses, which demonstrate that the majority of our zebrafish sequences are orthologous to human laminin genes. Together, these data represent a fundamental resource for the study of vertebrate laminins.

  4. Fifteen million years of evolution in the Oryza genus shows extensive gene family expansion.

    PubMed

    Jacquemin, Julie; Ammiraju, Jetty S S; Haberer, Georg; Billheimer, Dean D; Yu, Yeisoo; Liu, Liana C; Rivera, Luis F; Mayer, Klaus; Chen, Mingsheng; Wing, Rod A

    2014-04-01

    In analyzing gene families in the whole-genome sequences available for O. sativa (AA), O. glaberrima (AA), and O. brachyantha (FF), we observed large size expansions in the AA genomes compared to FF genomes for the super-families F-box and NB-ARC, and five additional families: the Aspartic proteases, BTB/POZ proteins (BTB), Glutaredoxins, Trypsin α-amylase inhibitor proteins, and Zf-Dof proteins. Their evolutionary dynamic was investigated to understand how and why such important size variations are observed between these closely related species. We show that expansions resulted from both amplification, largely by tandem duplications, and contraction by gene losses. For the F-box and NB-ARC gene families, the genes conserved in all species were under strong purifying selection while expanded orthologous genes were under more relaxed purifying selection. In F-box, NB-ARC, and BTB, the expanded groups were enriched in genes with little evidence of expression, in comparison with conserved groups. We also detected 87 loci under positive selection in the expanded groups. These results show that most of the duplicated copies in the expanded groups evolve neutrally after duplication because of functional redundancy but a fraction of these genes were preserved following neofunctionalization. Hence, the lineage-specific expansions observed between Oryza species were partly driven by directional selection.

  5. Genome-Wide Identification of the Invertase Gene Family in Populus.

    PubMed

    Chen, Zhong; Gao, Kai; Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials.

  6. Genome-Wide Identification of the Invertase Gene Family in Populus

    PubMed Central

    Su, Xiaoxing; Rao, Pian; An, Xinmin

    2015-01-01

    Invertase plays a crucial role in carbohydrate partitioning and plant development as it catalyses the irreversible hydrolysis of sucrose into glucose and fructose. The invertase family in plants is composed of two sub-families: acid invertases, which are targeted to the cell wall and vacuole; and neutral/alkaline invertases, which function in the cytosol. In this study, 5 cell wall invertase genes (PtCWINV1-5), 3 vacuolar invertase genes (PtVINV1-3) and 16 neutral/alkaline invertase genes (PtNINV1-16) were identified in the Populus genome and found to be distributed on 14 chromosomes. A comprehensive analysis of poplar invertase genes was performed, including structures, chromosome location, phylogeny, evolutionary pattern and expression profiles. Phylogenetic analysis indicated that the two sub-families were both divided into two clades. Segmental duplication is contributed to neutral/alkaline sub-family expansion. Furthermore, the Populus invertase genes displayed differential expression in roots, stems, leaves, leaf buds and in response to salt/cold stress and pathogen infection. In addition, the analysis of enzyme activity and sugar content revealed that invertase genes play key roles in the sucrose metabolism of various tissues and organs in poplar. This work lays the foundation for future functional analysis of the invertase genes in Populus and other woody perennials. PMID:26393355

  7. Mimiviridae: clusters of orthologous genes, reconstruction of gene repertoire evolution and proposed expansion of the giant virus family

    PubMed Central

    2013-01-01

    Background The family Mimiviridae belongs to the large monophyletic group of Nucleo-Cytoplasmic Large DNA Viruses (NCLDV; proposed order Megavirales) and encompasses giant viruses infecting amoeba and probably other unicellular eukaryotes. The recent discovery of the Cafeteria roenbergensis virus (CroV), a distant relative of the prototype mimiviruses, led to a substantial expansion of the genetic variance within the family Mimiviridae. In the light of these findings, a reassessment of the relationships between the mimiviruses and other NCLDV and reconstruction of the evolution of giant virus genomes emerge as interesting and timely goals. Results Database searches for the protein sequences encoded in the genomes of several viruses originally classified as members of the family Phycodnaviridae, in particular Organic Lake phycodnaviruses and Phaeocystis globosa viruses (OLPG), revealed a greater number of highly similar homologs in members of the Mimiviridae than in phycodnaviruses. We constructed a collection of 898 Clusters of Orthologous Genes for the putative expanded family Mimiviridae (MimiCOGs) and used these clusters for a comprehensive phylogenetic analysis of the genes that are conserved in most of the NCLDV. The topologies of the phylogenetic trees for these conserved viral genes strongly support the monophyly of the OLPG and the mimiviruses. The same tree topology was obtained by analysis of the phyletic patterns of conserved viral genes. We further employed the mimiCOGs to obtain a maximum likelihood reconstruction of the history of genes losses and gains among the giant viruses. The results reveal massive gene gain in the mimivirus branch and modest gene gain in the OLPG branch. Conclusions These phylogenomic results reported here suggest a substantial expansion of the family Mimiviridae. The proposed expanded family encompasses a greater diversity of viruses including a group of viruses with much smaller genomes than those of the original members of

  8. Eleven ancestral gene families lost in mammals and vertebrates while otherwise universally conserved in animals

    PubMed Central

    Danchin, Etienne GJ; Gouret, Philippe; Pontarotti, Pierre

    2006-01-01

    Background Gene losses played a role which may have been as important as gene and genome duplications and rearrangements, in modelling today species' genomes from a common ancestral set of genes. The set and diversity of protein-coding genes in a species has direct output at the functional level. While gene losses have been reported in all the major lineages of the metazoan tree of life, none have proposed a focus on specific losses in the vertebrates and mammals lineages. In contrast, genes lost in protostomes (i.e. arthropods and nematodes) but still present in vertebrates have been reported and extensively detailed. This probable over-anthropocentric way of comparing genomes does not consider as an important phenomena, gene losses in species that are usually described as "higher". However reporting universally conserved genes throughout evolution that have recently been lost in vertebrates and mammals could reveal interesting features about the evolution of our genome, particularly if these losses can be related to losses of capability. Results We report 11 gene families conserved throughout eukaryotes from yeasts (such as Saccharomyces cerevisiae) to bilaterian animals (such as Drosophila melanogaster or Caenorhabditis elegans). This evolutionarily wide conservation suggests they were present in the last common ancestors of fungi and metazoan animals. None of these 11 gene families are found in human nor mouse genomes, and their absence generally extends to all vertebrates. A total of 8 out of these 11 gene families have orthologs in plants, suggesting they were present in the Last Eukaryotic Common Ancestor (LECA). We investigated known functional information for these 11 gene families. This allowed us to correlate some of the lost gene families to loss of capabilities. Conclusion Mammalian and vertebrate genomes lost evolutionary conserved ancestral genes that are probably otherwise not dispensable in eukaryotes. Hence, the human genome, which is generally

  9. Systematic analysis and identification of stress-responsive genes of the NAC gene family in Brachypodium distachyon.

    PubMed

    You, Jun; Zhang, Lihua; Song, Bo; Qi, Xiaoquan; Chan, Zhulong

    2015-01-01

    Plant-specific NAC proteins are one of the largest families of transcription factors in plants, and members of this family have been characterized with roles in the regulation of diverse biological processes, including development and stress responses. In the present study, we identified 101 putative NAC domain-encoding genes (BdNACs) through systematic sequence analysis in Brachypodium distachyon, a new model plant of family Poaceae. BdNAC proteins were phylogenetically clustered into 13 groups, and each group possesses similar motif compositions. Phylogenetic analysis using known stress-related NACs from Arabidopsis and rice as query sequences identified 18 BdNACs as putative stress-responsive genes. In silico promoter analysis showed that almost all BdNAC genes contain putative stress-related cis-elements in their promoter regions. Expression profile of BdNAC genes in response to abiotic stresses and phytohormones was analyzed by quantitative real-time RT-PCR. Several putative stress-responsive BdNAC genes, including BdNAC003 and BdNAC044 which is ortholog of known stress-responsive rice gene SNAC1 and SNAC2, respectively, were highly regulated by multiple abiotic stresses and stress-related phytohormone treatments. Taken together, our results presented here would be helpful in laying the foundation for understanding of the complex mechanisms of NAC mediated abiotic stress signaling transduction pathways in B. distachyon.

  10. The phylogeny and evolutionary history of the Lesion Simulating Disease (LSD) gene family in Viridiplantae.

    PubMed

    Cabreira, Caroline; Cagliari, Alexandro; Bücker-Neto, Lauro; Margis-Pinheiro, Márcia; de Freitas, Loreta B; Bodanese-Zanettini, Maria Helena

    2015-12-01

    The Lesion Simulating Disease (LSD) genes encode a family of zinc finger proteins that play a role in programmed cell death (PCD) and other biological processes, such as plant growth and photosynthesis. In the present study, we report the reconstruction of the evolutionary history of the LSD gene family in Viridiplantae. Phylogenetic analysis revealed that the monocot and eudicot genes were distributed along the phylogeny, indicating that the expansion of the family occurred prior to the diversification between these clades. Sequences encoding proteins that present one, two, or three LSD domains formed separate groups. The secondary structure of these different LSD proteins presented a similar composition, with the β-sheets being their main component. The evolution by gene duplication was identified only to the genes that contain three LSD domains, which generated proteins with equal structure. Moreover, genes encoding proteins with one or two LSD domains evolved as single-copy genes and did not result from loss or gain in LSD domains. These results were corroborated by synteny analysis among regions containing paralogous/orthologous genes in Glycine max and Populus trichocarpa. The Ka/Ks ratio between paralogous/orthologous genes revealed that a subfunctionalization process possibly could be occurring with the LSD genes, explaining the involvement of LSD members in different biological processes, in addition to the negative regulation of PCD. This study presents important novelty in the evolutionary history of the LSD family and provides a basis for future research on individual LSD genes and their involvement in important pathway networks in plants.

  11. Evolutionary analysis of the jacalin-related lectin family genes in 11 fishes.

    PubMed

    Cao, Jun; Lv, Yueqing

    2016-09-01

    Jacalin-related lectins are a type of carbohydrate-binding proteins, which are distributed across a wide variety of organisms and involved in some important biological processes. The evolution of this gene family in fishes is unknown. Here, 47 putative jacalin genes in 11 fish species were identified and divided into 4 groups through phylogenetic analysis. Conserved gene organization and motif distribution existed in each group, suggesting their functional conservation. Some fishes have eleven jacalin genes, while others have only one or zero gene in their genomes, suggesting dynamic changes in the number of jacalin genes during the evolution of fishes. Intragenic recombination played a key role in the evolution of jacalin genes. Synteny analyses of jacalin genes in some fishes implied conserved and dynamic evolution characteristics of this gene family and related genome segments. Moreover, a few functional divergence sites were identified within each group pairs. Divergent expression profiles of the zebra fish jacalin genes were further investigated in different stresses. The results provided a foundation for exploring the characterization of the jacalin genes in fishes and will offer insights for additional functional studies.

  12. Genome-wide identification of the TIFY gene family in three cultivated Gossypium species and the expression of JAZ genes

    PubMed Central

    Sun, Quan; Wang, Guanghao; Zhang, Xiao; Zhang, Xiangrui; Qiao, Peng; Long, Lu; Yuan, Youlu; Cai, Yingfan

    2017-01-01

    TIFY proteins are plant-specific proteins containing TIFY, JAZ, PPD and ZML subfamilies. A total of 50, 54 and 28 members of the TIFY gene family in three cultivated cotton species—Gossypium hirsutum, Gossypium barbadense and Gossypium arboretum—were identified, respectively. The results of phylogenetic analysis showed that these TIFY genes were divided into eight clusters. The different clusters of gene family members often have similar gene structures, including the number of exons. The results of quantitative reverse transcription polymerase chain reaction (qRT-PCR) showed that different JAZ genes displayed distinct expression patterns in the leaves of upland cotton under treatment with Gibberellin (GA), methyl jasmonate (MeJA), Jasmonic acid (JA) and abscisic acid (ABA). Different groups of JAZ genes exhibited different expression patterns in cotton leaves infected with Verticillium dahliae. The results of the comparative analysis of TIFY genes in the three cultivated species will be useful for understanding the involvement of these genes in development and stress resistance in cotton. PMID:28186193

  13. Organisation and structural evolution of the rice glutathione S-transferase gene family.

    PubMed

    Soranzo, N; Sari Gorla, M; Mizzi, L; De Toma, G; Frova, C

    2004-06-01

    Glutathione S-transferases (GSTs) comprise a large family of key defence enzymes against xenobiotic toxicity. Here we describe the comprehensive characterisation of this important multigene family in the model monocot species rice [ Oryza sativa(L.)]. Furthermore, we investigate the molecular evolution of the family based on the analysis of (1) the patterns of within-genome duplication, and (2) the phylogenetic relationships and evolutionary divergence among rice, Arabidopsis, maize and soybean GSTs. By in-silico screening of the EST and genome divisions of the Genbank/EMBL/DDBJ database we have isolated 59 putative genes and two pseudogenes, making this the largest plant GST family characterised to date. Of these, 38 (62%) are represented by genomic and EST sequences and 23 (38%) are known only from their genomic sequences. A preliminary survey of EST collections shows a large degree of variability in gene expression between different tissues and environmental conditions, with a small number of genes (13) accounting for 80% of all ESTs. Rice GSTs are organised in four main phylogenetic classes, with 91% of all rice genes belonging to the two plant-specific classes Tau (40 genes) and Phi (16 genes). Pairwise identity scores range between 17 and 98% for proteins of the same class, and 7 and 21% for interclass comparisons. Rapid evolution by gene duplication is suggested by the discovery of two large clusters of 7 and 23 closely related genes on chromosomes 1 and 10, respectively. A comparison of the complete GST families in two monocot and two dicot species suggests a monophyletic origin for all Theta and Zeta GSTs, and no more than three common ancestors for all Phi and Tau genes.

  14. Genome-wide analysis of the MADS-box gene family in Brassica rapa (Chinese cabbage).

    PubMed

    Duan, Weike; Song, Xiaoming; Liu, Tongkun; Huang, Zhinan; Ren, Jun; Hou, Xilin; Li, Ying

    2015-02-01

    The MADS-box gene family is an ancient and well-studied transcription factor family that functions in almost every developmental process in plants. There are a number of reports about the MADS-box family in different plant species, but systematic analysis of the MADS-box transcription factor family in Brassica rapa (Chinese cabbage) is still lacking. In this study, 160 MADS-box transcription factors were identified from the entire Chinese cabbage genome and compared with the MADS-box factors from 21 other representative plant species. A detailed list of MADS proteins from these 22 species was sorted. Phylogenetic analysis of the BrMADS genes, together with their Arabidopsis and rice counterparts, showed that the BrMADS genes were categorised into type I (Mα, Mβ, Mγ) and type II (MIKC(C), MIKC*) groups, and the MIKC(C) proteins were further divided into 13 subfamilies. The Chinese cabbage type II group has 95 members, which is twice as much as the Arabidopsis type II group, indicating that the Chinese cabbage type II genes have been retained more frequently than the type I genes. Finally, RNA-seq transcriptome data and quantitative real-time PCR analysis revealed that BrMADS genes are expressed in a tissue-specific manner similar to Arabidopsis. Interestingly, a number of BrMIKC genes showed responses to different abiotic stress treatments, suggesting a function for some of the genes in these processes as well. Taken together, the characterization of the B. rapa MADS-box family presented here, will certainly help in the selection of appropriate candidate genes and further facilitate functional studies in Chinese cabbage.

  15. The zebrafish progranulin gene family and antisense transcripts

    PubMed Central

    Cadieux, Benoît; Chitramuthu, Babykumari P; Baranowski, David; Bennett, Hugh PJ

    2005-01-01

    Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor) that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn) genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial compartments of various organs

  16. Multi-gene panel testing for hereditary cancer susceptibility in a rural Familial Cancer Program.

    PubMed

    Hermel, David J; McKinnon, Wendy C; Wood, Marie E; Greenblatt, Marc S

    2017-01-01

    This study explores our Familial Cancer Program's experience implementing multi-gene panel testing in a largely rural patient population. We conducted a retrospective review of patients undergoing panel testing between May 2011 and August 2015. Our goal was to evaluate factors that might be predictors of identifying variants (pathogenic or uncertain significance) and to assess clinical management changes due to testing. We utilized a structured family history tool to determine the significance of patient's family histories with respect to identification of genetic variants. A total of 227 patients underwent panel testing at our center and 67 patients (29.5 %) had variants identified, with 8 (3.5 %) having multiple variants. Overall, 44 patients (19.4 %) had a variant of uncertain significance (VUS) and 28 patients (12.3 %) had a pathogenic variant detected, with 10 (4.4 %) having pathogenic variants in highly penetrant genes. We found no statistical difference in patient familial and personal cancer history, age, rural status, Ashkenazi Jewish ancestry, insurance coverage and prior single-gene testing among those with pathogenic, VUS and negative panel testing results. There were no predictors of pathogenic variants on regression analysis. Panel testing changed cancer screening and management guidelines from that expected based on family history alone in 13.2 % of patients. Ultimately, cancer panel testing does yield critical information not identified by traditional single gene testing but maximal utility through a broad range of personal and family histories requires improved interpretation of variants.

  17. The GLI-Kruppel family of human genes

    SciTech Connect

    Ruppert, J.M.; Kinzler, K.W.; Wong, A.J.; Bigner, S.H.; Kao, F.T.; Law, M.L.; Seuanez, H.N.; O'Brien, S.J.; Vogelstein, B.

    1988-08-01

    Previous characterization of GLI, a gene found to be amplified and expressed in a subset of human brain tumors, revealed the presence of five tandem fingers related to those of Kruppel (Kr), a Drosophila segmentation gene of the gap class. The authors have used the GLI cDNA as a molecular probe to isolate related sequences from the human genome. Partial characterization of six related loci, including sequence determination, expression studies, and chromosome localization, revealed that each locus could encode a separate finger protein. The predicted proteins all had similar H-C links, i.e., a conserved stretch of 9 amino acids connecting the C-terminal histidine of one finger to the N-terminal cysteine of the next. On the basis of amino acid sequence and intron-exon organization, the genes could be placed into one of two subgroups: the GLI subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 3/GCX/sub 3/(F/Y)X/sub 5/LX/sub 2/HX/sub 3-4/H(T/X)GEKP) or the Kr subgroup (with the consensus finger amino acid sequence (Y/F)XCX/sub 2/CX/sub 3/FX/sub 5/LX/sub 2/HXRXHTGEKP). Unlike GLI or Kr, most of the newly isolated genes were expressed in many adult tissues. The predicted proteins probably control the expression of other genes and, by analogy with Kr and GLI, may be important in human development, tissue-specific differentiation, or neoplasia.

  18. Interaction of PACAP with Sonic hedgehog reveals complex regulation of the hedgehog pathway by PKA.

    PubMed

    Niewiadomski, Pawel; Zhujiang, Annie; Youssef, Mary; Waschek, James A

    2013-11-01

    Sonic hedgehog (Shh) signaling is essential for proliferation of cerebellar granule cell progenitors (cGCPs) and its aberrant activation causes a cerebellar cancer medulloblastoma. Pituitary adenylate cyclase activating polypeptide (PACAP) inhibits Shh-driven proliferation of cGCPs and acts as tumor suppressor in murine medulloblastoma. We show that PACAP blocks canonical Shh signaling by a mechanism that involves activation of protein kinase A (PKA) and inhibition of the translocation of the Shh-dependent transcription factor Gli2 into the primary cilium. PKA is shown to play an essential role in inhibiting gene transcription in the absence of Shh, but global PKA activity levels are found to be a poor predictor of the degree of Shh pathway activation. We propose that the core Shh pathway regulates a small compartmentalized pool of PKA in the vicinity of primary cilia. GPCRs that affect global PKA activity levels, such as the PACAP receptor, cooperate with the canonical Shh signal to regulate Gli protein phosphorylation by PKA. This interaction serves to fine-tune the transcriptional and physiological function of the Shh pathway.

  19. Cross-species gene-family fluctuations reveal the dynamics of horizontal transfers.

    PubMed

    Grilli, Jacopo; Romano, Mariacristina; Bassetti, Federico; Cosentino Lagomarsino, Marco

    2014-06-01

    Prokaryotes vary their protein repertoire mainly through horizontal transfer and gene loss. To elucidate the links between these processes and the cross-species gene-family statistics, we perform a large-scale data analysis of the cross-species variability of gene-family abundance (the number of members of the family found on a given genome). We find that abundance fluctuations are related to the rate of horizontal transfers. This is rationalized by a minimal theoretical model, which predicts this link. The families that are not captured by the model show abundance profiles that are markedly peaked around a mean value, possibly because of specific abundance selection. Based on these results, we define an abundance variability index that captures a family's evolutionary behavior (and thus some of its relevant functional properties) purely based on its cross-species abundance fluctuations. Analysis and model, combined, show a quantitative link between cross-species family abundance statistics and horizontal transfer dynamics, which can be used to analyze genome 'flux'. Groups of families with different values of the abundance variability index correspond to genome sub-parts having different plasticity in terms of the level of horizontal exchange allowed by natural selection.

  20. Unique Loss of the PYHIN Gene Family in Bats Amongst Mammals: Implications for Inflammasome Sensing

    PubMed Central

    Ahn, Matae; Cui, Jie; Irving, Aaron T.; Wang, Lin-Fa

    2016-01-01

    Recent genomic analysis of two bat species (Pteropus alecto and Myotis davidii) revealed the absence of the PYHIN gene family. This family is recognized as important immune sensors of intracellular self and foreign DNA and activators of the inflammasome and/or interferon pathways. Further assessment of a wider range of bat genomes was necessary to determine if this is a universal pattern for this large mammalian group. Here we expanded genomic analysis of this gene family to include ten bat species. We confirmed the complete loss of this gene family, with only a truncated AIM2 remaining in one species (Pteronotus parnellii). Divergence of the PYHIN gene loci between the bat lineages infers different loss-of-function histories during bat evolution. While all other major groups of placental mammals have at least one gene member, only bats have lost the entire family. This removal of inflammasome DNA sensors may indicate an important adaptation that is flight-induced and related, at least in part, to pathogen-host co-existence. PMID:26906452

  1. A family of Turandot-related genes in the humoral stress response of Drosophila.

    PubMed

    Ekengren, S; Hultmark, D

    2001-06-22

    The Drosophila Turandot A (TotA) gene was recently shown to encode a stress-induced humoral factor which gives increased resistance to the lethal effects of high temperature. Here we show that TotA belongs to a family of eight Tot genes distributed at three different sites in the Drosophila genome. All Tot genes are induced under stressful conditions such as bacterial infection, heat shock, paraquat feeding or exposure to ultraviolet light, suggesting that all members of this family play a role in Drosophila stress tolerance. The induction of the Tot genes differs in important respects from the heat shock response, such as the strong but delayed response to bacterial infection seen for several of the genes.

  2. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  3. Real-Time Evolution of a Subtelomeric Gene Family in Candida albicans

    PubMed Central

    Anderson, Matthew Z.; Wigen, Lauren J.; Burrack, Laura S.; Berman, Judith

    2015-01-01

    Subtelomeric regions of the genome are notable for high rates of sequence evolution and rapid gene turnover. Evidence of subtelomeric evolution has relied heavily on comparisons of historical evolutionary patterns to infer trends and frequencies of these events. Here, we describe evolution of the subtelomeric TLO gene family in Candida albicans during laboratory passaging for over 4000 generations. C. albicans is a commensal and opportunistic pathogen of humans and the TLO gene family encodes a subunit of the Mediator complex that regulates transcription and affects a range of virulence factors. We identified 16 distinct subtelomeric recombination events that altered the TLO repertoire. Ectopic recombination between subtelomeres on different chromosome ends occurred approximately once per 5000 generations and was often followed by loss of heterozygosity, resulting in the complete loss of one TLO gene sequence with expansion of another. In one case, recombination within TLO genes produced a novel TLO gene sequence. TLO copy number changes were biased, with some TLOs preferentially being copied to novel chromosome arms and other TLO genes being frequently lost. The majority of these nonreciprocal recombination events occurred either within the 3′ end of the TLO coding sequence or within a conserved 50-bp sequence element centromere-proximal to TLO coding sequence. Thus, subtelomeric recombination is a rapid mechanism of generating genotypic diversity through alterations in the number and sequence of related gene family members. PMID:25956943

  4. Multispecies Analysis of Expression Pattern Diversification in the Recently Expanded Insect Ly6 Gene Family

    PubMed Central

    Tanaka, Kohtaro; Hazbun, Alexis; Hijazi, Assia; Vreede, Barbara; Sucena, Élio

    2015-01-01

    Gene families often consist of members with diverse expression domains reflecting their functions in a wide variety of tissues. However, how the expression of individual members, and thus their tissue-specific functions, diversified during the course of gene family expansion is not well understood. In this study, we approached this question through the analysis of the duplication history and transcriptional evolution of a rapidly expanding subfamily of insect Ly6 genes. We analyzed different insect genomes and identified seven Ly6 genes that have originated from a single ancestor through sequential duplication within the higher Diptera. We then determined how the original embryonic expression pattern of the founding gene diversified by characterizing its tissue-specific expression in the beetle Tribolium castaneum, the butterfly Bicyclus anynana, and the mosquito Anopheles stephensi and those of its duplicates in three higher dipteran species, representing various stages of the duplication history (Megaselia abdita, Ceratitis capitata, and Drosophila melanogaster). Our results revealed that frequent neofunctionalization episodes contributed to the increased expression breadth of this subfamily and that these events occurred after duplication and speciation events at comparable frequencies. In addition, at each duplication node, we consistently found asymmetric expression divergence. One paralog inherited most of the tissue-specificities of the founder gene, whereas the other paralog evolved drastically reduced expression domains. Our approach attests to the power of combining a well-established duplication history with a comprehensive coverage of representative species in acquiring unequivocal information about the dynamics of gene expression evolution in gene families. PMID:25743545

  5. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    PubMed

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression.

  6. Restricting profile function of hedgehog skyrmion

    NASA Astrophysics Data System (ADS)

    Yamashita, Jun; Hirayama, Minoru

    2006-11-01

    The profile function for the hedgehog skyrmion is investigated. After discussing how the form of the profile function is restricted by the field equation, the static energy is numerically calculated. It is found that the profile functions considered here sometimes give the static energy smaller than previous ones.

  7. Endometrial polyps in 2 African pygmy hedgehogs.

    PubMed

    Phillips, Irene D; Taylor, Jacqueline J; Allen, Andrew L

    2005-06-01

    Reports of spontaneously occurring endometrial polyps in animals are rare and have only involved a few species. This report is intended to advise veterinarians that older African pygmy hedgehogs may develop endometrial polyps and that these lesions can be a cause of bloody vaginal discharge, sometimes interpreted as hematuria.

  8. Twist transition of nematic hyperbolic hedgehogs

    NASA Astrophysics Data System (ADS)

    James, Richard; Fukuda, Jun-ichi

    2014-04-01

    Stability of an idealized hyperbolic hedgehog in a nematic liquid crystal against a twist transition is investigated by extending the methodology of Rüdinger and Stark [Liq. Cryst. 26, 753 (1999), 10.1080/026782999204840], where the hedgehog is confined between two concentric spheres. In the ideal hyperbolic-hedgehog the molecular orientation is assumed to rotate proportionally with respect to the inclination angle, θ (and in the opposite sense). However, when splay, k11, and bend, k33, moduli differ this proportionality is lost and the liquid crystal deforms relative to the ideal with bend and splay. Although slight, these deformations are shown to significantly shift the transition if k11/k33 is small. By increasing the degree of confinement the twist transition can be inhibited, a characteristic both hyperbolic and radial hedgehogs have in common. The twist transition of a hyperbolic defect that accompanies a particle is found to be well predicted by the earlier stability analysis of a thick shell.

  9. Dichotomy in the NRT Gene Families of Dicots and Grass Species

    PubMed Central

    Plett, Darren; Toubia, John; Garnett, Trevor; Tester, Mark; Kaiser, Brent N.; Baumann, Ute

    2010-01-01

    A large proportion of the nitrate (NO3−) acquired by plants from soil is actively transported via members of the NRT families of NO3− transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2) family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH) approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium). We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO3− transporters and NO3− transport in grass crop species. PMID:21151904

  10. Clade classification of monolignol biosynthesis gene family members reveals target genes to decrease lignin in Lolium perenne.

    PubMed

    van Parijs, F R D; Ruttink, T; Boerjan, W; Haesaert, G; Byrne, S L; Asp, T; Roldán-Ruiz, I; Muylle, H

    2015-07-01

    In monocots, lignin content has a strong impact on the digestibility of the cell wall fraction. Engineering lignin biosynthesis requires a profound knowledge of the role of paralogues in the multigene families that constitute the monolignol biosynthesis pathway. We applied a bioinformatics approach for genome-wide identification of candidate genes in Lolium perenne that are likely to be involved in the biosynthesis of monolignols. More specifically, we performed functional subtyping of phylogenetic clades in four multigene families: 4CL, COMT, CAD and CCR. Essential residues were considered for functional clade delineation within these families. This classification was complemented with previously published experimental evidence on gene expression, gene function and enzymatic activity in closely related crops and model species. This allowed us to assign functions to novel identified L. perenne genes, and to assess functional redundancy among paralogues. We found that two 4CL paralogues, two COMT paralogues, three CCR paralogues and one CAD gene are prime targets for genetic studies to engineer developmentally regulated lignin in this species. Based on the delineation of sequence conservation between paralogues and a first analysis of allelic diversity, we discuss possibilities to further study the roles of these paralogues in lignin biosynthesis, including expression analysis, reverse genetics and forward genetics, such as association mapping. We propose criteria to prioritise paralogues within multigene families and certain SNPs within these genes for developing genotyping assays or increasing power in association mapping studies. Although L. perenne was the target of the analyses presented here, this functional subtyping of phylogenetic clades represents a valuable tool for studies investigating monolignol biosynthesis genes in other monocot species.

  11. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    PubMed

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  12. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.)

    PubMed Central

    Deokar, Amit A.; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea (Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis-acting regulatory elements revealed enrichment of cis-elements involved in circadian control, light response, defense and stress responsiveness

  13. Characterization of resistance gene analogues (RGAs) in Apple (Malus 6domestica Borkh.) and their evolutionary history of the Rosaceae family

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The family of resistance gene analogues (RGAs) with a nucleotide-binding site (NBS) domain accounts for the largest number of disease resistance genes and is one of the largest gene families in plants. We have identified 868 RGAs in the genome of the apple (Malus × domestica Borkh.) cultivar ‘Golden...

  14. G-protein—coupled receptors, hedgehog signaling and primary cilia

    PubMed Central

    Mukhopadhyay, Saikat; Rohatgi, Rajat

    2014-01-01

    The Hedgehog (Hh) pathway has become an important model to study diverse aspects of cell biology of the primary cilium, and reciprocally, the study of ciliary processes provides an opportunity to solve longstanding mysteries in the mechanism of vertebrate Hh signal transduction. The cilium is emerging as an unique compartment for G-protein—coupled receptor (GPCR) signaling in many systems. Two members of the GPCR family, Smoothened and Gpr161, play important roles in the Hh pathway. We review the current understanding of how these proteins may function to regulate Hh signaling and also highlight some of the critical unanswered questions being tackled by the field. Uncovering GPCR-regulated mechanisms important in Hh signaling may provide therapeutic strategies against the Hh pathway that plays important roles in development, regeneration and cancer. PMID:24845016

  15. G-protein-coupled receptors, Hedgehog signaling and primary cilia.

    PubMed

    Mukhopadhyay, Saikat; Rohatgi, Rajat

    2014-09-01

    The Hedgehog (Hh) pathway has become an important model to study the cell biology of primary cilia, and reciprocally, the study of ciliary processes provides an opportunity to solve longstanding mysteries in the mechanism of vertebrate Hh signal transduction. The cilium is emerging as an unique compartment for G-protein-coupled receptor (GPCR) signaling in many systems. Two members of the GPCR family, Smoothened and Gpr161, play important roles in the Hh pathway. We review the current understanding of how these proteins may function to regulate Hh signaling and also highlight some of the critical unanswered questions being tackled by the field. Uncovering GPCR-regulated mechanisms important in Hh signaling may provide therapeutic strategies against the Hh pathway that plays important roles in development, regeneration and cancer.

  16. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    PubMed

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  17. Adaptation to drought in two wild tomato species: the evolution of the Asr gene family.

    PubMed

    Fischer, Iris; Camus-Kulandaivelu, Létizia; Allal, François; Stephan, Wolfgang

    2011-06-01

    Wild tomato species are a valuable system in which to study local adaptation to drought: they grow in diverse environments ranging from mesic to extremely arid conditions. Here, we investigate the evolution of members of the Asr (ABA/water stress/ripening induced) gene family, which have been reported to be involved in the water stress response. We analysed molecular variation in the Asr gene family in populations of two closely related species, Solanum chilense and Solanum peruvianum. We concluded that Asr1 has evolved under strong purifying selection. In contrast to previous reports, we did not detect evidence for positive selection at Asr2. However, Asr4 shows patterns consistent with local adaptation in an S. chilense population that lives in an extremely dry environment. We also discovered a new member of the gene family, Asr5. Our results show that the Asr genes constitute a dynamic gene family and provide an excellent example of tandemly arrayed genes that are of importance in adaptation. Taking the potential distribution of the species into account, it appears that S. peruvianum can cope with a great variety of environmental conditions without undergoing local adaptation, whereas S. chilense undergoes local adaptation more frequently.

  18. Challenges and solutions for gene identification in the presence of familial locus heterogeneity

    PubMed Central

    Rehman, Atteeq U; Santos-Cortez, Regie Lyn P; Drummond, Meghan C; Shahzad, Mohsin; Lee, Kwanghyuk; Morell, Robert J; Ansar, Muhammad; Jan, Abid; Wang, Xin; Aziz, Abdul; Riazuddin, Saima; Smith, Joshua D; Wang, Gao T; Ahmed, Zubair M; Gul, Khitab; Shearer, A Eliot; Smith, Richard J H; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hinnant, John; Khan, Shaheen N; Fisher, Rachel A; Ahmad, Wasim; Friderici, Karen H; Riazuddin, Sheikh; Friedman, Thomas B; Wilch, Ellen S; Leal, Suzanne M

    2015-01-01

    Next-generation sequencing (NGS) of exomes and genomes has accelerated the identification of genes involved in Mendelian phenotypes. However, many NGS studies fall short of identifying causal variants, with estimates for success rates as low as 25% for uncovering the pathological variant underlying disease etiology. An important reason for such failures is familial locus heterogeneity, where within a single pedigree causal variants in two or more genes underlie Mendelian trait etiology. As examples of intra- and inter-sibship familial locus heterogeneity, we present 10 consanguineous Pakistani families segregating hearing impairment due to homozygous variants in two different hearing impairment genes and a European-American pedigree in which hearing impairment is caused by four variants in three different genes. We have identified 41 additional pedigrees with syndromic and nonsyndromic hearing impairment for which a single previously reported hearing impairment gene has been identified but only segregates with the phenotype in a subset of affected pedigree members. We estimate that locus heterogeneity occurs in 15.3% (95% confidence interval: 11.9%, 19.9%) of the families in our collection. We demonstrate novel approaches to apply linkage analysis and homozygosity mapping (for autosomal recessive consanguineous pedigrees), which can be used to detect locus heterogeneity using either NGS or SNP array data. Results from linkage analysis and homozygosity mapping can also be used to group sibships or individuals most likely to be segregating the same causal variants and thereby increase the success rate of gene identification. PMID:25491636

  19. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    SciTech Connect

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L.

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  20. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    PubMed

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  1. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    PubMed

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes.

  2. Genome-Wide Analysis of the NADK Gene Family in Plants

    PubMed Central

    Li, Wen-Yan; Wang, Xiang; Li, Ri; Li, Wen-Qiang; Chen, Kun-Ming

    2014-01-01

    Background NAD(H) kinase (NADK) is the key enzyme that catalyzes de novo synthesis of NADP(H) from NAD(H) for NADP(H)-based metabolic pathways. In plants, NADKs form functional subfamilies. Studies of these families in Arabidopsis thaliana indicate that they have undergone considerable evolutionary selection; however, the detailed evolutionary history and functions of the various NADKs in plants are not clearly understood. Principal Findings We performed a comparative genomic analysis that identified 74 NADK gene homologs from 24 species representing the eight major plant lineages within the supergroup Plantae: glaucophytes, rhodophytes, chlorophytes, bryophytes, lycophytes, gymnosperms, monocots and eudicots. Phylogenetic and structural analysis classified these NADK genes into four well-conserved subfamilies with considerable variety in the domain organization and gene structure among subfamily members. In addition to the typical NAD_kinase domain, additional domains, such as adenylate kinase, dual-specificity phosphatase, and protein tyrosine phosphatase catalytic domains, were found in subfamily II. Interestingly, NADKs in subfamily III exhibited low sequence similarity (∼30%) in the kinase domain within the subfamily and with the other subfamilies. These observations suggest that gene fusion and exon shuffling may have occurred after gene duplication, leading to specific domain organization seen in subfamilies II and III, respectively. Further analysis of the exon/intron structures showed that single intron loss and gain had occurred, yielding the diversified gene structures, during the process of structural evolution of NADK family genes. Finally, both available global microarray data analysis and qRT-RCR experiments revealed that the NADK genes in Arabidopsis and Oryza sativa show different expression patterns in different developmental stages and under several different abiotic/biotic stresses and hormone treatments, underscoring the functional diversity

  3. OAS Gene Family Expression Is Associated with HIV-Related Neurocognitive Disorders.

    PubMed

    Sanfilippo, C; Pinzone, M R; Cambria, D; Longo, A; Palumbo, M; Di Marco, R; Condorelli, F; Nunnari, G; Malaguarnera, L; Di Rosa, M

    2017-02-24

    HIV-associated neurocognitive disorders are common in HIV-infected individuals, even in the combination antiretroviral therapy (c-ART) era. Several mechanisms are involved in neuronal damage, including chronic inflammation immune activation. Mammalian 2'-5'-oligoadenylate synthetase (OAS) genes are produced in response to interferon (IFN), mainly by monocytes, and exert their antiviral functions by activation of RNase L that degrades viral and cellular RNAs. In this study, we aimed at exploring OAS gene family RNA expression in simian immunodeficiency virus encephalitis (SIVE), in HIV-associated neurocognitive disorders (HAND), and in HIV-associate dementia (HAD). We analyzed three microarray datasets obtained from the NCBI in order to assess the expression levels of OAS gene family network in brain biopsies of macaques with SIVE vs uninfected animals, as well as post-mortem brain of individuals with HAND (on or off ART) vs uninfected controls and three brain regions of HIV-infected individuals with both neurocognitive impairment (HAD) and encephalitis (HIVE). All OAS genes were upregulated both in SIVE and in HAND. OAS expression was significantly higher in high-viremic individuals; increased expression levels persisted in cART subjects when compared to healthy controls. OAS gene network analysis showed that several genes belonging to the type I IFN pathway, especially CXCL10 and IFIT3, were similarly upregulated in SIVE/HAND. Furthermore, we identified a significant upregulation of OAS gene family RNA expression in basal ganglia, white matter, and frontal cortex of HIV-1, HAD, and HAD/HIVE patients compared to healthy subjects. OAS gene family expression is increased in brain sections from individuals with HAND, HAD, and HIVE as well as macaques with SIVE. OAS family expression is likely to be induced by IFN as a consequence of viral replication in the CNS. Its long-term upregulation may contribute to the chronic inflammatory status and neurocognitive impairment

  4. Genome-wide identification and analysis of the MADS-box gene family in sesame.

    PubMed

    Wei, Xin; Wang, Linhai; Yu, Jingyin; Zhang, Yanxin; Li, Donghua; Zhang, Xiurong

    2015-09-10

    MADS-box genes encode transcription factors that play crucial roles in plant growth and development. Sesame (Sesamum indicum L.) is an oil crop that contributes to the daily oil and protein requirements of almost half of the world's population; therefore, a genome-wide analysis of the MADS-box gene family is needed. Fifty-seven MADS-box genes were identified from 14 linkage groups of the sesame genome. Analysis of phylogenetic relationships with Arabidopsis thaliana, Utricularia gibba and Solanum lycopersicum MADS-box genes was performed. Sesame MADS-box genes were clustered into four groups: 28 MIKC(c)-type, 5 MIKC(⁎)-type, 14 Mα-type and 10 Mγ-type. Gene structure analysis revealed from 1 to 22 exons of sesame MADS-box genes. The number of exons in type II MADS-box genes greatly exceeded the number in type I genes. Motif distribution analysis of sesame MADS-box genes also indicated that type II MADS-box genes contained more motifs than type I genes. These results suggested that type II sesame MADS-box genes had more complex structures. By analyzing expression profiles of MADS-box genes in seven sesame transcriptomes, we determined that MIKC(C)-type MADS-box genes played significant roles in sesame flower and seed development. Although most MADS-box genes in the same clade showed similar expression features, some gene functions were diversified from the orthologous Arabidopsis genes. This research will contribute to uncovering the role of MADS-box genes in sesame development.

  5. Novel mutation of the NOTCH3 gene in a Polish family with CADASIL.

    PubMed

    Buczek, Julia; Błażejewska-Hyżorek, Beata; Cudna, Agnieszka; Lusawa, Małgorzata; Lewandowska, Eliza; Kurkowska-Jastrzębska, Iwona; Członkowska, Anna

    2016-01-01

    Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is an inherited small blood vessels disease caused by mutations in the gene encoding the neurogenic locus notch homolog protein 3 (NOTCH 3). We present a Polish family with a previously unreported novel mutation in exon 12 c.1851C>C/G of the NOTCH3 gene and varying disease expression. One of the two family members with the confirmed mutation presented with all the main CADASIL symptoms; while, his affected father was nearly asymptomatic. Both family members had epilepsy, coronary artery disease, and abdominal aorta aneurysm. Our observation confirms there is phenotypic variability in CADASIL not only between, but also within, families carrying the same mutation.

  6. Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family.

    PubMed

    Stadler, H S; Murray, J C; Leysens, N J; Goodfellow, P J; Solursh, M

    1995-06-01

    Homeobox genes represent a class of transcription factors that play key roles in the regulation of embryogenesis and development. Here we report the identification of a homeobox-containing gene family that is highly conserved at both the nucleotide and amino acid levels in a diverse number of species. These species encompass both vertebrate and invertebrate phylogenies, ranging from Homo sapiens to Drosophila melanogaster. In humans, at least two homeobox sequences from this family were identified representing a previously reported member of this family as well as a novel homeobox sequence that we physically mapped to the 10q25.2-q26.3 region of human Chromosome (Chr) 10. Multiple members of this family were also detected in three additional vertebrate species including Equus caballus (horse), Gallus gallus (Chicken), and Mus musculus (mouse), whereas only single members were detected in Tripneustes gratilla (sea urchin), Petromyzon marinus (lamprey), Salmo salar (salmon), Ovis aries (sheep), and D. melanogaster (fruit fly).

  7. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  8. Cross-Family Transcription Factor Interactions: An Additional Layer of Gene Regulation.

    PubMed

    Bemer, Marian; van Dijk, Aalt D J; Immink, Richard G H; Angenent, Gerco C

    2017-01-01

    Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger protein complexes. The importance of protein-protein interactions between members of a particular plant TF family has long been recognised; however, a significant number of interfamily TF interactions has recently been reported. The biological implications and the molecular mechanisms involved in cross-family interactions have now started to be elucidated and the examples illustrate potential roles in the bridging of biological processes. Hence, cross-family TF interactions expand the molecular toolbox for plants with additional mechanisms to control and fine-tune robust gene expression patterns and to adapt to their continuously changing environment.

  9. Hedgehog signaling pathway function conserved in Tribolium segmentation

    PubMed Central

    Farzana, Laila

    2008-01-01

    In Drosophila, maintenance of parasegmental boundaries and formation of segmental grooves depend on interactions between segment polarity genes. Wingless and Engrailed appear to have similar roles in both short and long germ segmentation, but relatively little is known about the extent to which Hedgehog signaling is conserved. In a companion study to the Tribolium genome project, we analyzed the expression and function of hedgehog, smoothened, patched, and cubitus interruptus orthologs during segmentation in Tribolium. Their expression was largely conserved between Drosophila and Tribolium. Parental RNAi analysis of positive regulators of the pathway (Tc-hh, Tc-smo, or Tc-ci) resulted in small spherical cuticles with little or no evidence of segmental grooves. Segmental Engrailed expression in these embryos was initiated but not maintained. Wingless-independent Engrailed expression in the CNS was maintained and became highly compacted during germ band retraction, providing evidence that derivatives from every segment were present in these small spherical embryos. On the other hand, RNAi analysis of a negative regulator (Tc-ptc) resulted in embryos with ectopic segmental grooves visible during germband elongation but not discernible in the first instar larval cuticles. These transient grooves formed adjacent to Engrailed expressing cells that encircled wider than normal wg domains in the Tc-ptc RNAi embryos. These results suggest that the en–wg–hh gene circuit is functionally conserved in the maintenance of segmental boundaries during germ band retraction and groove formation in Tribolium and that the segment polarity genes form a robust genetic regulatory module in the segmentation of this short germ insect. PMID:18392879

  10. Arsenic inhibits hedgehog signaling during P19 cell differentiation

    SciTech Connect

    Liu, Jui Tung; Bain, Lisa J.

    2014-12-15

    Arsenic is a toxicant found in ground water around the world, and human exposure mainly comes from drinking water or from crops grown in areas containing arsenic in soils or water. Epidemiological studies have shown that arsenic exposure during development decreased intellectual function, reduced birth weight, and altered locomotor activity, while in vitro studies have shown that arsenite decreased muscle and neuronal cell differentiation. The sonic hedgehog (Shh) signaling pathway plays an important role during the differentiation of both neurons and skeletal muscle. The purpose of this study was to investigate whether arsenic can disrupt Shh signaling in P19 mouse embryonic stem cells, leading to changes muscle and neuronal cell differentiation. P19 embryonic stem cells were exposed to 0, 0.25, or 0.5 μM of sodium arsenite for up to 9 days during cell differentiation. We found that arsenite exposure significantly reduced transcript levels of genes in the Shh pathway in both a time and dose-dependent manner. This included the Shh ligand, which was decreased 2- to 3-fold, the Gli2 transcription factor, which was decreased 2- to 3-fold, and its downstream target gene Ascl1, which was decreased 5-fold. GLI2 protein levels and transcriptional activity were also reduced. However, arsenic did not alter GLI2 primary cilium accumulation or nuclear translocation. Moreover, additional extracellular SHH rescued the inhibitory effects of arsenic on cellular differentiation due to an increase in GLI binding activity. Taken together, we conclude that arsenic exposure affected Shh signaling, ultimately decreasing the expression of the Gli2 transcription factor. These results suggest a mechanism by which arsenic disrupts cell differentiation. - Highlights: • Arsenic exposure decreases sonic hedgehog pathway-related gene expression. • Arsenic decreases GLI2 protein levels and transcriptional activity in P19 cells. • Arsenic exposure does not alter the levels of SHH

  11. The ABC transporter gene family of Daphnia pulex

    PubMed Central

    Sturm, Armin; Cunningham, Phil; Dean, Michael

    2009-01-01

    Background The large gene superfamily of ABC (ATP-binding cassette) transporters encodes membrane proteins involved in trafficking processes across biological membranes and further essential cell biological functions. ABC transporters are evolutionary ancient and involved in the biochemical defence against toxicants. We report here a genome-wide survey of ABC proteins of Daphnia pulex, providing for the first time information on ABC proteins in crustacea, a primarily aquatic arthropod subphylum of high ecological and economical importance. Results We identified 64 ABC proteins in the Daphnia genome, which possesses members of all current ABC subfamilies A to H. To unravel phylogenetic relationships, ABC proteins of Daphnia were compared to those from yeast, worm, fruit fly and human. A high conservation of Daphnia of ABC transporters was observed for proteins involved in fundamental cellular processes, including the mitochondrial half transporters of the ABCB subfamily, which function in iron metabolism and transport of Fe/S protein precursors, and the members of subfamilies ABCD, ABCE and ABCF, which have roles in very long chain fatty acid transport, initiation of gene transcription and protein translation, respectively. A number of Daphnia proteins showed one-to-one orthologous relationships to Drosophila ABC proteins including the sulfonyl urea receptor (SUR), the ecdysone transporter ET23, and the eye pigment precursor transporter scarlet. As the fruit fly, Daphnia lacked homologues to the TAP protein, which plays a role in antigene processing, and the cystic fibrosis transmembrane conductance regulator (CFTR), which functions as a chloride channel. Daphnia showed two proteins homologous to MDR (multidrug resistance) P-glycoproteins (ABCB subfamily) and six proteins homologous to MRPs (multidrug resistance-associated proteins) (ABCC subfamily). However, lineage specific gene duplications in the ABCB and ABCC subfamilies complicated the inference of function. A

  12. Cloning and characterization of a second member of the mouse mdr gene family.

    PubMed Central

    Gros, P; Raymond, M; Bell, J; Housman, D

    1988-01-01

    The mammalian mdr gene family comprises a small number of closely related genes. Previously, we have shown that one member, mdr1, has the capacity to convey multidrug resistance to drug-sensitive recipient cells in a gene transfer protocol. However, the functional characteristics of other members of this gene family have not been examined. In this report, we characterize a second member of the mdr gene family which we designated mdr2. We determined the nucleotide sequence corresponding to the complete coding region of this mdr2 transcript. The predicted amino acid sequence of this protein (1,276 amino acids) showed that it is a membrane glycoprotein highly homologous to mdr1 (85%), strongly suggesting that both genes originate from a common ancestor. Regions of divergence between mdr1 and mdr2 proteins are concentrated in two discrete segments of the predicted polypeptides, each approximately 100 residues in length. The mdr2 protein appears to be formed by the duplication of a structural unit which encodes three putative transmembrane loops and a predicted nucleotide-binding fold and is highly homologous to bacterial transport proteins such as hlyB. This strong homology suggests that mdr2 also participates in an energy-dependent membrane transport process. However, the direct relationship, if any, of this new member of the mdr family to multidrug resistance remains to be established. Knowledge of the complete nucleotide sequence and predicted amino acid sequence of the mdr2 gene product will enable the preparation of gene-specific probes and antibodies necessary to study the functional role of this gene in multidrug resistance and normal physiological processes. PMID:3405218

  13. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    PubMed Central

    2012-01-01

    Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs), symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs) has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication), by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in adaptation to host targets. PMID

  14. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    PubMed Central

    Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired. PMID:25961030

  15. Distinct patterns of expression of the RB gene family in mouse and human retina.

    PubMed

    Spencer, Clarellen; Pajovic, Sanja; Devlin, Hollie; Dinh, Quynh-Dao; Corson, Timothy W; Gallie, Brenda L

    2005-06-01

    Although RB1 function is disrupted in the majority of human cancers, an undefined cell of developing human retina is uniquely sensitive to cancer induction when the RB1 tumor suppressor gene is lost. Murine retinoblastoma is initiated only when two of the RB family of genes, RB1 and p107 or p130, are inactivated. Although whole embryonic retina shows RB family gene expression by several techniques, when E14 developing retina was depleted of the earliest differentiating cells, ganglion cells, the remaining proliferating murine embryonic retinal progenitor cells clearly did not express RB1 or p130, while the longer splice form of p107 was expressed. Each retinal cell type expressed some member of the RB family at some stage of differentiation. Rod photoreceptors stained for the RB1 protein product, pRB, and p107 in only a brief window of postnatal murine development, with no detectable staining for any of the RB family proteins in adult human and mouse rod photoreceptors. Adult mouse and human Muller glia, ganglion and rare horizontal cells, and adult human, but not adult mouse, cone photoreceptors stained for pRB. The RB gene family is dynamically and variably expressed through retinal development in specific retinal cells.

  16. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates

    PubMed Central

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability. PMID:26221069

  17. Evolutionary History of Cathepsin L (L-like) Family Genes in Vertebrates.

    PubMed

    Zhou, Jin; Zhang, Yao-Yang; Li, Qing-Yun; Cai, Zhong-Hua

    2015-01-01

    Cathepsin L family, an important cysteine protease found in lysosomes, is categorized into cathepsins B, F, H, K, L, S, and W in vertebrates. This categorization is based on their sequence alignment and traditional functional classification, but the evolutionary relationship of family members is unclear. This study determined the evolutionary relationship of cathepsin L family genes in vertebrates through phylogenetic construction. Results showed that cathepsins F, H, S and K, and L and V were chronologically diverged. Tandem-repeat duplication was found to occur in the evolutionary history of cathepsin L family. Cathepsin L in zebrafish, cathepsins S and K in xenopus, and cathepsin L in mice and rats underwent evident tandem-repeat events. Positive selection was detected in cathepsin L-like members in mice and rats, and amino acid sites under positive selection pressure were calculated. Most of these sites appeared at the connection of secondary structures, suggesting that the sites may slightly change spatial structure. Severe positive selection was also observed in cathepsin V (L2) of primates, indicating that this enzyme had some special functions. Our work provided a brief evolutionary history of cathepsin L family and differentiated cathepsins S and K from cathepsin L based on vertebrate appearance. Positive selection was the specific cause of differentiation of cathepsin L family genes, confirming that gene function variation after expansion events was related to interactions with the environment and adaptability.

  18. Different RET gene mutation-induced multiple endocrine neoplasia type 2A in 3 Chinese families

    PubMed Central

    Liu, Qiuli; Tong, Dali; Yuan, Wenqiang; Liu, Gaolei; Yuan, Gang; Lan, Weihua; Zhang, Dianzheng; Zhang, Jun; Huang, Zaoming; Zhang, Yao; Jiang, Jun

    2017-01-01

    Abstract Backgroud: Multiple endocrine neoplasia type 2A (MEN2A) is a condition with inherited autosomal dominant mutations in RET (rearranged during transfection) gene that predisposes the carrier to extremely high risk of medullary thyroid cancer (MTC) and other MEN2A-associated tumors such as parathyroid cancer and/or pheochromocytoma. Little is reported about MEN2A syndrome in the Chinese population. Methods: All members of the 3 families along with specific probands of MEN2A were analyzed for their clinical, laboratory, and genetic characteristics. Exome sequencing was performed on the 3 probands, and specific mutation in RET was further screened on each of the family members. Results: Different mutations in the RET gene were identified: C634S in Family 1, C611Y in Family 2, and C634Y in Family 3. Proband 1 mainly showed pheochromocytoma with MTC, both medullary thyroid carcinoma and pheochromocytoma were seen in proband 2, and proband 3 showed medullary thyroid carcinoma. Conclusion: The genetic evaluation is strongly recommended for patients with a positive family history, early onset of age, or multiple sites of masses. If the results verified the mutations of RET gene, thyroidectomy should be undertaken as the guide for better prognosis. PMID:28099363

  19. Genome-wide analysis of the omega-3 fatty acid desaturase gene family in Gossypium

    DOE PAGES

    Yurchenko, Olga P.; Park, Sunjung; Ilut, Daniel C.; ...

    2014-11-18

    The majority of commercial cotton varieties planted worldwide are derived from Gossypium hirsutum, which is a naturally occurring allotetraploid produced by interspecific hybridization of A- and D-genome diploid progenitor species. While most cotton species are adapted to warm, semi-arid tropical and subtropical regions, and thus perform well in these geographical areas, cotton seedlings are sensitive to cold temperature, which can significantly reduce crop yields. One of the common biochemical responses of plants to cold temperatures is an increase in omega-3 fatty acids, which protects cellular function by maintaining membrane integrity. The purpose of our study was to identify and characterizemore » the omega-3 fatty acid desaturase (FAD) gene family in G. hirsutum, with an emphasis on identifying omega-3 FADs involved in cold temperature adaptation. Results: Eleven omega-3 FAD genes were identified in G. hirsutum, and characterization of the gene family in extant A and D diploid species (G. herbaceum and G. raimondii, respectively) allowed for unambiguous genome assignment of all homoeologs in tetraploid G. hirsutum. The omega-3 FAD family of cotton includes five distinct genes, two of which encode endoplasmic reticulum-type enzymes (FAD3-1 and FAD3-2) and three that encode chloroplast-type enzymes (FAD7/8-1, FAD7/8-2, and FAD7/8-3). The FAD3-2 gene was duplicated in the A genome progenitor species after the evolutionary split from the D progenitor, but before the interspecific hybridization event that gave rise to modern tetraploid cotton. RNA-seq analysis revealed conserved, gene-specific expression patterns in various organs and cell types and semi-quantitative RT-PCR further revealed that FAD7/8-1 was specifically induced during cold temperature treatment of G. hirsutum seedlings. Conclusions: The omega-3 FAD gene family in cotton was characterized at the genome-wide level in three species, showing relatively ancient establishment of the gene family prior

  20. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

    2014-01-01

    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  1. Genome-wide identification and characterization of the Dof gene family in Medicago truncatula.

    PubMed

    Shu, Y J; Song, L L; Zhang, J; Liu, Y; Guo, C H

    2015-09-09

    The DNA-binding one zinc finger (Dof) family is a classic plant-specific zinc-finger transcription factor family, which is involved in many important processes, including seed maturation and germination, plant growth and development, and light responses. Investigation of the Medicago truncatula genome revealed 42 putative Dof genes, each of which holds one Dof domain. These genes were classified into four groups based on phylogenetic analysis, which are similar to the groups reported for Arabidopsis and rice. Based on genome duplication analysis, it was found that the MtDof genes were distributed on all chromosomes and had expanded through tandem gene duplication and segmental duplication events. Two main duplication regions were identified, one from tandem duplication and another from segmental duplication. By analyzing high-throughput sequencing data from M. truncatula, we found that most of the MtDof genes showed specific expression patterns in different tissues. According to cis-regulatory element analysis, these MtDof genes are regulated by different cis-acting motifs, which are important for the functional divergence of the MtDof genes in different processes. Thus, using genome-wide identification, evolution, and expression pattern analysis of the Dof genes in M. truncatula, our study provides valuable information for understanding the potential function of the Dof genes in regulating the growth and development of M. truncatula.

  2. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra.

    PubMed

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar.

  3. Expression Pattern of ERF Gene Family under Multiple Abiotic Stresses in Populus simonii × P. nigra

    PubMed Central

    Yao, Wenjing; Zhang, Xuemei; Zhou, Boru; Zhao, Kai; Li, Renhua; Jiang, Tingbo

    2017-01-01

    Identification of gene expression patterns of key genes across multiple abiotic stresses is critical for mechanistic understanding of stress resistance in plant. In the present study, we identified differentially expressed genes (DEGs) in di-haploid Populus simonii × P. nigra under respective stresses of NaCl, KCl, CdCl2, and PEG. On the basis of RNA-Seq, we detected 247 DEGs that are shared by the four stresses in wild type poplar, and mRNA abundance of the DEGs were validated in transgenic poplar overexpressing ERF76 gene by RNA-Seq and RT-qPCR. Results from gene ontology analysis indicated that these genes are enriched in significant pathways, such as phenylpropanoid biosynthesis, phenylalanine metabolism, starch and sucrose metabolism, and plant hormone signal transduction. Ethylene response factor (ERF) gene family plays significant role in plant abiotic stress responses. We also investigated expression pattern of ERF gene family under the four stresses. The ERFs and DEGs share similar expression pattern across the four stresses. The transgenic poplar is superior to WT in morphologic, physiological and biochemical traits, which demonstrated the ERF76 gene plays a significant role in stress resistance. These studies will give a rise in understanding the stress response mechanisms in poplar. PMID:28265277

  4. Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar.

    PubMed

    Zhang, Xin; Zong, Jie; Liu, Jianhua; Yin, Jinyuan; Zhang, Dabing

    2010-11-01

    WUSCHEL-related homeobox (WOX) genes form a large gene family specifically expressed in plants. They are known to play important roles in regulating the development of plant tissues and organs by determining cell fate. Recent available whole genome sequences allow us to do more comprehensive phylogenetic analysis of the WOX genes in plants. In the present study, we identified 11 and 21 WOXs from sorghum (Sorghum bicolor) and maize (Zea mays), respectively. The 72 WOX genes from rice (Oryza sativa), sorghum, maize, Arabidopsis (Arabidopsis thaliana) and poplar (Populus trichocarpa) were grouped into three well supported clades with nine subgroups according to the amino acid sequences of their homodomains. Their phylogenetic relationship was also supported by the observation of the motifs outside the homodomain. We observed the variation of duplication events among the nine sub-groups between monocots and eudicots, for instance, more gene duplication events of WOXs within subgroup A for monocots, while, less for dicots in this subgroup. Furthermore, we observed the conserved intron/exon structural patterns of WOX genes in rice, sorghum and Arabidopsis. In addition, WUS (Wuschel)-box and EAR (the ERF-associated amphiphilic repression)-like motif were observed to be conserved among several WOX subgroups in these five plants. Comparative analysis of expression patterns of WOX genes in rice and Arabidopsis suggest that the WOX genes play conserved and various roles in plants. This work provides insights into the evolution of the WOX gene family and is useful for future research.

  5. Isolation, structural analysis, and expression characteristics of the maize TIFY gene family.

    PubMed

    Zhang, Zhongbao; Li, Xianglong; Yu, Rong; Han, Meng; Wu, Zhongyi

    2015-10-01

    TIFY, previously known as ZIM, comprises a plant-specific family annotated as transcription factors that might play important roles in stress response. Despite TIFY proteins have been reported in Arabidopsis and rice, a comprehensive and systematic survey of ZmTIFY genes has not yet been conducted. To investigate the functions of ZmTIFY genes in this family, we isolated and characterized 30 ZmTIFY (1 TIFY, 3 ZML, and 26 JAZ) genes in an analysis of the maize (Zea mays L.) genome in this study. The 30 ZmTIFY genes were distributed over eight chromosomes. Multiple alignment and motif display results indicated that all ZmTIFY proteins share two conserved TIFY and Jas domains. Phylogenetic analysis revealed that the ZmTIFY family could be divided into two groups. Putative cis-elements, involved in abiotic stress response, phytohormones, pollen grain, and seed development, were detected in the promoters of maize TIFY genes. Microarray data showed that the ZmTIFY genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results indicated that ZmTIFY4, 5, 8, 26, and 28 were induced, while ZmTIFY16, 13, 24, 27, 18, and 30 were suppressed, by drought stress in the maize inbred lines Han21 and Ye478. ZmTIFY1, 19, and 28 were upregulated after infection by three pathogens, whereas ZmTIFY4, 13, 21, 23, 24, and 26 were suppressed. These results indicate that the ZmTIFY family may have vital roles in response to abiotic and biotic stresses. The data presented in this work provide vital clues for further investigating the functions of the genes in the ZmTIFY family.

  6. Molecular analysis of the PAX6 gene for aniridia and congenital cataracts in Tunisian families

    PubMed Central

    Chograni, Manèl; Derouiche, Kaouther; Chaabouni, Myriam; Lariani, Imen; Bouhamed, Habiba Chaabouni

    2014-01-01

    The aim of this study was to identify the genetic defect that is responsible for aniridia and congenital cataracts in two Tunisian families. Sequencing of the PAX6 gene in family F1 detected a novel c.265C>T transition in exon 6. In family F2, the previously described c.718C>T mutation in PAX6 was detected in the four affected members. This study adds new mutation to those previously reported in PAX6, providing further evidence for the genetic and phenotypic heterogeneity in individuals with aniridia ocular malformations. PMID:27081502

  7. Hedgehog Receptor Patched Is Expressed in a Tissue and Gestation Specific Manner During Early Human and Murine Development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Hedgehog (Hh) signaling pathway is fundamental for appropriate patterning of nearly every organ system in the developing fetus. The Hh receptor, Patched (Ptc), plays a fundamental role in regulating signal transduction in this pathway. Three main 5 splice forms of the Ptc gene (Ptc1B, Ptc1C, and...

  8. Rapid Expansion and Functional Divergence of Subtelomeric Gene Families in Yeasts

    PubMed Central

    Brown, Chris A.; Murray, Andrew W.; Verstrepen, Kevin J.

    2010-01-01

    Summary Background Subtelomeres, regions proximal to telomeres, exhibit characteristics unique to eukaryotic genomes. Genes residing in these loci are subject to epigenetic regulation and elevated rates of both meiotic and mitotic recombination. However, most genome sequences do not contain assembled subtelomeric sequences, and, as a result, subtelomeres are often overlooked in comparative genomics. Results We study the evolution and functional divergence of subtelomeric gene families in the yeast lineage. Our computational results show that subtelomeric families are evolving and expanding much faster than families that do not contain subtelomeric genes. Focusing on three related subtelomeric MAL gene families involved in disaccharide metabolism that show typical patterns of rapid expansion and evolution, we show experimentally how frequent duplication events followed by functional divergence yields novel alleles that allow metabolism of different carbohydrates. Conclusions Taken together, our computational and experimental analyses show that the extraordinary instability of eukaryotic subtelomeres supports rapid adaptation to novel niches by promoting gene recombination and duplication followed by functional divergence of the alleles. PMID:20471265

  9. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    PubMed

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  10. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses

    PubMed Central

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1–3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses. PMID:24614623

  11. Functional divergence of the glutathione S-transferase supergene family in Physcomitrella patens reveals complex patterns of large gene family evolution in land plants.

    PubMed

    Liu, Yan-Jing; Han, Xue-Min; Ren, Lin-Ling; Yang, Hai-Ling; Zeng, Qing-Yin

    2013-02-01

    Plant glutathione S-transferases (GSTs) are multifunctional proteins encoded by a large gene family that play major roles in the detoxification of xenobiotics and oxidative stress metabolism. To date, studies on the GST gene family have focused mainly on vascular plants (particularly agricultural plants). In contrast, little information is available on the molecular characteristics of this large gene family in nonvascular plants. In addition, the evolutionary patterns of this family in land plants remain unclear. In this study, we identified 37 GST genes from the whole genome of the moss Physcomitrella patens, a nonvascular representative of early land plants. The 37 P. patens GSTs were divided into 10 classes, including two new classes (hemerythrin and iota). However, no tau GSTs were identified, which represent the largest class among vascular plants. P. patens GST gene family members showed extensive functional divergence in their gene structures, gene expression responses to abiotic stressors, enzymatic characteristics, and the subcellular locations of the encoded proteins. A joint phylogenetic analysis of GSTs from P. patens and other higher vascular plants showed that different class GSTs had distinct duplication patterns during the evolution of land plants. By examining multiple characteristics, this study revealed complex patterns of evolutionary divergence among the GST gene family in land plants.

  12. Evolutionary analysis of multidrug resistance genes in fungi - impact of gene duplication and family conservation.

    PubMed

    Gossani, Cristiani; Bellieny-Rabelo, Daniel; Venancio, Thiago M

    2014-11-01

    Although the emergence of bacterial drug resistance is of great concern to the scientific community, few studies have evaluated this phenomenon systematically in fungi by using genome-wide datasets. In the present study, we assembled a large compendium of Saccharomyces cerevisiae chemical genetic data to study the evolution of multidrug resistance genes (MDRs) in the fungal lineage. We found that MDRs typically emerge in widely conserved families, most of which containing homologs from pathogenic fungi, such as Candida albicans and Coccidioides immitis, which could favor the evolution of drug resistance in those species. By integrating data from chemical genetics with protein family conservation, genetic and protein interactions, we found that gene families rarely have more than one MDR, indicating that paralogs evolve asymmetrically with regard to multidrug resistance roles. Furthermore, MDRs have more genetic and protein interaction partners than non-MDRs, supporting their participation in complex biochemical systems underlying the tolerance to multiple bioactive molecules. MDRs share more chemical genetic interactions with other MDRs than with non-MDRs, regardless of their evolutionary affinity. These results suggest the existence of an intricate system involved in the global drug tolerance phenotypes. Finally, MDRs are more likely to be hit repeatedly by mutations in laboratory evolution experiments, indicating that they have great adaptive potential. The results presented here not only reveal the main genomic features underlying the evolution of MDRs, but also shed light on the gene families from which drug resistance is more likely to emerge in fungi.

  13. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    PubMed Central

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes. PMID:23755192

  14. Targeting Breast Cancer Recurrence via Hedgehog-Mediated Sensitization of Breast Cancer Stem Cells

    DTIC Science & Technology

    2011-07-01

    force these cells back into the cell cycle, possibly sensitizing them to adjuvant cancer therapeutics. To test this hypothesis we developed three...force these cells back into the cell cycle, possibly sensitizing them to adjuvant cancer therapeutics. To test this hypothesis we developed three...canonical hedgehog target gene, Patched1, was not altered in response to oral-gavage of Smoothened agonists. In vitro testing of the compounds

  15. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume.

    PubMed

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development.

  16. Genome-Wide Identification, Characterization and Expression Analysis of the TCP Gene Family in Prunus mume

    PubMed Central

    Zhou, Yuzhen; Xu, Zongda; Zhao, Kai; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2016-01-01

    TCP proteins, belonging to a plant-specific transcription factors family, are known to have great functions in plant development, especially flower and leaf development. However, there is little information about this gene family in Prunus mume, which is widely cultivated in China as an ornamental and fruit tree. Here a genome-wide analysis of TCP genes was performed to explore their evolution in P. mume. Nineteen PmTCPs were identified and three of them contained putative miR319 target sites. Phylogenetic and comprehensive bioinformatics analyses of these genes revealed that different types of TCP genes had undergone different evolutionary processes and the genes in the same clade had similar chromosomal location, gene structure, and conserved domains. Expression analysis of these PmTCPs indicated that there were diverse expression patterns among different clades. Most TCP genes were predominantly expressed in flower, leaf, and stem, and showed high expression levels in the different stages of flower bud differentiation, especially in petal formation stage and gametophyte development. Genes in TCP-P subfamily had main roles in both flower development and gametophyte development. The CIN genes in double petal cultivars might have key roles in the formation of petal, while they were correlated with gametophyte development in the single petal cultivar. The CYC/TB1 type genes were highly detected in the formation of petal and pistil. The less-complex flower types of P. mume might result from the fact that there were only two CYC type genes present in P. mume and a lack of CYC2 genes to control the identity of flower types. These results lay the foundation for further study on the functions of TCP genes during flower development. PMID:27630648

  17. Pyrin gene and mutants thereof, which cause familial Mediterranean fever

    DOEpatents

    Kastner, Daniel L.; Aksentijevichh, Ivona; Centola, Michael; Deng, Zuoming; Sood, Ramen; Collins, Francis S.; Blake, Trevor; Liu, P. Paul; Fischel-Ghodsian, Nathan; Gumucio, Deborah L.; Richards, Robert I.; Ricke, Darrell O.; Doggett, Norman A.; Pras, Mordechai

    2003-09-30

    The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

  18. Severe Gardner Syndrome in Families with Mutations Restricted to a Specific Region of the APC Gene

    PubMed Central

    Davies, D. Rhodri; Armstrong, John G.; Thakker, Nalin; Horner, Keith; Guy, Simon P.; Clancy, Tara; Sloan, Phil; Blair, Val; Dodd, Chris; Warnes, Tom W.; Harris, Rodney; Evans, D. Gareth R.

    1995-01-01

    Familial adenomatous polyposis (FAP) is associated with a number of extraintestinal manifestations, which include osteomas, epidermoid cysts, and desmoid tumors, often referred to as “Gardner syndrome.” Recent studies have suggested that some of the phenotypic features of FAP are dependent on the position of the mutation within the APC gene. In particular, the correlation between congenital hypertrophy of the retinal pigment epithelium (CHRPE) and APC genotype indicates that affected families may be divided into distinct groups. We have investigated the association between the dento-osseous features of GS on dental panoramic radiographs (DPRs) and APC genotype in a regional cohort of FAP families. DPRs were performed on 84 affected individuals from 36 families, and the dento-osseous features of FAP were quantified by a weighted scoring system. Significant DPR abnormalities were present in 69% of affected individuals. The APC gene mutation was identified in 27 of these families, and for statistical analysis these were subdivided into three groups. Group 1 comprised 18 affected individuals from seven families with mutations 5' of exon 9; these families (except one) did not express CHRPE. Groups 2 comprised 38 individuals from 16 families with mutations between exon 9 and codon 1444, all of whom expressed CHRPE. Group 3 comprised 11 individuals from four families with mutations 3' of codon 1444, none of whom expressed CHRPE. Families with mutations 3' of codon 1444 had significantly more lesions on DPRs (P < .001) and appeared to have a higher incidence of desmoid tumors. These results suggest that the severity of some of the features of Gardner syndrome may correlate with genotype in FAP. ImagesFigure 2 PMID:7485167

  19. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis

    PubMed Central

    Ye, Qiaolin; Yin, Tongming

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I–III), with five subgroups (IIa–IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon–intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution

  20. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    PubMed

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  1. Expansion, diversification, and expression of T-box family genes in Porifera.

    PubMed

    Holstien, Kay; Rivera, Ajna; Windsor, Pam; Ding, Siyu; Leys, Sally P; Hill, Malcolm; Hill, April

    2010-12-01

    Sponges are among the earliest diverging lineage within the metazoan phyla. Although their adult morphology is distinctive, at several stages of development, they possess characteristics found in more complex animals. The T-box family of transcription factors is an evolutionarily ancient gene family known to be involved in the development of structures derived from all germ layers in the bilaterian animals. There is an incomplete understanding of the role that T-box transcription factors play in normal sponge development or whether developmental pathways using the T-box family share similarities between parazoan and eumetazoan animals. To address these questions, we present data that identify several important T-box genes in marine and freshwater sponges, place these genes in a phylogenetic context, and reveal patterns in how these genes are expressed in developing sponges. Phylogenetic analyses demonstrate that sponges have members of at least two of the five T-box subfamilies (Brachyury and Tbx2/3/4/5) and that the T-box genes expanded and diverged in the poriferan lineage. Our analysis of signature residues in the sponge T-box genes calls into question whether "true" Brachyury genes are found in the Porifera. Expression for a subset of the T-box genes was elucidated in larvae from the marine demosponge, Halichondria bowerbanki. Our results show that sponges regulate the timing and specificity of gene expression for T-box orthologs across larval developmental stages. In situ hybridization reveals distinct, yet sometimes overlapping expression of particular T-box genes in free-swimming larvae. Our results provide a comparative framework from which we can gain insights into the evolution of developmentally important pathways.

  2. Proteoglycan interactions with Sonic Hedgehog specify mitogenic responses

    PubMed Central

    Chan, Jennifer A.; Balasubramanian, Srividya; Witt, Rochelle M.; Nazemi, Kellie J.; Choi, Yoojin; Pazyra-Murphy, Maria F.; Walsh, Carolyn O.; Thompson, Margaret; Segal, Rosalind A.

    2009-01-01

    SUMMARY Sonic Hedgehog (Shh) has dual roles in vertebrate development, as it promotes progenitor cell proliferation and induces tissue patterning. Here we show mitogenic and patterning functions of Shh can be uncoupled from one another. Using a genetic approach to selectively inhibit Shh-proteoglycan interactions in a mouse model, we show binding of Shh to proteoglycans is required for proliferation of neural stem/precursor cells but not for tissue patterning. Shh-proteoglycan interactions regulate both spatial and temporal features of Shh signaling. Proteoglycans localize Shh to specialized mitogenic niches and also act at the single cell level to regulate the duration of Shh signaling, thereby promoting a gene expression program important for cell division. As activation of the Shh pathway is a feature of diverse human cancers, selective stimulation of proliferation by Shh-proteoglycan interactions may also figure prominently in neoplastic growth. PMID:19287388

  3. Proteoglycan interactions with Sonic Hedgehog specify mitogenic responses.

    PubMed

    Chan, Jennifer A; Balasubramanian, Srividya; Witt, Rochelle M; Nazemi, Kellie J; Choi, Yoojin; Pazyra-Murphy, Maria F; Walsh, Carolyn O; Thompson, Margaret; Segal, Rosalind A

    2009-04-01

    Sonic Hedgehog (Shh) has dual roles in vertebrate development, promoting progenitor cell proliferation and inducing tissue patterning. We found that the mitogenic and patterning functions of Shh can be uncoupled from one another. Using a genetic approach to selectively inhibit Shh-proteoglycan interactions in a mouse model, we found that binding of Shh to proteoglycans was required for proliferation of neural stem/precursor cells, but not for tissue patterning. Shh-proteoglycan interactions regulated both spatial and temporal features of Shh signaling. Proteoglycans localized Shh to specialized mitogenic niches and also acted at the single-cell level to regulate the duration of Shh signaling, thereby promoting a gene expression program that is important for cell division. Because activation of the Shh pathway is a feature of diverse human cancers, selective stimulation of proliferation by Shh-proteoglycan interactions may also figure prominently in neoplastic growth.

  4. Mutations in the hairless gene underlie APL in three families of Pakistani origin

    PubMed Central

    Kraemer, Liv; Wajid, Muhammad; Shimomura, Yutaka; Christiano, Angela M.

    2009-01-01

    Summary Background Atrichia with papular lesions (APL) (OMIM#209500) is a rare autosomal recessively inherited form of irreversible alopecia characterized by papular lesions of keratin-filled cysts on various regions of the body. Males and females are equally affected and present with a distinct pattern of total hair loss on scalp, axilla and body. It begins shortly after birth with the development of hair loss, and patients are normally devoid of eyelashes and eyebrows. Mutations in the hairless (HR) gene have been previously shown to be responsible for APL. Objective In this study, we studied the molecular basis of APL in three unrelated families of Pakistani origin. Method Molecular analysis of the HR genes was performed on genomic DNA from probands and family members. Results DNA sequencing of the HR gene in family A revealed a novel homozygous 2 bp deletion in exon 6 leading to a frameshift and a downstream premature termination codon in exon 8 (1782-83delAG). In family B, we identified a novel homozygous deletion of a G nucleotide at the exon 15–intron 15 boundary, termed 3097delG. Family C carries a previously reported missense mutation consisting of an A-to-G transition at nucleotide 276 resulting in the mutation N970S in exon 14. Conclusion Two mutations identified in this study are novel mutations in the HR gene and extend the body of evidence implicating the hairless gene family in the pathogenesis of human skin disorders. The one previously reported mutation suggests it may represent a recurrent mutation, or alternatively, an allele that is widely dispersed around the world. PMID:18164595

  5. The genome and transcriptome of the zoonotic hookworm Ancylostoma ceylanicum identify infection-specific gene families.

    PubMed

    Schwarz, Erich M; Hu, Yan; Antoshechkin, Igor; Miller, Melanie M; Sternberg, Paul W; Aroian, Raffi V

    2015-04-01

    Hookworms infect over 400 million people, stunting and impoverishing them. Sequencing hookworm genomes and finding which genes they express during infection should help in devising new drugs or vaccines against hookworms. Unlike other hookworms, Ancylostoma ceylanicum infects both humans and other mammals, providing a laboratory model for hookworm disease. We determined an A. ceylanicum genome sequence of 313 Mb, with transcriptomic data throughout infection showing expression of 30,738 genes. Approximately 900 genes were upregulated during early infection in vivo, including ASPRs, a cryptic subfamily of activation-associated secreted proteins (ASPs). Genes downregulated during early infection included ion channels and G protein-coupled receptors; this downregulation was observed in both parasitic and free-living nematodes. Later, at the onset of heavy blood feeding, C-lectin genes were upregulated along with genes for secreted clade V proteins (SCVPs), encoding a previously undescribed protein family. These findings provide new drug and vaccine targets and should help elucidate hookworm pathogenesis.

  6. Characterization of the 11S globulin gene family in the castor plant Ricinus communis L.

    PubMed

    Chileh, Tarik; Esteban-García, Belén; A