Science.gov

Sample records for helix-loop-helix protein-mediated transcriptional

  1. The Basic Helix-Loop-Helix Transcription Factor PIF5 Acts on Ethylene Biosynthesis and Phytochrome Signaling by Distinct Mechanisms

    USDA-ARS?s Scientific Manuscript database

    HYTOCHROME-INTERACTING FACTOR5 (PIF5), a basic helix-loop-helix transcription factor, interacts specifically with the photoactivated form of phytochrome B (phyB). Here, we report that dark-grown Arabidopsis thaliana seedlings overexpressing PIF5 (PIF5-OX) exhibit exaggerated apical hooks and short h...

  2. Challenges in Targeting a Basic Helix-Loop-Helix Transcription Factor with Hydrocarbon-Stapled Peptides.

    PubMed

    Edwards, Amanda L; Meijer, Dimphna H; Guerra, Rachel M; Molenaar, Remco J; Alberta, John A; Bernal, Federico; Bird, Gregory H; Stiles, Charles D; Walensky, Loren D

    2016-11-18

    Basic helix-loop-helix (bHLH) transcription factors play critical roles in organism development and disease by regulating cell proliferation and differentiation. Transcriptional activity, whether by bHLH homo- or heterodimerization, is dependent on protein-protein and protein-DNA interactions mediated by α-helices. Thus, α-helical decoys have been proposed as potential targeted therapies for pathologic bHLH transcription. Here, we developed a library of stabilized α-helices of OLIG2 (SAH-OLIG2) to test the capacity of hydrocarbon-stapled peptides to disrupt OLIG2 homodimerization, which drives the development and chemoresistance of glioblastoma multiforme, one of the deadliest forms of human brain cancer. Although stapling successfully reinforced the α-helical structure of bHLH constructs of varying length, sequence-specific dissociation of OLIG2 dimers from DNA was not achieved. Re-evaluation of the binding determinants for OLIG2 self-association and stability revealed an unanticipated role of the C-terminal domain. These data highlight potential pitfalls in peptide-based targeting of bHLH transcription factors given the liabilities of their positively charged amino acid sequences and multifactorial binding determinants.

  3. Transcriptional regulation of the Sex-lethal gene by helix-loop-helix proteins.

    PubMed

    Hoshijima, K; Kohyama, A; Watakabe, I; Inoue, K; Sakamoto, H; Shimura, Y

    1995-09-11

    Somatic sex determination in Drosophila depends on the expression of Sex-lethal (Sxl), whose level is determined by the relative number of X chromosomes and sets of autosomes (X:A ratio). The first step in regulation of Sxl expression is transcriptional control from its early promoter and several genes encoding transcription factors of the helix-loop-helix (HLH) family such as daughterless (da), sisterless-b (sis-b), deadpan (dpn) and extramacrochaetae (emc) have been implicated. By the use of transfection assays and in vitro binding experiments, here we show that da/sis-b heterodimers bind several sites on the Sxl early promoter with different affinities and consequently tune the level of active transcription from this promoter. Interestingly, our data indicate that repression by the dpn product of da/sis-b dependent activation results from specific binding of dpn protein to a unique site within the promoter. This contrasts with the mode of emc repression, which inhibits the formation of the da/sis-b heterodimers. These results reveal the molecular mechanisms by which Sxl gene transcription is positively or negatively regulated to control somatic sex determination.

  4. Possible roles of basic helix-loop-helix transcription factors in adaptation to drought.

    PubMed

    Castilhos, Graciela; Lazzarotto, Fernanda; Spagnolo-Fonini, Leila; Bodanese-Zanettini, Maria Helena; Margis-Pinheiro, Márcia

    2014-06-01

    Water deficiency decreases plant growth and productivity. Several mechanisms are activated in response to dehydration that allows plants to cope with stress, including factors controlling stomatal aperture and ramified root system development. In addition, ABA metabolism is also implicated in the regulation of drought responses. The basic helix-loop-helix (bHLH) proteins, a large family of conserved transcription factors that regulates many cellular processes in eukaryotic organisms, are also involved in several responses that are important for plants to cope with drought stress. This review discusses distinct mechanisms related to drought-adaptive responses, especially the possible involvement of the bHLH transcription factors such as MUTE, implicated in stomatal development; RD22, [corrected] an ABA-responsive gene; EGL3 and GL3, involved in thichome and root hair development; and SPT, which play roles in repressing leaf expansion. Transcription factors are potential targets for new strategies to increase the tolerance of cultivars to drought stress. Recognition of gene regulatory networks in crops is challenging, and the manipulation of bHLH genes as well as components that mediate bHLH transcription factor responses in different pathways could be essential to achieve abiotic stress tolerance in plants through genetic manipulation.

  5. Id Helix-Loop-Helix Proteins Antagonize Pax Transcription Factor Activity by Inhibiting DNA Binding

    PubMed Central

    Roberts, E. Claire; Deed, Richard W.; Inoue, Toshiaki; Norton, John D.; Sharrocks, Andrew D.

    2001-01-01

    The Id subfamily of helix-loop-helix (HLH) proteins plays a fundamental role in the regulation of cellular proliferation and differentiation. The major mechanism by which Id proteins are thought to inhibit differentiation is through interaction with other HLH proteins and inhibition of their DNA-binding activity. However, Id proteins have also been shown to interact with other proteins involved in regulating cellular proliferation and differentiation, suggesting a more widespread regulatory function. In this study we demonstrate functional interactions between Id proteins and members of the Pax-2/-5/-8 subfamily of paired-domain transcription factors. Members of the Pax transcription factor family have key functions in regulating several developmental processes exemplified by B lymphopoiesis, in which Pax-5 plays an essential role. Id proteins bind to Pax proteins in vitro and in vivo. Binding occurs through the paired DNA-binding domain of the Pax proteins and results in the disruption of DNA-bound complexes containing Pax-2, Pax-5, and Pax-8. In vivo, Id proteins modulate the transcriptional activity mediated by Pax-5 complexes on the B-cell-specific mb-1 promoter. Our results therefore demonstrate a novel facet of Id function in regulating cellular differentiation by functionally antagonizing the action of members of the Pax transcription factor family. PMID:11134340

  6. Modulation of basic helix-loop-helix transcription complex formation by Id proteins during neuronal differentiation.

    PubMed

    Jögi, Annika; Persson, Paula; Grynfeld, Anna; Påhlman, Sven; Axelson, Håkan

    2002-03-15

    It is assumed that the Id helix-loop-helix (HLH) proteins act by associating with ubiquitously expressed basic HLH (bHLH) transcription factors, such as E47 and E2-2, which prevents these factors from forming functional hetero- or homodimeric DNA binding complexes. Several tissue-specific bHLH proteins, including HASH-1, dHAND, and HES-1, are important for development of the nervous system. Neuroblastoma tumors are derived from the sympathetic nervous system and exhibit neural crest features. In differentiating neuroblastoma cells, HASH-1 is down-regulated, and there is coincident up-regulation of the transcriptional repressor HES-1, which is known to bind the HASH-1 promoter. We found that the three Id proteins expressed in neuroblastoma cells (Id1, Id2, and Id3) were down-regulated during induced differentiation, indicating that Id proteins help keep the tumor cells in an undifferentiated state. Studying interactions, we noted that all four Id proteins could dimerize with E47 or E2-2, but not with HASH-1 or dHAND. However, the Id proteins did complex with HES-1, and increased levels of Id2 reduced the DNA binding activity of HES-1. Furthermore, HES-1 interfered with Id2/E2-2 complex formation. The ability of Id proteins to affect HES-1 activity is of particular interest in neuronal cells, where regulation of HES-1 is essential for the timing of neuronal differentiation.

  7. The basic helix-loop-helix transcription factor, Mist1, induces maturation of mouse fetal hepatoblasts

    PubMed Central

    Chikada, Hiromi; Ito, Keiichi; Yanagida, Ayaka; Nakauchi, Hiromitsu; Kamiya, Akihide

    2015-01-01

    Hepatic stem/progenitor cells, hepatoblasts, have a high proliferative ability and can differentiate into mature hepatocytes and cholangiocytes. Therefore, these cells are considered to be useful for regenerative medicine and drug screening for liver diseases. However, it is problem that in vitro maturation of hepatoblasts is insufficient in the present culture system. In this study, a novel regulator to induce hepatic differentiation was identified and the molecular function of this factor was examined in embryonic day 13 hepatoblast culture with maturation factor, oncostatin M and extracellular matrices. Overexpression of the basic helix-loop-helix type transcription factor, Mist1, induced expression of mature hepatocytic markers such as carbamoyl-phosphate synthetase1 and several cytochrome P450 (CYP) genes in this culture system. In contrast, Mist1 suppressed expression of cholangiocytic markers such as Sox9, Sox17, Ck19, and Grhl2. CYP3A metabolic activity was significantly induced by Mist1 in this hepatoblast culture. In addition, Mist1 induced liver-enriched transcription factors, CCAAT/enhancer-binding protein α and Hepatocyte nuclear factor 1α, which are known to be involved in liver functions. These results suggest that Mist1 partially induces mature hepatocytic expression and function accompanied by the down-regulation of cholangiocytic markers. PMID:26456005

  8. Iron-binding E3 ligase mediates iron response in plants by targeting basic helix-loop-helix transcription factors.

    PubMed

    Selote, Devarshi; Samira, Rozalynne; Matthiadis, Anna; Gillikin, Jeffrey W; Long, Terri A

    2015-01-01

    Iron uptake and metabolism are tightly regulated in both plants and animals. In Arabidopsis (Arabidopsis thaliana), BRUTUS (BTS), which contains three hemerythrin (HHE) domains and a Really Interesting New Gene (RING) domain, interacts with basic helix-loop-helix transcription factors that are capable of forming heterodimers with POPEYE (PYE), a positive regulator of the iron deficiency response. BTS has been shown to have E3 ligase capacity and to play a role in root growth, rhizosphere acidification, and iron reductase activity in response to iron deprivation. To further characterize the function of this protein, we examined the expression pattern of recombinant ProBTS::β-GLUCURONIDASE and found that it is expressed in developing embryos and other reproductive tissues, corresponding with its apparent role in reproductive growth and development. Our findings also indicate that the interactions between BTS and PYE-like (PYEL) basic helix-loop-helix transcription factors occur within the nucleus and are dependent on the presence of the RING domain. We provide evidence that BTS facilitates 26S proteasome-mediated degradation of PYEL proteins in the absence of iron. We also determined that, upon binding iron at the HHE domains, BTS is destabilized and that this destabilization relies on specific residues within the HHE domains. This study reveals an important and unique mechanism for plant iron homeostasis whereby an E3 ubiquitin ligase may posttranslationally control components of the transcriptional regulatory network involved in the iron deficiency response.

  9. Specific Protein-Protein Interaction between Basic Helix-Loop-Helix Transcription Factors and Homeoproteins of the Pitx Family

    PubMed Central

    Poulin, Gino; Lebel, Mélanie; Chamberland, Michel; Paradis, Francois W.; Drouin, Jacques

    2000-01-01

    Homeoproteins and basic helix-loop-helix (bHLH) transcription factors are known for their critical role in development and cellular differentiation. The pituitary pro-opiomelanocortin (POMC) gene is a target for factors of both families. Indeed, pituitary-specific transcription of POMC depends on the action of the homeodomain-containing transcription factor Pitx1 and of bHLH heterodimers containing NeuroD1. We now show lineage-restricted expression of NeuroD1 in pituitary corticotroph cells and a direct physical interaction between bHLH heterodimers and Pitx1 that results in transcriptional synergism. The interaction between the bHLH and homeodomains is restricted to ubiquitous (class A) bHLH and to the Pitx subfamily. Since bHLH heterodimers interact with Pitx factors through their ubiquitous moiety, this mechanism may be implicated in other developmental processes involving bHLH factors, such as neurogenesis and myogenesis. PMID:10848608

  10. A genome-wide survey on basic helix-loop-helix transcription factors in giant panda.

    PubMed

    Dang, Chunwang; Wang, Yong; Zhang, Debao; Yao, Qin; Chen, Keping

    2011-01-01

    The giant panda (Ailuropoda melanoleuca) is a critically endangered mammalian species. Studies on functions of regulatory proteins involved in developmental processes would facilitate understanding of specific behavior in giant panda. The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including fruit fly, zebrafish, mouse and human. Our present study identified 107 bHLH family members being encoded in giant panda genome. Phylogenetic analyses revealed that they belong to 44 bHLH families with 46, 25, 15, 4, 11 and 3 members in group A, B, C, D, E and F, respectively, while the remaining 3 members were assigned into "orphan". Compared to mouse, the giant panda does not encode seven bHLH proteins namely Beta3a, Mesp2, Sclerax, S-Myc, Hes5 (or Hes6), EBF4 and Orphan 1. These results provide useful background information for future studies on structure and function of bHLH proteins in the regulation of giant panda development.

  11. Identification and Bioinformatics Analyses of the Basic Helix-loop-helix Transcription Factors in Xenopus laevis.

    PubMed

    Liu, Wuyi; Li, Fengmei

    2015-04-01

    Xenopus laevis is a long established model organism for developmental, behavioral and neurological studies. Herein, an updated genome-wide survey was conducted using the ongoing genome project of Xenopus laevis and 106 non-redundant Basic Helix-Loop-Helix (bHLH) genes were identified in the Xenopus laevis genome databases. Gene Ontology (GO) enrichment statistics showed 51 significant GO annotations of biological processes and molecular functions and 5 significant KEGG pathways and a number of Xenopus laevis bHLH genes play significant role in specific development or special physiology processes like the development processes of muscle and eye and other organs. Furthermore, each sub-group of the bHLH family has its special gene functions except for the common GO term categories. Molecular phylogenetic analyses revealed that among these identified bHLH proteins, 105 sequences could classified into 39 families with 46, 25, 10, 5, 16 and 3 members in the corresponding high-order groups A, B, C, D, E and F, respectively with an addition bHLH member categorized as an orphan. The present study provides much useful information for further researches on Xenopus laevis.

  12. Basic Helix-Loop-Helix Transcription Factor Gene Family Phylogenetics and Nomenclature

    PubMed Central

    Skinner, Michael K.; Rawls, Alan; Wilson-Rawls, Jeanne; Roalson, Eric H.

    2010-01-01

    A phylogenetic analysis of the basic helix-loop-helix (bHLH) gene superfamily was performed using seven different species (human, mouse, rat, worm, fly, yeast, and plant Arabidopsis) and involving over 600 bHLH genes [1]. All bHLH genes were identified in the genomes of the various species, including expressed sequence tags, and the entire coding sequence was used in the analysis. Nearly 15% of the gene family has been updated or added since the original publication. A super-tree involving six clades and all structural relationships was established and is now presented for four of the species. The wealth of functional data available for members of the bHLH gene superfamily provides us with the opportunity to use this exhaustive phylogenetic tree to predict potential functions of uncharacterized members of the family. This phylogenetic and genomic analysis of the bHLH gene family has revealed unique elements of the evolution and functional relationships of the different genes in the bHLH gene family. PMID:20219281

  13. A basic helix-loop-helix transcription factor, PhFBH4, regulates flower senescence by modulating ethylene biosynthesis pathway in petunia

    USDA-ARS?s Scientific Manuscript database

    The basic helix-loop-helix (bHLH) transcription factors (TFs) play important roles in regulating multiple biological processes in plants. However, there are few reports about the function of bHLHs in flower senescence. In this study, a bHLH TF, PhFBH4, was found to be dramatically upregulated during...

  14. Transcriptional synergy between LIM-homeodomain proteins and basic helix-loop-helix proteins: the LIM2 domain determines specificity.

    PubMed Central

    Johnson, J D; Zhang, W; Rudnick, A; Rutter, W J; German, M S

    1997-01-01

    LIM-homeodomain proteins direct cellular differentiation by activating transcription of cell-type-specific genes, but this activation requires cooperation with other nuclear factors. The LIM-homeodomain protein Lmx1 cooperates with the basic helix-loop-helix (bHLH) protein E47/Pan-1 to activate the insulin promoter in transfected fibroblasts. In this study, we show that two proteins originally called Lmx1 are the closely related products of two distinct vertebrate genes, Lmx1.1 and Lmx1.2. We have used yeast genetic systems to delineate the functional domains of the Lmx1 proteins and to characterize the physical interactions between Lmx1 proteins and E47/Pan-1 that produce synergistic transcriptional activation. The LIM domains of the Lmx1 proteins, and particularly the second LIM domain, mediate both specific physical interactions and transcriptional synergy with E47/Pan-1. The LIM domains of the LIM-homeodomain protein Isl-1, which cannot mediate transcriptional synergy with E47/Pan-1, do not interact with E47/Pan-1. In vitro studies demonstrate that the Lmx1.1 LIM2 domain interacts specifically with the bHLH domain of E47/Pan-1. These studies provide the basis for a model of the assembly of LIM-homeodomain-containing complexes on DNA elements that direct cell-type-restricted transcription in differentiated tissues. PMID:9199284

  15. Genome-wide features of neuroendocrine regulation in Drosophila by the basic helix-loop-helix transcription factor DIMMED

    PubMed Central

    Hadžić, Tarik; Park, Dongkook; Abruzzi, Katharine C.; Yang, Lin; Trigg, Jennifer S.; Rohs, Remo; Rosbash, Michael; Taghert, Paul H.

    2015-01-01

    Neuroendocrine (NE) cells use large dense core vesicles (LDCVs) to traffic, process, store and secrete neuropeptide hormones through the regulated secretory pathway. The dimmed (DIMM) basic helix-loop-helix transcription factor of Drosophila controls the level of regulated secretory activity in NE cells. To pursue its mechanisms, we have performed two independent genome-wide analyses of DIMM's activities: (i) in vivo chromatin immunoprecipitation (ChIP) to define genomic sites of DIMM occupancy and (ii) deep sequencing of purified DIMM neurons to characterize their transcriptional profile. By this combined approach, we showed that DIMM binds to conserved E-boxes in enhancers of 212 genes whose expression is enriched in DIMM-expressing NE cells. DIMM binds preferentially to certain E-boxes within first introns of specific gene isoforms. Statistical machine learning revealed that flanking regions of putative DIMM binding sites contribute to its DNA binding specificity. DIMM's transcriptional repertoire features at least 20 LDCV constituents. In addition, DIMM notably targets the pro-secretory transcription factor, creb-A, but significantly, DIMM does not target any neuropeptide genes. DIMM therefore prescribes the scale of secretory activity in NE neurons, by a systematic control of both proximal and distal points in the regulated secretory pathway. PMID:25634895

  16. The basic helix-loop-helix leucine zipper transcription factor Mitf is conserved in Drosophila and functions in eye development.

    PubMed Central

    Hallsson, Jón H; Haflidadóttir, Benedikta S; Stivers, Chad; Odenwald, Ward; Arnheiter, Heinz; Pignoni, Francesca; Steingrímsson, Eiríkur

    2004-01-01

    The MITF protein is a member of the MYC family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors and is most closely related to the TFE3, TFEC, and TFEB proteins. In the mouse, MITF is required for the development of several different cell types, including the retinal pigment epithelial (RPE) cells of the eye. In Mitf mutant mice, the presumptive RPE cells hyperproliferate, abnormally express the retinal transcriptional regulator Pax6, and form an ectopic neural retina. Here we report the structure of the Mitf gene in Drosophila and demonstrate expression during embryonic development and in the eye-antennal imaginal disc. In vitro, transcriptional regulation by Drosophila Mitf, like its mouse counterpart, is modified by the Eyeless (Drosophila Pax6) transcription factor. In vivo, targeted expression of wild-type or dominant-negative Drosophila Mitf results in developmental abnormalities reminiscent of Mitf function in mouse eye development. Our results suggest that the Mitf gene is the original member of the Mitf-Tfe subfamily of bHLH-Zip proteins and that its developmental function is at least partially conserved between vertebrates and invertebrates. These findings further support the common origin of the vertebrate and invertebrate eyes. PMID:15166150

  17. Phylogenetic analysis of basic helix-loop-helix transcription factors in the genome of a typical human-disease vector

    PubMed Central

    Chen, Meng-Yun; Dong, Ying; Chang, Rui-Xue; Ang, Qian-Qian; Zhang, Ran; Wu, Yan-Yan; Xu, Yi-Hui; Lu, Wen-Sheng; Zheng, Xiao-Dong

    2016-01-01

    Ixodes scapularis, the black-legged tick, is one of the most common human-disease vectors and transmits Borrelia species, such as B. burgdorferi, as well as Theileria microti, Anaplasma phagocytophilum, etc. As basic helix-loop-helix (bHLH) transcription factors have been recognized for many years as important regulators of various developmental processes, we performed phylogenetic analysis of the black-legged tick genome in order to identify the number and family of bHLH transcription factors. Because bHLH family members have been identified in many organisms, including silkworm and fruit fly, we were able to conduct this survey and identify 58 putative bHLH transcription factors. Phylogenetic analysis revealed that the black-legged tick has 26, 10, 9, 1, 9, and 1 member in groups A, B, C, D, E, and F, respectively, whereas two were orphan genes. This analysis also revealed that unlike silkworm and fruit fly, the black-legged tick has no Mesp, Mlx, or TF4 family members, but has one more MyoRb family member. The present study provides useful background information for future studies of the black-legged tick as a disease vector with the goal of prevention and treatment. PMID:27904685

  18. GLABRA2 Directly Suppresses Basic Helix-Loop-Helix Transcription Factor Genes with Diverse Functions in Root Hair Development

    PubMed Central

    Ohashi, Yohei; Kato, Mariko; Tsuge, Tomohiko; Aoyama, Takashi

    2015-01-01

    The Arabidopsis thaliana GLABRA2 (GL2) gene encodes a transcription factor involved in the cell differentiation of various epidermal tissues. During root hair pattern formation, GL2 suppresses root hair development in non-hair cells, acting as a node between the gene regulatory networks for cell fate determination and cell differentiation. Despite the importance of GL2 function, its molecular basis remains obscure because the GL2 target genes leading to the network for cell differentiation are unknown. We identified five basic helix-loop-helix (bHLH) transcription factor genes (ROOT HAIR DEFECTIVE6 [RHD6], RHD6-LIKE1 [RSL1], RSL2, Lj-RHL1-LIKE1 [LRL1], and LRL2) as GL2 direct targets using transcriptional and posttranslational induction systems. Chromatin immunoprecipitation analysis confirmed GL2 binding to upstream regions of these genes in planta. Reporter gene analyses showed that these genes are expressed in various stages of root hair development and are suppressed by GL2 in non-hair cells. GL2 promoter-driven GFP fusions of LRL1 and LRL2, but not those of the other bHLH proteins, conferred root hair development on non-hair cells. These results indicate that GL2 directly suppresses bHLH genes with diverse functions in root hair development. PMID:26486447

  19. The grape berry-specific basic helix-loop-helix transcription factor VvCEB1 affects cell size.

    PubMed

    Nicolas, Philippe; Lecourieux, David; Gomès, Eric; Delrot, Serge; Lecourieux, Fatma

    2013-02-01

    The development of fleshy fruits involves complex physiological and biochemical changes. After fertilization, fruit growth usually begins with cell division, continues with both cell division and expansion, allowing fruit set to occur, and ends with cell expansion only. In spite of the economical importance of grapevine, the molecular mechanisms controlling berry growth are not fully understood. The present work identified and characterized Vitis vinifera cell elongation bHLH protein (VvCEB1), a basic helix-loop-helix (bHLH) transcription factor controlling cell expansion in grape. VvCEB1 was expressed specifically in berry-expanding tissues with a maximum around veraison. The study of VvCEB1 promoter activity in tomato confirmed its specific fruit expression during the expansion phase. Overexpression of VvCEB1 in grape embryos showed that this protein stimulates cell expansion and affects the expression of genes involved in cell expansion, including genes of auxin metabolism and signalling. Taken together, these data show that VvCEB1 is a fruit-specific bHLH transcription factor involved in grape berry development.

  20. The Basic Helix-Loop-Helix Transcription Factor NEUROG3 Is Required for Development of the Human Endocrine Pancreas

    PubMed Central

    McGrath, Patrick S.; Watson, Carey L.; Ingram, Cameron; Helmrath, Michael A.

    2015-01-01

    Neurogenin3 (NEUROG3) is a basic helix-loop-helix transcription factor required for development of the endocrine pancreas in mice. In contrast, humans with NEUROG3 mutations are born with endocrine pancreas function, calling into question whether NEUROG3 is required for human endocrine pancreas development. To test this directly, we generated human embryonic stem cell (hESC) lines where both alleles of NEUROG3 were disrupted using CRISPR/Cas9-mediated gene targeting. NEUROG3−/− hESC lines efficiently formed pancreatic progenitors but lacked detectible NEUROG3 protein and did not form endocrine cells in vitro. Moreover, NEUROG3−/− hESC lines were unable to form mature pancreatic endocrine cells after engraftment of PDX1+/NKX6.1+ pancreatic progenitors into mice. In contrast, a 75–90% knockdown of NEUROG3 caused a reduction, but not a loss, of pancreatic endocrine cell development. We conclude that NEUROG3 is essential for endocrine pancreas development in humans and that as little as 10% NEUROG3 is sufficient for formation of pancreatic endocrine cells. PMID:25650326

  1. Basic helix-loop-helix transcription factor TCF21 is a downstream target of the male sex determining gene SRY.

    PubMed

    Bhandari, Ramji K; Sadler-Riggleman, Ingrid; Clement, Tracy M; Skinner, Michael K

    2011-01-01

    The cascade of molecular events involved in mammalian sex determination has been shown to involve the SRY gene, but specific downstream events have eluded researchers for decades. The current study identifies one of the first direct downstream targets of the male sex determining factor SRY as the basic-helix-loop-helix (bHLH) transcription factor TCF21. SRY was found to bind to the Tcf21 promoter and activate gene expression. Mutagenesis of SRY/SOX9 response elements in the Tcf21 promoter eliminated the actions of SRY. SRY was found to directly associate with the Tcf21 promoter SRY/SOX9 response elements in vivo during fetal rat testis development. TCF21 was found to promote an in vitro sex reversal of embryonic ovarian cells to induce precursor Sertoli cell differentiation. TCF21 and SRY had similar effects on the in vitro sex reversal gonadal cell transcriptomes. Therefore, SRY acts directly on the Tcf21 promoter to in part initiate a cascade of events associated with Sertoli cell differentiation and embryonic testis development.

  2. A genome-wide identification and analysis of basic helix-loop-helix transcription factors in cattle.

    PubMed

    Zhang, Debao; Li, Guanying; Wang, Yong

    2017-08-30

    Basic helix-loop-helix (BHLH) transcription factors comprise a large family of regulatory proteins and play critical roles in the developmental processes of higher organisms. Complete lists of BHLH family members have been identified in about 50 organisms, including fruit fly, zebrafish, mouse, giant panda, worm, yeast, rice and apple. Cattle, Bos taurus, is important for agriculture and animal nutrition, and is also a good model organism for health research. In the present study, 116 putative BHLHs were identified in the cattle genome. Phylogenetic analyses revealed that 111 Bos taurus BHLH (BtBHLH: Bos taurus BHLH) members belong to 44 families, with 48, 26, 16, 4, 13 and 4 members in group A, B, C, D, E and F respectively, and the remaining 5 BtBHLHs are orphan members. All of them were named and assigned into the corresponding BHLH families based on acceptable bootstrap values from in-group phylogenetic analyses with orthologous BHLHs from mouse and other mammalian species. A comparison between annotations deposited in the GenBank and KEGG databases with our analyses indicated that the annotations of 2 of the 116 BtBHLH members were inconsistent with our analytical results. Microarray evidence and expressed sequence tags of only 14 BtBHLH genes was now not available. Chromosomal locations of the BtBHLHs showed that the distribution of the BtBHLHs was uneven and some genes, e.g., BtOligo, BtHes and BtMyf6, may arise from gene duplication. The test of positive selection showed episodic positive selection occurs only in 5 families among the studied mammalian BHLHs. These results provide a solid basis for further studies on BHLH protein regulation of key growth and developmental processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Iron-Binding E3 Ligase Mediates Iron Response in Plants by Targeting Basic Helix-Loop-Helix Transcription Factors1[OPEN

    PubMed Central

    Selote, Devarshi; Samira, Rozalynne; Matthiadis, Anna; Gillikin, Jeffrey W.; Long, Terri A.

    2015-01-01

    Iron uptake and metabolism are tightly regulated in both plants and animals. In Arabidopsis (Arabidopsis thaliana), BRUTUS (BTS), which contains three hemerythrin (HHE) domains and a Really Interesting New Gene (RING) domain, interacts with basic helix-loop-helix transcription factors that are capable of forming heterodimers with POPEYE (PYE), a positive regulator of the iron deficiency response. BTS has been shown to have E3 ligase capacity and to play a role in root growth, rhizosphere acidification, and iron reductase activity in response to iron deprivation. To further characterize the function of this protein, we examined the expression pattern of recombinant ProBTS::β-GLUCURONIDASE and found that it is expressed in developing embryos and other reproductive tissues, corresponding with its apparent role in reproductive growth and development. Our findings also indicate that the interactions between BTS and PYE-like (PYEL) basic helix-loop-helix transcription factors occur within the nucleus and are dependent on the presence of the RING domain. We provide evidence that BTS facilitates 26S proteasome-mediated degradation of PYEL proteins in the absence of iron. We also determined that, upon binding iron at the HHE domains, BTS is destabilized and that this destabilization relies on specific residues within the HHE domains. This study reveals an important and unique mechanism for plant iron homeostasis whereby an E3 ubiquitin ligase may posttranslationally control components of the transcriptional regulatory network involved in the iron deficiency response. PMID:25452667

  4. The adenovirus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer.

    PubMed

    Gregor, P D; Sawadogo, M; Roeder, R G

    1990-10-01

    We isolated full-length cDNAs encoding the 43-kD form of human upstream stimulatory factor (USF), a cellular factor required for efficient transcription of the adenovirus major late (AdML) promoter in vitro. Sequence analysis showed USF to be a member of the c-myc-related family of DNA-binding proteins. Using proteins translated in vitro, we identified a DNA-binding domain near the carboxyl terminus, which includes both a helix-loop-helix motif and a leucine repeat. We show that USF interacts with its target DNA as a dimer. The leucine repeat is required for efficient DNA binding of the intact protein and for interactions between full-length and truncated USF proteins. Interestingly, it is not required for DNA binding of the isolated helix-loop-helix domain. The structure of different cDNA clones indicates that USF RNA is differentially spliced, and alternative exon usage may regulate the levels of functional USF protein.

  5. The activation domain of a basic helix-loop-helix protein is masked by repressor interaction with domains distinct from that required for transcription regulation.

    PubMed Central

    Jayaraman, P S; Hirst, K; Goding, C R

    1994-01-01

    While there are many examples of protein-protein interactions modulating the DNA-binding activity of transcription factors, little is known of the molecular mechanisms underlying the regulation of the transcription activation function. Using a two-hybrid system we show here that transcription repression of the basic domain/helix-loop-helix factor PHO4 is mediated by complex formation with the PHO80 repressor. In contrast to other systems, such as inhibition of GAL4 by GAL80 or of p53 by MDM2, where repression is mediated by direct interaction at regions overlapping the transcription activation domain, interaction with PHO80 involves two regions of PHO4 distinct from those involved in transcription activation or DNA-binding and dimerization. The possibility that repression of PHO4 by PHO80 may represent a general mechanism of transcription control, including regulation of the cell-type-specific transcription activation domain of c-Jun, is discussed. Images PMID:8187772

  6. Genome-wide DNA-binding specificity of PIL5, an Arabidopsis basic Helix-Loop-Helix (bHLH) transcription factor.

    PubMed

    Kang, Hyojin; Oh, Eunkyoo; Choi, Giltsu; Lee, Doheon

    2010-01-01

    PIL5 is a member of the basic Helix-Loop-Helix (bHLH) transcription factor superfamily. We previously showed that PIL5 binds to the G-box (CACGTG) motif with high affinity. However, since there are many randomly matched G-box motifs throughout the genome, other factors must account for the in-vivo PIL5 binding specificity. In this study, we investigated if in-vivo PIL5 binding sites can be explained by any other attributes extracted from various sources. Our results showed that PIL5 binding sites can be explained by attributes such as neighbouring motif composition, nucleosome density, DNA methylation and distance from transcription start site in addition to G-box.

  7. A genome-wide survey on basic helix-loop-helix transcription factors in rat and mouse.

    PubMed

    Zheng, Xiaodong; Zheng, X; Wang, Yong; Wang, Y; Yao, Qin; Yao, Q; Yang, Zhe; Yang, Z; Chen, Keping; Chen, K

    2009-04-01

    The basic helix-loop-helix (bHLH) proteins play essential roles in a wide range of developmental processes in higher organisms. bHLH family members have been identified in over 20 organisms, including nematode, fruit fly, and human. Our study identified 114 rat and 14 additional mouse bHLH members in rat and mouse genomes, respectively. Phylogenetic analyses revealed that both rat and mouse had 49, 26, 15, 4, 12, and 4 bHLH members in groups A, B, C, D, E, and F, respectively. Only the rat Mxi1 gene has two copies in the genome. All other rat bHLH genes and all mouse bHLH genes are single-copy genes. The chromosomal distribution pattern of mouse, rat, and human bHLH genes suggests the emergence of some bHLH genes through gene duplication, which probably happened at least before the divergence of vertebrates from invertebrates. The present study provides useful information for future studies using rat as a model animal for mammalian development.

  8. Dynamic Antagonism between Phytochromes and PIF Family Basic Helix-Loop-Helix Factors Induces Selective Reciprocal Responses to Light and Shade in a Rapidly Responsive Transcriptional Network in Arabidopsis

    USDA-ARS?s Scientific Manuscript database

    Plants respond to shade-modulated light signals via phytochrome (phy)-induced adaptive changes, termed shade avoidance. To examine the roles of Phytochrome-Interacting basic helix-loop-helix Factors, PIF1, 3, 4, and 5, in relaying such signals to the transcriptional network, we compared the shade-re...

  9. Transcriptome-wide analysis of basic helix-loop-helix transcription factors in Isatis indigotica and their methyl jasmonate responsive expression profiling.

    PubMed

    Zhang, Lei; Chen, Junfeng; Li, Qing; Chen, Wansheng

    2016-01-15

    Jasmonates (JAs) act as conserved elicitors of plant secondary metabolism. JAs perception triggers extensive transcriptional reprogramming leading to activation of the entire metabolic pathways. The family of basic helix-loop-helix (bHLH) transcription factors (TFs) has essential roles in JA signaling; however, little is known about their roles in regulation of secondary metabolites in Isatis indigotica. In this study, we identified 78 putative IibHLH sequences using the annotation of I. indigotica transcriptome. The identified proteins were characterized based on phylogenetic and conserved motif analyses. Using RNA sequencing, 16 IibHLHs showed significant positive response to MeJA (methyl jasmonate) at 1h, indicating their roles as early signaling events of JA-mediated transcriptional reprogramming. Ten IibHLHs presented co-expression pattern with biosynthetic pathway genes, suggesting their regulating role in secondary metabolite synthesis. These gene expression profiling data indicate that bHLHs can be used as candidate genes in molecular breeding programs to improve metabolite production in I. indigotica.

  10. Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.

    PubMed

    Schweizer, Fabian; Fernández-Calvo, Patricia; Zander, Mark; Diez-Diaz, Monica; Fonseca, Sandra; Glauser, Gaétan; Lewsey, Mathew G; Ecker, Joseph R; Solano, Roberto; Reymond, Philippe

    2013-08-01

    Arabidopsis thaliana plants fend off insect attack by constitutive and inducible production of toxic metabolites, such as glucosinolates (GSs). A triple mutant lacking MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that are known to additively control jasmonate-related defense responses, was shown to have a highly reduced expression of GS biosynthesis genes. The myc2 myc3 myc4 (myc234) triple mutant was almost completely devoid of GS and was extremely susceptible to the generalist herbivore Spodoptera littoralis. On the contrary, the specialist Pieris brassicae was unaffected by the presence of GS and preferred to feed on wild-type plants. In addition, lack of GS in myc234 drastically modified S. littoralis feeding behavior. Surprisingly, the expression of MYB factors known to regulate GS biosynthesis genes was not altered in myc234, suggesting that MYC2/MYC3/MYC4 are necessary for direct transcriptional activation of GS biosynthesis genes. To support this, chromatin immunoprecipitation analysis showed that MYC2 binds directly to the promoter of several GS biosynthesis genes in vivo. Furthermore, yeast two-hybrid and pull-down experiments indicated that MYC2/MYC3/MYC4 interact directly with GS-related MYBs. This specific MYC-MYB interaction plays a crucial role in the regulation of defense secondary metabolite production and underlines the importance of GS in shaping plant interactions with adapted and nonadapted herbivores.

  11. Tracheophytes Contain Conserved Orthologs of a Basic Helix-Loop-Helix Transcription Factor That Modulate ROOT HAIR SPECIFIC Genes[OPEN

    PubMed Central

    Cho, Hyun-Min

    2017-01-01

    ROOT HAIR SPECIFIC (RHS) genes, which contain the root hair-specific cis-element (RHE) in their regulatory regions, function in root hair morphogenesis. Here, we demonstrate that an Arabidopsis thaliana basic helix-loop-helix transcription factor, ROOT HAIR DEFECTVE SIX-LIKE4 (RSL4), directly binds to the RHE in vitro and in vivo, upregulates RHS genes, and stimulates root hair formation in Arabidopsis. Orthologs of RSL4 from a eudicot (poplar [Populus trichocarpa]), a monocot (rice [Oryza sativa]), and a lycophyte (Selaginella moellendorffii) each restored root hair growth in the Arabidopsis rsl4 mutant. In addition, the rice and S. moellendorffii RSL4 orthologs bound to the RHE in in vitro and in vivo assays. The RSL4 orthologous genes contain RHEs in their promoter regions, and RSL4 was able to bind to its own RHEs in vivo and amplify its own expression. This process likely provides a positive feedback loop for sustainable root hair growth. When RSL4 and its orthologs were expressed in cells in non-root-hair positions, they induced ectopic root hair growth, indicating that these genes are sufficient to specify root hair formation. Our results suggest that RSL4 mediates root hair formation by regulating RHS genes and that this mechanism is conserved throughout the tracheophyte (vascular plant) lineage. PMID:28087829

  12. A divalent ion is crucial in the structure and dominant-negative function of ID proteins, a class of helix-loop-helix transcription regulators.

    PubMed

    Wong, Marie Vivian; Jiang, Sizun; Palasingam, Paaventhan; Kolatkar, Prasanna R

    2012-01-01

    Inhibitors of DNA binding and differentiation (ID) proteins, a dominant-negative group of helix-loop-helix (HLH) transcription regulators, are well-characterized key players in cellular fate determination during development in mammals as well as Drosophila. Although not oncogenes themselves, their upregulation by various oncogenic proteins (such as Ras, Myc) and their inhibitory effects on cell cycle proteins (such as pRb) hint at their possible roles in tumorigenesis. Furthermore, their potency as inhibitors of cellular differentiation, through their heterodimerization with subsequent inactivation of the ubiquitous E proteins, suggest possible novel roles in engineering induced pluripotent stem cells (iPSCs). We present the high-resolution 2.1Å crystal structure of ID2 (HLH domain), coupled with novel biochemical insights in the presence of a divalent ion, possibly calcium (Ca2+), in the loop of ID proteins, which appear to be crucial for the structure and activity of ID proteins. These new insights will pave the way for new rational drug designs, in addition to current synthetic peptide options, against this potent player in tumorigenesis as well as more efficient ways for stem cells reprogramming.

  13. Helix-loop-helix transcription factors E12 and E47 are not essential for skeletal or cardiac myogenesis, erythropoiesis, chondrogenesis, or neurogenesis.

    PubMed Central

    Zhuang, Y; Kim, C G; Bartelmez, S; Cheng, P; Groudine, M; Weintraub, H

    1992-01-01

    E12 and E47 are two non-tissue-specific helix-loop-helix (HLH) transcription factors encoded by the E2A gene. Previous studies suggested that they are involved in regulation of differentiation in many tissue types including muscle, blood, and nerve through direct heterodimer interactions with tissue-specific HLH proteins. To gain further genetic insight into the functions of E12 and E47 during cell differentiation, we mutated both copies of the E2A gene in mouse embryonic stem (ES) cells and then tested the effect on differentiation in vitro. We find that the ES cells lacking functional E12 and E47 are capable of differentiating into both skeletal and cardiac muscle, erythrocytes, neurons, and cartilage that the same extent as wild-type cells. These results indicate that the E2A gene is not essential for differentiation of these cell types and suggest that redundant genes may control these developmental pathways. Images PMID:1465450

  14. A Genome-Wide Identification and Analysis of the Basic Helix-Loop-Helix Transcription Factors in Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Wan, Pin-Jun; Yuan, San-Yue; Wang, Wei-Xia; Chen, Xu; Lai, Feng-Xiang; Fu, Qiang

    2016-01-01

    The basic helix-loop-helix (bHLH) transcription factors in insects play essential roles in multiple developmental processes including neurogenesis, sterol metabolism, circadian rhythms, organogenesis and formation of olfactory sensory neurons. The identification and function analysis of bHLH family members of the most destructive insect pest of rice, Nilaparvata lugens, may provide novel tools for pest management. Here, a genome-wide survey for bHLH sequences identified 60 bHLH sequences (NlbHLHs) encoded in the draft genome of N. lugens. Phylogenetic analysis of the bHLH domains successfully classified these genes into 40 bHLH families in group A (25), B (14), C (10), D (1), E (8) and F (2). The number of NlbHLHs with introns is higher than many other insect species, and the average intron length is shorter than those of Acyrthosiphon pisum. High number of ortholog families of NlbHLHs was found suggesting functional conversation for these proteins. Compared to other insect species studied, N. lugens has the highest number of bHLH members. Furthermore, gene duplication events of SREBP, Kn(col), Tap, Delilah, Sim, Ato and Crp were found in N. lugens. In addition, a putative full set of NlbHLH genes is defined and compared with another insect species. Thus, our classification of these NlbHLH members provides a platform for further investigations of bHLH protein functions in the regulation of N. lugens, and of insects in general. PMID:27869716

  15. Molecular characterization of cold-responsive basic helix-loop-helix transcription factors MabHLHs that interact with MaICE1 in banana fruit.

    PubMed

    Peng, Huan-Huan; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye

    2013-11-01

    Basic helix-loop-helix (bHLH) transcription factors (TFs) are ubiquitously involved in the response of higher plants to various abiotic stresses. However, little is known about bHLH TFs involved in the cold stress response in economically important fruits. Here, five novel full-length bHLH genes, designated as MabHLH1-MabHLH5, were isolated and characterized from banana fruit. Gene expression profiles revealed that MabHLH1/2/4 were induced by cold stress and methyl jasmonate (MeJA) treatment. Transient assays in tobacco BY2 protoplasts showed that MabHLH1/2/4 promoters were activated by cold stress and MeJA treatments. Moreover, protein-protein interaction analysis demonstrated that MabHLH1/2/4 not only physically interacted with each other to form hetero-dimers in the nucleus, but also interacted with an important upstream component of cold signaling MaICE1, with different interaction domains at their N-terminus. These results indicate that banana fruit cold-responsive MabHLHs may form a big protein complex in the nucleus with MaICE1. Taken together, our findings advance our understanding of the possible involvement of bHLH TFs in the regulatory network of ICE-CBF cold signaling pathway.

  16. The grapevine basic helix-loop-helix (bHLH) transcription factor positively modulates CBF-pathway and confers tolerance to cold-stress in Arabidopsis.

    PubMed

    Xu, Weirong; Zhang, Ningbo; Jiao, Yuntong; Li, Ruimin; Xiao, Dongming; Wang, Zhenping

    2014-08-01

    Basic helix-loop-helix (bHLH)-type transcription factors play diverse roles in plant physiological response and stress-adaptive regulation network. Here, we identified one grapevine bHLH transcription factor from a cold-tolerant accession 'Heilongjiang seedling' of Chinese wild Vitis amurensis (VabHLH1) as a transcriptional activator involved in cold stress. We also compared with its counterpart from a cold-sensitive Vitis vinifera cv. Cabernet Sauvignon (VvbHLH1). These two putative proteins are characterized by the presence of the identically conserved regions of 54 amino acid residues of bHLH signature domain, and shared 99.1% amino acid identity, whereas several stress-related cis-regulatory elements located in both promoter regions differed in types and positions. Expressions of two bHLHs in grapevine leaves were induced by cold stress, but evidently differ between two grapevine genotypes upon cold exposure. Two grapevine bHLH proteins were exclusively localized to the nucleus and exhibited strong transcriptional activation activities in yeast cells. Overexpression of either VabHLH1 or VvbHLH1 transcription factor did not affect the growth and development of transgenic Arabidopsis plants, but enhanced tolerance to cold stress. The improved tolerance in VabHLH1- or VvbHLH1-overexpressing Arabidopsis plants is associated with multiple physiological and biochemical changes that occurred during the time-course cold stress. These most common changes include the evaluated levels of proline, decreased amounts of malondialdehyde and reduced membrane injury as reflected by electrolyte leakage. VabHLH1 and VvbHLH1 displayed overlapping, but not identical, roles in activating the corresponding CBF cold signaling pathway, especially in regulating the expression of CBF3 and RD29A. Our findings demonstrated that two grapevine bHLHs act as positive regulators of the cold stress response, modulating the level of COR gene expression, which in turn confer tolerance to cold

  17. Basic helix-loop-helix transcription factor Bmsage is involved in regulation of fibroin H-chain gene via interaction with SGF1 in Bombyx mori.

    PubMed

    Zhao, Xiao-Ming; Liu, Chun; Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You

    2014-01-01

    Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix-loop-helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells.

  18. The poplar basic helix-loop-helix transcription factor BEE3 - Like gene affects biomass production by enhancing proliferation of xylem cells in poplar.

    PubMed

    Noh, Seol Ah; Choi, Young-Im; Cho, Jin-Seong; Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems.

  19. The poplar basic helix-loop-helix transcription factor BEE3 – Like gene affects biomass production by enhancing proliferation of xylem cells in poplar

    SciTech Connect

    Noh, Seol Ah Choi, Young-Im Cho, Jin-Seong Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems. - Highlights: • We identify the BEE3-like gene form hybrid poplar (Populus alba × Populus glandulosa). • We examine effects of overexpression of PagBEE3L on growth in poplar. • We found that 35S:BEE3L transgenic plants showed more rapid growth than wild-type plants. • BEE3L protein plays an important role in the development of plant stem.

  20. Basic helix-loop-helix transcription factor BcbHLHpol functions as a positive regulator of pollen development in non-heading Chinese cabbage.

    PubMed

    Liu, Tongkun; Li, Ying; Zhang, Changwei; Duan, Weike; Huang, Feiyi; Hou, Xilin

    2014-12-01

    Cytoplasmic male sterility (CMS) is a common trait in higher plants, and several transcription factors regulate pollen development. Previously, we obtained a basic helix-loop-helix transcription factor, BcbHLHpol, via suppression subtractive hybridization in non-heading Chinese cabbage. However, the regulatory function of BcbHLHpol during anther and pollen development remains unclear. In this study, BcbHLHpol was cloned, and its tissue-specific expression profile was analyzed. The results of real-time polymerase chain reaction showed that BcbHLHpol was highly expressed in maintainer buds and that the transcripts of BcbHLHpol significantly decreased in the buds of pol CMS. A virus-induced gene silencing vector that targets BcbHLHpol was constructed and transformed into Brassica campestris plants to further explore the function of BcbHLHpol. Male sterility and short stature were observed in BcbHLHpol-silenced plants. The degradation of tapetal cells was inhibited in BcbHLHpol-silenced plants, and nutrients were insufficiently supplied to the microspore. These phenomena resulted in pollen abortion. This result indicates that BcbHLHpol functions as a positive regulator in pollen development. Yeast two-hybrid and bimolecular fluorescence complementation assays revealed that BcbHLHpol interacted with BcSKP1 in the nucleus. This finding suggests that BcbHLHpol and BcSKP1 are positive coordinating regulators of pollen development. Quantitative real-time PCR indicated that BcbHLHpol and BcSKP1 can be induced at low temperatures. Thus, we propose that BcbHLHpol is necessary for meiosis. This study provides insights into the regulatory functions of the BcbHLHpol network during anther development.

  1. Transcription enhancer factor 1 interacts with a basic helix-loop-helix zipper protein, Max, for positive regulation of cardiac alpha-myosin heavy-chain gene expression.

    PubMed Central

    Gupta, M P; Amin, C S; Gupta, M; Hay, N; Zak, R

    1997-01-01

    The M-CAT binding factor transcription enhancer factor 1 (TEF-1) has been implicated in the regulation of several cardiac and skeletal muscle genes. Previously, we identified an E-box-M-CAT hybrid (EM) motif that is responsible for the basal and cyclic AMP-inducible expression of the rat cardiac alpha-myosin heavy chain (alpha-MHC) gene in cardiac myocytes. In this study, we report that two factors, TEF-1 and a basic helix-loop-helix leucine zipper protein, Max, bind to the alpha-MHC EM motif. We also found that Max was a part of the cardiac troponin T M-CAT-TEF-1 complex even when the DNA template did not contain an apparent E-box binding site. In the protein-protein interaction assay, a stable association of Max with TEF-1 was observed when glutathione S-transferase (GST)-TEF-1 or GST-Max was used to pull down in vitro-translated Max or TEF-1, respectively. In addition, Max was coimmunoprecipitated with TEF-1, thus documenting an in vivo TEF-1-Max interaction. In the transient transcription assay, overexpression of either Max or TEF-1 resulted a mild activation of the alpha-MHC-chloramphenicol acetyltransferase (CAT) reporter gene at lower concentrations and repression of this gene at higher concentrations. However, when Max and TEF-1 expression plasmids were transfected together, the repression mediated by a single expression plasmid was alleviated and a three- to fourfold transactivation of the alpha-MHC-CAT reporter gene was observed. This effect was abolished once the EM motif in the promoter-reporter construct was mutated, thus suggesting that the synergistic transactivation function of the TEF-1-Max heterotypic complex is mediated through binding of the complex to the EM motif. These results demonstrate a novel association between Max and TEF-1 and indicate a positive cooperation between these two factors in alpha-MHC gene regulation. PMID:9199327

  2. The cold-induced basic helix-loop-helix transcription factor gene MdCIbHLH1 encodes an ICE-like protein in apple

    PubMed Central

    2012-01-01

    Background Plant growth is greatly affected by low temperatures, and the expression of a number of genes is induced by cold stress. Although many genes in the cold signaling pathway have been identified in Arabidopsis, little is known about the transcription factors involved in the cold stress response in apple. Results Here, we show that the apple bHLH (basic helix-loop-helix) gene MdCIbHLH1 (Cold-Induced bHLH1), which encodes an ICE-like protein, was noticeably induced in response to cold stress. The MdCIbHLH1 protein specifically bound to the MYC recognition sequences in the AtCBF3 promoter, and MdCIbHLH1 overexpression enhanced cold tolerance in transgenic Arabidopsis. In addition, the MdCIbHLH1 protein bound to the promoters of MdCBF2 and favorably contributed to cold tolerance in transgenic apple plants by upregulating the expression of MdCBF2 through the CBF (C-repeat-binding factor) pathway. Our findings indicate that MdCIbHLH1 functions in stress tolerance in different species. For example, ectopic MdCIbHLH1 expression conferred enhanced chilling tolerance in transgenic tobacco. Finally, we observed that cold induces the degradation of the MdCIbHLH1 protein in apple and that this degradation was potentially mediated by ubiquitination and sumoylation. Conclusions Based on these findings, MdCIbHLH1 encodes a transcription factor that is important for the cold tolerance response in apple. PMID:22336381

  3. Genome-wide identification, classification, and functional analysis of the basic helix-loop-helix transcription factors in the cattle, Bos Taurus.

    PubMed

    Li, Fengmei; Liu, Wuyi

    2017-06-01

    The basic helix-loop-helix (bHLH) transcription factors (TFs) form a huge superfamily and play crucial roles in many essential developmental, genetic, and physiological-biochemical processes of eukaryotes. In total, 109 putative bHLH TFs were identified and categorized successfully in the genomic databases of cattle, Bos Taurus, after removing redundant sequences and merging genetic isoforms. Through phylogenetic analyses, 105 proteins among these bHLH TFs were classified into 44 families with 46, 25, 14, 3, 13, and 4 members in the high-order groups A, B, C, D, E, and F, respectively. The remaining 4 bHLH proteins were sorted out as 'orphans.' Next, these 109 putative bHLH proteins identified were further characterized as significantly enriched in 524 significant Gene Ontology (GO) annotations (corrected P value ≤ 0.05) and 21 significantly enriched pathways (corrected P value ≤ 0.05) that had been mapped by the web server KOBAS 2.0. Furthermore, 95 bHLH proteins were further screened and analyzed together with two uncharacterized proteins in the STRING online database to reconstruct the protein-protein interaction network of cattle bHLH TFs. Ultimately, 89 bHLH proteins were fully mapped in a network with 67 biological process, 13 molecular functions, 5 KEGG pathways, 12 PFAM protein domains, and 25 INTERPRO classified protein domains and features. These results provide much useful information and a good reference for further functional investigations and updated researches on cattle bHLH TFs.

  4. Clade IVa Basic Helix-Loop-Helix Transcription Factors Form Part of a Conserved Jasmonate Signaling Circuit for the Regulation of Bioactive Plant Terpenoid Biosynthesis.

    PubMed

    Mertens, Jan; Van Moerkercke, Alex; Vanden Bossche, Robin; Pollier, Jacob; Goossens, Alain

    2016-12-01

    Plants produce many bioactive, specialized metabolites to defend themselves when facing various stress situations. Their biosynthesis is directed by a tightly controlled regulatory circuit that is elicited by phytohormones such as jasmonate (JA). The basic helix-loop-helix (bHLH) transcription factors (TFs) bHLH iridoid synthesis 1 (BIS1) and Triterpene Saponin Activating Regulator (TSAR) 1 and 2, from Catharanthus roseus and Medicago truncatula, respectively, all belong to clade IVa of the bHLH protein family and activate distinct terpenoid pathways, thereby mediating monoterpenoid indole alkaloid (MIA) and triterpene saponin (TS) accumulation, respectively, in these two species. In this study, we report that promoters of the genes encoding the enzymes involved in the specific terpenoid pathway of one of these species can be transactivated by the orthologous bHLH factor from the other species through recognition of the same cis-regulatory elements. Accordingly, ectopic expression of CrBIS1 in M. truncatula hairy roots up-regulated the expression of all genes required for soyasaponin production, resulting in strongly increased levels of soyasaponins in the transformed roots. Likewise, transient expression of MtTSAR1 and MtTSAR2 in C. roseus petals led to up-regulation of the genes involved in the iridoid branch of the MIA pathway. Together, our data illustrate the functional similarity of these JA-inducible TFs and indicate that recruitment of defined cis-regulatory elements constitutes an important aspect of the evolution of conserved regulatory modules for the activation of species-specific terpenoid biosynthesis pathways by common signals such as the JA phytohormones.

  5. The basic helix-loop-helix transcription factors dHAND and eHAND exhibit dimerization characteristics that suggest complex regulation of function.

    PubMed

    Firulli, B A; Hadzic, D B; McDaid, J R; Firulli, A B

    2000-10-27

    dHAND and eHAND are basic helix-loop-helix (bHLH) transcription factors expressed during embryogenesis and are required for the proper development of cardiac and extraembryonic tissues. HAND genes, like the myogenic bHLH genes, are classified as class B bHLH genes, which are expressed in a tissue-restricted pattern and function by forming heterodimers with class A bHLH proteins. Myogenic bHLH genes are shown not to form homodimers efficiently, suggesting that their activity is dependent on their E-protein partners. To identify HIPs (HAND-interacting proteins) that regulate the activity of the HAND genes, we screened an 9.5-10.5-day-old mouse embryonic yeast two-hybrid library with eHAND. Several HIPs held high sequence identity to eHAND, indicating that eHAND could form and function as a homodimer. Based on the high degree of amino acid identity between eHAND and dHAND, it is possible that dHAND could also form homodimers and heterodimers with eHAND. We show using yeast and mammalian two-hybrid assays as well as biochemical pull-down assays that eHAND and dHAND are capable of forming both HAND homo- and heterodimers in vivo. To investigate whether HAND genes form heterodimers with other biologically relevant bHLH proteins, we tested and show HAND heterodimerization with the recently identified Hairy-related transcription factors, HRT1-3. This finding is exciting, because both HRT and HAND genes are coexpressed in the developing heart and limb and both have been implicated in establishing tissue boundaries and pattern formation. Moreover, competition gel shift analysis demonstrates that dHAND and eHAND can negatively regulate the DNA binding of MyoD/E12 heterodimers in a manner similar to MISTI and Id proteins, suggesting a possible transcriptional inhibitory role for HAND genes. Taken together, these results show that dHAND and eHAND can form homo- and heterodimer combinations with multiple bHLH partners and that this broad dimerization profile reflects the

  6. Basic Helix-Loop-Helix Transcription Factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 Are Negative Regulators of Jasmonate Responses in Arabidopsis1[W][OPEN

    PubMed Central

    Sasaki-Sekimoto, Yuko; Jikumaru, Yusuke; Obayashi, Takeshi; Saito, Hikaru; Masuda, Shinji; Kamiya, Yuji; Ohta, Hiroyuki; Shirasu, Ken

    2013-01-01

    Jasmonates regulate transcriptional reprogramming during growth, development, and defense responses. Jasmonoyl-isoleucine, an amino acid conjugate of jasmonic acid (JA), is perceived by the protein complex composed of the F-box protein CORONATINE INSENSITIVE1 (COI1) and JASMONATE ZIM DOMAIN (JAZ) proteins, leading to the ubiquitin-dependent degradation of JAZ proteins. This activates basic helix-loop-helix-type MYC transcription factors to regulate JA-responsive genes. Here, we show that the expression of genes encoding other basic helix-loop-helix transcription factors, JASMONATE ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3, is positively regulated in a COI1- and MYC2-dependent manner in Arabidopsis (Arabidopsis thaliana). However, contrary to myc2, the jam1jam2jam3 triple mutant exhibited shorter roots when treated with methyl jasmonate (MJ), indicating enhanced responsiveness to JA. Our genome-wide expression analyses revealed that key jasmonate metabolic genes as well as a set of genes encoding transcription factors that regulate the JA-responsive metabolic genes are negatively regulated by JAMs after MJ treatment. Consistently, loss of JAM genes resulted in higher accumulation of anthocyanin in MJ-treated plants as well as higher accumulation of JA and 12-hydroxyjasmonic acid in wounded plants. These results show that JAMs negatively regulate the JA responses in a manner that is mostly antagonistic to MYC2. PMID:23852442

  7. Basic helix-loop-helix transcription factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 are negative regulators of jasmonate responses in Arabidopsis.

    PubMed

    Sasaki-Sekimoto, Yuko; Jikumaru, Yusuke; Obayashi, Takeshi; Saito, Hikaru; Masuda, Shinji; Kamiya, Yuji; Ohta, Hiroyuki; Shirasu, Ken

    2013-09-01

    Jasmonates regulate transcriptional reprogramming during growth, development, and defense responses. Jasmonoyl-isoleucine, an amino acid conjugate of jasmonic acid (JA), is perceived by the protein complex composed of the F-box protein CORONATINE INSENSITIVE1 (COI1) and JASMONATE ZIM DOMAIN (JAZ) proteins, leading to the ubiquitin-dependent degradation of JAZ proteins. This activates basic helix-loop-helix-type MYC transcription factors to regulate JA-responsive genes. Here, we show that the expression of genes encoding other basic helix-loop-helix transcription factors, JASMONATE ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3, is positively regulated in a COI1- and MYC2-dependent manner in Arabidopsis (Arabidopsis thaliana). However, contrary to myc2, the jam1jam2jam3 triple mutant exhibited shorter roots when treated with methyl jasmonate (MJ), indicating enhanced responsiveness to JA. Our genome-wide expression analyses revealed that key jasmonate metabolic genes as well as a set of genes encoding transcription factors that regulate the JA-responsive metabolic genes are negatively regulated by JAMs after MJ treatment. Consistently, loss of JAM genes resulted in higher accumulation of anthocyanin in MJ-treated plants as well as higher accumulation of JA and 12-hydroxyjasmonic acid in wounded plants. These results show that JAMs negatively regulate the JA responses in a manner that is mostly antagonistic to MYC2.

  8. Regulatory switch enforced by basic helix-loop-helix and ACT-domain mediated dimerizations of the maize transcription factor R.

    PubMed

    Kong, Que; Pattanaik, Sitakanta; Feller, Antje; Werkman, Joshua R; Chai, Chenglin; Wang, Yongqin; Grotewold, Erich; Yuan, Ling

    2012-07-24

    The maize R2R3-MYB regulator C1 cooperates with the basic helix-loop-helix (bHLH) factor R to activate the expression of anthocyanin biosynthetic genes coordinately. As is the case for other bHLH factors, R harbors several protein-protein interaction domains. Here we show that not the classical but rather a briefly extended R bHLH region forms homodimers that bind canonical G-box DNA motifs. This bHLH DNA-binding activity is abolished if the C-terminal ACT (aspartokinase, chorismate, and TyrA) domain is licensed to homodimerize. Then the bHLH remains in the monomeric form, allowing it to interact with R-interacting factor 1 (RIF1). In this configuration, the R-RIF1 complex is recruited to the promoters of a subset of anthocyanin biosynthetic genes, such as A1, through the interaction with its MYB partner C1. If, however, the ACT domain remains monomeric, the bHLH region dimerizes and binds to G-boxes present in several anthocyanin genes, such as Bz1. Our results provide a mechanism by which a dimerization domain in a bHLH factor behaves as a switch that permits distinct configurations of a regulatory complex to be tethered to different promoters. Such a combinatorial gene regulatory framework provides one mechanism by which genes lacking obviously conserved cis-regulatory elements are regulated coordinately.

  9. Proprotein convertase PACE4 is down-regulated by the basic helix-loop-helix transcription factor hASH-1 and MASH-1.

    PubMed

    Yoshida, I; Koide, S; Hasegawa, S I; Nakagawara, A; Tsuji, A; Matsuda, Y

    2001-12-15

    PACE4 is a mammalian subtilisin-like proprotein convertase that activates transforming growth factor (TGF)-beta-related proteins such as bone morphogenetic protein 2 (BMP2), BMP4 and Nodal and exhibits a dynamic expression pattern during embryogenesis. We recently determined that the 1 kb 5'-upstream region of the PACE4 gene contains 12 E-box (E1-E12) elements and that an E-box cluster (E4-E9) acts as a negative regulator [Tsuji, Yoshida, Hasegawa, Bando, Yoshida, Koide, Mori and Matsuda (1999) J. Biochem. (Tokyo) 126, 494-502]. It is known that the mammalian achaete-scute homologue 1 (MASH-1) binds specifically to an E-box (CACCTG) sequence in collaboration with E47, a ubiquitously expressed basic helix-loop-helix (bHLH) factor. To identify the roles of the bHLH factor and E-box elements in regulating PACE4 gene expression in neural development, we analysed the effects of human achaete-scute homologue 1 (hASH-1) on PACE4 gene expression with various neuroblastoma cell lines. The expressions of PACE4 and hASH-1 are correlated inversely in these cell lines. The overexpression of hASH-1 or MASH-1 causes a marked decrease in endogenous PACE4 gene expression but has no effect on the expression of other subtilisin-like proprotein convertases such as furin, PC5/6 and PC7/8. In contrast, other neural bHLH factors (MATH-1, MATH-2, neurogenin 1, neurogenin 2, neurogenin 3 and E47) did not affect PACE4 gene expression. Furthermore, an E-box cluster was a negative regulatory element for the promoter activity in NBL-S cells expressing hASH-1 at high level as determined by a luciferase assay. Binding of hASH-1 to the E-box cluster was confirmed by gel mobility-shift assay. In the present study we identified the PACE4 gene as one of the targets of hASH-1, which is a key factor in the initiation of neural differentiation. These results suggest that the alteration of PACE4 gene expression by hASH-1 causes rapid changes in the biological activities of TGF-beta-related proteins via

  10. Specificity for the hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression.

    PubMed

    Dawson, S R; Turner, D L; Weintraub, H; Parkhurst, S M

    1995-12-01

    The Hairy/Enhancer of split/Deadpan family of basic helix-loop-helix (bHLH) proteins function as transcriptional repressors. We have examined the mechanisms of repression used by the Hairy and E(SPL) proteins by assaying the antagonism between wild-type or altered Hairy/E(SPL) and Scute bHLH proteins during sex determination in Drosophila melanogaster. Domain swapping and mutagenesis of the Hairy and E(SPL) proteins show that three evolutionarily conserved domains are required for their function: the bHLH, Orange, and WRPW domains. However, the suppression of Scute activity by Hairy does not require the WRPW domain. We show that the Orange domain is an important functional domain that confers specificity among members of the Hairy/E(SPL) family. In addition, we show that a Xenopus Hairy homology conserves not only Hairy's structure but also its biological activity in our assays. We propose that transcriptional repression by the Hairy/E(SPL) family of bHLH proteins involves two separable mechanisms: repression of specific transcriptional activators, such as Scute, through the bHLH and Orange domains and repression of other activators via interaction of the C-terminal WRPW motif with corepressors, such as the Groucho protein.

  11. The Neurogenic Basic Helix-Loop-Helix Transcription Factor NeuroD6 Enhances Mitochondrial Biogenesis and Bioenergetics to Confer Tolerance of Neuronal PC12-NeuroD6 Cells to the Mitochondrial Stressor Rotenone

    PubMed Central

    Baxter, Kristin Kathleen; Uittenbogaard, Martine; Chiaramello, Anne

    2012-01-01

    The fundamental question of how and which neuronal specific transcription factors tailor mitochondrial bioenergetics to the need of developing neuronal cells has remained largely unexplored. In this study, we report that the neurogenic basic helix-loop-helix transcription factor NeuroD6 possesses mitochondrial biogenic properties by amplifying the mitochondrial DNA content and TFAM expression levels, a key regulator for mitochondrial biogenesis. NeuroD6-mediated increase in mitochondrial biogenesis in the neuronal progenitor-like PC12-NEUROD6 cells is concomitant with enhanced mitochondrial bioenergetic functions, including increased expression levels of specific subunits of respiratory complexes of the electron transport chain, elevated mitochondrial membrane potential and ATP levels produced by oxidative phosphorylation. Thus, NeuroD6 augments the bioenergetic capacity of PC12-NEUROD6 cells to generate an energetic reserve, which confers tolerance to the mitochondrial stressor, rotenone. We found that NeuroD6 induces an adaptive bioenergetic response throughout rotenone treatment involving maintenance of the mitochondrial membrane potential and ATP levels in conjunction with preservation of the actin network. In conclusion, our results support the concept that NeuroD6 plays an integrative role in regulating and coordinating the onset of neuronal differentiation with acquisition of adequate mitochondrial mass and energetic capacity to ensure energy demanding events, such as cytoskeletal remodeling, plasmalemmal expansion, and growth cone formation. PMID:22814253

  12. Overexpression of OrbHLH001, a putative helix-loop-helix transcription factor, causes increased expression of AKT1 and maintains ionic balance under salt stress in rice.

    PubMed

    Chen, Yuan; Li, Fei; Ma, Yan; Chong, Kang; Xu, Yunyuan

    2013-01-01

    The basic helix-loop-helix family of proteins, which function as transcription factors, have been intensively studied in plants and animals. However, the molecular mechanism of these factors contributing to stress tolerance is unknown. Here, we report on the overexpression of OrbHLH001 from Dongxiang wild rice (Oryza rufipogon) conferring salt tolerance in transgenic rice plants. The expression of OrbHLH001 was tissue specific, mainly in phloem tissues throughout the plant. Ion assay with the scanning ion-selective electrode technique showed that NaCl stress has a greater influence on Na(+) efflux and K(+) influx in OrbHLH001-overexpressed plants than the wild type. OrbHLH001 protein can induce the expression of OsAKT1 to regulate the Na(+)/K(+) ratio in OrbHLH001-overexpressed plants by specifically binding to an E-box motif in the promoter region of OsAKT1. The mechanism may have potential use in rice molecular breeding. Copyright © 2012 Elsevier GmbH. All rights reserved.

  13. Dynamic antagonism between phytochromes and PIF family basic helix-loop-helix factors induces selective reciprocal responses to light and shade in a rapidly responsive transcriptional network in Arabidopsis.

    PubMed

    Leivar, Pablo; Tepperman, James M; Cohn, Megan M; Monte, Elena; Al-Sady, Bassem; Erickson, Erika; Quail, Peter H

    2012-04-01

    Plants respond to shade-modulated light signals via phytochrome (phy)-induced adaptive changes, termed shade avoidance. To examine the roles of Phytochrome-Interacting basic helix-loop-helix Factors, PIF1, 3, 4, and 5, in relaying such signals to the transcriptional network, we compared the shade-responsive transcriptome profiles of wild-type and quadruple pif (pifq) mutants. We identify a subset of genes, enriched in transcription factor-encoding loci, that respond rapidly to shade, in a PIF-dependent manner, and contain promoter G-box motifs, known to bind PIFs. These genes are potential direct targets of phy-PIF signaling that regulate the primary downstream transcriptional circuitry. A second subset of PIF-dependent, early response genes, lacking G-box motifs, are enriched for auxin-responsive loci, and are thus potentially indirect targets of phy-PIF signaling, mediating the rapid cell expansion induced by shade. Comparing deetiolation- and shade-responsive transcriptomes identifies another subset of G-box-containing genes that reciprocally display rapid repression and induction in response to light and shade signals. These data define a core set of transcriptional and hormonal processes that appear to be dynamically poised to react rapidly to light-environment changes via perturbations in the mutually antagonistic actions of the phys and PIFs. Comparing the responsiveness of the pifq and triple pif mutants to light and shade confirms that the PIFs act with overlapping redundancy on seedling morphogenesis and transcriptional regulation but that each PIF contributes differentially to these responses.

  14. The neurogenic basic helix-loop-helix transcription factor NeuroD6 enhances mitochondrial biogenesis and bioenergetics to confer tolerance of neuronal PC12-NeuroD6 cells to the mitochondrial stressor rotenone

    SciTech Connect

    Baxter, Kristin Kathleen; Uittenbogaard, Martine; Chiaramello, Anne

    2012-10-15

    The fundamental question of how and which neuronal specific transcription factors tailor mitochondrial biogenesis and bioenergetics to the need of developing neuronal cells has remained largely unexplored. In this study, we report that the neurogenic basic helix-loop-helix transcription factor NeuroD6 possesses mitochondrial biogenic properties by amplifying the mitochondrial DNA content and TFAM expression levels, a key regulator for mitochondrial biogenesis. NeuroD6-mediated increase in mitochondrial biogenesis in the neuronal progenitor-like PC12-NEUROD6 cells is concomitant with enhanced mitochondrial bioenergetic functions, including increased expression levels of specific subunits of respiratory complexes of the electron transport chain, elevated mitochondrial membrane potential and ATP levels produced by oxidative phosphorylation. Thus, NeuroD6 augments the bioenergetic capacity of PC12-NEUROD6 cells to generate an energetic reserve, which confers tolerance to the mitochondrial stressor, rotenone. We found that NeuroD6 induces an adaptive bioenergetic response throughout rotenone treatment involving maintenance of the mitochondrial membrane potential and ATP levels in conjunction with preservation of the actin network. In conclusion, our results support the concept that NeuroD6 plays an integrative role in regulating and coordinating the onset of neuronal differentiation with acquisition of adequate mitochondrial mass and energetic capacity to ensure energy demanding events, such as cytoskeletal remodeling, plasmalemmal expansion, and growth cone formation. -- Highlights: Black-Right-Pointing-Pointer NeuroD6 induces mitochondrial biogenesis in neuroprogenitor-like cells. Black-Right-Pointing-Pointer NeuroD6 augments the bioenergetic reserve of the neuronal PC12-NeuroD6 cells. Black-Right-Pointing-Pointer NeuroD6 increases the mitochondrial membrane potential and ATP levels. Black-Right-Pointing-Pointer NeuroD6 confers tolerance to rotenone via an adaptive

  15. A Basic Helix-Loop-Helix Transcription Factor, PtrbHLH, of Poncirus trifoliata Confers Cold Tolerance and Modulates Peroxidase-Mediated Scavenging of Hydrogen Peroxide1[C][W

    PubMed Central

    Huang, Xiao-San; Wang, Wei; Zhang, Qian; Liu, Ji-Hong

    2013-01-01

    The basic helix-loop-helix (bHLH) transcription factors are involved in a variety of physiological processes. However, plant bHLHs functioning in cold tolerance and the underlying mechanisms remain poorly understood. Here, we report the identification and functional characterization of PtrbHLH isolated from trifoliate orange (Poncirus trifoliata). The transcript levels of PtrbHLH were up-regulated under various abiotic stresses, particularly cold. PtrbHLH was localized in the nucleus with transactivation activity. Overexpression of PtrbHLH in tobacco (Nicotiana tabacum) or lemon (Citrus limon) conferred enhanced tolerance to cold under chilling or freezing temperatures, whereas down-regulation of PtrbHLH in trifoliate orange by RNA interference (RNAi) resulted in elevated cold sensitivity. A range of stress-responsive genes was up-regulated or down-regulated in the transgenic lemon. Of special note, several peroxidase (POD) genes were induced after cold treatment. Compared with the wild type, POD activity was increased in the overexpression plants but decreased in the RNAi plants, which was inversely correlated with the hydrogen peroxide (H2O2) levels in the tested lines. Treatment of the transgenic tobacco plants with POD inhibitors elevated the H2O2 levels and greatly compromised their cold tolerance, while exogenous replenishment of POD enhanced cold tolerance of the RNAi line. In addition, transgenic tobacco and lemon plants were more tolerant to oxidative stresses. Yeast one-hybrid assay and transient expression analysis demonstrated that PtrbHLH could bind to the E-box elements in the promoter region of a POD gene. Taken together, these results demonstrate that PtrbHLH plays an important role in cold tolerance, at least in part, by positively regulating POD-mediated reactive oxygen species removal. PMID:23624854

  16. Backbone dynamics of a symmetric calmodulin dimer in complex with the calmodulin-binding domain of the basic-helix-loop-helix transcription factor SEF2-1/E2-2: a highly dynamic complex.

    PubMed

    Larsson, Göran; Schleucher, Jürgen; Onions, Jacqueline; Hermann, Stefan; Grundström, Thomas; Wijmenga, Sybren S

    2005-08-01

    Calmodulin (CaM) interacts specifically as a dimer with some dimeric basic-Helix-Loop-Helix (bHLH) transcription factors via a novel high affinity binding mode. Here we report a study of the backbone dynamics by (15)N-spin relaxation on the CaM dimer in complex with a dimeric peptide that mimics the CaM binding region of the bHLH transcription factor SEF2-1. The relaxation data were measured at multiple magnetic fields, and analyzed in a model-free manner using in-house written software designed to detect nanosecond internal motion. Besides picosecond motions, all residues also experience internal motion with an effective correlation time of approximately 2.5 ns with squared order parameter (S(2)) of approximately 0.75. Hydrodynamic calculations suggest that this can be attributed to motions of the N- and C-terminal domains of the CaM dimer in the complex. Moreover, residues with significant exchange broadening are found. They are clustered in the CaM:SEF2-1mp binding interface, the CaM:CaM dimer interface, and in the flexible helix connecting the CaM N- and C-terminal domains, and have similar exchange times (approximately 50 micros), suggesting a cooperative mechanism probably caused by protein:protein interactions. The dynamic features presented here support the conclusion that the conformationally heterogeneous bHLH mimicking peptide trapped inside the CaM dimer exchanges between different binding sites on both nanosecond and microsecond timescales. Nature has thus found a way to specifically recognize a relatively ill-fitting target. This novel mode of target-specific binding, which neither belongs to lock-and-key nor induced-fit binding, is characterized by dimerization and continuous exchange between multiple flexible binding alternatives.

  17. Inhibitor of differentiation 4 (ID4) acts as an inhibitor of ID-1, -2 and -3 and promotes basic helix loop helix (bHLH) E47 DNA binding and transcriptional activity.

    PubMed

    Sharma, Pankaj; Chinaranagari, Swathi; Chaudhary, Jaideep

    2015-05-01

    The four known ID proteins (ID1-4, Inhibitor of Differentiation) share a homologous helix loop helix (HLH) domain and act as dominant negative regulators of basic-HLH transcription factors. ID proteins also interact with many non-bHLH proteins in complex networks. The expression of ID proteins is increasingly observed in many cancers. Whereas ID-1, ID-2 and ID-3, are generally considered as tumor promoters, ID4 on the contrary has emerged as a tumor suppressor. In this study we demonstrate that ID4 heterodimerizes with ID-1, -2 and -3 and promote bHLH DNA binding, essentially acting as an inhibitor of inhibitors of differentiation proteins. Interaction of ID4 was observed with ID1, ID2 and ID3 that was dependent on intact HLH domain of ID4. Interaction with bHLH protein E47 required almost 3 fold higher concentration of ID4 as compared to ID1. Furthermore, inhibition of E47 DNA binding by ID1 was restored by ID4 in an EMSA binding assay. ID4 and ID1 were also colocalized in prostate cancer cell line LNCaP. The alpha helix forming alanine stretch N-terminal, unique to HLH ID4 domain was required for optimum interaction. Ectopic expression of ID4 in DU145 prostate cancer line promoted E47 dependent expression of CDKNI p21. Thus counteracting the biological activities of ID-1, -2 and -3 by forming inactive heterodimers appears to be a novel mechanism of action of ID4. These results could have far reaching consequences in developing strategies to target ID proteins for cancer therapy and understanding biologically relevant ID-interactions.

  18. Antagonistic regulation of growth and immunity by the Arabidopsis basic helix-loop-helix transcription factor homolog of brassinosteroid enhanced expression2 interacting with increased leaf inclination1 binding bHLH1.

    PubMed

    Malinovsky, Frederikke Gro; Batoux, Martine; Schwessinger, Benjamin; Youn, Ji Hyun; Stransfeld, Lena; Win, Joe; Kim, Seong-Ki; Zipfel, Cyril

    2014-03-01

    Plants need to finely balance resources allocated to growth and immunity to achieve optimal fitness. A tradeoff between pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and brassinosteroid (BR)-mediated growth was recently reported, but more information about the underlying mechanisms is needed. Here, we identify the basic helix-loop-helix (bHLH) transcription factor homolog of brassinosteroid enhanced expression2 interacting with IBH1 (HBI1) as a negative regulator of PTI signaling in Arabidopsis (Arabidopsis thaliana). HBI1 expression is down-regulated in response to different PAMPs. HBI1 overexpression leads to reduced PAMP-triggered responses. This inhibition correlates with reduced steady-state expression of immune marker genes, leading to increased susceptibility to the bacterium Pseudomonas syringae. Overexpression of the HBI1-related bHLHs brassinosteroid enhanced expression2 (BEE2) and cryptochrome-interacting bHLH (CIB1) partially inhibits immunity, indicating that BEE2 and CIB1 may act redundantly with HBI1. In contrast to its expression pattern upon PAMP treatment, HBI1 expression is enhanced by BR treatment. Also, HBI1-overexpressing plants are hyperresponsive to BR and more resistant to the BR biosynthetic inhibitor brassinazole. HBI1 is nucleus localized, and a mutation in a conserved leucine residue within the first helix of the protein interaction domain impairs its function in BR signaling. Interestingly, HBI1 interacts with several inhibitory atypical bHLHs, which likely keep HBI1 under negative control. Hence, HBI1 is a positive regulator of BR-triggered responses, and the negative effect of PTI is likely due to the antagonism between BR and PTI signaling. This study identifies a novel component involved in the complex tradeoff between innate immunity and BR-regulated growth.

  19. The role of a Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription factor in activin/nodal signaling.

    PubMed

    Ring, Colleen; Ogata, Souichi; Meek, Lauren; Song, Jihwan; Ohta, Tatsuru; Miyazono, Kohei; Cho, Ken W Y

    2002-04-01

    We investigated the regulation of the activin/nodal-inducible distal element (DE) of the Xenopus goosecoid (gsc) promoter. On the basis of its interaction with the DE, we isolated a Xenopus homolog of the human Williams-Beuren syndrome critical region 11 (XWBSCR11), and further, show that it interacts with pathway-specific Smad2 and Smad3 in a ligand-dependent manner. Interestingly, we also find that XWBSCR11 functions cooperatively with FoxH1 (Fast-1) to stimulate DE-dependent transcription. We propose a mechanism in which FoxH1 functions together with Smads as a cofactor for the recruitment of transcription factors like XWBSCR11 in the process of activin/nodal-mediated gsc-specific induction. This mechanism provides considerable opportunities for modulation of transcription across a variety of activin/nodal-inducible genes, increasing diversity in promoter selection, thus leading to the differential induction of activin/nodal target genes.

  20. Human variants in the neuronal basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) transcription factor complex NPAS4/ARNT2 disrupt function.

    PubMed

    Bersten, David C; Bruning, John B; Peet, Daniel J; Whitelaw, Murray L

    2014-01-01

    Neuronal Per-Arnt-Sim homology (PAS) Factor 4 (NPAS4) is a neuronal activity-dependent transcription factor which heterodimerises with ARNT2 to regulate genes involved in inhibitory synapse formation. NPAS4 functions to maintain excitatory/inhibitory balance in neurons, while mouse models have shown it to play roles in memory formation, social interaction and neurodegeneration. NPAS4 has therefore been implicated in a number of neuropsychiatric or neurodegenerative diseases which are underpinned by defects in excitatory/inhibitory balance. Here we have explored a broad set of non-synonymous human variants in NPAS4 and ARNT2 for disruption of NPAS4 function. We found two variants in NPAS4 (F147S and E257K) and two variants in ARNT2 (R46W and R107H) which significantly reduced transcriptional activity of the heterodimer on a luciferase reporter gene. Furthermore, we found that NPAS4.F147S was unable to activate expression of the NPAS4 target gene BDNF due to reduced dimerisation with ARNT2. Homology modelling predicts F147 in NPAS4 to lie at the dimer interface, where it appears to directly contribute to protein/protein interaction. We also found that reduced transcriptional activation by ARNT2 R46W was due to disruption of nuclear localisation. These results provide insight into the mechanisms of NPAS4/ARNT dimerisation and transcriptional activation and have potential implications for cognitive phenotypic variation and diseases such as autism, schizophrenia and dementia.

  1. Functional characterization of a basic helix-loop-helix (bHLH) transcription factor GhDEL65 from cotton (Gossypium hirsutum).

    PubMed

    Shangguan, Xiao-Xia; Yang, Chang-Qing; Zhang, Xiu-Fang; Wang, Ling-Jian

    2016-10-01

    Cotton fiber is proposed to share some similarity with the Arabidopsis thaliana leaf trichome, which is regulated by the MYB-bHLH-WD40 transcription complex. Although several MYB transcription factors and WD40 family proteins in cotton have been characterized, little is known about the role of bHLH family proteins in cotton. Here, we report that GhDEL65, a bHLH protein from cotton (Gossypium hirsutum), is a functional homologue of Arabidopsis GLABRA3 (GL3) and ENHANCER OF GLABRA3 (EGL3) in regulating trichome development. Transcripts of GhDEL65 were detected in 0 ∼ 1 days post-anthesis (DPA) ovules and abundant in 3-DPA fibers, implying that GhDEL65 may act in early fiber development. Ectopic expression of GhDEL65 in Arabidopsis gl3 egl3 double mutant partly rescued the trichome development, and constitutive expression of GhDEL65 in wild-type plants led to increased trichome density on rosette leaves and stems, mainly by activating the transcription of two key positive regulators of trichome development, GLABRA1 (GL1) and GLABRA2 (GL2), and suppressed the expression of a R3 single-repeat MYB factor TRIPTYCHON (TRY). GhDEL65 could interact with cotton R2R3 MYB transcription factors GhMYB2 and GhMYB3, as well as the WD40 protein GhTTG3, suggesting that the MYB-bHLH-WD40 protein complex also exists in cotton fiber cell, though its function in cotton fiber development awaits further investigation.

  2. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-inducible factor-1 alpha and developmentally expressed in blood vessels.

    PubMed

    Flamme, I; Fröhlich, T; von Reutern, M; Kappel, A; Damert, A; Risau, W

    1997-04-01

    Transcription factors of the bHLH-PAS protein family are important regulators of developmental processes such as neurogenesis and tracheal development in invertebrates. Recently a bHLH-PAS protein, named trachealess (trl) was identified as a master regulator of tracheogenesis. Hypoxia-inducible factor, HIF-1 alpha, is a vertebrate relative of trl which is likely to be involved in growth of blood vessels by the induction of vascular endothelial growth factor (VEGF) in response to hypoxia. In the present study we describe mRNA cloning and mRNA expression pattern of mouse HIF-related factor (HRF), a novel close relative of HIF-1 alpha which is expressed most prominently in brain capillary endothelial cells and other blood vessels as well as in bronchial epithelium in the embryo and the adult. In addition, smooth muscle cells of the uterus, neurons, brown adipose tissue and various epithelial tissues express HRF mRNA as well. High expression levels of HRF mRNA in embryonic choroid plexus and kidney glomeruli, places where VEGF is highly expressed, suggest a role of this factor in VEGF gene activation similar to that of HIF-1 alpha. Given the similarity between morphogenesis of the tracheal system and the vertebrate vascular system, the expression pattern of HRF in the vasculature and the bronchial tree raises the possibility that this family of transcription factors may be involved in tubulogenesis.

  3. A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis.

    PubMed

    Bai, Ming-Yi; Fan, Min; Oh, Eunkyoo; Wang, Zhi-Yong

    2012-12-01

    Environmental and endogenous signals, including light, temperature, brassinosteroid (BR), and gibberellin (GA), regulate cell elongation largely by influencing the expression of the paclobutrazol-resistant (PRE) family helix-loop-helix (HLH) factors, which promote cell elongation by interacting antagonistically with another HLH factor, IBH1. However, the molecular mechanism by which PREs and IBH1 regulate gene expression has remained unknown. Here, we show that IBH1 interacts with and inhibits a DNA binding basic helix-loop-helix (bHLH) protein, HBI1, in Arabidopsis thaliana. Overexpression of HBI1 increased hypocotyl and petiole elongation, whereas dominant inactivation of HBI1 and its homologs caused a dwarf phenotype, indicating that HBI1 is a positive regulator of cell elongation. In vitro and in vivo experiments showed that HBI1 directly bound to the promoters and activated two EXPANSIN genes encoding cell wall-loosening enzymes; HBI1's DNA binding and transcriptional activities were inhibited by IBH1, but the inhibitory effects of IBH1 were abolished by PRE1. The results indicate that PREs activate the DNA binding bHLH factor HBI1 by sequestering its inhibitor IBH1. Altering each of the three factors affected plant sensitivities to BR, GA, temperature, and light. Our study demonstrates that PREs, IBH1, and HBI1 form a chain of antagonistic switches that regulates cell elongation downstream of multiple external and endogenous signals.

  4. Myc/Max and other helix-loop-helix/leucine zipper proteins bend DNA toward the minor groove.

    PubMed Central

    Fisher, D E; Parent, L A; Sharp, P A

    1992-01-01

    A distinct family of DNA-binding proteins is characterized by the presence of adjacent "basic," helix-loop-helix, and leucine zipper domains. Members of this family include the Myc oncoproteins, their binding partner Max, and the mammalian transcription factors USF, TFE3, and TFEB. Consistent with their homologous domains, these proteins bind to DNA containing the same core hexanucleotide sequence CACGTG. Analysis of the conformation of DNA in protein-DNA complexes has been undertaken with a circular permutation assay. Large mobility anomalies were detected for all basic/helix-loop-helix/leucine zipper proteins tested, suggesting that each protein induced a similar degree of bending. Phasing analysis revealed that basic/helix-loop-helix/leucine zipper proteins orient the DNA bend toward the minor groove. The presence of in-phase spacing between adjacent binding sites for this family of proteins in the immunoglobulin heavy-chain enhancer suggests the possible formation of an unusual triple-bended structure and may have implications for the activities of Myc. Images PMID:1465398

  5. E-proteins and ID-proteins: Helix-loop-helix partners in development and disease

    PubMed Central

    Wang, Lan-Hsin; Baker, Nicholas E.

    2015-01-01

    The basic Helix-Loop-Helix (bHLH) proteins represent a well-known class of transcriptional regulators. Many bHLH proteins act as heterodimers with members of a class of ubiquitous partners, the E-proteins. A widely-expressed class of inhibitory heterodimer partners- the Inhibitor of DNA-binding (ID) proteins- also exists. Genetic and molecular analyses in humans and in knockout mice implicate E-proteins and ID-proteins in a wide variety of diseases, belying the notion that they are non-specific partner proteins. Here, we explore relationships of E-proteins and ID-proteins to a variety of disease processes and highlight gaps in knowledge of disease mechanisms. PMID:26555048

  6. Myogenic basic helix-loop-helix proteins regulate the expression of peroxisomal proliferator activated receptor-gamma coactivator-1alpha.

    PubMed

    Chang, Ju Hui; Lin, Kwang Huei; Shih, Chung Hsuan; Chang, Yu Jung; Chi, Hsiang Chung; Chen, Shen Liang

    2006-06-01

    Peroxisomal proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha), a transcriptional coactivator, is selectively expressed in slow-twitch fibers in skeletal muscle. Ectopic expression of the PGC-1alpha gene in either a cell or an animal has been shown to promote fast to slow fiber-type switch. The expression of PGC-1alpha in muscle is regulated by myocyte enhancer factor 2 and Forkhead in rhabdomyosarcoma, two transcription factors implicated in terminal muscle differentiation. In this study we found that PGC-1alpha expression was activated during terminal muscle differentiation in both C2C12 and Sol8 myoblasts. Using retrovirus-mediated MyoD overexpression in C3H10T1/2 cells, we also demonstrated that MyoD, the master regulator of terminal differentiation, could activate PGC-1alpha expression in vivo. Our transient transfection results also show that myogenic basic helix-loop-helix (bHLH) proteins, especially MyoD, can activate PGC-1alpha expression by targeting its promoter. Myogenic bHLH protein target sites on PGC-1alpha promoter were localized to a short region (-49 to approximately +2) adjacent to the transcription start site, which contains two putative E boxes. Mutation of either site significantly reduced MyoD-mediated transactivation in the cells, suggesting that both sites are required for myogenic bHLH protein-mediated activation. However, only one site, the E2 box, was directly bound by glutathione-S-transferase-MyoD protein in EMSAs. Our results indicate that myogenic bHLH proteins not only are involved in lineage determination and terminal differentiation, but also are directly implicated in activation of the key fiber-type and metabolic switch gene, PGC-1alpha.

  7. Specificity for the Hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression

    SciTech Connect

    Dawson, S.R.; Turner, D.L.; Weintraub, H.; Parkhurst, S.M.

    1995-12-01

    This report investigates transcriptional repressors in Drosophila melanogaster and their function in and effect on developmental processes such as sex determination. Details on the mechanism of function of these transcriptional repressors are also discussed. 50 refs., 3 figs., 4 tabs.

  8. Overexpression of a citrus basic helix-loop-helix transcription factor (CubHLH1), which is homologous to Arabidopsis activation-tagged bri1 suppressor 1 interacting factor genes, modulates carotenoid metabolism in transgenic tomato.

    PubMed

    Endo, Tomoko; Fujii, Hiroshi; Sugiyama, Aiko; Nakano, Michiharu; Nakajima, Naoko; Ikoma, Yoshinori; Omura, Mitsuo; Shimada, Takehiko

    2016-02-01

    To explore the transcription factors associated with carotenoid metabolism in citrus fruit, one transcription factor (CubHLH1) was selected through microarray screening in Satsuma mandarin (Citrus unshiu Marc.) fruit, which was treated with exogenous ethylene or gibberellin (GA), accelerating or retarding carotenoid accumulation in peel, respectively. The amino acid sequence of CubHLH1 has homology to Arabidopsis activation-tagged bri1 suppressor 1 (ATBS1) interacting factor (AIF), which is functionally characterized as a negative regulator of the brassinolide (BR) signalling pathway. Yeast two-hybrid analysis revealed that protein for CubHLH1 could interact with Arabidopsis and tomato ATBS1. Overexpression of CubHLH1 caused a dwarf phenotype in transgenic tomato (Solanum lycopersicum L.), suggesting that CubHLH1 has a similar function to Arabidopsis AIF. In the transgenic tomato fruit at ripening stage, the lycopene content was reduced along with the changes in carotenoid biosynthetic gene expression. The abscisic acid (ABA) content of all the transgenic tomato fruit was higher than that of the wild type. These results implied that CubHLH1 is considered to have a similar function to Arabidopsis AIFs and might be directly involved in carotenoid metabolism in mature citrus fruit.

  9. The helix-loop-helix Id-1 inhibits PSA expression in prostate cancer cells.

    PubMed

    Zielinski, Anne J; Fong, Sylvia; Allison, Juanita; Kawahara, Misako; Coppe, Jean-Philippe; Feiler, Heidi; Lee, Nancy M; Desprez, Pierre-Yves

    2010-05-15

    The inhibitor of basic helix-loop-helix transcription factors, Id-1, is an important gene whose expression increases during prostate cancer progression and that upregulates proliferation, migration and invasion. We used microarray analysis to identify the downstream genes whose transcriptional expression is modulated by Id-1 protein. We compared gene expression in control LNCaP cells and Id-1-transduced LNCaP cells, which become significantly more aggressive after Id-1 overexpression, thus mimicking the high levels of Id-1 detected in metastatic cell lines. We used the Affy HTA U133A Expression Arrays with 45,000 probe sets representing more than 39,000 transcripts. We found that one of the most significantly downregulated genes on Id-1 expression was kallikrein 3 [also called prostate specific antigen (PSA)], the most commonly used biomarker of prostate cancer. Here, we show that the reduction in PSA mRNA and protein expression associated with high-grade prostate cancers, which generally express high levels of Id-1, could be the consequence of Id-1 overexpression.

  10. Suppression of mammary epithelial cell differentiation by the helix-loop-helix protein Id-1

    SciTech Connect

    Desprez, P.; Hara, E.; Bissell, M.J.

    1995-06-01

    Cell proliferation and differentiation are precisely coordinated during the development and maturation of the mammary gland, and this balance invariably is disrupted during carcinogenesis. Little is known about the cell-specific transcription factors that regulate these processes in the mammary gland. The mouse mammary epithelial cell line SCp2 grows well under standard culture conditions but arrests growth, forms alveolus-like structures, and expresses {beta}-casein, a differentiation marker, 4 to 5 days after exposure to basement membrane and lactogenic hormones (differentiation signals). The authors show that this differentiation entails a marked decline in the expression of Id-1, a helix-loop-helix (HLH) protein that inactivates basic HLH transcription factors in other cell types. SCp2 cells stably transfected with an Id-1 expression vector grew more rapidly than control cells under standard conditions, but in response to differentiation signals, they lost three-dimensional organization, invaded the basement membrane, and then resumed growth. SCp2 cells expressing an Id-1 antisense vector grew more slowly than controls; in response to differentiation signals, they remained stably growth arrested and fully differentiated, as did control cells. The authors suggest that Id-1 renders cells refractory to differentiation signals and receptive to growth signals by inactivating one or more basic HLH proteins that coordinate growth and differentiation in the mammary epithelium. 53 refs., 6 figs.

  11. Salvador-Warts-Hippo pathway in a developmental checkpoint monitoring Helix-Loop-Helix proteins

    PubMed Central

    Wang, Lan-Hsin; Baker, Nicholas E.

    2014-01-01

    The E-proteins and Id-proteins are, respectively, the positive and negative heterodimer partners for the basic-helix-loop-helix protein family, and as such contribute to a remarkably large number of cell fate decisions. E-proteins and Id-proteins also function to inhibit or promote cell proliferation and cancer. Using a genetic modifier screen in Drosophila, we show that the Id-protein Extramacrochaetae enables growth by suppressing activation of the Salvador-Warts-Hippo pathway of tumor suppressors, activation that requires transcriptional activation of the expanded gene by the E-protein Daughterless. Daughterless protein binds to an intronic enhancer in the expanded gene, both activating the SWH pathway independently of the transmembrane protein Crumbs, and bypassing the negative feedback regulation that targets the same expanded enhancer. Thus the Salvador-Warts-Hippo pathway has a cell-autonomous function to prevent inappropriate differentiation due to transcription factor imbalance, and monitors the intrinsic developmental status of progenitor cells, distinct from any responses to cell-cell interactions. PMID:25579975

  12. Phylogenetic analysis of the human basic helix-loop-helix proteins

    PubMed Central

    2002-01-01

    Background The basic helix-loop-helix (bHLH) proteins are a large and complex multigene family of transcription factors with important roles in animal development, including that of fruitflies, nematodes and vertebrates. The identification of orthologous relationships among the bHLH genes from these widely divergent taxa allows reconstruction of the putative complement of bHLH genes present in the genome of their last common ancestor. Results We identified 39 different bHLH genes in the worm Caenorhabditis elegans, 58 in the fly Drosophila melanogaster and 125 in human (Homo sapiens). We defined 44 orthologous families that include most of these bHLH genes. Of these, 43 include both human and fly and/or worm genes, indicating that genes from these families were already present in the last common ancestor of worm, fly and human. Only two families contain both yeast and animal genes, and no family contains both plant and animal bHLH genes. We suggest that the diversification of bHLH genes is directly linked to the acquisition of multicellularity, and that important diversification of the bHLH repertoire occurred independently in animals and plants. Conclusions As the last common ancestor of worm, fly and human is also that of all bilaterian animals, our analysis indicates that this ancient ancestor must have possessed at least 43 different types of bHLH, highlighting its genomic complexity. PMID:12093377

  13. The Basic Helix-Loop-Helix Protein Family: Comparative Genomics and Phylogenetic Analysis

    PubMed Central

    Ledent, Valérie; Vervoort, Michel

    2001-01-01

    The basic Helix-Loop-Helix (bHLH) proteins are transcription factors that play important roles during the development of various metazoans including fly, nematode, and vertebrates. They are also involved in human diseases, particularly in cancerogenesis. We made an extensive search for bHLH sequences in the completely sequenced genomes of Caenorhabditis elegans and of Drosophila melanogaster. We found 35 and 56 different genes, respectively, which may represent the complete set of bHLH of these organisms. A phylogenetic analysis of these genes, together with a large number (>350) of bHLH from other sources, led us to define 44 orthologous families among which 36 include bHLH from animals only, and two have representatives in both yeasts and animals. In addition, we identified two bHLH motifs present only in yeast, and four that are present only in plants; however, the latter number is certainly an underestimate. Most animal families (35/38) comprise fly, nematode, and vertebrate genes, suggesting that their common ancestor, which lived in pre-Cambrian times (600 million years ago) already owned as many as 35 different bHLH genes. PMID:11337472

  14. Preferred sequences for DNA recognition by the TAL1 helix-loop-helix proteins

    SciTech Connect

    Hai-Ling Hsu; Lan Huang; Julia Tsou Tsan

    1994-02-01

    Tumor-specific activation of the TAL1 gene is the most common genetic alteration seen in patients with T-cell acute lymphoblastic leukemia. The TAL1 gene products contain the basic helix-loop-helix (bHLH) domain, a protein dimerization and DNA-binding motif common to several known transcription factors. A binding-site selection procedure has now been used to evaluate the DNA recognition properties of TAL1. These studies demonstrate that TAL1 polypeptides do not have intrinsic DNA-binding activity, presumably because of their inability to form bHLH homodimers. However, TAL1 readily interacts with any of the known class A bHLH proteins (E12, E47, E2-2, and HEB) to form heterodimers that bind DNA in a sequence-specific manner. The TAL1 heterodimers preferentially recognize a subset of E-box elements (CANNTG) that can be represented by the consensus sequence AACAGATGGT. This consensus is composed of half-sites for recognition by the participating class A bHLH polypeptide (AACAG) and the TAL1 polypeptide (ATGGT). TAL1 heterodimers with DNA-binding activity are readily detected in nuclear extracts of Jurkat, a leukemic cell line derived from a patient with T-cell acute lymphoblastic leukemia. Hence, TAL1 is likely to bind and regulate the transcription of a unique subset of subordinate target genes, some of which may mediate the malignant function of TAL1 during T-cell leukemogenesis. 48 refs., 10 figs.

  15. Suppression of Chondrogenesis by Id Helix-Loop-Helix Proteins in Murine Embryonic Orofacial Tissue

    PubMed Central

    Mukhopadhyay, Partha; Rezzoug, Francine; Webb, Cynthia L.; Pisano, M. Michele; Greene, Robert M.

    2009-01-01

    Inhibitors of differentiation (Id) proteins are helix-loop-helix (HLH) transcription factors lacking a DNA binding domain. Id proteins modulate cell proliferation, apoptosis, and differentiation in embryonic/fetal tissue. Perturbation of any of these processes in cells of the developing orofacial region results in orofacial anomalies. Chondrogenesis, a process integral to normal orofacial ontogenesis, is known to be modulated, in part, by Id proteins. In the present study, the mRNA and protein expression patterns of Id1, Id2, Id3 and Id4 were examined in developing murine orofacial tissue in vivo, as well as in murine embryonic maxillary mesenchymal cells in vitro. The functional role of Ids during chondrogenesis was also explored in vitro. Results reveal that cells derived from developing murine orofacial tissue: (1) express Id1, Id2, Id3 and Id4 mRNAs and proteins on each of gestational days 12-14, (2) express all four Id proteins in a developmentally regulated manner, (3) undergo chondrogenesis and express genes encoding various chondrogenic marker proteins (e.g. Runx2, Type X collagen, Sox9) when cultured under micromass conditions, and (4) can have their chondrogenic potential regulated via alteration of Id protein function through overexpression of a basic HLH factor. In summary, results from the current report reveal for the first time, the expression of all four Id proteins in cells derived from developing murine orofacial tissue, and demonstrate a functional role for the Ids in regulating the ability of these cells to undergo chondrogenesis. PMID:19349107

  16. Characterization of a helix-loop-helix (EF hand) motif of silver hake parvalbumin isoform B.

    PubMed Central

    Revett, S. P.; King, G.; Shabanowitz, J.; Hunt, D. F.; Hartman, K. L.; Laue, T. M.; Nelson, D. J.

    1997-01-01

    Parvalbumins are a class of calcium-binding proteins characterized by the presence of several helix-loop-helix (EF-hand) motifs. It is suspected that these proteins evolved via intragene duplication from a single EF-hand. Silver hake parvalbumin (SHPV) consists of three EF-type helix-loop-helix regions, two of which have the ability to bind calcium. The three helix-loop-helix motifs are designated AB, CD, and EF, respectively. In this study, native silver hake parvalbumin isoform B (SHPV-B) has been sequenced by mass spectrometry. The sequence indicates that this parvalbumin is a beta-lineage parvalbumin. SHPV-B was cleaved into two major fragments, consisting of the ABCD and EF regions of the native protein. The 33-amino acid EF fragment (residues 76-108), containing one of the calcium ion binding sites in native SHPV-B, has been isolated and studied for its structural characteristics, ability to bind divalent and trivalent cations, and for its propensity to undergo metal ion-induced self-association. The presence of Ca2+ does not induce significant secondary structure in the EF fragment. However, NMR and CD results indicate significant secondary structure promotion in the EF fragment in the presence of the higher charge-density trivalent cations. Sedimentation equilibrium analysis results show that the EF fragment exists in a monomer-dimer equilibrium when complexed with La3+. PMID:9385642

  17. Characterization of a helix-loop-helix (EF hand) motif of silver hake parvalbumin isoform B.

    PubMed

    Revett, S P; King, G; Shabanowitz, J; Hunt, D F; Hartman, K L; Laue, T M; Nelson, D J

    1997-11-01

    Parvalbumins are a class of calcium-binding proteins characterized by the presence of several helix-loop-helix (EF-hand) motifs. It is suspected that these proteins evolved via intragene duplication from a single EF-hand. Silver hake parvalbumin (SHPV) consists of three EF-type helix-loop-helix regions, two of which have the ability to bind calcium. The three helix-loop-helix motifs are designated AB, CD, and EF, respectively. In this study, native silver hake parvalbumin isoform B (SHPV-B) has been sequenced by mass spectrometry. The sequence indicates that this parvalbumin is a beta-lineage parvalbumin. SHPV-B was cleaved into two major fragments, consisting of the ABCD and EF regions of the native protein. The 33-amino acid EF fragment (residues 76-108), containing one of the calcium ion binding sites in native SHPV-B, has been isolated and studied for its structural characteristics, ability to bind divalent and trivalent cations, and for its propensity to undergo metal ion-induced self-association. The presence of Ca2+ does not induce significant secondary structure in the EF fragment. However, NMR and CD results indicate significant secondary structure promotion in the EF fragment in the presence of the higher charge-density trivalent cations. Sedimentation equilibrium analysis results show that the EF fragment exists in a monomer-dimer equilibrium when complexed with La3+.

  18. ETS-Mediated Cooperation between Basic Helix-Loop-Helix Motifs of the Immunoglobulin μ Heavy-Chain Gene Enhancer

    PubMed Central

    Dang, Wei; Sun, Xiao-hong; Sen, Ranjan

    1998-01-01

    The μE motifs of the immunoglobulin μ heavy-chain gene enhancer bind ubiquitously expressed proteins of the basic helix-loop-helix (bHLH) family. These elements work together with other, more tissue-restricted elements to produce B-cell-specific enhancer activity by presently undefined combinatorial mechanisms. We found that μE2 contributed to transcription activation in B cells only when the μE3 site was intact, providing the first evidence for functional interactions between bHLH proteins. In vitro assays showed that bHLH zipper proteins binding to μE3 enhanced Ets-1 binding to μA. One of the consequences of this protein-protein interaction was to facilitate binding of a second bHLH protein, E47, to the μE2 site, thereby generating a three-protein–DNA complex. Furthermore, transcriptional synergy between bHLH and bHLH zipper factors also required an intermediate ETS protein, which may bridge the transcription activation domains of the bHLH factors. Our observations define an unusual form of cooperation between bHLH and ETS proteins and suggest mechanisms by which tissue-restricted and ubiquitous factors combine to generate tissue-specific enhancer activity. PMID:9488464

  19. Neuronal basic helix-loop-helix proteins Neurod2/6 regulate cortical commissure formation before midline interactions.

    PubMed

    Bormuth, Ingo; Yan, Kuo; Yonemasu, Tomoko; Gummert, Maike; Zhang, Mingyue; Wichert, Sven; Grishina, Olga; Pieper, Alexander; Zhang, Weiqi; Goebbels, Sandra; Tarabykin, Victor; Nave, Klaus-Armin; Schwab, Markus H

    2013-01-09

    Establishment of long-range fiber tracts by neocortical projection neurons is fundamental for higher brain functions. The molecular control of axon tract formation, however, is still poorly understood. Here, we have identified basic helix-loop-helix (bHLH) transcription factors Neurod2 and Neurod6 as key regulators of fasciculation and targeted axogenesis in the mouse neocortex. In Neurod2/6 double-mutant mice, callosal axons lack expression of the cell adhesion molecule Contactin2, defasciculate in the subventricular zone, and fail to grow toward the midline without forming Probst bundles. Instead, mutant axons overexpress Robo1 and follow random trajectories into the ipsilateral cortex. In contrast to long-range axogenesis, generation and maintenance of pyramidal neurons and initial axon outgrowth are grossly normal, suggesting that these processes are under distinct transcriptional control. Our findings define a new stage in corpus callosum development and demonstrate that neocortical projection neurons require transcriptional specification by neuronal bHLH proteins to execute an intrinsic program of remote connectivity.

  20. Caught red-handed: Rc encodes a basic helix-loop-helix protein conditioning red pericarp in rice.

    PubMed

    Sweeney, Megan T; Thomson, Michael J; Pfeil, Bernard E; McCouch, Susan

    2006-02-01

    Rc is a domestication-related gene required for red pericarp in rice (Oryza sativa). The red grain color is ubiquitous among the wild ancestors of O. sativa, in which it is closely associated with seed shattering and dormancy. Rc encodes a basic helix-loop-helix (bHLH) protein that was fine-mapped to an 18.5-kb region on rice chromosome 7 using a cross between Oryza rufipogon (red pericarp) and O. sativa cv Jefferson (white pericarp). Sequencing of the alleles from both mapping parents as well as from two independent genetic stocks of Rc revealed that the dominant red allele differed from the recessive white allele by a 14-bp deletion within exon 6 that knocked out the bHLH domain of the protein. A premature stop codon was identified in the second mutant stock that had a light red pericarp. RT-PCR experiments confirmed that the Rc gene was expressed in both red- and white-grained rice but that a shortened transcript was present in white varieties. Phylogenetic analysis, supported by comparative mapping in rice and maize (Zea mays), showed that Rc, a positive regulator of proanthocyanidin, is orthologous with INTENSIFIER1, a negative regulator of anthocyanin production in maize, and is not in the same clade as rice bHLH anthocyanin regulators.

  1. The SUMO Pathway Promotes Basic Helix-Loop-Helix Proneural Factor Activity via a Direct Effect on the Zn Finger Protein Senseless

    PubMed Central

    Chen, Angela; Huang, Yan Chang; Wang, Pin Yao; Kemp, Sadie E.

    2012-01-01

    During development, proneural transcription factors of the basic helix-loop-helix (bHLH) family are required to commit cells to a neural fate. In Drosophila neurogenesis, a key mechanism promoting sense organ precursor (SOP) fate is the synergy between proneural factors and their coactivator Senseless in transcriptional activation of target genes. Here we present evidence that posttranslational modification by SUMO enhances this synergy via an effect on Senseless protein. We show that Senseless is a direct target for SUMO modification and that mutagenesis of a predicted SUMOylation motif in Senseless reduces Senseless/proneural synergy both in vivo and in cell culture. We propose that SUMOylation of Senseless via lysine 509 promotes its synergy with proneural proteins during transcriptional activation and hence regulates an important step in neurogenesis leading to the formation and maturation of the SOPs. PMID:22586269

  2. Molecular consequences of Ds insertion into and excision from the helix-loop-helix domain of the maize R gene.

    PubMed Central

    Liu, Y; Wang, L; Kermicle, J L; Wessler, S R

    1998-01-01

    The R and B proteins of maize are required to activate the transcription of several genes in the anthocyanin biosynthetic pathway. To determine the structural requirements for R function in vivo, we are exploiting its sensitive mutant phenotype to identify transposon (Ds) insertions that disrupt critical domains. Here we report that the ability of the r-m1 allele to activate transcription of at least three structural genes is reduced to only 2% of wild-type activity because of a 396-bp Ds element in helix 2 of the basic helix-loop-helix (bHLH) motif. Residual activity likely results from the synthesis of a mutant protein that contains seven additional amino acids in helix 2. This protein is encoded by a transcript where most of the Ds sequence has been spliced from pre-mRNA. Two phenotypic classes of stable derivative alleles, very pale and extremely pale, condition <1% of wild-type activity as a result of the presence of two- and three-amino-acid insertions, respectively, at the site of Ds excision. Localization of these mutant proteins to the nucleus indicates a requirement for an intact bHLH domain after nuclear import. The fact that deletion of the entire bHLH domain has only a minor effect on R protein activity while these small insertions virtually abolish activity suggests that deletion of the bHLH domain may bypass a requirement for bHLH-mediated protein-protein interactions in the activation of the structural genes in the anthocyanin biosynthetic pathway. PMID:9832539

  3. BuD, a helix-loop-helix DNA-binding domain for genome modification.

    PubMed

    Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

    2014-07-01

    DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein-DNA interactions in protein scaffolds is key to providing `toolkits' for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix-loop-helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  4. Macrocyclization and labeling of helix-loop-helix peptide with intramolecular bis-thioether linkage.

    PubMed

    Nishihara, Toshio; Kitada, Hidekazu; Fujiwara, Daisuke; Fujii, Ikuo

    2016-11-04

    Conformationally constrained peptides have been developed as an inhibitor for protein-protein interactions (PPIs), and we have de novo designed cyclized helix-loop-helix (cHLH) peptide with a disulfide bond consisting of 40 amino acids to generate molecular-targeting peptides. However, synthesis of long peptides has sometimes resulted in low yield according to the respective amino acid sequences. Here we developed a method for efficient synthesis and labeling for cHLH peptides. First, we synthesized two peptide fragments and connected them by the copper-mediated alkyne and azide cycloaddition (CuAAC) reaction. Cyclization was performed by bis-thioether linkage using 1,3-dibromomethyl-5-propargyloxybenzene, and subsequently, the cHLH peptide was labeled with an azide-labeled probe. Finally, we designed and synthesized a peptide inhibitor for the p53-HDM2 interaction using a structure-guided design and successfully labeled it with a fluorescent probe or a functional peptide, respectively, by click chemistry. This macrocyclization and labeling method for cHLH peptide would facilitate the discovery of de novo bioactive ligands and therapeutic leads. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 415-421, 2016. © 2016 Wiley Periodicals, Inc.

  5. Two single nucleotide polymorphisms in the human nescient helix-loop-helix 2 (NHLH2) gene reduce mRNA stability and DNA binding.

    PubMed

    Al Rayyan, Numan; Wankhade, Umesh D; Bush, Korie; Good, Deborah J

    2013-01-01

    Nescient helix-loop-helix-2 (NHLH2) is a basic helix-loop-helix transcription factor, which has been implicated, using mouse knockouts, in adult body weight regulation and fertility. A scan of the known single nucleotide polymorphisms (SNPs) in the NHLH2 gene revealed one in the 3' untranslated region (3'UTR), which lies within an AUUUA RNA stability motif. A second SNP is nonsynonymous within the coding region of NHLH2, and was found in a genome-wide association study for obesity. Both of these SNPs were examined for their effect on NLHL2 by creating mouse mimics and examining mRNA stability, and protein function in mouse hypothalamic cell lines. The 3'UTR SNP causes increased instability and, when the SNP-containing Nhlh2 3'UTR is attached to luciferase mRNA, reduced protein levels in cells. The nonsynonymous SNP at position 83 in the protein changes an alanine residue, conserved in NHLH2 orthologs through the Drosophila sp. to a proline residue. This change affects migration of the protein on an SDS-PAGE gel, and appears to alter secondary structure of the protein, as predicted using in silico methods. These results provide functional information on two rare human SNPs in the NHLH2 gene. One of these has been linked to human obese phenotypes, while the other is present in a relatively high proportion of individuals. Given their effects on NHLH2 protein levels, both SNPs deserve further analysis in whether they are causative and/or additive for human body weight and fertility phenotypes. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization

    PubMed Central

    Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua

    2015-01-01

    Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus. PMID:25992947

  7. Molecular cloning of ID4, a novel dominant negative helix-loop-helix human gene on chromosome 6p21.3-p22

    SciTech Connect

    Pagliuca, A.; Bartoli, P.C.; Saccone, S.

    1995-05-01

    Transcription factors containing a basic helix-loop-helix (bHLH) motif regulate the expression of tissue-specific genes in a number of mammalian and insect systems. DNA-binding activity of the bHLH proteins is dependent upon formation of homo- and/or heterodimers. Dominant negative HLH proteins (Id-related genes) also contain the HLH-dimerization domain but lack the DNA-binding basic domain. Consequently, Id proteins inhibit binding to DNA and transcriptional transactivation by heterodimerization with bHLH proteins. The authors report here the cDNA sequence of a novel human HLH gene (HGMW-approved symbol ID4) that lacks the basic domain. ID4 is differentially expressed in adult organs in four mRNA molecules, which are presumably a result of differential splicing and/or alternative usage of the polyadenylation sites. Transfection experiments indicated that enforced expression of Id-4H protein inhibits the trans-activation of the muscle creatine kinase E-box enhancer by MyoD. Finally, the authors localized the ID4 gene to the chromosome 6p21-p22 region. 18 refs., 4 figs.

  8. Targeted disruption of NeuroD, a proneural basic helix-loop-helix factor, impairs distal lung formation and neuroendocrine morphology in the neonatal lung.

    PubMed

    Neptune, Enid R; Podowski, Megan; Calvi, Carla; Cho, Jang-Hyeon; Garcia, Joe G N; Tuder, Rubin; Linnoila, R Ilona; Tsai, Ming-Jer; Dietz, Harry C

    2008-07-25

    Despite the importance of airspace integrity in vertebrate gas exchange, the molecular pathways that instruct distal lung formation are poorly understood. Recently, we found that fibrillin-1 deficiency in mice impairs alveolar formation and recapitulates the pulmonary features of human Marfan syndrome. To further elucidate effectors involved in distal lung formation, we performed expression profiling analysis comparing the fibrillin-1-deficient and wild-type developing lung. NeuroD, a basic helix-loop-helix transcription factor, fulfilled the expression criteria for a candidate mediator of distal lung development. We investigated its role in murine lung development using genetically targeted NeuroD-deficient mice. We found that NeuroD deficiency results in both impaired alveolar septation and altered morphology of the pulmonary neuroendocrine cells. NeuroD-deficient mice had enlarged alveoli associated with reduced epithelial proliferation in the airway and airspace compartments during development. Additionally, the neuroendocrine compartment in these mice manifested an increased number of neuroepithelial bodies but a reduced number of solitary pulmonary neuroendocrine cells in the neonatal lung. Overexpression of NeuroD in a murine lung epithelial cell line conferred a neuroendocrine phenotype characterized by the induction of neuroendocrine markers as well as increased proliferation. These results support an unanticipated role for NeuroD in the regulation of pulmonary neuroendocrine and alveolar morphogenesis and suggest an intimate connection between the neuroendocrine compartment and distal lung development.

  9. PIL5, a Phytochrome-Interacting Basic Helix-Loop-Helix Protein, Is a Key Negative Regulator of Seed Germination in Arabidopsis thalianaW⃞

    PubMed Central

    Oh, Eunkyoo; Kim, Jonghyun; Park, Eunae; Kim, Jeong-Il; Kang, Changwon; Choi, Giltsu

    2004-01-01

    The first decision made by an angiosperm seed, whether to germinate or not, is based on integration of various environmental signals such as water and light. The phytochromes (Phys) act as red and far-red light (Pfr) photoreceptors to mediate light signaling through yet uncharacterized pathways. We report here that the PIF3-like 5 (PIL5) protein, a basic helix-loop-helix transcription factor, is a key negative regulator of phytochrome-mediated seed germination. PIL5 preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB). Analyses of a pil5 mutant in conjunction with phyA and phyB mutants, a pif3 pil5 double mutant, and PIL5 overexpression lines indicate that PIL5 is a negative factor in Phy-mediated promotion of seed germination, inhibition of hypocotyl negative gravitropism, and inhibition of hypocotyl elongation. Our data identify PIL5 as the first Phy-interacting protein that regulates seed germination. PMID:15486102

  10. Disruption of alpha beta but not of gamma delta T cell development by overexpression of the helix-loop-helix protein Id3 in committed T cell progenitors.

    PubMed Central

    Blom, B; Heemskerk, M H; Verschuren, M C; van Dongen, J J; Stegmann, A P; Bakker, A Q; Couwenberg, F; Res, P C; Spits, H

    1999-01-01

    Enforced expression of Id3, which has the capacity to inhibit many basic helix-loop-helix (bHLH) transcription factors, in human CD34(+) hematopoietic progenitor cells that have not undergone T cell receptor (TCR) gene rearrangements inhibits development of the transduced cells into TCRalpha beta and gamma delta cells in a fetal thymic organ culture (FTOC). Here we document that overexpression of Id3, in progenitors that have initiated TCR gene rearrangements (pre-T cells), inhibits development into TCRalpha beta but not into TCRgamma delta T cells. Furthermore, Id3 impedes expression of recombination activating genes and downregulates pre-Talpha mRNA. These observations suggest possible mechanisms by which Id3 overexpression can differentially affect development of pre-T cells into TCRalpha beta and gamma delta cells. We also observed that cell surface CD4(-)CD8(-)CD3(-) cells with rearranged TCR genes developed from Id3-transduced but not from control-transduced pre-T cells in an FTOC. These cells had properties of both natural killer (NK) and pre-T cells. These findings suggest that bHLH factors are required to control T cell development after the T/NK developmental checkpoint. PMID:10329625

  11. A genome-wide identification and classification of basic helix-loop-helix genes in the jewel wasp, Nasonia vitripennis (Hymenoptera: Pteromalidae).

    PubMed

    Liu, Xiao-Ting; Wang, Yong; Wang, Xu-Hua; Tao, Xia-Fang; Yao, Qin; Chen, Ke-Ping

    2014-10-01

    Basic helix-loop-helix (bHLH) proteins are highly conserved DNA-binding transcription factors of a large superfamily. Animal bHLH proteins play important regulatory roles in various developmental processes such as neurogenesis, myogenesis, heart development, and hematopoiesis. The jewel wasp (Nasonia vitripennis) is a good model organism of hymenoptera insects for studies of developmental and evolutionary genetics. In this study, we identified 48 bHLH genes in the genome of N. vitripennis. According to phylogenetic analysis, based on N. vitripennis bHLH (NvbHLH) motif sequences and structural domain distribution in their full-length protein sequences, the identified NvbHLH genes were classified into 36 bHLH families with 19, 12, 9, 1, 6, and 1 member(s) in groups A, B, C, D, E, and F, respectively. Our classification to the identified NvbHLH family members confirms GenBank annotations for 21 of the 48 NvbHLH proteins and provides useful information for further characterization and annotation of the remaining 27 NvbHLH proteins. Compared to other insect species, N. vitripennis has the lowest number of bHLH family members. No NvbHLH members have been found in the families Net, MyoRa, and PTFa, while all other insect species have at least one member in each of the families. These data constitute a solid basis for further investigations into the functions of bHLH proteins in developmental regulation of N. vitripennis.

  12. Evidence supporting the existence of a NUPR1-like family of helix-loop-helix chromatin proteins related to, yet distinct from, AT hook-containing HMG proteins.

    PubMed

    Urrutia, Raul; Velez, Gabriel; Lin, Marisa; Lomberk, Gwen; Neira, Jose Luis; Iovanna, Juan

    2014-08-01

    NUPR1, a small chromatin protein, plays a critical role in cancer development, progression, and resistance to therapy. Here, using a combination of structural bioinformatics and molecular modeling methods, we report several novel findings that enhance our understanding of the biochemical function of this protein. We find that NUPR1 has been conserved throughout evolution, and over time it has undergone duplications and transpositions to form other transcriptional regulators. Using threading, homology-based molecular modeling, molecular mechanics calculations, and molecular dynamics simulations, we generated structural models for four of these proteins: NUPR1a, NUPR1b, NUPR2, and the NUPR-like domain of GTF2-I. Comparative analyses of these models combined with extensive linear motif identification reveal that these four proteins, though similar in their propensities for folding, differ in size, surface changes, and sites amenable for posttranslational modification. Lastly, taking NUPR1a as the paradigm for this family, we built models of a NUPR-DNA complex. Additional structural comparisons revealed that NUPR1 defines a new family of small-groove-binding proteins that share structural features with, yet are distinct from, helix-loop-helix AT-hook-containing HMG proteins. These models and inferences should lead to a better understanding of the function of this group of chromatin proteins, which play a critical role in the development of human malignant diseases.

  13. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    SciTech Connect

    Villano, C.M.; White, L.A. . E-mail: lawhite@aesop.rutgers.edu

    2006-08-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes.

  14. Seven Genes of the Enhancer of Split Complex of Drosophila Melanogaster Encode Helix-Loop-Helix Proteins

    PubMed Central

    Knust, E.; Schrons, H.; Grawe, F.; Campos-Ortega, J. A.

    1992-01-01

    Enhancer of split [E(spl)] is one of the neurogenic loci of Drosophila and, as such, is required for normal segregation of neural and epidermal cell progenitors. Genetic observations indicate that the E(spl) locus is in fact a gene complex comprising a cluster of related genes and that other genes of the region are also required for normal early neurogenesis. Three of the genes of the complex were known to encode helix-loop-helix (HLH) proteins and to be transcribed in nearly identical patterns. Here, we show that four other genes in the vicinity also encode HLH proteins and, during neuroblast segregation, three of them are expressed in the same pattern. We show by germ-line transformation that these three genes are also necessary to allow epidermal development of the neuroectodermal cells. PMID:1427040

  15. Enhanced complexity and catalytic efficiency in the hydrolysis of phosphate diesters by rationally designed helix-loop-helix motifs.

    PubMed

    Razkin, Jesus; Lindgren, Johan; Nilsson, Helena; Baltzer, Lars

    2008-08-11

    HJ1, a 42-residue peptide that folds into a helix-loop-helix motif and dimerizes to form a four-helix bundle, successfully catalyzes the cleavage of "early stage" DNA model substrates in an aqueous solution at pH 7.0, with a rate enhancement in the hydrolysis of heptyl 4-nitrophenyl phosphate of over three orders of magnitude over that of the imidazole-catalyzed reaction, k(2)(HJ1)/k(2)(Im) = 3135. The second-order rate constant, k(2)(HJ1) was determined to be 1.58x10(-4) M(-1) s(-1). The catalyst successfully assembles residues that in a single elementary reaction step are capable of general-acid and general-base catalysis as well as transition state stabilization and proximity effects. The reactivity achieved with the HJ1 polypeptide, rationally designed to catalyze the hydrolysis of phosphodiesters, is based on two histidine residues flanked by four arginines and two adjacent tyrosine residues, all located on the surface of a helix-loop-helix motif. The introduction of Tyr residues close to the catalytic site improves efficiency, in the cleavage of activated aryl alkyl phosphates as well as less activated dialkyl phosphates. HJ1 is also effective in the cleavage of an RNA-mimic substrate, uridine-3'-2,2,2-trichloroethyl phosphate (leaving group pK(a) = 12.3) with a second-order rate constant of 8.23x10(-4) M(-1) s(-1) in aqueous solution at pH 7.0, some 500 times faster than the reaction catalyzed by imidazole, k(2)(HJ1)/k(2)(Im) = 496.

  16. The basic helix-loop-helix transcription factor family in the sacred lotus, Nelumbo nucifera

    USDA-ARS?s Scientific Manuscript database

    Nelumbo nucifera (Sacred Lotus) is a basal eudicot with exceptional physiological and metabolic properties including seed longevity, adaptations for an aquatic habit, and floral thermiogenesis. It also occupies a unique position in the phylogeny of land plants and can be a useful species for studies...

  17. Involvement of the helix-loop-helix protein Id-1 in the glucocorticoid regulation of tight junctions in mammary epithelial cells.

    PubMed

    Woo, P L; Cercek, A; Desprez, P Y; Firestone, G L

    2000-09-15

    Mammary epithelial cell-cell junctions undergo morphological and structural differentiation during pregnancy and lactation, but little is known about the transcriptional regulators that are involved in this process. In Con8 mammary epithelial tumor cells, we have previously documented that the synthetic glucocorticoid, dexamethasone, induces the reorganization of the tight junction and adherens junction and stimulates the monolayer transepithelial electrical resistance (TER), a reliable in vitro measurement of tight junction sealing. Western blots demonstrated that dexamethasone treatment rapidly and strongly stimulated the level of the Id-1 protein, which is a serum-inducible helix-loop-helix transcriptional repressor. The steroid induction of Id-1 was robust by 4 h of treatment and maintained over a 24-h period. Isopropyl-1-thio-beta-d-galactopyranoside-inducible expression of exogenous Id-1 in Con8 cells was shown to strongly facilitate the dexamethasone induction of TER in the absence of serum without altering the dexamethasone-dependent reorganization of ZO-1, beta-catenin, or F-actin. Ectopic overexpression of Id-1 in the SCp2 nontumorigenic mammary epithelial cells, which does not undergo complete dexamethasone-dependent tight junction reorganization, enhanced the dexamethasone-induced ZO-1 tight junction localization and stimulated the monolayer TER. Moreover, antisense reduction of Id-1 protein in SCp2 cells prevented the apical junction reorganization and dexamethasone-stimulated TER. Our results implicate Id-1 as acting as a critical regulator of mammary epithelial cell-cell interactions at an early step in the glucocorticoid-dependent signaling pathway that controls tight junction integrity.

  18. Protein conformational changes studied by diffusion NMR spectroscopy: Application to helix-loop-helix calcium binding proteins

    PubMed Central

    Weljie, Aalim M.; Yamniuk, Aaron P.; Yoshino, Hidenori; Izumi, Yoshinobu; Vogel, Hans J.

    2003-01-01

    Pulsed-field gradient (PFG) diffusion NMR spectroscopy studies were conducted with several helix-loop-helix regulatory Ca2+-binding proteins to characterize the conformational changes associated with Ca2+-saturation and/or binding targets. The calmodulin (CaM) system was used as a basis for evaluation, with similar hydrodynamic radii (Rh) obtained for apo- and Ca2+-CaM, consistent with previously reported Rh data. In addition, conformational changes associated with CaM binding to target peptides from myosin light chain kinase (MLCK), phosphodiesterase (PDE), and simian immunodeficiency virus (SIV) were accurately determined compared with small-angle X-ray scattering results. Both sets of data demonstrate the well-established collapse of the extended Ca2+-CaM molecule into a globular complex upon peptide binding. The Rh of CaM complexes with target peptides from CaM-dependent protein kinase I (CaMKI) and an N-terminal portion of the SIV peptide (SIV-N), as well as the anticancer drug cisplatin were also determined. The CaMKI complex demonstrates a collapse analogous to that observed for MLCK, PDE, and SIV, while the SIV-N shows only a partial collapse. Interestingly, the covalent CaM–cisplatin complex shows a near complete collapse, not expected from previous studies. The method was extended to related calcium binding proteins to show that the Rh of calcium and integrin binding protein (CIB), calbrain, and the calcium-binding region from soybean calcium-dependent protein kinase (CDPK) decrease on Ca2+-binding to various extents. Heteronuclear NMR spectroscopy suggests that for CIB and calbrain this is likely because of shifting the equilibrium from unfolded to folded conformations, with calbrain forming a dimer structure. These results demonstrate the utility of PFG-diffusion NMR to rapidly and accurately screen for molecular size changes on protein–ligand and protein–protein interactions for this class of proteins. PMID:12538886

  19. Molecular characterization of the basic helix-loop-helix (bHLH) genes that are differentially expressed and induced by iron deficiency in Populus.

    PubMed

    Huang, Danqiong; Dai, Wenhao

    2015-07-01

    Two Populus bHLH genes ( PtFIT and PtIRO ) were cloned and characterized. The iron deficiency tolerance may be regulated by the PtFIT -dependent response pathway in Populus. Five orthologs of eight Arabidopsis basic helix-loop-helix (bHLH) genes responding to iron deficiency in Populus were analyzed. Open reading frame (ORF) regions of two bHLH genes (PtFIT and PtIRO) were isolated from the iron deficiency tolerant (PtG) and susceptible (PtY) genotypes of Populus tremula 'Erecta'. Gene sequence analyses showed that each of the two genes was identical in PtG and PtY. Phylogenetic analysis revealed that PtFIT was clustered with the bHLH genes regulating iron deficiency responses, while PtIRO was clustered with another group of the bHLH genes regulating iron deficiency responses in a FIT-independent pathway. Tissue-specific expression analysis indicated that PtFIT was only detected in the root among all tested tissues, while PtIRO was rarely detected in all tested tissues. Real-time PCR showed that PtFIT was up-regulated in roots under the iron-deficient condition. A higher level of PtFIT transcripts was detected in PtG than in PtY. Pearson Correlation Coefficient calculations indicated a strong positive correlation (r = 0.94) between PtFIT and PtIRT1 in PtG. It suggests that the iron deficiency tolerance of PtG may be regulated by the PtFIT-dependent response pathway. The PtFIT-transgenic poplar plants had an increased expression level of PtFIT and PtIRT1 responding to iron deficiency. One PtFIT-transgenic line (TL2) showed enhanced iron deficiency tolerance with higher chlorophyll content and Chl a/b ratio under iron deficiency than the control plants, indicating that PtFIT is involved in iron deficiency response in Populus. The results would provide useful information to understand iron deficiency response mechanisms in woody species.

  20. Functional Isoforms of IκB Kinase α (IKKα) Lacking Leucine Zipper and Helix-Loop-Helix Domains Reveal that IKKα and IKKβ Have Different Activation Requirements

    PubMed Central

    McKenzie, Fergus R.; Connelly, Margery A.; Balzarano, Darlene; Müller, Jurgen R.; Geleziunas, Romas; Marcu, Kenneth B.

    2000-01-01

    The activity of the NF-κB family of transcription factors is regulated principally by phosphorylation and subsequent degradation of their inhibitory IκB subunits. Site-specific serine phosphorylation of IκBs by two IκB kinases (IKKα [also known as CHUK] and IKKβ) targets them for proteolysis. IKKα and -β have a unique structure, with an amino-terminal serine-threonine kinase catalytic domain and carboxy-proximal helix-loop-helix (HLH) and leucine zipper-like (LZip) amphipathic α-helical domains. Here, we describe the properties of two novel cellular isoforms of IKKα: IKKα-ΔH and IKKα-ΔLH. IKKα-ΔH and IKKα-ΔLH are differentially spliced isoforms of the IKKα mRNA lacking its HLH domain and both its LZip and HLH domains, respectively. IKKα is the major RNA species in most murine cells and tissues, except for activated T lymphocytes and the brain, where the alternatively spliced isoforms predominate. Remarkably, IKKα-ΔH and IKKα-ΔLH, like IKKα, respond to tumor necrosis factor alpha stimulation to potentiate NF-κB activation in HEK293 cells. A mutant, catalytically inactive form of IKKα blocked IKKα-, IKKα-ΔH-, and IKKα-ΔLH-mediated NF-κB activation. Akin to IKKα, its carboxy-terminally truncated isoforms associated with the upstream activator NIK (NF-κB-inducing kinase). In contrast to IKKα, IKKα-ΔLH failed to associate with either itself, IKKα, IKKβ, or NEMO-IKKγ-IKKAP1, while IKKα-ΔH complexed with IKKβ and IKKα but not with NEMO. Interestingly, each IKKα isoform rescued HEK293 cells from the inhibitory effects of a dominant-negative NEMO mutant, while IKKα could not. IKKα-ΔCm, a recombinant mutant of IKKα structurally akin to IKKα-ΔLH, was equally functional in these assays, but in sharp contrast, IKKβ-ΔCm, a structurally analogous mutant of IKKβ, was inactive. Our results demonstrate that the functional roles of seemingly analogous domains in IKKα and IKKβ need not be equivalent and can also exhibit

  1. TAL2, a helix-loop-helix gene activated by the (7;9)(q34;q32) translocation in human T-cell leukemia.

    PubMed Central

    Xia, Y; Brown, L; Yang, C Y; Tsan, J T; Siciliano, M J; Espinosa, R; Le Beau, M M; Baer, R J

    1991-01-01

    Tumor-specific alteration of the TAL1 gene occurs in almost 25% of patients with T-cell acute lymphoblastic leukemia (T-ALL). We now report the identification of TAL2, a distinct gene that was isolated on the basis of its sequence homology with TAL1. The TAL2 gene is located 33 kilobase pairs from the chromosome 9 breakpoint of t(7;9)(q34;q32), a recurring translocation specifically associated with T-ALL. As a consequence of t(7;9)(q34;q32), TAL2 is juxtaposed with sequences from the T-cell receptor beta-chain gene on chromosome 7. TAL2 sequences are actively transcribed in SUP-T3, a T-ALL cell line that harbors the t(7;9)(q34;q32). The TAL2 gene product includes a helix-loop-helix protein dimerization and DNA binding domain that is especially homologous to those encoded by the TAL1 and LYL1 protooncogenes. Hence, TAL2, TAL1, and LYL1 constitute a discrete subgroup of helix-loop-helix proteins, each of which can potentially contribute to the development of T-ALL. Images PMID:1763056

  2. TAL2, a helix-loop-helix gene activated by the (7; 9)(q34; q32) translocation in human T-cell leukemia

    SciTech Connect

    Ying Xia; Brown, L.; Yang, C.Y.; Tsan, J.T.; Baer, R.J. ); Siciliano, M.J. ); Espinosa, R. III; Le Beau, M.M. )

    1991-12-15

    Tumor-specific alteration of the TAL1 gene occurs in almost 25% of patients with T-cell acute lymphoblastic leukemia (T-ALL). The authors now report the identification of TAL2, a distinct gene that was isolated on the basis of its sequence homology with TAL1. The TAL2 gene is located 33 kilobase pairs from the chromosome 9 breakpoint of t(7;9)(q34;q32), a recurring translocation specifically associated with T-ALL. As a consequence of t(7;9)(q34;q32), TAL2 is juxtaposed with sequences from the T-cell receptor {beta}-chain gene on chromosome 7. TAL2 sequences are actively transcribed in SUP-T3, a T-ALL cell line that harbors the t(7;9)(q34;q32). The TAL2 gene product includes a helix-loop-helix protein dimerization and DNA binding domain that is especially homologous to those encoded by the TAL1 and LYL1 protooncogenes. Hence, TAL2, TAL1, and LYL1 constitute a discrete subgroup of helix-loop-helix proteins, each of which can potentially contribute to the development of T-ALL.

  3. Ectopic expression of a basic helix-loop-helix gene transactivates parallel pathways of proanthocyanidin biosynthesis. structure, expression analysis, and genetic control of leucoanthocyanidin 4-reductase and anthocyanidin reductase genes in Lotus corniculatus.

    PubMed

    Paolocci, Francesco; Robbins, Mark P; Madeo, Laura; Arcioni, Sergio; Martens, Stefan; Damiani, Francesco

    2007-01-01

    Proanthocyanidins (PAs) are plant secondary metabolites and are composed primarily of catechin and epicatechin units in higher plant species. Due to the ability of PAs to bind reversibly with plant proteins to improve digestion and reduce bloat, engineering this pathway in leaves is a major goal for forage breeders. Here, we report the cloning and expression analysis of anthocyanidin reductase (ANR) and leucoanthocyanidin 4-reductase (LAR), two genes encoding enzymes committed to epicatechin and catechin biosynthesis, respectively, in Lotus corniculatus. We show the presence of two LAR gene families (LAR1 and LAR2) and that the steady-state levels of ANR and LAR1 genes correlate with the levels of PAs in leaves of wild-type and transgenic plants. Interestingly, ANR and LAR1, but not LAR2, genes produced active proteins following heterologous expression in Escherichia coli and are affected by the same basic helix-loop-helix transcription factor that promotes PA accumulation in cells of palisade and spongy mesophyll. This study provides direct evidence that the same subclass of transcription factors can mediate the expression of the structural genes of both branches of PA biosynthesis.

  4. Ectopic Expression of a Basic Helix-Loop-Helix Gene Transactivates Parallel Pathways of Proanthocyanidin Biosynthesis. Structure, Expression Analysis, and Genetic Control of Leucoanthocyanidin 4-Reductase and Anthocyanidin Reductase Genes in Lotus corniculatus1[W

    PubMed Central

    Paolocci, Francesco; Robbins, Mark P.; Madeo, Laura; Arcioni, Sergio; Martens, Stefan; Damiani, Francesco

    2007-01-01

    Proanthocyanidins (PAs) are plant secondary metabolites and are composed primarily of catechin and epicatechin units in higher plant species. Due to the ability of PAs to bind reversibly with plant proteins to improve digestion and reduce bloat, engineering this pathway in leaves is a major goal for forage breeders. Here, we report the cloning and expression analysis of anthocyanidin reductase (ANR) and leucoanthocyanidin 4-reductase (LAR), two genes encoding enzymes committed to epicatechin and catechin biosynthesis, respectively, in Lotus corniculatus. We show the presence of two LAR gene families (LAR1 and LAR2) and that the steady-state levels of ANR and LAR1 genes correlate with the levels of PAs in leaves of wild-type and transgenic plants. Interestingly, ANR and LAR1, but not LAR2, genes produced active proteins following heterologous expression in Escherichia coli and are affected by the same basic helix-loop-helix transcription factor that promotes PA accumulation in cells of palisade and spongy mesophyll. This study provides direct evidence that the same subclass of transcription factors can mediate the expression of the structural genes of both branches of PA biosynthesis. PMID:17098849

  5. Caught Red-Handed: Rc Encodes a Basic Helix-Loop-Helix Protein Conditioning Red Pericarp in RiceW⃞ 111111111111111111111111 100000000000000000000001 100001111000000001000001 100010000100000010100001 100100000010000010100001 101000000001000100010001 101000000001000100010001 101000000001001111111001 101000000001001000001001 100100000010001000001001 100010000100010000000101 100001111000010000000101 100000000000000000000001 111111111111111111111111

    PubMed Central

    Sweeney, Megan T.; Thomson, Michael J.; Pfeil, Bernard E.; McCouch, Susan

    2006-01-01

    Rc is a domestication-related gene required for red pericarp in rice (Oryza sativa). The red grain color is ubiquitous among the wild ancestors of O. sativa, in which it is closely associated with seed shattering and dormancy. Rc encodes a basic helix-loop-helix (bHLH) protein that was fine-mapped to an 18.5-kb region on rice chromosome 7 using a cross between Oryza rufipogon (red pericarp) and O. sativa cv Jefferson (white pericarp). Sequencing of the alleles from both mapping parents as well as from two independent genetic stocks of Rc revealed that the dominant red allele differed from the recessive white allele by a 14-bp deletion within exon 6 that knocked out the bHLH domain of the protein. A premature stop codon was identified in the second mutant stock that had a light red pericarp. RT-PCR experiments confirmed that the Rc gene was expressed in both red- and white-grained rice but that a shortened transcript was present in white varieties. Phylogenetic analysis, supported by comparative mapping in rice and maize (Zea mays), showed that Rc, a positive regulator of proanthocyanidin, is orthologous with INTENSIFIER1, a negative regulator of anthocyanin production in maize, and is not in the same clade as rice bHLH anthocyanin regulators. PMID:16399804

  6. deadpan, an essential pan-neural gene in Drosophila, encodes a helix-loop-helix protein similar to the hairy gene product.

    PubMed

    Bier, E; Vaessin, H; Younger-Shepherd, S; Jan, L Y; Jan, Y N

    1992-11-01

    Neural precursor cells in Drosophila acquire their identity early during their formation. In an attempt to determine whether all neural precursors share a set of genetic machinery, perhaps to control properties of differentiation common to all neurons, we used the enhancer-trap method to identify several genes (pan-neural genes) that are expressed in all neurons and/or their precursors. One of the pan-neural genes is deadpan, which encodes a helix-loop-helix protein closely related to the product of the segmentation gene hairy. The function of deadpan is essential for viability and is likely to be involved in the functional rather than the morphological differentiation of neurons.

  7. Microarray analysis of genes with impaired insulin regulation in the skeletal muscle of type 2 diabetic patients indicates the involvement of basic helix-loop-helix domain-containing, class B, 2 protein (BHLHB2).

    PubMed

    Rome, S; Meugnier, E; Lecomte, V; Berbe, V; Besson, J; Cerutti, C; Pesenti, S; Granjon, A; Disse, E; Clement, K; Lefai, E; Laville, M; Vidal, H

    2009-09-01

    One of the major processes by which insulin exerts its multiple biological actions is through gene expression regulation. Thus, the identification of transcription factors affected by insulin in target tissues represents an important challenge. The aim of the present study was to gain a greater insight into this issue through the identification of transcription factor genes with insulin-regulated expression in human skeletal muscle. Using microarray analysis, we defined the sets of genes modulated during a 3 h hyperinsulinaemic-euglycaemic clamp (2 mU min(-1) kg(-1)) in the skeletal muscle of insulin-sensitive control volunteers and in moderately obese insulin-resistant type 2 diabetic patients. Of the 1,529 and 1,499 genes regulated during the clamp in control and diabetic volunteers, respectively, we identified 30 transcription factors with impaired insulin-regulation in type 2 diabetic patients. Analysis of the promoters of the genes encoding these factors revealed a possible contribution of the transcriptional repressor basic helix-loop-helix domain-containing, class B, 2 protein (BHLHB2), insulin regulation of which is strongly altered in the muscle of diabetic patients. Gene ontology analysis of BHLHB2 target genes, identified after BHLHB2 overexpression in human primary myotubes, demonstrated that about 10% of the genes regulated in vivo during hyperinsulinaemia are potentially under the control of this repressor. The data also suggested that BHLHB2 is situated at the crossroads of a complex transcriptional network that is able to modulate major metabolic and biological pathways in skeletal muscle, including the regulation of a cluster of genes involved in muscle development and contraction. We have identified BHLHB2 as a potential novel mediator of insulin transcriptional action in human skeletal muscle.

  8. The myostatin gene is a downstream target gene of basic helix-loop-helix transcription factor MyoD.

    PubMed

    Spiller, Michael P; Kambadur, Ravi; Jeanplong, Ferenc; Thomas, Mark; Martyn, Julie K; Bass, John J; Sharma, Mridula

    2002-10-01

    Myostatin is a negative regulator of myogenesis, and inactivation of myostatin leads to heavy muscle growth. Here we have cloned and characterized the bovine myostatin gene promoter. Alignment of the upstream sequences shows that the myostatin promoter is highly conserved during evolution. Sequence analysis of 1.6 kb of the bovine myostatin gene upstream region revealed that it contains 10 E-box motifs (E1 to E10), arranged in three clusters, and a single MEF2 site. Deletion and mutation analysis of the myostatin gene promoter showed that out of three important E boxes (E3, E4, and E6) of the proximal cluster, E6 plays a significant role in the regulation of a reporter gene in C(2)C(12) cells. We also demonstrate by band shift and chromatin immunoprecipitation assay that the E6 E-box motif binds to MyoD in vitro and in vivo. Furthermore, cotransfection experiments indicate that among the myogenic regulatory factors, MyoD preferentially up-regulates myostatin promoter activity. Since MyoD expression varies during the myoblast cell cycle, we analyzed the myostatin promoter activity in synchronized myoblasts and quiescent "reserve" cells. Our results suggest that myostatin promoter activity is relatively higher during the G(1) phase of the cell cycle, when MyoD expression levels are maximal. However, in the reserve cells, which lack MyoD expression, a significant reduction in the myostatin promoter activity is observed. Taken together, these results suggest that the myostatin gene is a downstream target gene of MyoD. Since the myostatin gene is implicated in controlling G(1)-to-S progression of myoblasts, MyoD could be triggering myoblast withdrawal from the cell cycle by regulating myostatin gene expression.

  9. Drosophila CK2 phosphorylates Deadpan, a member of the HES family of basic-helix-loop-helix (bHLH) repressors.

    PubMed

    Karandikar, Umesh C; Shaffer, Jonathan; Bishop, Clifton P; Bidwai, Ashok P

    2005-06-01

    In Drosophila, protein kinase CK2 regulates a diverse array of developmental processes. One of these is cell-fate specification (neurogenesis) wherein CK2 regulates basic-helix-loop-helix (bHLH) repressors encoded by the Enhancer of Split Complex (E(spl)C). Specifically, CK2 phosphorylates and activates repressor functions of E(spl)M8 during eye development. In this study we describe the interaction of CK2 with an E(spl)-related bHLH repressor, Deadpan (Dpn). Unlike E(spl)-repressors which are expressed in cells destined for a non-neural cell fate, Dpn is expressed in the neuronal cells and is thought to control the activity of proneural genes. Dpn also regulates sex-determination by repressing sxl, the primary gene involved in sex differentiation. We demonstrate that Dpn is weakly phosphorylated by monomeric CK2alpha, whereas it is robustly phosphorylated by the embryo-holoenzyme, suggesting a positive role for CK2beta. The weak phosphorylation by CK2alpha is markedly stimulated by the activator polylysine to levels comparable to those with the holoenzyme. In addition, pull down assays indicate a direct interaction between Dpn and CK2. This is the first demonstration that Dpn is a partner and target of CK2, and raises the possibility that its repressor functions might also be regulated by phosphorylation.

  10. HEN1 and HEN2: a subgroup of basic helix-loop-helix genes that are coexpressed in a human neuroblastoma.

    PubMed Central

    Brown, L; Espinosa, R; Le Beau, M M; Siciliano, M J; Baer, R

    1992-01-01

    An important family of regulatory molecules is made up of proteins that possess the DNA-binding and dimerization motif known as the basic helix-loop-helix (bHLH) domain. The bHLH family includes subgroups of closely related proteins that share common functional properties and overlapping patterns of expression (e.g., the MyoD1 and achaete-scute subgroups). In this report we describe HEN1 and HEN2, mammalian genes that encode a distinct subgroup of bHLH proteins. The HEN1 gene was identified on the basis of cross-hybridization with TAL1, a known bHLH gene implicated in T-cell acute lymphoblastic leukemia. In situ fluorescence hybridization was used to localize the human HEN1 gene to chromosome band 1q22. HEN1 and HEN2 are coexpressed in the IMR-32 human neuroblastoma cell line, and they encode highly related proteins of 133 and 135 residues, respectively, that share 98% amino acid identity in their hHLH domains. These data imply that the bHLH protein subgroup encoded by HEN1 and HEN2 may serve important regulatory functions in the developing nervous system. Images PMID:1528853

  11. An-1 Encodes a Basic Helix-Loop-Helix Protein That Regulates Awn Development, Grain Size, and Grain Number in Rice[C][W][OPEN

    PubMed Central

    Luo, Jianghong; Liu, Hui; Zhou, Taoying; Gu, Benguo; Huang, Xuehui; Shangguan, Yingying; Zhu, Jingjie; Li, Yan; Zhao, Yan; Wang, Yongchun; Zhao, Qiang; Wang, Ahong; Wang, Ziqun; Sang, Tao; Wang, Zixuan; Han, Bin

    2013-01-01

    Long awns are important for seed dispersal in wild rice (Oryza rufipogon), but are absent in cultivated rice (Oryza sativa). The genetic mechanism involved in loss-of-awn in cultivated rice remains unknown. We report here the molecular cloning of a major quantitative trait locus, An-1, which regulates long awn formation in O. rufipogon. An-1 encodes a basic helix-loop-helix protein, which regulates cell division. The nearly-isogenic line (NIL-An-1) carrying a wild allele An-1 in the genetic background of the awnless indica Guangluai4 produces long awns and longer grains, but significantly fewer grains per panicle compared with Guangluai4. Transgenic studies confirmed that An-1 positively regulates awn elongation, but negatively regulates grain number per panicle. Genetic variations in the An-1 locus were found to be associated with awn loss in cultivated rice. Population genetic analysis of wild and cultivated rice showed a significant reduction in nucleotide diversity of the An-1 locus in rice cultivars, suggesting that the An-1 locus was a major target for artificial selection. Thus, we propose that awn loss was favored and strongly selected by humans, as genetic variations at the An-1 locus that cause awn loss would increase grain numbers and subsequently improve grain yield in cultivated rice. PMID:24076974

  12. Effects of postweaning administration of conjugated linoleic acid on development of obesity in nescient basic helix-loop-helix 2 knockout mice.

    PubMed

    Kim, Yoo; Kim, Daeyoung; Good, Deborah J; Park, Yeonhwa

    2015-06-03

    Conjugated linoleic acid (CLA) has been reported to prevent body weight gain and fat accumulation in part by improving physical activity in mice. However, the effects of postweaning administration of CLA on the development of obesity later in life have not yet been demonstrated. The current study investigated the role of postweaning CLA treatment on skeletal muscle energy metabolism in genetically induced inactive adult-onset obese model, nescient basic helix-loop-helix 2 knockout (N2KO) mice. Four-week-old male N2KO and wild type mice were fed either control or a CLA-containing diet (0.5%) for 4 weeks, and then CLA was withdrawn and control diet provided to all mice for the following 8 weeks. Postweaning CLA supplementation in wild type animals, but not N2KO mice, may activate AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor-δ (PPARδ) as well as promote desensitization of phosphatase and tensin homologue (PTEN) and sensitization of protein kinase B (AKT) at threonine 308 in gastrocnemius skeletal muscle, improving voluntary activity and glucose homeostasis. We suggest that postweaning administration of CLA may in part stimulate the underlying molecular targets involved in muscle energy metabolism to reduce weight gain in normal animals, but not in the genetically induced inactive adult-onset animal model.

  13. The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response.

    PubMed

    Colangelo, Elizabeth P; Guerinot, Mary Lou

    2004-12-01

    Regulation of iron uptake is critical for plant survival. Although the activities responsible for reduction and transport of iron at the plant root surface have been described, the genes controlling these activities are largely unknown. We report the identification of the essential gene Fe-deficiency Induced Transcription Factor 1 (FIT1), which encodes a putative transcription factor that regulates iron uptake responses in Arabidopsis thaliana. Like the Fe(III) chelate reductase FRO2 and high affinity Fe(II) transporter IRT1, FIT1 mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. fit1 mutant plants are chlorotic and die as seedlings but can be rescued by the addition of supplemental iron, pointing to a defect in iron uptake. fit1 mutant plants accumulate less iron than wild-type plants in root and shoot tissues. Microarray analysis shows that expression of many (72 of 179) iron-regulated genes is dependent on FIT1. We demonstrate that FIT1 regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation. We propose a new model for iron uptake in Arabidopsis where FRO2 and IRT1 are differentially regulated by FIT1.

  14. Conservation of Three-Dimensional Helix-Loop-Helix Structure through the Vertebrate Lineage Reopens the Cold Case of Gonadotropin-Releasing Hormone-Associated Peptide.

    PubMed

    Pérez Sirkin, Daniela I; Lafont, Anne-Gaëlle; Kamech, Nédia; Somoza, Gustavo M; Vissio, Paula G; Dufour, Sylvie

    2017-01-01

    GnRH-associated peptide (GAP) is the C-terminal portion of the gonadotropin-releasing hormone (GnRH) preprohormone. Although it was reported in mammals that GAP may act as a prolactin-inhibiting factor and can be co-secreted with GnRH into the hypophyseal portal blood, GAP has been practically out of the research circuit for about 20 years. Comparative studies highlighted the low conservation of GAP primary amino acid sequences among vertebrates, contributing to consider that this peptide only participates in the folding or carrying process of GnRH. Considering that the three-dimensional (3D) structure of a protein may define its function, the aim of this study was to evaluate if GAP sequences and 3D structures are conserved in the vertebrate lineage. GAP sequences from various vertebrates were retrieved from databases. Analysis of primary amino acid sequence identity and similarity, molecular phylogeny, and prediction of 3D structures were performed. Amino acid sequence comparison and phylogeny analyses confirmed the large variation of GAP sequences throughout vertebrate radiation. In contrast, prediction of the 3D structure revealed a striking conservation of the 3D structure of GAP1 (GAP associated with the hypophysiotropic type 1 GnRH), despite low amino acid sequence conservation. This GAP1 peptide presented a typical helix-loop-helix (HLH) structure in all the vertebrate species analyzed. This HLH structure could also be predicted for GAP2 in some but not all vertebrate species and in none of the GAP3 analyzed. These results allowed us to infer that selective pressures have maintained GAP1 HLH structure throughout the vertebrate lineage. The conservation of the HLH motif, known to confer biological activity to various proteins, suggests that GAP1 peptides may exert some hypophysiotropic biological functions across vertebrate radiation.

  15. Reovirus FAST Proteins Drive Pore Formation and Syncytiogenesis Using a Novel Helix-Loop-Helix Fusion-Inducing Lipid Packing Sensor.

    PubMed

    Read, Jolene; Clancy, Eileen K; Sarker, Muzaddid; de Antueno, Roberto; Langelaan, David N; Parmar, Hiren B; Shin, Kyungsoo; Rainey, Jan K; Duncan, Roy

    2015-06-01

    Pore formation is the most energy-demanding step during virus-induced membrane fusion, where high curvature of the fusion pore rim increases the spacing between lipid headgroups, exposing the hydrophobic interior of the membrane to water. How protein fusogens breach this thermodynamic barrier to pore formation is unclear. We identified a novel fusion-inducing lipid packing sensor (FLiPS) in the cytosolic endodomain of the baboon reovirus p15 fusion-associated small transmembrane (FAST) protein that is essential for pore formation during cell-cell fusion and syncytiogenesis. NMR spectroscopy and mutational studies indicate the dependence of this FLiPS on a hydrophobic helix-loop-helix structure. Biochemical and biophysical assays reveal the p15 FLiPS preferentially partitions into membranes with high positive curvature, and this partitioning is impeded by bis-ANS, a small molecule that inserts into hydrophobic defects in membranes. Most notably, the p15 FLiPS can be functionally replaced by heterologous amphipathic lipid packing sensors (ALPS) but not by other membrane-interactive amphipathic helices. Furthermore, a previously unrecognized amphipathic helix in the cytosolic domain of the reptilian reovirus p14 FAST protein can functionally replace the p15 FLiPS, and is itself replaceable by a heterologous ALPS motif. Anchored near the cytoplasmic leaflet by the FAST protein transmembrane domain, the FLiPS is perfectly positioned to insert into hydrophobic defects that begin to appear in the highly curved rim of nascent fusion pores, thereby lowering the energy barrier to stable pore formation.

  16. Reovirus FAST Proteins Drive Pore Formation and Syncytiogenesis Using a Novel Helix-Loop-Helix Fusion-Inducing Lipid Packing Sensor

    PubMed Central

    Sarker, Muzaddid; de Antueno, Roberto; Langelaan, David N.; Parmar, Hiren B.; Shin, Kyungsoo; Rainey, Jan K.; Duncan, Roy

    2015-01-01

    Pore formation is the most energy-demanding step during virus-induced membrane fusion, where high curvature of the fusion pore rim increases the spacing between lipid headgroups, exposing the hydrophobic interior of the membrane to water. How protein fusogens breach this thermodynamic barrier to pore formation is unclear. We identified a novel fusion-inducing lipid packing sensor (FLiPS) in the cytosolic endodomain of the baboon reovirus p15 fusion-associated small transmembrane (FAST) protein that is essential for pore formation during cell-cell fusion and syncytiogenesis. NMR spectroscopy and mutational studies indicate the dependence of this FLiPS on a hydrophobic helix-loop-helix structure. Biochemical and biophysical assays reveal the p15 FLiPS preferentially partitions into membranes with high positive curvature, and this partitioning is impeded by bis-ANS, a small molecule that inserts into hydrophobic defects in membranes. Most notably, the p15 FLiPS can be functionally replaced by heterologous amphipathic lipid packing sensors (ALPS) but not by other membrane-interactive amphipathic helices. Furthermore, a previously unrecognized amphipathic helix in the cytosolic domain of the reptilian reovirus p14 FAST protein can functionally replace the p15 FLiPS, and is itself replaceable by a heterologous ALPS motif. Anchored near the cytoplasmic leaflet by the FAST protein transmembrane domain, the FLiPS is perfectly positioned to insert into hydrophobic defects that begin to appear in the highly curved rim of nascent fusion pores, thereby lowering the energy barrier to stable pore formation. PMID:26061049

  17. A cell-penetrating peptide suppresses the hypoxia inducible factor-1 function by binding to the helix-loop-helix domain of the aryl hydrocarbon receptor nuclear translocator.

    PubMed

    Wang, Yu; Thompson, John D; Chan, William K

    2013-04-25

    The heterodimeric hypoxia inducible factor-1 (HIF-1) complex is composed of the hypoxia inducible factor-1 alpha (HIF-1α) and the aryl hydrocarbon receptor nuclear translocator (ARNT). Activation of the HIF-1 function is essential for tumor growth and metastasis. We previously showed that transfection of a plasmid containing an ARNT-interacting peptide (Ainp1) cDNA suppresses the HIF-1 signaling in Hep3B cells. Here we generated TAT fusion of the Ainp1 peptide (6His-TAT-Ainp1) to determine whether and how the Ainp1 peptide suppresses the HIF-1 function. The bacterially expressed 6His-TAT-Ainp1 was purified under denatured condition and then refolded by limited dialysis. The refolded 6His-TAT-Ainp1 interacts with the helix-loop-helix (HLH) domain of ARNT in a similar fashion as the native 6His-Ainp1. 6His-TAT-Ainp1 colocalizes with ARNT in the nucleus of HeLa and Hep3B cells after protein transduction. The transduced protein reaches the maximum intracellular levels within 2 h while remains detectable up to 96 h in HeLa cells. At 2 μM concentration, 6His-TAT-Ainp1 is not cytotoxic in HeLa cells but suppresses the cobalt chloride-activated, hypoxia responsive enhancer-driven luciferase expression in a dose-dependent manner. In addition, it decreases the cobalt chloride-dependent induction of the HIF-1 target genes at both the message (vascular endothelial growth factor and aldolase C) and protein (carbonic anhydrase IX and glucose transporter 1) levels. The protein levels of HIF-1α and ARNT are not altered in the presence of 6His-TAT-Ainp1. In summary, we provided evidence to support that the Ainp1 peptide directly suppresses the HIF-1 function by interacting with the ARNT HLH domain, and in turn interfering with the heterodimerization of HIF-1α and ARNT. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. GTF2IRD2 is located in the Williams-Beuren syndrome critical region 7q11.23 and encodes a protein with two TFII-I-like helix-loop-helix repeats.

    PubMed

    Makeyev, Aleksandr V; Erdenechimeg, Lkhamsuren; Mungunsukh, Ognoon; Roth, Jutta J; Enkhmandakh, Badam; Ruddle, Frank H; Bayarsaihan, Dashzeveg

    2004-07-27

    Williams-Beuren syndrome (also known as Williams syndrome) is caused by a deletion of a 1.55- to 1.84-megabase region from chromosome band 7q11.23. GTF2IRD1 and GTF2I, located within this critical region, encode proteins of the TFII-I family with multiple helix-loop-helix domains known as I repeats. In the present work, we characterize a third member, GTF2IRD2, which has sequence and structural similarity to the GTF2I and GTF2IRD1 paralogs. The ORF encodes a protein with several features characteristic of regulatory factors, including two I repeats, two leucine zippers, and a single Cys-2/His-2 zinc finger. The genomic organization of human, baboon, rat, and mouse genes is well conserved. Our exon-by-exon comparison has revealed that GTF2IRD2 is more closely related to GTF2I than to GTF2IRD1 and apparently is derived from the GTF2I sequence. The comparison of GTF2I and GTF2IRD2 genes revealed two distinct regions of homology, indicating that the helix-loop-helix domain structure of the GTF2IRD2 gene has been generated by two independent genomic duplications. We speculate that GTF2I is derived from GTF2IRD1 as a result of local duplication and the further evolution of its structure was associated with its functional specialization. Comparison of genomic sequences surrounding GTF2IRD2 genes in mice and humans allows refinement of the centromeric breakpoint position of the primate-specific inversion within the Williams-Beuren syndrome critical region.

  19. Proteins mediating DNA loops effectively block transcription.

    PubMed

    Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David

    2017-07-01

    Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  20. High AN1 variability and interaction with basic helix-loop-helix co-factors related to anthocyanin biosynthesis in potato leaves.

    PubMed

    D'Amelia, Vincenzo; Aversano, Riccardo; Batelli, Giorgia; Caruso, Immacolata; Castellano Moreno, Mar; Castro-Sanz, Ana Beatriz; Chiaiese, Pasquale; Fasano, Carlo; Palomba, Francesca; Carputo, Domenico

    2014-11-01

    AN1 is a regulatory gene that promotes anthocyanin biosynthesis in potato tubers and encodes a R2R3 MYB transcription factor. However, no clear evidence implicates AN1 in anthocyanin production in leaves, where these pigments might enhance environmental stress tolerance. In our study we found that AN1 displays intraspecific sequence variability in both coding/non-coding regions and in the promoter, and that its expression is associated with high anthocyanin content in leaves of commercial potatoes. Expression analysis provided evidence that leaf pigmentation is associated to AN1 expression and that StJAF13 acts as putative AN1 co-regulator for anthocyanin gene expression in leaves of the red leaf variety 'Magenta Love,' while a concomitant expression of StbHLH1 may contribute to anthocyanin accumulation in leaves of 'Double Fun.' Yeast two-hybrid experiments confirmed that AN1 interacts with StbHLH1 and StJAF13 and the latter interaction was verified and localized in the cell nucleus by bimolecular fluorescence complementation assays. In addition, transgenic tobacco (Nicotiana tabacum) overexpressing a combination of either AN1 with StJAF13 or AN1 with StbHLH1 showed deeper purple pigmentation with respect to AN1 alone. This further confirmed AN1/StJAF13 and AN1/StbHLH1 interactions. Our findings demonstrate that the classical loci identified for potato leaf anthocyanin accumulation correspond to AN1 and may represent an important step to expand our knowledge on the molecular mechanisms underlying anthocyanin biosynthesis in different plant tissues.

  1. The expression of proprotein convertase PACE4 is highly regulated by Hash-2 in placenta: possible role of placenta-specific basic helix-loop-helix transcription factor, human achaete-scute homologue-2.

    PubMed

    Koide, Shizuyo; Yoshida, Ichiro; Tsuji, Akihiko; Matsuda, Yoshiko

    2003-09-01

    PACE4 is a member of the mammalian subtilisin-like proprotein convertase (SPC) family, which contribute to the activation of transforming growth factor (TGF) beta family proteins. We previously reported that PACE4 is highly expressed in syncytiotrophoblasts of human placenta [Tsuji et al. (2003) BIOCHIM: Biophys. Acta 1645, 95-104]. In this study, the regulatory mechanism for PACE4 expression in placenta was analyzed using a human placental choriocarcinoma cell line, BeWo cells. Promoter analysis indicated that an E-box cluster (E4-E9) in the 5'-flanking region of the PACE4 gene acts as a negative regulatory element. The binding of human achaete-scute homologue 2 (Hash-2) to the E-box cluster was shown by gel mobility-shift assay. The overexpression of Hash-2 caused a marked decrease in PACE4 gene expression. When BeWo cells were grown under low oxygen (2%) conditions, the expression of Hash-2 decreased, while that of PACE4 increased. In both cases, other SPCs, such as furin, PC5/6, and PC7/8, were not affected. Further, PACE4 expression was found to be developmentally regulated in rat placenta. By in situ hybridization, Mash-2 (mammalian achaete-scute homologue 2) mRNA was found to be expressed in the spongiotrophoblast layer where PACE4 was not expressed. In contrast, the PACE4 mRNA was expressed mainly in the labyrinthine layer where Mash-2 was not detected. These results suggest that PACE4 expression is down-regulated by Hash-2/Mash-2 in both human and rat placenta and that many bioactive proteins might be regulated by PACE4 activity.

  2. Arabidopsis CRY2 and ZTL mediate blue-light regulation of the transcription factor CIB1 by distinct mechanisms.

    PubMed

    Liu, Hongtao; Wang, Qin; Liu, Yawen; Zhao, Xiaoying; Imaizumi, Takato; Somers, David E; Tobin, Elaine M; Lin, Chentao

    2013-10-22

    Plants possess multiple photoreceptors to mediate light regulation of growth and development, but it is not well understood how different photoreceptors coordinate their actions to jointly regulate developmental responses, such as flowering time. In Arabidopsis, the photoexcited cryptochrome 2 interacts with the transcription factor CRYPTOCHROME-INTERACTING basic helix-loop-helix 1 (CIB1) to activate transcription and floral initiation. We show that the CIB1 protein expression is regulated by blue light; CIB1 is highly expressed in plants exposed to blue light, but levels of the CIB1 protein decreases in the absence of blue light. We demonstrate that CIB1 is degraded by the 26S proteasome and that blue light suppresses CIB1 degradation. Surprisingly, although cryptochrome 2 physically interacts with CIB1 in response to blue light, it is not the photoreceptor mediating blue-light suppression of CIB1 degradation. Instead, two of the three light-oxygen-voltage (LOV)-domain photoreceptors, ZEITLUPE and LOV KELCH PROTEIN 2, but not FLAVIN-BINDING KELCH REPEAT 1, are required for the function and blue-light suppression of degradation of CIB1. These results support the hypothesis that the evolutionarily unrelated blue-light receptors, cryptochrome and LOV-domain F-box proteins, mediate blue-light regulation of the same transcription factor by distinct mechanisms.

  3. Cloning of the Ah-receptor cDNA reveals a distinctive ligand-activated transcription factor.

    PubMed Central

    Burbach, K M; Poland, A; Bradfield, C A

    1992-01-01

    A cDNA encoding the murine Ah receptor (Ahb-1 allele for aromatic hydrocarbon responsiveness) has been isolated and characterized. Analysis of the deduced protein sequence revealed a region with similarity to the basic region/helix-loop-helix (BR/HLH) motif found in many transcription factors that undergo dimerization for function. In addition to the BR/HLH domain, the N-terminal domain of the Ah receptor has extensive sequence similarity to the human ARNT (aryl hydrocarbon receptor nuclear translocator) protein and two regulatory proteins of Drosophila, Sim and Per. Photoaffinity labeling and peptide mapping studies indicate that the Ah receptor binds agonist at a domain that lies within this conserved N-terminal domain. The Ah receptor appears to be a ligand-activated transcription factor with a helix-loop-helix motif similar to those found in a variety of DNA-binding proteins, including Myc and MyoD. Images PMID:1325649

  4. Carboxylation of cytosine (5caC) in the CG dinucleotide in the E-box motif (CGCAG|GTG) increases binding of the Tcf3|Ascl1 helix-loop-helix heterodimer 10-fold.

    PubMed

    Golla, Jaya Prakash; Zhao, Jianfei; Mann, Ishminder K; Sayeed, Syed K; Mandal, Ajeet; Rose, Robert B; Vinson, Charles

    2014-06-27

    Three oxidative products of 5-methylcytosine (5mC) occur in mammalian genomes. We evaluated if these cytosine modifications in a CG dinucleotide altered DNA binding of four B-HLH homodimers and three heterodimers to the E-Box motif CGCAG|GTG. We examined 25 DNA probes containing all combinations of cytosine in a CG dinucleotide and none changed binding except for carboxylation of cytosine (5caC) in the strand CGCAG|GTG. 5caC enhanced binding of all examined B-HLH homodimers and heterodimers, particularly the Tcf3|Ascl1 heterodimer which increased binding ~10-fold. These results highlight a potential function of the oxidative products of 5mC, changing the DNA binding of sequence-specific transcription factors.

  5. Responses of a triple mutant defective in three iron deficiency-induced Basic Helix-Loop-Helix genes of the subgroup Ib(2) to iron deficiency and salicylic acid.

    PubMed

    Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra

    2014-01-01

    Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves.

  6. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors

    PubMed Central

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V.; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C.

    2016-01-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs, StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13 are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1, StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation. PMID:26884602

  7. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors.

    PubMed

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C

    2016-04-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs,StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13a re key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1,StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation.

  8. Experimental determination of the evolvability of a transcription factor.

    PubMed

    Maerkl, Sebastian J; Quake, Stephen R

    2009-11-03

    Sequence-specific binding of a transcription factor to DNA is the central event in any transcriptional regulatory network. However, relatively little is known about the evolutionary plasticity of transcription factors. For example, the exact functional consequence of an amino acid substitution on the DNA-binding specificity of most transcription factors is currently not predictable. Furthermore, although the major structural families of transcription factors have been identified, the detailed DNA-binding repertoires within most families have not been characterized. We studied the sequence recognition code and evolvability of the basic helix-loop-helix transcription factor family by creating all possible 95 single-point mutations of five DNA-contacting residues of Max, a human helix-loop-helix transcription factor and measured the detailed DNA-binding repertoire of each mutant. Our results show that the sequence-specific repertoire of Max accessible through single-point mutations is extremely limited, and we are able to predict 92% of the naturally occurring diversity at these positions. All naturally occurring basic regions were also found to be accessible through functional intermediates. Finally, we observed a set of amino acids that are functional in vitro but are not found to be used naturally, indicating that functionality alone is not sufficient for selection.

  9. Poplar MYB115 and MYB134 Transcription Factors Regulate Proanthocyanidin Synthesis and Structure1[OPEN

    PubMed Central

    Ma, Dawei; Mellway, Robin; Yoshida, Kazuko; Tran, Lan; Stewart, Don; Reichelt, Michael; Salminen, Juha-Pekka; Séguin, Armand

    2017-01-01

    The accumulation of proanthocyanidins is regulated by a complex of transcription factors composed of R2R3 MYB, basic helix-loop-helix, and WD40 proteins that activate the promoters of biosynthetic genes. In poplar (genus Populus), MYB134 is known to regulate proanthocyanidin biosynthesis by activating key flavonoid genes. Here, we characterize a second MYB regulator of proanthocyanidins, MYB115. Transgenic poplar overexpressing MYB115 showed a high-proanthocyanidin phenotype and reduced salicinoid accumulation, similar to the effects of MYB134 overexpression. Transcriptomic analysis of MYB115- and MYB134-overexpressing poplar plants identified a set of common up-regulated genes encoding proanthocyanidin biosynthetic enzymes and several novel uncharacterized MYB transcriptional repressors. Transient expression experiments demonstrated the capacity of both MYB134 and MYB115 to activate flavonoid promoters, but only in the presence of a basic helix-loop-helix cofactor. Yeast two-hybrid experiments confirmed the direct interaction of these transcription factors. The unexpected identification of dihydromyricetin in leaf extracts of both MYB115- and MYB134-overexpressing poplar led to the discovery of enhanced flavonoid B-ring hydroxylation and an increased proportion of prodelphinidins in proanthocyanidin of the transgenics. The dramatic hydroxylation phenotype of MYB115 overexpressors is likely due to the up-regulation of both flavonoid 3′,5′-hydroxylases and cytochrome b5. Overall, this work provides new insight into the complexity of the gene regulatory network for proanthocyanidin synthesis in poplar. PMID:28348066

  10. Poplar MYB115 and MYB134 Transcription Factors Regulate Proanthocyanidin Synthesis and Structure.

    PubMed

    James, Amy Midori; Ma, Dawei; Mellway, Robin; Gesell, Andreas; Yoshida, Kazuko; Walker, Vincent; Tran, Lan; Stewart, Don; Reichelt, Michael; Suvanto, Jussi; Salminen, Juha-Pekka; Gershenzon, Jonathan; Séguin, Armand; Constabel, C Peter

    2017-05-01

    The accumulation of proanthocyanidins is regulated by a complex of transcription factors composed of R2R3 MYB, basic helix-loop-helix, and WD40 proteins that activate the promoters of biosynthetic genes. In poplar (genus Populus), MYB134 is known to regulate proanthocyanidin biosynthesis by activating key flavonoid genes. Here, we characterize a second MYB regulator of proanthocyanidins, MYB115. Transgenic poplar overexpressing MYB115 showed a high-proanthocyanidin phenotype and reduced salicinoid accumulation, similar to the effects of MYB134 overexpression. Transcriptomic analysis of MYB115- and MYB134-overexpressing poplar plants identified a set of common up-regulated genes encoding proanthocyanidin biosynthetic enzymes and several novel uncharacterized MYB transcriptional repressors. Transient expression experiments demonstrated the capacity of both MYB134 and MYB115 to activate flavonoid promoters, but only in the presence of a basic helix-loop-helix cofactor. Yeast two-hybrid experiments confirmed the direct interaction of these transcription factors. The unexpected identification of dihydromyricetin in leaf extracts of both MYB115- and MYB134-overexpressing poplar led to the discovery of enhanced flavonoid B-ring hydroxylation and an increased proportion of prodelphinidins in proanthocyanidin of the transgenics. The dramatic hydroxylation phenotype of MYB115 overexpressors is likely due to the up-regulation of both flavonoid 3',5'-hydroxylases and cytochrome b5 Overall, this work provides new insight into the complexity of the gene regulatory network for proanthocyanidin synthesis in poplar. © 2017 American Society of Plant Biologists. All Rights Reserved.

  11. The Freud-1/CC2D1A family: transcriptional regulators implicated in mental retardation.

    PubMed

    Rogaeva, Anastasia; Galaraga, Kimberly; Albert, Paul R

    2007-10-01

    The CC2D1A gene family consists of two homologous genes, Freud-1/CC2D1A and Freud-2/CC2D1B, that share conserved domains, including several DM14 domains that are specific to this protein family, a C-terminal helix-loop-helix domain, and a C2 calcium-dependent phospholipid binding domain. Although the function of Freud-2 is unknown, Freud-1 has been shown to function as a transcriptional repressor of the serotonin-1A receptor gene that binds to a novel DNA element (FRE, 5'-repressor element). The DNA binding and repressor activities of Freud-1 are inhibited by calcium-calmodulin-dependent protein kinase. Recently, a deletion in the CC2D1A gene has been linked to nonsyndromic mental retardation. This deletion results in the truncation of the helix-loop-helix DNA binding and the C2 domains, crucial for Freud-1 repressor activity, and hence is predicted to generate an inactive or weakly dominant negative protein. The possible mechanisms by which inactivation of Freud-1 could lead to abnormal cortical development and cognitive impairment and the potential roles of Freud-1 gene targets are discussed.

  12. Cdk2-dependent phosphorylation of Id2 modulates activity of E2A-related transcription factors.

    PubMed Central

    Hara, E; Hall, M; Peters, G

    1997-01-01

    The helix-loop-helix (HLH) protein Id2 is thought to affect the balance between cell growth and differentiation by negatively regulating the function of basic-helix-loop-helix (bHLH) transcription factors. Id2 acts by forming heterodimers that are unable to bind to specific (E-box) DNA sequences. Here we show that this activity can be overcome by phosphorylation of a serine residue within a consensus target site for cyclin-dependent kinases (Cdks). In vitro, Id2 can be phosphorylated by either cyclin E-Cdk2 or cyclin A-Cdk2 but not by cyclin D-dependent kinases. Analogous phosphorylation occurs in serum-stimulated human diploid fibroblasts at a time in late G1 consistent with the appearance of active cyclin E-Cdk2. The phosphorylation of Id2 in these cells correlates with the restoration of a distinct E-box-dependent DNA-binding complex, suggesting that the levels of this complex are modulated by both the abundance and phosphorylation status of Id2. These data provide a link between cyclin-dependent kinases and bHLH transcription factors that may be critical for the regulation of cell proliferation and differentiation. PMID:9029153

  13. Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product

    NASA Astrophysics Data System (ADS)

    Rustgi, Anil K.; Dyson, Nicholas; Bernards, Rene

    1991-08-01

    THE proteins encoded by the myc gene family are involved in the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms1. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/helix-loop-helix and a leucine zipper motif, respectively. These motifs are involved both in DNA binding and in protein dimerization2-5. In addition, myc protein family members share several regions of highly conserved amino acids in their amino termini that are essential for transformation6,7. We report here that an N-terminal domain present in both the c-myc and N-myc proteins mediates binding to the retinoblastoma gene product, pRb. We show that the human papilloma virus E7 protein competes with c-myc for binding to pRb, indicating that these proteins share overlapping binding sites on pRb. Furthermore, a mutant Rb protein from a human tumour cell line that carried a 35-amino-acid deletion in its C terminus failed to bind to c-myc. Our results suggest that c-myc and pRb cooperate through direct binding to control cell proliferation.

  14. Epigenetic regulation of puberty via Zinc finger protein-mediated transcriptional repression

    PubMed Central

    Lomniczi, Alejandro; Wright, Hollis; Castellano, Juan Manuel; Matagne, Valerie; Toro, Carlos A.; Ramaswamy, Suresh; Plant, Tony M.; Ojeda, Sergio R.

    2015-01-01

    In primates, puberty is unleashed by increased GnRH release from the hypothalamus following an interval of juvenile quiescence. GWAS implicates Zinc finger (ZNF) genes in timing human puberty. Here we show that hypothalamic expression of several ZNFs decreased in agonadal male monkeys in association with the pubertal reactivation of gonadotropin secretion. Expression of two of these ZNFs, GATAD1 and ZNF573, also decreases in peripubertal female monkeys. However, only GATAD1 abundance increases when gonadotropin secretion is suppressed during late infancy. Targeted delivery of GATAD1 or ZNF573 to the rat hypothalamus delays puberty by impairing the transition of a transcriptional network from an immature repressive epigenetic configuration to one of activation. GATAD1 represses transcription of two key puberty-related genes, KISS1 and TAC3, directly, and reduces the activating histone mark H3K4me2 at each promoter via recruitment of histone demethylase KDM1A. We conclude that GATAD1 epitomizes a subset of ZNFs involved in epigenetic repression of primate puberty. PMID:26671628

  15. The bHLH Transcription Factor HBI1 Mediates the Trade-Off between Growth and Pathogen-Associated Molecular Pattern–Triggered Immunity in Arabidopsis[W][OPEN

    PubMed Central

    Fan, Min; Bai, Ming-Yi; Kim, Jung-Gun; Wang, Tina; Oh, Eunkyoo; Chen, Lawrence; Park, Chan Ho; Son, Seung-Hyun; Kim, Seong-Ki; Mudgett, Mary Beth; Wang, Zhi-Yong

    2014-01-01

    The trade-off between growth and immunity is crucial for survival in plants. However, the mechanism underlying growth-immunity balance has remained elusive. The PRE-IBH1-HBI1 tripartite helix-loop-helix/basic helix-loop-helix module is part of a central transcription network that mediates growth regulation by several hormonal and environmental signals. Here, genome-wide analyses of HBI1 target genes show that HBI1 regulates both overlapping and unique targets compared with other DNA binding components of the network in Arabidopsis thaliana, supporting a role in specifying network outputs and fine-tuning feedback regulation. Furthermore, HBI1 negatively regulates a subset of genes involved in immunity, and pathogen-associated molecular pattern (PAMP) signals repress HBI1 transcription. Constitutive overexpression and loss-of-function experiments show that HBI1 inhibits PAMP-induced growth arrest, defense gene expression, reactive oxygen species production, and resistance to pathogen. These results show that HBI1, as a component of the central growth regulation circuit, functions as a major node of crosstalk that mediates a trade-off between growth and immunity in plants. PMID:24550223

  16. Transcriptional Control of Early T and B Cell Developmental Choices

    PubMed Central

    Rothenberg, Ellen V.

    2014-01-01

    T and B cells share a common somatic gene rearrangement mechanism for assembling the genes that code for their antigen receptors and developmental pathways with many parallels. Shared usage of basic helix-loop-helix E proteins as transcriptional drivers underlies these common features. However, the transcription factor networks in which these E proteins are embedded are different both in membership and in architecture for T and B cell gene regulatory programs. These differences permit lineage commitment decisions to be made in different hierarchical orders. Furthermore, in a contrast to B-cell gene networks, the T-cell gene network architecture for effector differentiation is sufficiently modular so that E protein inputs can be removed. Complete “T-cell-like” effector differentiation can proceed without T-cell receptor rearrangement or selection when E proteins are neutralized, yielding natural killer and other innate lymphoid cells. PMID:24471430

  17. Id1 regulates angiogenesis through transcriptional repression of thrombospondin-1.

    PubMed

    Volpert, Olga V; Pili, Roberto; Sikder, Hashmat A; Nelius, Thomas; Zaichuk, Tetiana; Morris, Chad; Shiflett, Clinton B; Devlin, Meghann K; Conant, Katherine; Alani, Rhoda M

    2002-12-01

    Id proteins are helix-loop-helix transcription factors that regulate tumor angiogenesis. In order to identify downstream effectors of Id1 involved in the regulation of angiogenesis, we performed PCR-select subtractive hybridization on wild-type and Id1 knockout mouse embryo fibroblasts (MEFs). Here we demonstrate that thrombospondin-1 (TSP-1), a potent inhibitor of angiogenesis, is a target of transcriptional repression by Id1. We also show that Id1-null MEFs secrete an inhibitor of endothelial cell migration, which is completely inactivated by depletion of TSP-1. Furthermore, in vivo studies revealed decreased neovascularization in matrigel assays in Id1-null mice compared to their wild-type littermates. This decrease was completely reversed by a TSP-1 neutralizing antibody. We conclude that TSP-1 is a major target for Id1 effects on angiogenesis.

  18. The Transcriptional Coregulator LEUNIG_HOMOLOG Inhibits Light-Dependent Seed Germination in Arabidopsis

    PubMed Central

    Lee, Nayoung; Park, Jeongmoo; Kim, Keunhwa; Choi, Giltsu

    2015-01-01

    PHYTOCHROME-INTERACTING FACTOR1 (PIF1) is a basic helix-loop-helix transcription factor that inhibits light-dependent seed germination in Arabidopsis thaliana. However, it remains unclear whether PIF1 requires other factors to regulate its direct targets. Here, we demonstrate that LEUNIG_HOMOLOG (LUH), a Groucho family transcriptional corepressor, binds to PIF1 and coregulates its targets. Not only are the transcriptional profiles of the luh and pif1 mutants remarkably similar, more than 80% of the seeds of both genotypes germinate in the dark. We show by chromatin immunoprecipitation that LUH binds a subset of PIF1 targets in a partially PIF1-dependent manner. Unexpectedly, we found LUH binds and coregulates not only PIF1-activated targets but also PIF1-repressed targets. Together, our results indicate LUH functions with PIF1 as a transcriptional coregulator to inhibit seed germination. PMID:26276832

  19. Direct detection of transcription factors in cotyledons during seedling development using sensitive silicon-substrate photonic crystal protein arrays.

    PubMed

    Jones, Sarah I; Tan, Yafang; Shamimuzzaman, Md; George, Sherine; Cunningham, Brian T; Vodkin, Lila

    2015-03-01

    Transcription factors control important gene networks, altering the expression of a wide variety of genes, including those of agronomic importance, despite often being expressed at low levels. Detecting transcription factor proteins is difficult, because current high-throughput methods may not be sensitive enough. One-dimensional, silicon-substrate photonic crystal (PC) arrays provide an alternative substrate for printing multiplexed protein microarrays that have greater sensitivity through an increased signal-to-noise ratio of the fluorescent signal compared with performing the same assay upon a traditional aminosilanized glass surface. As a model system to test proof of concept of the silicon-substrate PC arrays to directly detect rare proteins in crude plant extracts, we selected representatives of four different transcription factor families (zinc finger GATA, basic helix-loop-helix, BTF3/NAC [for basic transcription factor of the NAC family], and YABBY) that have increasing transcript levels during the stages of seedling cotyledon development. Antibodies to synthetic peptides representing the transcription factors were printed on both glass slides and silicon-substrate PC slides along with antibodies to abundant cotyledon proteins, seed lectin, and Kunitz trypsin inhibitor. The silicon-substrate PC arrays proved more sensitive than those performed on glass slides, detecting rare proteins that were below background on the glass slides. The zinc finger transcription factor was detected on the PC arrays in crude extracts of all stages of the seedling cotyledons, whereas YABBY seemed to be at the lower limit of their sensitivity. Interestingly, the basic helix-loop-helix and NAC proteins showed developmental profiles consistent with their transcript patterns, indicating proof of concept for detecting these low-abundance proteins in crude extracts.

  20. Unique CCT repeats mediate transcription of the TWIST1 gene in mesenchymal cell lines

    SciTech Connect

    Ohkuma, Mizue; Funato, Noriko; Higashihori, Norihisa; Murakami, Masanori; Ohyama, Kimie; Nakamura, Masataka . E-mail: naka.gene@cmn.tmd.ac.jp

    2007-01-26

    TWIST1, a basic helix-loop-helix transcription factor, plays critical roles in embryo development, cancer metastasis and mesenchymal progenitor differentiation. Little is known about transcriptional regulation of TWIST1 expression. Here we identified DNA sequences responsible for TWIST1 expression in mesenchymal lineage cell lines. Reporter assays with TWIST1 promoter mutants defined the -102 to -74 sequences that are essential for TWIST1 expression in human and mouse mesenchymal cell lines. Tandem repeats of CCT, but not putative CREB and NF-{kappa}B sites in the sequences substantially supported activity of the TWIST1 promoter. Electrophoretic mobility shift assay demonstrated that the DNA sequences with the CCT repeats formed complexes with nuclear factors, containing, at least, Sp1 and Sp3. These results suggest critical implication of the CCT repeats in association with Sp1 and Sp3 factors in sustaining expression of the TWIST1 gene in mesenchymal cells.

  1. Grasses use an alternatively wired bHLH transcription factor network to establish stomatal identity.

    PubMed

    Raissig, Michael T; Abrash, Emily; Bettadapur, Akhila; Vogel, John P; Bergmann, Dominique C

    2016-07-19

    Stomata, epidermal valves facilitating plant-atmosphere gas exchange, represent a powerful model for understanding cell fate and pattern in plants. Core basic helix-loop-helix (bHLH) transcription factors regulating stomatal development were identified in Arabidopsis, but this dicot's developmental pattern and stomatal morphology represent only one of many possibilities in nature. Here, using unbiased forward genetic screens, followed by analysis of reporters and engineered mutants, we show that stomatal initiation in the grass Brachypodium distachyon uses orthologs of stomatal regulators known from Arabidopsis but that the function and behavior of individual genes, the relationships among genes, and the regulation of their protein products have diverged. Our results highlight ways in which a kernel of conserved genes may be alternatively wired to produce diversity in patterning and morphology and suggest that the stomatal transcription factor module is a prime target for breeding or genome modification to improve plant productivity.

  2. Characterization of msim, a murine homologue of the Drosophila sim transcription factor

    SciTech Connect

    Moffett, P.; Reece, M.; Pelletier, J.

    1996-07-01

    Mutations in the Drosophila single-minded (sim) gene result in loss of precursor cells that give rise to midline cells of the embryonic central nervous system. During the course of an exon-trapping strategy aimed at identifying transcripts that contribute to the etiology and pathophysiology of Down syndrome, we identified a human exon from the Down syndrome, we identified a human exon from the Down syndrome critical region showing significantly homology to the Drosophila sim gene. Using a cross-hybridization approach, we have isolated a murine homolog of Drosophila sim gene, which we designated msim. Nucleotide and predicted amino acid sequence analyses of msim cDNA clones indicate the this gene encodes a member of the basic-helix-loop-helix class of transcription factors. The murine and Drosophila proteins share 88% residues within the basic-helix-loop helix domain, with an overall homology of 92%. In addition, the N-terminal domain of MSIM contains two PAS dimerization motifs also featured in the Drosophila sim gene product, as well as a small number of other transcription factors. Northern blot analysis of adult murine tissues revealed that the msim gene produces a single mRNA species of {approximately}4 kb expressed in a small number of tissues, with the highest levels in the kidneys and lower levels present in skeletal muscle, lung, testis, brain, and heart. In situ hybridization experiments demonstrate that msim is also expressed in early fetal development in the central nervous system and in cartilage primordia. The characteristics of the msim gene are consistent with its putative function as a transcriptional regulator. 51 refs., 6 figs., 1 tab.

  3. Direct Detection of Transcription Factors in Cotyledons during Seedling Development Using Sensitive Silicon-Substrate Photonic Crystal Protein Arrays1[OPEN

    PubMed Central

    Jones, Sarah I.; Tan, Yafang; Shamimuzzaman, Md; George, Sherine; Cunningham, Brian T.; Vodkin, Lila

    2015-01-01

    Transcription factors control important gene networks, altering the expression of a wide variety of genes, including those of agronomic importance, despite often being expressed at low levels. Detecting transcription factor proteins is difficult, because current high-throughput methods may not be sensitive enough. One-dimensional, silicon-substrate photonic crystal (PC) arrays provide an alternative substrate for printing multiplexed protein microarrays that have greater sensitivity through an increased signal-to-noise ratio of the fluorescent signal compared with performing the same assay upon a traditional aminosilanized glass surface. As a model system to test proof of concept of the silicon-substrate PC arrays to directly detect rare proteins in crude plant extracts, we selected representatives of four different transcription factor families (zinc finger GATA, basic helix-loop-helix, BTF3/NAC [for basic transcription factor of the NAC family], and YABBY) that have increasing transcript levels during the stages of seedling cotyledon development. Antibodies to synthetic peptides representing the transcription factors were printed on both glass slides and silicon-substrate PC slides along with antibodies to abundant cotyledon proteins, seed lectin, and Kunitz trypsin inhibitor. The silicon-substrate PC arrays proved more sensitive than those performed on glass slides, detecting rare proteins that were below background on the glass slides. The zinc finger transcription factor was detected on the PC arrays in crude extracts of all stages of the seedling cotyledons, whereas YABBY seemed to be at the lower limit of their sensitivity. Interestingly, the basic helix-loop-helix and NAC proteins showed developmental profiles consistent with their transcript patterns, indicating proof of concept for detecting these low-abundance proteins in crude extracts. PMID:25635113

  4. Brassinosteroid-Induced Transcriptional Repression and Dephosphorylation-Dependent Protein Degradation Negatively Regulate BIN2-Interacting AIF2 (a BR Signaling-Negative Regulator) bHLH Transcription Factor.

    PubMed

    Kim, Yoon; Song, Ji-Hye; Park, Seon-U; Jeong, You-Seung; Kim, Soo-Hwan

    2017-01-09

    Brassinosteroids (BRs) are plant polyhydroxy-steroids that play important roles in plant growth and development via extensive signal integration through direct interactions between regulatory components of different signaling pathways. Recent studies have shown that diverse helix-loop-helix/basic helix-loop-helix (HLH/bHLH) family proteins are actively involved in control of BR signaling pathways and interact with other signaling pathways. In this study, we show that ATBS1-INTERACTING FACTOR 2 (AIF2), a nuclear-localized atypical bHLH transcription factor, specifically interacts with BRASSINOSTEROID-INSENSITIVE 2 (BIN2) among other BR signaling molecules. Overexpression of AIF2 down-regulated transcript expression of growth-promoting genes, thus resulting in retardation of growth. AIF2 renders plants hyposensitive to BR-induced root growth inhibition, but shows little effects on BR-promoted hypocotyl elongation. Notably, AIF2 was dephosphorylated by BR, and the dephosphorylated AIF2 was subject to proteasome-mediated degradation. AIF2 degradation was greatly induced by BR and ABA, but relatively slightly by other hormones such as auxin, gibberellin, cytokinin and ethylene. Moreover, AIF2 transcription was significantly suppressed by a BRI1/BZR1-mediated BR signaling pathway through a direct binding of BRASSINAZOLE RESISTANT 1 (BZR1) to the BR response element (BRRE) region of the AIF2 promoter. In conclusion, our study suggests that BIN2-driven AIF2 phosphorylation could augment the BIN2/AIF2-mediated negative circuit of BR signaling pathways, and the BR-induced transcriptional repression and protein degradation negatively regulate AIF2 transcription factor, reinforcing the BZR1/BES1-mediated positive BR signaling pathway.

  5. XopD SUMO protease affects host transcription, promotes pathogen growth, and delays symptom development in xanthomonas-infected tomato leaves.

    PubMed

    Kim, Jung-Gun; Taylor, Kyle W; Hotson, Andrew; Keegan, Mark; Schmelz, Eric A; Mudgett, Mary Beth

    2008-07-01

    We demonstrate that XopD, a type III effector from Xanthomonas campestris pathovar vesicatoria (Xcv), suppresses symptom production during the late stages of infection in susceptible tomato (Solanum lycopersicum) leaves. XopD-dependent delay of tissue degeneration correlates with reduced chlorophyll loss, reduced salicylic acid levels, and changes in the mRNA abundance of senescence- and defense-associated genes despite high pathogen titers. Subsequent structure-function analyses led to the discovery that XopD is a DNA binding protein that alters host transcription. XopD contains a putative helix-loop-helix domain required for DNA binding and two conserved ERF-associated amphiphilic motifs required to repress salicylic acid- and jasmonic acid-induced gene transcription in planta. Taken together, these data reveal that XopD is a unique virulence factor in Xcv that alters host transcription, promotes pathogen multiplication, and delays the onset of leaf chlorosis and necrosis.

  6. XopD SUMO Protease Affects Host Transcription, Promotes Pathogen Growth, and Delays Symptom Development in Xanthomonas-Infected Tomato Leaves[W][OA

    PubMed Central

    Kim, Jung-Gun; Taylor, Kyle W.; Hotson, Andrew; Keegan, Mark; Schmelz, Eric A.; Mudgett, Mary Beth

    2008-01-01

    We demonstrate that XopD, a type III effector from Xanthomonas campestris pathovar vesicatoria (Xcv), suppresses symptom production during the late stages of infection in susceptible tomato (Solanum lycopersicum) leaves. XopD-dependent delay of tissue degeneration correlates with reduced chlorophyll loss, reduced salicylic acid levels, and changes in the mRNA abundance of senescence- and defense-associated genes despite high pathogen titers. Subsequent structure-function analyses led to the discovery that XopD is a DNA binding protein that alters host transcription. XopD contains a putative helix-loop-helix domain required for DNA binding and two conserved ERF-associated amphiphilic motifs required to repress salicylic acid– and jasmonic acid–induced gene transcription in planta. Taken together, these data reveal that XopD is a unique virulence factor in Xcv that alters host transcription, promotes pathogen multiplication, and delays the onset of leaf chlorosis and necrosis. PMID:18664616

  7. Dlx1&2 and Mash1 Transcription Factors Control MGE and CGE Patterning and Differentiation through Parallel and Overlapping Pathways

    PubMed Central

    Long, Jason E.; Cobos, Inma; Potter, Greg B.

    2009-01-01

    Here we define the expression of ∼100 transcription factors (TFs) in progenitors and neurons of the developing mouse medial and caudal ganglionic eminences, anlage of the basal ganglia and pallial interneurons. We have begun to elucidate the transcriptional hierarchy of these genes with respect to the Dlx homeodomain genes, which are essential for differentiation of most γ-aminobutyric acidergic projection neurons of the basal ganglia. This analysis identified Dlx-dependent and Dlx-independent pathways. The Dlx-independent pathway depends in part on the function of the Mash1 basic helix-loop-helix (b-HLH) TF. These analyses define core transcriptional components that differentially specify the identity and differentiation of the globus pallidus, basal telencephalon, and pallial interneurons. PMID:19386638

  8. Circadian transcription factor BMAL1 regulates innate immunity against select RNA viruses.

    PubMed

    Majumdar, Tanmay; Dhar, Jayeeta; Patel, Sonal; Kondratov, Roman; Barik, Sailen

    2017-02-01

    BMAL1 (brain and muscle ARNT-like protein 1, also known as MOP3 or ARNT3) belongs to the family of the basic helix-loop-helix (bHLH)-PAS domain-containing transcription factors, and is a key component of the molecular oscillator that generates circadian rhythms. Here, we report that BMAL1-deficient cells are significantly more susceptible to infection by two major respiratory viruses of the Paramyxoviridae family, namely RSV and PIV3. Embryonic fibroblasts from Bmal1(-/-) mice produced nearly 10-fold more progeny virus than their wild type controls. These results were supported by animal studies whereby pulmonary infection of RSV produced a more severe disease and morbidity in Bmal1(-/-)mice. These results show that BMAL1 can regulate cellular innate immunity against specific RNA viruses.

  9. Iron assimilation and transcription factor controlled synthesis of riboflavin in plants.

    PubMed

    Vorwieger, A; Gryczka, C; Czihal, A; Douchkov, D; Tiedemann, J; Mock, H-P; Jakoby, M; Weisshaar, B; Saalbach, I; Bäumlein, H

    2007-06-01

    Iron homeostasis is vital for many cellular processes and requires a precise regulation. Several iron efficient plants respond to iron starvation with the excretion of riboflavin and other flavins. Basic helix-loop-helix transcription factors (TF) are involved in the regulation of many developmental processes, including iron assimilation. Here we describe the isolation and characterisation of two Arabidopsis bHLH TF genes, which are strongly induced under iron starvation. Their heterologous ectopic expression causes constitutive, iron starvation independent excretion of riboflavin. The results show that both bHLH TFs represent an essential component of the regulatory pathway connecting iron deficiency perception and riboflavin excretion and might act as integrators of various stress reactions.

  10. Structural Determination of Functional Domains in Early B-cell Factor (EBF) Family of Transcription Factors Reveals Similarities to Rel DNA-binding Proteins and a Novel Dimerization Motif*

    PubMed Central

    Siponen, Marina I.; Wisniewska, Magdalena; Lehtiö, Lari; Johansson, Ida; Svensson, Linda; Raszewski, Grzegorz; Nilsson, Lennart; Sigvardsson, Mikael; Berglund, Helena

    2010-01-01

    The early B-cell factor (EBF) transcription factors are central regulators of development in several organs and tissues. This protein family shows low sequence similarity to other protein families, which is why structural information for the functional domains of these proteins is crucial to understand their biochemical features. We have used a modular approach to determine the crystal structures of the structured domains in the EBF family. The DNA binding domain reveals a striking resemblance to the DNA binding domains of the Rel homology superfamily of transcription factors but contains a unique zinc binding structure, termed zinc knuckle. Further the EBF proteins contain an IPT/TIG domain and an atypical helix-loop-helix domain with a novel type of dimerization motif. The data presented here provide insights into unique structural features of the EBF proteins and open possibilities for detailed molecular investigations of this important transcription factor family. PMID:20592035

  11. Three redundant brassinosteroid early response genes encode putative bHLH transcription factors required for normal growth.

    PubMed Central

    Friedrichsen, Danielle M; Nemhauser, Jennifer; Muramitsu, Takamichi; Maloof, Julin N; Alonso, José; Ecker, Joseph R; Furuya, Masaki; Chory, Joanne

    2002-01-01

    Brassinosteroids (BRs) are a class of polyhydroxylated steroids that are important regulators of plant growth and development. We have identified three closely related basic helix-loop-helix (bHLH) transcription factors, BEE1, BEE2, and BEE3, as products of early response genes required for full BR response. Comparison of the phenotypes of plants that overexpress BEE1 with bee1 bee2 bee3 triple-knockout mutant plants suggests that BEE1, BEE2, and BEE3 are functionally redundant positive regulators of BR signaling. Expression of BEE1, BEE2, and BEE3 is also regulated by other hormones, notably abscisic acid (ABA), a known antagonist of BR signaling. Reduced ABA response in plants overexpressing BEE1 suggests that BEE proteins may function as signaling intermediates in multiple pathways. PMID:12454087

  12. The Stepwise Increase in the Number of Transcription Factor Families in the Precambrian Predated the Diversification of Plants On Land.

    PubMed

    Catarino, Bruno; Hetherington, Alexander J; Emms, David M; Kelly, Steven; Dolan, Liam

    2016-11-01

    The colonization of the land by streptophytes and their subsequent radiation is a major event in Earth history. We report a stepwise increase in the number of transcription factor (TF) families and subfamilies in Archaeplastida before the colonization of the land. The subsequent increase in TF number on land was through duplication within existing TF families and subfamilies. Almost all subfamilies of the Homeodomain (HD) and basic Helix-Loop-Helix (bHLH) had evolved before the radiation of extant land plant lineages from a common ancestor. We demonstrate that the evolution of these TF families independently followed similar trends in both plants and metazoans; almost all extant HD and bHLH subfamilies were present in the first land plants and in the last common ancestor of bilaterians. These findings reveal that the majority of innovation in plant and metazoan TF families occurred in the Precambrian before the Phanerozoic radiation of land plants and metazoans.

  13. Genome Wide Identification and Characterization of Apple bHLH Transcription Factors and Expression Analysis in Response to Drought and Salt Stress

    PubMed Central

    Mao, Ke; Dong, Qinglong; Li, Chao; Liu, Changhai; Ma, Fengwang

    2017-01-01

    The bHLH (basic helix-loop-helix) transcription factor family is the second largest in plants. It occurs in all three eukaryotic kingdoms, and plays important roles in regulating growth and development. However, family members have not previously been studied in apple. Here, we identified 188 MdbHLH proteins in apple “Golden Delicious” (Malus × domestica Borkh.), which could be classified into 18 groups. We also investigated the gene structures and 12 conserved motifs in these MdbHLHs. Coupled with expression analysis and protein interaction network prediction, we identified several genes that might be responsible for abiotic stress responses. This study provides insight and rich resources for subsequent investigations of such proteins in apple. PMID:28443104

  14. A genomewide survey of bHLH transcription factors in the coral Acropora digitifera identifies three novel orthologous families, pearl, amber, and peridot.

    PubMed

    Gyoja, Fuki; Kawashima, Takeshi; Satoh, Nori

    2012-04-01

    Decoding the genome of the coral, Acropora digitifera, enabled us to characterize a nearly full set of 70 basic helix-loop-helix (bHLH) transcription factors in this organism. This number is comparable to 68 bHLH genes in the sea anemone, Nematostella vectensis, and larger than those in most other invertebrate metazoans. The 70 bHLH genes were assigned to 29 orthologous families previously reported. In addition, we identified three novel HLH orthologous families, which we designated pearl, amber, and peridot, increasing the number of orthologous families to 32. Pearl and amber orthologues were found in genomes and expressed sequenced tags (ESTs) of Mollusca and Annelida in addition to Cnidaria. Peridot orthologues were found in genomes and ESTs of Cephalochordata and Hemichordata in addition to Cnidaria. These three genes were likely lost in the clades of Drosophila melanogaster, Caenorhabditis elegans, and Homo sapiens during animal evolution.

  15. Activation of transcription initiation from a stable RNA promoter by a Fis protein-mediated DNA structural transmission mechanism.

    PubMed

    Opel, Michael L; Aeling, Kimberly A; Holmes, Walter M; Johnson, Reid C; Benham, Craig J; Hatfield, G Wesley

    2004-07-01

    The leuV operon of Escherichia coli encodes three of the four genes for the tRNA1Leu isoacceptors. Transcription from this and other stable RNA promoters is known to be affected by a cis-acting UP element and by Fis protein interactions with the carboxyl-terminal domain of the alpha-subunits of RNA polymerase. In this report, we suggest that transcription from the leuV promoter also is activated by a Fis-mediated, DNA supercoiling-dependent mechanism similar to the IHF-mediated mechanism described previously for the ilvP(G) promoter (S. D. Sheridan et al., 1998, J Biol Chem 273: 21298-21308). We present evidence that Fis binding results in the translocation of superhelical energy from the promoter-distal portion of a supercoiling-induced DNA duplex destabilized (SIDD) region to the promoter-proximal portion of the leuV promoter that is unwound within the open complex. A mutant Fis protein, which is defective in contacting the carboxyl-terminal domain of the alpha-subunits of RNA polymerase, remains competent for stimulating open complex formation, suggesting that this DNA supercoiling-dependent component of Fis-mediated activation occurs in the absence of specific protein interactions between Fis and RNA polymerase. Fis-mediated translocation of superhelical energy from upstream binding sites to the promoter region may be a general feature of Fis-mediated activation of transcription at stable RNA promoters, which often contain A+T-rich upstream sequences.

  16. Transcriptional regulation of the FSH receptor: new perspectives

    PubMed Central

    Hermann, Brian P.; Heckert, Leslie L.

    2013-01-01

    The cell-surface receptor for the gonadotropin follicle-stimulating hormone (FSH) is expressed exclusively on Sertoli cells of the testis and granulosa cells of the ovary. FSH signal transduction through its receptor (Fshr) is critical for the timing and maintenance of normal gametogenesis in the mammalian gonad. In the 13 years since the gene encoding Fshr was first cloned, the mechanisms controlling its transcription have been extensively examined, but a clear understanding of what drives its unique cell-specificity remains elusive. Current knowledge of basal Fshr transcription highlights the role of an E-box in the proximal promoter which is bound by the basic helix-loop-helix transcription factors upstream stimulatory factor 1 (Usf1) and Usf2. Recent studies utilizing knockout mice and chromatin immunoprecipitation validated the importance of Usf to Fshr transcription and demonstrated a sexually dimorphic requirement for the Usf proteins to maintain normal Fshr expression. Studies have also shown that the promoter region itself is insufficient for appropriate Fshr expression in transgenic mice, indicating Fshr transcription depends on regulatory elements that lie outside of the promoter. Identification of such elements has been propelled by recent availability of genome sequence data, which facilitated studies using comparative genomics, DNase I hypersensitivity mapping, and transgenic analysis with large fragments of DNA. This review will focus on the current understanding of transcriptional regulatory processes that control expression of rat Fshr, including recent advances from our laboratory. PMID:17084019

  17. The SCL gene is formed from a transcriptionally complex locus.

    PubMed Central

    Aplan, P D; Begley, C G; Bertness, V; Nussmeier, M; Ezquerra, A; Coligan, J; Kirsch, I R

    1990-01-01

    We describe the structural organization of the human SCL gene, a helix-loop-helix family member which we believe plays a fundamental role in hematopoietic differentiation. The SCL locus is composed of eight exons distributed over 16 kb. SCL shows a pattern of expression quite restricted to early hematopoietic tissues, although in malignant states expression of the gene may be somewhat extended into later developmental stages. A detailed analysis of the transcript(s) arising from the SCL locus revealed that (i) the 5' noncoding portion of the SCL transcript, which resides within a CpG island, has a complex pattern of alternative exon utilization as well as two distinct transcription initiation sites; (ii) the 5' portions of the SCL transcript contain features that suggest a possible regulatory role for these segments; (iii) the pattern of utilization of the 5' exons is cell lineage dependent; and (iv) all of the currently studied chromosomal aberrations that affect the SCL locus either structurally or functionally eliminate the normal 5' transcription initiation sites. These data suggest that the SCL gene, and specifically its 5' region, may be a target for regulatory interactions during early hematopoietic development. Images PMID:2247063

  18. Transcriptional and epigenetic regulation of autophagy in aging.

    PubMed

    Lapierre, Louis R; Kumsta, Caroline; Sandri, Marco; Ballabio, Andrea; Hansen, Malene

    2015-01-01

    Macroautophagy is a major intracellular degradation process recognized as playing a central role in cell survival and longevity. This multistep process is extensively regulated at several levels, including post-translationally through the action of conserved longevity factors such as the nutrient sensor TOR. More recently, transcriptional regulation of autophagy genes has emerged as an important mechanism for ensuring the somatic maintenance and homeostasis necessary for a long life span. Autophagy is increased in many long-lived model organisms and contributes significantly to their longevity. In turn, conserved transcription factors, particularly the helix-loop-helix transcription factor TFEB and the forkhead transcription factor FOXO, control the expression of many autophagy-related genes and are important for life-span extension. In this review, we discuss recent progress in understanding the contribution of these transcription factors to macroautophagy regulation in the context of aging. We also review current research on epigenetic changes, such as histone modification by the deacetylase SIRT1, that influence autophagy-related gene expression and additionally affect aging. Understanding the molecular regulation of macroautophagy in relation to aging may offer new avenues for the treatment of age-related diseases.

  19. Transcriptional and epigenetic regulation of autophagy in aging

    PubMed Central

    Lapierre, Louis R; Kumsta, Caroline; Sandri, Marco; Ballabio, Andrea; Hansen, Malene

    2015-01-01

    Macroautophagy is a major intracellular degradation process recognized as playing a central role in cell survival and longevity. This multistep process is extensively regulated at several levels, including post-translationally through the action of conserved longevity factors such as the nutrient sensor TOR. More recently, transcriptional regulation of autophagy genes has emerged as an important mechanism for ensuring the somatic maintenance and homeostasis necessary for a long life span. Autophagy is increased in many long-lived model organisms and contributes significantly to their longevity. In turn, conserved transcription factors, particularly the helix-loop-helix transcription factor TFEB and the forkhead transcription factor FOXO, control the expression of many autophagy-related genes and are important for life-span extension. In this review, we discuss recent progress in understanding the contribution of these transcription factors to macroautophagy regulation in the context of aging. We also review current research on epigenetic changes, such as histone modification by the deacetylase SIRT1, that influence autophagy-related gene expression and additionally affect aging. Understanding the molecular regulation of macroautophagy in relation to aging may offer new avenues for the treatment of age-related diseases. PMID:25836756

  20. Inhibition of cell proliferation by the Mad1 transcriptional repressor.

    PubMed Central

    Roussel, M F; Ashmun, R A; Sherr, C J; Eisenman, R N; Ayer, D E

    1996-01-01

    Mad1 is a basic helix-loop-helix-leucine zipper protein that is induced upon differentiation of a number of distinct cell types. Mad1 dimerizes with Max and recognizes the same DNA sequences as do Myc:Max dimers. However, Mad1 and Myc appear to have opposing functions. Myc:Max heterodimers activate transcription while Mad:Max heterodimers repress transcription from the same promoter. In addition Mad1 has been shown to block the oncogenic activity of Myc. Here we show that ectopic expression of Mad1 inhibits the proliferative response of 3T3 cells to signaling through the colony-stimulating factor-1 (CSF-1) receptor. The ability of over-expressed Myc and cyclin D1 to complement the mutant CSF-1 receptor Y809F (containing a Y-to-F mutation at position 809) is also inhibited by Mad1. Cell cycle analysis of proliferating 3T3 cells transfected with Mad1 demonstrates a significant decrease in the fraction of cells in the S and G2/M phases and a concomitant increase in the fraction of G1 phase cells, indicating that Mad1 negatively influences cell cycle progression from the G1 to the S phase. Mutations in Mad1 which inhibit its activity as a transcription repressor also result in loss of Mad1 cell cycle inhibitory activity. Thus, the ability of Mad1 to inhibit cell cycle progression is tightly coupled to its function as a transcriptional repressor. PMID:8649388

  1. Identifying Novel Helix-Loop-Helix Genes in "Caenorhabditis elegans" through a Classroom Demonstration of Functional Genomics

    ERIC Educational Resources Information Center

    Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

    2003-01-01

    A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the "Caenorhabditis elegans" genome and further characterized three sequences that were predicted to encode…

  2. Identifying Novel Helix-Loop-Helix Genes in "Caenorhabditis elegans" through a Classroom Demonstration of Functional Genomics

    ERIC Educational Resources Information Center

    Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

    2003-01-01

    A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the "Caenorhabditis elegans" genome and further characterized three sequences that were predicted to encode…

  3. Receptor editing and marginal zone B cell development are regulated by the helix-loop-helix protein, E2A.

    PubMed

    Quong, Melanie W; Martensson, Annica; Langerak, Anton W; Rivera, Richard R; Nemazee, David; Murre, Cornelis

    2004-04-19

    Previous studies have indicated that the E2A gene products are required to initiate B lineage development. Here, we demonstrate that E2A(+/-) B cells that express an autoreactive B cell receptor fail to mature due in part to an inability to activate secondary immunoglobulin (Ig) light chain gene rearrangement. Both RAG1/2 gene expression and RS deletion are severely defective in E2A(+/-) mice. Additionally, we demonstrate that E2A(+/-) mice show an increase in the proportion of marginal zone B cells with a concomitant decrease in the proportion of follicular B cells. In contrast, Id3-deficient splenocytes show a decline in the proportion of marginal zone B cells. Based on these observations, we propose that E-protein activity regulates secondary Ig gene rearrangement at the immature B cell stage and contributes to cell fate determination of marginal zone B cells. Additionally, we propose a model in which E-proteins enforce the developmental checkpoint at the immature B cell stage.

  4. CBP/p300 as a co-factor for the Microphthalmia transcription factor.

    PubMed

    Sato, S; Roberts, K; Gambino, G; Cook, A; Kouzarides, T; Goding, C R

    1997-06-26

    The Microphthalmia basic-Helix-Loop-Helix-Leucine Zipper (bHLH-LZ) transcription factor (Mi) plays a crucial role in the genesis of melanocytes; mice deficient for a functional (Microphthalmia) gene product lack all pigment cells. We show here that the Mi activation domain resides N-terminal to the DNA-binding domain and that as little as 18 amino acids are sufficient to mediate transcription activation. The minimal activation region of Mi is highly conserved in the related transcription factor TFE3 and is predicted to adopt an amphipathic alpha-helical conformation. This region of Mi is also highly conserved with a region of E1A known to be essential for binding the CBP/p300 transcription cofactor. Consistent with these observations, the Mi activation domain can interact in vitro with CBP specifically through a region of CBP required for complex formation with E1A, P/CAF and c-Fos, and anti p300 antibodies can co-immunoprecipitate Mi from both melanocyte and melanoma cell lines. In addition, co-transfection of a vector expressing CBP2 (aas 1621-1891) fused to the VP16 activation domain potentiated the ability of Mi to activate transcription, confirming the significance of the CBP-Mi interaction observed in vitro. These data suggest that transcription activation by Mi is achieved at least in part by recruitment of CBP. The parallels between transcription regulation by Microphthalmia in melanocytes and MyoD in muscle cells are discussed.

  5. Specification of jaw identity by the Hand2 transcription factor

    PubMed Central

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko

    2016-01-01

    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  6. The transcription factor, the Cdk, its cyclin and their regulator: directing the transcriptional response to a nutritional signal.

    PubMed Central

    Hirst, K; Fisher, F; McAndrew, P C; Goding, C R

    1994-01-01

    The Pho80-Pho85 cyclin-cdk complex prevents transcription of PHO5 by inhibiting the ability of the basic-helix-loop-helix transcription factor Pho4 to activate transcription in response to high phosphate conditions. In low phosphate the Pho80-Pho85 complex is inactivated and Pho4 is then able to activate the acid phosphatase gene PHO5. We show here that Pho4 and the homeobox protein Pho2 interact in vivo and act cooperatively to activate the PHO5 UAS, with interaction being regulated by the phosphate switch. In addition, we also demonstrate that an additional factor, Pho81, interacts in high phosphate with both the Pho80 cyclin and with Pho4. In low phosphate, Pho80 and Pho81 dissociate from Pho4, but retain the ability to interact with each other. The evidence presented here supports the idea that Pho81 acts as a phosphate-sensitive trigger that regulates the ability of the Pho80-Pho85 cyclin-cdk complex to bind Pho4, while DNA binding by Pho4 is dependent on the phosphate-sensitive interaction with Pho2. Images PMID:7957107

  7. Combinatorial transcriptional interaction within the Cardiac Neural Crest: a pair of HANDs in heart formation

    PubMed Central

    Firulli, Anthony B.; Conway, Simon J.

    2008-01-01

    The cardiac neural crest migrate from rostral dorsal neural folds and populate the branchial arches, which directly contribute to cardiac-outflow structures. Although neural crest cell specification is associated with a number of morphogenic factors, little is understood about the mechanisms by which transcription factors actually implement the transcriptional programs that dictate cell migration and later the differentiation into the proper cell types within the heart. It is clear from genetic evidence that members of the paired box family and basic helix-loop-helix (bHLH) transcription factors from the twist family of proteins are expressed in and play an important function in cardiac neural crest specification and differentiation. Interestingly, both paired box and bHLH factors can function as dimers and in the case of twist family bHLH factors partner choice can clearly dictate a change in transcriptional program. The focus of this review is to consider the role that the protein-protein interactions of these transcription factors may play determining cardiac neural crest specification and differentiation and how genetic alteration of transcription factor stoichiometry within the cell may reflect more than a simple null event. PMID:15269889

  8. MYC2 Orchestrates a Hierarchical Transcriptional Cascade That Regulates Jasmonate-Mediated Plant Immunity in Tomato[OPEN

    PubMed Central

    Liu, Yuanyuan; Deng, Lei; Wu, Fangming; Huang, Zhuo; Zhou, Ming; Chen, Qian; Zhong, Silin

    2017-01-01

    The hormone jasmonate (JA), which functions in plant immunity, regulates resistance to pathogen infection and insect attack through triggering genome-wide transcriptional reprogramming in plants. We show that the basic helix-loop-helix transcription factor (TF) MYC2 in tomato (Solanum lycopersicum) acts downstream of the JA receptor to orchestrate JA-mediated activation of both the wounding and pathogen responses. Using chromatin immunoprecipitation sequencing (ChIP-seq) coupled with RNA sequencing (RNA-seq) assays, we identified 655 MYC2-targeted JA-responsive genes. These genes are highly enriched in Gene Ontology categories related to TFs and the early response to JA, indicating that MYC2 functions at a high hierarchical level to regulate JA-mediated gene transcription. We also identified a group of MYC2-targeted TFs (MTFs) that may directly regulate the JA-induced transcription of late defense genes. Our findings suggest that MYC2 and its downstream MTFs form a hierarchical transcriptional cascade during JA-mediated plant immunity that initiates and amplifies transcriptional output. As proof of concept, we showed that during plant resistance to the necrotrophic pathogen Botrytis cinerea, MYC2 and the MTF JA2-Like form a transcription module that preferentially regulates wounding-responsive genes, whereas MYC2 and the MTF ETHYLENE RESPONSE FACTOR.C3 form a transcription module that preferentially regulates pathogen-responsive genes. PMID:28733419

  9. Genetics Home Reference: Pitt-Hopkins syndrome

    MedlinePlus

    ... activities, the TCF4 protein is known as a transcription factor. The TCF4 protein plays a role in ... encoding a class I basic helix-loop-helix transcription factor, are responsible for Pitt-Hopkins syndrome, a ...

  10. Downregulation of the transcription factor scleraxis in brain of patients with Down syndrome.

    PubMed

    Yeghiazaryan, K; Turhani-Schatzmann, D; Labudova, O; Schuller, E; Olson, E N; Cairns, N; Lubec, G

    1999-01-01

    Performing gene hunting in fetal Down Syndrome (DS) brain, we found a downregulated sequence with 100% homology to the basic-helix-loop-helix transcription factor (TF) scleraxis (Scl). It was the aim of the study to evaluate Scl-mRNA steady state levels in adult DS brain with Alzheimer's disease (AD) neuropathological changes, brain of patients with AD, and controls in order to find out whether Scl-downregulation is linked to DS per se or simply to neurodegeneration, common to both disorders. Determination of Scl-mRNA steady state levels was carried out by a blotting method in frontal, parietal, temporal, occipital lobe and cerebellum. We found significantly decreased Scl-transcripts in brain of DS and AD, both, when normalized versus the house-keeping gene beta actin or total RNA. We demonstrate the significant decrease of Scl-mRNA steady state levels in the pathogenesis of DS and AD suggesting a tentative role for this transcription factor in the development of the neurodegenerative processes known to occur in both disorders. More specifically, the biological meaning of the downregulation of Scl may be the involvement in the pathogenesis of impaired neuronal plasticity and wiring observed in DS and AD, phenomena regulated by the concerted action of the many transcription factors expressed in human brain.

  11. Nato3 integrates with the Shh-Foxa2 transcriptional network regulating the differentiation of midbrain dopaminergic neurons.

    PubMed

    Nissim-Eliraz, Einat; Zisman, Sophie; Schatz, Omri; Ben-Arie, Nissim

    2013-09-01

    Mesencephalic dopaminergic (mesDA) neurons originate from the floor plate of the midbrain, a transient embryonic organizing center located at the ventral-most midline. Since the loss of mesDA leads to Parkinson's disease, the molecular mechanisms controlling the genesis and differentiation of dopaminergic progenitors are extensively studied and the identification and characterization of new genes is of interest. Here, we show that the expression of the basic helix-loop-helix transcription factor Nato3 (Ferd3l) increases in parallel to the differentiation of SN4741 dopaminergic cells in vitro. Nato3 transcription is directly regulated by the transcription factor Foxa2, a target and effector of the Sonic hedgehog (Shh) signaling cascade. Moreover, pharmacological inhibition of Shh signaling downregulated the expression of Nato3, thus defining Nato3 as a novel component of one of the major pathways controlling cell patterning and generation of mesDA. Furthermore, we show that Nato3 regulated Shh and Foxa2 through a novel feed-backward loop. Up- and downregulation of Nato3 further affected the transcription of Nurr1, implicated in the genesis of mesDA, but not of TH. Taken together, these data shed new light on the transcriptional networks controlling the generation of mesDA and may be utilized in the efforts to direct stem cells towards a dopaminergic fate.

  12. Association of the winged helix motif of the TFIIEα subunit of TFIIE with either the TFIIEβ subunit or TFIIB distinguishes its functions in transcription.

    PubMed

    Tanaka, Aki; Akimoto, Yusuke; Kobayashi, Satoko; Hisatake, Koji; Hanaoka, Fumio; Ohkuma, Yoshiaki

    2015-03-01

    In eukaryotes, the general transcription factor TFIIE consists of two subunits, α and β, and plays essential roles in transcription. Structure-function studies indicate that TFIIE has three-winged helix (WH) motifs, with one in TFIIEα and two in TFIIEβ. Recent studies suggested that, by binding to the clamp region of RNA polymerase II, TFIIEα-WH promotes the conformational change that transforms the promoter-bound inactive preinitiation complex to the active complex. Here, to elucidate its roles in transcription, functional analyses of point-mutated human TFIIEα-WH proteins were carried out. In vitro transcription analyses identified two classes of mutants. One class was defective in transcription initiation, and the other was defective in the transition from initiation to elongation. Analyses of the binding of this motif to other general transcription factors showed that the former class was defective in binding to the basic helix-loop-helix motif of TFIIEβ and the latter class was defective in binding to the N-terminal cyclin homology region of TFIIB. Furthermore, TFIIEα-WH bound to the TFIIH XPB subunit at a third distinct region. Therefore, these results provide further insights into the mechanisms underlying RNA polymerase II activation at the initial stages of transcription.

  13. ABA Suppresses Root Hair Growth via the OBP4 Transcriptional Regulator1[OPEN

    PubMed Central

    Kawamura, Ayako; Schäfer, Sabine; Breuer, Christian; Shibata, Michitaro; Mitsuda, Nobutaka; Ohme-Takagi, Masaru; Matsui, Minami

    2017-01-01

    Plants modify organ growth and tune morphogenesis in response to various endogenous and environmental cues. At the cellular level, organ growth is often adjusted by alterations in cell growth, but the molecular mechanisms underlying this control remain poorly understood. In this study, we identify the DNA BINDING WITH ONE FINGER (DOF)-type transcription regulator OBF BINDING PROTEIN4 (OBP4) as a repressor of cell growth. Ectopic expression of OBP4 in Arabidopsis (Arabidopsis thaliana) inhibits cell growth, resulting in severe dwarfism and the repression of genes involved in the regulation of water transport, root hair development, and stress responses. Among the basic helix-loop-helix transcription factors known to control root hair growth, OBP4 binds the ROOT HAIR DEFECTIVE6-LIKE2 (RSL2) promoter to repress its expression. The accumulation of OBP4 proteins is detected in expanding root epidermal cells, and its expression level is increased by the application of abscisic acid (ABA) at concentrations sufficient to inhibit root hair growth. ABA-dependent induction of OBP4 is associated with the reduced expression of RSL2. Furthermore, ectopic expression of OBP4 or loss of RSL2 function results in ABA-insensitive root hair growth. Taken together, our results suggest that OBP4-mediated transcriptional repression of RSL2 contributes to the ABA-dependent inhibition of root hair growth in Arabidopsis. PMID:28167701

  14. A regulatory transcriptional loop controls proliferation and differentiation in Drosophila neural stem cells.

    PubMed

    Yasugi, Tetsuo; Fischer, Anja; Jiang, Yanrui; Reichert, Heinrich; Knoblich, Juergen A

    2014-01-01

    Neurogenesis is initiated by a set of basic Helix-Loop-Helix (bHLH) transcription factors that specify neural progenitors and allow them to generate neurons in multiple rounds of asymmetric cell division. The Drosophila Daughterless (Da) protein and its mammalian counterparts (E12/E47) act as heterodimerization factors for proneural genes and are therefore critically required for neurogenesis. Here, we demonstrate that Da can also be an inhibitor of the neural progenitor fate whose absence leads to stem cell overproliferation and tumor formation. We explain this paradox by demonstrating that Da induces the differentiation factor Prospero (Pros) whose asymmetric segregation is essential for differentiation in one of the two daughter cells. Da co-operates with the bHLH transcription factor Asense, whereas the other proneural genes are dispensible. After mitosis, Pros terminates Asense expression in one of the two daughter cells. In da mutants, pros is not expressed, leading to the formation of lethal transplantable brain tumors. Our results define a transcriptional feedback loop that regulates the balance between self-renewal and differentiation in Drosophila optic lobe neuroblasts. They indicate that initiation of a neural differentiation program in stem cells is essential to prevent tumorigenesis.

  15. A Regulatory Transcriptional Loop Controls Proliferation and Differentiation in Drosophila Neural Stem Cells

    PubMed Central

    Jiang, Yanrui; Reichert, Heinrich; Knoblich, Juergen A.

    2014-01-01

    Neurogenesis is initiated by a set of basic Helix-Loop-Helix (bHLH) transcription factors that specify neural progenitors and allow them to generate neurons in multiple rounds of asymmetric cell division. The Drosophila Daughterless (Da) protein and its mammalian counterparts (E12/E47) act as heterodimerization factors for proneural genes and are therefore critically required for neurogenesis. Here, we demonstrate that Da can also be an inhibitor of the neural progenitor fate whose absence leads to stem cell overproliferation and tumor formation. We explain this paradox by demonstrating that Da induces the differentiation factor Prospero (Pros) whose asymmetric segregation is essential for differentiation in one of the two daughter cells. Da co-operates with the bHLH transcription factor Asense, whereas the other proneural genes are dispensible. After mitosis, Pros terminates Asense expression in one of the two daughter cells. In da mutants, pros is not expressed, leading to the formation of lethal transplantable brain tumors. Our results define a transcriptional feedback loop that regulates the balance between self-renewal and differentiation in Drosophila optic lobe neuroblasts. They indicate that initiation of a neural differentiation program in stem cells is essential to prevent tumorigenesis. PMID:24804774

  16. c/EBPbeta is a major regulatory element driving transcriptional activation of the CXCL12 promoter.

    PubMed

    Calonge, E; Alonso-Lobo, J M; Escandón, C; González, N; Bermejo, M; Santiago, B; Mestre, L; Pablos, J L; Caruz, A; Alcamí, J

    2010-02-26

    CXCL12 is considered a constitutively expressed chemokine with homeostatic functions. However, induction of CXCL12 expression and its potential role in several pathologic conditions have been reported, suggesting that CXCL12 gene expression can be induced by different stimuli. To elucidate the molecular mechanisms involved in the regulation of CXCL12 gene expression, we aim to define the molecular factors that operate at the transcriptional level. Basal, constitutive expression of CXCL12 was dependent on basic helix-loop-helix factors. Transcriptional up-regulation of the CXCL12 gene was induced by cellular confluence or inflammatory stimuli such as interleukin-1 and interleukin-6, in a CCAAT/enhancer binding protein beta (c/EBPbeta)-dependent manner. Chromatin immunoprecipitation assays confirmed c/EBPbeta binding to a specific response element located at -1171 of the promoter region of CXCL12. Our data show that c/EBPbeta is a major regulatory element driving transcription of the CXCL12 gene in response to cytokines and cell confluence.

  17. Characterization of MxFIT, an iron deficiency induced transcriptional factor in Malus xiaojinensis.

    PubMed

    Yin, Lili; Wang, Yi; Yuan, Mudan; Zhang, Xinzhong; Xu, Xuefeng; Han, Zhenhai

    2014-02-01

    Iron deficiency often results in nutritional disorder in fruit trees. Transcription factors play an important role in the regulation of iron uptake. In this study, we isolated an iron deficiency response transcription factor gene, MxFIT, from an iron-efficient apple genotype of Malus xiaojinensis. MxFIT encoded a basic helix-loop-helix protein and contained a 966 bp open reading frame. MxFIT protein was targeted to the nucleus in onion epidermal cells and showed strong transcriptional activation in yeast cells. Spatiotemporal expression analysis revealed that MxFIT was up-regulated in roots under iron deficiency at both mRNA and protein levels, while almost no expression was detected in leaves irrespective of iron supply. Ectopic expression of MxFIT resulted in enhanced iron deficiency responses in Arabidopsis under iron deficiency and stronger resistance to iron deficiency. Thus, MxFIT might be involved in iron uptake and plays an important role in iron deficiency response.

  18. The Transcriptional Repressor dMnt Is a Regulator of Growth in Drosophila melanogaster†

    PubMed Central

    Loo, Lenora W. M.; Secombe, Julie; Little, John T.; Carlos, Leni-Sue; Yost, Cynthia; Cheng, Pei-Feng; Flynn, Erin M.; Edgar, Bruce A.; Eisenman, Robert N.

    2005-01-01

    The Myc-Max-Mad/Mnt network of transcription factors has been implicated in oncogenesis and the regulation of proliferation in vertebrate cells. The identification of Myc and Max homologs in Drosophila melanogaster has demonstrated a critical role for dMyc in cell growth control. In this report, we identify and characterize the third member of this network, dMnt, the sole fly homolog of the mammalian Mnt and Mad family of transcriptional repressors. dMnt possesses two regions characteristic of Mad and Mnt proteins: a basic helix-loop-helix-zipper domain, through which it dimerizes with dMax to form a sequence-specific DNA binding complex, and a Sin-interacting domain, which mediates interaction with the dSin3 corepressor. Using the upstream activation sequence/GAL4 system, we show that expression of dMnt results in an inhibition of cellular growth and proliferation. Furthermore, we have generated a dMnt null allele, which results in flies with larger cells, increased weight, and decreased life span compared to wild-type flies. Our results demonstrate that dMnt is a transcriptional repressor that regulates D. melanogaster body size. PMID:16055719

  19. PRG-1 transcriptional regulation independent from Nex1/Math2-mediated activation.

    PubMed

    Geist, Beate; Vorwerk, Brita; Coiro, Pierluca; Ninnemann, Olaf; Nitsch, Robert

    2012-02-01

    Plasticity-related gene 1 (PRG-1) is a novel player in glutamatergic synaptic transmission, acting by interfering with lysophosphatidic acid (LPA)-dependent signaling pathways. In the central nervous system, PRG-1 expression is restricted to postsynaptic dendrites on glutamatergic neurons. In this study, we describe the promoter architecture of the PRG-1 gene using RNA ligase-mediated rapid amplification of cDNA ends (RLM-Race) and PCR analysis. We found that PRG-1 expression is under the control of a TATA-less promoter with multiple transcription start sites. We demonstrated also that 200-kb genomic environment of the PRG-1 gene is sufficient to mediate cell type-specific expression in a reporter mouse model. Characterization of the PRG-1 promoter resulted in the identification of a 450-bp sequence, mediating ≈40-fold enhancement of transcription in cultured primary neurons compared to controls, and which induced reporter expression in slice cultures in neurons. Recently, the regulation of PRG-1 by the basic helix-loop-helix transcription factor Nex1 (Math2, NeuroD6) was reported. However, our studies in Nex1-null-mice revealed that Nex1-deficiency induces no change in PRG-1 expression and localization. We detected an additional Nex1-independent regulation mechanism that increases PRG-1 expression and mediates neuron-specific expression in an organotypic environment.

  20. Enhanced generation of myeloid lineages in hematopoietic differentiation from embryonic stem cells by silencing transcriptional repressor Twist-2.

    PubMed

    Sharabi, Andrew B; Lee, Sung-Hyung; Goodell, Margaret A; Huang, Xue F; Chen, Si-Yi

    2009-12-01

    The self-renewal and multilineage differentiation of embryonic stem cells (ESC) is largely governed by transcription factors or repressors. Extensive efforts have focused on elucidating critical factors that control the differentiation of specific cell lineages, for instance, myeloid lineages in hematopoietic development. In this study, we found that Twist-2, a basic helix-loop-helix (bHLH) transcription factor, plays a critical role in inhibiting the differentiation of ESC. Murine ES cells, in which Twist-2 expression is silenced by lentivirally delivered shRNA, exhibit an enhanced formation of primary embryoid bodies (EB) and enhanced differentiation into mesodermally derived hematopoietic colonies. Furthermore, Twist-2 silenced (LV-siTwist-2) ESC display significantly increased generation of myeloid lineages (Gr-1(+) and F4/80(+) cells) during in vitro hematopoietic differentiation. Treatment with the Toll-like receptor (TLR) 4 ligand synergistically stimulates the generation of primary EB formation as well as of hematopoietic progenitors differentiated from LV-siTwist-2 ES cells. Thus, this study reveals the critical role of the transcriptional repressor Twist-2 in regulating the development of myeloid lineage in hematopoietic differentiation from ESC. This study also suggests a potential strategy for directional differentiation of ESC by inhibiting a transcriptional repressor.

  1. Silencing of the EPHB3 tumor-suppressor gene in human colorectal cancer through decommissioning of a transcriptional enhancer

    PubMed Central

    Jägle, Sabine; Rönsch, Kerstin; Timme, Sylvia; Andrlová, Hana; Bertrand, Miriam; Jäger, Marcel; Proske, Amelie; Schrempp, Monika; Yousaf, Afsheen; Michoel, Tom; Zeiser, Robert; Werner, Martin; Lassmann, Silke; Hecht, Andreas

    2014-01-01

    The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) counteracts tumor-cell dissemination by regulating intercellular adhesion and repulsion and acts as tumor/invasion suppressor in colorectal cancer. This protective mechanism frequently collapses at the adenoma–carcinoma transition due to EPHB3 transcriptional silencing. Here, we identify a transcriptional enhancer at the EPHB3 gene that integrates input from the intestinal stem-cell regulator achaete-scute family basic helix-loop-helix transcription factor 2 (ASCL2), Wnt/β-catenin, MAP kinase, and Notch signaling. EPHB3 enhancer activity is highly variable in colorectal carcinoma cells and precisely reflects EPHB3 expression states, suggesting that enhancer dysfunction underlies EPHB3 silencing. Interestingly, low Notch activity parallels reduced EPHB3 expression in colorectal carcinoma cell lines and poorly differentiated tumor-tissue specimens. Restoring Notch activity reestablished enhancer function and EPHB3 expression. Although essential for intestinal stem-cell maintenance and adenoma formation, Notch activity seems dispensable in colorectal carcinomas. Notch activation even promoted growth arrest and apoptosis of colorectal carcinoma cells, attenuated their self-renewal capacity in vitro, and blocked tumor growth in vivo. Higher levels of Notch activity also correlated with longer disease-free survival of colorectal cancer patients. In summary, our results uncover enhancer decommissioning as a mechanism for transcriptional silencing of the EPHB3 tumor suppressor and argue for an antitumorigenic function of Notch signaling in advanced colorectal cancer. PMID:24707046

  2. Silencing of the EPHB3 tumor-suppressor gene in human colorectal cancer through decommissioning of a transcriptional enhancer.

    PubMed

    Jägle, Sabine; Rönsch, Kerstin; Timme, Sylvia; Andrlová, Hana; Bertrand, Miriam; Jäger, Marcel; Proske, Amelie; Schrempp, Monika; Yousaf, Afsheen; Michoel, Tom; Zeiser, Robert; Werner, Martin; Lassmann, Silke; Hecht, Andreas

    2014-04-01

    The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) counteracts tumor-cell dissemination by regulating intercellular adhesion and repulsion and acts as tumor/invasion suppressor in colorectal cancer. This protective mechanism frequently collapses at the adenoma-carcinoma transition due to EPHB3 transcriptional silencing. Here, we identify a transcriptional enhancer at the EPHB3 gene that integrates input from the intestinal stem-cell regulator achaete-scute family basic helix-loop-helix transcription factor 2 (ASCL2), Wnt/β-catenin, MAP kinase, and Notch signaling. EPHB3 enhancer activity is highly variable in colorectal carcinoma cells and precisely reflects EPHB3 expression states, suggesting that enhancer dysfunction underlies EPHB3 silencing. Interestingly, low Notch activity parallels reduced EPHB3 expression in colorectal carcinoma cell lines and poorly differentiated tumor-tissue specimens. Restoring Notch activity reestablished enhancer function and EPHB3 expression. Although essential for intestinal stem-cell maintenance and adenoma formation, Notch activity seems dispensable in colorectal carcinomas. Notch activation even promoted growth arrest and apoptosis of colorectal carcinoma cells, attenuated their self-renewal capacity in vitro, and blocked tumor growth in vivo. Higher levels of Notch activity also correlated with longer disease-free survival of colorectal cancer patients. In summary, our results uncover enhancer decommissioning as a mechanism for transcriptional silencing of the EPHB3 tumor suppressor and argue for an antitumorigenic function of Notch signaling in advanced colorectal cancer.

  3. Mga, a dual-specificity transcription factor that interacts with Max and contains a T-domain DNA-binding motif.

    PubMed Central

    Hurlin, P J; Steingrìmsson, E; Copeland, N G; Jenkins, N A; Eisenman, R N

    1999-01-01

    The basic-helix-loop-helix-leucine zipper (bHLHZip) proteins Myc, Mad and Mnt are part of a transcription activation/repression system involved in the regulation of cell proliferation. The function of these proteins as transcription factors is mediated by heterodimerization with the small bHLHZip protein Max, which is required for their specific DNA binding to E-box sequences. We have identified a novel Max-interacting protein, Mga, which contains a Myc-like bHLHZip motif, but otherwise shows no relationship with Myc or other Max-interacting proteins. Like Myc, Mad and Mnt proteins, Mga requires heterodimerization with Max for binding to the preferred Myc-Max-binding site CACGTG. In addition to the bHLHZip domain, Mga contains a second DNA-binding domain: the T-box or T-domain. The T-domain is a highly conserved DNA-binding motif originally defined in Brachyury and characteristic of the Tbx family of transcription factors. Mga binds the preferred Brachyury-binding sequence and represses transcription of reporter genes containing promoter-proximal Brachyury-binding sites. Surprisingly, Mga is converted to a transcription activator of both Myc-Max and Brachyury site-containing reporters in a Max-dependent manner. Our results suggest that Mga functions as a dual-specificity transcription factor that regulates the expression of both Max-network and T-box family target genes. PMID:10601024

  4. The Purple Cauliflower Arises from Activation of a MYB Transcription Factor1[W][OA

    PubMed Central

    Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L.; Li, Li

    2010-01-01

    Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3’-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal. PMID:20855520

  5. The purple cauliflower arises from activation of a MYB transcription factor.

    PubMed

    Chiu, Li-Wei; Zhou, Xiangjun; Burke, Sarah; Wu, Xianli; Prior, Ronald L; Li, Li

    2010-11-01

    Anthocyanins are responsible for the color of many flowers, fruits, and vegetables. An interesting and unique Purple (Pr) gene mutation in cauliflower (Brassica oleracea var botrytis) confers an abnormal pattern of anthocyanin accumulation, giving the striking mutant phenotype of intense purple color in curds and a few other tissues. To unravel the nature of the Pr mutation in cauliflower, we isolated the Pr gene via a combination of candidate gene analysis and fine mapping. Pr encoded a R2R3 MYB transcription factor that exhibited tissue-specific expression, consistent with an abnormal anthocyanin accumulation pattern in the mutant. Transgenic Arabidopsis (Arabidopsis thaliana) and cauliflower plants expressing the Pr-D allele recapitulated the mutant phenotype, confirming the isolation of the Pr gene. Up-regulation of Pr specifically activated a basic helix-loop-helix transcription factor and a subset of anthocyanin structural genes encoding flavonoid 3'-hydroxylase, dihydroflavonol 4-reductase, and leucoanthocyanidin dioxygenase to confer ectopic accumulation of pigments in the purple cauliflower. Our results indicate that the genetic variation including a Harbinger DNA transposon insertion in the upstream regulatory region of the Pr-D allele is responsible for the up-regulation of the Pr gene in inducing phenotypic change in the plant. The successful isolation of Pr provides important information on the regulatory control of anthocyanin biosynthesis in Brassica vegetables, and offers a genetic resource for development of new varieties with enhanced health-promoting properties and visual appeal.

  6. Segregating neural and mechanosensory fates in the developing ear: patterning, signaling, and transcriptional control

    PubMed Central

    Raft, Steven; Groves, Andrew K.

    2014-01-01

    The vertebrate inner ear is composed of multiple sensory receptor epithelia, each of which is specialized for detection of sound, gravity or angular acceleration. Each receptor epithelium contains mechanosensitive hair cells, which are connected to the brainstem by bipolar sensory neurons. Hair cells and their associated neurons are derived from the embryonic rudiment of the inner ear epithelium, but the precise spatial and temporal patterns of their generation, as well as the signals that coordinate these events, have only recently begun to be understood. Gene expression, lineage tracing, and mutant analyses suggest that both neurons and hair cells are generated from a common domain of neural and sensory competence in the embryonic inner ear rudiment. Members of the Shh, Wnt and FGF families, together with retinoic acid signals, regulate transcription factor genes within the inner ear rudiment to establish the axial identity of the ear and regionalize neurogenic activity. Close-range signaling, such as that of the Notch pathway, specifies the fate of sensory regions and individual cell types. We also describe positive and negative interactions between basic helix-loop-helix and SoxB family transcription factors that specify either neuronal or sensory fates in a context-dependent manner. Finally, we review recent work on inner ear development in zebrafish, which demonstrates that the relative timing of neurogenesis and sensory epithelial formation is not phylogenetically constrained. PMID:24902666

  7. Segregating neural and mechanosensory fates in the developing ear: patterning, signaling, and transcriptional control.

    PubMed

    Raft, Steven; Groves, Andrew K

    2015-01-01

    The vertebrate inner ear is composed of multiple sensory receptor epithelia, each of which is specialized for detection of sound, gravity, or angular acceleration. Each receptor epithelium contains mechanosensitive hair cells, which are connected to the brainstem by bipolar sensory neurons. Hair cells and their associated neurons are derived from the embryonic rudiment of the inner ear epithelium, but the precise spatial and temporal patterns of their generation, as well as the signals that coordinate these events, have only recently begun to be understood. Gene expression, lineage tracing, and mutant analyses suggest that both neurons and hair cells are generated from a common domain of neural and sensory competence in the embryonic inner ear rudiment. Members of the Shh, Wnt, and FGF families, together with retinoic acid signals, regulate transcription factor genes within the inner ear rudiment to establish the axial identity of the ear and regionalize neurogenic activity. Close-range signaling, such as that of the Notch pathway, specifies the fate of sensory regions and individual cell types. We also describe positive and negative interactions between basic helix-loop-helix and SoxB family transcription factors that specify either neuronal or sensory fates in a context-dependent manner. Finally, we review recent work on inner ear development in zebrafish, which demonstrates that the relative timing of neurogenesis and sensory epithelial formation is not phylogenetically constrained.

  8. Phosphatidic acid and phosphoinositides facilitate liposome association of Yas3p and potentiate derepression of ARE1 (alkane-responsive element one)-mediated transcription control.

    PubMed

    Kobayashi, Satoshi; Hirakawa, Kiyoshi; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2013-12-01

    In the n-alkane assimilating yeast Yarrowia lipolytica, the expression of ALK1, encoding a cytochrome P450 that catalyzes terminal mono-oxygenation of n-alkanes, is induced by n-alkanes. The transcription of ALK1 is regulated by a heterocomplex that comprises the basic helix-loop-helix transcription activators, Yas1p and Yas2p, and binds to alkane-responsive element 1 (ARE1) in the ALK1 promoter. An Opi1 family transcription repressor, Yas3p, represses transcription by binding to Yas2p. Yas3p localizes in the nucleus when Y. lipolytica is grown on glucose but localizes to the endoplasmic reticulum (ER) upon the addition of n-alkanes. In this study, we showed that recombinant Yas3p binds to the acidic phospholipids, phosphatidic acid (PA) and phosphoinositides (PIPs), in vitro. The ARE1-mediated transcription was enhanced in vivo in mutants defective in an ortholog of the Saccharomyces cerevisiae gene PAH1, encoding PA phosphatase, and in an ortholog of SAC1, encoding PIP phosphatase in the ER. Truncation mutation analyses for Yas3p revealed two regions that bound to PA and PIPs. These results suggest that the interaction with acidic phospholipids is important for the n-alkane-induced association of Yas3p with the ER membrane.

  9. Identification of GTF2IRD1, a putative transcription factor within the Williams-Beuren syndrome deletion at 7q11.23.

    PubMed

    Franke, Y; Peoples, R J; Francke, U

    1999-01-01

    Williams-Beuren syndrome (WBS) is a microdeletion syndrome caused by haploinsufficiency of genes at 7q11.23. Here we describe the identification and characterization of a novel gene named GTF2IRD1, for GTF2I-repeat domain 1, within the WBS deletion region. Northern blot analysis revealed ubiquitous expression during development with two transcripts of 3.6 kb and 5.0 kb generated by alternative splicing. GTF2IRD1 encodes a protein of 944 amino acids that contains a region of high similarity to a unique motif with helix-loop-helix forming potential occurring within the transcription factor GTF2I. Analogous to TFII-I, the product of GTF2IRD1 may have the ability to interact with other HLH-proteins and function as a transcription factor or as a negative transcriptional regulator. A recent report of the identification of a muscle-specific transcription factor, MusTRD1, supports this hypothesis (O'Mahoney et al., 1998). The open reading frame described for MusTRD1 is identical to that of GTF2IRD1; however, the putative MusTRD1-protein is 486 amino acids shorter than the predicted protein encoded by GTF2IRD1. A heterozygous deletion of GTF2IRD1 may contribute to the complex WBS phenotype.

  10. The aryl hydrocarbon receptor nuclear translocator (ARNT) family of proteins: transcriptional modifiers with multi-functional protein interfaces.

    PubMed

    Labrecque, M P; Prefontaine, G G; Beischlag, T V

    2013-08-01

    The basic Helix-Loop-Helix/PER-ARNT-SIM (bHLH-PAS) domain family of transcription factors mediates cellular responses to a variety of internal and external stimuli. As functional transcription factors, these proteins act as bHLH-PAS heterodimers and can be further sub-classified into sensory/activated subunits and regulatory or ARNT-like proteins. This class of proteins act as master regulators of the bHLH-PAS superfamily of transcription factors that mediate circadian rhythm gene programs, innate and adaptive immune responses, oxygen-sensing mechanisms and compensate for deleterious environmental exposures. Some contribute to the etiology of human pathologies including cancer because of their effects on cell growth and metabolism. We will review the canonical roles of ARNT and ARNT-like proteins with an emphasis on coactivator selectivity and recruitment. We will also discuss recent advances in our understanding of noncanonical DNA-binding independent or off-target roles of ARNT that are uncoupled from its classic heterodimeric bHLH-PAS binding partners. Understanding the DNA binding-independent functions of ARNT may identify novel therapeutic options for the treatment of a large spectrum of disease states.

  11. Molecular characterization of maize bHLH transcription factor (ZmKS), a new ZmOST1 kinase substrate.

    PubMed

    Rabissi, Agnese; Vilela, Belmiro; Lumbreras, Victoria; Ludevid, Dolors; Culiáñez-Macià, Francisco A; Pagés, Montserrat

    2016-12-01

    In order to identify potential substrates of the maize kinase in the ABA signalling network, ZmOST1 was used as bait against a library of cDNAs from dehydrated young leaves. A ZmOST1-interactive polypeptide ZmKS (gene locus tag: GRMZM2G114873), showing homology with the Arabidopsis thaliana basic helix-loop-helix (bHLH) DNA-binding transcription factor was identified. Using a comparative genomic approach, the ZmKS corresponding protein was identified as conceptual translated bHLH transcription factor ABA-responsive kinase substrate. ZmKS is localized in the nucleus, shows a potential binding specificity preferentially detectable on cis-acting E-box like heptameric motifs CCACTTG and CAAGTTG, and is phosphorylated by maize protein kinase ZmOST1. ZmKS is expressed in embryo, leaf and root, expression being affected by ABA and osmotic stress. Transgenic Arabidopsis plants, with gain of ZmKS function, show a delay in germination and a transcriptional stomatal opening-facilitator activity, switchover upon ZmKS phosphorylation, suggesting that ZmKS is an ABA-repressed trans-acting activator. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. OsMYC2 mediates numerous defence-related transcriptional changes via jasmonic acid signalling in rice.

    PubMed

    Ogawa, Satoshi; Kawahara-Miki, Ryouka; Miyamoto, Koji; Yamane, Hisakazu; Nojiri, Hideaki; Tsujii, Yoshimasa; Okada, Kazunori

    2017-05-06

    Jasmonic acid (JA) plays central roles in various events in plants, especially defence against pathogens and insects. The basic helix-loop-helix (bHLH) transcription factor MYC2 has attracted attention as a master regulator of JA signalling in dicotyledonous plants. However, how MYC2 functions in monocotyledonous plants, including agriculturally important crops such as cultivated rice, has been poorly understood. To elucidate the comprehensive effects of rice MYC2 (OsMYC2) on the JA-inducible transcriptional modifications, we performed RNA-sequencing by using OsMYC2-knockdown plants (osmyc2RNAi). In osmyc2RNAi, JA-inducible expression of many defence-related genes, for example chitinases and proteinase inhibitors, was compromised. Decrease in JA-dependent activation of the biosynthetic pathways of specialised metabolites, especially defence compounds, was also evident in the osmyc2RNAi line. Furthermore, a substantial change was noted in the expression of distinct types of transcription factors, such as MYB-type factors, likely depicting the importance of OsMYC2 in not only defence responses but also other morphogenetic events. Our findings provide fundamental information to understand the overall functions of MYC2 in JA signalling in monocotyledonous plants, which might yield agricultural benefits. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Site-directed mutagenesis and saturation mutagenesis for the functional study of transcription factors involved in plant secondary metabolite biosynthesis.

    PubMed

    Pattanaik, Sitakanta; Werkman, Joshua R; Kong, Que; Yuan, Ling

    2010-01-01

    Regulation of gene expression is largely coordinated by a complex network of interactions between transcription factors (TFs), co-factors, and their cognate cis-regulatory elements in the genome. TFs are multidomain proteins that arise evolutionarily through protein domain shuffling. The modular nature of TFs has led to the idea that specific modules of TFs can be re-designed to regulate desired gene(s) through protein engineering. Utilization of designer TFs for the control of metabolic pathways has emerged as an effective approach for metabolic engineering. We are interested in engineering the basic helix-loop-helix (bHLH, Myc-type) transcription factors. Using site-directed and saturation mutagenesis, in combination with efficient and high-throughput screening systems, we have identified and characterized several amino acid residues critical for higher transactivation activity of a Myc-like bHLH transcription factor involved in anthocyanin biosynthetic pathway in plants. Site-directed and saturation mutagenesis should be generally applicable to engineering of all TFs.

  14. Distinct and Shared Transcriptomes Are Regulated by Microphthalmia-Associated Transcription Factor Isoforms in Mast Cells1

    PubMed Central

    Shahlaee, Amir H.; Brandal, Stephanie; Lee, Youl-Nam; Jie, Chunfa; Takemoto, Clifford M.

    2008-01-01

    The Microphthalmia-associated transcription factor (Mitf) is an essential basic helix-loop-helix leucine zipper transcription factor for mast cell development. Mice deficient in Mitf harbor a severe mast cell deficiency, and Mitf-mutant mast cells cultured ex vivo display a number of functional defects. Therefore, an understanding of the genetic program regulated by Mitf may provide important insights into mast cell differentiation. Multiple, distinct isoforms of Mitf have been identified in a variety of cell types; we found that Mitf-a, Mitf-e, and Mitf-mc were the major isoforms expressed in mast cells. To determine the physiologic function of Mitf in mast cells, we restored expression of these isoforms in primary mast cells from Mitf−/−mice. We found that these isoforms restored granular morphology and integrin-mediated migration. By microarray analysis, proteases, signaling molecules, cell surface receptor, and transporters comprised the largest groups of genes up-regulated by all isoforms. Furthermore, we found that isoforms also regulated distinct genes sets, suggesting separable biological activities. This work defines the transcriptome regulated by Mitf in mast cells and supports its role as master regulator of mast cell differentiation. Expression of multiple isoforms of this transcription factor may provide for redundancy of biological activities while also allowing diversity of function. PMID:17182576

  15. Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development

    PubMed Central

    Cisse, Babacar; Caton, Michele L.; Lehner, Manfred; Maeda, Takahiro; Scheu, Stefanie; Locksley, Richard; Holmberg, Dan; Zweier, Christiane; den Hollander, Nicolette S.; Kant, Sarina G.; Holter, Wolfgang; Rauch, Anita; Zhuang, Yuan; Reizis, Boris

    2008-01-01

    Summary Plasmacytoid dendritic cells (PDC) represent a unique immune cell type specialized in type I interferon (IFN) secretion in response to viral nucleic acids. The molecular control of PDC lineage specification has been poorly understood. We report that basic helix-loop-helix transcription factor (E protein) E2-2/Tcf4 is preferentially expressed in murine and human PDC. Constitutive or inducible deletion of murine E2-2 blocked the development of PDC but not of other lineages, and abolished IFN response to unmethylated DNA. Moreover, E2-2 haploinsufficiency in mice and in human Pitt-Hopkins syndrome patients was associated with aberrant expression profile and impaired IFN response of the PDC. E2-2 directly activated multiple PDC-enriched genes, including transcription factors involved in PDC development (SpiB, Irf8) and function (Irf7). These results identify E2-2 as a specific transcriptional regulator of the PDC lineage in mice and humans, and reveal a key function of E proteins in the innate immune system. PMID:18854153

  16. Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.

    PubMed

    Cisse, Babacar; Caton, Michele L; Lehner, Manfred; Maeda, Takahiro; Scheu, Stefanie; Locksley, Richard; Holmberg, Dan; Zweier, Christiane; den Hollander, Nicolette S; Kant, Sarina G; Holter, Wolfgang; Rauch, Anita; Zhuang, Yuan; Reizis, Boris

    2008-10-03

    Plasmacytoid dendritic cells (PDCs) represent a unique immune cell type specialized in type I interferon (IFN) secretion in response to viral nucleic acids. The molecular control of PDC lineage specification has been poorly understood. We report that basic helix-loop-helix transcription factor (E protein) E2-2/Tcf4 is preferentially expressed in murine and human PDCs. Constitutive or inducible deletion of murine E2-2 blocked the development of PDCs but not of other lineages and abolished IFN response to unmethylated DNA. Moreover, E2-2 haploinsufficiency in mice and in human Pitt-Hopkins syndrome patients was associated with aberrant expression profile and impaired IFN response of the PDC. E2-2 directly activated multiple PDC-enriched genes, including transcription factors involved in PDC development (SpiB, Irf8) and function (Irf7). These results identify E2-2 as a specific transcriptional regulator of the PDC lineage in mice and humans and reveal a key function of E proteins in the innate immune system.

  17. Genome-wide identification, classification and functional analyses of the bHLH transcription factor family in the pig, Sus scrofa.

    PubMed

    Liu, Wuyi

    2015-08-01

    The basic helix-loop-helix (bHLH) transcription factors are one of the largest families of gene regulatory proteins and play crucial roles in genetic, developmental and physiological processes in eukaryotes. Here, we conducted a survey of the Sus scrofa genome and identified 109 putative bHLH transcription factor members belonging to super-groups A, B, C, D, E, and F, respectively, while four members were orphan genes. We identified 6 most significantly enriched KEGG pathways and 116 most significant GO annotation categories. Further comprehensive surveys in human genome and other 12 medical databases identified 72 significantly enriched biological pathways with these 113 pig bHLH transcription factors. From the functional protein association network analysis 93 hub proteins were identified and 55 hub proteins created a tight network or a functional module within their protein families. Especially, there were 20 hub proteins found highly connected in the functional interaction network. The present study deepens our understanding and provided insights into the evolution and functional aspects of animal bHLH proteins and should serve as a solid foundation for further for analyses of specific bHLH transcription factors in the pig and other mammals.

  18. The Xanthomonas Type III Effector XopD Targets the Arabidopsis Transcription Factor MYB30 to Suppress Plant Defense[W

    PubMed Central

    Canonne, Joanne; Marino, Daniel; Jauneau, Alain; Pouzet, Cécile; Brière, Christian; Roby, Dominique; Rivas, Susana

    2011-01-01

    Plant and animal pathogens inject type III effectors (T3Es) into host cells to suppress host immunity and promote successful infection. XopD, a T3E from Xanthomonas campestris pv vesicatoria, has been proposed to promote bacterial growth by targeting plant transcription factors and/or regulators. Here, we show that XopD from the B100 strain of X. campestris pv campestris is able to target MYB30, a transcription factor that positively regulates Arabidopsis thaliana defense and associated cell death responses to bacteria through transcriptional activation of genes related to very-long-chain fatty acid (VLCFA) metabolism. XopD specifically interacts with MYB30, resulting in inhibition of the transcriptional activation of MYB30 VLCFA-related target genes and suppression of Arabidopsis defense. The helix-loop-helix domain of XopD is necessary and sufficient to mediate these effects. These results illustrate an original strategy developed by Xanthomonas to subvert plant defense and promote development of disease. PMID:21917550

  19. Interplay of the E box, the cyclic AMP response element, and HTF4/HEB in transcriptional regulation of the neurospecific, neurotrophin-inducible vgf gene.

    PubMed Central

    Di Rocco, G; Pennuto, M; Illi, B; Canu, N; Filocamo, G; Trani, E; Rinaldi, A M; Possenti, R; Mandolesi, G; Sirinian, M I; Jucker, R; Levi, A; Nasi, S

    1997-01-01

    vgf is a neurotrophin response-specific, developmentally regulated gene that codes for a neurosecretory polypeptide. Its transcription in neuronal cells is selectively activated by the neurotrophins nerve growth factor (NGF), brain-derived neurotrophic factor, and neurotrophin 3, which induce survival and differentiation, and not by epidermal growth factor. We studied a short region of the rat vgf promoter which is essential for its regulated expression. A cyclic AMP response element (CRE) within this region is necessary for NGF induction of vgf transcription. Two sites upstream of CRE, an E box and a CCAAT sequence, bind nuclear protein complexes and are involved in transcriptional control. The E box has a dual role. It acts as an inhibitor in NIH 3T3 fibroblasts, together with a second E box located downstream, and as a stimulator in the NGF-responsive cell line PC12. By expression screening, we have isolated the cDNA for a basic helix-loop-helix transcription factor, a homolog of the HTF4/HEB E protein, that specifically binds the vgf promoter E box. The E protein was present in various cell lines, including PC12 cells, and was a component of a multiprotein nuclear complex that binds the promoter in vitro. The E box and CRE cooperate in binding to this complex, which may be an important determinant for neural cell-specific expression. PMID:9032251

  20. Complementary quantitative proteomics reveals that transcription factor AP-4 mediates E-box-dependent complex formation for transcriptional repression of HDM2.

    PubMed

    Ku, Wei-Chi; Chiu, Sung-Kay; Chen, Yi-Ju; Huang, Hsin-Hung; Wu, Wen-Guey; Chen, Yu-Ju

    2009-09-01

    Transcription factor activating enhancer-binding protein 4 (AP-4) is a basic helix-loop-helix protein that binds to E-box elements. AP-4 has received increasing attention for its regulatory role in cell growth and development, including transcriptional repression of the human homolog of murine double minute 2 (HDM2), an important oncoprotein controlling cell growth and survival, by an unknown mechanism. Here we demonstrate that AP-4 binds to an E-box located in the HDM2-P2 promoter and represses HDM2 transcription in a p53-independent manner. Incremental truncations of AP-4 revealed that the C-terminal Gln/Pro-rich domain was essential for transcriptional repression of HDM2. To further delineate the molecular mechanism(s) of AP-4 transcriptional control and its potential implications, we used DNA-affinity purification followed by complementary quantitative proteomics, cICAT and iTRAQ labeling methods, to identify a previously unknown E-box-bound AP-4 protein complex containing 75 putative components. The two labeling methods complementarily quantified differentially AP-4-enriched proteins, including the most significant recruitment of DNA damage response proteins, followed by transcription factors, transcriptional repressors/corepressors, and histone-modifying proteins. Specific interaction of AP-4 with CCCTC binding factor, stimulatory protein 1, and histone deacetylase 1 (an AP-4 corepressor) was validated using AP-4 truncation mutants. Importantly, inclusion of trichostatin A did not alleviate AP-4-mediated repression of HDM2 transcription, suggesting a previously unidentified histone deacetylase-independent repression mechanism. In contrast, the complementary quantitative proteomics study suggested that transcription repression occurs via coordination of AP-4 with other transcription factors, histone methyltransferases, and/or a nucleosome remodeling SWI.SNF complex. In addition to previously known functions of AP-4, our data suggest that AP-4 participates in a

  1. MyoD stimulates delta-1 transcription and triggers notch signaling in the Xenopus gastrula.

    PubMed Central

    Wittenberger, T; Steinbach, O C; Authaler, A; Kopan, R; Rupp, R A

    1999-01-01

    The Notch signaling cascade is involved in many developmental decisions, a paradigm of which has been the selection between epidermal and neural cell fates in both invertebrates and vertebrates. Notch has also been implicated as a regulator of myogenesis, although its precise function there has remained controversial. Here we show that the muscle-determining factor MyoD is a direct, positive regulator of the Notch ligand Delta-1 in prospective myoblasts of the pre-involuted mesoderm in Xenopus gastrulae. Injection of a dominant MyoD repressor variant ablates mesodermal Delta-1 expression in vivo. Furthermore, MyoD-dependent Delta-1 induction is sufficient to activate transcription from promoters of E(spl)-related genes in a Notch-dependent manner. These results indicate that a hallmark of neural cell fate determination, i.e. the feedback loop between differentiation promoting basic helix-loop-helix proteins and the Notch regulatory circuitry, is conserved in myogenesis, supporting a direct involvement of Notch in muscle determination. PMID:10202155

  2. An atypical bHLH transcription factor regulates early xylem development downstream of auxin.

    PubMed

    Ohashi-Ito, Kyoko; Matsukawa, Manami; Fukuda, Hiroo

    2013-03-01

    The vascular system in plants, which comprises xylem, phloem and vascular stem cells, originates from provascular cells and forms a continuous network throughout the plant body. Although various aspects of vascular development have been extensively studied, the early process of vascular development remains largely unknown. LONESOME HIGHWAY (LHW), which encodes an atypical basic helix-loop-helix (bHLH) transcription factor, plays an essential role in establishing vascular cells. Here, we report the analysis of LHW homologs in relation to vascular development. Three LHW homologs, LONESOME HIGHWAY LIKE 1-3 (LHL1-LHL3), were preferentially expressed in the plant vasculature. Genetic analysis indicated that, although the LHL3 loss-of-function mutant showed no obvious phenotype, the lhw lhl3 double mutant displayed more severe phenotypic defects in the vasculature of the cotyledons and roots than the lhw single mutant. Only one xylem vessel was formed at the metaxylem position in lhw lhl3 roots, whereas the lhw root formed one protoxylem and one or two metaxylem vessels. Conversely, overexpression of LHL3 enhanced xylem development in the roots. Moreover, N-1-naphthylphthalamic acid caused ectopic LHL3 expression in accordance with induced auxin maximum. These results suggest that LHL3 plays a positive role in xylem differentiation downstream of auxin.

  3. Id3 Is a Direct Transcriptional Target of Pax7 in Quiescent Satellite Cells

    PubMed Central

    Kumar, Deepak; Shadrach, Jennifer L.; Wagers, Amy J.

    2009-01-01

    Pax7 is a key regulator of skeletal muscle stem cells and is required along with Pax3 to generate skeletal muscle precursors. We have identified a collection of genes induced by either Pax3 or Pax7 in C2C12 muscle cells. Two notable Pax3/7 targets are the inhibitory helix-loop-helix (HLH) proteins inhibitor of DNA binding (Id) 2 and Id3, both of which are coordinately expressed with Pax7 in quiescent satellite cells and are induced in quiescent C2C12 myogenic cells after ectopic expression of either Pax3 or Pax7. Ectopic Pax7 activates expression of a luciferase reporter driven by the Id3 promoter, and maximal induction of this reporter requires a conserved Pax7 binding site located upstream of the Id3 gene. Chromatin immunoprecipitation indicated that Pax7 is bound upstream of the Id3 promoter in quiescent satellite cells. In addition, short hairpin RNA-mediated knockdown of Pax7 expression in cultured satellite cells coordinately decreased both Id2 and Id3 expression. Together, these findings indicate that Id3 is a direct transcriptional target for Pax7 in quiescent satellite cells, and they suggest that Pax7 acts to block premature differentiation of quiescent satellite cells by inducing the expression of Id2 and Id3, which in turn may act to block either the precocious induction of myogenic basic (b)HLH proteins, the activity of myogenic bHLH proteins, or both. PMID:19458195

  4. The interplay between microRNAs and Twist1 transcription factor: a systematic review.

    PubMed

    Khanbabaei, Hashem; Teimoori, Ali; Mohammadi, Milad

    2016-06-01

    Twist1 (also known as Twist) is a transcription factor that belongs to the family of basic helix-loop-helix (bHLH) proteins. It functions as a negative regulator of epithelial gene expression and a positive regulator of mesenchymal gene expression, thereby leading to induction of the epithelial mesenchymal transition (EMT), a process in which epithelial cells acquire the motile and migratory characteristics of mesenchymal cells. In addition to regulating the expression of protein-coding genes, Twist1 regulates the expression of microRNAs (miRNAs), adding a regulatory layer to EMT induction. Interestingly, the mRNA of Twist1 represents a downstream target of miRNAs, indicating an intricate network between miRNAs and Twist1. This network was shown to play multiple roles in cancer cell migration, invasion, and metastasis. The network can induce angiogenesis, protect cells from oncogene-induced apoptosis and senescence, enhance cancer cell resistance to conventional therapies, and increase cancer stem cell (CSC) populations. Recently, miRNAs have attracted considerable attention as potential promising tools in cancer therapies. Thus, this systematic review was conducted to clarify the reciprocal link between Twist1 and miRNAs in order to provide potential candidate miRNAs for diagnostic and therapeutic approaches in cancer treatment.

  5. Genetic dissection of endothelial transcriptional activity of zebrafish aryl hydrocarbon receptors (AHRs)

    PubMed Central

    Sugden, Wade W.; Leonardo-Mendonça, Roberto C.; Acuña-Castroviejo, Darío

    2017-01-01

    The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix transcription factor conserved across phyla from flies to humans. Activated by a number of endogenous ligands and environmental toxins, studies on AHR function and gene regulation have largely focused on a toxicological perspective relating to aromatic hydrocarbons generated by human activities and the often-deleterious effects of exposure on vertebrates mediated by AHR activation. A growing body of work has highlighted the importance of AHR in physiologic processes, including immune cell differentiation and vascular patterning. Here we dissect the contribution of the 3 zebrafish AHRs, ahr1a, ahr1b and ahr2, to endothelial cyp1a1/b1 gene regulation under physiologic conditions and upon exposure to the AHR ligand Beta-naphthoflavone. We show that in fish multiple AHRs are functional in the vasculature, with vessel-specific differences in the ability of ahr1b to compensate for the loss of ahr2 to maintain AHR signaling. We further provide evidence that AHR can regulate the expression of the chemokine receptor cxcr4a in endothelial cells, a regulatory mechanism that may provide insight into AHR function in the endothelium. PMID:28817646

  6. Genetic dissection of endothelial transcriptional activity of zebrafish aryl hydrocarbon receptors (AHRs).

    PubMed

    Sugden, Wade W; Leonardo-Mendonça, Roberto C; Acuña-Castroviejo, Darío; Siekmann, Arndt F

    2017-01-01

    The aryl hydrocarbon receptor (AHR) is a basic helix-loop-helix transcription factor conserved across phyla from flies to humans. Activated by a number of endogenous ligands and environmental toxins, studies on AHR function and gene regulation have largely focused on a toxicological perspective relating to aromatic hydrocarbons generated by human activities and the often-deleterious effects of exposure on vertebrates mediated by AHR activation. A growing body of work has highlighted the importance of AHR in physiologic processes, including immune cell differentiation and vascular patterning. Here we dissect the contribution of the 3 zebrafish AHRs, ahr1a, ahr1b and ahr2, to endothelial cyp1a1/b1 gene regulation under physiologic conditions and upon exposure to the AHR ligand Beta-naphthoflavone. We show that in fish multiple AHRs are functional in the vasculature, with vessel-specific differences in the ability of ahr1b to compensate for the loss of ahr2 to maintain AHR signaling. We further provide evidence that AHR can regulate the expression of the chemokine receptor cxcr4a in endothelial cells, a regulatory mechanism that may provide insight into AHR function in the endothelium.

  7. Artificial ligand binding within the HIF2[alpha] PAS-B domain of the HIF2 transcription factor

    SciTech Connect

    Scheuermann, Thomas H.; Tomchick, Diana R.; Machius, Mischa; Guo, Yan; Bruick, Richard K.; Gardner, Kevin H.

    2009-05-12

    The hypoxia-inducible factor (HIF) basic helix-loop-helix Per-aryl hydrocarbon receptor nuclear translocator (ARNT)-Sim (bHLH-PAS) transcription factors are master regulators of the conserved molecular mechanism by which metazoans sense and respond to reductions in local oxygen concentrations. In humans, HIF is critically important for the sustained growth and metastasis of solid tumors. Here, we describe crystal structures of the heterodimer formed by the C-terminal PAS domains from the HIF2{alpha} and ARNT subunits of the HIF2 transcription factor, both in the absence and presence of an artificial ligand. Unexpectedly, the HIF2{alpha} PAS-B domain contains a large internal cavity that accommodates ligands identified from a small-molecule screen. Binding one of these ligands to HIF2{alpha} PAS-B modulates the affinity of the HIF2{alpha}:ARNT PAS-B heterodimer in vitro. Given the essential role of PAS domains in forming active HIF heterodimers, these results suggest a presently uncharacterized ligand-mediated mechanism for regulating HIF2 activity in endogenous and clinical settings.

  8. Artificial ligand binding within the HIF2alpha PAS-B domain of the HIF2 transcription factor.

    PubMed

    Scheuermann, Thomas H; Tomchick, Diana R; Machius, Mischa; Guo, Yan; Bruick, Richard K; Gardner, Kevin H

    2009-01-13

    The hypoxia-inducible factor (HIF) basic helix-loop-helix Per-aryl hydrocarbon receptor nuclear translocator (ARNT)-Sim (bHLH-PAS) transcription factors are master regulators of the conserved molecular mechanism by which metazoans sense and respond to reductions in local oxygen concentrations. In humans, HIF is critically important for the sustained growth and metastasis of solid tumors. Here, we describe crystal structures of the heterodimer formed by the C-terminal PAS domains from the HIF2alpha and ARNT subunits of the HIF2 transcription factor, both in the absence and presence of an artificial ligand. Unexpectedly, the HIF2alpha PAS-B domain contains a large internal cavity that accommodates ligands identified from a small-molecule screen. Binding one of these ligands to HIF2alpha PAS-B modulates the affinity of the HIF2alpha:ARNT PAS-B heterodimer in vitro. Given the essential role of PAS domains in forming active HIF heterodimers, these results suggest a presently uncharacterized ligand-mediated mechanism for regulating HIF2 activity in endogenous and clinical settings.

  9. 14-3-3 Proteins are essential for regulation of RTG3-dependent transcription in Saccharomyces cerevisiae.

    PubMed

    van Heusden, G P; Steensma, H Y

    2001-12-01

    14-3-3 proteins comprise a family of highly conserved proteins that bind more than 60 different, mostly phosphorylated, proteins. The yeast Saccharomyces cerevisiae has two genes, BMH1 and BMH2, encoding 14-3-3 proteins. Disruption of both genes together is lethal. In this study we constructed a mutant with a single, temperature-sensitive bmh allele. Recessive mutations in SIN4 and RTG3 can suppress the temperature-sensitive phenotype of this mutant. These genes encode a global transcriptional regulator and a basic helix-loop-helix transcription factor, respectively. The yeast 14-3-3 proteins were shown to bind to the Rtg3 protein. Overexpression of RTG3 is lethal even in wild-type cells. These genetic and biochemical data are consistent with a model in which the 14-3-3 proteins are required to keep the Rtg3 protein in an inactive state, which is (one of) the essential function(s) of the 14-3-3 proteins.

  10. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

    PubMed Central

    Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

    2010-01-01

    The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

  11. The Transcriptional Repressor MYB2 Regulates Both Spatial and Temporal Patterns of Proanthocyandin and Anthocyanin Pigmentation in Medicago truncatula.

    PubMed

    Jun, Ji Hyung; Liu, Chenggang; Xiao, Xirong; Dixon, Richard A

    2015-10-01

    Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. © 2015 American Society of Plant Biologists. All rights reserved.

  12. Cloning and characterization of GRIPE, a novel interacting partner of the transcription factor E12 in developing mouse forebrain.

    PubMed

    Heng, Julian Ik Tsen; Tan, Seong-Seng

    2002-11-08

    The helix-loop-helix (HLH) family of transcription factors are key contributors to a wide array of developmental processes, including neurogenesis and hematopoiesis. These factors are thought to exert their regulatory influences by binding to cognate promoter-DNA sequences as dimers. Although studies in mice have convincingly demonstrated that neurogenic HLH proteins such as NeuroD are intimately involved in neuronal fate determination, the role of the ubiquitously expressed HLH protein, E12, in mammalian neurogenesis remains ambiguous. To address this, a yeast two-hybrid interaction screen was employed to identify dimerization partners to E12. Screening of an embryonic day 11.5 forebrain library resulted in the cloning of GRIPE, a novel GAP-related interacting protein to E12. GRIPE binds to the HLH region of E12 and may require E12 for nuclear import. Furthermore, GRIPE may negatively regulate E12-dependent target gene transcription. High levels of GRIPE and E12 mRNA were coincidentally detected during embryogenesis, but only GRIPE mRNA levels remained high in adult brain, particularly in neurons of the cortex and hippocampus. These observations were recapitulated through an in vitro model of neurogenesis. Taken together, these results indicate that GRIPE is a novel protein dimerization of which with E12 has important consequences for cells undergoing neuronal differentiation.

  13. A Novel Soybean ERF Transcription Factor, GmERF113, Increases Resistance to Phytophthora sojae Infection in Soybean

    PubMed Central

    Zhao, Yuanling; Chang, Xin; Qi, Dongyue; Dong, Lidong; Wang, Guangjin; Fan, Sujie; Jiang, Liangyu; Cheng, Qun; Chen, Xi; Han, Dan; Xu, Pengfei; Zhang, Shuzhen

    2017-01-01

    Phytophthora root and stem rot of soybean caused by the oomycete Phytophthora sojae, is a destructive disease worldwide. Ethylene response factors (ERFs) play important roles in regulating plant biotic and abiotic stress tolerance. In this study, a new ERF gene, GmERF113, was isolated from the highly resistant soybean ‘Suinong 10.’ Sequence analysis suggested that the protein encoded by GmERF113 contained a conserved AP2/ERF domain of 58 amino acid and belonged to the B-4 subgroup of the ERF subfamily. Expression of GmERF113 was significantly induced by P. sojae, ethylene, and methyl jasmonate. GmERF113 protein localized to the nucleus when transiently expressed in Arabidopsis protoplasts, could bind to the GCC-box, and acted as a transcription activator. In addition, a region of the full-length GmERF113, GmERF113-II, interacted with a basic helix-loop-helix transcription factor (GmbHLH) in yeast cells. Full-length GmERF113 also interacted with GmbHLH in planta. GmERF113-overexpressing transgenic plants in susceptible cultivar ‘Dongnong 50’ soybean exhibited increased resistance to P. sojae and positively regulated the expression of the pathogenesis-related genes, PR1 and PR10-1. These results indicate that GmERF113 may play a crucial role in the defense of soybean against P. sojae infection. PMID:28326092

  14. The TAL1/SCL Transcription Factor Regulates Cell Cycle Progression and Proliferation in Differentiating Murine Bone Marrow Monocyte Precursors▿

    PubMed Central

    Dey, Soumyadeep; Curtis, David J.; Jane, Stephen M.; Brandt, Stephen J.

    2010-01-01

    Monocytopoiesis involves the stepwise differentiation in the bone marrow (BM) of common myeloid precursors (CMPs) to monocytes. The basic helix-loop-helix transcription factor TAL1/SCL plays a critical role in other hematopoietic lineages, and while it had been reported to be expressed by BM-derived macrophages, its role in monocytopoiesis had not been elucidated. Using cell explant models of monocyte/macrophage (MM) differentiation, one originating with CMPs and the other from more committed precursors, we characterized the phenotypic and molecular consequences of inactivation of Tal1 expression ex vivo. While Tal1 knockout had minimal effects on cell survival and slightly accelerated terminal differentiation, it profoundly inhibited cell proliferation and decreased entry into and traversal of the G1 and S phases. In conjunction, steady-state levels of p16(Ink4a) mRNA were increased and those of Gata2 mRNA decreased. Chromatin immunoprecipitation analysis demonstrated the association of Tal1 and E47, one of its E protein DNA-binding partners, with an E box-GATA sequence element in intron 4 of the Gata2 gene and with three E boxes upstream of p16(Ink4a). Finally, wild-type Tal1, but not a DNA binding-defective mutant, rescued the proliferative defect in Tal1-null MM precursors. These results document the importance of this transcription factor in cell cycle progression and proliferation during monocytopoiesis and the requirement for direct DNA binding in these processes. PMID:20194619

  15. A Conserved Network of Transcriptional Activators and Repressors Regulates Anthocyanin Pigmentation in Eudicots[C][W][OPEN

    PubMed Central

    Albert, Nick W.; Davies, Kevin M.; Lewis, David H.; Zhang, Huaibi; Montefiori, Mirco; Brendolise, Cyril; Boase, Murray R.; Ngo, Hanh; Jameson, Paula E.; Schwinn, Kathy E.

    2014-01-01

    Plants require sophisticated regulatory mechanisms to ensure the degree of anthocyanin pigmentation is appropriate to myriad developmental and environmental signals. Central to this process are the activity of MYB-bHLH-WD repeat (MBW) complexes that regulate the transcription of anthocyanin genes. In this study, the gene regulatory network that regulates anthocyanin synthesis in petunia (Petunia hybrida) has been characterized. Genetic and molecular evidence show that the R2R3-MYB, MYB27, is an anthocyanin repressor that functions as part of the MBW complex and represses transcription through its C-terminal EAR motif. MYB27 targets both the anthocyanin pathway genes and basic-helix-loop-helix (bHLH) ANTHOCYANIN1 (AN1), itself an essential component of the MBW activation complex for pigmentation. Other features of the regulatory network identified include inhibition of AN1 activity by the competitive R3-MYB repressor MYBx and the activation of AN1, MYB27, and MYBx by the MBW activation complex, providing for both reinforcement and feedback regulation. We also demonstrate the intercellular movement of the WDR protein (AN11) and R3-repressor (MYBx), which may facilitate anthocyanin pigment pattern formation. The fundamental features of this regulatory network in the Asterid model of petunia are similar to those in the Rosid model of Arabidopsis thaliana and are thus likely to be widespread in the Eudicots. PMID:24642943

  16. Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters.

    PubMed Central

    Du, H; Roy, A L; Roeder, R G

    1993-01-01

    Earlier in vitro studies identified USF as a cellular factor which activates the adenovirus major late (Ad-ML) promoter by binding to an E-box motif located at position -60 with respect to the cap site. Purified USF contains 44 and 43 kDa polypeptides, and the latter was found (by cDNA cloning) to be a helix-loop-helix protein. In this report, we demonstrate a 25-to 30-fold stimulation of transcription via an upstream binding site by ectopic expression of the 43 kDa form of USF (USF43) in transient transfection assays. More recent data have also revealed alternate interactions of USF43 at pyrimidine-rich (consensus YYAYTCYY) initiator (Inr) elements present in a variety of core promoters. In agreement with this observation, we show here that USF43 can recognize the initiator elements of the HIV-1 promoter, as well as those in the Ad-ML promoter, and that ectopic expression of USF43 can stimulate markedly the corresponding core promoters (TATA and initiator elements) when analyzed in transient co-transfection assays. Mutations in either Inr 1 or Inr 2 reduced the USF43-dependent transcription activity in vivo. In addition, in vitro transcription assays showed that mutations in either or both of the Inr 1 and Inr 2 sequences of the HIV-1 and Ad-ML promoters could affect transcription efficiency, but not the position of the transcriptional start site. These results indicate that USF43 can stimulate transcription through initiator elements in two viral promoters, although the exact mechanism and physiological significance of this effect remain unclear. Images PMID:8440240

  17. Sterol regulatory element binding protein-mediated effect of fluvastatin on cytosolic 3-hydroxy-3-methylglutaryl-coenzyme A synthase transcription.

    PubMed

    Mascaró, C; Ortiz, J A; Ramos, M M; Haro, D; Hegardt, F G

    2000-02-15

    The effects of acute treatment with fluvastatin, a hypocholesteremic drug, on the mRNA levels of several regulatory enzymes of cholesterogenesis and of the LDL receptor were determined in rat liver. Fluvastatin increased the hepatic mRNA levels for HMG-CoA reductase up to 12-fold in 5 weeks of treatment at a daily dose of 6. 3 mg/kg. The effect was less marked in cytosolic HMG-CoA synthase, farnesyl-PP synthase, squalene synthetase, and LDL receptor. SREBP-2 mRNA levels were also increased, but SREBP-1 were not. De novo synthesis of cholesterol in several cultured cells was reduced by increasing concentrations of fluvastatin, and the IC(50) values of fluvastatin in HepG2, CV-1, and CHO cells were respectively 0.01, 0. 05, and 0.1 microM. When CHO cells stably transfected with a chimeric gene composed of the promoter of cytosolic HMG-CoA synthase and the CAT gene as a reporter were incubated with fluvastatin, the CAT gene was overexpressed, an effect which was similar to the cotransfection with the processed form of SREBP-1a. Both ALLN and fluvastatin increased the transcriptional activity of cytosolic HMG-CoA synthase. Mutation in either SRE or NF-Y boxes abolished the increase in transcriptional rate caused by fluvastatin in the promoter of cytosolic HMG-CoA synthase. These results indicate that the increase in transcriptional activity in the HMG-CoA synthase gene attributable to fluvastatin is a consequence of the activation of the proteolytic cleavage of SREBPs by reduced levels of intracellular cholesterol.

  18. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    SciTech Connect

    Damiani, R.D. Jr.; Wessler, S.R. )

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

  19. Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract.

    PubMed

    Schmiesing, André; Emonet, Aurélia; Gouhier-Darimont, Caroline; Reymond, Philippe

    2016-04-01

    Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. © 2016 American Society of Plant Biologists. All Rights Reserved.

  20. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  1. Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development[C][W][OA

    PubMed Central

    Hsieh, Wen-Ping; Hsieh, Hsu-Liang; Wu, Shu-Hsing

    2012-01-01

    Transcriptomic adjustment plays an important role in Arabidopsis thaliana seed germination and deetiolation in response to environmental light signals. The G-box cis-element is commonly present in promoters of genes that respond positively or negatively to the light signal. In pursuing additional transcriptional regulators that modulate light-mediated transcriptome changes, we identified bZIP16, a basic region/Leu zipper motif transcription factor, by G-box DNA affinity chromatography. We confirmed that bZIP16 has G-box–specific binding activity. Analysis of bzip16 mutants revealed that bZIP16 is a negative regulator in light-mediated inhibition of cell elongation but a positive regulator in light-regulated seed germination. Transcriptome analysis supported that bZIP16 is primarily a transcriptional repressor regulating light-, gibberellic acid (GA)–, and abscisic acid (ABA)–responsive genes. Chromatin immunoprecipitation analysis revealed that bZIP16 could directly target ABA-responsive genes and RGA-LIKE2, a DELLA gene in the GA signaling pathway. bZIP16 could also indirectly repress the expression of PHYTOCHROME INTERACTING FACTOR3-LIKE5, which encodes a basic helix-loop-helix protein coordinating hormone responses during seed germination. By repressing the expression of these genes, bZIP16 functions to promote seed germination and hypocotyl elongation during the early stages of Arabidopsis seedling development. PMID:23104829

  2. Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract1[OPEN

    PubMed Central

    Schmiesing, André; Gouhier-Darimont, Caroline

    2016-01-01

    Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. PMID:26884488

  3. An ABA-increased interaction of the PYL6 ABA receptor with MYC2 Transcription Factor: A putative link of ABA and JA signaling.

    PubMed

    Aleman, Fernando; Yazaki, Junshi; Lee, Melissa; Takahashi, Yohei; Kim, Alice Y; Li, Zixing; Kinoshita, Toshinori; Ecker, Joseph R; Schroeder, Julian I

    2016-06-30

    Abscisic acid (ABA) is a plant hormone that mediates abiotic stress tolerance and regulates growth and development. ABA binds to members of the PYL/RCAR ABA receptor family that initiate signal transduction inhibiting type 2C protein phosphatases. Although crosstalk between ABA and the hormone Jasmonic Acid (JA) has been shown, the molecular entities that mediate this interaction have yet to be fully elucidated. We report a link between ABA and JA signaling through a direct interaction of the ABA receptor PYL6 (RCAR9) with the basic helix-loop-helix transcription factor MYC2. PYL6 and MYC2 interact in yeast two hybrid assays and the interaction is enhanced in the presence of ABA. PYL6 and MYC2 interact in planta based on bimolecular fluorescence complementation and co-immunoprecipitation of the proteins. Furthermore, PYL6 was able to modify transcription driven by MYC2 using JAZ6 and JAZ8 DNA promoter elements in yeast one hybrid assays. Finally, pyl6 T-DNA mutant plants show an increased sensitivity to the addition of JA along with ABA in cotyledon expansion experiments. Overall, the present study identifies a direct mechanism for transcriptional modulation mediated by an ABA receptor different from the core ABA signaling pathway, and a putative mechanistic link connecting ABA and JA signaling pathways.

  4. DNA binding and transcriptional regulatory activity of mammalian achaete-scute homologous (MASH) proteins revealed by interaction with a muscle-specific enhancer.

    PubMed

    Johnson, J E; Birren, S J; Saito, T; Anderson, D J

    1992-04-15

    The MASH genes are vertebrate homologues of achaete-scute, genes required for neuronal determination in Drosophila. The sequence of MASH1 and MASH2 contains a basic helix-loop-helix (bHLH) motif that is present in other transcriptional regulators such as MyoD and E12. In the absence of an authentic target for the MASH proteins, we examined their DNA binding and transcriptional regulatory activity by using a binding site (the E box) from the muscle creatine kinase (MCK) gene, a target of MyoD. Like myogenic bHLH proteins, the MASH proteins form heterooligomers with E12 that bind the MCK E box with high affinity in vitro. Unexpectedly, however, MASH1 and MASH2 also activate transcription of both exogenous and endogenous MCK in transfected C3H/10T1/2 fibroblasts. However, they do not induce myogenesis. Myogenic activity is not exclusively a property of the MyoD basic region, as substitution of this domain fails to confer myogenic activity on MASH1. These data suggest that different bHLH proteins may activate overlapping but distinct sets of target genes in the same cell type.

  5. Overexpression of EMT-inducing transcription factors as a potential poor prognostic factor for hepatocellular carcinoma in Asian populations: A meta-analysis.

    PubMed

    Wan, Tao; Zhang, Tianwei; Si, Xiaoying; Zhou, Yanming

    2017-08-29

    The clinical relevance of epithelial to mesenchymal transition (EMT) in hepatocellular carcinoma (HCC) progression has been highlighted during the last decade. The zinc finger E-box binding homeobox (ZEB) family, the zinc-finger transcriptional repressor (SNAI) family, and the basic helix-loop-helix transcription factor (Twist) family, known as the prominent EMT-inducing transcription factors (EMT-TFs), played a crucial role in the process of EMT. Here, this meta-analysis aimed to evaluate the prognostic value of EMT-TFs high expression in patients with HCC after hepatectomy. A total of 10 studies involving 1334 patients were retrieved for analysis, the synthetic date indicated that EMT-TFs overexpression was associated with poor postoperative overall survival (OS) [HR = 1.71; 95% CI: 1.40-2.08; p < 0.00001] in HCC. The subgroup analyses revealed that overexpression of each individual EMT-TF (in addition to ZEB2) tended to be associated with poor OS. Moreover, EMT-TFs overexpression correlated with TNM stage, poor histological differentiation, intrahepatic metastasis and vascular invasion. Relevant literature search in the PubMed, Web of Science database and Cochrane Library was performed to retrieve all eligible studies. The pooled hazard ratio (HR) or odds ratio (OR) with its 95% confidence interval (CI) were calculated to investigation clinicopathological and prognostic significance of EMT-TFs expression in HCC. EMT-TFs overexpression indicated an unfavorable prognosis in HCC patients following curative resection.

  6. Overexpression of EcbHLH57 Transcription Factor from Eleusine coracana L. in Tobacco Confers Tolerance to Salt, Oxidative and Drought Stress

    PubMed Central

    Nataraja, Karaba N.; Udayakumar, M.

    2015-01-01

    Basic helix-loop-helix (bHLH) transcription factors constitute one of the largest families in plants and are known to be involved in various developmental processes and stress tolerance. We report the characterization of a stress responsive bHLH transcription factor from stress adapted species finger millet which is homologous to OsbHLH57 and designated as EcbHLH57. The full length sequence of EcbHLH57 consisted of 256 amino acids with a conserved bHLH domain followed by leucine repeats. In finger millet, EcbHLH57 transcripts were induced by ABA, NaCl, PEG, methyl viologen (MV) treatments and drought stress. Overexpression of EcbHLH57 in tobacco significantly increased the tolerance to salinity and drought stress with improved root growth. Transgenic plants showed higher photosynthetic rate and stomatal conductance under drought stress that resulted in higher biomass. Under long-term salinity stress, the transgenic plants accumulated higher seed weight/pod and pod number. The transgenic plants were also tolerant to oxidative stress and showed less accumulation of H202 and MDA levels. The overexpression of EcbHLH57 enhanced the expression of stress responsive genes such as LEA14, rd29A, rd29B, SOD, APX, ADH1, HSP70 and also PP2C and hence improved tolerance to diverse stresses. PMID:26366726

  7. The transcriptional integrator CREB-binding protein mediates positive cross talk between nuclear hormone receptors and the hematopoietic bZip protein p45/NF-E2.

    PubMed Central

    Cheng, X; Reginato, M J; Andrews, N C; Lazar, M A

    1997-01-01

    Thyroid hormone (T3) and retinoic acid (RA) play important roles in erythropoiesis. We found that the hematopoietic cell-specific bZip protein p45/NF-E2 interacts with T3 receptor (TR) and RA receptor (RAR) but not retinoid X receptor. The interaction is between the DNA-binding domain of the nuclear receptor and the leucine zipper region of p45/NF-E2 but is markedly enhanced by cognate ligand. Remarkably, ligand-dependent transactivation by TR and RAR is markedly potentiated by p45/NF-E2. This effect of p45/NF-E2 is prevented by maf-like protein p18, which functions positively as a heterodimer with p45/NF-E2 on DNA. Potentiation of hormone action by p45/NF-E2 requires its activation domain, which interacts strongly with the multifaceted coactivator cyclic AMP response element protein-binding protein (CBP). The region of CBP which interacts with p45/NF-E2 is the same interaction domain that mediates inhibition of hormone-stimulated transcription by AP1 transcription factors. Overexpression of the bZip interaction domain of CBP specifically abolishes the positive cross talk between TR and p45/NF-E2. Thus, positive cross talk between p45/NF-E2 and nuclear hormone receptors requires direct protein-protein interactions between these factors and with CBP, whose integration of positive signals from two transactivation domains provides a novel mechanism for potentiation of hormone action in hematopoietic cells. PMID:9032267

  8. The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses[C][W

    PubMed Central

    Fernández-Calvo, Patricia; Chini, Andrea; Fernández-Barbero, Gemma; Chico, José-Manuel; Gimenez-Ibanez, Selena; Geerinck, Jan; Eeckhout, Dominique; Schweizer, Fabian; Godoy, Marta; Franco-Zorrilla, José Manuel; Pauwels, Laurens; Witters, Erwin; Puga, María Isabel; Paz-Ares, Javier; Goossens, Alain; Reymond, Philippe; De Jaeger, Geert; Solano, Roberto

    2011-01-01

    Jasmonates (JAs) trigger an important transcriptional reprogramming of plant cells to modulate both basal development and stress responses. In spite of the importance of transcriptional regulation, only one transcription factor (TF), the Arabidopsis thaliana basic helix-loop-helix MYC2, has been described so far as a direct target of JAZ repressors. By means of yeast two-hybrid screening and tandem affinity purification strategies, we identified two previously unknown targets of JAZ repressors, the TFs MYC3 and MYC4, phylogenetically closely related to MYC2. We show that MYC3 and MYC4 interact in vitro and in vivo with JAZ repressors and also form homo- and heterodimers with MYC2 and among themselves. They both are nuclear proteins that bind DNA with sequence specificity similar to that of MYC2. Loss-of-function mutations in any of these two TFs impair full responsiveness to JA and enhance the JA insensitivity of myc2 mutants. Moreover, the triple mutant myc2 myc3 myc4 is as impaired as coi1-1 in the activation of several, but not all, JA-mediated responses such as the defense against bacterial pathogens and insect herbivory. Our results show that MYC3 and MYC4 are activators of JA-regulated programs that act additively with MYC2 to regulate specifically different subsets of the JA-dependent transcriptional response. PMID:21335373

  9. Induction of the unfolded protein response by cigarette smoke is primarily an activating transcription factor 4-C/EBP homologous protein mediated process

    PubMed Central

    Geraghty, Patrick; Wallace, Alison; D’Armiento, Jeanine M

    2011-01-01

    Purpose: Cigarette smoke is the major risk factor associated with the development of chronic obstructive pulmonary disease (COPD). Recent studies propose a link between endoplasmic reticulum (ER) stress and emphysema, demonstrated by increased ER stress markers under smoking conditions. Here, we investigate whether cigarette smoke-induced ER stress is cell specific and correlates with acute and chronic cigarette smoke exposure. Methods: Gene and protein expression changes in human primary lung cell cultures following cigarette smoke extract (CSE) exposure were monitored by qPCR and Western blot analysis. Mice and guinea pigs were exposed to cigarette smoke and ER stress markers examined in whole lung homogenates. Inflammatory cells from the bronchoalveolar lavage fluid of 10 days smoke exposed mice were also examined. Results: Cigarette smoke induced a trend increase in the ER stress response through an activating transcription factor 4 (ATF4) mediated induction of C/EBP homologous protein (CHOP) in primary small airway epithelial cells. Bronchial epithelial cells and macrophages responded similarly to CSE. Wild-type mice and guinea pigs exposed to acute levels of cigarette smoke exhibited increased levels of CHOP but not at significant levels. However, after long-term chronic cigarette smoke exposure, CHOP expression was reduced. Interestingly, inflammatory cells from smoke exposed mice had a significant increase in CHOP/ATF4 expression. Conclusion: A trend increase in CHOP levels appear in multiple human lung cell types following acute cigarette smoke exposure in vitro. In vivo, inflammatory cells, predominately macrophages, demonstrate significant cigarette smoke-induced ER stress. Early induction of CHOP in cigarette smoke may play a pivotal role in early induction of lung disease, however in vivo long-term cigarette smoke exposure exhibited a reduction in the ER stress response. PMID:21697995

  10. Transcriptional regulation of neurodevelopmental and metabolic pathways by NPAS3.

    PubMed

    Sha, L; MacIntyre, L; Machell, J A; Kelly, M P; Porteous, D J; Brandon, N J; Muir, W J; Blackwood, D H; Watson, D G; Clapcote, S J; Pickard, B S

    2012-03-01

    The basic helix-loop-helix PAS (Per, Arnt, Sim) domain transcription factor gene NPAS3 is a replicated genetic risk factor for psychiatric disorders. A knockout (KO) mouse model exhibits behavioral and adult neurogenesis deficits consistent with human illness. To define the location and mechanism of NPAS3 etiopathology, we combined immunofluorescent, transcriptomic and metabonomic approaches. Intense Npas3 immunoreactivity was observed in the hippocampal subgranular zone-the site of adult neurogenesis--but was restricted to maturing, rather than proliferating, neuronal precursor cells. Microarray analysis of a HEK293 cell line over-expressing NPAS3 showed that transcriptional targets varied according to circadian rhythm context and C-terminal deletion. The most highly up-regulated NPAS3 target gene, VGF, encodes secretory peptides with established roles in neurogenesis, depression and schizophrenia. VGF was just one of many NPAS3 target genes also regulated by the SOX family of transcription factors, suggesting an overlap in neurodevelopmental function. The parallel repression of multiple glycolysis genes by NPAS3 reveals a second role in the regulation of glucose metabolism. Comparison of wild-type and Npas3 KO metabolite composition using high-resolution mass spectrometry confirmed these transcriptional findings. KO brain tissue contained significantly altered levels of NAD(+), glycolysis metabolites (such as dihydroxyacetone phosphate and fructose-1,6-bisphosphate), pentose phosphate pathway components and Kreb's cycle intermediates (succinate and α-ketoglutarate). The dual neurodevelopmental and metabolic aspects of NPAS3 activity described here increase our understanding of mental illness etiology, and may provide a mechanism for innate and medication-induced susceptibility to diabetes commonly reported in psychiatric patients.

  11. Fragment-Based NMR Study of the Conformational Dynamics in the bHLH Transcription Factor Ascl1.

    PubMed

    Baronti, Lorenzo; Hošek, Tomáš; Gil-Caballero, Sergio; Raveh-Amit, Hadas; Calçada, Eduardo O; Ayala, Isabel; Dinnyés, András; Felli, Isabella C; Pierattelli, Roberta; Brutscher, Bernhard

    2017-04-11

    The Achaete-scute homolog 1 (Ascl1) protein regulates a large subset of genes that leads neuronal progenitor cells to distinctive differentiation pathways during human brain development. Although it is well known that Ascl1 binds DNA as a homo- or heterodimer via its basic helix-loop-helix (bHLH) motif, little is known about the conformational sampling properties of the DNA-free full-length protein, and in particular about the bHLH domain-flanking N- and C-terminal segments, which are predicted to be highly disordered in solution. The structural heterogeneity, low solubility, and high aggregation propensity of Ascl1 in aqueous buffer solutions make high-resolution studies of this protein a challenging task. Here, we have adopted a fragment-based strategy that allowed us to obtain high-quality NMR data providing, to our knowledge, the first comprehensive high-resolution information on the structural propensities and conformational dynamics of Ascl1. The emerging picture is that of an overall extended and highly dynamic polypeptide chain comprising three helical segments and lacking persistent long-range interactions. We also show that the C-terminal helix of the bHLH domain is involved in intermolecular interactions, even in the absence of DNA. Our results contribute to a better understanding of the mechanisms of action that govern the regulation of proneural transcription factors. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Tubular cell dedifferentiation and peritubular inflammation are coupled by the transcription regulator Id1 in renal fibrogenesis

    PubMed Central

    Li, Yingjian; Wen, Xiaoyan; Liu, Youhua

    2011-01-01

    During renal fibrogenesis, tubular epithelial-mesenchymal transition is closely associated with peritubular inflammation; however, it is not clear whether these two processes are connected. We previously identified the inhibitor of differentiation-1 (Id1), a dominant negative antagonist of basic helix-loop-helix transcription factors, as a major trigger of tubular cell dedifferentiation after injury. Id1 was induced selectively in degenerated proximal tubule and collecting duct epithelia after injury and was present in both the cytoplasm and nucleus, suggesting shuttling between these two compartments. Interestingly, the upregulation of Id1 was associated with peritubular inflammation in mouse and human nephropathies. In vitro, Id1 potentiated NF-κB signaling and augmented RANTES expression in kidney epithelial cells, which led to an enhanced recruitment of inflammatory cells. Id1 also induced Snail1 expression and triggered tubular epithelial dedifferentiation. In vivo, genetic ablation of Id1 in mice reduced peritubular inflammation and decreased tubular expression of RANTES following ureteral obstruction. Mice lacking Id1 were also protected against myofibroblast activation and matrix expression, leading to a reduced total collagen deposition in obstructive nephropathy. Thus, these results indicate that Id1 shuttles between nucleus and cytoplasm and promotes peritubular inflammation and tubular epithelial dedifferentiation, suggesting that these two events are intrinsically coupled during renal fibrogenesis. PMID:22278018

  13. Ubiquitination-Related MdBT Scaffold Proteins Target a bHLH Transcription Factor for Iron Homeostasis1[OPEN

    PubMed Central

    Zhao, Qiang; Wang, Qing-Jie; Wang, Xiao-Fei; You, Chun-Xiang

    2016-01-01

    Iron (Fe) homeostasis is crucial for plant growth and development. A network of basic helix-loop-helix (bHLH) transcription factors positively regulates Fe uptake during iron deficiency. However, their up-regulation or overexpression leads to Fe overload and reactive oxygen species generation, thereby damaging the plants. Here, we found that two BTB/TAZ proteins, MdBT1 and MdBT2, interact with the MbHLH104 protein in apple. In addition, the function of MdBT2 was characterized as a regulator of MdbHLH104 degradation via ubiquitination and the 26S proteasome pathway, thereby controlling the activity of plasma membrane H+-ATPases and the acquisition of iron. Furthermore, MdBT2 interacted with MdCUL3 proteins, which were required for the MdBT2-mediated ubiquitination modification of MdbHLH104 and its degradation. In sum, our findings demonstrate that MdBT proteins interact with MdCUL3 to bridge the formation of the MdBTsMdCUL3 complex, which negatively modulates the degradation of the MdbHLH104 protein in response to changes in Fe status to maintain iron homeostasis in plants. PMID:27660166

  14. Multiple post-domestication origins of kabuli chickpea through allelic variation in a diversification-associated transcription factor.

    PubMed

    Varma Penmetsa, R; Carrasquilla-Garcia, Noelia; Bergmann, Emily M; Vance, Lisa; Castro, Brenna; Kassa, Mulualem T; Sarma, Birinchi K; Datta, Subhojit; Farmer, Andrew D; Baek, Jong-Min; Coyne, Clarice J; Varshney, Rajeev K; von Wettberg, Eric J B; Cook, Douglas R

    2016-09-01

    Chickpea (Cicer arietinum) is among the founder crops domesticated in the Fertile Crescent. One of two major forms of chickpea, the so-called kabuli type, has white flowers and light-colored seed coats, properties not known to exist in the wild progenitor. The origin of the kabuli form has been enigmatic. We genotyped a collection of wild and cultivated chickpea genotypes with 538 single nucleotide polymorphisms (SNPs) and examined patterns of molecular diversity relative to geographical sources and market types. In addition, we examined sequence and expression variation in candidate anthocyanin biosynthetic pathway genes. A reduction in genetic diversity and extensive genetic admixture distinguish cultivated chickpea from its wild progenitor species. Among germplasm, the kabuli form is polyphyletic. We identified a basic helix-loop-helix (bHLH) transcription factor at chickpea's B locus that conditions flower and seed colors, orthologous to Mendel's A gene of garden pea, whose loss of function is associated invariantly with the kabuli type of chickpea. From the polyphyletic distribution of the kabuli form in germplasm, an absence of nested variation within the bHLH gene and invariant association of loss of function of bHLH among the kabuli type, we conclude that the kabuli form arose multiple times during the phase of phenotypic diversification after initial domestication of cultivated chickpea. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  15. Structure of the leukemia oncogene LMO2: implications for the assembly of a hematopoietic transcription factor complex.

    PubMed

    El Omari, Kamel; Hoosdally, Sarah J; Tuladhar, Kapil; Karia, Dimple; Vyas, Paresh; Patient, Roger; Porcher, Catherine; Mancini, Erika J

    2011-02-17

    The LIM only protein 2 (LMO2) is a key regulator of hematopoietic stem cell development whose ectopic expression in T cells leads to the onset of acute lymphoblastic leukemia. Through its LIM domains, LMO2 is thought to function as the scaffold for a DNA-binding transcription regulator complex, including the basic helix-loop-helix proteins SCL/TAL1 and E47, the zinc finger protein GATA-1, and LIM-domain interacting protein LDB1. To understand the role of LMO2 in the formation of this complex and ultimately to dissect its function in normal and aberrant hematopoiesis, we solved the crystal structure of LMO2 in complex with the LID domain of LDB1 at 2.4 Å resolution. We observe a largely unstructured LMO2 kept in register by the LID binding both LIM domains. Comparison of independently determined crystal structures of LMO2 reveals large movements around a conserved hinge between the LIM domains. We demonstrate that such conformational flexibility is necessary for binding of LMO2 to its partner protein SCL/TAL1 in vitro and for the function of this complex in vivo. These results, together with molecular docking and analysis of evolutionarily conserved residues, yield the first structural model of the DNA-binding complex containing LMO2, LDB1, SCL/TAL1, and GATA-1.

  16. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection

    PubMed Central

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  17. Overexpression of a bHLH1 Transcription Factor of Pyrus ussuriensis Confers Enhanced Cold Tolerance and Increases Expression of Stress-Responsive Genes

    PubMed Central

    Jin, Cong; Huang, Xiao-San; Li, Kong-Qing; Yin, Hao; Li, Lei-Ting; Yao, Zheng-Hong; Zhang, Shao-Ling

    2016-01-01

    The basic helix-loop-helix (bHLH) transcription factors are involved in arrays of physiological and biochemical processes. However, knowledge concerning the functions of bHLHs in cold tolerance remains poorly understood. In this study, a PubHLH1 gene isolated from Pyrus ussuriensis was characterized for its function in cold tolerance. PubHLH1 was upregulated by cold, salt, and dehydration, with the greatest induction under cold conditions. PubHLH1 had the transactivational activity and localized in the nucleus. Ectopic expression of PubHLH1 in transgenic tobacco conferred enhanced tolerance to cold stress. The transgenic lines had higher survival rates, higher chlorophyll, higher proline contents, lower electrolyte leakages and MDA when compared with wild type (WT). In addition, transcript levels of eight genes associated with ROS scavenging, regulation, and stress defense were higher in the transgenic plants relative to the WT under the chilling stress. Taken together, these results demonstrated that PubHLH1 played a key role in cold tolerance and, at least in part, contributed to activation of stress-responsive genes. PMID:27092159

  18. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    PubMed Central

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; Kim, Youngchang; Rastinejad, Fraydoon

    2016-01-01

    The neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the wider mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs. DOI: http://dx.doi.org/10.7554/eLife.18790.001 PMID:27782878

  19. The Transcriptional Repressor MYB2 Regulates Both Spatial and Temporal Patterns of Proanthocyandin and Anthocyanin Pigmentation in Medicago truncatula[OPEN

    PubMed Central

    2015-01-01

    Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. PMID:26410301

  20. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    SciTech Connect

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; Kim, Youngchang; Rastinejad, Fraydoon

    2016-10-26

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the wider mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.

  1. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    DOE PAGES

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...

    2016-10-26

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

  2. Two bHLH Transcription Factors, bHLH34 and bHLH104, Regulate Iron Homeostasis in Arabidopsis thaliana1

    PubMed Central

    Li, Xiaoli; Zhang, Huimin; Ai, Qin; Yu, Diqiu

    2016-01-01

    The regulation of iron (Fe) homeostasis is critical for plant survival. Although the systems responsible for the reduction, uptake, and translocation of Fe have been described, the molecular mechanism by which plants sense Fe status and coordinate the expression of Fe deficiency-responsive genes is largely unknown. Here, we report that two basic helix-loop-helix-type transcription factors, bHLH34 and bHLH104, positively regulate Fe homeostasis in Arabidopsis (Arabidopsis thaliana). Loss of function of bHLH34 and bHLH104 causes disruption of the Fe deficiency response and the reduction of Fe content, whereas overexpression plants constitutively promote the expression of Fe deficiency-responsive genes and Fe accumulation. Further analysis indicates that bHLH34 and bHLH104 directly activate the transcription of the Ib subgroup bHLH genes, bHLH38/39/100/101. Moreover, overexpression of bHLH101 partially rescues the Fe deficiency phenotypes of bhlh34bhlh104 double mutants. Further investigation suggests that bHLH34, bHLH104, and bHLH105 (IAA-LEUCINE RESISTANT3) function as homodimers or heterodimers to nonredundantly regulate Fe homeostasis. This work reveals that plants have evolved complex molecular mechanisms to regulate Fe deficiency response genes to adapt to Fe deficiency conditions. PMID:26921305

  3. Structural Basis for LMO2-Driven Recruitment of the SCL:E47bHLH Heterodimer to Hematopoietic-Specific Transcriptional Targets

    PubMed Central

    El Omari, Kamel; Hoosdally, Sarah J.; Tuladhar, Kapil; Karia, Dimple; Hall-Ponselé, Elisa; Platonova, Olga; Vyas, Paresh; Patient, Roger; Porcher, Catherine; Mancini, Erika J.

    2013-01-01

    Summary Cell fate is governed by combinatorial actions of transcriptional regulators assembling into multiprotein complexes. However, the molecular details of how these complexes form are poorly understood. One such complex, which contains the basic-helix-loop-helix heterodimer SCL:E47 and bridging proteins LMO2:LDB1, critically regulates hematopoiesis and induces T cell leukemia. Here, we report the crystal structure of (SCL:E47)bHLH:LMO2:LDB1LID bound to DNA, providing a molecular account of the network of interactions assembling this complex. This reveals an unexpected role for LMO2. Upon binding to SCL, LMO2 induces new hydrogen bonds in SCL:E47, thereby strengthening heterodimer formation. This imposes a rotation movement onto E47 that weakens the heterodimer:DNA interaction, shifting the main DNA-binding activity onto additional protein partners. Along with biochemical analyses, this illustrates, at an atomic level, how hematopoietic-specific SCL sequesters ubiquitous E47 and associated cofactors and supports SCL’s reported DNA-binding-independent functions. Importantly, this work will drive the design of small molecules inhibiting leukemogenic processes. PMID:23831025

  4. A proteomic study showing differential regulation of stress, redox regulation and peroxidase proteins by iron supply and the transcription factor FER.

    PubMed

    Brumbarova, Tzvetina; Matros, Andrea; Mock, Hans-Peter; Bauer, Petra

    2008-04-01

    Plants need to mobilize iron in the soil, and the basic helix-loop-helix transcription factor FER is a central regulator of iron acquisition in tomato roots. FER activity is controlled by iron supply. To analyse to what extent FER influences Fe-regulated protein expression, we investigated the root proteome of wild-type tomato, the fer mutant and a transgenic FER overexpression line under low-iron conditions versus sufficient and generous iron supply. The root proteomes were analysed by two-dimensional gel electrophoresis with three technical and three biological replicates. Statistical analysis identified 39 protein spots that were differentially regulated in selected pairwise comparisons of experimental conditions. Of these, 24 were correlated with expression clusters revealed by principal component analysis. The 39 protein spots were analysed by MALDI-TOF and nanoLC-MS/MS to deduce their possible functions. We investigated the functional representation in the identified expression clusters, and found that loss of FER function in iron-cultured plants mimicked an iron-deficiency status. The largest identified protein expression cluster was upregulated by iron deficiency and in the fer mutant. Two iron-regulated proteins required FER activity for induction by iron deficiency. Few proteins were suppressed by iron deficiency. The differentially expressed proteins belonged predominantly to the functional categories 'stress', 'redox regulation' and 'miscellaneous peroxidases'. Hence, we were able to identify distinct expression clusters of proteins with distinct functions.

  5. The bHLH Transcription Factor Hand Regulates the Expression of Genes Critical to Heart and Muscle Function in Drosophila melanogaster

    PubMed Central

    Hallier, Benjamin; Hoffmann, Julia; Roeder, Thomas; Tögel, Markus; Meyer, Heiko; Paululat, Achim

    2015-01-01

    Hand proteins belong to the highly conserved family of basic Helix-Loop-Helix transcription factors and are critical to distinct developmental processes, including cardiogenesis and neurogenesis in vertebrates. In Drosophila melanogaster a single orthologous hand gene is expressed with absence of the respective protein causing semilethality during early larval instars. Surviving adult animals suffer from shortened lifespan associated with a disorganized myofibrillar structure being apparent in the dorsal vessel, the wing hearts and in midgut tissue. Based on these data, the major biological significance of Hand seems to be related to muscle development, maintenance or function; however, up to now the physiological basis for Hand functionality remains elusive. Thus, the identification of genes whose expression is, directly or indirectly, regulated by Hand has considerable relevance with respect to understanding its biological functionality in flies and vertebrates. Beneficially, hand mutants are viable and exhibit affected tissues, which renders Drosophila an ideal model to investigate up- or downregulated target genes by a comparative microarray approach focusing on the respective tissues from mutant specimens. Our present work reveals for the first time that Drosophila Hand regulates the expression of numerous genes of diverse physiological relevancy, including distinct factors required for proper muscle development and function such as Zasp52 or Msp-300. These results relate Hand activity to muscle integrity and functionality and may thus be highly beneficial to the evaluation of corresponding hand phenotypes. PMID:26252215

  6. Structural basis for LMO2-driven recruitment of the SCL:E47bHLH heterodimer to hematopoietic-specific transcriptional targets.

    PubMed

    El Omari, Kamel; Hoosdally, Sarah J; Tuladhar, Kapil; Karia, Dimple; Hall-Ponselé, Elisa; Platonova, Olga; Vyas, Paresh; Patient, Roger; Porcher, Catherine; Mancini, Erika J

    2013-07-11

    Cell fate is governed by combinatorial actions of transcriptional regulators assembling into multiprotein complexes. However, the molecular details of how these complexes form are poorly understood. One such complex, which contains the basic-helix-loop-helix heterodimer SCL:E47 and bridging proteins LMO2:LDB1, critically regulates hematopoiesis and induces T cell leukemia. Here, we report the crystal structure of (SCL:E47)bHLH:LMO2:LDB1LID bound to DNA, providing a molecular account of the network of interactions assembling this complex. This reveals an unexpected role for LMO2. Upon binding to SCL, LMO2 induces new hydrogen bonds in SCL:E47, thereby strengthening heterodimer formation. This imposes a rotation movement onto E47 that weakens the heterodimer:DNA interaction, shifting the main DNA-binding activity onto additional protein partners. Along with biochemical analyses, this illustrates, at an atomic level, how hematopoietic-specific SCL sequesters ubiquitous E47 and associated cofactors and supports SCL's reported DNA-binding-independent functions. Importantly, this work will drive the design of small molecules inhibiting leukemogenic processes. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  7. PER and TIM inhibit the DNA binding activity of a Drosophila CLOCK-CYC/dBMAL1 heterodimer without disrupting formation of the heterodimer: a basis for circadian transcription.

    PubMed

    Lee, C; Bae, K; Edery, I

    1999-08-01

    The Drosophila CLOCK (dCLOCK) and CYCLE (CYC) (also referred to as dBMAL1) proteins are members of the basic helix-loop-helix PAS (PER-ARNT-SIM) superfamily of transcription factors and are required for high-level expression of the circadian clock genes period (per) and timeless (tim). Several lines of evidence indicate that PER, TIM, or a PER-TIM heterodimer somehow inhibit the transcriptional activity of a putative dCLOCK-CYC complex, generating a negative-feedback loop that is a core element of the Drosophila circadian oscillator. In this report we show that PER and/or TIM inhibits the binding of a dCLOCK-CYC heterodimer to an E-box-containing DNA fragment that is present in the 5' nontranscribed region of per and acts as a circadian enhancer element. Surprisingly, inhibition of this DNA binding activity by PER, TIM, or both is not accompanied by disruption of the association between dCLOCK and CYC. The results suggest that the interaction of PER, TIM, or both with the dCLOCK-CYC heterodimer induces a conformational change or masks protein regions in the heterodimer, leading to a reduction in DNA binding activity. Together with other findings, our results strongly suggest that daily cycles in the association of PER and TIM with the dCLOCK-CYC complex probably contribute to rhythmic expression of per and tim.

  8. Multisite light-induced phosphorylation of the transcription factor PIF3 is necessary for both its rapid degradation and concomitant negative feedback modulation of photoreceptor phyB levels in Arabidopsis.

    PubMed

    Ni, Weimin; Xu, Shou-Ling; Chalkley, Robert J; Pham, Thao Nguyen D; Guan, Shenheng; Maltby, Dave A; Burlingame, Alma L; Wang, Zhi-Yong; Quail, Peter H

    2013-07-01

    Plants constantly monitor informational light signals using sensory photoreceptors, which include the phytochrome (phy) family (phyA to phyE), and adjust their growth and development accordingly. Following light-induced nuclear translocation, photoactivated phy molecules bind to and induce rapid phosphorylation and degradation of phy-interacting basic Helix Loop Helix (bHLH) transcription factors (PIFs), such as PIF3, thereby regulating the expression of target genes. However, the mechanisms underlying the signal-relay process are still not fully understood. Here, using mass spectrometry, we identify multiple, in vivo, light-induced Ser/Thr phosphorylation sites in PIF3. Using transgenic expression of site-directed mutants of PIF3, we provide evidence that a set of these phosphorylation events acts collectively to trigger rapid degradation of the PIF3 protein in response to initial exposure of dark-grown seedlings to light. In addition, we show that phyB-induced PIF3 phosphorylation is also required for the known negative feedback modulation of phyB levels in prolonged light, potentially through codegradation of phyB and PIF3. This mutually regulatory intermolecular transaction thus provides a mechanism with the dual capacity to promote early, graded, or threshold regulation of the primary, PIF3-controlled transcriptional network in response to initial light exposure, and later, to attenuate global sensitivity to the light signal through reductions in photoreceptor levels upon prolonged exposure.

  9. Multisite Light-Induced Phosphorylation of the Transcription Factor PIF3 Is Necessary for Both Its Rapid Degradation and Concomitant Negative Feedback Modulation of Photoreceptor phyB Levels in Arabidopsis[C][W

    PubMed Central

    Ni, Weimin; Xu, Shou-Ling; Chalkley, Robert J.; Pham, Thao Nguyen D.; Guan, Shenheng; Maltby, Dave A.; Burlingame, Alma L.; Wang, Zhi-Yong; Quail, Peter H.

    2013-01-01

    Plants constantly monitor informational light signals using sensory photoreceptors, which include the phytochrome (phy) family (phyA to phyE), and adjust their growth and development accordingly. Following light-induced nuclear translocation, photoactivated phy molecules bind to and induce rapid phosphorylation and degradation of phy-interacting basic Helix Loop Helix (bHLH) transcription factors (PIFs), such as PIF3, thereby regulating the expression of target genes. However, the mechanisms underlying the signal-relay process are still not fully understood. Here, using mass spectrometry, we identify multiple, in vivo, light-induced Ser/Thr phosphorylation sites in PIF3. Using transgenic expression of site-directed mutants of PIF3, we provide evidence that a set of these phosphorylation events acts collectively to trigger rapid degradation of the PIF3 protein in response to initial exposure of dark-grown seedlings to light. In addition, we show that phyB-induced PIF3 phosphorylation is also required for the known negative feedback modulation of phyB levels in prolonged light, potentially through codegradation of phyB and PIF3. This mutually regulatory intermolecular transaction thus provides a mechanism with the dual capacity to promote early, graded, or threshold regulation of the primary, PIF3-controlled transcriptional network in response to initial light exposure, and later, to attenuate global sensitivity to the light signal through reductions in photoreceptor levels upon prolonged exposure. PMID:23903316

  10. Transcriptional coordination between leaf cell differentiation and chloroplast development established by TCP20 and the subgroup Ib bHLH transcription factors.

    PubMed

    Andriankaja, Megan E; Danisman, Selahattin; Mignolet-Spruyt, Lorin F; Claeys, Hannes; Kochanke, Irina; Vermeersch, Mattias; De Milde, Liesbeth; De Bodt, Stefanie; Storme, Veronique; Skirycz, Aleksandra; Maurer, Felix; Bauer, Petra; Mühlenbock, Per; Van Breusegem, Frank; Angenent, Gerco C; Immink, Richard G H; Inzé, Dirk

    2014-06-01

    The establishment of the photosynthetic apparatus during chloroplast development creates a high demand for iron as a redox metal. However, iron in too high quantities becomes toxic to the plant, thus plants have evolved a complex network of iron uptake and regulation mechanisms. Here, we examined whether four of the subgroup Ib basic helix-loop-helix transcription factors (bHLH38, bHLH39, bHLH100, bHLH101), previously implicated in iron homeostasis in roots, also play a role in regulating iron metabolism in developing leaves. These transcription factor genes were strongly up-regulated during the transition from cell proliferation to expansion, and thus sink-source transition, in young developing leaves of Arabidopsis thaliana. The four subgroup Ib bHLH genes also showed reduced expression levels in developing leaves of plants treated with norflurazon, indicating their expression was tightly linked to the onset of photosynthetic activity in young leaves. In addition, we provide evidence for a mechanism whereby the transcriptional regulators SAC51 and TCP20 antagonistically regulate the expression of these four subgroup Ib bHLH genes. A loss-of-function mutant analysis also revealed that single mutants of bHLH38, bHLH39, bHLH100, and bHLH101 developed smaller rosettes than wild-type plants in soil. When grown in agar plates with reduced iron concentration, triple bhlh39 bhlh100 bhlh101 mutant plants were smaller than wild-type plants. However, measurements of the iron content in single and multiple subgroup Ib bHLH genes, as well as transcript profiling of iron response genes during early leaf development, do not support a role for bHLH38, bHLH39, bHLH100, and bHLH101 in iron homeostasis during early leaf development.

  11. Targeting the bHLH transcriptional networks by mutated E proteins in experimental glioma.

    PubMed

    Beyeler, Sarah; Joly, Sandrine; Fries, Michel; Obermair, Franz-Josef; Burn, Felice; Mehmood, Rashid; Tabatabai, Ghazaleh; Raineteau, Olivier

    2014-10-01

    Glioblastomas (GB) are aggressive primary brain tumors. Helix-loop-helix (HLH, ID proteins) and basic HLH (bHLH, e.g., Olig2) proteins are transcription factors that regulate stem cell proliferation and differentiation throughout development and into adulthood. Their convergence on many oncogenic signaling pathways combined with the observation that their overexpression in GB correlates with poor clinical outcome identifies these transcription factors as promising therapeutic targets. Important dimerization partners of HLH/bHLH proteins are E proteins that are necessary for nuclear translocation and DNA binding. Here, we overexpressed a wild type or a dominant negative form of E47 (dnE47) that lacks its nuclear localization signal thus preventing nuclear translocation of bHLH proteins in long-term glioma cell lines and in glioma-initiating cell lines and analyzed the effects in vitro and in vivo. While overexpression of E47 was sufficient to induce apoptosis in absence of bHLH proteins, dnE47 was necessary to prevent nuclear translocation of Olig2 and to achieve similar proapoptotic responses. Transcriptional analyses revealed downregulation of the antiapoptotic gene BCL2L1 and the proproliferative gene CDC25A as underlying mechanisms. Overexpression of dnE47 in glioma-initiating cell lines with high HLH and bHLH protein levels reduced sphere formation capacities and expression levels of Nestin, BCL2L1, and CDC25A. Finally, the in vivo induction of dnE47 expression in established xenografts prolonged survival. In conclusion, our data introduce a novel approach to jointly neutralize HLH and bHLH transcriptional networks activities, and identify these transcription factors as potential targets in glioma.

  12. Transcription factors, sucrose, and sucrose metabolic genes interact to regulate potato phenylpropanoid metabolism

    PubMed Central

    Payyavula, Raja S.; Navarre, Duroy A.

    2013-01-01

    Much remains unknown about how transcription factors and sugars regulate phenylpropanoid metabolism in tuber crops like potato (Solanum tuberosum). Based on phylogeny and protein similarity to known regulators of phenylpropanoid metabolism, 15 transcription factors were selected and their expression was compared in white, yellow, red, and purple genotypes with contrasting phenolic and anthocyanin profiles. Red and purple genotypes had increased phenylalanine ammonia lyase (PAL) enzyme activity, markedly higher levels of phenylpropanoids, and elevated expression of most phenylpropanoid structural genes, including a novel anthocyanin O-methyltransferase. The transcription factors Anthocyanin1 (StAN1), basic Helix Loop Helix1 (StbHLH1), and StWD40 were more strongly expressed in red and purple potatoes. Expression of 12 other transcription factors was not associated with phenylpropanoid content, except for StMYB12B, which showed a negative relationship. Increased expression of AN1, bHLH1, and WD40 was also associated with environmentally mediated increases in tuber phenylpropanoids. Treatment of potato plantlets with sucrose induced hydroxycinnamic acids, flavonols, anthocyanins, structural genes, AN1, bHLH1, WD40, and genes encoding the sucrose-hydrolysing enzymes SUSY1, SUSY4, and INV2. Transient expression of StAN1 in tobacco leaves induced bHLH1, structural genes, SUSY1, SUSY4, and INV1, and increased phenylpropanoid amounts. StAN1 infiltration into tobacco leaves decreased sucrose and glucose concentrations. In silico promoter analysis revealed the presence of MYB and bHLH regulatory elements on sucrolytic gene promoters and sucrose-responsive elements on the AN1 promoter. These findings reveal an interesting dynamic between AN1, sucrose, and sucrose metabolic genes in modulating potato phenylpropanoids. PMID:24098049

  13. Molecular genetics of blood-fleshed peach reveals activation of anthocyanin biosynthesis by NAC transcription factors.

    PubMed

    Zhou, Hui; Lin-Wang, Kui; Wang, Huiliang; Gu, Chao; Dare, Andrew P; Espley, Richard V; He, Huaping; Allan, Andrew C; Han, Yuepeng

    2015-04-01

    Anthocyanin pigmentation is an important consumer trait in peach (Prunus persica). In this study, the genetic basis of the blood-flesh trait was investigated using the cultivar Dahongpao, which shows high levels of cyanidin-3-glucoside in the mesocarp. Elevation of anthocyanin levels in the flesh was correlated with the expression of an R2R3 MYB transcription factor, PpMYB10.1. However, PpMYB10.1 did not co-segregate with the blood-flesh trait. The blood-flesh trait was mapped to a 200-kb interval on peach linkage group (LG) 5. Within this interval, a gene encoding a NAC domain transcription factor (TF) was found to be highly up-regulated in blood-fleshed peaches when compared with non-red-fleshed peaches. This NAC TF, designated blood (BL), acts as a heterodimer with PpNAC1 which shows high levels of expression in fruit at late developmental stages. We show that the heterodimer of BL and PpNAC1 can activate the transcription of PpMYB10.1, resulting in anthocyanin pigmentation in tobacco. Furthermore, silencing the BL gene reduces anthocyanin pigmentation in blood-fleshed peaches. The transactivation activity of the BL-PpNAC1 heterodimer is repressed by a SQUAMOSA promoter-binding protein-like TF, PpSPL1. Low levels of PpMYB10.1 expression in fruit at early developmental stages is probably attributable to lower levels of expression of PpNAC1 plus the presence of high levels of repressors such as PpSPL1. We present a mechanism whereby BL is the key gene for the blood-flesh trait in peach via its activation of PpMYB10.1 in maturing fruit. Partner TFs such as basic helix-loop-helix proteins and NAC1 are required, as is the removal of transcriptional repressors.

  14. Miz-1 and Max compete to engage c-Myc: implication for the mechanism of inhibition of c-Myc transcriptional activity by Miz-1.

    PubMed

    Bédard, Mikaël; Maltais, Loïka; Montagne, Martin; Lavigne, Pierre

    2017-02-01

    c-Myc is a basic helix-loop-helix leucine zipper (b-HLH-LZ) transcription factor deregulated in the majority of human cancers. As a heterodimer with Max, another b-HLH-LZ transcription factor, deregulated and persistent c-Myc accumulates at transcriptionally active promoters and enhancers and amplifies transcription. This leads to the so-called transcriptional addiction of tumor cells. Recent studies have showed that c-Myc transcriptional activities can be reversed by its association with Miz-1, a POZ transcription factor containing 13 classical zinc fingers. Although evidences have led to suggest that c-Myc interacts with both Miz-1 and Max to form a ternary repressive complex, earlier evidences also suggest that Miz-1 and Max may compete to engage c-Myc. In such a scenario, the Miz-1/c-Myc complex would be the entity responsible for the inhibition of c-Myc transcriptional amplification. Considering the implications of the Miz-1/c-Myc interaction, it is highly important to solve this duality. While two potential c-Myc interacting domains (hereafter termed MID) have been identified in Miz-1 by yeast two-hybrid, with the b-HLH-LZ as a bait, the biophysical characterization of these interactions has not been reported so far. Here, we report that the MID located between the 12th and 13th zinc finger of Miz-1 and the b-HLH-LZ of Max compete to form a complex with the b-HLH-LZ of c-Myc. Our results support the notion that the repressive action of Miz-1 on c-Myc does not rely on the formation of a ternary complex. The implications of these observations for the mechanism of inhibition of c-Myc transcriptional activity by Miz-1 are discussed. Proteins 2017; 85:199-206. © 2016 Wiley Periodicals, Inc.

  15. A smallest 6 kda metalloprotease, mini-matrilysin, in living world: a revolutionary conserved zinc-dependent proteolytic domain- helix-loop-helix catalytic zinc binding domain (ZBD)

    PubMed Central

    2012-01-01

    Background The Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family. The metzincin super family share a catalytic domain consisting of a twisted five-stranded β sheet and three long α helices (A, B and C). The catalytic zinc is at the bottom of the cleft and is ligated by three His residues in the consensus sequence motif, HEXXHXXGXXH, which is located in helix B and part of the adjacent Met turn region. An interesting question is - what is the minimum portion of the enzyme that still possesses catalytic and inhibitor recognition?” Methods We have expressed a 60-residue truncated form of matrilysin which retains only the helix B-Met turn-helix C region and deletes helix A and the five-stranded β sheet which form the upper portion of the active cleft. This is only 1/4 of the full catalytic domain. The E. coli derived 6 kDa MMP-7 ZBD fragments were purified and refolded. The proteolytic activities were analyzed by Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay and CM-transferrin zymography analysis. SC44463, BB94 and Phosphoramidon were computationally docked into the 3day structure of the human MMP7 ZBD and TAD and thermolysin using the docking program GOLD. Results This minimal 6 kDa matrilysin has been refolded and shown to have proteolytic activity in the Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay. Triton X-100 and heparin are important factors in the refolding environment for this mini-enzyme matrilysin. This minienzyme has the proteolytic activity towards peptide substrate, but the hexamer and octamer of the mini MMP-7 complex demonstrates the CM-transferrin proteolytic activities in zymographic analysis. Peptide digestion is inhibited by SC44463, specific MMP7 inhibitors, but not phosphorimadon. Interestingly, the mini MMP-7 can be processed by autolysis and producing ~ 6 ~ 7 kDa fragments. Thus, many of the functions of the enzyme are retained indicating that the helix B-Met loop-helix C is the minimal functional “domain” found to date for the matrixin family. Conclusions The helix B-Met loop-helix C folding conserved in metalloprotease metzincin super family is able to facilitate proteolytic catalysis for specific substrate and inhibitor recognition. The autolysis processing and producing 6 kDa mini MMP-7 is the smallest metalloprotease in living world. PMID:22642296

  16. A murine uterine transcriptome, responsive to steroid receptor coactivator-2, reveals transcription factor 23 as essential for decidualization of human endometrial stromal cells.

    PubMed

    Kommagani, Ramakrishna; Szwarc, Maria M; Kovanci, Ertug; Creighton, Chad J; O'Malley, Bert W; Demayo, Francesco J; Lydon, John P

    2014-04-01

    Recent data from human and mouse studies strongly support an indispensable role for steroid receptor coactivator-2 (SRC-2)-a member of the p160/SRC family of coregulators-in progesterone-dependent endometrial stromal cell decidualization, an essential cellular transformation process that regulates invasion of the developing embryo into the maternal compartment. To identify the key progesterone-induced transcriptional changes that are dependent on SRC-2 and required for endometrial decidualization, we performed comparative genome-wide transcriptional profiling of endometrial tissue RNA from ovariectomized SRC-2(flox/flox) (SRC-2(f/f) [control]) and PR(cre/+)/SRC-2(flox/flox) (SRC-2(d/d) [SRC-2-depleted]) mice, acutely treated with vehicle or progesterone. Although data mining revealed that only a small subset of the total progesterone-dependent transcriptional changes is dependent on SRC-2 (∼13%), key genes previously reported to mediate progesterone-driven endometrial stromal cell decidualization are present within this subset. Along with providing a more detailed molecular portrait of the decidual transcriptional program governed by SRC-2, the degree of functional diversity of these progesterone mediators underscores the pleiotropic regulatory role of SRC-2 in this tissue. To showcase the utility of this powerful informational resource to uncover novel signaling paradigms, we stratified the total SRC-2-dependent subset of progesterone-induced transcriptional changes in terms of novel gene expression and identified transcription factor 23 (Tcf23), a basic-helix-loop-helix transcription factor, as a new progesterone-induced target gene that requires SRC-2 for full induction. Importantly, using primary human endometrial stromal cells in culture, we demonstrate that TCF23 function is essential for progesterone-dependent decidualization, providing crucial translational support for this transcription factor as a new decidual mediator of progesterone action.

  17. SREBP-2 negatively regulates FXR-dependent transcription of FGF19 in human intestinal cells.

    PubMed

    Miyata, Masaaki; Hata, Tatsuya; Yamazoe, Yasushi; Yoshinari, Kouichi

    2014-01-10

    Sterol regulatory element-binding protein-2 (SREBP-2) is a basic helix-loop-helix-leucine zipper transcription factor that positively regulates transcription of target genes involved in cholesterol metabolism. In the present study, we have investigated a possible involvement of SREBP-2 in human intestinal expression of fibroblast growth factor (FGF)19, which is an endocrine hormone involved in the regulation of lipid and glucose metabolism. Overexpression of constitutively active SREBP-2 decreased FGF19 mRNA levels in human colon-derived LS174T cells. In reporter assays, active SREBP-2 overexpression suppressed GW4064/FXR-mediated increase in reporter activities in regions containing the IR-1 motif (+848 to +5200) in the FGF19 gene. The suppressive effect disappeared in reporter activities in the region containing the IR-1 motif when the mutation was introduced into the IR-1 motif. In electrophoretic mobility shift assays, binding of the FXR/retinoid X receptor α heterodimer to the IR-1 motif was attenuated by adding active SREBP-2, but SREBP-2 binding to the IR-1 motif was not observed. In chromatin immunoprecipitation assays, specific binding of FXR to the IR-1-containing region of the FGF19 gene (+3214 to +3404) was increased in LS174T cells by treatment with cholesterol and 25-hydroxycholesterol. Specific binding of SREBP-2 to FXR was observed in glutathione-S-transferase (GST) pull-down assays. These results suggest that SREBP-2 negatively regulates the FXR-mediated transcriptional activation of the FGF19 gene in human intestinal cells.

  18. A GATA-dependent right ventricular enhancer controls dHAND transcription in the developing heart.

    PubMed

    McFadden, D G; Charité, J; Richardson, J A; Srivastava, D; Firulli, A B; Olson, E N

    2000-12-01

    Heart formation in vertebrates is believed to occur in a segmental fashion, with discreet populations of cardiac progenitors giving rise to different chambers of the heart. However, the mechanisms involved in specification of different chamber lineages are unclear. The basic helix-loop-helix transcription factor dHAND is expressed in cardiac precursors throughout the cardiac crescent and the linear heart tube, before becoming restricted to the right ventricular chamber at the onset of looping morphogenesis. dHAND is also expressed in the branchial arch neural crest, which contributes to craniofacial structures and the aortic arch arteries. Using a series of dHAND-lacZ reporter genes in transgenic mice, we show that cardiac and neural crest expression of dHAND are controlled by separate upstream enhancers and we describe a composite cardiac-specific enhancer that directs lacZ expression in a pattern that mimics that of the endogenous dHAND gene throughout heart development. Deletion analysis reduced this enhancer to a 1.5 kb region and identified subregions responsible for expression in the right ventricle and cardiac outflow tract. Comparison of mouse regulatory elements required for right ventricular expression to the human dHAND upstream sequence revealed two conserved consensus sites for binding of GATA transcription factors. Mutation of these sites abolished transgene expression in the right ventricle, identifying dHAND as a direct transcriptional target of GATA factors during right ventricle development. Since GATA factors are not chamber-restricted, these findings suggest the existence of positive and/or negative coregulators that cooperate with GATA factors to control right ventricular-specific gene expression in the developing heart.

  19. A transcription factor network specifying inhibitory versus excitatory neurons in the dorsal spinal cord.

    PubMed

    Borromeo, Mark D; Meredith, David M; Castro, Diogo S; Chang, Joshua C; Tung, Kuang-Chi; Guillemot, Francois; Johnson, Jane E

    2014-07-01

    The proper balance of excitatory and inhibitory neurons is crucial for normal processing of somatosensory information in the dorsal spinal cord. Two neural basic helix-loop-helix transcription factors (TFs), Ascl1 and Ptf1a, have contrasting functions in specifying these neurons. To understand how Ascl1 and Ptf1a function in this process, we identified their direct transcriptional targets genome-wide in the embryonic mouse neural tube using ChIP-Seq and RNA-Seq. We show that Ascl1 and Ptf1a directly regulate distinct homeodomain TFs that specify excitatory or inhibitory neuronal fates. In addition, Ascl1 directly regulates genes with roles in several steps of the neurogenic program, including Notch signaling, neuronal differentiation, axon guidance and synapse formation. By contrast, Ptf1a directly regulates genes encoding components of the neurotransmitter machinery in inhibitory neurons, and other later aspects of neural development distinct from those regulated by Ascl1. Moreover, Ptf1a represses the excitatory neuronal fate by directly repressing several targets of Ascl1. Ascl1 and Ptf1a bind sequences primarily enriched for a specific E-Box motif (CAGCTG) and for secondary motifs used by Sox, Rfx, Pou and homeodomain factors. Ptf1a also binds sequences uniquely enriched in the CAGATG E-box and in the binding motif for its co-factor Rbpj, providing two factors that influence the specificity of Ptf1a binding. The direct transcriptional targets identified for Ascl1 and Ptf1a provide a molecular understanding of how these DNA-binding proteins function in neuronal development, particularly as key regulators of homeodomain TFs required for neuronal subtype specification. © 2014. Published by The Company of Biologists Ltd.

  20. Proteasome-mediated turnover of the transcriptional activator FIT is required for plant iron-deficiency responses.

    PubMed

    Sivitz, Alicia; Grinvalds, Claudia; Barberon, Marie; Curie, Catherine; Vert, Grégory

    2011-06-01

    Plants display a number of responses to low iron availability in order to increase iron uptake from the soil. In the model plant Arabidopsis thaliana, the ferric-chelate reductase FRO2 and the ferrous iron transporter IRT1 control iron entry from the soil into the root epidermis. To maintain iron homeostasis, the expression of FRO2 and IRT1 is tightly controlled by iron deficiency at the transcriptional level. The basic helix-loop-helix (bHLH) transcription factor FIT represents the most upstream actor known in the iron-deficiency signaling pathway, and directly regulates the expression of the root iron uptake machinery genes FRO2 and IRT1. However, how FIT is controlled by iron and acts to activate transcription of its targets remains obscure. Here we show that FIT mRNA and endogenous FIT protein accumulate in Arabidopsis roots upon iron deficiency. However, using plants constitutively expressing FIT, we observed that FIT protein accumulation is reduced in iron-limited conditions. This post-transcriptional regulation of FIT is perfectly synchronized with the accumulation of endogenous FIT and IRT1 proteins, and therefore is part of the early responses to low iron. We demonstrated that such regulation affects FIT protein stability under iron deficiency as a result of 26S proteasome-dependent degradation. In addition, we showed that FIT post-translational regulation by iron is required for FRO2 and IRT1 gene expression. Taken together our results indicate that FIT transcriptional and post-translational regulations are integrated in plant roots to ensure that the positive regulator FIT accumulates as a short-lived protein following iron shortage, and to allow proper iron-deficiency responses.

  1. Genome-wide analysis of the bHLH transcription factor family in Chinese cabbage (Brassica rapa ssp. pekinensis).

    PubMed

    Song, Xiao-Ming; Huang, Zhi-Nan; Duan, Wei-Ke; Ren, Jun; Liu, Tong-Kun; Li, Ying; Hou, Xi-Lin

    2014-02-01

    Basic helix-loop-helix (bHLH) transcription factors are widely distributed in eukaryotic organisms and are thought to be one of the largest families of regulatory proteins. This important family of transcriptional regulators plays crucial roles in plant development. However, a systematic analysis of the bHLH transcription factor family has not been reported in Chinese cabbage. In this study, 230 bHLH transcription factors were identified from the whole Chinese cabbage genome and compared with proteins from other representative plants, fungi and metazoans. The Chinese cabbage bHLH (BrabHLH) gene family could be classified into 24 subfamilies. Phylogenetic analysis of BrabHLHs along with bHLHs from Arabidopsis and rice indicated 26 subfamilies. The identification, classification, phylogenetic reconstruction, conserved motifs, chromosome distribution, functional annotation, expression patterns and interaction networks of BrabHLHs were analyzed. Distribution mapping showed that BrabHLHs were non-randomly located on the ten Chinese cabbage chromosomes. One hundred and twenty-four orthologous bHLH genes were identified between Chinese cabbage and Arabidopsis, and the interaction networks of the orthologous genes were constructed in Chinese cabbage. Quantitative RT-PCR analysis showed that expressions of BrabHLH genes varied widely under different abiotic stress treatments for different times. Thus, this comprehensive analysis of BrabHLHs represents a rich resource, aiding the elucidation of the roles of bHLH family members in plant growth and development. Furthermore, the comparative genomics analysis deepened our understanding of the evolution of this gene family after a polyploidy event.

  2. NLR-Associating Transcription Factor bHLH84 and Its Paralogs Function Redundantly in Plant Immunity

    PubMed Central

    Xu, Fang; Kapos, Paul; Cheng, Yu Ti; Li, Meng; Zhang, Yuelin; Li, Xin

    2014-01-01

    In plants and animals, nucleotide-binding and leucine-rich repeat domain containing (NLR) immune receptors are utilized to detect the presence or activities of pathogen-derived molecules. However, the mechanisms by which NLR proteins induce defense responses remain unclear. Here, we report the characterization of one basic Helix-loop-Helix (bHLH) type transcription factor (TF), bHLH84, identified from a reverse genetic screen. It functions as a transcriptional activator that enhances the autoimmunity of NLR mutant snc1 (suppressor of npr1-1, constitutive 1) and confers enhanced immunity in wild-type backgrounds when overexpressed. Simultaneously knocking out three closely related bHLH paralogs attenuates RPS4-mediated immunity and partially suppresses the autoimmune phenotypes of snc1, while overexpression of the other two close paralogs also renders strong autoimmunity, suggesting functional redundancy in the gene family. Intriguingly, the autoimmunity conferred by bHLH84 overexpression can be largely suppressed by the loss-of-function snc1-r1 mutation, suggesting that SNC1 is required for its proper function. In planta co-immunoprecipitation revealed interactions between not only bHLH84 and SNC1, but also bHLH84 and RPS4, indicating that bHLH84 associates with these NLRs. Together with previous finding that SNC1 associates with repressor TPR1 to repress negative regulators, we hypothesize that nuclear NLR proteins may interact with both transcriptional repressors and activators during immune responses, enabling potentially faster and more robust transcriptional reprogramming upon pathogen recognition. PMID:25144198

  3. Expression and cellular localization of the transcription factor NeuroD1 in the developing and adult rat pineal gland.

    PubMed

    Castro, Analía E; Benitez, Sergio G; Farias Altamirano, Luz E; Savastano, Luis E; Patterson, Sean I; Muñoz, Estela M

    2015-05-01

    Circadian rhythms govern many aspects of mammalian physiology. The daily pattern of melatonin synthesis and secretion is one of the classic examples of circadian oscillations. It is mediated by a class of neuroendocrine cells known as pinealocytes which are not yet fully defined. An established method to evaluate functional and cytological characters is through the expression of lineage-specific transcriptional regulators. NeuroD1 is a basic helix-loop-helix transcription factor involved in the specification and maintenance of both endocrine and neuronal phenotypes. We have previously described developmental and adult regulation of NeuroD1 mRNA in the rodent pineal gland. However, the transcript levels were not influenced by the elimination of sympathetic input, suggesting that any rhythmicity of NeuroD1 might be found downstream of transcription. Here, we describe NeuroD1 protein expression and cellular localization in the rat pineal gland during development and the daily cycle. In embryonic and perinatal stages, protein expression follows the mRNA pattern and is predominantly nuclear. Thereafter, NeuroD1 is mostly found in pinealocyte nuclei in the early part of the night and in cytoplasm during the day, a rhythm maintained into adulthood. Additionally, nocturnal nuclear NeuroD1 levels are reduced after sympathetic disruption, an effect mimicked by the in vivo administration of α- and β-adrenoceptor blockers. NeuroD1 phosphorylation at two sites, Ser(274) and Ser(336) , associates with nuclear localization in pinealocytes. These data suggest that NeuroD1 influences pineal phenotype both during development and adulthood, in an autonomic and phosphorylation-dependent manner.

  4. Tissue and cell-type co-expression networks of transcription factors and wood component genes in Populus trichocarpa.

    PubMed

    Shi, Rui; Wang, Jack P; Lin, Ying-Chung; Li, Quanzi; Sun, Ying-Hsuan; Chen, Hao; Sederoff, Ronald R; Chiang, Vincent L

    2017-05-01

    Co-expression networks based on transcriptomes of Populus trichocarpa major tissues and specific cell types suggest redundant control of cell wall component biosynthetic genes by transcription factors in wood formation. We analyzed the transcriptomes of five tissues (xylem, phloem, shoot, leaf, and root) and two wood forming cell types (fiber and vessel) of Populus trichocarpa to assemble gene co-expression subnetworks associated with wood formation. We identified 165 transcription factors (TFs) that showed xylem-, fiber-, and vessel-specific expression. Of these 165 TFs, 101 co-expressed (correlation coefficient, r > 0.7) with the 45 secondary cell wall cellulose, hemicellulose, and lignin biosynthetic genes. Each cell wall component gene co-expressed on average with 34 TFs, suggesting redundant control of the cell wall component gene expression. Co-expression analysis showed that the 101 TFs and the 45 cell wall component genes each has two distinct groups (groups 1 and 2), based on their co-expression patterns. The group 1 TFs (44 members) are predominantly xylem and fiber specific, and are all highly positively co-expressed with the group 1 cell wall component genes (30 members), suggesting their roles as major wood formation regulators. Group 1 TFs include a lateral organ boundary domain gene (LBD) that has the highest number of positively correlated cell wall component genes (36) and TFs (47). The group 2 TFs have 57 members, including 14 vessel-specific TFs, and are generally less correlated with the cell wall component genes. An exception is a vessel-specific basic helix-loop-helix (bHLH) gene that negatively correlates with 20 cell wall component genes, and may function as a key transcriptional suppressor. The co-expression networks revealed here suggest a well-structured transcriptional homeostasis for cell wall component biosynthesis during wood formation.

  5. Real-time imaging of bHLH transcription factors reveals their dynamic control in the multipotency and fate choice of neural stem cells.

    PubMed

    Imayoshi, Itaru; Ishidate, Fumiyoshi; Kageyama, Ryoichiro

    2015-01-01

    The basic-helix-loop-helix (bHLH) transcription factors Ascl1/Mash1, Hes1, and Olig2 regulate the fate choice of neurons, astrocytes, and oligodendrocytes, respectively; however, these factors are coexpressed in self-renewing multipotent neural stem cells (NSCs) even before cell fate determination. This fact raises the possibility that these fate determination factors are differentially expressed between self-renewing and differentiating NSCs with unique expression dynamics. Real-time imaging analysis utilizing fluorescent proteins is a powerful strategy for monitoring expression dynamics. Fusion with fluorescent reporters makes it possible to analyze the dynamic behavior of specific proteins in living cells. However, it is technically challenging to conduct long-term imaging of proteins, particularly those with low expression levels, because a high-sensitivity and low-noise imaging system is required, and very often bleaching of fluorescent proteins and cell toxicity by prolonged laser exposure are problematic. Furthermore, to analyze the functional roles of the dynamic expression of cellular proteins, it is essential to image reporter fusion proteins that are expressed at comparable levels to their endogenous expression. In this review, we introduce our recent reports about the dynamic control of bHLH transcription factors in multipotency and fate choice of NSCs, focusing on real-time imaging of fluorescent reporters fused with bHLH transcription factors. Our imaging results indicate that bHLH transcription factors are expressed in an oscillatory manner by NSCs, and that one of them becomes dominant during fate choice. We propose that the multipotent state of NSCs correlates with the oscillatory expression of several bHLH transcription factors, whereas the differentiated state correlates with the sustained expression of a single bHLH transcription factor.

  6. Twist1 Transcriptional Targets in the Developing Atrio-Ventricular Canal of the Mouse

    PubMed Central

    Vrljicak, Pavle; Cullum, Rebecca; Xu, Eric; Chang, Alex C. Y.; Wederell, Elizabeth D.; Bilenky, Mikhail; Jones, Steven J. M.; Marra, Marco A.; Karsan, Aly; Hoodless, Pamela A.

    2012-01-01

    Malformations of the cardiovascular system are the most common type of birth defect in humans, frequently affecting the formation of valves and septa. During heart valve and septa formation, cells from the atrio-ventricular canal (AVC) and outflow tract (OFT) regions of the heart undergo an epithelial-to-mesenchymal transformation (EMT) and invade the underlying extracellular matrix to give rise to endocardial cushions. Subsequent maturation of newly formed mesenchyme cells leads to thin stress-resistant leaflets. TWIST1 is a basic helix-loop-helix transcription factor expressed in newly formed mesenchyme cells of the AVC and OFT that has been shown to play roles in cell survival, cell proliferation and differentiation. However, the downstream targets of TWIST1 during heart valve formation remain unclear. To identify genes important for heart valve development downstream of TWIST1, we performed global gene expression profiling of AVC, OFT, atria and ventricles of the embryonic day 10.5 mouse heart by tag-sequencing (Tag-seq). Using this resource we identified a novel set of 939 genes, including 123 regulators of transcription, enriched in the valve forming regions of the heart. We compared these genes to a Tag-seq library from the Twist1 null developing valves revealing significant gene expression changes. These changes were consistent with a role of TWIST1 in controlling differentiation of mesenchymal cells following their transformation from endothelium in the mouse. To study the role of TWIST1 at the DNA level we performed chromatin immunoprecipitation and identified novel direct targets of TWIST1 in the developing heart valves. Our findings support a role for TWIST1 in the differentiation of AVC mesenchyme post-EMT in the mouse, and suggest that TWIST1 can exert its function by direct DNA binding to activate valve specific gene expression. PMID:22815831

  7. Cloning and functional characterisation of avian transcription factor E2A.

    PubMed

    Conlon, Thomas M; Meyer, Kerstin B

    2004-06-14

    During B lymphocyte development the E2A gene is a critical regulator of cell proliferation and differentiation. With regards to the immunoglobulin genes the E2A proteins contribute to the regulation of gene rearrangement, expression and class switch recombination. We are now using the chicken cell line DT40 as a model system to further analyse the function of E2A. Here we report the cloning and functional analysis of the transcription factor E2A from chicken. Using RACE PCR on the chicken lymphoma cell line DT40 we have isolated full-length clones for the two E2A splice variants E12 and E47. Sequence conservation between the human and chicken proteins is extensive: the basic-helix-loop-helix DNA binding domain of human and chicken E47 and E12 are 93% and 92% identical, respectively. In addition high levels of conservation are seen in activation domain I, the potential NLS and the ubiquitin ligase interaction domain. E2A is expressed in a variety of tissues in chicken, with higher levels of expression in organs rich in immune cells. We demonstrate that chicken E12 and E47 proteins are strong transcriptional activators whose function depends on the presence of activation domain I. As in mammals, the dominant negative proteins Id1 and Id3 can inhibit the function of chicken E47. The potential for homologous recombination in DT40 allows the genetic dissection of biochemical pathways in somatic cells. With the cloning of avian E2A and the recent description of an in vitro somatic hypermutation assay in this cell line, it should now be possible to dissect the potential role of E2A in the regulation of somatic hypermutation and gene conversion.

  8. Blue Light–Dependent Interaction between Cryptochrome2 and CIB1 Regulates Transcription and Leaf Senescence in Soybean[W

    PubMed Central

    Meng, Yingying; Li, Hongyu; Wang, Qin; Liu, Bin; Lin, Chentao

    2013-01-01

    Cryptochromes are blue light receptors that regulate light responses in plants, including various crops. The molecular mechanism of plant cryptochromes has been extensively investigated in Arabidopsis thaliana, but it has not been reported in any crop species. Here, we report a study of the mechanism of soybean (Glycine max) cryptochrome2 (CRY2a). We found that CRY2a regulates leaf senescence, which is a life history trait regulated by light and photoperiods via previously unknown mechanisms. We show that CRY2a undergoes blue light–dependent interaction with the soybean basic helix-loop-helix transcription activator CIB1 (for cryptochrome-interacting bHLH1) that specifically interacts with the E-box (CANNTG) DNA sequences. Analyses of transgenic soybean plants expressing an elevated or reduced level of the CRY2a or CIB1 demonstrate that CIB1 promotes leaf senescence, whereas CRY2a suppresses leaf senescence. Results of the gene expression and molecular interaction analyses support the hypothesis that CIB1 activates transcription of senescence-associated genes, such as WRKY DNA BINDING PROTEIN53b (WRKY53b), and leaf senescence. CIB1 interacts with the E-box–containing promoter sequences of the WRKY53b chromatin, whereas photoexcited CRY2a interacts with CIB1 to inhibit its DNA binding activity. These findings argue that CIB-dependent transcriptional regulation is an evolutionarily conserved CRY-signaling mechanism in plants, and this mechanism is opted in evolution to mediate light regulation of different aspects of plant development in different plant species. PMID:24272488

  9. The Arabidopsis bHLH25 and bHLH27 transcription factors contribute to susceptibility to the cyst nematode Heterodera schachtii.

    PubMed

    Jin, Jing; Hewezi, Tarek; Baum, Thomas J

    2011-01-01

    Successful cyst nematode parasitism depends on the formation and maintenance of feeding sites (syncytia) in host roots, and these processes are highly regulated by the interaction between the cyst nematode and the host. Using an integrated research approach and the Arabidopsis-Beta vulgaris (sugar beet) cyst nematode (Heterodera schachtii) pathosystem, we have determined that the two Arabidopsis basic helix-loop-helix transcription factors bHLH25 and bHLH27 positively influence cyst nematode parasitism. Promoter studies indicated that as early as 1 day post-inoculation, both transcription factor genes were upregulated in developing syncytia, whereas in non-infected plants, these two promoters were not found to be active in the same cells. By using yeast two-hybrid analyses and bimolecular fluorescence complementation assays, we documented that the two bHLH transcription factors can dimerize in planta. Transgenic Arabidopsis plants overexpressing either one or both of the bHLH genes exhibited altered morphology of roots and shoots, as well as an increased susceptibility to H. schachtii. bhlh25 or bhlh27 single mutants were without strong phenotypes, presumably because of functional redundancies in this gene family. However, the bhlh25 bhlh27 double mutant was less susceptible to H. schachtii, confirming an important conducive role of the co-expression of both transcription factor genes for cyst nematode parasitism. Our results document an example of pathogen-induced ectopic co-expression of two regulatory genes to enhance pathogen success, although these transcription factors apparently do not function in concert in non-infected plants. This is an intriguing biological phenomenon that highlights the complexity of obligate biotrophic plant-pathogen interactions, like those of cyst nematodes.

  10. Metabolic Profiling of Retrograde Pathway Transcription Factors Rtg1 and Rtg3 Knockout Yeast

    PubMed Central

    Hashim, Zanariah; Mukai, Yukio; Bamba, Takeshi; Fukusaki, Eiichiro

    2014-01-01

    Rtg1 and Rtg3 are two basic helix-loop-helix (bHLH) transcription factors found in yeast Saccharomyces cerevisiae that are involved in the regulation of the mitochondrial retrograde (RTG) pathway. Under RTG response, anaplerotic synthesis of citrate is activated, consequently maintaining the supply of important precursors necessary for amino acid and nucleotide synthesis. Although the roles of Rtg1 and Rtg3 in TCA and glyoxylate cycles have been extensively reported, the investigation of other metabolic pathways has been lacking. Characteristic dimer formation in bHLH proteins, which allows for combinatorial gene expression, and the link between RTG and other regulatory pathways suggest more complex metabolic signaling involved in Rtg1/Rtg3 regulation. In this study, using a metabolomics approach, we examined metabolic alteration following RTG1 and RTG3 deletion. We found that apart from TCA and glyoxylate cycles, which have been previously reported, polyamine biosynthesis and other amino acid metabolism were significantly altered in RTG-deficient strains. We revealed that metabolic alterations occurred at various metabolic sites and that these changes relate to different growth phases, but the difference can be detected even at the mid-exponential phase, when mitochondrial function is repressed. Moreover, the effect of metabolic rearrangements can be seen through the chronological lifespan (CLS) measurement, where we confirmed the role of the RTG pathway in extending the yeast lifespan. Through a comprehensive metabolic profiling, we were able to explore metabolic phenotypes previously unidentified by other means and illustrate the possible correlations of Rtg1 and Rtg3 in different pathways. PMID:25007314

  11. Down-Regulating the Expression of 53 Soybean Transcription Factor Genes Uncovers a Role for SPEECHLESS in Initiating Stomatal Cell Lineages during Embryo Development.

    PubMed

    Danzer, John; Mellott, Eric; Bui, Anhthu Q; Le, Brandon H; Martin, Patrick; Hashimoto, Meryl; Perez-Lesher, Jeanett; Chen, Min; Pelletier, Julie M; Somers, David A; Goldberg, Robert B; Harada, John J

    2015-07-01

    We used an RNA interference screen to assay the function of 53 transcription factor messenger RNAs (mRNAs) that accumulate specifically within soybean (Glycine max) seed regions, subregions, and tissues during development. We show that basic helix-loop-helix (bHLH) transcription factor genes represented by Glyma04g41710 and its paralogs are required for the formation of stoma in leaves and stomatal precursor complexes in mature embryo cotyledons. Phylogenetic analysis indicates that these bHLH transcription factor genes are orthologous to Arabidopsis (Arabidopsis thaliana) SPEECHLESS (SPCH) that initiate asymmetric cell divisions in the leaf protoderm layer and establish stomatal cell lineages. Soybean SPCH (GmSPCH) mRNAs accumulate primarily in embryo, seedling, and leaf epidermal layers. Expression of Glyma04g41710 under the control of the SPCH promoter rescues the Arabidopsis spch mutant, indicating that Glyma04g41710 is a functional ortholog of SPCH. Developing soybean embryos do not form mature stoma, and stomatal differentiation is arrested at the guard mother cell stage. We analyzed the accumulation of GmSPCH mRNAs during soybean seed development and mRNAs orthologous to MUTE, FAMA, and inducer of C-repeat/dehydration responsive element-binding factor expression1/scream2 that are required for stoma formation in Arabidopsis. The mRNA accumulation patterns provide a potential explanation for guard mother cell dormancy in soybean embryos. Our results suggest that variation in the timing of bHLH transcription factor gene expression can explain the diversity of stomatal forms observed during plant development.

  12. Down-Regulating the Expression of 53 Soybean Transcription Factor Genes Uncovers a Role for SPEECHLESS in Initiating Stomatal Cell Lineages during Embryo Development1[OPEN

    PubMed Central

    Danzer, John; Mellott, Eric; Bui, Anhthu Q.; Le, Brandon H.; Martin, Patrick; Hashimoto, Meryl; Perez-Lesher, Jeanett; Chen, Min; Pelletier, Julie M.; Somers, David A.; Goldberg, Robert B.; Harada, John J.

    2015-01-01

    We used an RNA interference screen to assay the function of 53 transcription factor messenger RNAs (mRNAs) that accumulate specifically within soybean (Glycine max) seed regions, subregions, and tissues during development. We show that basic helix-loop-helix (bHLH) transcription factor genes represented by Glyma04g41710 and its paralogs are required for the formation of stoma in leaves and stomatal precursor complexes in mature embryo cotyledons. Phylogenetic analysis indicates that these bHLH transcription factor genes are orthologous to Arabidopsis (Arabidopsis thaliana) SPEECHLESS (SPCH) that initiate asymmetric cell divisions in the leaf protoderm layer and establish stomatal cell lineages. Soybean SPCH (GmSPCH) mRNAs accumulate primarily in embryo, seedling, and leaf epidermal layers. Expression of Glyma04g41710 under the control of the SPCH promoter rescues the Arabidopsis spch mutant, indicating that Glyma04g41710 is a functional ortholog of SPCH. Developing soybean embryos do not form mature stoma, and stomatal differentiation is arrested at the guard mother cell stage. We analyzed the accumulation of GmSPCH mRNAs during soybean seed development and mRNAs orthologous to MUTE, FAMA, and INDUCER OF C-REPEAT/DEHYDRATION RESPONSIVE ELEMENT-BINDING FACTOR EXPRESSION1/SCREAM2 that are required for stoma formation in Arabidopsis. The mRNA accumulation patterns provide a potential explanation for guard mother cell dormancy in soybean embryos. Our results suggest that variation in the timing of bHLH transcription factor gene expression can explain the diversity of stomatal forms observed during plant development. PMID:25963149

  13. Transcriptional regulation of neuronal genes and its effect on neural functions: gene expression in response to static magnetism in cultured rat hippocampal neurons.

    PubMed

    Hirai, Takao; Yoneda, Yukio

    2005-07-01

    We have previously shown a marked but transient increase in DNA binding of the nuclear transcription factor activator protein-1 after brief exposure to static magnetic fields in cultured rat hippocampal neurons, suggesting that exposure to static magnetism would lead to long-term consolidation as well as amplification of different functional alterations through modulation of de novo protein synthesis at the level of gene transcription in the hippocampus. Hippocampal neurons were cultured under sustained exposure to static magnetic fields at 100 mT, followed by extraction of total RNA for differential display (DD) analysis using random primers. The first and the second DD polymerase chain reaction similarly showed the downregulation of particular genes in response to sustained magnetism. Nucleotide sequence analysis followed by BLASTN homology searching revealed high homology of these 2 DD-PCR products to the 3' non-coding regions of the mouse basic helix-loop-helix transcription factor ALF1 and that of histone H3.3A, respectively. On Northern blot analysis using the 2 cloned differentially expressed fragments labeled with [alpha-(32)P]dCTP by the random primer method, a marked decrease was seen in expression of mRNA for ALF1 and histone H3.3A in hippocampal neurons cultured under sustained exposure to static magnetic fields at 100 mT. It thus appears that static magnetism may modulate cellular integrity and functionality through expression of a variety of responsive genes required for gene transcription and translation, proliferation, differentiation, maturation, survival, and so on in cultured rat hippocampal neurons.

  14. Biochemical and molecular analysis of pink tomatoes: deregulated expression of the gene encoding transcription factor SlMYB12 leads to pink tomato fruit color.

    PubMed

    Ballester, Ana-Rosa; Molthoff, Jos; de Vos, Ric; Hekkert, Bas te Lintel; Orzaez, Diego; Fernández-Moreno, Josefina-Patricia; Tripodi, Pasquale; Grandillo, Silvana; Martin, Cathie; Heldens, Jos; Ykema, Marieke; Granell, Antonio; Bovy, Arnaud

    2010-01-01

    The color of tomato fruit is mainly determined by carotenoids and flavonoids. Phenotypic analysis of an introgression line (IL) population derived from a cross between Solanum lycopersicum 'Moneyberg' and the wild species Solanum chmielewskii revealed three ILs with a pink fruit color. These lines had a homozygous S. chmielewskii introgression on the short arm of chromosome 1, consistent with the position of the y (yellow) mutation known to result in colorless epidermis, and hence pink-colored fruit, when combined with a red flesh. Metabolic analysis showed that pink fruit lack the ripening-dependent accumulation of the yellow-colored flavonoid naringenin chalcone in the fruit peel, while carotenoid levels are not affected. The expression of all genes encoding biosynthetic enzymes involved in the production of the flavonol rutin from naringenin chalcone was down-regulated in pink fruit, suggesting that the candidate gene underlying the pink phenotype encodes a regulatory protein such as a transcription factor rather than a biosynthetic enzyme. Of 26 MYB and basic helix-loop-helix transcription factors putatively involved in regulating transcription of genes in the phenylpropanoid and/or flavonoid pathway, only the expression level of the MYB12 gene correlated well with the decrease in the expression of structural flavonoid genes in peel samples of pink- and red-fruited genotypes during ripening. Genetic mapping and segregation analysis showed that MYB12 is located on chromosome 1 and segregates perfectly with the characteristic pink fruit color. Virus-induced gene silencing of SlMYB12 resulted in a decrease in the accumulation of naringenin chalcone, a phenotype consistent with the pink-colored tomato fruit of IL1b. In conclusion, biochemical and molecular data, gene mapping, segregation analysis, and virus-induced gene silencing experiments demonstrate that the MYB12 transcription factor plays an important role in regulating the flavonoid pathway in tomato fruit

  15. Id-1 is induced in MDCK epithelial cells by activated Erk/MAPK pathway in response to expression of the Snail and E47 transcription factors

    SciTech Connect

    Jorda, Mireia; Vinyals, Antonia; Marazuela, Anna; Cubillo, Eva; Olmeda, David; Valero, Eva; Cano, Amparo; Fabra, Angels . E-mail: afabra@idibell.org

    2007-07-01

    Id-1, a member of the helix-loop-helix transcription factor family has been shown to be involved in cell proliferation, angiogenesis and invasion of many types of human cancers. We have previously shown that stable expression of E47 and Snail repressors of the E-cadherin promoter in MDCK epithelial cell line triggers epithelial mesenchymal transition (EMT) concomitantly with changes in gene expression. We show here that both factors activate the Id-1 gene promoter and induce Id-1 mRNA and protein. The upregulation of the Id-1 gene occurs through the transactivation of the promoter by the Erk/MAPK signaling pathway. Moreover, oncogenic Ras is also able to activate Id-1 promoter in MDCK cells in the absence of both E47 and Snail transcription factors. Several transcriptionally active regulatory elements have been identified in the proximal promoter, including AP-1, Sp1 and four putative E-boxes. By EMSA, we only detected an increased binding to Sp1 and AP-1 elements in E47- and Snail-expressing cells. Binding is affected by the treatment of cells with PD 98059 MEK inhibitor, suggesting that MAPK/Erk contributes to the recruitment or assembly of proteins to Id-1 promoter. Small interfering RNA directed against Sp1 reduced Id-1 expression and the upregulation of the promoter, indicating that Sp1 is required for Id-1 induction in E47- and Snail-expressing cells. Our results provide new insights into how some target genes are activated during and/or as a consequence of the EMT triggered by both E47 and Snail transcription factors.

  16. The coat protein of Alfalfa mosaic virus interacts and interferes with the transcriptional activity of the bHLH transcription factor ILR3 promoting salicylic acid-dependent defence signalling response.

    PubMed

    Aparicio, Frederic; Pallás, Vicente

    2017-02-01

    During virus infection, specific viral component-host factor interaction elicits the transcriptional reprogramming of diverse cellular pathways. Alfalfa mosaic virus (AMV) can establish a compatible interaction in tobacco and Arabidopsis hosts. We show that the coat protein (CP) of AMV interacts directly with transcription factor (TF) ILR3 of both species. ILR3 is a basic helix-loop-helix (bHLH) family member of TFs, previously proposed to participate in diverse metabolic pathways. ILR3 has been shown to regulate NEET in Arabidopsis, a critical protein in plant development, senescence, iron metabolism and reactive oxygen species (ROS) homeostasis. We show that the AMV CP-ILR3 interaction causes a fraction of this TF to relocate from the nucleus to the nucleolus. ROS, pathogenesis-related protein 1 (PR1) mRNAs, salicylic acid (SA) and jasmonic acid (JA) contents are increased in healthy Arabidopsis loss-of-function ILR3 mutant (ilr3.2) plants, which implicates ILR3 in the regulation of plant defence responses. In AMV-infected wild-type (wt) plants, NEET expression is reduced slightly, but is induced significantly in ilr3.2 mutant plants. Furthermore, the accumulation of SA and JA is induced in Arabidopsis wt-infected plants. AMV infection in ilr3.2 plants increases JA by over 10-fold, and SA is reduced significantly, indicating an antagonist crosstalk effect. The accumulation levels of viral RNAs are decreased significantly in ilr3.2 mutants, but the virus can still systemically invade the plant. The AMV CP-ILR3 interaction may down-regulate a host factor, NEET, leading to the activation of plant hormone responses to obtain a hormonal equilibrium state, where infection remains at a level that does not affect plant viability.

  17. Expression Differences of Pigment Structural Genes and Transcription Factors Explain Flesh Coloration in Three Contrasting Kiwifruit Cultivars

    PubMed Central

    Liu, Yanfei; Zhou, Bin; Qi, Yingwei; Chen, Xin; Liu, Cuihua; Liu, Zhande; Ren, Xiaolin

    2017-01-01

    Fruits of kiwifruit cultivars (Actinidia chinensis and A. deliciosa) generally have green or yellow flesh when ripe. A small number of genotypes have red flesh but this coloration is usually restricted to the inner pericarp. Three kiwifruit cultivars having red (‘Hongyang’), or yellow (‘Jinnong-2’), or green (‘Hayward’) flesh were investigated for their color characteristics and pigment contents during development and ripening. The results show the yellow of the ‘Jinnong-2’ fruit is due to the combined effects of chlorophyll degradation and of beta-carotene accumulation. The red inner pericarps of ‘Hongyang’ fruit are due to anthocyanin accumulation. Expression differences of the pathway genes in the inner pericarps of the three different kiwifruits suggest that stay-green (SGR) controls the degradation of chlorophylls, while lycopene beta-cyclase (LCY-β) controls the biosynthesis of beta-carotene. The abundance of anthocyanin in the inner pericarps of the ‘Hongyang’ fruit is the results of high expressions of UDP flavonoid glycosyltransferases (UFGT). At the same time, expressions of anthocyanin transcription factors show that AcMYBF110 expression parallels changes in anthocyanin concentration, so seems to be a key R2R3 MYB, regulating anthocyanin biosynthesis. Further, transient color assays reveal that AcMYBF110 can autonomously induce anthocyanin accumulation in Nicotiana tabacum leaves by activating the transcription of dihydroflavonol 4-reductase (NtDFR), anthocyanidin synthase (NtANS) and NtUFGT. For basic helix-loop-helix proteins (bHLHs) and WD-repeat proteins (WD40s), expression differences show these may depend on AcMYBF110 forming a MYB-bHLH-WD40 complex to regulate anthocyanin biosynthesis, instead of it having a direct involvement. PMID:28919902

  18. The study of a SPATULA-like bHLH transcription factor expressed during peach (Prunus persica) fruit development.

    PubMed

    Tani, Eleni; Tsaballa, Aphrodite; Stedel, Catalina; Kalloniati, Chrissanthi; Papaefthimiou, Dimitra; Polidoros, Alexios; Darzentas, Nikos; Ganopoulos, Ioannis; Flemetakis, Emmanouil; Katinakis, Panagiotis; Tsaftaris, Athanasios

    2011-06-01

    Extensive studies on the dry fruits of the model plant arabidopsis (Arabidopsis thaliana) have revealed various gene regulators of the development and dehiscence of the siliques. Peach pericarp is analogous to the valve tissues of the arabidopsis siliques. The stone (otherwise called pit) in drupes is formed through lignification of the fruit endocarp. The lignified endocarp in peach can be susceptible to split-pit formation under certain genetic as well as environmental factors. This phenomenon delays processing of the clingstone varieties of peach and causes economical losses for the peach fruit canning industry. The fruitfull (FUL) and shatterproof (SHP) genes are key MADS-box transcription protein coding factors that control fruit development and dehiscence in arabidopsis by promoting the expression of basic helix-loop-helix (bHLH) transcription factors like Spatula (SPT) and Alcatraz (ALC). Results from our previous studies on peach suggested that temporal regulation of PPERFUL and PPERSHP gene expression may be involved in the regulation of endocarp margin development. In the present study a PPERSPATULA-like (PPERSPT) gene was cloned and characterized. Comparative analysis of temporal regulation of PPERSPT gene expression during pit hardening in a resistant and a susceptible to split-pit variety, suggests that this gene adds one more component to the genes network that controls endocarp margins development in peach. Taking into consideration that no ALC-like genes have been identified in any dicot plant species outside the Brassicaceae family, where arabidopsis belongs, PPERSPT may have additional role(s) in peach that are fulfilled in arabidopsis by ALC.

  19. Transcription Factor SCL Is Required for c-kit Expression and c-Kit Function in Hemopoietic Cells

    PubMed Central

    Krosl, Gorazd; He, Gang; Lefrancois, Martin; Charron, Frédéric; Roméo, Paul-Henri; Jolicoeur, Paul; Kirsch, Ilan R.; Nemer, Mona; Hoang, Trang

    1998-01-01

    In normal hemopoietic cells that are dependent on specific growth factors for cell survival, the expression of the basic helix-loop-helix transcription factor SCL/Tal1 correlates with that of c-Kit, the receptor for Steel factor (SF) or stem cell factor. To address the possibility that SCL may function upstream of c-kit, we sought to modulate endogenous SCL function in the CD34+ hemopoietic cell line TF-1, which requires SF, granulocyte/macrophage colony–stimulating factor, or interleukin 3 for survival. Ectopic expression of an antisense SCL cDNA (as-SCL) or a dominant negative SCL (dn-SCL) in these cells impaired SCL DNA binding activity, and prevented the suppression of apoptosis by SF only, indicating that SCL is required for c-Kit–dependent cell survival. Consistent with the lack of response to SF, the level of c-kit mRNA and c-Kit protein was significantly and specifically reduced in as-SCL– or dn-SCL– expressing cells. c-kit mRNA, c-kit promoter activity, and the response to SF were rescued by SCL overexpression in the antisense or dn-SCL transfectants. Furthermore, ectopic c-kit expression in as-SCL transfectants is sufficient to restore cell survival in response to SF. Finally, enforced SCL in the pro–B cell line Ba/F3, which is both SCL and c-kit negative is sufficient to induce c-Kit and SF responsiveness. Together, these results indicate that c-kit, a gene that is essential for the survival of primitive hemopoietic cells, is a downstream target of the transcription factor SCL. PMID:9687522

  20. Angiopoietin-2 is a direct transcriptional target of TAL1, LYL1 and LMO2 in endothelial cells.

    PubMed

    Deleuze, Virginie; El-Hajj, Rawan; Chalhoub, Elias; Dohet, Christiane; Pinet, Valérie; Couttet, Philippe; Mathieu, Danièle

    2012-01-01

    The two related basic helix-loop-helix, TAL1 and LYL1, and their cofactor LIM-only-2 protein (LMO2) are present in blood and endothelial cells. While their crucial role in early hematopoiesis is well established, their function in endothelial cells and especially in angiogenesis is less understood. Here, we identified ANGIOPOIETIN-2 (ANG-2), which encodes a major regulator of angiogenesis, as a direct transcriptional target of TAL1, LYL1 and LMO2. Knockdown of any of the three transcription factors in human blood and lymphatic endothelial cells caused ANG-2 mRNA and protein down-regulation. Transient transfections showed that the full activity of the ANG-2 promoter required the integrity of a highly conserved Ebox-GATA composite element. Accordingly, chromatin immunoprecipitation assays demonstrated that TAL1, LYL1, LMO2 and GATA2 occupied this region of ANG-2 promoter in human endothelial cells. Furthermore, we showed that LMO2 played a central role in assembling TAL1-E47, LYL1-LYL1 or/and LYL1-TAL1 dimers with GATA2. The resulting complexes were able to activate endogenous ANG-2 expression in endothelial cells as well as in non-endothelial cells. Finally, we showed that ANG-2 gene activation during angiogenesis concurred with the up-regulation of TAL1 and LMO2. Altogether, we identified ANG-2 as a bona fide target gene of LMO2-complexes with TAL1 and/or LYL1, highlighting a new function of the three hematopoietic factors in the endothelial lineage.

  1. Pbx and Prdm1a transcription factors differentially regulate subsets of the fast skeletal muscle program in zebrafish.

    PubMed

    Yao, Zizhen; Farr, Gist H; Tapscott, Stephen J; Maves, Lisa

    2013-06-15

    The basic helix-loop-helix factor Myod initiates skeletal muscle differentiation by directly and sequentially activating sets of muscle differentiation genes, including those encoding muscle contractile proteins. We hypothesize that Pbx homeodomain proteins direct Myod to a subset of its transcriptional targets, in particular fast-twitch muscle differentiation genes, thereby regulating the competence of muscle precursor cells to differentiate. We have previously shown that Pbx proteins bind with Myod on the promoter of the zebrafish fast muscle gene mylpfa and that Pbx proteins are required for Myod to activate mylpfa expression and the fast-twitch muscle-specific differentiation program in zebrafish embryos. Here we have investigated the interactions of Pbx with another muscle fiber-type regulator, Prdm1a, a SET-domain DNA-binding factor that directly represses mylpfa expression and fast muscle differentiation. The prdm1a mutant phenotype, early and increased fast muscle differentiation, is the opposite of the Pbx-null phenotype, delayed and reduced fast muscle differentiation. To determine whether Pbx and Prdm1a have opposing activities on a common set of genes, we used RNA-seq analysis to globally assess gene expression in zebrafish embryos with single- and double-losses-of-function for Pbx and Prdm1a. We find that the levels of expression of certain fast muscle genes are increased or approximately wild type in pbx2/4-MO;prdm1a-/- embryos, suggesting that Pbx activity normally counters the repressive action of Prdm1a for a subset of the fast muscle program. However, other fast muscle genes require Pbx but are not regulated by Prdm1a. Thus, our findings reveal that subsets of the fast muscle program are differentially regulated by Pbx and Prdm1a. Our findings provide an example of how Pbx homeodomain proteins act in a balance with other transcription factors to regulate subsets of a cellular differentiation program.

  2. Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors

    PubMed Central

    Winbush, Ari; van der Linden, Alexander M.

    2016-01-01

    Food and feeding-state dependent changes in chemoreceptor gene expression may allow Caenorhabditis elegans to modify their chemosensory behavior, but the mechanisms essential for these expression changes remain poorly characterized. We had previously shown that expression of a feeding state-dependent chemoreceptor gene, srh-234, in the ADL sensory neuron of C. elegans is regulated via the MEF-2 transcription factor. Here, we show that MEF-2 acts together with basic helix-loop-helix (bHLH) transcription factors to regulate srh-234 expression as a function of feeding state. We identify a cis-regulatory MEF2 binding site that is necessary and sufficient for the starvation-induced down regulation of srh-234 expression, while an E-box site known to bind bHLH factors is required to drive srh-234 expression in ADL. We show that HLH-2 (E/Daughterless), HLH-3 and HLH-4 (Achaete-scute homologs) act in ADL neurons to regulate srh-234 expression. We further demonstrate that the expression levels of srh-234 in ADL neurons are regulated remotely by MXL-3 (Max-like 3 homolog) and HLH-30 (TFEB ortholog) acting in the intestine, which is dependent on insulin signaling functioning specifically in ADL neurons. We also show that this intestine-to-neuron feeding-state regulation of srh-234 involves a subset of insulin-like peptides. These results combined suggest that chemoreceptor gene expression is regulated by both cell-autonomous and non-cell-autonomous transcriptional mechanisms mediated by MEF2 and bHLH factors, which may allow animals to fine-tune their chemosensory responses in response to changes in their feeding state. PMID:27487365

  3. Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.

    PubMed

    Gruner, Matthew; Grubbs, Jeremy; McDonagh, Aja; Valdes, Dominic; Winbush, Ari; van der Linden, Alexander M

    2016-08-01

    Food and feeding-state dependent changes in chemoreceptor gene expression may allow Caenorhabditis elegans to modify their chemosensory behavior, but the mechanisms essential for these expression changes remain poorly characterized. We had previously shown that expression of a feeding state-dependent chemoreceptor gene, srh-234, in the ADL sensory neuron of C. elegans is regulated via the MEF-2 transcription factor. Here, we show that MEF-2 acts together with basic helix-loop-helix (bHLH) transcription factors to regulate srh-234 expression as a function of feeding state. We identify a cis-regulatory MEF2 binding site that is necessary and sufficient for the starvation-induced down regulation of srh-234 expression, while an E-box site known to bind bHLH factors is required to drive srh-234 expression in ADL. We show that HLH-2 (E/Daughterless), HLH-3 and HLH-4 (Achaete-scute homologs) act in ADL neurons to regulate srh-234 expression. We further demonstrate that the expression levels of srh-234 in ADL neurons are regulated remotely by MXL-3 (Max-like 3 homolog) and HLH-30 (TFEB ortholog) acting in the intestine, which is dependent on insulin signaling functioning specifically in ADL neurons. We also show that this intestine-to-neuron feeding-state regulation of srh-234 involves a subset of insulin-like peptides. These results combined suggest that chemoreceptor gene expression is regulated by both cell-autonomous and non-cell-autonomous transcriptional mechanisms mediated by MEF2 and bHLH factors, which may allow animals to fine-tune their chemosensory responses in response to changes in their feeding state.

  4. The crystal structure of the AhRR/ARNT heterodimer reveals the structural basis of the repression of AhR-mediated transcription.

    PubMed

    Sakurai, Shunya; Shimizu, Toshiyuki; Ohto, Umeharu

    2017-09-13

    2,3,7,8-Tetrachlorodibenzo-p-dioxin and related compounds (TCDDs) are extraordinarily potent environmental toxic pollutants. Most of the TCDD toxicities are mediated by aryl hydrocarbon receptor (AhR), a ligand-dependent transcription factor belonging to the basic helix-loop-helix-Per-ARNT-Sim (bHLH-PAS) family. Upon ligand binding, AhR forms a heterodimer with AhR nuclear translocator (ARNT) and induces the expression of genes involved in various biological responses. One of the genes induced by AhR encodes AhR repressor (AhRR), which also forms a heterodimer with ARNT and represses the activation of AhR-dependent transcription. The control of AhR activation is critical for managing AhR-mediated diseases, but the mechanisms by which AhRR represses AhR activation remain poorly understood, due to the lack of structural information. Here, we determined the structure of the AhRR/ARNT heterodimer by X-ray crystallography, which revealed an asymmetric intertwined domain organization presenting structural features that are both conserved and distinct among bHLH-PAS family members. The structures of AhRR/ARNT and AhR/ARNT were similar in the bHLH-PAS-A region, while the PAS-B of ARNT in the AhRR/ARNT complex exhibited a different domain arrangement in this family reported so far. The structure clearly disclosed that AhRR competitively represses AhR binding to ARNT and target DNA, and further suggested the existence of an AhRR/ARNT-specific repression mechanism. This study provides a structural basis for understanding the mechanism by which AhRR represses AhR-mediated gene transcription. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  5. ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12) Interacts with FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT) Linking Iron Deficiency and Oxidative Stress Responses.

    PubMed

    Le, Cham Thi Tuyet; Brumbarova, Tzvetina; Ivanov, Rumen; Stoof, Claudia; Weber, Eva; Mohrbacher, Julia; Fink-Straube, Claudia; Bauer, Petra

    2016-01-01

    Plants grown under iron (Fe)-deficient conditions induce a set of genes that enhance the efficiency of Fe uptake by the roots. In Arabidopsis (Arabidopsis thaliana), the central regulator of this response is the basic helix-loop-helix transcription factor FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT). FIT activity is regulated by protein-protein interactions, which also serve to integrate external signals that stimulate and possibly inhibit Fe uptake. In the search of signaling components regulating FIT function, we identified ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12), an abiotic stress-induced transcription factor. ZAT12 interacted with FIT, dependent on the presence of the ethylene-responsive element-binding factor-associated amphiphilic repression motif. ZAT12 protein was found expressed in the root early differentiation zone, where its abundance was modulated in a root layer-specific manner. In the absence of ZAT12, FIT expression was upregulated, suggesting a negative effect of ZAT12 on Fe uptake. Consistently, zat12 loss-of-function mutants had higher Fe content than the wild type at sufficient Fe. We found that under Fe deficiency, hydrogen peroxide (H2O2) levels were enhanced in a FIT-dependent manner. FIT protein, in turn, was stabilized by H2O2 but only in the presence of ZAT12, showing that H2O2 serves as a signal for Fe deficiency responses. We propose that oxidative stress-induced ZAT12 functions as a negative regulator of Fe acquisition. A model where H2O2 mediates the negative regulation of plant responses to prolonged stress might be applicable to a variety of stress conditions.

  6. Rox, a novel bHLHZip protein expressed in quiescent cells that heterodimerizes with Max, binds a non-canonical E box and acts as a transcriptional repressor.

    PubMed Central

    Meroni, G; Reymond, A; Alcalay, M; Borsani, G; Tanigami, A; Tonlorenzi, R; Nigro, C L; Messali, S; Zollo, M; Ledbetter, D H; Brent, R; Ballabio, A; Carrozzo, R

    1997-01-01

    Proteins of the Myc and Mad family are involved in transcriptional regulation and mediate cell differentiation and proliferation. These molecules share a basic-helix-loop-helix leucine zipper domain (bHLHZip) and bind DNA at the E box (CANNTG) consensus by forming heterodimers with Max. We report the isolation, characterization and mapping of a human gene and its mouse homolog encoding a new member of this family of proteins, named Rox. Through interaction mating and immunoprecipitation techniques, we demonstrate that Rox heterodimerizes with Max and weakly homodimerizes. Interestingly, bandshift assays demonstrate that the Rox-Max heterodimer shows a novel DNA binding specificity, having a higher affinity for the CACGCG site compared with the canonical E box CACGTG site. Transcriptional studies indicate that Rox represses transcription in both human HEK293 cells and yeast. We demonstrate that repression in yeast is through interaction between the N-terminus of the protein and the Sin3 co-repressor, as previously shown for the other Mad family members. ROX is highly expressed in quiescent fibroblasts and expression markedly decreases when cells enter the cell cycle. Moreover, ROX expression appears to be induced in U937 myeloid leukemia cells stimulated to differentiate with 12-O-tetradecanoylphorbol-13-acetate. The identification of a novel Max-interacting protein adds an important piece to the puzzle of Myc/Max/Mad coordinated action and function in normal and pathological situations. Furthermore, mapping of the human gene to chromosome 17p13.3 in a region that frequently undergoes loss of heterozygosity in a number of malignancies, together with the biochemical and expression features, suggest involvement of ROX in human neoplasia. PMID:9184233

  7. Mad3 and Mad4: novel Max-interacting transcriptional repressors that suppress c-myc dependent transformation and are expressed during neural and epidermal differentiation.

    PubMed Central

    Hurlin, P J; Quéva, C; Koskinen, P J; Steingrímsson, E; Ayer, D E; Copeland, N G; Jenkins, N A; Eisenman, R N

    1995-01-01

    The basic helix-loop-helix-leucine zipper (bHLHZip) protein Max associates with members of the Myc family, as well as with the related proteins Mad (Mad1) and Mxi1. Whereas both Myc:Max and Mad:Max heterodimers bind related E-box sequences, Myc:Max activates transcription and promotes proliferation while Mad:Max represses transcription and suppresses Myc dependent transformation. Here we report the identification and characterization of two novel Mad1- and Mxi1-related proteins, Mad3 and Mad4. Mad3 and Mad4 interact with both Max and mSin3 and repress transcription from a promoter containing CACGTG binding sites. Using a rat embryo fibroblast transformation assay, we show that both Mad3 and Mad4 inhibit c-Myc dependent cell transformation. An examination of the expression patterns of all mad genes during murine embryogenesis reveals that mad1, mad3 and mad4 are expressed primarily in growth-arrested differentiating cells. mxi1 is also expressed in differentiating cells, but is co-expressed with either c-myc, N-myc, or both in proliferating cells of the developing central nervous system and the epidermis. In the developing central nervous system and epidermis, downregulation of myc genes occurs concomitant with upregulation of mad family genes. These expression patterns, together with the demonstrated ability of Mad family proteins to interfere with the proliferation promoting activities of Myc, suggest that the regulated expression of Myc and Mad family proteins function in a concerted fashion to regulate cell growth in differentiating tissues. Images PMID:8521822

  8. Overexpression of GmERF5, a new member of the soybean EAR motif-containing ERF transcription factor, enhances resistance to Phytophthora sojae in soybean.

    PubMed

    Dong, Lidong; Cheng, Yingxin; Wu, Junjiang; Cheng, Qun; Li, Wenbin; Fan, Sujie; Jiang, Liangyu; Xu, Zhaolong; Kong, Fanjiang; Zhang, Dayong; Xu, Pengfei; Zhang, Shuzhen

    2015-05-01

    Phytophthora root and stem rot of soybean [Glycine max (L.) Merr.], caused by Phytophthora sojae Kaufmann and Gerdemann, is a destructive disease throughout the soybean planting regions in the world. Here, we report insights into the function and underlying mechanisms of a novel ethylene response factor (ERF) in soybean, namely GmERF5, in host responses to P. sojae. GmERF5-overexpressing transgenic soybean exhibited significantly enhanced resistance to P. sojae and positively regulated the expression of the PR10, PR1-1, and PR10-1 genes. Sequence analysis suggested that GmERF5 contains an AP2/ERF domain of 58 aa and a conserved ERF-associated amphiphilic repression (EAR) motif in its C-terminal region. Following stress treatments, GmERF5 was significantly induced by P. sojae, ethylene (ET), abscisic acid (ABA), and salicylic acid (SA). The activity of the GmERF5 promoter (GmERF5P) was upregulated in tobacco leaves with ET, ABA, Phytophthora nicotianae, salt, and drought treatments, suggesting that GmERF5 could be involved not only in the induced defence response but also in the ABA-mediated pathway of salt and drought tolerance. GmERF5 could bind to the GCC-box element and act as a repressor of gene transcription. It was targeted to the nucleus when transiently expressed in Arabidopsis protoplasts. GmERF5 interacted with a basic helix-loop-helix transcription factor (GmbHLH) and eukaryotic translation initiation factor (GmEIF) both in yeast cells and in planta. To the best of our knowledge, GmERF5 is the first soybean EAR motif-containing ERF transcription factor demonstrated to be involved in the response to pathogen infection.

  9. A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with pbx-Meis1/Prep1.

    PubMed

    Knoepfler, P S; Bergstrom, D A; Uetsuki, T; Dac-Korytko, I; Sun, Y H; Wright, W E; Tapscott, S J; Kamps, M P

    1999-09-15

    The t(1;19) chromosomal translocation of pediatric pre-B cell leukemia produces chimeric oncoprotein E2a-Pbx1, which contains the N-terminal transactivation domain of the basic helix-loop-helix (bHLH) transcription factor, E2a, joined to the majority of the homeodomain protein, Pbx1. There are three Pbx family members, which bind DNA as heterodimers with both broadly expressed Meis/Prep1 homeo-domain proteins and specifically expressed Hox homeodomain proteins. These Pbx heterodimers can augment the function of transcriptional activators bound to adjacent elements. In heterodimers, a conserved tryptophan motif in Hox proteins binds a pocket on the surface of the Pbx homeodomain, while Meis/Prep1 proteins bind an N-terminal Pbx domain, raising the possibility that the tryptophan-interaction pocket of the Pbx component of a Pbx-Meis/Prep1 complex is still available to bind trypto-phan motifs of other transcription factors bound to flanking elements. Here, we report that Pbx-Meis1/Prep1 binds DNA cooperatively with heterodimers of E2a and MyoD, myogenin, Mrf-4 or Myf-5. As with Hox proteins, a highly conserved tryptophan motif N-terminal to the DNA-binding domains of each myogenic bHLH family protein is required for cooperative DNA binding with Pbx-Meis1/Prep1. In vivo, MyoD requires this tryptophan motif to evoke chromatin remodeling in the Myogenin promoter and to activate Myogenin transcription. Pbx-Meis/Prep1 complexes, therefore, have the potential to cooperate with the myogenic bHLH proteins in regulating gene transcription.

  10. Transforming growth factor beta 1-responsive element: closely associated binding sites for USF and CCAAT-binding transcription factor-nuclear factor I in the type 1 plasminogen activator inhibitor gene.

    PubMed Central

    Riccio, A; Pedone, P V; Lund, L R; Olesen, T; Olsen, H S; Andreasen, P A

    1992-01-01

    Transforming growth factor beta (TGF-beta) is the name of a group of closely related polypeptides characterized by a multiplicity of effects, including regulation of extracellular proteolysis and turnover of the extracellular matrix. Its cellular mechanism of action is largely unknown. TGF-beta 1 is a strong and fast inducer of type 1 plasminogen activator inhibitor gene transcription. We have identified a TGF-beta 1-responsive element in the 5'-flanking region of the human type 1 plasminogen activator inhibitor gene and shown that it is functional both in its natural context and when fused to a heterologous nonresponsive promoter. Footprinting and gel retardation experiments showed that two different nuclear factors, present in extracts from both TGF-beta 1-treated and nontreated cells, bind to adjacent sequences contained in the responsive unit. A palindromic sequence binds a trans-acting factor(s) of the CCAAT-binding transcription factor-nuclear factor I family. A partially overlapping dyad symmetry interacts with a second protein that much evidence indicates to be USF. USF is a transactivator belonging to the basic helix-loop-helix family of transcription factors. Mutations which abolish the binding of either CCAAT-binding transcription factor-nuclear factor I or USF result in reduction of transcriptional activation upon exposure to TGF-beta 1, thus showing that both elements of the unit are necessary for the TGF-beta 1 response. We discuss the possible relationship of these findings to the complexity of the TGF-beta action. Images PMID:1549130

  11. The bHLH Transcription Factor NeuroD Governs Photoreceptor Genesis and Regeneration Through Delta-Notch Signaling

    PubMed Central

    Taylor, Scott M.; Alvarez-Delfin, Karen; Saade, Carole J.; Thomas, Jennifer L.; Thummel, Ryan; Fadool, James M.; Hitchcock, Peter F.

    2015-01-01

    Purpose Photoreceptor genesis in the retina requires precise regulation of progenitor cell competence, cell cycle exit, and differentiation, although information around the mechanisms that govern these events currently is lacking. In zebrafish, the basic helix-loop-helix (bHLH) transcription factor NeuroD governs photoreceptor genesis, but the signaling pathways through which NeuroD functions are unknown. The purpose of this study was to identify these pathways, and during photoreceptor genesis, Notch signaling was investigated as the putative mediator of NeuroD function. Methods In embryos, genetic mosaic analysis was used to determine if NeuroD functions is cell- or non–cell-autonomous. Morpholino-induced NeuroD knockdown, CRISPR/Cas9 mutation, and pharmacologic and transgenic approaches were used, followed by in situ hybridization, immunocytochemistry, and quantitative RT-PCR (qRT-PCR), to identify mechanisms through which NeuroD functions. In adults, following photoreceptor ablation and NeuroD knockdown, similar methods as above were used to identify NeuroD function during photoreceptor regeneration. Results In embryos, NeuroD function is non–cell-autonomous, NeuroD knockdown increases Notch pathway gene expression, Notch inhibition rescues the NeuroD knockdown-induced deficiency in cell cycle exit but not photoreceptor maturation, and Notch activation and CRISPR/Cas9 mutation of neurod recapitulate NeuroD knockdown. In adults, NeuroD knockdown prevents cell cycle exit and photoreceptor regeneration and increases Notch pathway gene expression, and Notch inhibition rescues this phenotype. Conclusions These data demonstrate that during embryonic development, NeuroD governs photoreceptor genesis via non–cell-autonomous mechanisms and that, during photoreceptor development and regeneration, Notch signaling is a mechanistic link between NeuroD and cell cycle exit. In contrast, during embryonic development, NeuroD governs photoreceptor maturation via mechanisms

  12. Microphthalmia-associated transcription factor mutations are associated with white-spotted coat color in swamp buffalo.

    PubMed

    Yusnizar, Y; Wilbe, M; Herlino, A O; Sumantri, C; Noor, R Rachman; Boediono, A; Andersson, L; Andersson, G

    2015-12-01

    A candidate gene analysis of the microphthalmia-associated transcription factor (MITF) gene was used in an attempt to identify the genetic basis for a white-spotted coat color phenotype in the Asian swamp buffalo (Bubalus bubalis carabanensis). Ninety-three buffaloes-32 solid, 38 spotted and 23 white individuals-were Sanger-sequenced for all MITF exons as well as highly conserved intronic and flanking regions. MITF cDNA representing skin and iris tissue from six spotted, nine solid and one white buffaloes was also Sanger-sequenced to confirm detected mutations. Two independent loss-of-function mutations, a premature stop codon (c.328C>T, p.Arg110*) and a donor splice-site mutation (c.840+2T>A, p.Glu281_Leu282Ins8), both of which cause white-spotted coat color in swamp buffaloes, were identified. The nonsense mutation leads to a premature stop codon in exon 3, and likely removal of the resulting mRNA via nonsense-mediated decay pathway, whereas the donor splice-site mutation leads to aberrant splicing of exon 8 that encodes part of a highly conserved region of MITF. The resulting insertion of eight amino acid residues is expected to perturb the leucine zipper part in the basic helix-loop-helix leucine zipper (bHLH-Zip) domain and will most likely influence dimerization and DNA binding capacity. Electrophoretic mobility shift assay was performed using mutant and wild-type MITF proteins and showed that the mutant MITF protein resulting from the splice-site mutation decreased in vitro DNA binding capacity compared to wild-type MITF. White-spotted buffalo bulls are sacrificed in funeral ceremonies in Tana Toraja, Indonesia, because they are considered holy, and our results show that genetic variation causes a tie to the cultural use of these buffaloes.

  13. Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

    PubMed Central

    2011-01-01

    Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

  14. NO FLOWERING IN SHORT DAY (NFL) is a bHLH transcription factor that promotes flowering specifically under short-day conditions in Arabidopsis.

    PubMed

    Sharma, Nidhi; Xin, Ruijiao; Kim, Dong-Hwan; Sung, Sibum; Lange, Theo; Huq, Enamul

    2016-02-15

    Flowering in plants is a dynamic and synchronized process where various cues including age, day length, temperature and endogenous hormones fine-tune the timing of flowering for reproductive success. Arabidopsis thaliana is a facultative long day (LD) plant where LD photoperiod promotes flowering. Arabidopsis still flowers under short-day (SD) conditions, albeit much later than in LD conditions. Although factors regulating the inductive LD pathway have been extensively investigated, the non-inductive SD pathway is much less understood. Here, we identified a key basic helix-loop-helix transcription factor called NFL (NO FLOWERING IN SHORT DAY) that is essential to induce flowering specifically under SD conditions in Arabidopsis. nfl mutants do not flower under SD conditions, but flower similar to the wild type under LD conditions. The no-flowering phenotype in SD is rescued either by exogenous application of gibberellin (GA) or by introducing della quadruple mutants in the nfl background, suggesting that NFL acts upstream of GA to promote flowering. NFL is expressed at the meristematic regions and NFL is localized to the nucleus. Quantitative RT-PCR assays using apical tissues showed that GA biosynthetic genes are downregulated and the GA catabolic and receptor genes are upregulated in the nfl mutant compared with the wild type, consistent with the perturbation of the endogenous GA biosynthetic and catabolic intermediates in the mutant. Taken together, these data suggest that NFL is a key transcription factor necessary for promotion of flowering under non-inductive SD conditions through the GA signaling pathway. © 2016. Published by The Company of Biologists Ltd.

  15. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    SciTech Connect

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  16. NO FLOWERING IN SHORT DAY (NFL) is a bHLH transcription factor that promotes flowering specifically under short-day conditions in Arabidopsis

    PubMed Central

    Sharma, Nidhi; Xin, Ruijiao; Kim, Dong-Hwan; Sung, Sibum; Lange, Theo; Huq, Enamul

    2016-01-01

    Flowering in plants is a dynamic and synchronized process where various cues including age, day length, temperature and endogenous hormones fine-tune the timing of flowering for reproductive success. Arabidopsis thaliana is a facultative long day (LD) plant where LD photoperiod promotes flowering. Arabidopsis still flowers under short-day (SD) conditions, albeit much later than in LD conditions. Although factors regulating the inductive LD pathway have been extensively investigated, the non-inductive SD pathway is much less understood. Here, we identified a key basic helix-loop-helix transcription factor called NFL (NO FLOWERING IN SHORT DAY) that is essential to induce flowering specifically under SD conditions in Arabidopsis. nfl mutants do not flower under SD conditions, but flower similar to the wild type under LD conditions. The no-flowering phenotype in SD is rescued either by exogenous application of gibberellin (GA) or by introducing della quadruple mutants in the nfl background, suggesting that NFL acts upstream of GA to promote flowering. NFL is expressed at the meristematic regions and NFL is localized to the nucleus. Quantitative RT-PCR assays using apical tissues showed that GA biosynthetic genes are downregulated and the GA catabolic and receptor genes are upregulated in the nfl mutant compared with the wild type, consistent with the perturbation of the endogenous GA biosynthetic and catabolic intermediates in the mutant. Taken together, these data suggest that NFL is a key transcription factor necessary for promotion of flowering under non-inductive SD conditions through the GA signaling pathway. PMID:26758694

  17. Neurodevelopmental models of transcription factor 4 deficiency converge on a common ion channel as a potential therapeutic target for Pitt Hopkins syndrome.

    PubMed

    Rannals, Matthew D; Page, Stephanie Cerceo; Campbell, Morganne N; Gallo, Ryan A; Mayfield, Brent; Maher, Brady J

    2016-01-01

    The clinically pleiotropic gene, Transcription Factor 4 (TCF4), is a broadly expressed basic helix-loop-helix (bHLH) transcription factor linked to multiple neurodevelopmental disorders, including schizophrenia, 18q deletion syndrome, and Pitt Hopkins syndrome (PTHS). In vivo suppression of Tcf4 by shRNA or mutation by CRISPR/Cas9 in the developing rat prefrontal cortex resulted in attenuated action potential output. To explain this intrinsic excitability deficit, we demonstrated that haploinsufficiency of TCF4 lead to the ectopic expression of two ion channels, Scn10a and Kcnq1. These targets of TCF4 regulation were identified through molecular profiling experiments that used translating ribosome affinity purification to enrich mRNA from genetically manipulated neurons. Using a mouse model of PTHS (Tcf4(+/tr)), we observed a similar intrinsic excitability deficit, however the underlying mechanism appeared slightly different than our rat model - as Scn10a expression was similarly increased but Kcnq1 expression was decreased. Here, we show that the truncated TCF4 protein expressed in our PTHS mouse model binds to wild-type TCF4 protein, and we suggest the difference in Kcnq1 expression levels between these two rodent models appears to be explained by a dominant-negative function of the truncated TCF4 protein. Despite the differences in the underlying molecular mechanisms, we observed common underlying intrinsic excitability deficits that are consistent with ectopic expression of Scn10a. The converging molecular function of TCF4 across two independent rodent models indicates SCN10a is a potential therapeutic target for Pitt-Hopkins syndrome.

  18. The bHLH Transcription Factor bHLH104 Interacts with IAA-LEUCINE RESISTANT3 and Modulates Iron Homeostasis in Arabidopsis

    PubMed Central

    Zhang, Jie; Liu, Bing; Li, Mengshu; Feng, Dongru; Jin, Honglei; Wang, Peng; Liu, Jun; Xiong, Feng; Wang, Jinfa; Wang, Hong-Bin

    2015-01-01

    Iron (Fe) is an indispensable micronutrient for plant growth and development. The regulation of Fe homeostasis in plants is complex and involves a number of transcription factors. Here, we demonstrate that a basic helix-loop-helix (bHLH) transcription factor, bHLH104, belonging to the IVc subgroup of bHLH family, acts as a key component positively regulating Fe deficiency responses. Knockout of bHLH104 in Arabidopsis thaliana greatly reduced tolerance to Fe deficiency, whereas overexpression of bHLH104 had the opposite effect and led to accumulation of excess Fe in soil-grown conditions. The activation of Fe deficiency-inducible genes was substantially suppressed by loss of bHLH104. Further investigation showed that bHLH104 interacted with another IVc subgroup bHLH protein, IAA-LEUCINE RESISTANT3 (ILR3), which also plays an important role in Fe homeostasis. Moreover, bHLH104 and ILR3 could bind directly to the promoters of Ib subgroup bHLH genes and POPEYE (PYE) functioning in the regulation of Fe deficiency responses. Interestingly, genetic analysis showed that loss of bHLH104 could decrease the tolerance to Fe deficiency conferred by the lesion of BRUTUS, which encodes an E3 ligase and interacts with bHLH104. Collectively, our data support that bHLH104 and ILR3 play pivotal roles in the regulation of Fe deficiency responses via targeting Ib subgroup bHLH genes and PYE expression. PMID:25794933

  19. Increased expression of bHLH Transcription Factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis

    PubMed Central

    Patel, Divya; Chaudhary, Jaideep

    2012-01-01

    E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/ influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer. PMID:22564737

  20. The Arabidopsis SET-domain protein ASHR3 is involved in stamen development and interacts with the bHLH transcription factor ABORTED MICROSPORES (AMS).

    PubMed

    Thorstensen, Tage; Grini, Paul E; Mercy, Inderjit S; Alm, Vibeke; Erdal, Sigrid; Aasland, Rein; Aalen, Reidunn B

    2008-01-01

    The Arabidopsis thaliana genome contains more than 30 genes encoding SET-domain proteins that are thought to be epigenetic regulators of gene expression and chromatin structure. SET-domain proteins can be divided into subgroups, and members of the Polycomb group (PcG) and trithorax group (trxG) have been shown to be important regulators of development. Both in animals and plants some of these proteins are components of multimeric protein complexes. Here, we have analyzed the Arabidopsis trxG protein ASHR3 which has a SET domain and pre- and post-SET domains similar to that of Ash1 in Drosophila. In addition to the SET domain, a divergent PHD finger is found in the N-terminus of the ASHR3 protein. As expected from SET-domain proteins involved in transcriptional activation, ASHR3 (coupled to GFP) localizes to euchromatin. A yeast two-hybrid screening revealed that the ASHR3 protein interacts with the putative basic helix-loop-helix (bHLH) transcription factor ABORTED MICROSPORES (AMS), which is involved in anther and stamen development in Arabidopsis. Deletion mapping indicated that both the PHD finger and the SET domain mediate the interaction between the two proteins. Overexpression of ASHR3 led in general to growth arrest, and specifically to degenerated anthers and male sterility. Expression analyses demonstrated that ASHR3 like AMS is expressed in the anther and in stamen filaments. We therefore propose that AMS can target ASHR3 to chromatin and regulate genes involved in stamen development and function.

  1. Human calcium/calmodulin-dependent serine protein kinase regulates the expression of p21 via the E2A transcription factor.

    PubMed

    Sun, Rongju; Su, Yongyue; Zhao, Xiaodong; Qi, Jie; Luo, Xiaofeng; Yang, Zongcheng; Yao, Yongming; Luo, Xiangdong; Xia, Zhaofan

    2009-04-15

    CASK (calcium/calmodulin-dependent serine protein kinase) is a kind of scaffolding protein that recruits or organizes other proteins at the plasma membrane to co-ordinate signal transduction pathways within the cytoplasm and nucleus. We have previously found that hCASK (human CASK) binds Id1 (inhibitor of DNA binding 1) through hCASK's GUK (guanylate kinase) domain and inhibits cell growth, probably via interactions with Id1. Overexpression of hCASK resulted in a reduced rate of cell growth, although inhibition of CASK via RNAi (RNA interference) promoted cell proliferation in ECV304 cells. This study revealed that hCASK regulates the protein and mRNA level of p21(wafi/cip1) (referred to throughout as p21), and activated the expression of p21 in a time-dependent manner. Two E-boxes in the proximal region at the TSS (transcription start site) play key roles in regulating hCASK-mediated p21 expression. We suggest that E2A (E12 and E47), a representative of the E proteins that binds the E-box elements, is a participant in the mediation of p21 expression by hCASK. The results of the present study suggest that hCASK regulation of cell growth might involve p21 expression, and that the bHLH (basic helix-loop-helix) transcription factor E2A probably participates in hCASK regulation of p21 expression. From these findings, we propose a novel proliferation signalling pathway mediated by hCASK.

  2. Carnosol, a Constituent of Zyflamend, Inhibits Aryl Hydrocarbon Receptor-Mediated Activation of CYP1A1 and CYP1B1 Transcription and Mutagenesis

    PubMed Central

    Mohebati, Arash; Guttenplan, Joseph B.; Kochhar, Amit; Zhao, Zhong-Lin; Kosinska, Wieslawa; Subbaramaiah, Kotha; Dannenberg, Andrew J.

    2012-01-01

    The aryl hydrocarbon receptor (AhR), a ligand-activated member of the basic-helix-loop-helix family of transcription factors, plays a significant role in polycyclic aromatic hydrocarbon (PAH) induced carcinogenesis. In the upper aerodigestive tract of humans, tobacco smoke, a source of PAHs, activates the AhR leading to increased expression of CYP1A1 and CYP1B1, which encode proteins that convert PAHs to genotoxic metabolites. Inhibitors of Hsp90 ATPase cause a rapid decrease in levels of AhR, an Hsp90 client protein, and thereby block PAH-mediated induction of CYP1A1 and CYP1B1. The main objective of this study was to determine whether Zyflamend, a polyherbal preparation, suppressed PAH-mediated induction of CYP1A1 and CYP1B1 and inhibited DNA adduct formation and mutagenesis. We also investigated whether carnosol, one of multiple phenolic antioxidants in Zyflamend, had similar inhibitory effects. Treatment of cell lines derived from oral leukoplakia (MSK-Leuk1) and skin (HaCaT) with benzo[a]pyrene (B[a]P), a prototypic PAH, induced CYP1A1 and CYP1B1 transcription, resulting in enhanced levels of message and protein. Both Zyflamend and carnosol suppressed these effects of B[a]P. Notably, both Zyflamend and carnosol inhibited Hsp90 ATPase activity and caused a rapid reduction in AhR levels. The formation of B[a]P induced DNA adducts and mutagenesis were also inhibited by Zyflamend and carnosol. Collectively, these results show that Zyflamend and carnosol inhibit Hsp90 ATPase leading to reduced levels of AhR, suppression of B[a]P-mediated induction of CYP1A1 and CYP1B1 and inhibition of mutagenesis. Carnosol-mediated inhibition of Hsp90 ATPase activity can help explain the chemopreventive activity of herbs such as Rosemary, which contain this phenolic antioxidant. PMID:22374940

  3. Cloning, tissue expression pattern and daily rhythms of Period1, Period2, and Clock transcripts in the flatfish Senegalese sole, Solea senegalensis.

    PubMed

    Martín-Robles, Águeda J; Whitmore, David; Sánchez-Vázquez, Francisco Javier; Pendón, Carlos; Muñoz-Cueto, José A

    2012-07-01

    An extensive network of endogenous oscillators governs vertebrate circadian rhythmicity. At the molecular level, they are composed of a set of clock genes that participate in transcriptional-translational feedback loops to control their own expression and that of downstream output genes. These clocks are synchronized with the environment, although entrainment by external periodic cues remains little explored in fish. In this work, partial cDNA sequences of clock genes representing both positive (Clock) and negative (Period1, Period2) elements of the molecular feedback loops were obtained from the nocturnal flatfish Senegalese sole, a relevant species for aquaculture and chronobiology. All of the above genes exhibited high identities with their respective teleost clock genes, and Per-Arnt-Sim or basic helix-loop-helix binding domains were recognized in their primary structure. They showed a widespread distribution through the animal body and some of them displayed daily mRNA rhythms in central (retina, optic tectum, diencephalon, and cerebellum) and peripheral (liver) tissues. These rhythms were most robust in retina and liver, exhibiting marked Period1 and Clock daily oscillations in transcript levels as revealed by ANOVA and cosinor analysis. Interestingly, expression profiles were inverted in retina and optic tectum compared to liver. Such differences suggest the existence of tissue-dependent zeitgebers for clock gene expression in this species (i.e., light for retina and optic tectum and feeding time for liver). This study provides novel insight into the location of the molecular clocks (central vs. peripheral) and their different phasing and synchronization pathways, which contributes to better understand the teleost circadian systems and its plasticity.

  4. A novel bHLH transcription factor PebHLH35 from Populus euphratica confers drought tolerance through regulating stomatal development, photosynthesis and growth in Arabidopsis

    SciTech Connect

    Dong, Yan; Wang, Congpeng; Han, Xiao; Tang, Sha; Liu, Sha; Xia, Xinli; Yin, Weilun

    2014-07-18

    Highlights: • PebHLH35 is firstly cloned from Populus euphratica and characterized its functions. • PebHLH35 is important for earlier seedling establishment and vegetative growth. • PebHLH35 enhances tolerance to drought by regulating growth. • PebHLH35 enhances tolerance to drought by regulating stomatal development. • PebHLH35 enhances tolerance to drought by regulating photosynthesis and transpiration. - Abstract: Plant basic helix-loop-helix (bHLH) transcription factors (TFs) are involved in a variety of physiological processes including the regulation of plant responses to various abiotic stresses. However, few drought-responsive bHLH family members in Populus have been reported. In this study, a novel bHLH gene (PebHLH35) was cloned from Populus euphratica. Expression analysis in P. euphratica revealed that PebHLH35 was induced by drought and abscisic acid. Subcellular localization studies using a PebHLH35-GFP fusion showed that the protein was localized to the nucleus. Ectopic overexpression of PebHLH35 in Arabidopsis resulted in a longer primary root, more leaves, and a greater leaf area under well-watered conditions compared with vector control plants. Notably, PebHLH35 overexpression lines showed enhanced tolerance to water-deficit stress. This finding was supported by anatomical and physiological analyses, which revealed a reduced stomatal density, stomatal aperture, transpiration rate, and water loss, and a higher chlorophyll content and photosynthetic rate. Our results suggest that PebHLH35 functions as a positive regulator of drought stress responses by regulating stomatal density, stomatal aperture, photosynthesis and growth.

  5. Structure-Function Analysis of the v-Myc Oncoprotein

    DTIC Science & Technology

    1997-06-01

    transcription activation domain (TAD) and a carboxy-terminal basic helix-loop-helix/ leucine zipper (bHLH/LZ) motif (Henriksson and Luscher , 1996). Work by...U. (1996). Active repression mechanisms of eukaryotic transcription repressors. Trends in Genetics 12: 229-234. Henriksson, M. and Luscher , B. (1996

  6. Enhancing oligodendrocyte differentiation by transient transcription activation via DNA nanoparticle-mediated transfection.

    PubMed

    Li, Xiaowei; Tzeng, Stephany Y; Zamboni, Camila Gadens; Koliatsos, Vassilis E; Ming, Guo-Li; Green, Jordan J; Mao, Hai-Quan

    2017-05-01

    Current approaches to derive oligodendrocytes from human pluripotent stem cells (hPSCs) need extended exposure of hPSCs to growth factors and small molecules, which limits their clinical application because of the lengthy culture time required and low generation efficiency of myelinating oligodendrocytes. Compared to extrinsic growth factors and molecules, oligodendrocyte differentiation and maturation can be more effectively modulated by regulation of the cell transcription network. In the developing central nervous system (CNS), two basic helix-loop-helix transcription factors, Olig1 and Olig2, are decisive in oligodendrocyte differentiation and maturation. Olig2 plays a critical role in the specification of oligodendrocytes and Olig1 is crucial in promoting oligodendrocyte maturation. Recently viral vectors have been used to overexpress Olig2 and Olig1 in neural stem/progenitor cells (NSCs) to induce the maturation of oligodendrocytes and enhance the remyelination activity in vivo. Because of the safety issues with viral vectors, including the insertional mutagenesis and potential tumor formation, non-viral transfection methods are preferred for clinical translation. Here we report a poly(β-amino ester) (PBAE)-based nanoparticle transfection method to deliver Olig1 and Olig2 into human fetal tissue-derived NSCs and demonstrate efficient oligodendrocyte differentiation following transgene expression of Olig1 and Olig2. This approach is potentially translatable for engineering stem cells to treat injured or diseased CNS tissues. Current protocols to derive oligodendrocytes from human pluripotent stem cells (hPSCs) require lengthy culture time with low generation efficiencies of mature oligodendrocytes. We described a new approach to enhance oligodendrocyte differentiation through nanoparticle-mediated transcription modulation. We tested an effective transfection method using cell-compatible poly (β-amino ester) (PBAE)/DNA nanoparticles as gene carrier to deliver

  7. The NEUROD gene maps to human chromosome 2q32 and mouse chromosome 2

    SciTech Connect

    Tamimi, R.; Dyer-Montgomery, K.; Hernandez, R.; Tapscott, S.J.

    1996-06-15

    The Neurod gene is a basic-helix-loop-helix gene that regulates neurogenesis and is identical to the hamster beta2 gene that was cloned as a regulator of insulin transcription. Here we report the cloning of human NEUROD and mapping of the gene to human chromosome 2q32 and to mouse chromosome 2. 12 refs., 1 fig.

  8. NEUROD2 and NEUROD3 genes map to human chromosomes 17q12 and 5q23-q31 and mouse chromosomes 11 and 13, respectively

    SciTech Connect

    Tamimi, R.M.; Montgomery-Dyer, K.; Tapscott, S.J.

    1997-03-01

    NEUROD2 and NEUROD3 are transcription factors involved in neurogenesis that are related to the basic helix-loop-helix protein NEUROD. NEUROD2 maps to human chromosome 17q12 and mouse chromosome 11. NEUROD3 maps to human chromosome 5q23-q31 and mouse chromosome 13. 16 refs., 2 figs.

  9. Discovery of the porcine NGN3 gene and testing its endocrine function in the pig

    USDA-ARS?s Scientific Manuscript database

    Neurogenin 3 (NGN3) is a member of the basic helix-loop-helix transcription factor family. NGN3 is both necessary and sufficient to drive endocrine differentiation in the developing pancreas in mouse and humans. Until now, the sequence for NGN3 eluded discovery despite completion of the pig genome a...

  10. Functional profiling identifies genes involved in organ specific branches of the PIF3 regulatory network in Arabidopsis

    USDA-ARS?s Scientific Manuscript database

    The phytochrome (phy)-interacting basic helix-loop-helix transcription factors (PIFs) constitutively sustain the etiolated state of dark-germinated seedlings by actively repressing deetiolation in darkness. This action is rapidly reversed upon light exposure by phy-induced proteolytic degradation of...

  11. PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORα (PPARα) AGONISTS DIFFERENTIALLY REGULATE INHIBITOR OF DNA BINDING (ID2) EXPRESSION IN RODENTS AND HUMAN CELLS

    EPA Science Inventory

    Abstract Inhibitor of DNA binding (Id2) is a member of the helix-loop-helix (HLH) transcription factor family whose members play important roles in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones,...

  12. An 'oligarchy' rules neural development.

    PubMed

    Rowitch, David H; Lu, Q Richard; Kessaris, Nicoletta; Richardson, William D

    2002-08-01

    Recent reports show that Olig genes, which encode the basic helix-loop-helix Olig transcription factors, are essential for development of oligodendrocytes. Surprisingly, Olig function is also required for formation of somatic motor neurons. These findings alter our views of how the oligodendrocyte lineage is generated and raise further questions about the underlying developmental relationships between neurons and glia.

  13. PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORα (PPARα) AGONISTS DIFFERENTIALLY REGULATE INHIBITOR OF DNA BINDING (ID2) EXPRESSION IN RODENTS AND HUMAN CELLS

    EPA Science Inventory

    Abstract Inhibitor of DNA binding (Id2) is a member of the helix-loop-helix (HLH) transcription factor family whose members play important roles in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones,...

  14. High-Mobility Group Box-1 Protein Mediates the Regulation of Signal Transducer and Activator of Transcription-3 in the Diabetic Retina and in Human Retinal Müller Cells.

    PubMed

    Mohammad, Ghulam; Jomar, Deema; Siddiquei, Mohammad Mairaj; Alam, Kaiser; Abu El-Asrar, Ahmed M

    2017-01-01

    The expression of high-mobility group box-1 (HMGB1) and signal transducer and activator of transcription-3 (STAT-3) is upregulated in the diabetic retina. We hypothesized that the activation of STAT-3 is under the control of HMGB1. Retinas from 1-month-old diabetic rats and from normal rats intravitreally injected with HMGB1 and human retinal Müller glial cells (MIO-M1) stimulated with HMGB1 or high glucose were studied by Western blot analysis and immunofluorescence. We also studied the effect of the HMGB1 inhibitor glycyrrhizin (GA) on high-glucose-induced pSTAT-3 nuclear translocation and upregulation in Müller cells and on pSTAT-3 expression in the retinas of diabetic rats (n = 7-10 in each group). In addition, we studied the effect of STAT-3 inhibitor on the HMGB1-induced induction of vascular endothelial growth factor (VEGF) by Müller cells and human retinal microvascular endothelial cell (HRMEC) migration. Treatment of retinal Müller cells with recombinant HMGB1 induced nuclear translocation of pSTAT-3 but did not alter pSTAT-3 expression. High glucose induced a significant upregulation of HMGB1 and pSTAT-3 upregulation and nuclear translocation in retinal Müller cells. GA co-treatment normalized the high-glucose-induced upregulation of HMGB1 and pSTAT-3 upregulation and nuclear translocation in Müller cells. Intravitreal administration of HMGB1 in normal and diabetic rats upregulated pSTAT-3 expression in the retina. GA attenuated the diabetes-induced upregulation of pSTAT-3 in the retina. The STAT-3 inhibitor attenuated HMGB1-induced VEGF upregulation by Müller cells and HRMEC migration. The results suggest a role for HMGB1 in the modulation of STAT-3 expression in the diabetic retina. © 2016 S. Karger AG, Basel.

  15. NPAS3 Regulates Transcription and Expression of VGF: Implications for Neurogenesis and Psychiatric Disorders

    PubMed Central

    Yang, Dongxue; Zhang, Wenbo; Padhiar, Arshad; Yue, Yao; Shi, Yonghui; Zheng, Tiezheng; Davis, Kaspar; Zhang, Yu; Huang, Min; Li, Yuyuan; Sha, Li

    2016-01-01

    Neuronal PAS domain protein 3 (NPAS3) and VGF (VGF Nerve Growth Factor (NGF) Inducible) are important for neurogenesis and psychiatric disorders. Previously, we have demonstrated that NPAS3 regulates VGF at the transcriptional level. In this study, VGF (non-acronymic) was found regulated by NPAS3 in neuronal stem cells. However, the underlying mechanism of this regulation remains unclear. The aim of this study was to explore the correlation of NPAS3 and VGF, and their roles in neural cell proliferation, in the context of psychiatric illnesses. First, we focused on the structure of NPAS3, to identify the functional domain of NPAS3. Truncated NPAS3 lacking transactivation domain was also found to activate VGF, which suggested that not only transactivation domain but other structural motifs were also involved in the regulation. Second, Mutated enhancer box (E-box) of VGF promoter showed a significant response to this basic helix-loop-helix (bHLH) transcription factor, which suggested an indirect regulatory mechanism for controlling VGF expression by NPAS3. κB site within VGF promoter was identified for VGF activation induced by NPAS3, apart from direct binding to E-box. Furthermore, ectopically expressed NPAS3 in PC12 cells produced parallel responses for nuclear factor kappa-light-chain-enhancer of activated B cells [NF-κB (P65)] expression, which specifies that NPAS3 regulates VGF through the NF-κB signaling pathway. Over-expression of NPAS3 also enhances the cell proliferation, which can be blocked by knockdown of VGF. Finally, NPAS3 was found to influence proliferation of neural cells through VGF. Therefore, downstream signaling pathways that are responsible for NPAS3-VGF induced proliferation via glutamate receptors were explored. Combining this work and published literature, a potential network composed by NPAS3, NF-κB, Brain-Derived Neurotrophic Factor (BDNF), NGF and VGF, was proposed. This network collectively detailed how NPAS3 connects with VGF and

  16. The Drosophila Transcription Factor Dimmed Affects Neuronal Growth and Differentiation in Multiple Ways Depending on Neuron Type and Developmental Stage

    PubMed Central

    Liu, Yiting; Luo, Jiangnan; Nässel, Dick R.

    2016-01-01

    Growth of postmitotic neurons occurs during different stages of development, including metamorphosis, and may also be part of neuronal plasticity and regeneration. Recently we showed that growth of post-mitotic neuroendocrine cells expressing the basic helix loop helix (bHLH) transcription factor Dimmed (Dimm) in Drosophila could be regulated by insulin/IGF signaling and the insulin receptor (dInR). Dimm is also known to confer a secretory phenotype to neuroendocrine cells and can be part of a combinatorial code specifying terminal differentiation in peptidergic neurons. To further understand the mechanisms of Dimm function we ectopically expressed Dimm or Dimm together with dInR in a wide range of Dimm positive and Dimm negative peptidergic neurons, sensory neurons, interneurons, motor neurons, and gut endocrine cells. We provide further evidence that dInR mediated cell growth occurs in a Dimm dependent manner and that one source of insulin-like peptide (DILP) for dInR mediated cell growth in the CNS is DILP6 from glial cells. Expressing both Dimm and dInR in Dimm negative neurons induced growth of cell bodies, whereas dInR alone did not. We also found that Dimm alone can regulate cell growth depending on specific cell type. This may be explained by the finding that the dInR is a direct target of Dimm. Conditional gene targeting experiments showed that Dimm alone could affect cell growth in certain neuron types during metamorphosis or in the adult stage. Another important finding was that ectopic Dimm inhibits apoptosis of several types of neurons normally destined for programmed cell death (PCD). Taken together our results suggest that Dimm plays multiple transcriptional roles at different developmental stages in a cell type-specific manner. In some cell types ectopic Dimm may act together with resident combinatorial code transcription factors and affect terminal differentiation, as well as act in transcriptional networks that participate in long term maintenance

  17. Gene expression array of HTLV type 1-infected T cells: Up-regulation of transcription factors and cell cycle genes.

    PubMed

    de La Fuente, C; Deng, L; Santiago, F; Arce, L; Wang, L; Kashanchi, F

    2000-11-01

    By utilizing a human cDNA expression array blot (588 genes), we have observed overexpression of various transcription factors, cell cycle regulated kinases, and DNA repair genes in HTLV-1-infected T cells. One of the genes of interest, and focus in this study, is the cyclin-dependent kinase inhibitor, p21/waf1. The p21/waf1 transcription and protein is overexpressed in all HTLV-1-infected cell lines tested as well as ATL and HAM/TSP patient samples. While p21/waf1 has been shown to display a selectivity for G(1)/S cyclin/cdk complexes, we have observed p21/waf1 to be complexed with cyclin A/cdk2. Functionally, the association of p21/cyclin A/cdk2 decreased the histone H1 phosphorylation in vitro, as observed in immunoprecipitations followed by kinase assays, as well as affecting other substrates such as the C-terminus of Rb protein involved in c-Abl and HDAC1 regulation. Wild-type, but not a mutant form (M47) of Tax, was found to be able to transactivate the p21/waf1 promoter in a p53-independent manner. We found that the minimal p21/waf1 promoter (-49 to +49 sequence) was activated by Tax and the minimal promoter contained two E2A transcription factor binding sites located between the TATA box and the initiation site. E2A proteins, E12 and E47, as well as a related helix-loop-helix protein, HEB, are all up-regulated in HTLV-1-infected T cells. When using band shift analysis, we found that only the E1 site (overlapping the transcription start site) was a functional DNA binding site. By using a chromatin immunoprecipitation (ChIP) assay, we observed that histone H4, and not histone H3, was acetylated from the endogenous p21/waf1 promoter in vivo, implying that CBP/p300, and not the SAGA complex, was critical in complexing with E2A in up-regulation of p21/waf1 in HTLV-1-infected cells.

  18. Armet is an effector protein mediating aphid-plant interactions.

    PubMed

    Wang, Wei; Dai, Huaien; Zhang, Yi; Chandrasekar, Raman; Luo, Lan; Hiromasa, Yasuaki; Sheng, Changzhong; Peng, Gongxin; Chen, Shaoliang; Tomich, John M; Reese, John; Edwards, Owain; Kang, Le; Reeck, Gerald; Cui, Feng

    2015-05-01

    Aphid saliva is predicted to contain proteins that modulate plant defenses and facilitate feeding. Armet is a well-characterized bifunctional protein in mammalian systems. Here we report a new role of Armet, namely as an effector protein in the pea aphid, Acyrthosiphon pisum. Pea aphid Armet's physical and chemical properties and its intracellular role are comparable to those reported for mammalian Armets. Uniquely, we detected Armet in aphid watery saliva and in the phloem sap of fava beans fed on by aphids. Armet's transcript level is several times higher in the salivary gland when aphids feed on bean plants than when they feed on an artificial diet. Knockdown of the Armet transcript by RNA interference disturbs aphid feeding behavior on fava beans measured by the electrical penetration graph technique and leads to a shortened life span. Inoculation of pea aphid Armet protein into tobacco leaves induced a transcriptional response that included pathogen-responsive genes. The data suggest that Armet is an effector protein mediating aphid-plant interactions. © FASEB.

  19. Genome-wide analysis of bHLH transcription factor and involvement in the infection by yellow leaf curl virus in tomato (Solanum lycopersicum).

    PubMed

    Wang, Jinyan; Hu, Zhongze; Zhao, Tongmin; Yang, Yuwen; Chen, Tianzi; Yang, Mali; Yu, Wengui; Zhang, Baolong

    2015-02-05

    The basic helix-loop-helix (bHLH) proteins are a superfamily of transcription factors that can bind to specific DNA target sites. They have been well characterized in model plants such as Arabidopsis and rice and have been shown to be important regulatory components in many different biological processes. However, no systemic analysis of the bHLH transcription factor family has yet been reported in tomatoes. Tomato yellow leaf curl virus (TYLCV) threatens tomato production worldwide by causing leaf yellowing, leaf curling, plant stunting and flower abscission. A total of 152 bHLH transcription factors were identified from the entire tomato genome. Phylogenetic analysis of bHLH domain sequences from Arabidopsis and tomato facilitated classification of these genes into 26 subfamilies. The evolutionary and possible functional relationships revealed during this analysis are supported by other criteria, including the chromosomal distribution of these genes, the conservation of motifs and exon/intron structural patterns, and the predicted DNA binding activities within subfamilies. Distribution mapping results showed bHLH genes were localized on the 12 tomato chromosomes. Among the 152 bHLH genes from the tomato genome, 96 bHLH genes were detected in the TYLCV-susceptible and resistant tomato breeding line before (0 dpi) and after TYLCV (357 dpi) infection. As anticipated, gene ontology (GO) analysis indicated that most bHLH genes are related to the regulation of macromolecule metabolic processes and gene expression. Only four bHLH genes were differentially expressed between 0 and 357 dpi. Virus-induced gene silencing (VIGS) of one bHLH genes SlybHLH131 in resistant lines can lead to the cell death. In the present study, 152 bHLH transcription factor genes were identified. One of which bHLH genes, SlybHLH131, was found to be involved in the TYLCV infection through qRT-PCR expression analysis and VIGS validation. The isolation and identification of these bHLH transcription

  20. Phorbol ester-induced transcription of a fibroblast growth factor-binding protein is modulated by a complex interplay of positive and negative regulatory promoter elements.

    PubMed

    Harris, V K; Liaudet-Coopman, E D; Boyle, B J; Wellstein, A; Riegel, A T

    1998-07-24

    Earlier studies from our laboratory showed that a secreted binding protein for fibroblast growth factors (FGF-BP) is expressed at high levels in squamous cell carcinoma (SCC) cell lines. Overexpression studies or conversely reduced expression of FGF-BP by ribozyme targeting have elucidated a direct role of this protein in angiogenesis during tumor development. We have also observed a significant up-regulation of FGF-BP during TPA (12-O-tetradecanoylphorbol-13-acetate) promotion of skin cancer. Here we investigate the mechanism of TPA induction of FGF-BP gene expression in the human ME-180 SCC cell line. We found that TPA increased FGF-BP mRNA levels in a time- and dose-dependent manner mediated via the protein kinase C signal transduction pathway. Results from actinomycin D and cycloheximide experiments as well as nuclear transcription assays revealed that TPA up-regulated the steady-state levels of FGF-BP mRNA by increasing its rate of gene transcription independently of de novo protein synthesis. We isolated the human FGF-BP promoter and determined by deletion analysis that TPA regulatory elements were all contained in the first 118 base pairs upstream of the transcription start site. Further mutational analysis revealed that full TPA induction required interplay between several regulatory elements with homology to Ets, AP-1, and CAATT/enhancer binding protein C/EBP sites. In addition, deletion or mutation of a 10-base pair region juxtaposed to the AP-1 site dramatically increased TPA induced FGF-BP gene expression. This region represses the extent of the FGF-BP promoter response to TPA and contained sequences recognized by the family of E box helix-loop-helix transcription factors. Gel shift analysis showed specific and TPA-inducible protein binding to the Ets, AP-1, and C/EBP sites. Furthermore, distinct, specific, and TPA-inducible binding to the imperfect E box repressor element was also apparent. Overall, our data indicate that TPA effects on FGF-BP gene

  1. TabHLH1, a bHLH-type transcription factor gene in wheat, improves plant tolerance to Pi and N deprivation via regulation of nutrient transporter gene transcription and ROS homeostasis.

    PubMed

    Yang, Tongren; Hao, Lin; Yao, Sufei; Zhao, Yuanyuan; Lu, Wenjing; Xiao, Kai

    2016-07-01

    Basic helix-loop-helix (bHLH) transcription factors (TFs) comprise a large TF family and act as crucial regulators in various biological processes in plants. Here, we report the functional characterization of TabHLH1, a bHLH TF member in wheat (Triticum aestivum). TabHLH1 shares conserved bHLH domain and targets to nucleus with transactivation activity. Upon Pi and N deprivation, the expression of TabHLH1 was up-regulated in roots and leaves, showing a pattern to be gradually increased within 23-h treatment regimes. The lines with overexpression of TabHLH1 exhibited drastically improved tolerance to Pi and N deprivation, showing larger plant phenotype, more biomass, higher concentration and more accumulation of P and N than wild type (WT) upon the Pi- and N-starvation stresses. NtPT1 and NtNRT2.2, the genes encoding phosphate transporter (PT) and nitrate transporter (NRT) in tobacco, respectively, showed up-regulated expression in TabHLH1-overexpressing plants; knockdown expression of them led to deteriorated growth feature, lowered biomass, and decreased nutrient accumulation of plants under Pi- and N-deficient conditions. Compared with WT, the TabHLH1-overexpressing plants also showed lowered reactive oxygen species (ROS) accumulation and improved antioxidant enzyme (AE) activities, such as those of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). NtSOD1, NtCAT1, and NtPOD1;6 that encode SOD, CAT, and POD, respectively, were up-regulated in TabHLH1-overexpressing plants. Further knockdown of these AE gene expression caused reduced antioxidant enzymatic activities, indicative of their crucial roles in mediating cellular ROS homeostasis in Pi- and N-starvation conditions. Together, TabHLH1 plays an important role in mediating adaptation to the Pi- and N-starvation stresses through transcriptional regulation of a set of genes encoding PT, NRT and AEs that mediate the taken up of Pi and N and the cellular homeostasis of ROS initiated by the nutrient

  2. Epigenetic role of CCAAT box-binding transcription factor NF-Y on ID gene family in human embryonic carcinoma cells.

    PubMed

    Moeinvaziri, Farideh; Shahhoseini, Maryam

    2015-11-01

    Nuclear factor Y (NF-Y) is a histone substitute protein that specifically binds to the CCAAT box of the target genes and thereby promotes their regulation. NF-Y transcription factor, with defined CCAAT element-binding activities, target a gene family that encodes a group of basic helix-loop-helix ID factors (ID1-ID4), with or without CCAAT box at their promoter region. In this study, the expressions of NF-Y in mRNA and protein level were evaluated in a human embryonic carcinoma cell line, named NTera2, before and after 7 days induction of differentiation. We also looked into expression levels of ID genes in NTera2 cells during differentiation because of their critical role in development. By using chromatin immunoprecipitation coupled with real-time polymerase chain reaction, NF-Y incorporation and acetylation/dimethylation of histone H3 at lysine 9 (H3K9ac/me2) was quantitatively evaluated on the regulatory regions of considered genes to monitor the changes in epigenetic markers at ID gene promoters throughout differentiation. The results demonstrated a marked down-regulation of ID1, ID2, and ID3 genes, parallel to a loss of NF-Y binding to the promoters of these genes. The data show that although the genes encoding NF-Y complex remained expressed at mRNA level, NF-YC is lost at the protein level onset of differentiation. Additionally, the epigenetic marks of H3K9ac and H3K9me2 at the target gene promoters decreased and increased, respectively, after 1 day of differentiation. It is suggested that, in the absence of NF-Y binding, the corresponding regions adopt a heterochromatic nature, whereas when NF-Y comes back after 7 days of differentiation, the ID1-3 promoters become again converted into active chromatin. The ID4 gene, lacking a CCAAT box, behaves differently and does not show any incorporation. This experiment implies for the first time that the presence of NF-Y transcription factor plays a pivotal role in transcriptional regulation of ID genes in

  3. Activation of anthocyanin biosynthesis by expression of the radish R2R3-MYB transcription factor gene RsMYB1.

    PubMed

    Lim, Sun-Hyung; Song, Ji-Hye; Kim, Da-Hye; Kim, Jae Kwang; Lee, Jong-Yeol; Kim, Young-Mi; Ha, Sun-Hwa

    2016-03-01

    RsMYB1, a MYB TF of red radish origin, was characterized as a positive regulator to transcriptionally activate the anthocyanin biosynthetic machinery by itself in Arabidopsis and tobacco plants. Anthocyanins, providing the bright red-orange to blue-violet colors, are flavonoid-derived pigments with strong antioxidant activity that have benefits for human health. We isolated RsMYB1, which encodes an R2R3-MYB transcription factor (TF), from red radish plants (Raphanus sativus L.) that accumulate high levels of anthocyanins. RsMYB1 shows higher expression in red radish than in common white radish, in both leaves and roots, at different growth stages. Consistent with RsMYB1 function as an anthocyanin-promoting TF, red radishes showed higher expression of all six anthocyanin biosynthetic and two anthocyanin regulatory genes. Transient expression of RsMYB1 in tobacco showed that RsMYB1 is a positive regulator of anthocyanin production with better efficiency than the basic helix-loop-helix (bHLH) TF gene B-Peru. Also, the synergistic effect of RsMYB1 with B-Peru was larger than the effect of the MYB TF gene mPAP1D with B-peru. Arabidopsis plants stably expressing RsMYB1 produced red pigmentation throughout the plant, accompanied by up-regulation of the six structural and two regulatory genes for anthocyanin production. This broad transcriptional activation of anthocyanin biosynthetic machinery in Arabidopsis included up-regulation of TRANSPARENT TESTA8, which encodes a bHLH TF. These results suggest that overexpression of RsMYB1 promotes anthocyanin production by triggering the expression of endogenous bHLH genes as potential binding partners for RsMYB1. In addition, RsMYB1-overexpressing Arabidopsis plants had a higher antioxidant capacity than did non-transgenic control plants. Taken together, RsMYB1 is an actively positive regulator for anthocyanins biosynthesis in radish plants and it might be one of the best targets for anthocyanin production by single gene

  4. Characterization of CgHIFα-Like, a Novel bHLH-PAS Transcription Factor Family Member, and Its Role under Hypoxia Stress in the Pacific Oyster Crassostrea gigas

    PubMed Central

    Wang, Ting; Meng, Jie; Li, Li; Zhang, Guofan

    2016-01-01

    Hypoxia-inducible factor (HIF), a critical member of the basic-helix-loop-helix (bHLH)-containing Per-Arnt-Sim (PAS) protein family, is a master transcription factor involved in maintaining oxygen homeostasis. In the present study, we isolated and characterized a novel bHLH-PAS family member, CgHIFα-like gene, from the Pacific oyster Crassostrea gigas, and determined its importance during hypoxia stress. The 3020-bp CgHIFα-like cDNA encoded a protein of 888 amino acids. The predicted CgHIFα-like amino acid sequence was conserved in the N-terminal bHLH, PAS, and PAC domains (but not in the C-terminal domain) and was most closely related to the HIF family in the bHLH-PAS protein phylogenic tree. Similar to the mammalian HIF-1α, CgHIFα-like could be expressed as four mRNA isoforms containing alternative 5′-untranslated regions and different translation initiation codons. At the mRNA level, these isoforms were expressed in a tissue-specific manner and showed increased transcription to varying degrees under hypoxic conditions. Additionally, the western blot analysis demonstrated that CgHIFα-like was induced by hypoxia. Electrophoretic mobility shift assay indicated that CgHIFα-like could bind to the hypoxia responsive element (HRE), whereas dual-luciferase reporter analysis demonstrated that CgHIFα-like could transactivate the reporter gene containing the HREs. In addition to CgHIFα-like, we identified CgARNT from the C. gigas, analyzed its expression pattern, and confirmed its interaction with CgHIFα-like using a yeast two-hybrid assay. In conclusion, this is the first report on the cloning and characterization of a novel hypoxia transcription factor in mollusks, which could accumulate under hypoxia and regulate hypoxia related gene expression by binding to HRE and dimerizing with CgARNT. As only one member of HIF has been identified in invertebrates to date, our results provide new insights into the unique mechanisms of hypoxia tolerance in mollusks. PMID

  5. Cloning and characterization of AabHLH1, a bHLH transcription factor that positively regulates artemisinin biosynthesis in Artemisia annua.

    PubMed

    Ji, Yunpeng; Xiao, Jingwei; Shen, Yalin; Ma, Dongming; Li, Zhenqiu; Pu, Gaobin; Li, Xing; Huang, Lili; Liu, Benye; Ye, Hechun; Wang, Hong

    2014-09-01

    Amorpha-4,11-diene synthase (ADS) and Cyt P450 monooxygenase (CYP71AV1) in Artemisia annua L. are two key enzymes involved in the biosynthesis of artemisinin. The promoters of ADS and CYP71AV1 contain E-box elements, which are putative binding sites for basic helix-loop-helix (bHLH) transcription factors. This study successfully isolated a bHLH transcription factor gene from A. annua, designated as AabHLH1, from a cDNA library of the glandular secretory trichomes (GSTs) in which artemisinin is synthesized and sequestered. AabHLH1 encodes a protein of 650 amino acids containing one putative bHLH domain. AabHLH1 and ADS genes were strongly induced by ABA and the fungal elicitor, chitosan. The transient expression analysis of the AabHLH1-green fluorescent protein (GFP) reporter gene revealed that AabHLH1 was targeted to nuclei. Biochemical analysis demonstrated that the AabHLH1 protein was capable of binding to the E-box cis-elements, present in both ADS and CYP71AV1 promoters, and possessed transactivation activity in yeast. In addition, transient co-transformation of AabHLH1 and CYP71AV1Pro::GUS in A. annua leaves showed a significant activation of the expression of the GUS (β-glucuronidase) gene in transformed A. annua, but mutation of the E-boxes resulted in abolition of activation, suggesting that the E-box is important for the CYP71AV1 promoter activity. Furthermore, transient expression of AabHLH1 in A. annua leaves increased transcript levels of the genes involved in artemisinin biosynthesis, such as ADS, CYP71AV1 and HMGR. These results suggest that AabHLH1 can positively regulate the biosynthesis of artemisinin. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  6. Thermodynamics of b-HLH-LZ protein binding to DNA: the energetic importance of protein-DNA contacts in site-specific E-box recognition by the complete gene product of the Max p21 transcription factor.

    PubMed

    Meier-Andrejszki, Laura; Bjelić, Sasa; Naud, Jean-François; Lavigne, Pierre; Jelesarov, Ilian

    2007-10-30

    The Myc/Mad/Max network of dimeric basic region-helix-loop-helix-leucine zipper (b-HLH-LZ) transcription factors bind to enhancer box sequences (E-box) in the promotors of a large set of genes that control cell metabolism, proliferation, and differentiation. Max (Myc-associated factor X) is the obligate heterodimerization partner of Myc and Mad proteins. On the other hand, Max is the only member of the family capable of forming a stable homodimer. As part of the transcriptional regulation mechanism, Myc/Max and Mad/Max heterodimers and Max homodimers are thought to compete for binding to the E-box target sequences. E-box recognition is structurally supported by the b-HLH-LZ structural motif, which also promotes dimerization. However, the actual dimerization and heterodimerization constants of the complete gene products and their affinities for E-box sequences are not known. Also, the detailed thermodynamic characterization of DNA binding by these transcription factors has not been done yet. Such knowledge is necessary for complete understanding of the transcriptional regulation carried out by the Myc/Mad/Max network. Here, we report the first in-depth thermodynamic characterization of the stability and specific DNA binding of a full length gene product of the Myc/Mad/Max family, namely, Max protein isoform p21 (Max p21). Using calorimetric methods (DSC and ITC) we have determined the dimerization constant of Max p21 in the low micromolar range, and the Max p21/E-box complex dissociation constant in the low nanomolar range at 37 degrees C. The association is driven by a large exothermic effect, which is partly compensated by entropic factors. The energetic contribution to binding affinity of seven highly conserved residues that contact the DNA was probed by X-to-Ala mutagenesis. The results demonstrate that high binding affinity critically relies on the side chain of Arg 26. Furthermore, the mutational analysis points to the important role of the persistent helical

  7. Coronary Artery Disease Associated Transcription Factor TCF21 Regulates Smooth Muscle Precursor Cells That Contribute to the Fibrous Cap

    PubMed Central

    Raiesdana, Azad; Kundu, Ramendra; Miller, Clint L.; Kim, Juyong B.; Arora, Komal; Carcamo-Oribe, Ivan; Xiong, Yiqin; Tellakula, Nikhil; Nanda, Vivek; Murthy, Nikitha; Boisvert, William A.; Hedin, Ulf; Perisic, Ljubica; Aldi, Silvia; Maegdefessel, Lars; Pjanic, Milos; Owens, Gary K.; Tallquist, Michelle D.; Quertermous, Thomas

    2015-01-01

    Recent genome wide association studies have identified a number of genes that contribute to the risk for coronary heart disease. One such gene, TCF21, encodes a basic-helix-loop-helix transcription factor believed to serve a critical role in the development of epicardial progenitor cells that give rise to coronary artery smooth muscle cells (SMC) and cardiac fibroblasts. Using reporter gene and immunolocalization studies with mouse and human tissues we have found that vascular TCF21 expression in the adult is restricted primarily to adventitial cells associated with coronary arteries and also medial SMC in the proximal aorta of mouse. Genome wide RNA-Seq studies in human coronary artery SMC (HCASMC) with siRNA knockdown found a number of putative TCF21 downstream pathways identified by enrichment of terms related to CAD, including “vascular disease,” “disorder of artery,” and “occlusion of artery,” as well as disease-related cellular functions including “cellular movement” and “cellular growth and proliferation.” In vitro studies in HCASMC demonstrated that TCF21 expression promotes proliferation and migration and inhibits SMC lineage marker expression. Detailed in situ expression studies with reporter gene and lineage tracing revealed that vascular wall cells expressing Tcf21 before disease initiation migrate into vascular lesions of ApoE-/- and Ldlr-/- mice. While Tcf21 lineage traced cells are distributed throughout the early lesions, in mature lesions they contribute to the formation of a subcapsular layer of cells, and others become associated with the fibrous cap. The lineage traced fibrous cap cells activate expression of SMC markers and growth factor receptor genes. Taken together, these data suggest that TCF21 may have a role regulating the differentiation state of SMC precursor cells that migrate into vascular lesions and contribute to the fibrous cap and more broadly, in view of the association of this gene with human CAD, provide

  8. Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis

    SciTech Connect

    Patel, Divya; Chaudhary, Jaideep

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer E2A, considered as a tumor suppressor is highly expressed in prostate cancer. Black-Right-Pointing-Pointer Silencing of E2A attenuates cell proliferation and promotes apoptosis. Black-Right-Pointing-Pointer E2A regulates c-myc, Id1, Id3 and CDKN1A expression. Black-Right-Pointing-Pointer Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. Black-Right-Pointing-Pointer Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.

  9. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions

    PubMed Central

    Schwinn, Kathy E.; Boase, Murray R.; Bradley, J. Marie; Lewis, David H.; Deroles, Simon C.; Martin, Cathie R.; Davies, Kevin M.

    2014-01-01

    Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida)] and Eustoma grandiflorum (lisianthus) plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor [TF; ROSEA1 (ROS1)] that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related basic helix-loop-helix TF transgene (LEAF COLOR, LC), which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high-light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1 × 35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment in the petal throat region, and the anthers changed from yellow to purple pigmentation. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1 × 35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants. PMID:25414715

  10. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions.

    PubMed

    Schwinn, Kathy E; Boase, Murray R; Bradley, J Marie; Lewis, David H; Deroles, Simon C; Martin, Cathie R; Davies, Kevin M

    2014-01-01

    Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida)] and Eustoma grandiflorum (lisianthus) plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor [TF; ROSEA1 (ROS1)] that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related basic helix-loop-helix TF transgene (LEAF COLOR, LC), which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high-light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1 × 35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment in the petal throat region, and the anthers changed from yellow to purple pigmentation. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1 × 35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants.

  11. Ablation of the transcriptional regulator Id1 enhances energy expenditure, increases insulin sensitivity, and protects against age and diet induced insulin resistance, and hepatosteatosis

    PubMed Central

    Satyanarayana, Ande; Klarmann, Kimberly D.; Gavrilova, Oksana; Keller, Jonathan R.

    2012-01-01

    Obesity is a major health concern that contributes to the development of diabetes, hyperlipidemia, coronary artery disease, and cancer. Id proteins are helix-loop-helix transcription factors that regulate the proliferation and differentiation of cells from multiple tissues, including adipocytes. We screened mouse tissues for the expression of Id1 and found that Id1 protein is highly expressed in brown adipose tissue (BAT) and white adipose tissue (WAT), suggesting a role for Id1 in adipogenesis and cell metabolism. Id1−/− mice are viable but show a significant reduction in fat mass (P<0.005) over the life of the animal that was not due to decreased number of adipocytes. Analysis of Id1−/− mice revealed higher energy expenditure, increased lipolysis, and fatty acid oxidation, resulting in reduced triglyceride accumulation in WAT compared to Id1+/+ mice. Serum levels of triglycerides (193.9±32.2 vs. 86.5±33.8, P<0.0005), cholesterol (189.4±33.8 vs. 110.6±8.23, P<0.0005) and leptin (1263±835 vs. 222±260, P<0.005) were significantly lower in aged Id1−/− mice compared to Id1+/+ mice. Id1-deficient mice have higher resting (P<0.005) and total (P<0.05) O2 consumption and lower respiratory exchange ratio (P<0.005), confirming that Id1−/− mice use a higher proportion of lipid as an energy source for the increased energy expenditure. The expression of PGC1α and UCP1 were 2- to 3-fold up-regulated in Id1−/− BAT, suggesting that loss of Id1 increases thermogenesis. As a consequence of higher energy expenditure and reduced fat mass, Id1−/− mice displayed enhanced insulin sensitivity. Id1 deficiency protected mice against age- and high-fat-diet-induced adiposity, insulin resistance, and hepatosteatosis. Our findings suggest that Id1 plays a critical role in the regulation of energy homeostasis and could be a potential target in the treatment of insulin resistance and fatty liver disease.—Satyanarayana, A., Klarmann, K. D., Gavrilova, l O., Keller

  12. Computational modeling of the bHLH domain of the transcription factor TWIST1 and R118C, S144R and K145E mutants

    PubMed Central

    2012-01-01

    Background Human TWIST1 is a highly conserved member of the regulatory basic helix-loop-helix (bHLH) transcription factors. TWIST1 forms homo- or heterodimers with E-box proteins, such as E2A (isoforms E12 and E47), MYOD and HAND2. Haploinsufficiency germ-line mutations of the twist1 gene in humans are the main cause of Saethre-Chotzen syndrome (SCS), which is characterized by limb abnormalities and premature fusion of cranial sutures. Because of the importance of TWIST1 in the regulation of embryonic development and its relationship with SCS, along with the lack of an experimentally solved 3D structure, we performed comparative modeling for the TWIST1 bHLH region arranged into wild-type homodimers and heterodimers with E47. In addition, three mutations that promote DNA binding failure (R118C, S144R and K145E) were studied on the TWIST1 monomer. We also explored the behavior of the mutant forms in aqueous solution using molecular dynamics (MD) simulations, focusing on the structural changes of the wild-type versus mutant dimers. Results The solvent-accessible surface area of the homodimers was smaller on wild-type dimers, which indicates that the cleft between the monomers remained more open on the mutant homodimers. RMSD and RMSF analyses indicated that mutated dimers presented values that were higher than those for the wild-type dimers. For a more careful investigation, the monomer was subdivided into four regions: basic, helix I, loop and helix II. The basic domain presented a higher flexibility in all of the parameters that were analyzed, and the mutant dimer basic domains presented values that were higher than the wild-type dimers. The essential dynamic analysis also indicated a higher collective motion for the basic domain. Conclusions Our results suggest the mutations studied turned the dimers into more unstable structures with a wider cleft, which may be a reason for the loss of DNA binding capacity observed for in vitro circumstances. PMID:22839202

  13. Determination of binding constant of transcription factor myc-max/max-max and E-box DNA: the effect of inhibitors on the binding.

    PubMed

    Park, Seyeon; Chung, Sunah; Kim, Kyung-Mee; Jung, Kyung-Chae; Park, Chihoon; Hahm, Eun-Ryeong; Yang, Chul-Hak

    2004-02-24

    The truncated myc and max proteins, only containing basic regions and helix-loop-helix/zipper (b/HLH/Zip) regions were over-expressed in E. coli and used for the determination of the binding constant and of the inhibitory mechanism on myc-max (or max-max)-DNA complex formation. The association kinetic constants (k(1) and k(-1)) of truncated max-max or myc-max dimer and DNA were determined as k(1)=(1.7+/-0.6)x10(5) M(-1) s(-1), k(-1)=(3.4+/-1.2)x10(-2) s(-1) for max-max and DNA or k(1)=(2.1+/-0.7)x10(5) M(-1) s(-1), k(-1)=(3.2+/-1.4)x10(-2) s(-1) for myc-max and DNA. The equilibrium binding constant (K(1)) was determined using these kinetic parameters [K(XXD)=(7.8+/-2.6)x10(6) M(-1) for max-max and DNA or K(XYD)=(6.9+/-2.2)x10(6) M(-1) for myc-max and DNA]. The binding constants of myc-max or max-max dimer formation were K(XX)=(2.6+/-0.9)x10(5) M(-1) or K(XY)=(1.3+/-0.4)x10(4) M(-1), respectively. When truncated proteins were used, the max-max dimer formation was easier than the myc-max dimer formation, contrary to the physiologically determined case. This leads us to deduce that domains other than b/HLH/Zip are very important for the transcriptional regulatory activity in physiological conditions. The truncated myc and max proteins, which were expressed in E. coli and contained only b/HLH/Zip regions were also used for the screening of inhibitors of myc-max-DNA complex formation. A synthesized curcuminoid, 1,7-bis(4-methyl-3-nitrophenyl)-1,6-heptadiene-3,5-dione (curcuminoid 004), showed the most potent inhibition out of the synthesized curcuminoids, in competition with DNA. The dissociation constant of max-max dimer and the inhibitor was 9 microM, when investigated using in vitro expressed b/HLH/Zip dimer proteins. The curcuminoid 004 showed an inhibitory effect on the binding of myc-max protein to the E-box element in SNU16 cells, and suppressed the expression of myc target genes including ornithine decarboxylase (ODC), cdc25a and c-myc in myc over

  14. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  15. Computational modeling of the bHLH domain of the transcription factor TWIST1 and R118C, S144R and K145E mutants.

    PubMed

    Maia, Amanda M; da Silva, João Hm; Mencalha, André L; Caffarena, Ernesto R; Abdelhay, Eliana

    2012-07-28

    Human TWIST1 is a highly conserved member of the regulatory basic helix-loop-helix (bHLH) transcription factors. TWIST1 forms homo- or heterodimers with E-box proteins, such as E2A (isoforms E12 and E47), MYOD and HAND2. Haploinsufficiency germ-line mutations of the twist1 gene in humans are the main cause of Saethre-Chotzen syndrome (SCS), which is characterized by limb abnormalities and premature fusion of cranial sutures. Because of the importance of TWIST1 in the regulation of embryonic development and its relationship with SCS, along with the lack of an experimentally solved 3D structure, we performed comparative modeling for the TWIST1 bHLH region arranged into wild-type homodimers and heterodimers with E47. In addition, three mutations that promote DNA binding failure (R118C, S144R and K145E) were studied on the TWIST1 monomer. We also explored the behavior of the mutant forms in aqueous solution using molecular dynamics (MD) simulations, focusing on the structural changes of the wild-type versus mutant dimers. The solvent-accessible surface area of the homodimers was smaller on wild-type dimers, which indicates that the cleft between the monomers remained more open on the mutant homodimers. RMSD and RMSF analyses indicated that mutated dimers presented values that were higher than those for the wild-type dimers. For a more careful investigation, the monomer was subdivided into four regions: basic, helix I, loop and helix II. The basic domain presented a higher flexibility in all of the parameters that were analyzed, and the mutant dimer basic domains presented values that were higher than the wild-type dimers. The essential dynamic analysis also indicated a higher collective motion for the basic domain. Our results suggest the mutations studied turned the dimers into more unstable structures with a wider cleft, which may be a reason for the loss of DNA binding capacity observed for in vitro circumstances.

  16. Induction of motor neuron differentiation by transduction of Olig2 protein.

    PubMed

    Mie, Masayasu; Kaneko, Mami; Henmi, Fumiaki; Kobatake, Eiry

    2012-10-26

    Olig2 protein, a member of the basic helix-loop-helix transcription factor family, was introduced into the mouse embryonic carcinoma cell line P19 for induction of motor neuron differentiation. We show that Olig2 protein has the ability to permeate the cell membrane without the addition of a protein transduction domain (PTD), similar to other basic helix-loop-helix transcription factors such as MyoD and NeuroD2. Motor neuron differentiation was evaluated for the elongation of neurites and the expression of choline acetyltransferase (ChAT) mRNA, a differentiation marker of motor neurons. By addition of Olig2 protein, motor neuron differentiation was induced in P19 cells. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. The oligodendrocyte-specific G protein-coupled receptor GPR17 is a cell-intrinsic timer of myelination.

    PubMed

    Chen, Ying; Wu, Heng; Wang, Shuzong; Koito, Hisami; Li, Jianrong; Ye, Feng; Hoang, Jenny; Escobar, Sabine S; Gow, Alexander; Arnett, Heather A; Trapp, Bruce D; Karandikar, Nitin J; Hsieh, Jenny; Lu, Q Richard

    2009-11-01

    The basic helix-loop-helix transcription factor Olig1 promotes oligodendrocyte maturation and is required for myelin repair. We characterized an Olig1-regulated G protein-coupled receptor, GPR17, whose function is to oppose the action of Olig1. Gpr17 was restricted to oligodendrocyte lineage cells, but was downregulated during the peak period of myelination and in adulthood. Transgenic mice with sustained Gpr17 expression in oligodendrocytes exhibited stereotypic features of myelinating disorders in the CNS. Gpr17 overexpression inhibited oligodendrocyte differentiation and maturation both in vivo and in vitro. Conversely, Gpr17 knockout mice showed early onset of oligodendrocyte myelination. The opposing action of Gpr17 on oligodendrocyte maturation reflects, at least partially, upregulation and nuclear translocation of the potent oligodendrocyte differentiation inhibitors ID2/4. Collectively, these findings suggest that GPR17 orchestrates the transition between immature and myelinating oligodendrocytes via an ID protein-mediated negative regulation and may serve as a potential therapeutic target for CNS myelin repair.

  18. Protein-mediated energy-dissipating pathways in mitochondria.

    PubMed

    Starkov, Anatoly A

    2006-05-15

    Mitochondrial production of reactive oxygen species (ROS) is a well-established fact of fundamental importance to aging and etiology of many pathologies with serious public health implications. The ROS production is an innate property of mitochondrial biochemistry inseparable from the oxidative metabolism. Recent discoveries indicate that in addition to several ROS-detoxifying enzyme systems, which remove ROS, mitochondria may also be able to limit their ROS production by the mechanism comprising several protein-mediated energy-dissipating ("uncoupling") pathways. Although the physiological significance and in vivo modus operandi of these pathways remain to be elucidated, several proteins potentially capable of energy dissipation are known. This mini-review addresses the identity of mitochondrial protein-mediated energy-dissipating pathways and the experimental evidence to their role in controlling ROS production.

  19. Protein-mediated energy-dissipating pathways in mitochondria.

    PubMed

    Starkov, Anatoly A

    2006-10-27

    Mitochondrial production of reactive oxygen species (ROS) is a well-established fact of fundamental importance to aging and etiology of many pathologies with serious public health implications. The ROS production is an innate property of mitochondrial biochemistry inseparable from the oxidative metabolism. Recent discoveries indicate that in addition to several ROS-detoxifying enzyme systems, which remove ROS, mitochondria may also be able to limit their ROS production by the mechanism comprising several protein-mediated energy-dissipating ("uncoupling") pathways. Although the physiological significance and in vivo modus operandi of these pathways remain to be elucidated, several proteins potentially capable of energy dissipation are known. This mini-review addresses the identity of mitochondrial protein-mediated energy-dissipating pathways and the experimental evidence to their role in controlling ROS production.

  20. Protein Mediators of Sterol Transport Across Intestinal Brush Border Membrane

    PubMed Central

    Brown, J. Mark; Yu, Liqing

    2012-01-01

    Dysregulation of cholesterol balance contributes significantly to atherosclerotic cardiovascular disease (ASCVD), the leading cause of death in the United States. The intestine has the unique capability to act as a gatekeeper for entry of cholesterol into the body, and inhibition of intestinal cholesterol absorption is now widely regarded as an attractive non-statin therapeutic strategy for ASCVD prevention. In this chapter we discuss the current state of knowledge regarding sterol transport across the intestinal brush border membrane. The purpose of this work is to summarize substantial progress made in the last decade in regards to protein-mediated sterol trafficking, and to discuss this in the context of human disease. PMID:20213550

  1. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  2. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    PubMed

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  3. The role of thermal fluctuations and mechanical constraints in protein-mediated DNA looping

    NASA Astrophysics Data System (ADS)

    Blumberg, Seth; Gajraj, Arivalagan; Pennington, Matthew; Tkachenko, Alexei; Meiners, Jens-Christian

    2005-05-01

    Protein-mediated DNA looping, which occurs when a linker protein binds to two operator sites on the same DNA molecule, is an important regulatory element of many biological processes such as transcription and DNA replication. In physiologic conditions, the conformation of DNA undergoes thermal fluctuations which enable the operators to align for looping. The likelihood for the operator sites to align can be significantly altered by mechanically constraining the substrate DNA. For instance, tension extends DNA and increases the free energy of operator alignment. By modeling DNA as a wormlike chain, we use statistical mechanics to show that when the loop size is greater than 100bp a tension of 500 femtonewtons can increase the time required for loop closure by two orders of magnitude. This force is small compared to the piconewton forces that are associated with RNA polymerases and other molecular motors, indicating that intracellular mechanical forces might affect transcriptional regulation. We propose that supercoiling of DNA may help to stabilize the looping process against the disruptive effective of tension. Since DNA looping is important in gene regulation and genetic transformation, our theory suggests that thermal fluctuations and response to mechanical constraints play an important role in a living cell. Indeed, recent micromechanical measurements on DNA looping have verified the importance of mechanical constraints. Besides providing perspective on these experiments we offer suggestions for future micromechanical studies.

  4. Prostacyclin-induced hyperthermia - Implication of a protein mediator

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williams, B. A.

    1982-01-01

    The mechanism of the prostacyclin-linked hyperthermia is studied in rabbits. Results show that intracerebroventricular administration of prostacyclin (PGI2) induces dose-related hyperthermia at room temperature (21 C), as well as at low (4 C) and high (30 C) ambient temperatures. It is found that this PGI2-induced hyperthermia is not mediated by its stable metabolite 6-keto prostaglandin F-1(alpha). Only one of the three anion transport systems, the liver transport system, appears to be important to the central inactivation of pyrogen, prostaglandin E2, and PGI2. Phenoxybenzamine and pimozide have no thermolytic effect on PGI2-induced hyperthermia, while PGI2 still induces hyperthermia after norepinephrine (NE) and dopamine levels are depleted by 6-hydroxydopamine. Indomethacin and SC-19220 (a PG antagonist) do not antagonize PGI2 induced hyperthermia, while theophylline does not accentuate the PGI2-induced hyperthermia. However, the hyperthermic response to PGI2 is attenuated by central administration of the protein synthesis inhibitor, anisomycin. It is concluded that PGI2-induced hyperthermia is not induced by NE, dopamine, or cyclic AMP, but rather that a protein mediator is implicated in the induction of fever by PG12.

  5. Morphology, Biophysical Properties and Protein-Mediated Fusion of Archaeosomes

    PubMed Central

    Šuštar, Vid; Zelko, Jasna; Lopalco, Patrizia; Lobasso, Simona; Ota, Ajda; Ulrih, Nataša Poklar; Corcelli, Angela; Kralj-Iglič, Veronika

    2012-01-01

    As variance from standard phospholipids of eubacteria and eukaryotes, archaebacterial diether phospholipids contain branched alcohol chains (phytanol) linked to glycerol exclusively with ether bonds. Giant vesicles (GVs) constituted of different species of archaebacterial diether phospholipids and glycolipids (archaeosomes) were prepared by electroformation and observed under a phase contrast and/or fluorescence microscope. Archaebacterial lipids and different mixtures of archaebacterial and standard lipids formed GVs which were analysed for size, yield and ability to adhere to each other due to the mediating effects of certain plasma proteins. GVs constituted of different proportions of archaeal or standard phosphatidylcholine were compared. In nonarchaebacterial GVs (in form of multilamellar lipid vesicles, MLVs) the main transition was detected at Tm = 34. 2°C with an enthalpy of ΔH = 0.68 kcal/mol, whereas in archaebacterial GVs (MLVs) we did not observe the main phase transition in the range between 10 and 70°C. GVs constituted of archaebacterial lipids were subject to attractive interaction mediated by beta 2 glycoprotein I and by heparin. The adhesion constant of beta 2 glycoprotein I – mediated adhesion determined from adhesion angle between adhered GVs was in the range of 10−8 J/m2. In the course of protein mediated adhesion, lateral segregation of the membrane components and presence of thin tubular membranous structures were observed. The ability of archaebacterial diether lipids to combine with standard lipids in bilayers and their compatibility with adhesion-mediating molecules offer further evidence that archaebacterial lipids are appropriate for the design of drug carriers. PMID:22792173

  6. Gene expression profiling of human neural progenitor cells following the serum-induced astrocyte differentiation.

    PubMed

    Obayashi, Shinya; Tabunoki, Hiroko; Kim, Seung U; Satoh, Jun-ichi

    2009-05-01

    Neural stem cells (NSC) with self-renewal and multipotent properties could provide an ideal cell source for transplantation to treat spinal cord injury, stroke, and neurodegenerative diseases. However, the majority of transplanted NSC and neural progenitor cells (NPC) differentiate into astrocytes in vivo under pathological environments in the central nervous system, which potentially cause reactive gliosis. Because the serum is a potent inducer of astrocyte differentiation of rodent NPC in culture, we studied the effect of the serum on gene expression profile of cultured human NPC to identify the gene signature of astrocyte differentiation of human NPC. Human NPC spheres maintained in the serum-free culture medium were exposed to 10% fetal bovine serum (FBS) for 72 h, and processed for analyzing on a Whole Human Genome Microarray of 41,000 genes, and the microarray data were validated by real-time RT-PCR. The serum elevated the levels of expression of 45 genes, including ID1, ID2, ID3, CTGF, TGFA, METRN, GFAP, CRYAB and CSPG3, whereas it reduced the expression of 23 genes, such as DLL1, DLL3, PDGFRA, SOX4, CSPG4, GAS1 and HES5. Thus, the serum-induced astrocyte differentiation of human NPC is characterized by a counteraction of ID family genes on Delta family genes. Coimmunoprecipitation analysis identified ID1 as a direct binding partner of a proneural basic helix-loop-helix (bHLH) transcription factor MASH1. Luciferase assay indicated that activation of the DLL1 promoter by MASH1 was counteracted by ID1. Bone morphogenetic protein 4 (BMP4) elevated the levels of ID1 and GFAP expression in NPC under the serum-free culture conditions. Because the serum contains BMP4, these results suggest that the serum factor(s), most probably BMP4, induces astrocyte differentiation by upregulating the expression of ID family genes that repress the proneural bHLH protein-mediated Delta expression in human NPC.

  7. Identification of a human achaete-scute homolog highly expressed in neuroendocrine tumors.

    PubMed Central

    Ball, D W; Azzoli, C G; Baylin, S B; Chi, D; Dou, S; Donis-Keller, H; Cumaraswamy, A; Borges, M; Nelkin, B D

    1993-01-01

    Basic helix-loop-helix transcription factors of the achaete-scute family are instrumental in Drosophila neurosensory development and are candidate regulators of development in the mammalian central nervous system and neural crest. We report the isolation and initial characterization of a human achaete-scute homolog that is highly expressed in two neuroendocrine cancers, medullary thyroid cancer (MTC) and small cell lung cancer (SCLC). The human gene, which we have termed human achaete-scute homology 1 (hASH1), was cloned from a human MTC cDNA library. It encodes a predicted protein of 238 aa that is 95% homologous to mammalian achaete-scute homolog (MASH) 1, a rodent basic helix-loop-helix factor. The 57-residue basic helix-loop-helix domain is identical to that in the rodent gene, and the basic and helical regions, excluding the loop, are 72-80% identical to Drosophila achaete-scute family members. The proximal coding region of the hASH1 cDNA contains a striking 14-copy repeat of the triplet CAG that exhibits polymorphism in human genomic DNA. Thus, hASH1 is a candidate locus for disease-causing mutations via triplet repeat amplification. Analysis of rodent-human somatic cell hybrids permitted assignment of hASH1 to human chromosome 12. Northern blots revealed hASH1 transcripts in RNA from a human MTC cell line, two fresh MTC tumors, fetal brain, and three lines of human SCLC. In contrast, cultured lines of non-SCLC lung cancers and a panel of normal adult human tissues showed no detectable hASH1 transcripts. Expression of hASH1 may provide a useful marker for cancers with neuroendocrine features and may contribute to the differentiation and growth regulation of these cells. Images Fig. 3 Fig. 4 Fig. 5 PMID:8390674

  8. A bile‐inducible membrane protein mediates bifidobacterial bile resistance

    PubMed Central

    Ruiz, Lorena; O'Connell‐Motherway, Mary; Zomer, Aldert; de los Reyes‐Gavilán, Clara G.; Margolles, Abelardo; van Sinderen, Douwe

    2012-01-01

    Summary Bbr_0838 from Bifidobacterium breve UCC2003 is predicted to encode a 683 residue membrane protein, containing both a permease domain that displays similarity to transporters belonging to the major facilitator superfamily, as well as a CBS (cystathionine beta synthase) domain. The high level of similarity to bile efflux pumps from other bifidobacteria suggests a significant and general role for Bbr_0838 in bile tolerance. Bbr_0838 transcription was shown to be monocistronic and strongly induced upon exposure to bile. Further analysis delineated the transcriptional start site and the minimal region required for promoter activity and bile regulation. Insertional inactivation of Bbr_0838 in B. breve UCC2003 resulted in a strain, UCC2003:838800, which exhibited reduced survival upon cholate exposure as compared with the parent strain, a phenotype that was reversed when a functional, plasmid‐encoded Bbr_0838 gene was introduced into UCC2003:838800. Transcriptome analysis of UCC2003:838800 grown in the presence or absence of bile demonstrated that transcription of Bbr_0832, which is predicted to encode a macrolide efflux transporter gene, was significantly increased in the presence of bile, representing a likely compensatory mechanism for bile removal in the absence of Bbr_0838. This study represents the first in‐depth analysis of a bile‐inducible locus in bifidobacteria, identifying a key gene relevant for bifidobacterial bile tolerance. PMID:22296641

  9. Hypoxia prevents induction of aromatase expression in human trophoblast cells in culture: potential inhibitory role of the hypoxia-inducible transcription factor Mash-2 (mammalian achaete-scute homologous protein-2).

    PubMed

    Jiang, B; Kamat, A; Mendelson, C R

    2000-10-01

    The human placenta has a remarkable capacity to aromatize C19-steroids, produced by the fetal adrenals, to estrogens. This reaction is catalyzed by aromatase P450 (P450arom), encoded by the CYP19 gene. In placenta, CYP19 gene expression is restricted to the syncytiotrophoblast layer. Cytotrophoblasts isolated from human placenta, when placed in monolayer culture in 20% O2, spontaneously fuse to form syncytiotrophoblast. These morphological changes are associated with a marked induction of aromatase activity and CYP19 gene expression. When cytotrophoblasts are cultured in an atmosphere containing 2% O2, they manifest increased rates of DNA synthesis and fail to fuse and form syncytiotrophoblast. The objective of the present study was to utilize cytotrophoblasts isolated from midterm human placenta to analyze the effects of O2 on CYP19 gene expression and the molecular mechanisms that mediate these effects. We observed that when trophoblast cells were maintained in 2% O2, there was only a modest induction of CYP19 expression as a function of time in culture, and aromatase activity was barely detectable. However, when cytotrophoblasts that had been maintained in 2% O2 for 3 days were placed in a 20% O2 environment, there was a rapid onset of cell fusion and induction of P450arom mRNA and aromatase activity. In addition, mRNAs for the helix-loop-helix factors Mash-2 (mammalian achaete-scute homologous protein-2) and Id1 (inhibitor of differentiation 1) were readily detectable in freshly isolated cytotrophoblasts and were markedly decreased upon differentiation to syncytiotrophoblast in 20% O2. By contrast, when cytotrophoblasts were cultured in 2% O2, mRNA levels for Mash-2 and Id1 remained elevated. Interestingly, overexpression of Mash-2 in primary cultures of human trophoblast cells markedly inhibited cell fusion and the spontaneous induction of P450arom mRNA levels and caused a marked decrease in expression of co-transfected fusion gene constructs containing either

  10. Myomaker is essential for muscle regeneration.

    PubMed

    Millay, Douglas P; Sutherland, Lillian B; Bassel-Duby, Rhonda; Olson, Eric N

    2014-08-01

    Regeneration of injured adult skeletal muscle involves fusion of activated satellite cells to form new myofibers. Myomaker is a muscle-specific membrane protein required for fusion of embryonic myoblasts, but its potential involvement in adult muscle regeneration has not been explored. We show that myogenic basic helix-loop-helix (bHLH) transcription factors induce myomaker expression in satellite cells during acute and chronic muscle regeneration. Moreover, genetic deletion of myomaker in adult satellite cells completely abolishes muscle regeneration, resulting in severe muscle destruction after injury. Myomaker is the only muscle-specific protein known to be absolutely essential for fusion of embryonic and adult myoblasts.

  11. Symbiont-induced odorant binding proteins mediate insect host hematopoiesis

    PubMed Central

    Benoit, Joshua B; Vigneron, Aurélien; Broderick, Nichole A; Wu, Yineng; Sun, Jennifer S; Carlson, John R; Aksoy, Serap; Weiss, Brian L

    2017-01-01

    Symbiotic bacteria assist in maintaining homeostasis of the animal immune system. However, the molecular mechanisms that underlie symbiont-mediated host immunity are largely unknown. Tsetse flies (Glossina spp.) house maternally transmitted symbionts that regulate the development and function of their host’s immune system. Herein we demonstrate that the obligate mutualist, Wigglesworthia, up-regulates expression of odorant binding protein six in the gut of intrauterine tsetse larvae. This process is necessary and sufficient to induce systemic expression of the hematopoietic RUNX transcription factor lozenge and the subsequent production of crystal cells, which actuate the melanotic immune response in adult tsetse. Larval Drosophila’s indigenous microbiota, which is acquired from the environment, regulates an orthologous hematopoietic pathway in their host. These findings provide insight into the molecular mechanisms that underlie enteric symbiont-stimulated systemic immune system development, and indicate that these processes are evolutionarily conserved despite the divergent nature of host-symbiont interactions in these model systems. DOI: http://dx.doi.org/10.7554/eLife.19535.001 PMID:28079523

  12. The MYB182 Protein Down-Regulates Proanthocyanidin and Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes1[OPEN

    PubMed Central

    Yoshida, Kazuko; Ma, Dawei; Constabel, C. Peter

    2015-01-01

    Trees in the genus Populus (poplar) contain phenolic secondary metabolites including the proanthocyanidins (PAs), which help to adapt these widespread trees to diverse environments. The transcriptional activation of PA biosynthesis in response to herbivory and ultraviolet light stress has been documented in poplar leaves, and a regulator of this process, the R2R3-MYB transcription factor MYB134, has been identified. MYB134-overexpressing transgenic plants show a strong high-PA phenotype. Analysis of these transgenic plants suggested the involvement of additional MYB transcription factors, including repressor-like MYB factors. Here, MYB182, a subgroup 4 MYB factor, was found to act as a negative regulator of the flavonoid pathway. Overexpression of MYB182 in hairy root culture and whole poplar plants led to reduced PA and anthocyanin levels as well as a reduction in the expression of key flavonoid genes. Similarly, a reduced accumulation of transcripts of a MYB PA activator and a basic helix-loop-helix cofactor was observed in MYB182-overexpressing hairy roots. Transient promoter activation assays in poplar cell culture demonstrated that MYB182 can disrupt transcriptional activation by MYB134 and that the basic helix-loop-helix-binding motif of MYB182 was essential for repression. Microarray analysis of transgenic plants demonstrated that down-regulated targets of MYB182 also include shikimate pathway genes. This work shows that MYB182 plays an important role in the fine-tuning of MYB134-mediated flavonoid metabolism. PMID:25624398

  13. Tal1 transgenic expression reveals absence of B lymphocytes.

    PubMed

    Palamarchuk, Alexey; Zanesi, Nicola; Aqeilan, Rami I; Efanov, Alexey; Maximov, Vadim; Santanam, Urmila; Hagan, John P; Croce, Carlo M; Pekarsky, Yuri

    2006-06-15

    TAL1 oncogene encodes a helix-loop-helix transcription factor, Tal1, which is required for blood cell development, and its activation is a frequent event in T-cell acute lymphoblastic leukemia. Tal1 interacts and inhibits other helix-loop-helix factors such as E47 and HEB. To investigate the function of Tal1 in B cells, we generated Emu-TAL1 transgenic mouse line, expressing Tal1 in mouse B-cell lineage. Fluorescence-activated cell sorting (FACS) analysis of lymphocytes isolated from spleens of five out of five founders reveals complete absence of IgM- or CD19-expressing cells. Only 2% to 3% of these cells were B220+ and 100% of B220+ cells were CD43+, indicating that these mice were able to make pro-B cells. Similarly, FACS analysis of bone marrow cells in Emu-TAL1 mice revealed complete absence of B220+IgM+ and B220+CD19+ cells. Analysis of the recombination status of IgH genes revealed the presence of D-J but absence or drastic reduction of V-D-J rearrangements. Our results suggest that Tal1 overexpression in B cells results in a phenotype similar to that of B cells of E47/E2A knockout animals. This represents first in vivo evidence that Tal1 can completely inhibit E47/E2A function.

  14. PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) regulates auxin biosynthesis at high temperature

    PubMed Central

    Franklin, Keara A.; Lee, Sang Ho; Patel, Dhaval; Kumar, S. Vinod; Spartz, Angela K.; Gu, Chen; Ye, Songqing; Yu, Peng; Breen, Gordon; Cohen, Jerry D.; Wigge, Philip A.; Gray, William M.

    2011-01-01

    At high ambient temperature, plants display dramatic stem elongation in an adaptive response to heat. This response is mediated by elevated levels of the phytohormone auxin and requires auxin biosynthesis, signaling, and transport pathways. The mechanisms by which higher temperature results in greater auxin accumulation are unknown, however. A basic helix-loop-helix transcription factor, PHYTOCHROME-INTERACTING FACTOR 4 (PIF4), is also required for hypocotyl elongation in response to high temperature. PIF4 also acts redundantly with its homolog, PIF5, to regulate diurnal growth rhythms and elongation responses to the threat of vegetative shade. PIF4 activity is reportedly limited in part by binding to both the basic helix-loop-helix protein LONG HYPOCOTYL IN FAR RED 1 and the DELLA family of growth-repressing proteins. Despite the importance of PIF4 in integrating multiple environmental signals, the mechanisms by which PIF4 controls growth are unknown. Here we demonstrate that PIF4 regulates levels of auxin and the expression of key auxin biosynthesis genes at high temperature. We also identify a family of SMALL AUXIN UP RNA (SAUR) genes that are expressed at high temperature in a PIF4-dependent manner and promote elongation growth. Taken together, our results demonstrate direct molecular links among PIF4, auxin, and elongation growth at high temperature. PMID:22123947

  15. Inhibitor of DNA Binding 4 (ID4) Regulation of Adipocyte Differentiation and Adipose Tissue Formation in Mice*

    PubMed Central

    Murad, Joana M.; Place, Chelsea S.; Ran, Cong; Hekmatyar, Shahryar K. N.; Watson, Nathan P.; Kauppinen, Risto A.; Israel, Mark A.

    2010-01-01

    Inhibitor of DNA binding 4 (ID4) is a helix-loop-helix protein that heterodimerizes with basic helix-loop-helix transcription factors inhibiting their function. ID4 expression is important for adipogenic differentiation of the 3T3-L1 cell line, and inhibition of ID4 is associated with a concomitant decrease in CCAAT/enhancer-binding protein α and peroxisome proliferator-activated receptor γ mRNA and protein expression. Mice with a homozygous deletion of Id4 (Id4−/−) have reduced body fat and gain much less weight compared with wild-type littermates when placed on diets with high fat content. Mouse embryonic fibroblasts (MEFs) isolated from Id4−/− mice have reduced adipogenic potential when compared with wild-type MEFs. In agreement with changes in morphological differentiation, the levels of CCAAT/enhancer-binding protein α and peroxisome proliferator-activated receptor γ were also reduced in MEFs from Id4−/− mice. Our results demonstrate the importance of ID4 in adipocyte differentiation and the implications of this regulation for adipose tissue formation. PMID:20460371

  16. Protein-mediated loops and phase transition in nonthermal denaturation of DNA

    NASA Astrophysics Data System (ADS)

    Petrosyan, Karen G.; Hu, Chin-Kun

    2011-01-01

    We use a statistical mechanical model to study nonthermal denaturation of DNA in the presence of protein-mediated loops. We find that looping proteins which randomly link DNA bases located at a distance along the chain could cause a first-order phase transition. We estimate the denaturation transition time near the phase transition, which can be compared with experimental data. The model describes the formation of multiple loops via dynamical (fluctuational) linking between looping proteins, which is essential in many cellular biological processes.

  17. Blue light photoreceptors are required for the stability and function of a resistance protein mediating viral defense in Arabidopsis

    PubMed Central

    Jeong, Rae-Dong; Kachroo, Aardr

    2010-01-01

    This light-perceiving ability of plants requires the activities of proteins termed photoreceptors. In addition to various growth and developmental processes, light also plays a role in plant defense against pathogens and is required for activation of several defense genes and regulation of the cell death response. However, the molecular or biochemical basis of light modulated regulation of defense signaling is largely unclear. We demonstrate a direct role for blue-light photoreceptors in resistance (R) protein-mediated plant defense against Turnip Crinkle Virus (TCV) in Arabidopsis. The blue-light photoreceptors, cryptochrome (CRY) 2 and phototropin (PHOT) 2, are specifically required for maintaining the stability of the R protein HRT, and thereby resistance to TCV. Exogenous application of the phytohormone salicylic acid elevates HRT levels in phot2 but not in cry2 background. These data indicate that CRY2 and PHOT2 function distinctly in maintaining post-transcriptional stability of HRT. HRT-mediated resistance is also dependent on CRY1 and PHOT1 proteins, but these do not contribute to the stability of HRT. HRT interacts with the CRY2/PHOT2-interacting protein COP1, a E3 ubiquitin ligase. Exogenous application of a proteasome inhibitor prevents blue-light-dependent degradation of HRT, suggesting that HRT is degraded via the 26S proteasome. These and the fact that PHOT2 interacts directly with the R protein RPS2 suggest that blue-light photoreceptors might be involved in regulation and/or signaling mediated by several R proteins. PMID:21057210

  18. The genomic organization of the human transcription factor 3 (TFE3) gene

    SciTech Connect

    Macchi, P.; Repetto, M.; Villa, A.; Vezzoni, P.

    1995-08-10

    We have determined the exon-intron structure of the human TFE3 gene located on Xp11.22-23. By designing PCR primers, we were able to amplify various segments of the TFE3 genomic region, thus establishing that this gene is composed of seven exons, the first six of which are small (from 56 to 159 nt). The 5{prime} UT region is contained entirely in the first exon, while the 3{prime} UT region is contained in the seventh exon. The comparison of the genomic and the published cDNA versions revealed that the deduced amino acid sequence of TFE3 in the C-terminus region is 125 amino acids shorter than previously reported. This eliminates most of the putative proline- and arginine-rich domain and makes the human sequence more similar to its mouse homolog. The activation domain at the N-terminus is contained in exon 2, as has been described for the mouse. The basic helix-loop-helix (BHLH) motif is spread over exons 4 to 6, while the leucine zipper (LZ) is almost all contained in the last portion of exon 6. This split BHLH is different from other BHLH-LZ genes whose genomic structures have been determined up to now. 20 refs., 1 fig., 1 tab.

  19. Feedback regulation of NEUROG2 activity by MTGR1 is required for progression of neurogenesis.

    PubMed

    Aaker, Joshua D; Patineau, Andrea L; Yang, Hyun-Jin; Ewart, David T; Gong, Wuming; Li, Tongbin; Nakagawa, Yasushi; McLoon, Steven C; Koyano-Nakagawa, Naoko

    2009-12-01

    The sequential steps of neurogenesis are characterized by highly choreographed changes in transcription factor activity. In contrast to the well-studied mechanisms of transcription factor activation during neurogenesis, much less is understood regarding how such activity is terminated. We previously showed that MTGR1, a member of the MTG family of transcriptional repressors, is strongly induced by a proneural basic helix-loop-helix transcription factor, NEUROG2 in developing nervous system. In this study, we describe a novel feedback regulation of NEUROG2 activity by MTGR1. We show that MTGR1 physically interacts with NEUROG2 and represses transcriptional activity of NEUROG2. MTGR1 also prevents DNA binding of the NEUROG2/E47 complex. In addition, we provide evidence that proper termination of NEUROG2 activity by MTGR1 is necessary for normal progression of neurogenesis in the developing spinal cord. These results highlight the importance of feedback regulation of proneural gene activity in neurodevelopment.

  20. Feedback regulation of NEUROG2 activity by MTGR1 is required for progression of neurogenesis

    PubMed Central

    Aaker, Joshua D.; Patineau, Andrea L.; Yang, Hyun-jin; Ewart, David T.; Gong, Wuming; Li, Tongbin; Nakagawa, Yasushi; McLoon, Steven C.; Koyano-Nakagawa, Naoko

    2009-01-01

    The sequential steps of neurogenesis are characterized by highly choreographed changes in transcription factor activity. In contrast to the well-studied mechanisms of transcription factor activation during neurogenesis, much less is understood regarding how such activity is terminated. We previously showed that MTGR1, a member of the MTG family of transcriptional repressors, is strongly induced by a proneural basic helix-loop-helix transcription factor, NEUROG2 in developing nervous system. In this study, we describe a novel feedback regulation of NEUROG2 activity by MTGR1. We show that MTGR1 physically interacts with NEUROG2 and represses transcriptional activity of NEUROG2. MTGR1 also prevents DNA binding of the NEUROG2/E47 complex. In addition, we provide evidence that proper termination of NEUROG2 activity by MTGR1 is necessary for normal progression of neurogenesis in the developing spinal cord. These results highlight the importance of feedback regulation of proneural gene activity in neurodevelopment. PMID:19646530

  1. HaloTag protein-mediated specific labeling of living cells with quantum dots

    SciTech Connect

    So, Min-kyung; Yao Hequan; Rao Jianghong

    2008-09-26

    Quantum dots emerge as an attractive alternative to small molecule fluorophores as fluorescent tags for in vivo cell labeling and imaging. This communication presents a method for specific labeling of live cells using quantum dots. The labeling is mediated by HaloTag protein expressed at the cell surface which forms a stable covalent adduct with its ligand (HaloTag ligand). The labeling can be performed in one single step with quantum dot conjugates that are functionalized with HaloTag ligand, or in two steps with biotinylated HaloTag ligand first and followed by streptavidin coated quantum dots. Live cell fluorescence imaging indicates that the labeling is specific and takes place at the cell surface. This HaloTag protein-mediated cell labeling method should facilitate the application of quantum dots for live cell imaging.

  2. Molecular mechanisms of epithelial–mesenchymal transition

    PubMed Central

    Lamouille, Samy; Xu, Jian; Derynck, Rik

    2014-01-01

    The transdifferentiation of epithelial cells into motile mesenchymal cells, a process known as epithelial–mesenchymal transition (EMT), is integral in development, wound healing and stem cell behaviour, and contributes pathologically to fibrosis and cancer progression. This switch in cell differentiation and behaviour is mediated by key transcription factors, including SNAIL, zinc-finger E-box-binding (ZEB) and basic helix-loop-helix transcription factors, the functions of which are finely regulated at the transcriptional, translational and post-translational levels. The reprogramming of gene expression during EMT, as well as non-transcriptional changes, are initiated and controlled by signalling pathways that respond to extracellular cues. Among these, transforming growth factor-β (TGFβ) family signalling has a predominant role; however, the convergence of signalling pathways is essential for EMT. PMID:24556840

  3. Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis thaliana.

    PubMed

    Suetsugu, Noriyuki; Yamada, Noboru; Kagawa, Takatoshi; Yonekura, Hisashi; Uyeda, Taro Q P; Kadota, Akeo; Wada, Masamitsu

    2010-05-11

    Organelle movement is essential for efficient cellular function in eukaryotes. Chloroplast photorelocation movement is important for plant survival as well as for efficient photosynthesis. Chloroplast movement generally is actin dependent and mediated by blue light receptor phototropins. In Arabidopsis thaliana, phototropins mediate chloroplast movement by regulating short actin filaments on chloroplasts (cp-actin filaments), and the chloroplast outer envelope protein CHUP1 is necessary for cp-actin filament accumulation. However, other factors involved in cp-actin filament regulation during chloroplast movement remain to be determined. Here, we report that two kinesin-like proteins, KAC1 and KAC2, are essential for chloroplasts to move and anchor to the plasma membrane. A kac1 mutant showed severely impaired chloroplast accumulation and slow avoidance movement. A kac1kac2 double mutant completely lacked chloroplast photorelocation movement and showed detachment of chloroplasts from the plasma membrane. KAC motor domains are similar to those of the kinesin-14 subfamily (such as Ncd and Kar3) but do not have detectable microtubule-binding activity. The C-terminal domain of KAC1 could interact with F-actin in vitro. Instead of regulating microtubules, KAC proteins mediate chloroplast movement via cp-actin filaments. We conclude that plants have evolved a unique mechanism to regulate actin-based organelle movement using kinesin-like proteins.

  4. Protein-mediated efficient synergistic "antenna effect" in a ternary system in D₂O medium.

    PubMed

    Ghorai, Shyamal Kr; Samanta, Swarna Kamal; Mukherjee, Manini; Ghosh, Sanjib

    2012-08-16

    A ternary system consisting of a protein, catechin (either + or - epimer), and Tb(III) in suitable aqueous buffer medium at physiological pH (= 6.8) has been shown to exhibit highly efficient "antenna effect". Steady state and time-resolved emission studies of each component in the binary complexes (protein with Tb(III) and (+)- or (-)-catechin with Tb(III)) and the ternary systems along with the molecular docking studies reveal that the efficient sensitization could be ascribed to the effective shielding of microenvironment of Tb(III) from O-H oscillator and increased Tb-C (+/-) interaction in the ternary systems in aqueous medium. The ternary system exhibits protein-mediated efficient antenna effect in D(2)O medium due to synergistic ET from both the lowest ππ* triplet state of Trp residue in protein and that of catechin apart from protection of the Tb(III) environment from matrix vibration. The simple system consisting of (+)- or (-)-catechin and Tb(III) in D(2)O buffer at pH 6.8 has been prescribed to be a useful biosensor.

  5. The TIM Barrel Architecture Facilitated the Early Evolution of Protein-Mediated Metabolism.

    PubMed

    Goldman, Aaron David; Beatty, Joshua T; Landweber, Laura F

    2016-01-01

    The triosephosphate isomerase (TIM) barrel protein fold is a structurally repetitive architecture that is present in approximately 10% of all enzymes. It is generally assumed that this ubiquity in modern proteomes reflects an essential historical role in early protein-mediated metabolism. Here, we provide quantitative and comparative analyses to support several hypotheses about the early importance of the TIM barrel architecture. An information theoretical analysis of protein structures supports the hypothesis that the TIM barrel architecture could arise more easily by duplication and recombination compared to other mixed α/β structures. We show that TIM barrel enzymes corresponding to the most taxonomically broad superfamilies also have the broadest range of functions, often aided by metal and nucleotide-derived cofactors that are thought to reflect an earlier stage of metabolic evolution. By comparison to other putatively ancient protein architectures, we find that the functional diversity of TIM barrel proteins cannot be explained simply by their antiquity. Instead, the breadth of TIM barrel functions can be explained, in part, by the incorporation of a broad range of cofactors, a trend that does not appear to be shared by proteins in general. These results support the hypothesis that the simple and functionally general TIM barrel architecture may have arisen early in the evolution of protein biosynthesis and provided an ideal scaffold to facilitate the metabolic transition from ribozymes, peptides, and geochemical catalysts to modern protein enzymes.

  6. A family of yeast proteins mediating bidirectional vacuolar amino acid transport.

    PubMed

    Russnak, R; Konczal, D; McIntire, S L

    2001-06-29

    Seven genes in Saccharomyces cerevisiae are predicted to code for membrane-spanning proteins (designated AVT1-7) that are related to the neuronal gamma-aminobutyric acid-glycine vesicular transporters. We have now demonstrated that four of these proteins mediate amino acid transport in vacuoles. One protein, AVT1, is required for the vacuolar uptake of large neutral amino acids including tyrosine, glutamine, asparagine, isoleucine, and leucine. Three proteins, AVT3, AVT4, and AVT6, are involved in amino acid efflux from the vacuole and, as such, are the first to be shown directly to transport compounds from the lumen of an acidic intracellular organelle. This function is consistent with the role of the vacuole in protein degradation, whereby accumulated amino acids are exported to the cytosol. Protein AVT6 is responsible for the efflux of aspartate and glutamate, an activity that would account for their exclusion from vacuoles in vivo. Transport by AVT1 and AVT6 requires ATP for function and is abolished in the presence of nigericin, indicating that the same pH gradient can drive amino acid transport in opposing directions. Efflux of tyrosine and other large neutral amino acids by the two closely related proteins, AVT3 and AVT4, is similar in terms of substrate specificity to transport system h described in mammalian lysosomes and melanosomes. These findings suggest that yeast AVT transporter function has been conserved to control amino acid flux in vacuolar-like organelles.

  7. Liposome reconstitution of a minimal protein-mediated membrane fusion machine

    PubMed Central

    Top, Deniz; de Antueno, Roberto; Salsman, Jayme; Corcoran, Jennifer; Mader, Jamie; Hoskin, David; Touhami, Ahmed; Jericho, Manfred H; Duncan, Roy

    2005-01-01

    Biological membrane fusion is dependent on protein catalysts to mediate localized restructuring of lipid bilayers. A central theme in current models of protein-mediated membrane fusion involves the sequential refolding of complex homomeric or heteromeric protein fusion machines. The structural features of a new family of fusion-associated small transmembrane (FAST) proteins appear incompatible with existing models of membrane fusion protein function. While the FAST proteins function to induce efficient cell–cell fusion when expressed in transfected cells, it was unclear whether they function on their own to mediate membrane fusion or are dependent on cellular protein cofactors. Using proteoliposomes containing the purified p14 FAST protein of reptilian reovirus, we now show via liposome–cell and liposome–liposome fusion assays that p14 is both necessary and sufficient for membrane fusion. Stoichiometric and kinetic analyses suggest that the relative efficiency of p14-mediated membrane fusion rivals that of the more complex cellular and viral fusion proteins, making the FAST proteins the simplest known membrane fusion machines. PMID:16079913

  8. Blood Group Antigen Recognition via the Group A Streptococcal M Protein Mediates Host Colonization

    PubMed Central

    De Oliveira, David M. P.; Hartley-Tassell, Lauren; Everest-Dass, Arun; Day, Christopher J.; Dabbs, Rebecca A.; Ve, Thomas; Kobe, Bostjan; Nizet, Victor; Packer, Nicolle H.; Walker, Mark J.; Jennings, Michael P.

    2017-01-01

    ABSTRACT Streptococcus pyogenes (group A streptococcus [GAS]) is responsible for over 500,000 deaths worldwide each year. The highly virulent M1T1 GAS clone is one of the most frequently isolated serotypes from streptococcal pharyngitis and invasive disease. The oral epithelial tract is a niche highly abundant in glycosylated structures, particularly those of the ABO(H) blood group antigen family. Using a high-throughput approach, we determined that a strain representative of the globally disseminated M1T1 GAS clone 5448 interacts with numerous, structurally diverse glycans. Preeminent among GAS virulence factors is the surface-expressed M protein. M1 protein showed high affinity for several terminal galactose blood group antigen structures. Deletion mutagenesis shows that M1 protein mediates glycan binding via its B repeat domains. Association of M1T1 GAS with oral epithelial cells varied significantly as a result of phenotypic differences in blood group antigen expression, with significantly higher adherence to those cells expressing H antigen structures compared to cells expressing A, B, or AB antigen structures. These data suggest a novel mechanism for GAS attachment to host cells and propose a link between host blood group antigen expression and M1T1 GAS colonization. PMID:28119471

  9. Genetic regulation of vertebrate eye development.

    PubMed

    Zagozewski, J L; Zhang, Q; Eisenstat, D D

    2014-11-01

    Eye development is a complex and highly regulated process that consists of several overlapping stages: (i) specification then splitting of the eye field from the developing forebrain; (ii) genesis and patterning of the optic vesicle; (iii) regionalization of the optic cup into neural retina and retina pigment epithelium; and (iv) specification and differentiation of all seven retinal cell types that develop from a pool of retinal progenitor cells in a precise temporal and spatial manner: retinal ganglion cells, horizontal cells, cone photoreceptors, amacrine cells, bipolar cells, rod photoreceptors and Müller glia. Genetic regulation of the stages of eye development includes both extrinsic (such as morphogens, growth factors) and intrinsic factors (primarily transcription factors of the homeobox and basic helix-loop helix families). In the following review, we will provide an overview of the stages of eye development highlighting the role of several important transcription factors in both normal developmental processes and in inherited human eye diseases.

  10. TWIST and ovarian cancer stem cells: implications for chemoresistance and metastasis

    PubMed Central

    Nuti, Sudhakar V.; Mor, Gil; Li, Peiyao; Yin, Gang

    2014-01-01

    The transcription factor TWIST1 is a highly evolutionally conserved basic Helix-Loop-Helix (bHLH) transcription factor that functions as a master regulator of gastrulation and mesodermal development. Although TWIST1 was initially associated with embryo development, an increasing number of studies have shown TWIST1 role in the regulation of tissue homeostasis, primarily as a regulator of inflammation. More recently, TWIST1 has been found to be involved in the process of tumor metastasis through the regulation of Epithelial Mesenchymal Transition (EMT). The objective of this review is to examine the normal functions of TWIST1 and its role in tumor development, with a particular focus on ovarian cancer. We discuss the potential role of TWIST1 in the context of ovarian cancer stem cells and its influence in the process of tumor formation. PMID:25238494

  11. Sense organ identity in the Drosophila antenna is specified by the expression of the proneural gene atonal.

    PubMed

    Jhaveri, D; Sen, A; Reddy, G V; Rodrigues, V

    2000-12-01

    We have shown that the basic helix-loop-helix transcription factor Atonal is sufficient for specification of one of the three subsets of olfactory sense organs on the Drosophila antenna. Misexpression of Atonal in all sensory precursors in the antennal disc results in their conversion to coeloconic sensilla. The mechanism by which specific sense organ fate is triggered remains unclear. We have shown that the homeodomain transcription factor Cut which acts in the chordotonal-external sense organ choice does not play a role in olfactory sense organ development. The expression of atonal in specific domains of the antennal disc is regulated by an interplay of the patterning genes, Hedgehog and Wingless, and Drosophila epidermal growth factor receptor pathway.

  12. Relationship between brassinosteroids and genes controlling stomatal production in the Arabidopsis hypocotyl.

    PubMed

    Fuentes, Sonia; Cañamero, Roberto C; Serna, Laura

    2012-01-01

    Stomata are excellent model systems for examining the mechanisms that regulate cell fate determination and pattern formation. It has recently been demonstrated that brassinosteroids control stomatal development by regulating both the MAPK kinase kinase YODA and the basic helix-loop-helix transcriptional factor SPEECHLESS. Here, we show that these plant regulators positively regulate stomatal formation in the hypocotyl and also accelerate their development. Hormone tests, reporter gene studies and mutant analyses revealed that brassinosteroids act upstream of the transcriptional factors CAPRICE and GLABRA2. These plant regulators control an earlier stage of stomatal production than those regulated by the membrane receptor TOO MANY MOUTHS. This work highlights differences in the genetic control of stomatal development between cotyledons or leaves and hypocotyls.

  13. Groucho is required for Drosophila neurogenesis, segmentation, and sex determination and interacts directly with hairy-related bHLH proteins.

    PubMed

    Paroush, Z; Finley, R L; Kidd, T; Wainwright, S M; Ingham, P W; Brent, R; Ish-Horowicz, D

    1994-12-02

    We have used the interaction trap, a yeast two-hybrid system, to identify proteins interacting with hairy, a basic-helix-loop-helix (bHLH) protein that represses transcription during Drosophila embryonic segmentation. We find that the groucho (gro) protein binds specifically to hairy and also to hairy-related bHLH proteins encoded by deadpan and the Enhancer of split complex. The C-terminal WRPW motif present in all these bHLH proteins is essential for this interaction. We demonstrate that these associations reflect in vivo maternal requirements for gro during neurogenesis, segmentation, and sex determination, three processes regulated by the above bHLH proteins, and we propose that gro is a transcriptional corepressor recruited to specific target promoters by hairy-related bHLH proteins.

  14. Network theory inspired analysis of time-resolved expression data reveals key players guiding P. patens stem cell development.

    PubMed

    Busch, Hauke; Boerries, Melanie; Bao, Jie; Hanke, Sebastian T; Hiss, Manuel; Tiko, Theodhor; Rensing, Stefan A

    2013-01-01

    Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems.

  15. Formation of the Embryonic Head in the Mouse: Attributes of a Gene Regulatory Network.

    PubMed

    Tam, Patrick P L; Fossat, Nicolas; Wilkie, Emilie; Loebel, David A F; Ip, Chi Kin; Ramialison, Mirana

    2016-01-01

    The embryonic head is the first major body part to be constructed during embryogenesis. The allocation and the assembly of the progenitor tissues, which start at gastrulation, are accompanied by the spatiotemporal activity of transcription factors and signaling pathways that drives lineage specification, germ layer formation, and cell/tissue movement. The morphogenesis, regionalization, and patterning of the brain and craniofacial structures rely on the function of LIM-domain, homeodomain, and basic helix-loop-helix transcription factors. These factors constitute the central nodes of a gene regulatory network (GRN) which encompasses and intersects with signaling pathways involved with head formation. It is predicted that the functional output of this "head GRN" impacts on cellular function and cell-cell interactions that are essential for lineage differentiation and tissue modeling, which are key processes underpinning the formation of the head. © 2016 Elsevier Inc. All rights reserved.

  16. SCL (stem cell leukemia) gene, and a hematopoietic growth and differentiation factor encoded thereby

    SciTech Connect

    Kirsch, I.R.; Begley, C.G.

    1989-11-17

    A new human gene, SCL, was identified. The gene was discovered because of its involvement in a chromosomal translocation associated with the occurrence of a stem cell leukemia manifesting myeloid and lymphoid differentiation capabilities. The sequence of a cDNA for the normal SCL transcript is reported, as well as for an aberrant fusion transcript produced in the leukemic cells. Although different at their 3' untranslated regions, both cDNAs predict a protein within which is contained a region of primary amino acid sequence homology to the previously described amphipathic helix-loop-helix DNA binding and dimerization motif also contained within a variety of proteins whose role in development, differentiation, and proliferation has already been established.

  17. The emerging role of Twist proteins in hematopoietic cells and hematological malignancies

    PubMed Central

    Merindol, N; Riquet, A; Szablewski, V; Eliaou, J-F; Puisieux, A; Bonnefoy, N

    2014-01-01

    Twist1 and Twist2 (Twist1–2) are two transcription factors, members of the basic helix-loop-helix family, that have been well established as master transcriptional regulators of embryogenesis and developmental programs of mesenchymal cell lineages. Their role in oncogenesis in epithelium-derived cancer and in epithelial-to-mesenchymal transition has also been thoroughly characterized. Recently, emerging evidence also suggests a key role for Twist1–2 in the function and development of hematopoietic cells, as well as in survival and development of numerous hematological malignancies. In this review, we summarize the latest data that depict the role of Twist1–2 in monocytes, T cells and B lymphocyte activation, and in associated hematological malignancies. PMID:24769647

  18. The MYB182 protein down-regulates proanthocyanidin and anthocyanin biosynthesis in poplar by repressing both structural and regulatory flavonoid genes.

    PubMed

    Yoshida, Kazuko; Ma, Dawei; Constabel, C Peter

    2015-03-01

    Trees in the genus Populus (poplar) contain phenolic secondary metabolites including the proanthocyanidins (PAs), which help to adapt these widespread trees to diverse environments. The transcriptional activation of PA biosynthesis in response to herbivory and ultraviolet light stress has been documented in poplar leaves, and a regulator of this process, the R2R3-MYB transcription factor MYB134, has been identified. MYB134-overexpressing transgenic plants show a strong high-PA phenotype. Analysis of these transgenic plants suggested the involvement of additional MYB transcription factors, including repressor-like MYB factors. Here, MYB182, a subgroup 4 MYB factor, was found to act as a negative regulator of the flavonoid pathway. Overexpression of MYB182 in hairy root culture and whole poplar plants led to reduced PA and anthocyanin levels as well as a reduction in the expression of key flavonoid genes. Similarly, a reduced accumulation of transcripts of a MYB PA activator and a basic helix-loop-helix cofactor was observed in MYB182-overexpressing hairy roots. Transient promoter activation assays in poplar cell culture demonstrated that MYB182 can disrupt transcriptional activation by MYB134 and that the basic helix-loop-helix-binding motif of MYB182 was essential for repression. Microarray analysis of transgenic plants demonstrated that down-regulated targets of MYB182 also include shikimate pathway genes. This work shows that MYB182 plays an important role in the fine-tuning of MYB134-mediated flavonoid metabolism. © 2015 American Society of Plant Biologists. All Rights Reserved.

  19. Reciprocal interaction of the circadian clock with the iron homeostasis network in Arabidopsis.

    PubMed

    Hong, Sunghyun; Kim, Sun A; Guerinot, Mary Lou; McClung, C Robertson

    2013-02-01

    In plants, iron (Fe) uptake and homeostasis are critical for survival, and these processes are tightly regulated at the transcriptional and posttranscriptional levels. Circadian clocks are endogenous oscillating mechanisms that allow an organism to anticipate environmental changes to coordinate biological processes both with one another and with the environmental day/night cycle. The plant circadian clock controls many physiological processes through rhythmic expression of transcripts. In this study, we examined the expression of three Fe homeostasis genes (IRON REGULATED TRANSPORTER1 [IRT1], BASIC HELIX LOOP HELIX39, and FERRITIN1) in Arabidopsis (Arabidopsis thaliana) using promoter:LUCIFERASE transgenic lines. Each of these promoters showed circadian regulation of transcription. The circadian clock monitors a number of clock outputs and uses these outputs as inputs to modulate clock function. We show that this is also true for Fe status. Fe deficiency results in a lengthened circadian period. We interrogated mutants impaired in the Fe homeostasis response, including irt1-1, which lacks the major high-affinity Fe transporter, and fit-2, which lacks Fe deficiency-induced TRANSCRIPTION FACTOR1, a basic helix-loop-helix transcription factor necessary for induction of the Fe deficiency response. Both mutants exhibit symptoms of Fe deficiency, including lengthened circadian period. To determine which components are involved in this cross talk between the circadian and Fe homeostasis networks, we tested clock- or Fe homeostasis-related mutants. Mutants defective in specific clock gene components were resistant to the change in period length under different Fe conditions observed in the wild type, suggesting that these mutants are impaired in cross talk between Fe homeostasis and the circadian clock.

  20. DNA Topoisomerase I Affects Polycomb Group Protein-Mediated Epigenetic Regulation and Plant Development by Altering Nucleosome Distribution in Arabidopsis[W

    PubMed Central

    Liu, Xigang; Gao, Lei; Dinh, Thanh Theresa; Shi, Ting; Li, Dongming; Wang, Ruozhong; Guo, Lin; Xiao, Langtao; Chen, Xuemei

    2014-01-01

    It has been perplexing that DNA topoisomerases, enzymes that release DNA supercoils, play specific roles in development. In this study, using a floral stem cell model in Arabidopsis thaliana, we uncovered a role for TOPOISOMERASE1α (TOP1α) in Polycomb Group (PcG) protein-mediated histone 3 lysine 27 trimethylation (H3K27me3) at, and transcriptional repression of, the stem cell maintenance gene WUSCHEL (WUS). We demonstrated that H3K27me3 deposition at other PcG targets also requires TOP1α. Intriguingly, the repression of some, as well as the expression of many, PcG target genes requires TOP1α. The mechanism that unifies the opposing effects of TOP1α appears to lie in its role in decreasing nucleosome density, which probably allows the binding of factors that either recruit PcG, as we demonstrated for AGAMOUS at the WUS locus, or counteract PcG-mediated regulation. Although TOP1α reduces nucleosome density at all genes, the lack of a 5′ nucleosome-free region is a feature that distinguishes PcG targets from nontargets and may condition the requirement for TOP1α for their expression. This study uncovers a connection between TOP1α and PcG, which explains the specific developmental functions of TOP1α. PMID:25070639

  1. Sm-Like Protein-Mediated RNA Metabolism Is Required for Heat Stress Tolerance in Arabidopsis

    PubMed Central

    Okamoto, Masanori; Matsui, Akihiro; Tanaka, Maho; Morosawa, Taeko; Ishida, Junko; Iida, Kei; Mochizuki, Yoshiki; Toyoda, Tetsuro; Seki, Motoaki

    2016-01-01

    Sm-like proteins play multiple functions in RNA metabolism, which is essential for biological processes such as stress responses in eukaryotes. The Arabidopsis thaliana sad1 mutant has a mutation of sm-like protein 5 (LSM5) and shows impaired drought and salt stress tolerances. The lsm5/sad1 mutant also showed hypersensitivity to heat stress. GFP-fused LSM5/SAD1 was localized in the nucleus under optimal growth conditions. After heat stress treatment, GFP-fused LSM5/SAD1 fluorescence was also observed as small cytoplasmic dots, in addition to nuclear localization. Whole genome transcriptome analysis revealed that many genes in Arabidopsis were drastically changed in response to heat stress. More heat-responsive genes were highly expressed in lsm5/sad1 mutant at both 2 and 6 h after heat stress treatment. Additionally, intron-retained and capped transcripts accumulated in the lsm5/sad1 mutant after heat stress treatment. In this study, we also identified non-Arabidopsis Genome Initiative transcripts that were expressed from unannotated regions. Most of these transcripts were antisense transcripts, and many capped non-AGI transcripts accumulated in the lsm5/sad1 mutant during heat stress treatment. These results indicated that LSM5/SAD1 functions to degrade aberrant transcripts through appropriate mRNA splicing and decapping, and precise RNA metabolic machinery is required for heat stress tolerance. PMID:27493656

  2. Mutations affecting the BHLHA9 DNA-binding domain cause MSSD, mesoaxial synostotic syndactyly with phalangeal reduction, Malik-Percin type.

    PubMed

    Malik, Sajid; Percin, Ferda E; Bornholdt, Dorothea; Albrecht, Beate; Percesepe, Antonio; Koch, Manuela C; Landi, Antonio; Fritz, Barbara; Khan, Rizwan; Mumtaz, Sara; Akarsu, Nurten A; Grzeschik, Karl-Heinz

    2014-12-04

    Mesoaxial synostotic syndactyly, Malik-Percin type (MSSD) (syndactyly type IX) is a rare autosomal-recessive nonsyndromic digit anomaly with only two affected families reported so far. We previously showed that the trait is genetically distinct from other syndactyly types, and through autozygosity mapping we had identified a locus on chromosome 17p13.3 for this unique limb malformation. Here, we extend the number of independent pedigrees from various geographic regions segregating MSSD to a total of six. We demonstrate that three neighboring missense mutations affecting the highly conserved DNA-binding region of the basic helix-loop-helix A9 transcription factor (BHLHA9) are associated with this phenotype. Recombinant BHLHA9 generated by transient gene expression is shown to be located in the cytoplasm and the cell nucleus. Transcription factors 3, 4, and 12, members of the E protein (class I) family of helix-loop-helix transcription factors, are highlighted in yeast two-hybrid analysis as potential dimerization partners for BHLHA9. In the presence of BHLHA9, the potential of these three proteins to activate expression of an E-box-regulated target gene is reduced considerably. BHLHA9 harboring one of the three substitutions detected in MSSD-affected individuals eliminates entirely the transcription activation by these class I bHLH proteins. We conclude that by dimerizing with other bHLH protein monomers, BHLHA9 could fine tune the expression of regulatory factors governing determination of central limb mesenchyme cells, a function made impossible by altering critical amino acids in the DNA binding domain. These findings identify BHLHA9 as an essential player in the regulatory network governing limb morphogenesis in humans.

  3. Protein Mediated Oxidative Stress in Patients with Diabetes and its Associated Neuropathy: Correlation with Protein Carbonylation and Disease Activity Markers

    PubMed Central

    Almogbel, Ebtehal

    2017-01-01

    Introduction Free radicals have been implicated as Diabetes Mellitus (DM) contributors in type 2 DM and its associated Diabetes Mellitus Neuropathy (DMN). However, the potential for protein mediated oxidative stress to contribute disease pathogenesis remains largely unexplored. Aim To investigate the status and contribution of protein mediated oxidative stress in patients with DM or DMN and to explore whether oxidative protein modification has a role in DM progression to DM associated neuropathy. Materials and Methods Sera from 42 DM and 37 DMN patients with varying levels of disease activities biomarkers (HbA1C, patients’ age or disease duration) and 21 age- and sex-matched healthy controls were evaluated for serum levels of protein mediated oxidative stress. Results Serum analysis showed significantly higher levels of protein carbonyl contents in both DM and DMN patients compared with healthy controls. Importantly, not only was there an increased number of subjects positive for protein carbonylation, but also the levels of protein carbonyl contents were significantly higher among DM and DMN patients, whose HbA1C were ≥8.8 as compared with patients with lower HbA1C (HbA1C<8.8). Similar pattern of protein carbonyls formation was also observed with patients’ ages or with patient’s disease durations, suggesting a possible relationship between protein oxidation and disease progression. Furthermore, sera from DMN patients had higher levels of protein carbonylation compared with non-neuropathic DM patients’ sera, suggesting an involvement of protein oxidation in the progression of diabetes to diabetes neuropathy. Conclusion These findings support an association between protein oxidation and DM or DMN progression. The stronger response observed in patients with higher HbA1C or patients’ ages or disease durations suggests, that protein mediated oxidative stress may be useful in evaluating the progression of DM and its associated DMN and in elucidating the

  4. Effect of Reactor Turbulence on the Binding-Protein-Mediated Aspartate Transport System in Thin Wastewater Biofilms

    PubMed Central

    Eighmy, T. Taylor; Bishop, P. L.

    1985-01-01

    This research documents an effect of reactor turbulence on the ability of gram-negative wastewater biofilm bacteria to actively transport l-aspartate via a binding-protein-mediated transport system. Biofilms which were not preadapted to turbulence and which possessed two separate and distinct aspartate transport systems (systems 1 and 2) were subjected to a turbulent flow condition in a hydrodynamically defined closed-loop reactor system. A shear stress treatment of 3.1 N · m−2 for 10 min at a turbulent Reynolds number (Re = 11,297) inactivated the low-affinity, high-capacity binding-protein-mediated transport system (system 2) and resolved the high-affinity, low-capacity membrane-bound proton symport system (system 1). The Kt and Vmax values for the resolved system were statistically similar to Kt and Vmax values for system 1 when system 2 was inactivated either by osmotic shock or arsenate, two treatments which are known to inactivate binding-protein-mediated transport systems. We hypothesize that shear stress disrupts system 2 by deforming the outer membranes of the firmly adhered gram-negative bacteria. PMID:16346830

  5. Npas4 Is Activated by Melatonin, and Drives the Clock Gene Cry1 in the Ovine Pars Tuberalis

    PubMed Central

    West, A.; Dupré, S.M.; Yu, L.; Paton, I.R.; Miedzinska, K.; McNeilly, A.S.; Davis, J.R.E.

    2013-01-01

    Seasonal mammals integrate changes in the duration of nocturnal melatonin secretion to drive annual physiologic cycles. Melatonin receptors within the proximal pituitary region, the pars tuberalis (PT), are essential in regulating seasonal neuroendocrine responses. In the ovine PT, melatonin is known to influence acute changes in transcriptional dynamics coupled to the onset (dusk) and offset (dawn) of melatonin secretion, leading to a potential interval-timing mechanism capable of decoding changes in day length (photoperiod). Melatonin offset at dawn is linked to cAMP accumulation, which directly induces transcription of the clock gene Per1. The rise of melatonin at dusk induces a separate and distinct cohort, including the clock-regulated genes Cry1 and Nampt, but little is known of the up-stream mechanisms involved. Here, we used next-generation sequencing of the ovine PT transcriptome at melatonin onset and identified Npas4 as a rapidly induced basic helix-loop-helix Per-Arnt-Sim domain transcription factor. In vivo we show nuclear localization of NPAS4 protein in presumptive melatonin target cells of the PT (α-glycoprotein hormone-expressing cells), whereas in situ hybridization studies identified acute and transient expression in the PT of Npas4 in response to melatonin. In vitro, NPAS4 forms functional dimers with basic helix loop helix-PAS domain cofactors aryl hydrocarbon receptor nuclear translocator (ARNT), ARNT2, and ARNTL, transactivating both Cry1 and Nampt ovine promoter reporters. Using a combination of 5′-deletions and site-directed mutagenesis, we show NPAS4-ARNT transactivation to be codependent upon two conserved central midline elements within the Cry1 promoter. Our data thus reveal NPAS4 as a candidate immediate early-response gene in the ovine PT, driving molecular responses to melatonin. PMID:23598442

  6. FAMA: A Molecular Link between Stomata and Myrosin Cells.

    PubMed

    Shirakawa, Makoto; Ueda, Haruko; Shimada, Tomoo; Hara-Nishimura, Ikuko

    2016-10-01

    Plants use sophisticated defense strategies against herbivores, including the myrosinase-glucosinolate system in Brassicales plants. This system sequesters myrosinase in myrosin cells, which are idioblasts in inner leaf tissues, and produces a toxic compound when cells are damaged by herbivores. Although the molecular mechanisms underlying myrosin cell development are largely unknown, recent studies have revealed that two key components, a basic helix-loop-helix (bHLH) transcription factor (FAMA) and vesicle trafficking factors (such as SYNTAXIN OF PLANTS 22), regulate the differentiation and fate determination of myrosin cells. FAMA also functions as a master regulator of guard cell (GC) differentiation. In this review, we discuss how FAMA operates two distinct genetic programs: the generation of myrosin cells in inner plant tissue and GCs in the epidermis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Expression of ARNT, ARNT2, HIF1 alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse.

    PubMed

    Jain, S; Maltepe, E; Lu, M M; Simon, C; Bradfield, C A

    1998-04-01

    The basic helix-loop-helix-PAS (bHLH-PAS) protein ARNT is a dimeric partner of the Ah receptor (AHR) and hypoxia inducible factor 1 alpha(HIF1 alpha). These dimers mediate biological responses to xenobiotic exposure and low oxygen tension. The recent cloning of ARNT and HIF1(homologues (ARNT2 and HIF2 alpha) indicates that at least six distinct bHLH-PAS heterodimeric combinations can occur in response to a number of environmental stimuli. In an effort to understand the biological relevance of this combinatorial complexity, we characterized their relative expression at a number of developmental time points by parallel in situ hybridization of adjacent tissue sections. Our results reveal that in general there is limited redundancy in the expression of these six transcription factors and that each of these bHLH-PAS members displays a unique pattern of developmental expression emerging as early as embryonic day 9.5.

  8. Flavonoids: biosynthesis, biological functions, and biotechnological applications

    PubMed Central

    Falcone Ferreyra, María L.; Rius, Sebastián P.; Casati, Paula

    2012-01-01

    Flavonoids are widely distributed secondary metabolites with different metabolic functions in plants. The elucidation of the biosynthetic pathways, as well as their regulation by MYB, basic helix-loop-helix (bHLH), and WD40-type transcription factors, has allowed metabolic engineering of plants through the manipulation of the different final products with valuable applications. The present review describes the regulation of flavonoid biosynthesis, as well as the biological functions of flavonoids in plants, such as in defense against UV-B radiation and pathogen infection, nodulation, and pollen fertility. In addition, we discuss different strategies and achievements through the genetic engineering of flavonoid biosynthesis with implication in the industry and the combinatorial biosynthesis in microorganisms by the reconstruction of the pathway to obtain high amounts of specific compounds. PMID:23060891

  9. Lineage-specific stem cells, signals and asymmetries during stomatal development.

    PubMed

    Han, Soon-Ki; Torii, Keiko U

    2016-04-15

    Stomata are dispersed pores found in the epidermis of land plants that facilitate gas exchange for photosynthesis while minimizing water loss. Stomata are formed from progenitor cells, which execute a series of differentiation events and stereotypical cell divisions. The sequential activation of master regulatory basic-helix-loop-helix (bHLH) transcription factors controls the initiation, proliferation and differentiation of stomatal cells. Cell-cell communication mediated by secreted peptides, receptor kinases, and downstream mitogen-activated kinase cascades enforces proper stomatal patterning, and an intrinsic polarity mechanism ensures asymmetric cell divisions. As we review here, recent studies have provided insights into the intrinsic and extrinsic factors that control stomatal development. These findings have also highlighted striking similarities between plants and animals with regards to their mechanisms of specialized cell differentiation. © 2016. Published by The Company of Biologists Ltd.

  10. Biophysical properties of regions flanking the bHLH-Zip motif in the p22 Max protein.

    PubMed

    Pursglove, Sharon E; Fladvad, Malin; Bellanda, Massimo; Moshref, Ahmad; Henriksson, Marie; Carey, Jannette; Sunnerhagen, Maria

    2004-10-22

    The Max protein is the central dimerization partner in the Myc-Max-Mad network of transcriptional regulators, and a founding structural member of the family of basic-helix-loop-helix (bHLH)-leucine zipper (Zip) proteins. Biologically important regions flanking its bHLH-Zip motif have been disordered or absent in crystal structures. The present study shows that these regions are resistant to proteolysis in both the presence and absence of DNA, and that Max dimers containing both flanking regions have significantly higher helix content as measured by circular dichroism than that predicted from the crystal structures. Nuclear magnetic resonance measurements in the absence of DNA also support the inferred structural order. Deletion of both flanking regions is required to achieve maximal DNA affinity as measured by EMSA. Thus, the previously observed functionalities of these Max regions in DNA binding, phosphorylation, and apoptosis are suggested to be linked to structural properties.

  11. Time to pump iron: iron-deficiency-signaling mechanisms of higher plants.

    PubMed

    Walker, Elsbeth L; Connolly, Erin L

    2008-10-01

    Iron is an essential nutrient for plants, yet it often limits plant growth. On the contrary, overaccumulation of iron within plant cells leads to oxidative stress. As a consequence, iron-uptake systems are carefully regulated to ensure that iron homeostasis is maintained. In response to iron limitation, plants induce expression of sets of activities that function at the root-soil interface to solubilize iron and subsequently transfer it across the plasma membrane of root cells. Recent advances have revealed key players in the signaling pathways that function to induce these iron-uptake responses. Transcription factors belonging to the basic helix-loop-helix, ABI3/VP1(B3), and NAC families appear to function either directly or indirectly in the upregulation of iron deficiency responses.

  12. A rat gene with sequence homology to the Drosophila gene hairy is rapidly induced by growth factors known to influence neuronal differentiation.

    PubMed Central

    Feder, J N; Jan, L Y; Jan, Y N

    1993-01-01

    Several genes encoding transcription factors with a helix-loop-helix (HLH) motif are involved in the early process of neural development in Drosophila spp. We report the isolation from the rat a homolog of one of these genes, called hairy. The rat-hairy-like (RHL) gene is expressed early during embryogenesis. In contrast to the restricted expression of hairy mRNA in Drosophila spp., however, the mRNA encoded by RHL is detectable in all tissues examined. Stimulation of PC12 pheochromocytoma cells by nerve growth factor, basis fibroblast growth factor, or epidermal growth factor or of Rat-1 fibroblasts by epidermal growth factor causes a rapid and transient induction of the RHL gene. Thus, RHL acts as an immediate-early gene that can potentially transduce growth factor signals during the development of the mammalian embryo. Images PMID:8417318

  13. Proprioceptor pathway development is dependent on Math1

    NASA Technical Reports Server (NTRS)

    Bermingham, N. A.; Hassan, B. A.; Wang, V. Y.; Fernandez, M.; Banfi, S.; Bellen, H. J.; Fritzsch, B.; Zoghbi, H. Y.

    2001-01-01

    The proprioceptive system provides continuous positional information on the limbs and body to the thalamus, cortex, pontine nucleus, and cerebellum. We showed previously that the basic helix-loop-helix transcription factor Math1 is essential for the development of certain components of the proprioceptive pathway, including inner-ear hair cells, cerebellar granule neurons, and the pontine nuclei. Here, we demonstrate that Math1 null embryos lack the D1 interneurons and that these interneurons give rise to a subset of proprioceptor interneurons and the spinocerebellar and cuneocerebellar tracts. We also identify three downstream genes of Math1 (Lh2A, Lh2B, and Barhl1) and establish that Math1 governs the development of multiple components of the proprioceptive pathway.

  14. Overexpression of Id-1 protein is a marker in colorectal cancer progression.

    PubMed

    Zhao, Zeng-Ren; Zhang, Zhi-Yong; Zhang, Hong; Jiang, Li; Wang, Ming-Wei; Sun, Xiao-Feng

    2008-02-01

    The inhibitor of differentiation/DNA binding 1 (Id-1), a negative regulator of basic helix-loop-helix transcription factors, plays an important role in the regulation of cell proliferation and differentiation. We examined the Id-1 expression by immunohistochemistry in 9 adenomas, 79 primary colorectal adenocarcinomas matched with 40 adjacent normal mucosa specimens and its relationship with clinicopathological factors. The Id-1 expression was increased in the carcinoma compared to the adjacent normal mucosa either in the unmatched and matched samples or to the adenoma. There was no significant difference in the Id-1 expression between normal mucosa and adenoma. The Id-1 expression of carcinoma was increased from Dukes' stages A to B, to C and to D. The cases with lymph node metastasis had a higher rate of a stronger Id-1 expression than those without lymph node metastasis. In conclusion, Id-1 overexpression plays an important role in colorectal cancer progression.

  15. Impaired cued and contextual memory in NPAS2-deficient mice.

    PubMed

    Garcia, J A; Zhang, D; Estill, S J; Michnoff, C; Rutter, J; Reick, M; Scott, K; Diaz-Arrastia, R; McKnight, S L

    2000-06-23

    Neuronal PAS domain protein 2 (NPAS2) is a basic helix-loop-helix (bHLH) PAS domain transcription factor expressed in multiple regions of the vertebrate brain. Targeted insertion of a beta-galactosidase reporter gene (lacZ) resulted in the production of an NPAS2-lacZ fusion protein and an altered form of NPAS2 lacking the bHLH domain. The neuroanatomical expression pattern of NPAS2-lacZ was temporally and spatially coincident with formation of the mature frontal association/limbic forebrain pathway. NPAS2-deficient mice were subjected to a series of behavioral tests and were found to exhibit deficits in the long-term memory arm of the cued and contextual fear task. Thus, NPAS2 may serve a dedicated regulatory role in the acquisition of specific types of memory.

  16. Dynamic expression and essential functions of Hes7 in somite segmentation.

    PubMed

    Bessho, Y; Sakata, R; Komatsu, S; Shiota, K; Yamada, S; Kageyama, R

    2001-10-15

    The basic helix-loop-helix (bHLH) gene Hes7, a putative Notch effector, encodes a transcriptional repressor. Here, we found that Hes7 expression oscillates in 2-h cycles in the presomitic mesoderm (PSM). In Hes7-null mice, somites are not properly segmented and their anterior-posterior polarity is disrupted. As a result, the somite derivatives such as vertebrae and ribs are severely disorganized. Although expression of Notch and its ligands is not affected significantly, the oscillator and Notch modulator lunatic fringe is expressed continuously throughout the mutant PSM. These results indicate that Hes7 controls the cyclic expression of lunatic fringe and is essential for coordinated somite segmentation.

  17. Impaired Thermogenesis and a Molecular Signature for Brown Adipose Tissue in Id2 Null Mice

    PubMed Central

    Zhou, Peng; Robles-Murguia, Maricela; Mathew, Deepa; Duffield, Giles E.

    2016-01-01

    Inhibitor of DNA binding 2 (ID2) is a helix-loop-helix transcriptional repressor rhythmically expressed in many adult tissues. Our previous studies have demonstrated that Id2 null mice have sex-specific elevated glucose uptake in brown adipose tissue (BAT). Here we further explored the role of Id2 in the regulation of core body temperature over the circadian cycle and the impact of Id2 deficiency on genes involved in insulin signaling and adipogenesis in BAT. We discovered a reduced core body temperature in Id2−/− mice. Moreover, in Id2−/− BAT, 30 genes including Irs1, PPARs, and PGC-1s were identified as differentially expressed in a sex-specific pattern. These data provide valuable insights into the impact of Id2 deficiency on energy homeostasis of mice in a sex-specific manner. PMID:27144179

  18. Identification of White Spot Syndrome Virus Latency-Related Genes in Specific-Pathogen-Free Shrimps by Use of a Microarray

    PubMed Central

    Khadijah, Siti; Neo, Soek Ying; Hossain, M. S.; Miller, Lance D.; Mathavan, S.; Kwang, Jimmy

    2003-01-01

    To investigate whether specific-pathogen-free (SPF) shrimps are asymptomatic carriers of white spot syndrome virus (WSSV), we used a WSSV-specific DNA microarray to measure WSSV gene expression in SPF and WSSV-infected shrimps. Three WSSV genes were found to be relatively highly expressed in SPF shrimps. Reverse transcription-PCR using nested primers as well as real-time detection confirmed that these genes have no detectable counterparts in GenBank; structural analysis of the putative proteins revealed helix-loop-helix and leucine zipper motifs. Viral sequences could be PCR amplified from genomic DNA of SPF shrimp, further supporting the suggestion that these shrimps are asymptomatic carriers. PMID:12941929

  19. Proprioceptor pathway development is dependent on Math1

    NASA Technical Reports Server (NTRS)

    Bermingham, N. A.; Hassan, B. A.; Wang, V. Y.; Fernandez, M.; Banfi, S.; Bellen, H. J.; Fritzsch, B.; Zoghbi, H. Y.

    2001-01-01

    The proprioceptive system provides continuous positional information on the limbs and body to the thalamus, cortex, pontine nucleus, and cerebellum. We showed previously that the basic helix-loop-helix transcription factor Math1 is essential for the development of certain components of the proprioceptive pathway, including inner-ear hair cells, cerebellar granule neurons, and the pontine nuclei. Here, we demonstrate that Math1 null embryos lack the D1 interneurons and that these interneurons give rise to a subset of proprioceptor interneurons and the spinocerebellar and cuneocerebellar tracts. We also identify three downstream genes of Math1 (Lh2A, Lh2B, and Barhl1) and establish that Math1 governs the development of multiple components of the proprioceptive pathway.

  20. Distinct DNA binding preferences for the c-Myc/Max and Max/Max dimers.

    PubMed Central

    Solomon, D L; Amati, B; Land, H

    1993-01-01

    The transcription factor c-Myc and its dimerisation partner Max are members of the basic/helix-loop-helix/leucine-zipper (bHLH-Z) family and bind to the DNA core sequence CACGTG. Using a site-selection protocol, we determined the complete 12 base pair consensus binding sites of c-Myc/Max (RACCACGTGGTY) and Max/Max (RANCACGTGNTY) dimers. We find that the c-Myc/Max dimer fails to bind the core when it is flanked by a 5'T or a 3'A, while the Max/Max dimer readily binds such sequences. Furthermore we show that inappropriate flanking sequences preclude transactivation by c-Myc in vivo. In conclusion, Max/Max dimers are less discriminatory than c-Myc/Max and may regulate other genes in addition to c-Myc/Max targets. PMID:8265351

  1. Contiguous gene deletion neighboring TWIST1 identified in a patient with Saethre-Chotzen syndrome associated with neurodevelopmental delay: Possible contribution of HDAC9.

    PubMed

    Shimbo, Hiroko; Oyoshi, Tatsuki; Kurosawa, Kenji

    2017-02-21

    Saethre-Chotzen syndrome (SCS) is an autosomal dominant craniosynostotic disorder characterized by coronal synostosis, facial asymmetry, ptosis, and limb abnormalities. Haploinsufficiency of TWIST1, a basic helix-loop-helix transcription factor is responsible for SCS. Here, we report a 15-month-old male patient with typical clinical features of SCS in addition to developmental delay, which is a rare complication in SCS. He showed a de novo 0.9-Mb microdeletion in 7p21, in which TWIST1, NPMIP13, FERD3L, TWISTNB, and HDAC9 were included. In comparison with previously reported patients, HDAC9 was suggested to contribute to developmental delay in SCS patients with 7p21 mirodeletions. © 2017 Japanese Teratology Society.

  2. Heterotrimeric G protein mediates ethylene-induced stomatal closure via hydrogen peroxide synthesis in Arabidopsis.

    PubMed

    Ge, Xiao-Min; Cai, Hong-Li; Lei, Xue; Zhou, Xue; Yue, Ming; He, Jun-Min

    2015-04-01

    Heterotrimeric G proteins function as key players in hydrogen peroxide (H2O2) production in plant cells, but whether G proteins mediate ethylene-induced H2O2 production and stomatal closure are not clear. Here, evidences are provided to show the Gα subunit GPA1 as a missing link between ethylene and H2O2 in guard cell ethylene signalling. In wild-type leaves, ethylene-triggered H2O2 synthesis and stomatal closure were dependent on activation of Gα. GPA1 mutants showed the defect of ethylene-induced H2O2 production and stomatal closure, whereas wGα and cGα overexpression lines showed faster stomatal closure and H2O2 production in response to ethylene. Ethylene-triggered H2O2 generation and stomatal closure were impaired in RAN1, ETR1, ERS1 and EIN4 mutants but not impaired in ETR2 and ERS2 mutants. Gα activator and H2O2 rescued the defect of RAN1 and EIN4 mutants or etr1-3 in ethylene-induced H2O2 production and stomatal closure, but only rescued the defect of ERS1 mutants or etr1-1 and etr1-9 in ethylene-induced H2O2 production. Stomata of CTR1 mutants showed constitutive H2O2 production and stomatal closure, but which could be abolished by Gα inhibitor. Stomata of EIN2, EIN3 and ARR2 mutants did not close in responses to ethylene, Gα activator or H2O2, but do generate H2O2 following challenge of ethylene or Gα activator. The data indicate that Gα mediates ethylene-induced stomatal closure via H2O2 production, and acts downstream of RAN1, ETR1, ERS1, EIN4 and CTR1 and upstream of EIN2, EIN3 and ARR2. The data also show that ETR1 and ERS1 mediate both ethylene and H2O2 signalling in guard cells.

  3. Poly(rC) binding proteins mediate poliovirus mRNA stability.

    PubMed Central

    Murray, K E; Roberts, A W; Barton, D J

    2001-01-01

    The 5'-terminal 88 nt of poliovirus RNA fold into a cloverleaf RNA structure and form ribonucleoprotein complexes with poly(rC) binding proteins (PCBPs; AV Gamarnik, R Andino, RNA, 1997, 3:882-892; TB Parsley, JS Towner, LB Blyn, E Ehrenfeld, BL Semler, RNA, 1997, 3:1124-1134). To determine the functional role of these ribonucleoprotein complexes in poliovirus replication, HeLa S10 translation-replication reactions were used to quantitatively assay poliovirus mRNA stability, poliovirus mRNA translation, and poliovirus negative-strand RNA synthesis. Ribohomopoly(C) RNA competitor rendered wild-type poliovirus mRNA unstable in these reactions. A 5'-terminal 7-methylguanosine cap prevented the degradation of wild-type poliovirus mRNA in the presence of ribohomopoly(C) competitor. Ribohomopoly(A), -(G), and -(U) did not adversely affect poliovirus mRNA stability. Ribohomopoly(C) competitor RNA inhibited the translation of poliovirus mRNA but did not inhibit poliovirus negative-strand RNA synthesis when poliovirus replication proteins were provided in trans using a chimeric helper mRNA possessing the hepatitis C virus IRES. A C24A mutation prevented UV crosslinking of PCBPs to 5' cloverleaf RNA and rendered poliovirus mRNA unstable. A 5'-terminal 7-methylguanosine cap blocked the degradation of C24A mutant poliovirus mRNA. The C24A mutation did not inhibit the translation of poliovirus mRNA nor diminish viral negative-strand RNA synthesis relative to wild-type RNA. These data support the conclusion that poly(rC) binding protein(s) mediate the stability of poliovirus mRNA by binding to the 5'-terminal cloverleaf structure of poliovirus mRNA. Because of the general conservation of 5' cloverleaf RNA sequences among picornaviruses, including C24 in loop b of the cloverleaf, we suggest that viral mRNA stability of polioviruses, coxsackieviruses, echoviruses, and rhinoviruses is mediated by interactions between PCBPs and 5' cloverleaf RNA. PMID:11497431

  4. Identification and characterization of a putative baculoviral transcriptional factor IE-1 from Choristoneura fumiferana granulovirus.

    PubMed

    Rashidan, Kianoush Khajeh; Nassoury, Nasha; Merzouki, Abderrazzak; Guertin, Claude

    2002-11-30

    A gene that encodes a protein homologue to baculoviral IE-1 was identified and sequenced in the genome of the Choristoneura fumiferana granulovirus (ChfuGV). The gene has an 1278 nucleotide (nt) open-reading frame (ORF) that encodes 426 amino acids with an estimated molecular weight of 50.33 kDa. At the nucleotide level, several cis-acting regulatory elements were detected within the promoter region of the ie-1 gene of ChfuGV along with other studied granuloviruses (GVs). Two putative CCAAT elements were detected within the noncoding leader region of this gene; one was located on the opposite strand at -92 and the other at -420 nt from the putative start triplet. Two baculoviral late promoter motifs (TAAG) were also detected within the promoter region of the ie-1 gene of ChfuGV. A single polyadenylation signal, AATAAA, was located 18nt downstream of the putative translational stop codon of ie-1 from ChfuGV. At the protein level, the amino acid sequence data that was derived from the nucleotide sequence in ChfuGV IE-1 was compared to those of the Cydia pomonella granulovirus (CpGV), Xestia c-nigrum granulovirus (XcGV) and Plutella xylostella granulovirus (PxGV). The C-terminal regions of the granuloviral IE-1 sequences appeared to be more conserved when compared to the N-terminal regions. A domain, similar to the basic helix-loop-helix like (bHLH-like) domain in NPVs, was detected at the C-terminal region of IE-1 from ChfuGV (residues 387 to 414). A phylogenetic tree for baculoviral IE-1 was constructed using a maximum parsimony analysis. A phylogenetic estimation demonstrates that ChfuGV IE-1 is most closely related to that of CpGV.

  5. Functional Specificity of a Hox Protein Mediated by the Recognition of Minor Groove Structure

    SciTech Connect

    Joshi,R.; Passner, J.; Rohs, R.; Jain, R.; Sosinksy, A.; Crickmore, M.; Jacob, V.; Aggarwal, A.; Honig, B.; et. al

    2007-01-01

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  6. Gi proteins mediate activation of the canonical hedgehog pathway in the myocardium.

    PubMed

    Carbe, Christian J; Cheng, Lan; Addya, Sankar; Gold, Jessica I; Gao, Erhe; Koch, Walter J; Riobo, Natalia A

    2014-07-01

    During myocardial ischemia, upregulation of the hedgehog (Hh) pathway promotes neovascularization and increases cardiomyocyte survival. The canonical Hh pathway activates a transcriptional program through the Gli family of transcription factors by derepression of the seven-transmembrane protein smoothened (Smo). The mechanisms linking Smo to Gli are complex and, in some cell types, involve coupling of Smo to Gi proteins. In the present study, we investigated, for the first time, the transcriptional response of cardiomyocytes to sonic hedgehog (Shh) and the role of Gi protein utilization. Our results show that Shh strongly activates Gli1 expression by quantitative PCR in a Smo-dependent manner in neonatal rat ventricular cardiomyocytes. Microarray analysis of gene expression changes elicited by Shh and sensitive to a Smo inhibitor identified a small subset of 37 cardiomyocyte-specific genes regulated by Shh, including some in the PKA and purinergic signaling pathways. In addition, neonatal rat ventricular cardiomyocytes infected with an adenovirus encoding GiCT, a peptide that impairs receptor-Gi protein coupling, showed reduced activation of Hh targets. In vitro data were confirmed in transgenic mice with cardiomyocyte-inducible GiCT expression. Transgenic GiCT mice showed specific reduction of Gli1 expression in the heart under basal conditions and failed to upregulate the Hh pathway upon ischemia and reperfusion injury, unlike their littermate controls. This study characterizes, for the first time, the transcriptional response of cardiomyocytes to Shh and establishes a critical role for Smo coupling to Gi in Hh signaling in the normal and ischemic myocardium. Copyright © 2014 the American Physiological Society.

  7. The Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT/HIF-1β) is influenced by hypoxia and hypoxia-mimetics.

    PubMed

    Wolff, Matthias; Jelkmann, Wolfgang; Dunst, Jürgen; Depping, Reinhard

    2013-01-01

    The Aryl Hydrocarbon Receptor Nuclear Translocator (ARNT, HIF-1β) is a member of the basic-Helix-Loop-Helix PER/ARNT/SIM (bHLH/PAS) protein family and a vital transcriptional regulator regarding development and physiological adaptation processes. ARNT is discussed to be linked with cancer, and other diseases. ARNT is known to be translocated into the cell nucleus, where accumulation of the protein takes place. ARNT is a heterodimerisation partner of the xenobiotic ligand activated Aryl Hydrocarbon Receptor (AhR), the Single Minded proteins (SIM), the cardiovascular helix-loop-helix factor 1 and the Hypoxia Inducible Factor proteins (HIF-α). ARNT is obligatory for HIF-1, HIF-2 and HIF-3 binding to DNA. Whereas degradation of the HIF-α subunits is suppressed by hypoxia, ARNT is generally regarded as constitutively expressed in excess within the cell, and stabilisation is commonly thought to be oxygen-independent. However, we provide evidence that the regulation of ARNT is far more complex. The aim of our study was to reevaluate the regulation of ARNT expression. We examined cell lines of different origin like MCF-7 and T47D (human breast cancer), HeLa (human cervix carcinoma), Hep3B and HepG2 (human hepatoma), Kelly (human neuroblastoma), REPC (human kidney) and Cos7 (primary primate kidney) cells. We used immunoblot analysis, densitometry, RT-PCR and transient transfection. Our results show that ARNT protein levels are influenced by hypoxia and hypoxia mimetics such as cobalt(II)-chloride (CoCl2) and dimethyloxalylglycine (DMOG) in a cell line specific manner. We demonstrate that this effect might be triggered by HIF-1α which plays an important role in the process of stabilizing ARNT in hypoxia. © 2013 S. Karger AG, Basel

  8. RNA binding proteins mediate the ability of a fungus to adapt to the cold.

    PubMed

    Fang, Weiguo; St Leger, Raymond J

    2010-03-01

    Little is known about how fungi adapt to chilling. In eubacteria, cold shock proteins (CSPs) facilitate translation by destabilizing RNA secondary structure. Animals and plants have homologous cold shock domains within proteins, and additional glycine-rich RNA binding proteins (GRPs), but their role in stress resistance is poorly understood. In this study, we identified GRP homologues in diverse fungi. However, only Aspergillus clavatus and Metarhizium anisopliae possessed cold shock domains. Both M. anisopliae's small eubacteria-like CSP (CRP1) and its GRP (CRP2) homologue were induced by cold. Disrupting either Crp1 or Crp2 greatly reduced metabolism and conidial germination rates at low temperatures, and decreased tolerance to freezing. However, while both Crp1 and Crp2 reduced freezing-induced production of reactive oxygen species, only Crp1 protected cells against H(2)O(2) and increased M. anisopliae's virulence to caterpillars. Unlike CRP2, CRP1 rescued the cold-sensitive growth defects of an Escherichia coli CSP deletion mutant, and CRP1 also demonstrated transcription anti-termination activity, so CRP1 can regulate transcription and translation at low temperature. Expressing either Crp1 or Crp2 in yeast increased metabolism at cold temperatures and Crp1 improved tolerance to freezing. Thus besides providing a model relevant to many biological systems, Crp1 and Crp2 have potential applications in biotechnology.

  9. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    PubMed Central

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  10. Negative Regulation of STAT3 Protein-mediated Cellular Respiration by SIRT1 Protein*

    PubMed Central

    Bernier, Michel; Paul, Rajib K.; Martin-Montalvo, Alejandro; Scheibye-Knudsen, Morten; Song, Shaoming; He, Hua-Jun; Armour, Sean M.; Hubbard, Basil P.; Bohr, Vilhelm A.; Wang, Lili; Zong, Yaping; Sinclair, David A.; de Cabo, Rafael

    2011-01-01

    In mammals, the transcriptional activity of signal transducer and activator of transcription 3 (STAT3) is regulated by the deacetylase SIRT1. However, whether the newly described nongenomic actions of STAT3 toward mitochondrial oxidative phosphorylation are dependent on SIRT1 is unclear. In this study, Sirt1 gene knock-out murine embryonic fibroblast (MEF) cells were used to delineate the role of SIRT1 in the regulation of STAT3 mitochondrial function. Here, we show that STAT3 mRNA and protein levels and the accumulation of serine-phosphorylated STAT3 in mitochondria were increased significantly in Sirt1-KO cells as compared with wild-type MEFs. Various mitochondrial bioenergetic parameters, such as the oxygen consumption rate in cell cultures, enzyme activities of the electron transport chain complexes in isolated mitochondria, and production of ATP and lactate, indicated that Sirt1-KO cells exhibited higher mitochondrial respiration as compared with wild-type MEFs. Two independent approaches, including ectopic expression of SIRT1 and siRNA-mediated knockdown of STAT3, led to reduction in intracellular ATP levels and increased lactate production in Sirt1-KO cells that were approaching those of wild-type controls. Comparison of profiles of phospho-antibody array data indicated that the deletion of SirT1 was accompanied by constitutive activation of the pro-inflammatory NF-κB pathway, which is key for STAT3 induction and increased cellular respiration in Sirt1-KO cells. Thus, SIRT1 appears to be a functional regulator of NF-κB-dependent STAT3 expression that induces mitochondrial biogenesis. These results have implications for understanding the interplay between STAT3 and SIRT1 in pro-inflammatory conditions. PMID:21467030

  11. FoxO proteins mediate hypoxic induction of connective tissue growth factor in endothelial cells.

    PubMed

    Samarin, Jana; Wessel, Julia; Cicha, Iwona; Kroening, Sven; Warnecke, Christina; Goppelt-Struebe, Margarete

    2010-02-12

    Hypoxia, a driving force in neovascularization, promotes alterations in gene expression mediated by hypoxia-inducible factor (HIF)-1alpha. Connective tissue growth factor (CTGF, CCN2) is a modulator of endothelial cell growth and migration, but its regulation by hypoxia is poorly understood. Therefore, we analyzed signaling pathways involved in the regulation of CTGF by hypoxia in endothelial cells. Exposure to low oxygen tension or treatment with the hypoxia-mimetic dimethyloxalyl glycine (DMOG) stabilized HIF-1alpha and up-regulated CTGF in human umbilical vein endothelial cells and in a murine microvascular endothelial cell line. Induction of CTGF correlated with a HIF-dependent increase in protein and mRNA levels, and nuclear accumulation of the transcription factor FoxO3a. By contrast, gene expression and cellular localization of FoxO1 were not significantly altered by hypoxia. Expression of CTGF was strongly reduced by siRNA silencing of FoxO1 or FoxO3a. Furthermore, nuclear exclusion of FoxO1/3a transcription factors by inhibition of serine/threonine protein phosphatases by okadaic acid inhibited CTGF expression, providing evidence for both FoxO proteins as regulators of CTGF expression. The DMOG-stimulated induction of CTGF was further increased when endothelial cells were co-incubated with transforming growth factor-beta, an activator of Smad signaling. Activation of RhoA-Rho kinase signaling by the microtubule-disrupting drug combretastatin A4 also enhanced the DMOG-induced CTGF expression, thus placing CTGF induction by hypoxia in a network of interacting signaling pathways. Our findings provide evidence that FoxO1, hypoxia-stimulated expression of FoxO3a and its nuclear accumulation are required for the induction of CTGF by hypoxia in endothelial cells.

  12. Structure of the GLD-1 homodimerization domain: Insights into STAR protein-mediated translational regulation

    PubMed Central

    Beuck, Christine; Szymczyna, Blair R.; Kerkow, Donald E.; Carmel, Andrew B.; Columbus, Linda; Stanfield, Robyn L.; Williamson, James R.

    2010-01-01

    SUMMARY Post-transcriptional regulation of gene expression is an important mechanism for modulating protein levels in eukaryotes, especially in developmental pathways. The highly conserved homodimeric STAR/GSG proteins play a key role in regulating translation by binding bipartite consensus sequences in the untranslated regions of target mRNAs, but the exact mechanism remains unknown. Structures of STAR protein RNA binding subdomains have been determined, but structural information is lacking for the homodimerization subdomain. Here, we present the structure of the C. elegans GLD-1 homodimerization domain dimer, determined by a combination of X-ray crystallography and NMR spectroscopy, revealing a helix-turn-helix monomeric fold with the two protomers stacked perpendicularly. Structure-based mutagenesis demonstrates that the dimer interface is not easily disrupted, but the structural integrity of the monomer is crucial for GLD-1 dimerization. Finally, an improved model for STAR-mediated translational regulation of mRNA, based on the GLD-1 homodimerization domain structure, is presented. PMID:20223220

  13. Construction, expression and characterization of a chimeric multi-domain protein mediating specific DNA transfer.

    PubMed

    Gao, Peng; Li, Xiao; Liu, Yanjing; Liu, Yan; Kan, Shifu; Jin, Jing; Wang, Shuqi; Yuan, Changji; Jin, Ningyi

    2010-12-01

    The delivery of plasmid DNA to target cells using a simple, defined, non-viral system is an area of intense research in gene therapy. Here, we describe a novel DNA carrier protein termed TG, consisting of the DNA-binding domain of the yeast transcriptional activator GAL4 and human immunodeficiency virus type 1 Tat protein, which can transfer modified naked plasmid DNA into target cells to express foreign genes of interest. The TG protein was expressed in Escherichia coli (E. coli), refolded and purified on an immobilized Ni(2+) affinity chromatography column. SDS-PAGE and Western blotting revealed that the fusion protein was highly expressed with a yield of approximately 275 mg/L. We also constructed the pIRES-UAS-EGFP DNA vector, consisting of upstream activating sequences (UASs) for the specific binding of the DNA-binding protein and the enhanced green fluorescent protein (EGFP) gene. The TG protein could bind specifically to pIRES-UAS-EGFP, forming a complex which could efficiently transfect target cells and result in detectable EGFP protein expression. Thus, these results provide a basis for development of efficient non-viral DNA transfer vectors for further improvements of gene therapy strategies.

  14. The Human Metapneumovirus Fusion Protein Mediates Entry via an Interaction with RGD-Binding Integrins

    PubMed Central

    Cox, Reagan G.; Livesay, S. Brent; Johnson, Monika; Ohi, Melanie D.

    2012-01-01

    Paramyxoviruses use a specialized fusion protein to merge the viral envelope with cell membranes and initiate infection. Most paramyxoviruses require the interaction of two viral proteins to enter cells; an attachment protein binds cell surface receptors, leading to the activation of a fusion (F) protein that fuses the viral envelope and host cell plasma membrane. In contrast, human metapneumovirus (HMPV) expressing only the F protein is replication competent, suggesting a primary role for HMPV F in attachment and fusion. We previously identified an invariant arginine-glycine-aspartate (RGD) motif in the HMPV F protein and showed that the RGD-binding integrin αVβ1-promoted HMPV infection. Here we show that both HMPV F-mediated binding and virus entry depend upon multiple RGD-binding integrins and that HMPV F can mediate binding and fusion in the absence of the viral attachment (G) protein. The invariant F-RGD motif is critical for infection, as an F-RAE virus was profoundly impaired. Further, F-integrin binding is required for productive viral RNA transcription, indicating that RGD-binding integrins serve as receptors for the HMPV fusion protein. Thus, HMPV F is triggered to induce virus-cell fusion by interactions with cellular receptors in a manner that is independent of the viral G protein. These results suggest a stepwise mechanism of HMPV entry mediated by the F protein through its interactions with cellular receptors, including RGD-binding integrins. PMID:22933271

  15. Z-DNA Binding Protein Mediates Host Control of Toxoplasma gondii Infection

    PubMed Central

    Pittman, Kelly J.; Cervantes, Patrick W.

    2016-01-01

    Intrinsic to Toxoplasma gondii infection is the parasite-induced modulation of the host immune response, which ensures establishment of a chronic lifelong infection. This manipulation of the host immune response allows T. gondii to not only dampen the ability of the host to eliminate the parasite but also trigger parasite differentiation to the slow-growing, encysted bradyzoite form. We previously used RNA sequencing (RNA-seq) to profile the transcriptomes of mice and T. gondii during acute and chronic stages of infection. One of the most abundant host transcripts during acute and chronic infection was Z-DNA binding protein 1 (ZBP1). In this study, we determined that ZBP1 functions to control T. gondii growth. In activated macrophages isolated from ZBP1 deletion (ZBP1−/−) mice, T. gondii has an increased rate of replication and a decreased rate of degradation. We also identified a novel function for ZBP1 as a regulator of nitric oxide (NO) production in activated macrophages, even in the absence of T. gondii infection. Upon stimulation, T. gondii-infected ZBP1−/− macrophages display increased proinflammatory cytokines compared to wild-type macrophages under the same conditions. These in vitro phenotypes were recapitulated in vivo, with ZBP1−/− mice having increased susceptibility to oral challenge, higher cyst burdens during chronic infection, and elevated inflammatory cytokine responses. Taken together, these results highlight a role for ZBP1 in assisting host control of T. gondii infection. PMID:27481249

  16. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes.

    PubMed

    Amemiya-Kudo, Michiyo; Shimano, Hitoshi; Hasty, Alyssa H; Yahagi, Naoya; Yoshikawa, Tomohiro; Matsuzaka, Takashi; Okazaki, Hiroaki; Tamura, Yoshiaki; Iizuka, Yoko; Ohashi, Ken; Osuga, Jun-ichi; Harada, Kenji; Gotoda, Takanari; Sato, Ryuichiro; Kimura, Satoshi; Ishibashi, Shun; Yamada, Nobuhiro

    2002-08-01

    Recent studies on the in vivo roles of the sterol regulatory element binding protein (SREBP) family indicate that SREBP-2 is more specific to cholesterogenic gene expression whereas SREBP-1 targets lipogenic genes. To define the molecular mechanism involved in this differential regulation, luciferase-reporter gene assays were performed in HepG2 cells to compare the transactivities of nuclear SREBP-1a, -1c, and -2 on a battery of SREBP-target promoters containing sterol regulatory element (SRE), SRE-like, or E-box sequences. The results show first that cholesterogenic genes containing classic SREs in their promoters are strongly and efficiently activated by both SREBP-1a and SREBP-2, but not by SREBP-1c. Second, an E-box containing reporter gene is much less efficiently activated by SREBP-1a and -1c, and SREBP-2 was inactive in spite of its ability to bind to the E-box. Third, promoters of lipogenic enzymes containing variations of SRE (SRE-like sequences) are strongly activated by SREBP-1a, and only modestly and equally by both SREBP-1c and -2. Finally, substitution of the unique tyrosine residue within the basic helix-loop-helix (bHLH) portion of nuclear SREBPs with arginine, the conserved residue found in all other bHLH proteins, abolishes the transactivity of all SREBPs for SRE, and conversely results in markedly increased activity of SREBP-1 but not activity of SREBP-2 for E-boxes. These data demonstrate the different specificity and affinity of nuclear SREBP-1 and -2 for different target DNAs, explaining a part of the mechanism behind the differential in vivo regulation of cholesterogenic and lipogenic enzymes by SREBP-1 and -2, respectively.

  17. Transcription factories

    PubMed Central

    Rieder, Dietmar; Trajanoski, Zlatko; McNally, James G.

    2012-01-01

    There is considerable evidence that transcription does not occur homogeneously or diffusely throughout the nucleus, but rather at a number of specialized, discrete sites termed transcription factories. The factories are composed of ~4–30 RNA polymerase molecules, and are associated with many other molecules involved in transcriptional activation and mRNA processing. Some data suggest that the polymerase molecules within a factory remain stationary relative to the transcribed DNA, which is thought to be reeled through the factory site. There is also some evidence that transcription factories could help organize chromatin and nuclear structure, contributing to both the formation of chromatin loops and the clustering of active and co-regulated genes. PMID:23109938

  18. G-protein-mediated desensitization of metabotropic glutamatergic and muscarinic responses in CA3 cells in rat hippocampus.

    PubMed Central

    Guérineau, N C; Bossu, J L; Gähwiler, B H; Gerber, U

    1997-01-01

    1. Desensitization of a metabotropic response was investigated in CA3 pyramidal neurons in hippocampal slice cultures using the patch-clamp technique. 2. 1S,3R-1-aminocyclopentane-1,3-dicarboxylate (1S,3R-ACPD), an agonist at metabotropic glutamate receptors (mGluRs), and metacholine (MCh), an agonist at muscarinic receptors, induced a cationic current that appears to be activated through a G-protein-independent transduction process, as previously shown. Prolonged or repetitive bath application of agonists led to rapid desensitization of the cationic current with a time constant of approximately 20 s. 3. Complete recovery from desensitization was observed within 6 min. 4. These responses mediated by mGluRs and muscarinic receptors cross-desensitized. 5. Preventing the activation of G-proteins by loading cells with GDP beta S strongly reduced or suppressed desensitization, and resulted in a sustained inward cationic current. When cells were filled with GTP gamma S to irreversibly activate G-proteins, the desensitization process was enhanced such that a first application of agonist caused a markedly reduced response. 6. These results show that a cationic current induced by metabotropic agonists in hippocampal pyramidal cells undergoes apparent desensitization and suggests that this process occurs through a G-protein-mediated inhibition of the underlying membrane conductance. PMID:9147332

  19. Transcription elongation

    PubMed Central

    Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

    2014-01-01

    Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity. PMID:25764114

  20. A novel Zea mays ssp. mexicana L. MYC-type ICE-like transcription factor gene ZmmICE1, enhances freezing tolerance in transgenic Arabidopsis thaliana.

    PubMed

    Lu, Xiang; Yang, Lei; Yu, Mengyuan; Lai, Jianbin; Wang, Chao; McNeil, David; Zhou, Meixue; Yang, Chengwei

    2017-04-01

    The annual Zea mays ssp. mexicana L., a member of the teosinte group, is a close wild relative of maize and thus can be effectively used in maize improvement. In this study, an ICE-like gene, ZmmICE1, was isolated from a cDNA library of RNA-Seq from cold-treated seedling tissues of Zea mays ssp. mexicana L. The deduced protein of ZmmICE1 contains a highly conserved basic helix-loop-helix (bHLH) domain and C-terminal region of ICE-like proteins. The ZmmICE1 protein localizes to the nucleus and shows sumoylation when expressed in an Escherichia coli reconstitution system. In addition, yeast one hybrid assays indicated that ZmmICE1 has transactivation activities. Moreover, ectopic expression of ZmmICE1 in the Arabidopsis ice1-2 mutant increased freezing tolerance. The ZmmICE1 overexpressed plants showed lower electrolyte leakage (EL), reduced contents of malondialdehyde (MDA). The expression of downstream cold related genes of Arabidopsis C-repeat-binding factors (AtCBF1, AtCBF2 and AtCBF3), cold-responsive genes (AtCOR15A and AtCOR47), kinesin-1 member gene (AtKIN1) and responsive to desiccation gene (AtRD29A) was significantly induced when compared with wild type under low temperature treatment. Taken together, these results indicated that ZmmICE1 is the homolog of Arabidopsis inducer of CBF expression genes (AtICE1/2) and plays an important role in the regulation of freezing stress response. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Protein- mediated enamel mineralization

    PubMed Central

    Moradian-Oldak, Janet

    2012-01-01

    Enamel is a hard nanocomposite bioceramic with significant resilience that protects the mammalian tooth from external physical and chemical damages. The remarkable mechanical properties of enamel are associated with its hierarchical structural organization and its thorough connection with underlying dentin. This dynamic mineralizing system offers scientists a wealth of information that allows the study of basic principals of organic matrix-mediated biomineralization and can potentially be utilized in the fields of material science and engineering for development and design of biomimetic materials. This chapter will provide a brief overview of enamel hierarchical structure and properties as well as the process and stages of amelogenesis. Particular emphasis is given to current knowledge of extracellular matrix protein and proteinases, and the structural chemistry of the matrix components and their putative functions. The chapter will conclude by discussing the potential of enamel for regrowth. PMID:22652761

  2. Transcriptional regulator Id2 mediates CD8+ T cell immunity.

    PubMed

    Cannarile, Michael A; Lind, Nicholas A; Rivera, Richard; Sheridan, Alison D; Camfield, Kristin A; Wu, Bei Bei; Cheung, Kitty P; Ding, Zhaoqing; Goldrath, Ananda W

    2006-12-01

    Transcriptional programs that initiate and sustain the proliferation, differentiation and survival of CD8(+) T cells during immune responses are not completely understood. Here we show that inhibitor of DNA binding 2 (Id2), an antagonist of E protein transcription factors, was upregulated in CD8(+) T cells during infection and that expression of Id2 was maintained in memory CD8(+) T cells. Although Id2-deficient naive CD8(+) T cells recognized antigen and proliferated normally early after infection, effector CD8(+) T cells did not accumulate because the cells were highly susceptible to apoptosis. Id2-deficient CD8(+) T cells responding to infection had changes in the expression of genes that influence survival and had altered memory formation. Our data emphasize the importance of Id2 in regulating gene expression by CD8(+) T cells and the magnitude of effector responses, suggesting a mechanism involving Id protein- and E protein-mediated survival and differentiation of mature T cells.

  3. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Investigation of cell adhesion to silica nanoparticle-decorated surfaces and the associated protein-mediated mechanisms

    NASA Astrophysics Data System (ADS)

    Ballard, Jake D.

    sizes examined. For the first time, this study offers insight into a molecular mechanism that is linked to nanostructured material surface feature size through quantified changes in protein structure and cell adhesion behavior. These results provide an explanation of the molecular level events occurring on nanostructured material surfaces that contribute to protein-mediated size-selective and cell type-specific responses of various cell types.

  5. Delta–Notch—and then? Protein interactions and proposed modes of repression by Hes and Hey bHLH factors

    PubMed Central

    Fischer, Andreas; Gessler, Manfred

    2007-01-01

    Hes and Hey genes are the mammalian counterparts of the Hairy and Enhancer-of-split type of genes in Drosophila and they represent the primary targets of the Delta–Notch signaling pathway. Hairy-related factors control multiple steps of embryonic development and misregulation is associated with various defects. Hes and Hey genes (also called Hesr, Chf, Hrt, Herp or gridlock) encode transcriptional regulators of the basic helix-loop-helix class that mainly act as repressors. The molecular details of how Hes and Hey proteins control transcription are still poorly understood, however. Proposed modes of action include direct binding to N- or E-box DNA sequences of target promoters as well as indirect binding through other sequence-specific transcription factors or sequestration of transcriptional activators. Repression may rely on recruitment of corepressors and induction of histone modifications, or even interference with the general transcriptional machinery. All of these models require extensive protein–protein interactions. Here we review data published on protein–protein and protein–DNA interactions of Hairy-related factors and discuss their implications for transcriptional regulation. In addition, we summarize recent progress on the identification of potential target genes and the analysis of mouse models. PMID:17586813

  6. The window period of NEUROGENIN3 during human gestation.

    PubMed

    Salisbury, Rachel J; Blaylock, Jennifer; Berry, Andrew A; Jennings, Rachel E; De Krijger, Ronald; Piper Hanley, Karen; Hanley, Neil A

    2014-01-01

    The basic helix-loop-helix transcription factor, NEUROG3, is critical in causing endocrine commitment from a progenitor cell population in the developing pancreas. In human, NEUROG3 has been detected from 8 weeks post-conception (wpc). However, the profile of its production and when it ceases to be detected is unknown. In this study we have defined the profile of NEUROG3 detection in the developing pancreas to give insight into when NEUROG3-dependent endocrine commitment is possible in the human fetus. Immunohistochemistry allowed counting of cells with positively stained nuclei from 7 wpc through to term. mRNA was also isolated from sections of human fetal pancreas and NEUROG3 transcription analyzed by quantitative reverse transcription and polymerase chain reaction. NEUROG3 was detected as expected at 8 wpc. The number of NEUROG3-positive cells increased to peak levels between 10 wpc and 14 wpc. It declined at and after 18 wpc such that it was not detected in human fetal pancreas at 35-41 wpc. Analysis of NEUROG3 transcription corroborated this profile by demonstrating very low levels of transcript at 35-41 wpc, more than 10-fold lower than levels at 12-16 wpc. These data define the appearance, peak and subsequent disappearance of the critical transcription factor, NEUROG3, in human fetal pancreas for the first time. By inference, the window for pancreatic endocrine differentiation via NEUROG3 action opens at 8 wpc and closes between 21 and 35 wpc.

  7. Antisense transcription licenses nascent transcripts to mediate transcriptional gene silencing

    PubMed Central

    Dang, Yunkun; Cheng, Jiasen; Sun, Xianyun; Zhou, Zhipeng; Liu, Yi

    2016-01-01

    In eukaryotes, antisense transcription can regulate sense transcription by induction of epigenetic modifications. We showed previously that antisense transcription triggers Dicer-independent siRNA (disiRNA) production and disiRNA locus DNA methylation (DLDM) in Neurospora crassa. Here we show that the conserved exonuclease ERI-1 (enhanced RNAi-1) is a critical component in this process. Antisense transcription and ERI-1 binding to target RNAs are necessary and sufficient to trigger DLDM. Convergent transcription causes stalling of RNA polymerase II during transcription, which permits ERI-1 to bind nascent RNAs in the nucleus and recruit a histone methyltransferase complex that catalyzes chromatin modifications. Furthermore, we show that, in the cytoplasm, ERI-1 targets hundreds of transcripts from loci without antisense transcription to regulate RNA stability. Together, our results demonstrate a critical role for transcription kinetics in long noncoding RNA-mediated epigenetic modifications and identify ERI-1 as an important regulator of cotranscriptional gene silencing and post-transcriptional RNA metabolism. PMID:27856616

  8. Role of hypoxia-inducible factor-{alpha} in hepatitis-B-virus X protein-mediated MDR1 activation

    SciTech Connect

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook . E-mail: kwkang@chosun.ac.kr

    2007-06-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and induced the nuclear translocation of C/EBP{beta}. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1{alpha} siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1{alpha} activation, and suggest HIF-1{alpha} for the therapeutic target of HBV-mediated chemoresistance.

  9. Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.

    PubMed Central

    Robb, L; Lyons, I; Li, R; Hartley, L; Köntgen, F; Harvey, R P; Metcalf, D; Begley, C G

    1995-01-01

    The scl gene encodes a basic-helix-loop-helix transcription factor which was identified through its involvement in chromosomal translocations in T-cell leukemia. To elucidate its physiological role, scl was targeted in embryonic stem cells. Mice heterozygous for the scl null mutation were intercrossed and their offspring were genotyped. Homozygous mutant (scl-/-) pups were not detected in newborn litters, and analysis at earlier time points demonstrated that scl-/- embryos were dying around embryonic day 9.5. The scl-/- embryos were pale, edematous, and markedly growth retarded after embryonic day 8.75. Histological studies showed complete absence of recognizable hematopoiesis in the yolk sac of these embryos. Early organogenesis appeared to be otherwise normal. Culture of yolk sac cells of wild-type, heterozygous, and homozygous littermates confirmed the absence of hematopoietic cells in scl-/- yolk sacs. Reverse transcription PCR was used to examine the transcripts of several genes implicated in early hematopoiesis. Transcripts of GATA-1 and PU.1 transcription factors were absent from RNA from scl-/- yolk sacs and embryos. These results implicate scl as a crucial regulator of early hematopoiesis. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7624372

  10. The bHLH proteins BEE and BIM positively modulate the shade avoidance syndrome in Arabidopsis seedlings.

    PubMed

    Cifuentes-Esquivel, Nicolás; Bou-Torrent, Jordi; Galstyan, Anahit; Gallemí, Marçal; Sessa, Giovanna; Salla Martret, Mercè; Roig-Villanova, Irma; Ruberti, Ida; Martínez-García, Jaime F

    2013-09-01

    The shade avoidance syndrome (SAS) refers to a set of plant responses initiated after perception by the phytochromes of light with a reduced red to far-red ratio, indicative of vegetation proximity or shade. These responses, including elongation growth, anticipate eventual shading from potential competitor vegetation by overgrowing neighboring plants or flowering to ensure production of viable seeds for the next generation. In Arabidopsis thaliana seedlings, the SAS includes dramatic changes in gene expression, such as induction of PHYTOCHROME RAPIDLY REGULATED 1 (PAR1), encoding an atypical basic helix-loop-helix (bHLH) protein that acts as a transcriptional co-factor to repress hypocotyl elongation. Indeed, PAR1 has been proposed to act fundamentally as a dominant negative antagonist of conventional bHLH transcription factors by forming heterodimers with them to prevent their binding to DNA or other transcription factors. Here we report the identification of PAR1-interacting factors, including the brassinosteroid signaling components BR-ENHANCED EXPRESSION (BEE) and BES1-INTERACTING MYC-LIKE (BIM), and characterize their role as networked positive regulators of SAS hypocotyl responses. We provide genetic evidence that these bHLH transcriptional regulators not only control plant growth and development under shade and non-shade conditions, but are also redundant in the control of plant viability. Our results suggest that SAS responses are initiated as a consequence of a new balance of transcriptional regulators within the pre-existing bHLH network triggered by plant proximity, eventually causing hypocotyls to elongate.

  11. Reconstitution of an E box-binding Myc:Max complex with recombinant full-length proteins expressed in Escherichia coli.

    PubMed

    Farina, Anthony; Faiola, Francesco; Martinez, Ernest

    2004-04-01

    The c-Myc oncoprotein (Myc) is a DNA sequence-specific transcription factor that regulates transcription of a wide variety of genes involved in the control of cell growth, proliferation, differentiation, and apoptosis and its deregulated expression is implicated in many types of human cancer. Myc has an N-terminal transcription activation domain (TAD) that interacts with various coactivators and a C-terminal basic-helix-loop-helix-leucine zipper (bHLHZip) domain required for E box-specific DNA-binding and heterodimerization with its obligatory bHLHZip protein partner Max. The analysis of the mechanisms by which the Myc:Max complex regulates transcription at the molecular level in vitro has been hampered by the difficulty in obtaining highly pure recombinant Myc:Max heterodimers that contain full-length Myc with its complete TAD domain and that have sequence-specific DNA-binding activity. Here, we describe a simple method to reconstitute recombinant Myc:Max complexes from highly purified full-length proteins expressed in Escherichia coli that are soluble and highly active in E box-specific DNA-binding in vitro. The reconstituted Myc:Max complexes are stable and lack Max:Max homodimers. This procedure should facilitate the characterization of the DNA-binding and transcription activation functions of full-length Myc:Max complexes in vitro and in particular the role of Myc TAD-interacting cofactors and Myc:Max post-translational modifications.

  12. Reconstitution of an E box-binding Myc:Max complex with recombinant full-length proteins expressed in Escherichia coli

    PubMed Central

    Farina, Anthony; Faiola, Francesco; Martinez, Ernest

    2014-01-01

    The c-Myc oncoprotein (Myc) is a DNA sequence-specific transcription factor that regulates transcription of a wide variety of genes involved in the control of cell growth, proliferation, differentiation, and apoptosis and its deregulated expression is implicated in many types of human cancer. Myc has an N-terminal transcription activation domain (TAD) that interacts with various coactivators and a C-terminal basic-helix-loop-helix-leucine zipper (bHLHZip) domain required for E box-specific DNA-binding and heterodimerization with its obligatory bHLHZip protein partner Max. The analysis of the mechanisms by which the Myc:Max complex regulates transcription at the molecular level in vitro has been hampered by the difficulty in obtaining highly pure recombinant Myc:Max heterodimers that contain full-length Myc with its complete TAD domain and that have sequence-specific DNA-binding activity. Here, we describe a simple method to reconstitute recombinant Myc:Max complexes from highly purified full-length proteins expressed in Escherichia coli that are soluble and highly active in E box-specific DNA-binding in vitro. The reconstituted Myc:Max complexes are stable and lack Max:Max homodimers. This procedure should facilitate the characterization of the DNA-binding and transcription activation functions of full-length Myc:Max complexes in vitro and in particular the role of Myc TAD-interacting cofactors and Myc:Max post-translational modifications. PMID:15003254

  13. Regulation of Sterol Biosynthesis in the Human Fungal Pathogen Aspergillus fumigatus: Opportunities for Therapeutic Development

    PubMed Central

    Dhingra, Sourabh; Cramer, Robert A.

    2017-01-01

    Sterols are a major component of eukaryotic cell membranes. For human fungal infections caused by the filamentous fungus Aspergillus fumigatus, antifungal drugs that target sterol biosynthesis and/or function remain the standard of care. Yet, an understanding of A. fumigatus sterol biosynthesis regulatory mechanisms remains an under developed therapeutic target. The critical role of sterol biosynthesis regulation and its interactions with clinically relevant azole drugs is highlighted by the basic helix loop helix (bHLH) class of transcription factors known as Sterol Regulatory Element Binding Proteins (SREBPs). SREBPs regulate transcription of key ergosterol biosynthesis genes in fungi including A. fumigatus. In addition, other emerging regulatory pathways and target genes involved in sterol biosynthesis and drug interactions provide additional opportunities including the unfolded protein response, iron responsive transcriptional networks, and chaperone proteins such as Hsp90. Thus, targeting molecular pathways critical for sterol biosynthesis regulation presents an opportunity to improve therapeutic options for the collection of diseases termed aspergillosis. This mini-review summarizes our current understanding of sterol biosynthesis regulation with a focus on mechanisms of transcriptional regulation by the SREBP family of transcription factors. PMID:28203225

  14. Robust specification of sensory neurons by dual functions of charlatan, a Drosophila NRSF/REST-like repressor of extramacrochaetae and hairy.

    PubMed

    Yamasaki, Yasutoyo; Lim, Young-Mi; Niwa, Nao; Hayashi, Shigeo; Tsuda, Leo

    2011-08-01

    Sensory bristle formation in Drosophila is a well-characterized system for studying sensory organ development at the molecular level. The master proneural genes of the achaete-scute (ac-sc) complex, which encode basic-helix-loop-helix (bHLH) transcription factors, are necessary and sufficient for sensory bristle formation. charlatan (chn) was originally identified as a transcriptional activator of ac-sc gene expression through interaction with its enhancer, an activity that promotes sensory bristle development. In contrast, Chn was also identified as a functional homologue of mammalian neuron-restrictive silencing factor or RE1 silencing transcription factor (NRSF/REST), an important transcriptional repressor during vertebrate neurogenesis and stem cell development that acts through epigenetic gene silencing. Here, we report that Chn acts as a repressor of extramacrochaetae (emc) and hairy, molecules that inhibit ac-sc expression. This double-negative mechanism, together with direct activation via the achaete enhancer, increases expression of achaete and ensures robust development of sensory neurons. A mutation in the C-terminal repressor motif of Chn, which causes Chn to lose its repression activity, converted Chn to an activator of emc and hairy, suggesting that Chn is a dual functional regulator of transcription. Because chn-like sequences are found among arthropods, regulation of neuronal development by Chn-like molecules may be widely conserved.

  15. Integrin αvβ1 Modulation Affects Subtype B Avian Metapneumovirus Fusion Protein-mediated Cell-Cell Fusion and Virus Infection.

    PubMed

    Yun, Bing-Ling; Guan, Xiao-Lu; Liu, Yong-Zhen; Zhang, Yao; Wang, Yong-Qiang; Qi, Xiao-Le; Cui, Hong-Yu; Liu, Chang-Jun; Zhang, Yan-Ping; Gao, Hong-Lei; Gao, Li; Li, Kai; Gao, Yu-Long; Wang, Xiao-Mei

    2016-07-08

    Avian metapneumovirus (aMPV) fusion (F) protein mediates virus-cell membrane fusion to initiate viral infection, which requires F protein binding to its receptor(s) on the host cell surface. However, the receptor(s) for aMPV F protein is still not identified. All known subtype B aMPV (aMPV/B) F proteins contain a conserved Arg-Asp-Asp (RDD) motif, suggesting that the aMPV/B F protein may mediate membrane fusion via the binding of RDD to integrin. When blocked with integrin-specific peptides, aMPV/B F protein fusogenicity and viral replication were significantly reduced. Specifically we identified integrin αv and/or β1-mediated F protein fusogenicity and viral replication using antibody blocking, small interfering RNAs (siRNAs) knockdown, and overexpression. Additionally, overexpression of integrin αv and β1 in aMPV/B non-permissive cells conferred aMPV/B F protein binding and aMPV/B infection. When RDD was altered to RAE (Arg-Ala-Glu), aMPV/B F protein binding and fusogenic activity were profoundly impaired. These results suggest that integrin αvβ1 is a functional receptor for aMPV/B F protein-mediated membrane fusion and virus infection, which will provide new insights on the fusogenic mechanism and pathogenesis of aMPV.

  16. Methamphetamine potentiates HIV-1 Tat protein-mediated activation of redox-sensitive pathways in discrete regions of the brain.

    PubMed

    Flora, Govinder; Lee, Yong Woo; Nath, Avindra; Hennig, Bernhard; Maragos, William; Toborek, Michal

    2003-01-01

    Tat is a major regulatory protein encoded by human immunodeficiency viral genome, which has been implicated in the pathogenesis of HIV infection, including neurologic complications associated with this disease. In addition, drug abuse has been identified as a major risk factor of HIV infection. We hypothesize that abusive drugs, such as methamphetamine (METH), can directly influence specific molecular processes that can further contribute to toxic effects of Tat. To elucidate the molecular signaling pathways of Tat- and/or METH-induced toxicity, we investigated the effects of a single injection of Tat (25 microg/microl into the right hippocampus) and/or METH (10 mg/kg, intraperitoneally) on the generation of cellular oxidative stress, DNA-binding activity of specific redox-responsive transcription factors, and expression of inflammatory genes. Administration of Tat or METH resulted in stimulation of cellular oxidative stress and activation of redox-regulated transcription factors in the cortical, striatal, and hippocampal regions of the mouse brain. In addition, DNA-binding activities of NF-kappaB, AP-1, and CREB in the frontal cortex and hippocampus were more pronounced in mice injected with Tat plus METH compared to the effects of Tat or METH alone. Intercellular adhesion molecule-1 gene expression also was upregulated in a synergistic manner in cortical, striatal, and hippocampal regions in mice which received injections of Tat combined with METH compared to the effects of these agents alone. Moreover, synergistic effects of Tat plus METH on the tumor necrosis factor-alpha and interleukin-1beta mRNA levels were observed in the striatal region. These results indicate that Tat and METH can cross-amplify their cellular effects, leading to alterations of redox-regulated inflammatory pathways in the brain. Such synergistic proinflammatory stimulation may have significant implications in HIV-infected patients who abuse drugs.

  17. Lamin A/C sustains PcG protein architecture, maintaining transcriptional repression at target genes.

    PubMed

    Cesarini, Elisa; Mozzetta, Chiara; Marullo, Fabrizia; Gregoretti, Francesco; Gargiulo, Annagiusi; Columbaro, Marta; Cortesi, Alice; Antonelli, Laura; Di Pelino, Simona; Squarzoni, Stefano; Palacios, Daniela; Zippo, Alessio; Bodega, Beatrice; Oliva, Gennaro; Lanzuolo, Chiara

    2015-11-09

    Beyond its role in providing structure to the nuclear envelope, lamin A/C is involved in transcriptional regulation. However, its cross talk with epigenetic factors--and how this cross talk influences physiological processes--is still unexplored. Key epigenetic regulators of development and differentiation are the Polycomb group (PcG) of proteins, organized in the nucleus as microscopically visible foci. Here, we show that lamin A/C is evolutionarily required for correct PcG protein nuclear compartmentalization. Confocal microscopy supported by new algorithms for image analysis reveals that lamin A/C knock-down leads to PcG protein foci disassembly and PcG protein dispersion. This causes detachment from chromatin and defects in PcG protein-mediated higher-order structures, thereby leading to impaired PcG protein repressive functions. Using myogenic differentiation as a model, we found that reduced levels of lamin A/C at the onset of differentiation led to an anticipation of the myogenic program because of an alteration of PcG protein-mediated transcriptional repression. Collectively, our results indicate that lamin A/C can modulate transcription through the regulation of PcG protein epigenetic factors.

  18. R-twist gene expression during rat palatogenesis.

    PubMed

    Bloch-Zupan, A; Hunter, N; Manthey, A; Gibbins, J

    2001-04-01

    Palatal clefting is often associated with premature fusion of cranial sutures in human craniosynostosis syndromes, many of which are characterised by mutations affecting the fibroblast growth factor receptor (FGFR) gene family. In palatal fusion, epithelio-mesenchymal transition (EMT) contributes to the dispersion of the midline epithelial seam. EMT has also been observed in neoplastic epithelial cells in relation to the acquisition of malignant characteristics where morphological changes are accompanied by rapid switching in the expression of fgfr2 from the epithelial type (kgfr) to the mesenchymal type (bek). The twist gene codes for a basic helix-loop-helix transcription factor putatively involved in regulation of transcription of fgfr2. Mutations in the TWIST gene have been described as being responsible for the Saethre-Chotzen syndrome, an autosomal dominant craniosynostosis associated with cleft palate as well as other disturbances of the facial skeleton. In this study we have analysed the distribution of twist transcripts during rat palatogenesis in vivo from 14.5 to 17.5 days post coitum by in situ hybridisation with digoxygenin-labelled ssDNA probes. twist transcripts were found to be concentrated in mesenchymal cells beneath the epithelium at the tip of the palatal shelves immediately prior to, and during fusion as well as in a localised epithelial area at the tip of the shelves prior to fusion, thereby implicating twist gene expression in the process of palatogenesis. This pattern of expression illuminates the disturbances of maxillary growth that occur in human craniosynostotic syndromes.

  19. Upstream stimulatory factor 2 and hypoxia-inducible factor 2α (HIF2α) cooperatively activate HIF2 target genes during hypoxia.

    PubMed

    Pawlus, Matthew R; Wang, Liyi; Ware, Katie; Hu, Cheng-Jun

    2012-11-01

    While the functions of hypoxia-inducible factor 1α (HIF1α)/aryl hydrocarbon receptor nuclear translocator (ARNT) and HIF2α/ARNT (HIF2) proteins in activating hypoxia-inducible genes are well established, the role of other transcription factors in the hypoxic transcriptional response is less clear. We report here for the first time that the basic helix-loop-helix-leucine-zip transcription factor upstream stimulatory factor 2 (USF2) is required for the hypoxic transcriptional response, specifically, for hypoxic activation of HIF2 target genes. We show that inhibiting USF2 activity greatly reduces hypoxic induction of HIF2 target genes in cell lines that have USF2 activity, while inducing USF2 activity in cells lacking USF2 activity restores hypoxic induction of HIF2 target genes. Mechanistically, USF2 activates HIF2 target genes by binding to HIF2 target gene promoters, interacting with HIF2α protein, and recruiting coactivators CBP and p300 to form enhanceosome complexes that contain HIF2α, USF2, CBP, p300, and RNA polymerase II on HIF2 target gene promoters. Functionally, the effect of USF2 knockdown on proliferation, motility, and clonogenic survival of HIF2-dependent tumor cells in vitro is phenocopied by HIF2α knockdown, indicating that USF2 works with HIF2 to activate HIF2 target genes and to drive HIF2-depedent tumorigenesis.

  20. PHYTOCHROME INTERACTING FACTOR3 Associates with the Histone Deacetylase HDA15 in Repression of Chlorophyll Biosynthesis and Photosynthesis in Etiolated Arabidopsis Seedlings[W][OA

    PubMed Central

    Liu, Xuncheng; Chen, Chia-Yang; Wang, Ko-Ching; Luo, Ming; Tai, Ready; Yuan, Lianyu; Zhao, Minglei; Yang, Songguang; Tian, Gang; Cui, Yuhai; Hsieh, Hsu-Liang; Wu, Keqiang

    2013-01-01

    PHYTOCHROME INTERACTING FACTOR3 (PIF3) is a key basic helix-loop-helix transcription factor of Arabidopsis thaliana that negatively regulates light responses, repressing chlorophyll biosynthesis, photosynthesis, and photomorphogenesis in the dark. However, the mechanism for the PIF3-mediated transcription regulation remains largely unknown. In this study, we found that the REDUCED POTASSIUM DEPENDENCY3/HISTONE DEACETYLASE1-type histone deacetylase HDA15 directly interacted with PIF3 in vivo and in vitro. Genome-wide transcriptome analysis revealed that HDA15 acts mainly as a transcriptional repressor and negatively regulates chlorophyll biosynthesis and photosynthesis gene expression in etiolated seedlings. HDA15 and PIF3 cotarget to the genes involved in chlorophyll biosynthesis and photosynthesis in the dark and repress gene expression by decreasing the acetylation levels and RNA Polymerase II–associated transcription. The binding of HDA15 to the target genes depends on the presence of PIF3. In addition, PIF3 and HDA15 are dissociated from the target genes upon exposure to red light. Taken together, our results indicate that PIF3 associates with HDA15 to repress chlorophyll biosynthetic and photosynthetic genes in etiolated seedlings. PMID:23548744

  1. Wnt9a deficiency discloses a repressive role of Tcf7l2 on endocrine differentiation in the embryonic pancreas

    PubMed Central

    Pujadas, G.; Cervantes, S.; Tutusaus, A.; Ejarque, M.; Sanchez, L.; García, A.; Esteban, Y.; Fargas, L.; Alsina, B.; Hartmann, C.; Gomis, R.; Gasa, R.

    2016-01-01

    Transcriptional and signaling networks establish complex cross-regulatory interactions that drive cellular differentiation during development. Using microarrays we identified the gene encoding the ligand Wnt9a as a candidate target of Neurogenin3, a basic helix-loop-helix transcription factor that functions as a master regulator of pancreatic endocrine differentiation. Here we show that Wnt9a is expressed in the embryonic pancreas and that its deficiency enhances activation of the endocrine transcriptional program and increases the number of endocrine cells at birth. We identify the gene encoding the endocrine transcription factor Nkx2-2 as one of the most upregulated genes in Wnt9a-ablated pancreases and associate its activation to reduced expression of the Wnt effector Tcf7l2. Accordingly, in vitro studies confirm that Tcf7l2 represses activation of Nkx2-2 by Neurogenin3 and inhibits Nkx2-2 expression in differentiated β-cells. Further, we report that Tcf7l2 protein levels decline upon initiation of endocrine differentiation in vivo, disclosing the downregulation of this factor in the developing endocrine compartment. These findings highlight the notion that modulation of signalling cues by lineage-promoting factors is pivotal for controlling differentiation programs. PMID:26771085

  2. Comparative analysis of the human and mouse Hey1 promoter: Hey genes are new Notch target genes.

    PubMed

    Maier, M M; Gessler, M

    2000-08-28

    Hey genes (Hey1, Hey2 and HeyL) encode a new group of basic helix-loop-helix transcription factors that are related to the hairy/Enhancer of split genes. In the present study, we cloned and characterized the promoter region of the human and mouse Hey1 gene. The transcription initiation site was located 138 nucleotides upstream of the start codon. There is a minimal sequence element (nt -30 to -247) that is essential and important for basal transcription in three different cell types. Further upstream, a highly conserved sequence block (nt -324 to -646; approximately 90% human/mouse similarity) could be identified that contains several putative binding sites for transcription factors and likely represents an important regulatory region for this gene. Cotransfection experiments demonstrated that the mHey1 promoter activity is up-regulated by the activated form of all four mammalian Notch receptors via two functional RBP-Jkappa binding sites. The other members of the Hey gene family, Hey2 and HeyL, also possess RBP-Jkappa binding sites and they are similarly responsive to Notch signaling. Thus, our data clearly demonstrate that Hey genes form a new class of Notch signal transducers that should prove to be relevant in various developmental processes. Copyright 2000 Academic Press.

  3. RPD1 (SIN3/UME4) is required for maximal activation and repression of diverse yeast genes

    SciTech Connect

    Vidal, M.; Gaber, R.F. ); Strich, R.; Esposito, R.E. )

    1991-12-01

    The authors show that the extent of transcriptional regulation of many, apparently unrelated, genes in Saccharomyces cerevisiae is dependent on RPD1 (and RPD3). Genes regulated by stimuli as diverse as external signals (PH05), cell differentiation processes (SPO11 and SPO13), cell type (RME1, FUS1, H0, TY2, STE6, STE3, and BAR1), and genes whose regulatory signals remain unknown (TRK2) depend on RPD1 to achieve maximal states of transcriptional regulation. RPD1 enhances both positive and negative regulation of these genes: in rpdl{Delta} mutants, higher levels of expression are observed under repression conditions and lower levels are observed under activation conditions. They show that several independent genetic screens, designed to identify yeast transcriptional regulator, have detected the RPD1 locus (also known as SIN3, SD11, and UME4). The inferred RPD1 protein contains four regions predicted to take on helix-loop-helix-like secondary structures and three regions (acidic, glutamine rich, and proline rich) reminiscent of the activating domains of transcriptional activators.

  4. Molecular characterization of SIG1, a Saccharomyces cerevisiae gene involved in negative regulation of G-protein-mediated signal transduction.

    PubMed Central

    Leberer, E; Dignard, D; Harcus, D; Whiteway, M; Thomas, D Y

    1994-01-01

    Two recessive mutations in the Saccharomyces cerevisiae SIG1 (suppressor of inhibitory G-protein) gene have been identified by their ability to suppress the signalling defect of dominant-negative variants of the mating response G-protein beta-subunit. The mutations and deletion of SIG1 enhance the sensitivity of the cells to pheromone and stimulate the basal transcription of a mating specific gene, FUS1, suggesting that Sig1p plays a negatively regulatory role in G beta gamma-mediated signal transduction. An additional function of Sig1p in vegetatively growing cells is suggested by the finding that the mutations and deletion of SIG1 cause temperature-sensitive growth defects. The SIG1 gene encodes a protein with a molecular weight of 65 kDa that contains at the amino-terminus two zinc finger-like sequence motifs. Epistasis experiments localize the action of Sig1p within the pheromone signalling pathway at a position at or shortly after the G-protein. We propose that Sig1p represents a novel negative regulator of G beta gamma-mediated signal transduction. Images PMID:8039500

  5. Novel stand-alone RAM domain protein-mediated catalytic control of anthranilate phosphoribosyltransferase in tryptophan biosynthesis in Thermus thermophilus.

    PubMed

    Kubota, Tetsuo; Matsushita, Hajime; Tomita, Takeo; Kosono, Saori; Yoshida, Minoru; Kuzuyama, Tomohisa; Nishiyama, Makoto

    2017-01-01

    Regulation of amino acid metabolism (RAM) domains are widely distributed among prokaryotes. In most cases, a RAM domain fuses with a DNA-binding domain to act as a transcriptional regulator. The extremely thermophilic bacterium, Thermus thermophilus, only carries a single gene encoding a RAM domain-containing protein on its genome. This protein is a stand-alone RAM domain protein (SraA) lacking a DNA-binding domain. Therefore, we hypothesized that SraA, which senses amino acids through its RAM domain, may interact with other proteins to modify its functions. In the present study, we identified anthranilate phosphoribosyltransferase (AnPRT), the second enzyme in the tryptophan biosynthetic pathway, as a partner protein that interacted with SraA in T. thermophilus. In the presence of tryptophan, SraA was assembled to a decamer and exhibited the ability to form a stable hetero-complex with AnPRT. An enzyme assay revealed that AnPRT was only inhibited by tryptophan in the presence of SraA. This result suggests a novel feedback control mechanism for tryptophan biosynthesis through an inter-RAM domain interaction in bacteria.

  6. Chromatin potentiates transcription

    PubMed Central

    Nagai, Shigeki; Davis, Ralph E.; Mattei, Pierre Jean; Eagen, Kyle Patrick; Kornberg, Roger D.

    2017-01-01

    Chromatin isolated from the chromosomal locus of the PHO5 gene of yeast in a transcriptionally repressed state was transcribed with 12 pure proteins (80 polypeptides): RNA polymerase II, six general transcription factors, TFIIS, the Pho4 gene activator protein, and the SAGA, SWI/SNF, and Mediator complexes. Contrary to expectation, a nucleosome occluding the TATA box and transcription start sites did not impede transcription but rather, enhanced it: the level of chromatin transcription was at least sevenfold greater than that of naked DNA, and chromatin gave patterns of transcription start sites closely similar to those occurring in vivo, whereas naked DNA gave many aberrant transcripts. Both histone acetylation and trimethylation of H3K4 (H3K4me3) were important for chromatin transcription. The nucleosome, long known to serve as a general gene repressor, thus also performs an important positive role in transcription. PMID:28137832

  7. Transcriptional enhancers: Transcription, function and flexibility.

    PubMed

    Melamed, Philippa; Yosefzon, Yahav; Rudnizky, Sergei; Pnueli, Lilach

    2016-01-01

    Active transcriptional enhancers are often transcribed to eRNAs, whose changing levels mirror those of the target gene mRNA. We discuss some of the reported functions of these eRNAs and their likely diversity to allow utilization of distinct cis regulatory regions to enhance transcription in diverse developmental and cellular contexts.

  8. NRPB3, the third largest subunit of RNA polymerase II, is essential for stomatal patterning and differentiation in Arabidopsis.

    PubMed

    Chen, Liang; Guan, Liping; Qian, Pingping; Xu, Fan; Wu, Zhongliang; Wu, Yujun; He, Kai; Gou, Xiaoping; Li, Jia; Hou, Suiwen

    2016-05-01

    Stomata are highly specialized epidermal structures that control transpiration and gas exchange between plants and the environment. Signal networks underlying stomatal development have been previously uncovered but much less is known about how signals involved in stomatal development are transmitted to RNA polymerase II (Pol II or RPB), which plays a central role in the transcription of mRNA coding genes. Here, we identify a partial loss-of-function mutation of the third largest subunit of nuclear DNA-dependent Pol II (NRPB3) that exhibits an increased number of stomatal lineage cells and paired stomata. Phenotypic and genetic analyses indicated that NRPB3 is not only required for correct stomatal patterning, but is also essential for stomatal differentiation. Protein-protein interaction assays showed that NRPB3 directly interacts with two basic helix-loop-helix (bHLH) transcription factors, FAMA and INDUCER OF CBF EXPRESSION1 (ICE1), indicating that NRPB3 serves as an acceptor for signals from transcription factors involved in stomatal development. Our findings highlight the surprisingly conserved activating mechanisms mediated by the third largest subunit of Pol II in eukaryotes. © 2016. Published by The Company of Biologists Ltd.

  9. Activation of hypoxia-inducible factor-1; definition of regulatory domains within the alpha subunit.

    PubMed

    Pugh, C W; O'Rourke, J F; Nagao, M; Gleadle, J M; Ratcliffe, P J

    1997-04-25

    Hypoxia-inducible factor-1 (HIF-1), a heterodimeric DNA binding complex composed of two basic-helix-loop-helix Per-AHR-ARNT-Sim proteins (HIF-1alpha and -1beta), is a key component of a widely operative transcriptional response activated by hypoxia, cobaltous ions, and iron chelation. To identify regions of HIF-1 subunits responsible for oxygen-regulated activity, we constructed chimeric genes in which portions of coding sequence from HIF-1 genes were either linked to a heterologous DNA binding domain or encoded between such a DNA binding domain and a constitutive activation domain. Sequences from HIF-1alpha but not HIF-1beta conferred oxygen-regulated activity. Two minimal domains within HIF-1alpha (amino acids 549-582 and amino acids 775-826) were defined by deletional analysis, each of which could act independently to convey inducible responses. Both these regions confer transcriptional activation, and in both cases adjacent sequences appeared functionally repressive in transactivation assays. The inducible operation of the first domain, but not the second, involved major changes in the level of the activator fusion protein in transfected cells, inclusion of this sequence being associated with a marked reduction of expressed protein level in normoxic cells, which was relieved by stimulation with hypoxia, cobaltous ions, or iron chelation. These results lead us to propose a dual mechanism of activation in which the operation of an inducible activation domain is amplified by regulation of transcription factor abundance, most likely occurring through changes in protein stability.

  10. The semidominant Mi(b) mutation identifies a role for the HLH domain in DNA binding in addition to its role in protein dimerization.

    PubMed Central

    Steingrímsson, E; Nii, A; Fisher, D E; Ferré-D'Amaré, A R; McCormick, R J; Russell, L B; Burley, S K; Ward, J M; Jenkins, N A; Copeland, N G

    1996-01-01

    The mouse microphthalmia (mi) locus encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor called MITF (microphthalmia transcription factor). Mutations at mi affect the development of several different cell types, including melanocytes, mast cells, osteoclasts and pigmented epithelial cells of the eye. Here we describe the phenotypic and molecular characterization of the semidominant Microphthalmia(brwnish) (Mi(b)) mutation. We show that this mutation primarily affects melanocytes and produces retinal degeneration. The mutation is a G to A transition leading to a Gly244Glu substitution in helix 2 of the HLH dimerization domain. This location is surprising since other semidominant mi mutations characterized to date have been shown to affect DNA binding or transcriptional activation domains of MITF and act as dominant negatives, while mutations that affect MITF dimerization are inherited recessively. Gel retardation assays showed that while the mutant MITF(Mi-b) protein retains its dimerization potential, it is defective in its ability to bind DNA. Computer modeling suggested that the Gly244Glu mutation might disrupt DNA binding by interfering with productive docking of the protein dimer onto DNA. The Mi(b) mutation therefore appears to dissociate a DNA recognition function of the HLH domain from its role in protein dimerization. Images PMID:8947051

  11. Pbx acts with Hand2 in early myocardial differentiation.

    PubMed

    Maves, Lisa; Tyler, Ashlee; Moens, Cecilia B; Tapscott, Stephen J

    2009-09-15

    Transcription factors of the basic helix-loop-helix (bHLH) family are critical regulators of muscle cell differentiation. For example, Myod drives skeletal muscle differentiation, and Hand2 potentiates cardiac muscle differentiation. Understanding how these bHLH factors regulate distinct transcriptional targets in a temporally and spatially controlled manner is critical for understanding their activity in cellular differentiation. We previously showed that Pbx homeodomain proteins modulate the activity of Myod to promote the differentiation of fast-twitch skeletal muscle. Here, we test the hypothesis that Pbx proteins are also necessary for cardiac muscle differentiation through interacting with Hand2. We show that Pbx proteins are required for the activation of cardiac muscle differentiation in zebrafish embryos. Loss of Pbx activity leads to delay of myocardial differentiation and subsequent defective cardiac morphogenesis, similar to reduced Hand2 activity. Genetic interaction experiments support the hypothesis that Pbx proteins modulate the activity of Hand2 in myocardial differentiation. Furthermore, we show that Pbx proteins directly bind the promoter of the myocardial differentiation gene myl7 in vitro, supporting a direct role for Pbx proteins in promoting cardiac muscle differentiation. Our findings demonstrate new roles for Pbx proteins in vertebrate cardiac development and also provide new insight into connections between the transcriptional regulation of skeletal and cardiac muscle differentiation programs.

  12. Pbx acts with Hand2 in early myocardial differentiation

    PubMed Central

    Maves, Lisa; Tyler, Ashlee; Moens, Cecilia B.; Tapscott, Stephen J.

    2009-01-01

    Transcription factors of the basic helix-loop-helix (bHLH) family are critical regulators of muscle cell differentiation. For example, Myod drives skeletal muscle differentiation, and Hand2 potentiates cardiac muscle differentiation. Understanding how these bHLH factors regulate distinct transcriptional targets in a temporally and spatially controlled manner is critical for understanding their activity in cellular differentiation. We previously showed that Pbx homeodomain proteins modulate the activity of Myod to promote the differentiation of fast-twitch skeletal muscle. Here, we test the hypothesis that Pbx proteins are also necessary for cardiac muscle differentiation through interacting with Hand2. We show that Pbx proteins are required for the activation of cardiac muscle differentiation in zebrafish embryos. Loss of Pbx activity leads to delay of myocardial differentiation and subsequent defective cardiac morphogenesis, similar to reduced Hand2 activity. Genetic interaction experiments support the hypothesis that Pbx proteins modulate the activity of Hand2 in myocardial differentiation. Furthermore, we show that Pbx proteins directly bind the promoter of the myocardial differentiation gene myl7 in vitro, supporting a direct role for Pbx proteins in promoting cardiac muscle differentiation. Our findings demonstrate new roles for Pbx proteins in vertebrate cardiac development and also provide new insight into connections between the transcriptional regulation of skeletal and cardiac muscle differentiation programs. PMID:19607825

  13. Expression of the mad gene during cell differentiation in vivo and its inhibition of cell growth in vitro

    PubMed Central

    1995-01-01

    Mad is a basic region helix-loop-helix leucine zipper transcription factor which can dimerize with the Max protein and antagonize transcriptional activation by the Myc-Max transcription factor heterodimer. While the expression of Myc is necessary for cell proliferation, the expression of Mad is induced upon differentiation of at least some leukemia cell lines. Here, the expression of the mad gene has been explored in developing mouse tissues. During organogenesis in mouse embryos mad mRNA was predominantly expressed in the liver and in the mantle layer of the developing brain. At later stages mad expression was detected in neuroretina, epidermis, and whisker follicles, and in adult mice mad was expressed at variable levels in most organs analyzed. Interestingly, in the skin mad was highly expressed in the differentiating epidermal keratinocytes, but not in the underlying proliferating basal keratinocyte layer. Also, in the gut mad mRNA was abundant in the intestinal villi, where cells cease proliferation and differentiate, but not in the crypts, where the intestinal epithelial cells proliferate. In the testis, mad expression was associated with the completion of meiosis and early development of haploid cells. In cell culture, Mad inhibited colony formation of a mouse keratinocyte cell line and rat embryo fibroblast transformation by Myc and Ras. The pattern of mad expression in tissues and its ability to inhibit cell growth in vitro suggests that Mad can cause the cessation of cell proliferation associated with cell differentiation in vivo. PMID:7896882

  14. Formation of a repressive complex in the mammalian circadian clock is mediated by the secondary pocket of CRY1

    DOE PAGES

    Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany; ...

    2017-01-31

    The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

  15. Repression by PRDM13 is critical for generating precision in neuronal identity

    PubMed Central

    Kollipara, Rahul K; Ma, Zhenzhong; Borromeo, Mark D; Chang, Joshua C

    2017-01-01

    The mechanisms that activate some genes while silencing others are critical to ensure precision in lineage specification as multipotent progenitors become restricted in cell fate. During neurodevelopment, these mechanisms are required to generate the diversity of neuronal subtypes found in the nervous system. Here we report interactions between basic helix-loop-helix (bHLH) transcriptional activators and the transcriptional repressor PRDM13 that are critical for specifying dorsal spinal cord neurons. PRDM13 inhibits gene expression programs for excitatory neuronal lineages in the dorsal neural tube. Strikingly, PRDM13 also ensures a battery of ventral neural tube specification genes such as Olig1, Olig2 and Prdm12 are excluded dorsally. PRDM13 does this via recruitment to chromatin by multiple neural bHLH factors to restrict gene expression in specific neuronal lineages. Together these findings highlight the function of PRDM13 in repressing the activity of bHLH transcriptional activators that together are required to achieve precise neuronal specification during mouse development. PMID:28850031

  16. Regulation of the Drosophila Hypoxia-Inducible Factor α Sima by CRM1-Dependent Nuclear Export ▿

    PubMed Central

    Romero, Nuria M.; Irisarri, Maximiliano; Roth, Peggy; Cauerhff, Ana; Samakovlis, Christos; Wappner, Pablo

    2008-01-01

    Hypoxia-inducible factor α (HIF-α) proteins are regulated by oxygen levels through several different mechanisms that include protein stability, transcriptional coactivator recruitment, and subcellular localization. It was previously reported that these transcription factors are mainly nuclear in hypoxia and cytoplasmic in normoxia, but so far the molecular basis of this regulation is unclear. We show here that the Drosophila melanogaster HIF-α protein Sima shuttles continuously between the nucleus and the cytoplasm. We identified the relevant nuclear localization signal and two functional nuclear export signals (NESs). These NESs are in the Sima basic helix-loop-helix (bHLH) domain and promote CRM1-dependent nuclear export. Site-directed mutagenesis of either NES provoked Sima nuclear retention and increased transcriptional activity, suggesting that nuclear export contributes to Sima regulation. The identified NESs are conserved and probably functional in the bHLH domains of several bHLH-PAS proteins. We propose that rapid nuclear export of Sima regulates the duration of cellular responses to hypoxia. PMID:18332128

  17. Regulation of the Drosophila hypoxia-inducible factor alpha Sima by CRM1-dependent nuclear export.

    PubMed

    Romero, Nuria M; Irisarri, Maximiliano; Roth, Peggy; Cauerhff, Ana; Samakovlis, Christos; Wappner, Pablo

    2008-05-01

    Hypoxia-inducible factor alpha (HIF-alpha) proteins are regulated by oxygen levels through several different mechanisms that include protein stability, transcriptional coactivator recruitment, and subcellular localization. It was previously reported that these transcription factors are mainly nuclear in hypoxia and cytoplasmic in normoxia, but so far the molecular basis of this regulation is unclear. We show here that the Drosophila melanogaster HIF-alpha protein Sima shuttles continuously between the nucleus and the cytoplasm. We identified the relevant nuclear localization signal and two functional nuclear export signals (NESs). These NESs are in the Sima basic helix-loop-helix (bHLH) domain and promote CRM1-dependent nuclear export. Site-directed mutagenesis of either NES provoked Sima nuclear retention and increased transcriptional activity, suggesting that nuclear export contributes to Sima regulation. The identified NESs are conserved and probably functional in the bHLH domains of several bHLH-PAS proteins. We propose that rapid nuclear export of Sima regulates the duration of cellular responses to hypoxia.

  18. Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster.

    PubMed

    Tognon, Emiliana; Kobia, Francis; Busi, Ilaria; Fumagalli, Arianna; De Masi, Federico; Vaccari, Thomas

    2016-01-01

    In vertebrates, TFEB (transcription factor EB) and MITF (microphthalmia-associated transcription factor) family of basic Helix-Loop-Helix (bHLH) transcription factors regulates both lysosomal function and organ development. However, it is not clear whether these 2 processes are interconnected. Here, we show that Mitf, the single TFEB and MITF ortholog in Drosophila, controls expression of vacuolar-type H(+)-ATPase pump (V-ATPase) subunits. Remarkably, we also find that expression of Vha16-1 and Vha13, encoding 2 key components of V-ATPase, is patterned in the wing imaginal disc. In particular, Vha16-1 expression follows differentiation of proneural regions of the disc. These regions, which will form sensory organs in the adult, appear to possess a distinctive endolysosomal compartment and Notch (N) localization. Modulation of Mitf activity in the disc in vivo alters endolysosomal function and disrupts proneural patterning. Similar to our findings in Drosophila, in human breast epithelial cells we observe that impairment of the Vha16-1 human ortholog ATP6V0C changes the size and function of the endolysosomal compartment and that depletion of TFEB reduces ligand-independent N signaling activity. Our data suggest that lysosomal-associated functions regulated by the TFEB-V-ATPase axis might play a conserved role in shaping cell fate.

  19. β-Catenin Up-regulates Atoh1 Expression in Neural Progenitor Cells by Interaction with an Atoh1 3′ Enhancer*

    PubMed Central

    Shi, Fuxin; Cheng, Yen-fu; Wang, Xiaohui L.; Edge, Albert S. B.

    2010-01-01

    Atoh1, a basic helix-loop-helix transcription factor, plays a critical role in the differentiation of several epithelial and neural cell types. We found that β-catenin, the key mediator of the canonical Wnt pathway, increased expression of Atoh1 in mouse neuroblastoma cells and neural progenitor cells, and baseline Atoh1 expression was decreased by siRNA directed at β-catenin. The up-regulation of Atoh1 was caused by an interaction of β-catenin with the Atoh1 enhancer that could be demonstrated by chromatin immunoprecipitation. We found that two putative Tcf-Lef sites in the 3′ enhancer of the Atoh1 gene displayed an affinity for β-catenin and were critical for the activation of Atoh1 transcription because mutation of either site decreased expression of a reporter gene downstream of the enhancer. Tcf-Lef co-activators were found in the complex that bound to these sites in the DNA together with β-catenin. I