Sample records for hepatitis rna transcripts

  1. Isolation of hepatitis C virus RNA from serum for reverse transcription-PCR.

    PubMed Central

    Nolte, F S; Thurmond, C; Mitchell, P S


    Standard multistep extraction and isolation of RNA for hepatitis C virus (HCV) reverse transcription (RT)-PCR are impractical for routine use in clinical laboratories. We compared three simple commercially available methods for RNA isolation (RNAzol B, TRISOLV, and ULTRASPEC; Biotecx Laboratories, Houston, Tex.) and a total nucleic acid isolation method (IsoQuick; MicroProbe Corp., Garden Grove, Calif.) for the recovery of HCV RNA from sera obtained from 12 viremic patients for RT-PCR. RNAzol B, TRISOLV, ULTRASPEC, and IsoQuick extraction methods detected 87.5, 79.2, 33.3, and 58.3% of the paired positive samples, respectively. The method used for isolation of RNA is an important concern when optimizing HCV RT-PCR. Images PMID:8150964

  2. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay.

    PubMed Central

    Young, K K; Resnick, R M; Myers, T W


    Amplification of RNA by the polymerase chain reaction (PCR) is normally a two-step process requiring separate enzymes and buffer conditions. We describe a combined reverse transcription-PCR (RT-PCR) assay for hepatitis C virus (HCV) RNA amplification in which a single enzyme and buffer condition are used. In this assay, both the RT and PCR steps are carried out with the thermoactive DNA polymerase of Thermus thermophilus. A transcription vector containing HCV sequences has also been constructed to generate quantifiable HCV RNA templates that can be used to optimize reaction conditions and to assess the efficiency of amplification. Amplification from < or = 100 copies of RNA was detected reproducibly by gel electrophoresis. The assay sensitivity was increased to 10 RNA copies by hybridization to a probe. The patterns of viremia in three individuals infected with HCV were examined by amplification of HCV RNA from plasma samples collected serially over a period of 1 year. These results were correlated with the times of seroconversion and the onset of rise in levels of alanine aminotransferase in serum. In all three subjects, HCV RNA was detected prior to seroconversion and the initial rise in levels of alanine aminotransferase in serum. Upon seroconversion, HCV RNA fell to a level below the detection limit of the assay. This pattern of transient viremia appears to be characteristic of acute, resolving HCV infections. The combined RT-PCR assay is a sensitive method which circumvents the problems associated with PCR amplification of RNA. Using this assay, we demonstrated that three donors infected by the same index case all have similar patterns of viremia. Images PMID:8385151

  3. Rapid detection of hepatitis C virus RNA by a reverse transcription loop-mediated isothermal amplification assay.


    Wang, Qin-qin; Zhang, Jie; Hu, Jin-song; Chen, Hao-tai; Du, Li; Wu, Li-qin; Ding, Yao-zhong; Xiong, Sheng-he; Huang, Xin-cheng; Zhang, Yin-hong; Liu, Yong-sheng


    The usefulness of reverse transcription loop-mediated isothermal amplification (RT-LAMP) for the rapid diagnosis of hepatitis C virus (HCV) RNA was evaluated. This assay showed higher sensitivities than that of nested RT-PCR, with a detection limit of 600 IU mL(-1) , and no cross-reactivity was observed with hepatitis A virus, hepatitis B virus and hepatitis E virus. Furthermore, 106 stored sera from recently diagnosed cases were retrospectively investigated with real-time RT-PCR, the nested RT-PCR, in parallel with this new assay. The general detection rates of HCV RT-LAMP, real-time PCR and the nested RT-PCR for 106 stored sera samples were 95%, 96% and 88%, respectively. This study provides the first data on the usefulness of HCV RT-LAMP in the diagnosis of HCV RNA, especially in the early clinical diagnosis of acute HCV infection.

  4. Doubly Spliced RNA of Hepatitis B Virus Suppresses Viral Transcription via TATA-Binding Protein and Induces Stress Granule Assembly

    PubMed Central

    Tsai, Kuen-Nan; Chong, Chin-Liew; Chou, Yu-Chi; Huang, Chien-Chiao; Wang, Yi-Ling; Wang, Shao-Win; Chen, Mong-Liang


    ABSTRACT The risk of liver cancer in patients infected with the hepatitis B virus (HBV) and their clinical response to interferon alpha therapy vary based on the HBV genotype. The mechanisms underlying these differences in HBV pathogenesis remain unclear. In HepG2 cells transfected with a mutant HBVG2335A expression plasmid that does not transcribe the 2.2-kb doubly spliced RNA (2.2DS-RNA) expressed by wild-type HBV genotype A, the level of HBV pregenomic RNA (pgRNA) was higher than that in cells transfected with an HBV genotype A expression plasmid. By using cotransfection with HBV genotype D and 2.2DS-RNA expression plasmids, we found that a reduction of pgRNA was observed in the cells even in the presence of small amounts of the 2.2DS-RNA plasmid. Moreover, ectopic expression of 2.2DS-RNA in the HBV-producing cell line 1.3ES2 reduced the expression of pgRNA. Further analysis showed that exogenously transcribed 2.2DS-RNA inhibited a reconstituted transcription in vitro. In Huh7 cells ectopically expressing 2.2DS-RNA, RNA immunoprecipitation revealed that 2.2DS-RNA interacted with the TATA-binding protein (TBP) and that nucleotides 432 to 832 of 2.2DS-RNA were required for efficient TBP binding. Immunofluorescence experiments showed that 2.2DS-RNA colocalized with cytoplasmic TBP and the stress granule components, G3BP and poly(A)-binding protein 1 (PABP1), in Huh7 cells. In conclusion, our study reveals that 2.2DS-RNA acts as a repressor of HBV transcription through an interaction with TBP that induces stress granule formation. The expression of 2.2DS-RNA may be one of the viral factors involved in viral replication, which may underlie differences in clinical outcomes of liver disease and responses to interferon alpha therapy between patients infected with different HBV genotypes. IMPORTANCE Patients infected with certain genotypes of HBV have a lower risk of hepatocellular carcinoma and exhibit a more favorable response to antiviral therapy than patients

  5. RNA transcripts of full-length cDNA clones of rabbit hepatitis E virus are infectious in rabbits.


    Cossaboom, Caitlin M; Huang, Yao-Wei; Yugo, Danielle M; Kenney, Scott P; Piñeyro, Pablo; Matzinger, Shannon R; Heffron, C Lynn; Pierson, F William; Meng, Xiang-Jin


    Hepatitis E virus (HEV), the causative agent of hepatitis E, is a single-stranded positive-sense RNA virus belonging to the family Hepeviridae. At least four genotypes of the family infect humans: genotypes 1 and 2 are transmitted to humans through contaminated water, while genotypes 3 and 4 are zoonotic and have animal reservoirs. A novel strain of HEV recently identified in rabbits is a distant member of genotype 3, and thus poses a potential risk of zoonotic transmission to humans. The objective of this study was to construct and characterize an infectious cDNA clone of the rabbit HEV. Two full-length cDNA clones of rabbit HEV, pT7g-rabHEV and pT7-rabHEV, were constructed and their infectivity was tested by in vitro transfection of Huh7 human liver cells and by direct intrahepatic inoculation of rabbits with capped RNA transcripts. Results showed that positive signal for rabbit HEV protein was detected by an immunofluorescence assay with a HEV-specific antibody in Huh7 human liver cells transfected with capped RNA transcripts from the two full-length cDNA clones. Rabbits intrahepatically inoculated with capped RNA transcripts from each of the two clones developed active HEV infection as evidenced by seroconversion to anti-HEV antibodies, and detection of rabbit HEV RNA in sera and feces of inoculated animals. The availability of a rabbit HEV infectious cDNA clone now affords us the ability to delineate the mechanism of HEV replication and cross-species infection in a small animal model.

  6. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.


    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P


    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  7. Regulation of the microRNA processor DGCR8 by hepatitis B virus proteins via the transcription factor YY1.


    Shan, Xuefeng; Ren, Min; Chen, Ke; Huang, Ailong; Tang, Hua


    MicroRNAs (miRNAs) are a new class of well-conserved small noncoding RNAs that mediate posttranscriptional gene regulation. Hepatitis B virus (HBV) causes various liver diseases, including chronic hepatitis, liver cirrhosis and hepatocellular cancer. Recent data have indicated HBV alters miRNAs expression patterns, but the underlying mechanisms have not been fully established so far. Here, we provide a hypothesis that HBV alters the expressions of miRNAs by playing a role in the microRNA production process. In this study, we demonstrate that HBV downregulates miRNAs processor DGCR8 mRNA and protein expression in stable and transient HBV-expressing cells. HBV downregulates DGCR8 expression by inhibiting its promoter activity, and HBs and HBx may be involved in this process. Ectopic expression and knockdown of YY1 revealed that YY1 suppresses the activity of the DGCR8 promoter, while YY1 expression is significantly upregulated by HBV. In conclusion, our data show that HBV proteins repress DGCR8 promoter activity by upregulating the expression of transcription factor YY1. This provides a new insight into the mechanism of HBV-induced miRNA dysregulation.

  8. PRMT5 Restricts Hepatitis B Virus Replication via Epigenetic Repression of cccDNA Transcription and Interference with pgRNA Encapsidation.


    Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong


    Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscured. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In the cell culture-based models for HBV infection and the liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 (H4R3me2s) on cccDNAwas a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered H4R3me2s on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based hSWI/SNF chromatin remodeler, which resulted in the downregulation of the binding of RNA Pol II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independent of its methyltransferase activity. Further study revealed that PRMT5 interfered with pre-genomic RNA (pgRNA) encapsidation by preventing its interaction with viral polymerase protein through binding to the RT-RH region of polymerase which is crucial for the polymerase-pgRNA interaction.

  9. Hepatitis B virus X protein induces RNA polymerase III-dependent gene transcription and increases cellular TATA-binding protein by activating the Ras signaling pathway.


    Wang, H D; Trivedi, A; Johnson, D L


    Our previous studies have shown that the hepatitis B virus protein, X, activates all three classes of RNA polymerase III (pol III)-dependent promoters by increasing the cellular level of TATA-binding protein (TBP) (H.-D. Wang et al., Mol. Cell. Biol. 15:6720-6728, 1995), a limiting transcription component (A. Trivedi et al., Mol. Cell. Biol. 16:6909-6916, 1996). We have investigated whether these X-mediated events are dependent on the activation of the Ras/Raf-1 signaling pathway. Transient expression of a dominant-negative mutant Ras gene (Ras-ala15) in a Drosophila S-2 stable cell line expressing X (X-S2), or incubation of the cells with a Ras farnesylation inhibitor, specifically blocked both the X-dependent activation of a cotransfected tRNA gene and the increase in cellular TBP levels. Transient expression of a constitutively activated form of Ras (Ras-val12) in control S2 cells produced both an increase in tRNA gene transcription and an increase in cellular TBP levels. These events are not cell type specific since X-mediated gene induction was also shown to be dependent on Ras activation in a stable rat 1A cell line expressing X. Furthermore, increases in RNA pol III-dependent gene activity and TBP levels could be restored in X-S2 cells expressing Ras-ala15 by coexpressing a constitutively activated form of Raf-1. These events are serum dependent, and when the cells are serum deprived, the X-mediated effects are augmented. Together, these results demonstrate that the X-mediated induction of RNA pol III-dependent genes and increase in TBP are both dependent on the activation of the Ras/Raf-1 signaling cascade. In addition, these studies define two new and important consequences mediated by the activation of the Ras signal transduction pathway: an increase in the central transcription factor, TBP, and the induction of RNA pol III-dependent gene activity.

  10. Novel mechanism for reverse transcription in hepatitis B viruses.

    PubMed Central

    Wang, G H; Seeger, C


    Reverse transcription of all retroviruses and most retroid elements requires tRNA as a primer for DNA synthesis. However, in hepatitis B viruses the viral polymerase itself acts as a primer for reverse transcription (G.-H. Wang and C. Seeger, Cell 71:663-670, 1992). We have now demonstrated that in order to prime DNA synthesis, the polymerase binds to an RNA hairpin, which then serves as a template for the formation of a short DNA primer that is covalently linked to protein. Following its synthesis, the nascent DNA strand apparently dissociates from its template and reanneals with complementary sequences at the 3' end of the RNA genome, where DNA synthesis continues. Since this RNA hairpin also functions as a packaging signal for viral RNA, hepadnaviruses have adopted a replication strategy that relies on the same signal for two biochemically distinct events, RNA packaging and reverse transcription. This mechanism is without precedent among all known retroid elements and among other viruses and bacteriophages that use protein as a primer for RNA or DNA synthesis. It could provide an effective target for antiviral therapy, which is required for the treatment of more than 300 million carriers of hepatitis B virus. Images PMID:7692081

  11. RNA polymerase II transcription: structure and mechanism.


    Liu, Xin; Bushnell, David A; Kornberg, Roger D


    A minimal RNA polymerase II (pol II) transcription system comprises the polymerase and five general transcription factors (GTFs) TFIIB, -D, -E, -F, and -H. The addition of Mediator enables a response to regulatory factors. The GTFs are required for promoter recognition and the initiation of transcription. Following initiation, pol II alone is capable of RNA transcript elongation and of proofreading. Structural studies reviewed here reveal roles of GTFs in the initiation process and shed light on the transcription elongation mechanism. This article is part of a Special Issue entitled: RNA Polymerase II Transcript Elongation.

  12. Transcriptional Profiling and miRNA-Target Network Analysis Identify Potential Biomarkers for Efficacy Evaluation of Fuzheng-Huayu Formula-Treated Hepatitis B Caused Liver Cirrhosis

    PubMed Central

    Chen, Qilong; Wu, Feizhen; Wang, Mei; Dong, Shu; Liu, Yamin; Lu, Yiyu; Song, Yanan; Zhou, Qianmei; Liu, Ping; Luo, Yunquan; Su, Shibing


    Fuzheng-Huayu (FZHY) formula has been found to have a satisfactory effect on hepatitis B-caused cirrhosis (HBC) treatment. However, the efficacy evaluation of FZHY is often challenging. In this study, a randomized, double-blind and placebo-controlled trial was used to evaluate the therapeutic efficacy of FZHY in HBC treatment. In the trial, 35 medical indexes were detected, and 14 indexes had a statistically-significant difference before compared to after the trial. Importantly, the Child-Pugh score also demonstrated FZHY having therapeutic efficacy. Furthermore, the microRNA (miRNA) profiles of 12 serum samples were detected in FZHY groups, and 112 differential-expressed (DE) miRNAs were determined. Using predicted miRNA targets, 13 kernel miRNAs were identified from the established miRNA-target network. Subsequently, quantitative Real-time Polymerase Chain Reaction (qRT-PCR) was used to validate the expression level of 13 identified miRNAs in the trials. The results showed that nine miRNAs have a statistically-significant difference before compared to after FZHY treatment. By means of a logistic regression model, a miRNA panel with hsa-miR-18a-5p, -326, -1182 and -193b-5p was established, and it can clearly improve the accuracy of the efficacy evaluation of FZHY. This study suggested that the particular miRNAs can act as potential biomarkers and obviously increase the diagnostic accuracy for drug evaluation in HBC treatment progression. PMID:27271613

  13. Transcription by RNA polymerases I and III

    PubMed Central

    Paule, Marvin R.; White, Robert J.


    The task of transcribing nuclear genes is shared between three RNA polymerases in eukaryotes: RNA polymerase (pol) I synthesises the large rRNA, pol II synthesises mRNA and pol III synthesises tRNA and 5S rRNA. Although pol II has received most attention, pol I and pol III are together responsible for the bulk of transcriptional activity. This survey will summarise what is known about the process of transcription by pol I and pol III, how it happens and the proteins involved. Attention will be drawn to the similarities between the three nuclear RNA polymerase systems and also to their differences. PMID:10684922

  14. TaqMan real-time reverse transcription-PCR assay for universal detection and quantification of avian hepatitis E virus from clinical samples in the presence of a heterologous internal control RNA.


    Troxler, Salome; Marek, Ana; Prokofieva, Irina; Bilic, Ivana; Hess, Michael


    Avian hepatitis E virus (HEV) isolates could be separated into at least three genotypes. In this study, the development of the first duplex TaqMan real-time reverse transcription-PCR (RT-PCR) assay for detection and quantification of avian HEV is presented. Primers and probes binding within relatively conserved open reading frame 3 (ORF3) were designed. Tenfold dilution series of in vitro-transcribed avian HEV RNA were used as the standard for quantification. A 712-bp region of the green fluorescent protein gene was transcribed in vitro and used as a heterologous internal control for both RNA isolation and real-time RT-PCR. The duplex real-time RT-PCR for avian HEV had an efficiency of 1.04, a regression squared value of 0.996, and a sensitivity of approximately 3.6 × 10(3) copies per reaction mixture when in vitro-transcribed RNA was used as the template. The presence of in vitro-transcribed heterologous internal control RNA did not affect amplification of avian HEV RNA compared to that achieved by the single assay. The sensitivity of the real-time RT-PCR assay was comparable to that of conventional RT-PCR, and it was shown to be highly specific, as tissues from uninfected chickens, mammalian HEVs, and other viral genomes did not produce positive signals. All tested field samples with virus belonging to different avian HEV genotypes were successfully detected with this new duplex TaqMan real-time RT-PCR assay.

  15. Transcription termination by nuclear RNA polymerases

    PubMed Central

    Richard, Patricia; Manley, James L.


    Gene transcription in the cell nucleus is a complex and highly regulated process. Transcription in eukaryotes requires three distinct RNA polymerases, each of which employs its own mechanisms for initiation, elongation, and termination. Termination mechanisms vary considerably, ranging from relatively simple to exceptionally complex. In this review, we describe the present state of knowledge on how each of the three RNA polymerases terminates and how mechanisms are conserved, or vary, from yeast to human. PMID:19487567

  16. RNA-guided transcriptional regulation


    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.


    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  17. FoxO1 deacetylation regulates thyroid hormone-induced transcription of key hepatic gluconeogenic genes.


    Singh, Brijesh Kumar; Sinha, Rohit Anthony; Zhou, Jin; Xie, Sherwin Ying; You, Seo-Hee; Gauthier, Karine; Yen, Paul Michael


    Hepatic gluconeogenesis is a concerted process that integrates transcriptional regulation with hormonal signals. A major regulator is thyroid hormone (TH), which acts through its nuclear receptor (TR) to induce the expression of the hepatic gluconeogenic genes, phosphoenolpyruvate carboxykinase (PCK1) and glucose-6-phosphatase (G6PC). Forkhead transcription factor FoxO1 also is an important regulator of these genes; however, its functional interactions with TR are not known. Here, we report that TR-mediated transcriptional activation of PCK1 and G6PC in human hepatic cells and mouse liver was FoxO1-dependent and furthermore required FoxO1 deacetylation by the NAD(+)-dependent deacetylase, SirT1. siRNA knockdown of FoxO1 decreased, whereas overexpression of FoxO1 increased, TH-dependent transcriptional activation of PCK1 and G6PC in cultured hepatic cells. FoxO1 siRNA knockdown also decreased TH-mediated transcription in vivo. Additionally, TH was unable to induce FoxO1 deacetylation or hepatic PCK1 gene expression in TH receptor β-null (TRβ(-/-)) mice. Moreover, TH stimulated FoxO1 recruitment to the PCK1 and G6PC gene promoters in a SirT1-dependent manner. In summary, our results show that TH-dependent deacetylation of a second metabolically regulated transcription factor represents a novel mechanism for transcriptional integration of nuclear hormone action with cellular energy status.

  18. Competitor template RNA for detection and quantitation of hepatitis A virus by PCR.


    Goswami, B B; Koch, W H; Cebula, T A


    PCR was used to introduce a 63-bp deletion into the putative RNA replicase coding sequence of hepatitis A virus. RNA was synthesized in vitro from the deletion mutant cloned into a transcription vector. Upon amplification by PCR, cDNA made from the competitor RNA generated an amplified fragment that could be easily distinguished from the product generated from wild-type hepatitis A virus genomic RNA by gel electrophoresis, when the same primers were used, without further manipulation. The competitor RNA was used as a positive control in PCR-based detection of very low copy numbers of hepatitis A virus genomic RNA in the presence of unrelated hard-shell clam RNA. When the competitor RNA was used for competitive PCR to quantitate wild-type RNA, the presence of one template at a 10-fold to 100-fold higher level almost completely inhibited product formation from the underrepresented template. The competitor RNA should be useful as a control for reverse transcription and PCRs to determine hepatitis A virus genome RNA when accidental contamination of test samples by a wild-type positive control template would compromise the results.

  19. Transcription and Recombination: When RNA Meets DNA

    PubMed Central

    Aguilera, Andrés; Gaillard, Hélène


    A particularly relevant phenomenon in cell physiology and proliferation is the fact that spontaneous mitotic recombination is strongly enhanced by transcription. The most accepted view is that transcription increases the occurrence of double-strand breaks and/or single-stranded DNA gaps that are repaired by recombination. Most breaks would arise as a consequence of the impact that transcription has on replication fork progression, provoking its stalling and/or breakage. Here, we discuss the mechanisms responsible for the cross talk between transcription and recombination, with emphasis on (1) the transcription–replication conflicts as the main source of recombinogenic DNA breaks, and (2) the formation of cotranscriptional R-loops as a major cause of such breaks. The new emerging questions and perspectives are discussed on the basis of the interference between transcription and replication, as well as the way RNA influences genome dynamics. PMID:25085910

  20. A movie of RNA polymerase II transcription.


    Cheung, Alan C M; Cramer, Patrick


    We provide here a molecular movie that captures key aspects of RNA polymerase II initiation and elongation. To create the movie, we combined structural snapshots of the initiation-elongation transition and of elongation, including nucleotide addition, translocation, pausing, proofreading, backtracking, arrest, reactivation, and inhibition. The movie reveals open questions about the mechanism of transcription and provides a useful teaching tool.

  1. Functional Integration of Transcriptional and RNA Processing Machineries

    PubMed Central

    Pandit, Shatakshi; Wang, Dong; Fu, Xiang-Dong


    Co-transcriptional RNA processing not only permits temporal RNA processing before the completion of transcription, but also allows sequential recognition of RNA processing signals on nascent transcripts threading out from the elongating RNAPII complex. Rapid progress in recent years has established multiple contacts that physically connect the transcription and RNA processing machineries, which centers on the C-terminal domain (CTD) of the largest subunit of RNAPII. While co-transcriptional RNA processing has been substantiated, the evidence for “reciprocal” coupling starts to emerge, which emphasizes functional integration of transcription and RNA processing machineries in a mutually beneficial manner for efficient and regulated gene expression. PMID:18436438

  2. Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat.


    Blake, W L; Clarke, S D


    The objective of this research was to determine whether dietary polyunsaturated fatty acids suppress hepatic fatty acid synthase (FAS) mRNA levels by altering FAS gene transcription. Male Sprague-Dawley rats were meal-fed for 10 d a high glucose diet supplemented with 20% digestible energy as menhaden oil or tripalmitin. The transcription rate for FAS was determined by nuclear run-on analysis in hepatic nuclei isolated from rats 2 h postmeal. The values for transcription rates of FAS and S14 (a putative lipogenic protein) in rats fed menhaden oil were only 6 and 21%, respectively, of the rates in rats fed the tripalmitin diet (p less than 0.02). Gene transcription for beta-actin and phosphoenolpyruvate carboxykinase did not differ between treatments. The reduction in hepatic FAS mRNA levels caused by dietary polyunsaturated fats appears to be caused primarily by an inhibition of FAS transcription. The control of transcription by polyunsaturated fats appears not to be mediated by cAMP because the transcription rate for phosphoenolpyruvate carboxykinase (whose gene is very sensitive to cAMP stimulation) was unaffected by the source of dietary fat.

  3. The human RNA polymerase II interacts with the terminal stem-loop regions of the hepatitis delta virus RNA genome

    SciTech Connect

    Greco-Stewart, Valerie S.; Miron, Paul; Abrahem, Abrahem; Pelchat, Martin . E-mail:


    The hepatitis delta virus (HDV) is an RNA virus that depends on DNA-dependent RNA polymerase (RNAP) for its transcription and replication. While it is generally accepted that RNAP II is involved in HDV replication, its interaction with HDV RNA requires confirmation. A monoclonal antibody specific to the carboxy terminal domain of the largest subunit of RNAP II was used to establish the association of RNAP II with both polarities of HDV RNA in HeLa cells. Co-immunoprecipitations using HeLa nuclear extract revealed that RNAP II interacts with HDV-derived RNAs at sites located within the terminal stem-loop domains of both polarities of HDV RNA. Analysis of these regions revealed a strong selection to maintain a rod-like conformation and demonstrated several conserved features. These results provide the first direct evidence of an association between human RNAP II and HDV RNA and suggest two transcription start sites on both polarities of HDV RNA.

  4. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts

    PubMed Central

    Turowski, Tomasz W.; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David


    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5′ peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential “housekeeping” roles. Many tRNA genes were found to generate long, 3′-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3′-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5′-exonuclease Rat1. PMID:27206856

  5. Structural analysis of hepatitis C RNA genome using DNA microarrays

    PubMed Central

    Martell, María; Briones, Carlos; de Vicente, Aránzazu; Piron, María; Esteban, Juan I.; Esteban, Rafael; Guardia, Jaime; Gómez, Jordi


    Many studies have tried to identify specific nucleotide sequences in the quasispecies of hepatitis C virus (HCV) that determine resistance or sensitivity to interferon (IFN) therapy, unfortunately without conclusive results. Although viral proteins represent the most evident phenotype of the virus, genomic RNA sequences determine secondary and tertiary structures which are also part of the viral phenotype and can be involved in important biological roles. In this work, a method of RNA structure analysis has been developed based on the hybridization of labelled HCV transcripts to microarrays of complementary DNA oligonucleotides. Hybridizations were carried out at non-denaturing conditions, using appropriate temperature and buffer composition to allow binding to the immobilized probes of the RNA transcript without disturbing its secondary/tertiary structural motifs. Oligonucleotides printed onto the microarray covered the entire 5′ non-coding region (5′NCR), the first three-quarters of the core region, the E2–NS2 junction and the first 400 nt of the NS3 region. We document the use of this methodology to analyse the structural degree of a large region of HCV genomic RNA in two genotypes associated with different responses to IFN treatment. The results reported here show different structural degree along the genome regions analysed, and differential hybridization patterns for distinct genotypes in NS2 and NS3 HCV regions. PMID:15247323

  6. Transcriptional proofreading in dense RNA polymerase traffic

    NASA Astrophysics Data System (ADS)

    Sahoo, Mamata; Klumpp, Stefan


    The correction of errors during transcription involves the diffusive backward translocation (backtracking) of RNA polymerases (RNAPs) on the DNA. A trailing RNAP on the same template can interfere with backtracking as it progressively restricts the space that is available for backward translocation and thereby ratchets the backtracked RNAP forward. We analyze the resulting negative impact on proofreading theoretically using a driven lattice gas model of transcription under conditions of dense RNAP traffic. The fraction of errors that are corrected is calculated exactly for the case of a single RNAP; for multi-RNAP transcription, we use simulations and an analytical approximation and find a decrease with increasing traffic density. Moreover, we ask how the parameters of the system have to be set to keep down the impact of the interference of a trailing RNAP. Our analysis uncovers a surprisingly simple picture of the design of the error correction system: its efficiency is essentially determined by the rate for the initial backtracking step, while the value of the cleavage rate ensures that the correction mechanism remains efficient at high transcription rates. Finally, we argue that our analysis can also be applied to cases with transcription-translation coupling where the leading ribosome on the transcript assumes the role of the trailing RNAP.

  7. Transcription and translation in an RNA world

    PubMed Central

    Taylor, William R


    The RNA world hypothesis requires a ribozyme that was an RNA-directed RNA polymerase (ribopolymerase). If such a replicase makes a reverse complementary copy of any sequence (including itself), in a simple RNA world, there is no mechanism to prevent self-hybridization. It is proposed that this can be avoided through the synthesis of a parallel complementary copy. The logical consequences of this are pursued and developed in a computer simulation, where the behaviour of the parallel copy is compared to the conventional reverse complementary copy. It is found that the parallel copy is more efficient at higher temperatures (up to 90°C). A model for the ribopolymerase, based on the core of the large subunit (LSU) of the ribosome, is described. The geometry of a potential active site for this ribopolymerase suggests that it contained a cavity (now occupied by the aminoacyl-tRNA) and that an amino acid binding in this might have ‘poisoned’ the ribopolymerase by cross-reacting with the nucleoside-triphosphate before polymerization could occur. Based on a similarity to the active site components of the class-I tRNA synthetase enzymes, it is proposed that the amino acid could become attached to the nascent RNA transcript producing a variety of aminoacylated tRNA-like products. Using base-pairing interactions, some of these molecules might cross-link two ribopolymerases, giving rise to a precursor of the modern ribosome. A hybrid dimer, half polymerase and half proto-ribosome, could account for mRNA translocation before the advent of protein elongation factors. PMID:17008216

  8. BC1 RNA: transcriptional analysis of a neural cell-specific RNA polymerase III transcript.

    PubMed Central

    Martignetti, J A; Brosius, J


    Rodent BC1 RNA represents the first example of a neural cell-specific RNA polymerase III (Pol III) transcription product. By developing a rat brain in vitro system capable of supporting Pol III-directed transcription, we showed that the rat BC1 RNA intragenic promoter elements, comprising an A box element and a variant B box element, as well as its upstream region, containing octamer-binding consensus sequences and functional TATA and proximal sequence element sites, are necessary for transcription. The BC1 B box, lacking the invariant A residue found in the consensus B boxes of tRNAs, represents a functionally related and possibly distinct promoter element. The transcriptional activity of the BC1 B box element is greatly increased, in both a BC1 RNA and a chimeric tRNA(Leu) gene construct, when the BC1 5' flanking region is present and is appropriately spaced. Moreover, a tRNA consensus B-box sequence can efficiently replace the BC1 B box only if the BC1 upstream region is removed. These interactions, identified only in a homologous in vitro system, between upstream Pol II and intragenic Pol III promoters suggest a mechanism by which the tissue-specific BC1 RNA gene and possibly other Pol III-transcribed genes can be regulated. PMID:7862155

  9. rRNA transcription rate in Escherichia coli.

    PubMed Central

    Gotta, S L; Miller, O L; French, S L


    The rate of in vivo transcription elongation for Escherichia coli rRNA operons was determined by electron microscopy following addition of rifampin to log-phase cultures. Direct observation of RNA polymerase positions along rRNA operons 30, 40, and 70 s after inhibition of transcription initiation yielded a transcription elongation rate of 42 nucleotides per s. Images FIG. 1 PMID:1717439

  10. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.


    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin


    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription.

  11. Coupling pre-mRNA processing to transcription on the RNA factory assembly line

    PubMed Central

    Lee, Kuo-Ming; Tarn, Woan-Yuh


    It has been well-documented that nuclear processing of primary transcripts of RNA polymerase II occurs co-transcriptionally and is functionally coupled to transcription. Moreover, increasing evidence indicates that transcription influences pre-mRNA splicing and even several post-splicing RNA processing events. In this review, we discuss the issues of how RNA polymerase II modulates co-transcriptional RNA processing events via its carboxyl terminal domain, and the protein domains involved in coupling of transcription and RNA processing events. In addition, we describe how transcription influences the expression or stability of mRNAs through the formation of distinct mRNP complexes. Finally, we delineate emerging findings that chromatin modifications function in the regulation of RNA processing steps, especially splicing, in addition to transcription. Overall, we provide a comprehensive view that transcription could integrate different control systems, from epigenetic to post-transcriptional control, for efficient gene expression. PMID:23392244

  12. Surveillance study of hepatitis A virus RNA on fig and date samples.


    Boxman, Ingeborg L A; te Loeke, Nathalie A J M; Klunder, Kyara; Hägele, Geke; Jansen, Claudia C C


    A total of 91 fig and 185 date samples were analyzed by reverse transcription (RT) real-time PCR for the presence of hepatitis A virus (HAV) RNA. Two batches of dates tested positive, and the HAV RNA detected was genotyped as IA. These findings warrant further development of methods applicable to food which is consumed untreated and is exported from countries in which HAV is endemic.

  13. Optical tweezers studies of transcription by eukaryotic RNA polymerases.


    Lisica, Ana; Grill, Stephan W


    Transcription is the first step in the expression of genetic information and it is carried out by large macromolecular enzymes called RNA polymerases. Transcription has been studied for many years and with a myriad of experimental techniques, ranging from bulk studies to high-resolution transcript sequencing. In this review, we emphasise the advantages of using single-molecule techniques, particularly optical tweezers, to study transcription dynamics. We give an overview of the latest results in the single-molecule transcription field, focusing on transcription by eukaryotic RNA polymerases. Finally, we evaluate recent quantitative models that describe the biophysics of RNA polymerase translocation and backtracking dynamics.

  14. RNA-RNA and RNA-protein interactions in coronavirus replication and transcription

    PubMed Central

    Sola, Isabel; Mateos-Gomez, Pedro A; Almazan, Fernando; Zuñiga, Sonia


    Coronavirus (CoV) RNA synthesis includes the replication of the viral genome, and the transcription of sgRNAs by a discontinuous mechanism. Both processes are regulated by RNA sequences such as the 5′ and 3′ untranslated regions (UTRs), and the transcription regulating sequences (TRSs) of the leader (TRS-L) and those preceding each gene (TRS-Bs). These distant RNA regulatory sequences interact with each other directly and probably through protein-RNA and protein-protein interactions involving viral and cellular proteins.1 By analogy to other plus-stranded RNA viruses, such as polioviruses, in which translation and replication switch involves a cellular factor (PCBP) and a viral protein (3CD),2 it is conceivable that in CoVs the switch between replication and transcription is also associated with the binding of proteins that are specifically recruited by the replication or transcription complexes. Complexes between RNA motifs such as TRS-L and the TRS-Bs located along the CoV genome are probably formed previously to the transcription start, and most likely promote template-switch of the nascent minus RNA to the TRS-L region.3 Many cellular proteins interacting with regulatory CoV RNA sequences4 are members of the heterogeneous nuclear ribonucleoprotein (hnRNP) family of RNA-binding proteins, involved in mRNA processing and transport, which shuttle between the nucleus and the cytoplasm. In the context of CoV RNA synthesis, these cellular ribonucleoproteins might also participate in RNA-protein complexes to bring into physical proximity TRS-L and distant TRS-B, as proposed for CoV discontinuous transcription.5–7 In this review, we summarize RNA-RNA and RNA-protein interactions that represent modest examples of complex quaternary RNA-protein structures required for the fine-tuning of virus replication. Design of chemically defined replication and transcription systems will help to clarify the nature and activity of these structures. PMID:21378501

  15. Dietary protein-related changes in hepatic transcription correspond to modifications in hepatic protein expression in growing pigs.


    Junghans, Peter; Kaehne, Thilo; Beyer, Manfred; Metges, Cornelia C; Schwerin, Manfred


    In a previous investigation we showed by expression profiling based on transcription analysis using differential display RT-PCR (DDRT-PCR) and real-time RT-PCR that a soy protein diet (SPI) significantly changes the hepatic transcription pattern compared with a casein diet (CAS). The present study was conducted to determine whether the transcriptional modulation is translated into protein expression. The hepatic mRNA abundance of four genes (EP24.16, LC3, NPAP60L, RFC2) that showed diet-related expression in previous DDRT-PCR experiments was analyzed by real-time RT-PCR. Two pigs that showed the most prominent SPI-related changes of transcription and two casein-fed pigs were selected and their hepatic protein pattern was studied comparatively by two-dimensional gel electrophoresis and peptide mass fingerprinting. The two-dimensional protein gel electrophoresis revealed a predominant SPI-associated upregulation of protein expression that corresponded to the results of the mRNA study. Of 380 diet-related protein spots displayed, 215 appeared exclusively or enlarged in the two SPI pigs; 10 of 39 diet-related expressed protein spots extracted could be identified by peptide mass fingerprinting and database search. Compared with the transcriptomics approach, the proteomics approach led in part to the identification of the same diet-associated expressed molecules (plasminogen, trypsin, phospholipase A2, glutathione-S-transferase alpha, retinal binding protein) or at least molecules belonging to the same metabolic pathways (protein and amino acid metabolism, oxidative stress response, lipid metabolism). The present results at the proteome level confirm SPI-related increased oxidative stress response and significant effects on protein biosynthesis already observed at the transcriptome level.

  16. Transcriptional interference by RNA polymerase pausing and dislodgement of transcription factors.


    Palmer, Adam C; Egan, J Barry; Shearwin, Keith E


    Transcriptional interference is the in cis suppression of one transcriptional process by another. Mathematical modeling shows that promoter occlusion by elongating RNA polymerases cannot produce strong interference. Interference may instead be generated by (1) dislodgement of slow-to-assemble pre-initiation complexes and transcription factors and (2) prolonged occlusion by paused RNA polymerases.

  17. Involvement of tristetraprolin in transcriptional activation of hepatic 3-hydroxy-3-methylglutaryl coenzyme A reductase by insulin

    SciTech Connect

    Ness, Gene C.; Edelman, Jeffrey L.; Brooks, Patricia A.


    Highlights: Black-Right-Pointing-Pointer siRNAs to tristetraprolin blocks transcription of HMGR in vivo in rat liver. Black-Right-Pointing-Pointer siRNAs to tristetraprolin inhibits insulin activation of HMGR transcription. Black-Right-Pointing-Pointer Insulin acts to rapidly increase tristetraprolin in liver nuclear extracts. -- Abstract: Several AU-rich RNA binding element (ARE) proteins were investigated for their possible effects on transcription of hepatic 3-hydroxy-3-methyglutaryl coenzyme A reductase (HMGR) in normal rats. Using in vivo electroporation, four different siRNAs to each ARE protein were introduced together with HMGR promoter (-325 to +20) luciferase construct and compared to saline controls. All four siRNAs to tristetraprolin (TTP) completely eliminated transcription from the HMGR promoter construct. Since insulin acts to rapidly increase hepatic HMGR transcription, the effect of TTP siRNA on induction by insulin was tested. The 3-fold stimulation by insulin was eliminated by this treatment. In comparison, siRNA to AU RNA binding protein/enoyl coenzyme A hydratase (AUH) had no effect. These findings indicate a role for TTP in the insulin-mediated activation of hepatic HMGR transcription.

  18. Preclinical evaluation of AMPLICOR hepatitis C virus test for detection of hepatitis C virus RNA.

    PubMed Central

    Nolte, F S; Thurmond, C; Fried, M W


    We compared a single-enzyme, combined reverse transcription-PCR (RT-PCR; AMPLICOR HCV Test; Roche Molecular Systems, Branchburg, N.J.) with an independent, two-enzyme, standard RT-PCR (SRT-PCR) assay for the detection of hepatitis C virus (HCV) RNA in serum and plasma. Test samples included a proficiency testing panel consisting of 10 undiluted plasma samples, three separate dilution series, and sera from 99 patients with chronic liver disease. The quantity of HCV RNA in each patient serum sample was determined by a branched DNA (bDNA) signal amplification assay (Quantiplex HCV-RNA assay; Chiron, Emeryville, Calif.). There was complete concordance between the results of the RT-PCR assays with the 10 undiluted plasma samples used for proficiency testing (3 positive and 7 negative samples). However, the analytical sensitivity of SRT-PCR was 4- to 10-fold greater than that of the AMPLICOR test in the dilution series. HCV RNA was detected in 44, 45, and 40 of the patient serum samples, by SRT-PCR, the AMPLICOR test, and the bDNA assay, respectively. There was 97% agreement between the results of the RT-PCR assays, with only three discrepancies. Review of the patients' medical records resolved all three discrepancies in favor of the AMPLICOR results (two false-negative SRT-PCR results and one false-positive SRT-PCR result). The quantity of HCV RNA in sera from five (11%) patients with viremia detected by AMPLICOR was below the bDNA assay cutoff (< 3.5 x 10(5) RNA equivalents per ml).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7665645

  19. Transcriptional regulation of mammalian miRNA genes

    PubMed Central

    Schanen, Brian C.; Li, Xiaoman


    MicroRNAs (miRNAs) are members of a growing family of non-coding transcripts, 21-23 nucleotides long, which regulate a diverse collection of biological processes and various diseases by RNA-mediated gene-silencing mechanisms. While currently many studies focus on defining the regulatory functions of miRNAs, few are directed towards how miRNA genes are themselves transcriptionally regulated. Recent studies of miRNA transcription have elucidated RNA polymerase II as the major polymerase of miRNAs, however, little is known of the structural features of miRNA promoters, especially those of mammalian miRNAs. Here, we review the current literature regarding features conserved among miRNA promoters useful for their detection and the current novel methodologies available to enable researchers to advance our understanding of the transcriptional regulation of miRNA genes. PMID:20977933

  20. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.


    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth


    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  1. Single molecule studies of RNA polymerase II transcription in vitro.


    Horn, Abigail E; Goodrich, James A; Kugel, Jennifer F


    Eukaryotic mRNA transcription by RNA polymerase II (RNAP II) is the first step in gene expression and a key determinant of cellular regulation. Elucidating the mechanism by which RNAP II synthesizes RNA is therefore vital to determining how genes are controlled under diverse biological conditions. Significant advances in understanding RNAP II transcription have been achieved using classical biochemical and structural techniques; however, aspects of the transcription mechanism cannot be assessed using these approaches. The application of single-molecule techniques to study RNAP II transcription has provided new insight only obtainable by studying molecules in this complex system one at a time.

  2. Comparison of circulating, hepatocyte specific messenger RNA and microRNA as biomarkers for chronic hepatitis B and C.


    Zhang, Xiaonan; Zhang, Zhanqing; Dai, Fahui; Shi, Bisheng; Chen, Liang; Zhang, Xinxin; Zang, Guoqing; Zhang, Jiming; Chen, Xiaorong; Qian, Fangxing; Hu, Yunwen; Yuan, Zhenghong


    Circulating microRNAs have been widely recognized as a novel category of biomarker in a variety of physiological and pathological conditions. Other reports revealed that fragments of organ specific messenger RNAs are also detectable in serum/plasma and can be utilized as sensitive indicators of liver pathology and cancer. In order to assess the sensitivity and reliability of these two class of RNAs as marker of hepatitis B or C induced chronic liver disease, we collected plasma samples from 156 chronic hepatitis B or C patients (HBV active n = 112, HBV carrier n = 19, hepatitis C n = 25) and 22 healthy donors and quantified their circulating mRNA for albumin, HP (haptoglobin), CYP2E1 (cytochrome P450, family 2, subfamily E) and ApoA2 (Apolipoprotein A2) in conjunction with microRNA-122, a well established marker for acute and chronic liver injury. We found that plasma microRNA-122 level is significantly elevated in patients with active HBV but not in HBV carriers. Furthermore, microRNA-122 is not elevated in HCV patients even though their median serum alanine aminotransferase (sALT) was three fold of the healthy donors. Nevertheless, circulating mRNAs, especially albumin mRNA, showed much more sensitivity in distinguishing active hepatitis B, hepatitis B carrier or HCV patients from healthy control. Correlation and multiple linear regression analysis suggested that circulating mRNAs and miRNAs are much more related to HBsAg titre than to sALT. Immunoprecipitation of HBsAg in HBV patients' plasma resulted in enrichment of albumin and HP mRNA suggesting that fragments of liver specific transcripts can be encapsidated into HBsAg particles. Taken together, our results suggest that hepatocyte specific transcripts in plasma like albumin mRNA showed greater sensitivity and specificity in differentiating HBV or HCV induced chronic liver disease than microRNA-122. Circulating mRNA fragments merit more attention in the quest of next generation biomarkers for

  3. Modulation of RNA polymerase assembly dynamics in transcriptional regulation

    PubMed Central

    Gorski, Stanislaw A.; Snyder, Sara K.; John, Sam; Grummt, Ingrid; Misteli, Tom


    The interaction of transcription factors with target genes is highly dynamic. Whether the dynamic nature of these interactions is merely an intrinsic property of transcriptions factors or serves a regulatory role is unknown. Here, we have used single cell fluorescence imaging combined with computational modeling and chromatin immunoprecipitation to analyze transcription complex dynamics in gene regulation during the cell cycle in living cells. We demonstrate a link between the dynamics of RNA polymerase I (RNA pol I) assembly and transcriptional output. We show that transcriptional upregulation is accompanied by prolonged retention of RNA pol I components at the promoter, resulting in longer promoter dwell time, and an increase in the steady state population of assembling polymerase. As a consequence, polymerase assembly efficiency, and ultimately, an rate of entry into processive elongation are elevated. Our results show that regulation of rDNA transcription in vivo occurs via modulation of the efficiency of transcription complex subunit capture and assembly. PMID:18498750

  4. RNA polymerase II transcription on the fast lane.


    Marcello, Alessandro


    Transcription by RNA polymerase II is the process that copies DNA into RNA leading to the expression of a specific gene. Averaged estimates of polymerase elongation rates in mammalian cells have been shown to vary between 1 and 4 kilobases per minute. However, recent advances in live cell imaging allowed direct measurements of RNA biogenesis from a single gene exceeded 50 kb·min(-1) . This unexpected finding opens novel and intriguing perspectives on the control of metazoan transcription.

  5. DNA display of folded RNA libraries enabling RNA-SELEX without reverse transcription.


    MacPherson, I S; Temme, J S; Krauss, I J


    A method for the physical attachment of folded RNA libraries to their encoding DNA is presented as a way to circumvent the reverse transcription step during systematic evolution of RNA ligands by exponential enrichment (RNA-SELEX). A DNA library is modified with one isodC base to stall T7 polymerase and a 5' "capture strand" which anneals to the nascent RNA transcript. This method is validated in a selection of RNA aptamers against human α-thrombin with dissociation constants in the low nanomolar range. This method will be useful in the discovery of RNA aptamers and ribozymes containing base modifications that make them resistant to accurate reverse transcription.

  6. 2-Selenouridine triphosphate synthesis and Se-RNA transcription.


    Sun, Huiyan; Jiang, Sibo; Caton-Williams, Julianne; Liu, Hehua; Huang, Zhen


    2-Selenouridine ((Se)U) is one of the naturally occurring modifications of Se-tRNAs ((Se)U-RNA) at the wobble position of the anticodon loop. Its role in the RNA-RNA interaction, especially during the mRNA decoding, is elusive. To assist the research exploration, herein we report the enzymatic synthesis of the (Se)U-RNA via 2-selenouridine triphosphate ((Se)UTP) synthesis and RNA transcription. Moreover, we have demonstrated that the synthesized (Se)UTP is stable and recognizable by T7 RNA polymerase. Under the optimized conditions, the transcription yield of (Se)U-RNA can reach up to 85% of the corresponding native RNA. Furthermore, the transcribed (Se)U-hammerhead ribozyme has the similar activity as the corresponding native, which suggests usefulness of (Se)U-RNAs in function and structure studies of noncoding RNAs, including the Se-tRNAs.

  7. The transcription cofactor CRTC1 protects from aberrant hepatic lipid accumulation

    PubMed Central

    Kim, Hwijin


    Nonalcoholic fatty liver disease (NAFLD) is a rapidly emerging global health-problem. NAFLD encompasses a range of conditions associated with hepatic steatosis, aberrant accumulation of fat in hepatocytes. Although obesity and metabolic syndrome are considered to have a strong association with NAFLD, genetic factors that predispose liver to NAFLD and molecular mechanisms by which excess hepatic lipid develops remain largely unknown. We report that the transcription cofactor CRTC1 confers broad spectrum protection against hepatic steatosis development. CRTC1 directly interferes with the expression of genes regulated by lipogenic transcription factors, most prominently liver x receptor α (LXRα). Accordingly, Crtc1 deficient mice develop spontaneous hepatic steatosis in young age. As a cyclic AMP effector, CRTC1 mediates anti-steatotic effects of calorie restriction (CR). Notably, CRTC1 also mediates anti-lipogenic effects of bile acid signaling, whereas it is negatively regulated by miR-34a, a pathogenic microRNA upregulated in a broad spectrum of NAFLD. These patterns of gene function and regulation of CRTC1 are distinct from other CR-responsive proteins, highlighting critical protective roles that CRTC1 selectively plays against NAFLD development, which in turn provides novel opportunities for selectively targeting beneficial therapeutic effects of CR. PMID:27869139

  8. Transcript-RNA-templated DNA recombination and repair.


    Keskin, Havva; Shen, Ying; Huang, Fei; Patel, Mikir; Yang, Taehwan; Ashley, Katie; Mazin, Alexander V; Storici, Francesca


    Homologous recombination is a molecular process that has multiple important roles in DNA metabolism, both for DNA repair and genetic variation in all forms of life. Generally, homologous recombination involves the exchange of genetic information between two identical or nearly identical DNA molecules; however, homologous recombination can also occur between RNA molecules, as shown for RNA viruses. Previous research showed that synthetic RNA oligonucleotides can act as templates for DNA double-strand break (DSB) repair in yeast and human cells, and artificial long RNA templates injected in ciliate cells can guide genomic rearrangements. Here we report that endogenous transcript RNA mediates homologous recombination with chromosomal DNA in yeast Saccharomyces cerevisiae. We developed a system to detect the events of homologous recombination initiated by transcript RNA following the repair of a chromosomal DSB occurring either in a homologous but remote locus, or in the same transcript-generating locus in reverse-transcription-defective yeast strains. We found that RNA-DNA recombination is blocked by ribonucleases H1 and H2. In the presence of H-type ribonucleases, DSB repair proceeds through a complementary DNA intermediate, whereas in their absence, it proceeds directly through RNA. The proximity of the transcript to its chromosomal DNA partner in the same locus facilitates Rad52-driven homologous recombination during DSB repair. We demonstrate that yeast and human Rad52 proteins efficiently catalyse annealing of RNA to a DSB-like DNA end in vitro. Our results reveal a novel mechanism of homologous recombination and DNA repair in which transcript RNA is used as a template for DSB repair. Thus, considering the abundance of RNA transcripts in cells, RNA may have a marked impact on genomic stability and plasticity.

  9. Natural antisense and noncoding RNA transcripts as potential drug targets.


    Wahlestedt, Claes


    Information on the complexity of mammalian RNA transcription has increased greatly in the past few years. Notably, thousands of sense transcripts (conventional protein-coding genes) have antisense transcript partners, most of which are noncoding. Interestingly, a number of antisense transcripts regulate the expression of their sense partners, either in a discordant (antisense knockdown results in sense-transcript elevation) or concordant (antisense knockdown results in concomitant sense-transcript reduction) manner. Two new pharmacological strategies based on the knockdown of antisense RNA transcripts by siRNA (or another RNA targeting principle) are proposed in this review. In the case of discordant regulation, knockdown of antisense transcript elevates the expression of the conventional (sense) gene, thereby conceivably mimicking agonist-activator action. In the case of concordant regulation, knockdown of antisense transcript, or concomitant knockdown of antisense and sense transcripts, results in an additive or even synergistic reduction of the conventional gene expression. Although both strategies have been demonstrated to be valid in cell culture, it remains to be seen whether they provide advantages in other contexts.

  10. Antitermination of transcription from an Escherichia coli ribosomal RNA promoter.


    Holben, W E; Morgan, E A


    The Escherichia coli lac and ara promoters and rrnC ribosomal RNA promoter-leader region were fused to lacZYA. Transcription termination signals were introduced into the lac genes of these fusions by Tn9 and IS1 insertions. Measurement of lac enzymes from upstream and downstream of the insertions showed that termination signals resulting from these insertions are very efficient when transcription begins at lac or ara promoters but are very inefficient when transcription begins at the rrnC promoter-leader region. The rrnC promoter-leader region must, therefore, modify RNA polymerase to enable it to read through transcription termination signals.

  11. Nascent RNA sequencing reveals distinct features in plant transcription

    PubMed Central

    Hetzel, Jonathan; Duttke, Sascha H.; Benner, Christopher; Chory, Joanne


    Transcriptional regulation of gene expression is a major mechanism used by plants to confer phenotypic plasticity, and yet compared with other eukaryotes or bacteria, little is known about the design principles. We generated an extensive catalog of nascent and steady-state transcripts in Arabidopsis thaliana seedlings using global nuclear run-on sequencing (GRO-seq), 5′GRO-seq, and RNA-seq and reanalyzed published maize data to capture characteristics of plant transcription. De novo annotation of nascent transcripts accurately mapped start sites and unstable transcripts. Examining the promoters of coding and noncoding transcripts identified comparable chromatin signatures, a conserved “TGT” core promoter motif and unreported transcription factor-binding sites. Mapping of engaged RNA polymerases showed a lack of enhancer RNAs, promoter-proximal pausing, and divergent transcription in Arabidopsis seedlings and maize, which are commonly present in yeast and humans. In contrast, Arabidopsis and maize genes accumulate RNA polymerases in proximity of the polyadenylation site, a trend that coincided with longer genes and CpG hypomethylation. Lack of promoter-proximal pausing and a higher correlation of nascent and steady-state transcripts indicate Arabidopsis may regulate transcription predominantly at the level of initiation. Our findings provide insight into plant transcription and eukaryotic gene expression as a whole. PMID:27729530

  12. Basic mechanism of transcription by RNA polymerase II

    PubMed Central

    Svetlov, Vladimir; Nudler, Evgeny


    RNA polymerase II-like enzymes carry out transcription of genomes in Eukaryota, Archaea, and some viruses. They also exhibit fundamental similarity to RNA polymerases from bacteria, chloroplasts, and mitochondria. In this review we take an inventory of recent studiesilluminating different steps of basic transcription mechanism, likely common for most multi-subunit RNA polymerases. Through the amalgamation of structural and computational chemistry data we attempt to highlight the most feasible reaction pathway for the two-metal nucleotidyl transfer mechanism, and to evaluate the way catalysis can be linked to translocation in the mechano-chemical cycle catalyzed by RNA polymerase II. PMID:22982365

  13. Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells

    PubMed Central

    Sigova, Alla A.; Mullen, Alan C.; Molinie, Benoit; Gupta, Sumeet; Orlando, David A.; Guenther, Matthew G.; Almada, Albert E.; Lin, Charles; Sharp, Phillip A.; Giallourakis, Cosmas C.; Young, Richard A.


    Many long noncoding RNA (lncRNA) species have been identified in mammalian cells, but the genomic origin and regulation of these molecules in individual cell types is poorly understood. We have generated catalogs of lncRNA species expressed in human and murine embryonic stem cells and mapped their genomic origin. A surprisingly large fraction of these transcripts (>60%) originate from divergent transcription at promoters of active protein-coding genes. The divergently transcribed lncRNA/mRNA gene pairs exhibit coordinated changes in transcription when embryonic stem cells are differentiated into endoderm. Our results reveal that transcription of most lncRNA genes is coordinated with transcription of protein-coding genes. PMID:23382218

  14. Transcript RNA supports precise repair of its own DNA gene.


    Keskin, Havva; Meers, Chance; Storici, Francesca


    The transfer of genetic information from RNA to DNA is considered an extraordinary process in molecular biology. Despite the fact that cells transcribe abundant amount of RNA with a wide range of functions, it has been difficult to uncover whether RNA can serve as a template for DNA repair and recombination. An increasing number of experimental evidences suggest a direct role of RNA in DNA modification. Recently, we demonstrated that endogenous transcript RNA can serve as a template to repair a DNA double-strand break (DSB), the most harmful DNA lesion, not only indirectly via formation of a DNA copy (cDNA) intermediate, but also directly in a homology driven mechanism in budding yeast. These results point out that the transfer of genetic information from RNA to DNA is more general than previously thought. We found that transcript RNA is more efficient in repairing a DSB in its own DNA (in cis) than in a homologous but ectopic locus (in trans). Here, we summarize current knowledge about the process of RNA-driven DNA repair and recombination, and provide further data in support of our model of DSB repair by transcript RNA in cis. We show that a DSB is precisely repaired predominately by transcript RNA and not by residual cDNA in conditions in which formation of cDNA by reverse transcription is inhibited. Additionally, we demonstrate that defects in ribonuclease (RNase) H stimulate precise DSB repair by homologous RNA or cDNA sequence, and not by homologous DNA sequence carried on a plasmid. These results highlight an antagonistic role of RNase H in RNA-DNA recombination. Ultimately, we discuss several questions that should be addressed to better understand mechanisms and implications of RNA-templated DNA repair and recombination.

  15. Direct Characterization of Transcription Elongation by RNA Polymerase I

    PubMed Central

    Ucuncuoglu, Suleyman; Engel, Krysta L.; Purohit, Prashant K.; Dunlap, David D.; Schneider, David A.


    RNA polymerase I (Pol I) transcribes ribosomal DNA and is responsible for more than 60% of transcription in a growing cell. Despite this fundamental role that directly impacts cell growth and proliferation, the kinetics of transcription by Pol I are poorly understood. This study provides direct characterization of S. Cerevisiae Pol I transcription elongation using tethered particle microscopy (TPM). Pol I was shown to elongate at an average rate of approximately 20 nt/s. However, the maximum speed observed was, in average, about 60 nt/s, comparable to the rate calculated based on the in vivo number of active genes, the cell division rate and the number of engaged polymerases observed in EM images. Addition of RNA endonucleases to the TPM elongation assays enhanced processivity. Together, these data suggest that additional transcription factors contribute to efficient and processive transcription elongation by RNA polymerase I in vivo. PMID:27455049

  16. Nuclear stability and transcriptional directionality separate functionally distinct RNA species.


    Andersson, Robin; Refsing Andersen, Peter; Valen, Eivind; Core, Leighton J; Bornholdt, Jette; Boyd, Mette; Heick Jensen, Torben; Sandelin, Albin


    Mammalian genomes are pervasively transcribed, yielding a complex transcriptome with high variability in composition and cellular abundance. Although recent efforts have identified thousands of new long non-coding (lnc) RNAs and demonstrated a complex transcriptional repertoire produced by protein-coding (pc) genes, limited progress has been made in distinguishing functional RNA from spurious transcription events. This is partly due to present RNA classification, which is typically based on technical rather than biochemical criteria. Here we devise a strategy to systematically categorize human RNAs by their sensitivity to the ribonucleolytic RNA exosome complex and by the nature of their transcription initiation. These measures are surprisingly effective at correctly classifying annotated transcripts, including lncRNAs of known function. The approach also identifies uncharacterized stable lncRNAs, hidden among a vast majority of unstable transcripts. The predictive power of the approach promises to streamline the functional analysis of known and novel RNAs.

  17. Enhanced amplification of hepatitis C virus (HCV) cDNA by PCR: detection of HCV RNA in archival sera.

    PubMed Central

    Beardsley, A M; Gowans, E J; Burrell, C J; Marmion, B P


    A reverse transcription-PCR assay which successfully amplified hepatitis C virus RNA from poorly stored archival sera was optimized. Maximum sensitivity was achieved with Moloney murine leukemia virus RNase H- reverse transcriptase and by a single round of PCR amplification of a short (112-bp) fragment of the 5' untranslated region of the viral genome. PMID:8735126

  18. Persistent nuclear actin filaments inhibit transcription by RNA polymerase II.


    Serebryannyy, Leonid A; Parilla, Megan; Annibale, Paolo; Cruz, Christina M; Laster, Kyle; Gratton, Enrico; Kudryashov, Dmitri; Kosak, Steven T; Gottardi, Cara J; de Lanerolle, Primal


    Actin is abundant in the nucleus and it is clear that nuclear actin has important functions. However, mystery surrounds the absence of classical actin filaments in the nucleus. To address this question, we investigated how polymerizing nuclear actin into persistent nuclear actin filaments affected transcription by RNA polymerase II. Nuclear filaments impaired nuclear actin dynamics by polymerizing and sequestering nuclear actin. Polymerizing actin into stable nuclear filaments disrupted the interaction of actin with RNA polymerase II and correlated with impaired RNA polymerase II localization, dynamics, gene recruitment, and reduced global transcription and cell proliferation. Polymerizing and crosslinking nuclear actin in vitro similarly disrupted the actin-RNA-polymerase-II interaction and inhibited transcription. These data rationalize the general absence of stable actin filaments in mammalian somatic nuclei. They also suggest a dynamic pool of nuclear actin is required for the proper localization and activity of RNA polymerase II.

  19. Divergent RNA transcription: a role in promoter unwinding?


    Naughton, Catherine; Corless, Samuel; Gilbert, Nick


    New approaches using biotinylated-psoralen as a probe for investigating DNA structure have revealed new insights into the relationship between DNA supercoiling, transcription and chromatin compaction. We explore a hypothesis that divergent RNA transcription generates negative supercoiling at promoters facilitating initiation complex formation and subsequent promoter clearance.

  20. The transcriptional factor Osterix directly interacts with RNA helicase A.


    Amorim, Bruna Rabelo; Okamura, Hirohiko; Yoshida, Kaya; Qiu, Lihong; Morimoto, Hiroyuki; Haneji, Tatsuji


    Osterix is an osteoblast-specific transcriptional factor, required for bone formation and osteoblast differentiation. Here, we identified new Osterix interacting factors by using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Among the candidates, RNA helicase A was identified to interact with Osterix. To determine the interaction of Osterix with RNA helicase A, immunoprecipitation assay was performed. Western analysis confirmed the association between Osterix and RNA helicase A. Immunocytochemical analysis also showed that Osterix and RNA helicase A were co-localized in HEK 293 cells. Our data suggest that RNA helicase A might be a component of Osterix regulation.

  1. High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss.


    Siersbæk, Majken; Varticovski, Lyuba; Yang, Shutong; Baek, Songjoon; Nielsen, Ronni; Mandrup, Susanne; Hager, Gordon L; Chung, Jay H; Grøntved, Lars


    Epigenetic factors have been suggested to play an important role in metabolic memory by trapping and maintaining initial metabolic changes within the transcriptional regulatory machinery. In this study we fed mice a high fat diet (HFD) for seven weeks followed by additional five weeks of chow, to identify HFD-mediated changes to the hepatic transcriptional program that may persist after weight loss. Mice fed a HFD displayed increased fasting insulin levels, hepatosteatosis and major changes in hepatic gene transcription associated with modulation of H3K27Ac at enhancers, but no significant changes in chromatin accessibility, indicating that HFD-regulated gene transcription is primarily controlled by modulating the activity of pre-established enhancers. After return to the same body weight as chow fed control mice, the fasting insulin, glucose, and hepatic triglyceride levels were fully restored to normal levels. Moreover, HFD-regulated H3K27Ac and mRNA levels returned to similar levels as control mice. These data demonstrates that the transcription regulatory landscape in the liver induced by HFD is highly dynamic and can be reversed by weight loss. This provides hope for efficient treatment of early obesity-associated changes to hepatic complications by simple weight loss intervention without persistent reprograming of the liver transcriptome.

  2. High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss

    PubMed Central

    Siersbæk, Majken; Varticovski, Lyuba; Yang, Shutong; Baek, Songjoon; Nielsen, Ronni; Mandrup, Susanne; Hager, Gordon L.; Chung, Jay H.; Grøntved, Lars


    Epigenetic factors have been suggested to play an important role in metabolic memory by trapping and maintaining initial metabolic changes within the transcriptional regulatory machinery. In this study we fed mice a high fat diet (HFD) for seven weeks followed by additional five weeks of chow, to identify HFD-mediated changes to the hepatic transcriptional program that may persist after weight loss. Mice fed a HFD displayed increased fasting insulin levels, hepatosteatosis and major changes in hepatic gene transcription associated with modulation of H3K27Ac at enhancers, but no significant changes in chromatin accessibility, indicating that HFD-regulated gene transcription is primarily controlled by modulating the activity of pre-established enhancers. After return to the same body weight as chow fed control mice, the fasting insulin, glucose, and hepatic triglyceride levels were fully restored to normal levels. Moreover, HFD-regulated H3K27Ac and mRNA levels returned to similar levels as control mice. These data demonstrates that the transcription regulatory landscape in the liver induced by HFD is highly dynamic and can be reversed by weight loss. This provides hope for efficient treatment of early obesity-associated changes to hepatic complications by simple weight loss intervention without persistent reprograming of the liver transcriptome. PMID:28071704

  3. The chemical structure of DNA sequence signals for RNA transcription

    NASA Technical Reports Server (NTRS)

    George, D. G.; Dayhoff, M. O.


    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  4. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    SciTech Connect

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.


    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. /sup 32/P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA.

  5. Transcriptional termination in mammals: Stopping the RNA polymerase II juggernaut

    PubMed Central

    Proudfoot, Nick J.


    Terminating transcription is a highly intricate process for mammalian protein-coding genes. First, the chromatin template slows down transcription at the gene end. Then, the transcript is cleaved at the poly(A) signal to release the messenger RNA.The remaining transcript is selectively unraveled and degraded. This induces critical conformational changes in the heart of the enzyme that trigger termination. Termination can also occur at variable positions along the gene and so prevent aberrant transcript formation or intentionally make different transcripts.These may form multiple messenger RNAs with altered regulatory properties or encode different proteins. Finally, termination can be perturbed to achieve particular cellular needs or blocked in cancer or virally infected cells. In such cases, failure to terminate transcription can spell disaster for the cell. PMID:27284201

  6. Microprocessor mediates transcriptional termination of long noncoding RNA transcripts hosting microRNAs.


    Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L


    MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.

  7. Traffic into silence: endomembranes and post-transcriptional RNA silencing

    PubMed Central

    Kim, Yun Ju; Maizel, Alexis; Chen, Xuemei


    microRNAs (miRNAs) and small interfering RNAs (siRNAs) are small RNAs that repress gene expression at the post-transcriptional level in plants and animals. Small RNAs guide Argonaute-containing RNA-induced silencing complexes to target RNAs in a sequence-specific manner, resulting in mRNA deadenylation followed by exonucleolytic decay, mRNA endonucleolytic cleavage, or translational inhibition. Although our knowledge of small RNA biogenesis, turnover, and mechanisms of action has dramatically expanded in the past decade, the subcellular location of small RNA-mediated RNA silencing still needs to be defined. In contrast to the prevalent presumption that RNA silencing occurs in the cytosol, emerging evidence reveals connections between the endomembrane system and small RNA activities in plants and animals. Here, we summarize the work that uncovered this link between small RNAs and endomembrane compartments and present an overview of the involvement of the endomembrane system in various aspects of RNA silencing. We propose that the endomembrane system is an integral component of RNA silencing that has been long overlooked and predict that a marriage between cell biology and RNA biology holds the key to a full understanding of post-transcriptional gene regulation by small RNAs. PMID:24668229

  8. Nascent transcription affected by RNA polymerase IV in Zea mays.


    Erhard, Karl F; Talbot, Joy-El R B; Deans, Natalie C; McClish, Allison E; Hollick, Jay B


    All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3'-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance.

  9. Inhibition of hepatitis B virus (HBV) by LNA-mediated nuclear interference with HBV DNA transcription

    SciTech Connect

    Sun, Zhen; Xiang, Wenqing; Guo, Yajuan; Chen, Zhi; Liu, Wei; Lu, Daru


    Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry of oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.

  10. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William


    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  11. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Sträßer, Katja


    ABSTRACT RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  12. The RNA-induced transcriptional silencing complex targets chromatin exclusively via interacting with nascent transcripts

    PubMed Central

    Shimada, Yukiko; Mohn, Fabio; Bühler, Marc


    Small RNAs regulate chromatin modification and transcriptional gene silencing across the eukaryotic kingdom. Although these processes have been well studied, fundamental mechanistic aspects remain obscure. Specifically, it is unclear exactly how small RNA-loaded Argonaute protein complexes target chromatin to mediate silencing. Here, using fission yeast, we demonstrate that transcription of the target locus is essential for RNA-directed formation of heterochromatin. However, high transcriptional activity is inhibitory; thus, a transcriptional window exists that is optimal for silencing. We further found that pre-mRNA splicing is compatible with RNA-directed heterochromatin formation. However, the kinetics of pre-mRNA processing is critical. Introns close to the 5′ end of a transcript that are rapidly spliced result in a bistable response whereby the target either remains euchromatic or becomes fully silenced. Together, our results discount siRNA–DNA base pairing in RNA-mediated heterochromatin formation, and the mechanistic insights further reveal guiding paradigms for the design of small RNA-directed chromatin silencing studies in multicellular organisms. PMID:27941123

  13. RNA-Seq profiling reveals novel hepatic gene expression pattern in aflatoxin B1 treated rats.


    Merrick, B Alex; Phadke, Dhiral P; Auerbach, Scott S; Mav, Deepak; Stiegelmeyer, Suzy M; Shah, Ruchir R; Tice, Raymond R


    Deep sequencing was used to investigate the subchronic effects of 1 ppm aflatoxin B1 (AFB1), a potent hepatocarcinogen, on the male rat liver transcriptome prior to onset of histopathological lesions or tumors. We hypothesized RNA-Seq would reveal more differentially expressed genes (DEG) than microarray analysis, including low copy and novel transcripts related to AFB1's carcinogenic activity compared to feed controls (CTRL). Paired-end reads were mapped to the rat genome (Rn4) with TopHat and further analyzed by DESeq and Cufflinks-Cuffdiff pipelines to identify differentially expressed transcripts, new exons and unannotated transcripts. PCA and cluster analysis of DEGs showed clear separation between AFB1 and CTRL treatments and concordance among group replicates. qPCR of eight high and medium DEGs and three low DEGs showed good comparability among RNA-Seq and microarray transcripts. DESeq analysis identified 1,026 differentially expressed transcripts at greater than two-fold change (p<0.005) compared to 626 transcripts by microarray due to base pair resolution of transcripts by RNA-Seq, probe placement within transcripts or an absence of probes to detect novel transcripts, splice variants and exons. Pathway analysis among DEGs revealed signaling of Ahr, Nrf2, GSH, xenobiotic, cell cycle, extracellular matrix, and cell differentiation networks consistent with pathways leading to AFB1 carcinogenesis, including almost 200 upregulated transcripts controlled by E2f1-related pathways related to kinetochore structure, mitotic spindle assembly and tissue remodeling. We report 49 novel, differentially-expressed transcripts including confirmation by PCR-cloning of two unique, unannotated, hepatic AFB1-responsive transcripts (HAfT's) on chromosomes 1.q55 and 15.q11, overexpressed by 10 to 25-fold. Several potentially novel exons were found and exon refinements were made including AFB1 exon-specific induction of homologous family members, Ugt1a6 and Ugt1a7c. We find the

  14. Transcript quantitation in total yeast cellular RNA using kinetic PCR

    PubMed Central

    Kang, John J.; Watson, Robert M.; Fisher, Mary E.; Higuchi, Russell; Gelfand, David H.; Holland, Michael J.


    Kinetically monitored, reverse transcriptase-initiated PCR (kinetic RT–PCR, kRT–PCR) is a novel application of kinetic PCR for high throughput transcript quantitation in total cellular RNA. The assay offers the simplicity and flexibility of an enzyme assay with distinct advantages over DNA microarray hybridization and SAGE technologies for certain applications. The reproducibility, sensitivity and accuracy of the kRT–PCR were assessed for yeast transcripts previously quantitated by a variety of methods including SAGE analysis. Changes in transcript levels between different genetic or physiological cell states were reproducibly quantitated with an accuracy of ±20%. The assay was sufficiently sensitive to quantitate yeast transcripts over a range of more than five orders of magnitude, including low abundance transcripts encoding cell cycle and transcriptional regulators. PMID:10606670

  15. The hepatitis B virus X protein increases the cellular level of TATA-binding protein, which mediates transactivation of RNA polymerase III genes

    SciTech Connect

    Wang, Horng-Dar; Johnson, D.L.; Yuh, Chio-Hwa


    This report decribes the mechanism by which the hepatitis B virus X gene product induces RNA polymerase III genes. The RNA pol III transcription system serves as model for understanding the mechanism of X in the transactivation of cellular genes in both Drosophila and rat cell lines. 53 refs., 7 figs., 1 tab.

  16. Molecular breeding of Saccharomyces cerevisiae with high RNA content by harnessing essential ribosomal RNA transcription regulator.


    Sasano, Yu; Kariya, Takahiro; Usugi, Shogo; Sugiyama, Minetaka; Harashima, Satoshi


    As yeast is commonly used for RNA production, it is industrially important to breed strains with high RNA contents. The upstream activating factor (UAF) plays an important role in transcription of ribosomal RNA (rRNA), a major constituent of intracellular RNA species. Here, we targeted the essential rRNA transcription regulator Rrn5 of Saccharomyces cerevisiae, a component of the UAF complex, and disrupted the genomic RRN5 gene using a helper plasmid carrying an RRN5 gene. Then we isolated nine suppressor mutants (Sup mutants) of RRN5 gene disruption, causing deficiency in rRNA transcription. The Sup mutants had RNA contents of approximately 40% of the wild type level and expansion of rDNA repeats to ca. 400-700 copies. Reintroduction of a functional RRN5 gene into Sup mutants caused a reduction in the number of rDNA repeats to close to the wild type level but did not change RNA content. However, we found that reintroduction of RRN5 into the Sup16 mutant (in which the FOB1 gene encoding the rDNA replication fork barrier site binding protein was disrupted) resulted in a significant increase (17%) in RNA content compared with wild type, although the rDNA repeat copy number was almost identical to the wild type strain. In this case, upregulated transcription of non-transcribed spacers (NTS) occurred, especially in the NTS2 region; this was likely mediated by RNA polymerase II and accounted for the increased RNA content. Thus, we propose a novel breeding strategy for developing high RNA content yeast by harnessing the essential rRNA transcription regulator.

  17. Interplay between SIRT1 and hepatitis B virus X protein in the activation of viral transcription.


    Deng, Jian-Jun; Kong, Ka-Yiu Edwin; Gao, Wei-Wei; Tang, Hei-Man Vincent; Chaudhary, Vidyanath; Cheng, Yun; Zhou, Jie; Chan, Chi-Ping; Wong, Danny Ka-Ho; Yuen, Man-Fung; Jin, Dong-Yan


    Hepatitis B virus (HBV) genome is organized into a minichromosome known as covalently closed circular DNA (cccDNA), which serves as the template for all viral transcripts. SIRT1 is an NAD(+)-dependent protein deacetylase which activates HBV transcription by promoting the activity of cellular transcription factors and coactivators. How SIRT1 and viral transactivator X protein (HBx) might affect each other remains to be clarified. In this study we show synergy and mutual dependence between SIRT1 and HBx in the activation of HBV transcription. All human sirtuins SIRT1 through SIRT7 activated HBV gene expression. The steady-state levels of SIRT1 protein were elevated in HBV-infected liver tissues and HBV-replicating hepatoma cells. SIRT1 interacted with HBx and potentiated HBx transcriptional activity on precore promoter and covalently closed circular DNA (cccDNA) likely through a deacetylase-independent mechanism, leading to more robust production of cccDNA, pregenomic RNA and surface antigen. SIRT1 and HBx proteins were more abundant when both were expressed. SIRT1 promoted the recruitment of HBx as well as cellular transcriptional factors and coactivators such as PGC-1α and FXRα to cccDNA. Depletion of SIRT1 suppressed HBx recruitment. On the other hand, SIRT1 recruitment to cccDNA was compromised when HBx was deficient. Whereas pharmaceutical agonists of SIRT1 such as resveratrol activated HBV transcription, small-molecule inhibitors of SIRT1 including sirtinol and Ex527 exhibited anti-HBV activity. Taken together, our findings revealed not only the interplay between SIRT1 and HBx in the activation of HBV transcription but also new strategies and compounds for developing antivirals against HBV.

  18. A heteromeric transcription factor required for mammalian RNA polymerase II.

    PubMed Central

    Kitajima, S; Tanaka, Y; Kawaguchi, T; Nagaoka, T; Weissman, S M; Yasukochi, Y


    A general transcription factor, FC, essential for specific initiation of in vitro transcription by mammalian RNA polymerase II was identified and a procedure developed to purify it to near homogeneity from HeLa cell nuclei. Purified FC is composed of two polypeptides of apparent molecular masses 80 kDa and 30 kDa, on SDS-PAGE, and has a native size of 280 kDa estimated by gel filtration column. Both polypeptides were shown to be essential for reconstituting in vitro transcription activity. Biochemical analysis showed that the 80 kDa and 30 kDa components were present in a 1:1 molar ratio. FC was also demonstrated to interact directly or indirectly with purified RNA polymerase II. Similarities between FC and transcription factors reported by others from human, rat or Drosophila cells are discussed. Images PMID:2395645

  19. Repairing RNA Transcripts that Mediate Breast Cancer Susceptibility

    DTIC Science & Technology


    is actually the yield of TES product plus the yield of cryptic is in contrast to hammerhead and hairpin ribozymes , which products. This increases the...therapeutics. To this end, we have developed a novel biomolecule (a ribozyme ) that can specifically excise regions from RNA transcripts. In this work, we...designed a ribozyme that excises an insertion mutation that is linked to breast cancer predisposition from a short mimic of the p53 transcript in a

  20. Swinger RNA self-hybridization and mitochondrial non-canonical swinger transcription, transcription systematically exchanging nucleotides.


    Seligmann, Hervé


    Stem-loop hairpins punctuate mitochondrial post-transcriptional processing. Regulation of mitochondrial swinger transcription, transcription producing RNAs matching the mitogenome only assuming systematic exchanges between nucleotides (23 bijective transformations along 9 symmetric exchanges X<>Y, e.g. A<>G, and 14 asymmetric exchanges X>Y>Z>X, e.g. A>G>C>A) remains unknown. Does swinger RNA self-hybridization regulate swinger, as regular, transcription? Groups of 8 swinger transformations share canonical self-hybridization properties within each group, group 0 includes identity (regular) transcription. The human mitogenome has more stem-loop hairpins than randomized sequences for all groups. Group 2 transformations reveal complementarity of the light strand replication origin (OL) loop and a neighboring tRNA gene, detecting the longtime presumed OL/tRNA homology. Non-canonical G=U pairings in hairpins increases with swinger RNA detection. These results confirm biological relevancy of swinger-transformed DNA/RNA, independently of, and in combination with, previously detected swinger DNA/RNA and swinger peptides. Swinger-transformed mitogenomes include unsuspected multilayered information.

  1. Mechanism for the autogenous control of the crp operon: transcriptional inhibition by a divergent RNA transcript.

    PubMed Central

    Okamoto, K; Freundlich, M


    Expression of the crp gene is negatively autoregulated by the complex of cyclic AMP and its receptor protein (cAMP-CRP). We find a second promoter in this region that is strongly activated in vitro and in vivo by cAMP-CRP. Transcription from this promoter is initiated 3 nucleotides upstream and on the opposite strand from the start of crp mRNA. The addition of the purified 5' segment of the divergent RNA specifically inhibits crp transcription in vitro. cAMP-CRP does not block crp expression if the new promoter is altered so that divergent RNA cannot be made. The initial nucleotides of the divergent RNA are complementary to 10 of the first 11 nucleotides of the crp mRNA. Since the next 11 nucleotides of crp mRNA are A + U-rich, and RNA hybrid between the divergent RNA and the 5' end of crp mRNA could produce a structure similar to a rho-independent terminator, leading to inhibition of crp transcription. Images PMID:2425359

  2. Transcription of a yeast ribosomal RNA minigene in Saccharomyces cerevisiae.

    PubMed Central

    Quincey, R V; Arnold, R E


    A transcription system using intact yeast has been developed for investigating which sequences are implicated in the initiation of transcription of yeast rRNA genes. The system employs an rRNA minigene that consists of the initiation and termination sites for rRNA biosynthesis separated by approx. 700 base pairs of vector DNA in the Escherichia coli-yeast shuttle vector, pJDB207. Two recombinants containing this minigene were constructed; one retained all of the nontranscribed spacer DNA upstream from the initiation site, the other retained 208 base pairs of this DNA. Transcripts of this structurally unique minigene in RNA from yeast transformed with these recombinants were readily detected by nuclease S1 mapping. These transcripts were initiated at the site used by the host rRNA genes, were approx. 3-fold more abundant in the recombinant retaining all of the nontranscribed spacer and were less abundant when the yeast was not growing. Images Fig. 4. Fig. 5. Fig. 6. PMID:6097222

  3. Giardia lamblia RNA polymerase II: amanitin-resistant transcription.


    Seshadri, Vishwas; McArthur, Andrew G; Sogin, Mitchell L; Adam, Rodney D


    Giardia lamblia is an early branching eukaryote, and although distinctly eukaryotic in its cell and molecular biology, transcription and translation in G. lamblia demonstrate important differences from these processes in higher eukaryotes. The cyclic octapeptide amanitin is a relatively selective inhibitor of eukaryotic RNA polymerase II (RNAP II) and is commonly used to study RNAP II transcription. Therefore, we measured the sensitivity of G. lamblia RNAP II transcription to alpha-amanitin and found that unlike most other eukaryotes, RNAP II transcription in Giardia is resistant to 1 mg/ml amanitin. In contrast, 50 microg/ml amanitin inhibits 85% of RNAP III transcription activity using leucyl-tRNA as a template. To better understand transcription in G. lamblia, we identified 10 of the 12 known eukaryotic rpb subunits, including all 10 subunits that are required for viability in Saccharomyces cerevisiae. The amanitin motif (amanitin binding site) of Rpb1 from G. lamblia has amino acid substitutions at six highly conserved sites that have been associated with amanitin resistance in other organisms. These observations of amanitin resistance of Giardia RNA polymerase II support previous proposals of the mechanism of amanitin resistance in other organisms and provide a molecular framework for the development of novel drugs with selective activity against G. lamblia.

  4. The metabolic sensors FXRα, PGC-1α, and SIRT1 cooperatively regulate hepatitis B virus transcription.


    Curtil, Claire; Enache, Liviu S; Radreau, Pauline; Dron, Anne-Gaëlle; Scholtès, Caroline; Deloire, Alexandre; Roche, Didier; Lotteau, Vincent; André, Patrice; Ramière, Christophe


    Hepatitis B virus (HBV) genome transcription is highly dependent on liver-enriched, metabolic nuclear receptors (NRs). Among others, NR farnesoid X receptor α (FXRα) enhances HBV core promoter activity and pregenomic RNA synthesis. Interestingly, two food-withdrawal-induced FXRα modulators, peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1α) and deacetylase SIRT1, have been found to be associated with HBV genomes ex vivo. Whereas PGC-1α induction was shown to increase HBV replication, the effect of SIRT1 on HBV transcription remains unknown. Here, we showed that, in hepatocarcinoma-derived Huh-7 cells, combined activation of FXRα by GW4064 and SIRT1 by activator 3 increased HBV core promoter-controlled luciferase expression by 25-fold, compared with a 10-fold increase with GW4064 alone. Using cell lines differentially expressing FXRα in overexpression and silencing experiments, we demonstrated that SIRT1 activated the core promoter in an FXRα- and PGC-1α-dependent manner. Maximal activation (>150-fold) was observed in FXRα- and PGC-1α-overexpressing Huh-7 cells treated with FXRα and SIRT1 activators. Similarly, in cells transfected with full-length HBV genomes, maximal induction (3.5-fold) of core promoter-controlled synthesis of 3.5-kb RNA was observed in the same conditions of transfection and treatments. Thus, we identified a subnetwork of metabolic factors regulating HBV replication, strengthening the hypothesis that transcription of HBV and metabolic genes is similarly controlled.

  5. Gastrointestinal hormone mRNA expression in human colonic adenocarcinomas, hepatic metastases and cell lines

    PubMed Central

    Monges, G; Biagini, P; Cantaloube, J F; De Micco, P; Parriaux, D; Seitz, J F; Delpero, J R; Hassoun, J


    Aims—(1) To investigate the expression of the four main hormones of the digestive tract by performing reverse transcription polymerase chain reaction (RT-PCR) on a series of samples, comprising tumoral and healthy colonic tissues, hepatic metastases and colonic cell line samples; and (2) to study the patterns of labelling obtained with serological and morphological markers. Methods—After extraction and reverse transcription, gastrin, somatostatin, cholecystokinin (CCK) and transforming growth factor α (TGFα) mRNAs were detected by PCR and nested PCR using specific primers. The corresponding proteins were detected by immunohistochemistry. Results—The cell lines expressed all four mRNAs. Gastrin mRNA was present in most tumoral and metastatic samples, while the somatostatin transcript was detected in all samples and was frequently overexpressed in the normal colon. TGFα mRNA was expressed systematically in tumours of the right and transverse colon, but not in those located in the left colon; the expression of CCK mRNA was systematically absent in the left colon. Conclusions—The data presented here shed some light on the transcriptional events involved in the production of the various hormones present in the gastrointestinal tract, in both healthy and tumoral tissues. The various mRNAs expressed in cell lines are therefore not systematically expressed in the human pathology. Images PMID:16696065

  6. Inhibition of Hepatitis B virus cccDNA replication by siRNA

    SciTech Connect

    Li Guiqiu; Gu Hongxi . E-mail:; Li Di; Xu Weizhen


    The development of an effective therapy for Hepatitis B virus (HBV) infection is still a challenge. Progress in RNA interference (RNAi) has shed slight on developing a new anti-HBV strategy. Here, we present a series of experiments showing a significant reduction in HBV transcripts and replication intermediates in HepG2.2.15 cells by vector-based siRNA targeted nuclear localization signal (NLS) region. More importantly, we showed that siRNA1 markedly inhibited HBV covalently closed circular DNA (cccDNA) replication. Our results indicated that HBV NLS may serve as a novel RNAi target to combat HBV infection, which can enhance anti-HBV efficacy and overcome the drawbacks of current therapies.

  7. Control of Transcriptional Elongation by RNA Polymerase II: A Retrospective.


    Brannan, Kris; Bentley, David L


    The origins of our current understanding of control of transcription elongation lie in pioneering experiments that mapped RNA polymerase II on viral and cellular genes. These studies first uncovered the surprising excess of polymerase molecules that we now know to be situated at the at the 5' ends of most genes in multicellular organisms. The pileup of pol II near transcription start sites reflects a ubiquitous bottle-neck that limits elongation right at the start of the transcription elongation. Subsequent seminal work identified conserved protein factors that positively and negatively control the flux of polymerase through this bottle-neck, and make a major contribution to control of gene expression.

  8. L_RNA_scaffolder: scaffolding genomes with transcripts

    PubMed Central


    Background Generation of large mate-pair libraries is necessary for de novo genome assembly but the procedure is complex and time-consuming. Furthermore, in some complex genomes, it is hard to increase the N50 length even with large mate-pair libraries, which leads to low transcript coverage. Thus, it is necessary to develop other simple scaffolding approaches, to at least solve the elongation of transcribed fragments. Results We describe L_RNA_scaffolder, a novel genome scaffolding method that uses long transcriptome reads to order, orient and combine genomic fragments into larger sequences. To demonstrate the accuracy of the method, the zebrafish genome was scaffolded. With expanded human transcriptome data, the N50 of human genome was doubled and L_RNA_scaffolder out-performed most scaffolding results by existing scaffolders which employ mate-pair libraries. In these two examples, the transcript coverage was almost complete, especially for long transcripts. We applied L_RNA_scaffolder to the highly polymorphic pearl oyster draft genome and the gene model length significantly increased. Conclusions The simplicity and high-throughput of RNA-seq data makes this approach suitable for genome scaffolding. L_RNA_scaffolder is available at PMID:24010822

  9. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.


    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  10. Histones are required for transcription of yeast rRNA genes by RNA polymerase I.


    Tongaonkar, Prasad; French, Sarah L; Oakes, Melanie L; Vu, Loan; Schneider, David A; Beyer, Ann L; Nomura, Masayasu


    Nucleosomes and their histone components have generally been recognized to act negatively on transcription. However, purified upstream activating factor (UAF), a transcription initiation factor required for RNA polymerase (Pol) I transcription in Saccharomyces cerevisiae, contains histones H3 and H4 and four nonhistone protein subunits. Other studies have shown that histones H3 and H4 are associated with actively transcribed rRNA genes. To examine their functional role in Pol I transcription, we constructed yeast strains in which synthesis of H3 is achieved from the glucose-repressible GAL10 promoter. We found that partial depletion of H3 (approximately 50% depletion) resulted in a strong inhibition (>80%) of Pol I transcription. A combination of biochemical analysis and electron microscopic (EM) analysis of Miller chromatin spreads indicated that initiation and elongation steps and rRNA processing were compromised upon histone depletion. A clear decrease in relative amounts of UAF, presumably caused by reduced stability, was also observed under the conditions of H3 depletion. Therefore, the observed inhibition of initiation can be explained, in part, by the decrease in UAF concentration. In addition, the EM results suggested that the defects in rRNA transcript elongation and processing may be a result of loss of histones from rRNA genes rather than (or in addition to) an indirect consequence of effects of histone depletion on expression of other genes. Thus, these results show functional importance of histones associated with actively transcribed rRNA genes.

  11. Applications of competitor RNA in diagnostic reverse transcription-PCR.


    Kleiboeker, Steven B


    Detection of RNA viruses by reverse transcription (RT)-PCR has proven to be a useful approach for the diagnosis of infections caused by many viral pathogens. However, adequate controls are required for each step of the RT-PCR protocol to ensure the accuracies of diagnostic test results. Heterologous competitor RNA can be used as a control for a number of different aspects of diagnostic RT-PCR. Competitor RNA can be applied to assessments of the efficiency of RNA recovery during extraction procedures, detection of endogenous RT-PCR inhibitors that could lead to false-negative results, and quantification of viral template in samples used for diagnosis; competitor RNA can also be used as a positive control for the RT-PCR. In the present study, heterologous competitor RNA was synthesized by a method that uses two long oligonucleotide primers containing primer binding sites for RT-PCR amplification of porcine reproductive and respiratory syndrome virus or West Nile virus. Amplification of the competitor RNA by RT-PCR resulted in a product that was easily distinguished from the amplification product of viral RNA by agarose gel electrophoresis. Assessment of a variety of RNA samples prepared from routine submissions to a veterinary diagnostic laboratory found that either partial or complete inhibition of the RT-PCR could be demonstrated for approximately 20% of the samples. When inhibition was detected, either dilution of the sample or RNA extraction by an alternative protocol proved successful in eliminating the source of inhibition.

  12. Characterization of CRISPR RNA transcription by exploiting stranded metatranscriptomic data

    PubMed Central

    Ye, Yuzhen; Zhang, Quan


    CRISPR–Cas systems are bacterial adaptive immune systems, each typically composed of a locus of cas genes and a CRISPR array of spacers flanked by repeats. Processed transcripts of CRISPR arrays (crRNAs) play important roles in the interference process mediated by these systems, guiding targeted immunity. Here we developed computational approaches that allow us to characterize the expression of many CRISPRs in their natural environments, using community RNA-seq (metatranscriptomic) data. By exploiting public human gut metatranscriptomic data sets, we studied the expression of 56 repeat-sequence types of CRISPRs, revealing that most CRISPRs are transcribed in one direction (producing crRNAs). In rarer cases, including a type II system associated with Bacteroides fragilis, CRISPRs are transcribed in both directions. Type III CRISPR–Cas systems were found in the microbiomes, but metatranscriptomic reads were barely found for their CRISPRs. We observed individual-level variation of the crRNA transcription, and an even greater transcription of a CRISPR from the antisense strand than the crRNA strand in one sample. The orientations of CRISPR expression implicated by metatranscriptomic data are largely in agreement with prior predictions for CRISPRs, with exceptions. Our study shows the promise of exploiting community RNA-seq data for investigating the transcription of CRISPR–Cas systems. PMID:27190232

  13. In vitro transcription of a cloned mouse ribosomal RNA gene.

    PubMed Central

    Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M


    An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

  14. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone


    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  15. Transcription of Inflammatory Genes: Long Noncoding RNA and Beyond

    PubMed Central

    Carpenter, Susan


    The innate immune system must coordinate elaborate signaling pathways to turn on expression of hundreds of genes to provide protection against pathogens and resolve acute inflammation. Multiple genes within distinct functional categories are coordinately and temporally regulated by transcriptional on and off switches in response to distinct external stimuli. Three classes of transcription factors act together with transcriptional coregulators and chromatin-modifying complexes to control these programs. In addition, newer studies implicate long noncoding RNA (lncRNA) as additional regulators of these responses. LncRNAs promote, fine-tune, and restrain the inflammatory program. In this study, we provide an overview of gene regulation and the emerging importance of lncRNAs in the immune system. PMID:25250698

  16. Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.


    Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang


    MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs.

  17. Rapid detection of duck hepatitis virus type-1 by reverse transcription loop-mediated isothermal amplification.


    Song, Cuiping; Wan, Hongquan; Yu, Shengqing; Han, Xiangan; Qiu, Xusheng; Hu, Qinghai; Tan, Lei; Ding, Chan


    A reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of duck hepatitis virus type-1 (DHV-1) was established. Using primers specific to the highly conserved 3D gene of DHV-1, the developed RT-LAMP assay detected the viral RNA of DHV-1 extracted from both allantoic fluid and liver samples of infected ducks. The assay is as sensitive as RT-PCR, and shows no cross-reaction with other common avian viral and bacterial pathogens. In addition to detection via ethidium bromide staining following gel electrophoresis, naked-eye observation after staining with SYBR Green I dye can be used to detect RT-LAMP products; this enables field application of this assay. The findings demonstrate that RT-LAMP can serve as a helpful tool for the detection and surveillance of DHV-1 in the poultry industry.

  18. Mechanism of histone survival during transcription by RNA polymerase II.


    Kulaeva, Olga I; Studitsky, Vasily M


    This work is related to and stems from our recent NSMB paper, "Mechanism of chromatin remodeling and recovery during passage of RNA polymerase II" (December 2009). Synopsis. Recent genomic studies from many laboratories have suggested that nucleosomes are not displaced from moderately transcribed genes. Furthermore, histones H3/H4 carrying the primary epigenetic marks are not displaced or exchanged (in contrast to H2A/H2B histones) during moderate transcription by RNA polymerase II (Pol II) in vivo. These exciting observations suggest that the large molecule of Pol II passes through chromatin structure without even transient displacement of H3/H4 histones. The most recent analysis of the RNA polymerase II (Pol II)-type mechanism of chromatin remodeling in vitro (described in our NSMB 2009 paper) suggests that nucleosome survival is tightly coupled with formation of a novel intermediate: a very small intranucleosomal DNA loop (Ø-loop) containing transcribing Pol II. In the submitted manuscript we critically evaluate one of the key predictions of this model: the lack of even transient displacement of histones H3/H4 during Pol II transcription in vitro. The data suggest that, indeed, histones H3/H4 are not displaced during Pol II transcription in vitro. These studies are directly connected with the observation in vivo on the lack of exchange of histones H3/H4 during Pol II transcription.

  19. Molecular Basis for Coordinating Transcription Termination with Noncoding RNA Degradation

    PubMed Central

    Tudek, Agnieszka; Porrua, Odil; Kabzinski, Tomasz; Lidschreiber, Michael; Kubicek, Karel; Fortova, Andrea; Lacroute, François; Vanacova, Stepanka; Cramer, Patrick; Stefl, Richard; Libri, Domenico


    Summary The Nrd1-Nab3-Sen1 (NNS) complex is essential for controlling pervasive transcription and generating sn/snoRNAs in S. cerevisiae. The NNS complex terminates transcription of noncoding RNA genes and promotes exosome-dependent processing/degradation of the released transcripts. The Trf4-Air2-Mtr4 (TRAMP) complex polyadenylates NNS target RNAs and favors their degradation. NNS-dependent termination and degradation are coupled, but the mechanism underlying this coupling remains enigmatic. Here we provide structural and functional evidence demonstrating that the same domain of Nrd1p interacts with RNA polymerase II and Trf4p in a mutually exclusive manner, thus defining two alternative forms of the NNS complex, one involved in termination and the other in degradation. We show that the Nrd1-Trf4 interaction is required for optimal exosome activity in vivo and for the stimulation of polyadenylation of NNS targets by TRAMP in vitro. We propose that transcription termination and RNA degradation are coordinated by switching between two alternative partners of the NNS complex. PMID:25066235

  20. The RNA polymerase flow model of gene transcription.


    Edri, Shlomit; Gazit, Eran; Cohen, Eyal; Tuller, Tamir


    Gene expression is a fundamental cellular process by which proteins are synthesized based on the information coded in the genes. The two major steps of this process are the transcription of the DNA segment corresponding to a gene to mRNA molecules and the translation of the mRNA molecules to proteins by the ribosome. Thus, understanding, modeling and engineering the different stages of this process have both important biotechnological applications and contributions to basic life science. In previous studies we have introduced the Homogenous Ribosome Flow Model (HRFM) and demonstrated its advantages in analyses of the translation process. In this study we introduce the RNA Polymerase Flow Model (RPFM), a non trivial extension of the HRFM, which also includes a backward flow and can be used for modeling transcription and maybe other similar processes. We compare the HRFM and the RPFM in the three regimes of the transcription process: rate limiting initiation, rate limiting elongation and rate limiting termination via a simulative and analytical analysis. In addition, based on experimental data, we show that RPFM is a better choice for modeling transcription process.

  1. Transcription of ribosomal RNA: the role of antitermination of RNA polymerase

    NASA Astrophysics Data System (ADS)

    Klumpp, Stefan; Hwa, Terry


    The genes encoding ribosomal RNA are transcribed at high rates of 1-2 transcripts per second. These high transcription rates are crucial to maintain the large concentration of ribosomes necessary in fast growing bacteria. To understand how transcription is regulated under these conditions, we developed a model for the traffic of transcribing RNA polymerases (RNAP). Our simulations show that the transcription rate is limited by the elongation stage of transcription rather than by transcript initiation. The maximal transcription rate is severly impaired by RNAP pausing with pause durations in the second range which is ubiquitous under single-molecule conditions. We propose that ribosomal antitermination reduces pauses and thereby increases the transcription rate. This idea is in quantitative agreement with the observed increase of the elongation rate due to antitermination and predicts a two-fold increase of the transcription rate. Antitermination must be highly efficient, since incomplete antitermination with only a few percent of non-antiterminated, i.e. slow, RNAPs completely abolishes its effect. This result suggests that rho-dependent termination may selectively terminate slow RNAPs.

  2. Bacterial RNA polymerase can retain σ70 throughout transcription.


    Harden, Timothy T; Wells, Christopher D; Friedman, Larry J; Landick, Robert; Hochschild, Ann; Kondev, Jane; Gelles, Jeff


    Production of a messenger RNA proceeds through sequential stages of transcription initiation and transcript elongation and termination. During each of these stages, RNA polymerase (RNAP) function is regulated by RNAP-associated protein factors. In bacteria, RNAP-associated σ factors are strictly required for promoter recognition and have historically been regarded as dedicated initiation factors. However, the primary σ factor in Escherichia coli, σ(70), can remain associated with RNAP during the transition from initiation to elongation, influencing events that occur after initiation. Quantitative studies on the extent of σ(70) retention have been limited to complexes halted during early elongation. Here, we used multiwavelength single-molecule fluorescence-colocalization microscopy to observe the σ(70)-RNAP complex during initiation from the λ PR' promoter and throughout the elongation of a long (>2,000-nt) transcript. Our results provide direct measurements of the fraction of actively transcribing complexes with bound σ(70) and the kinetics of σ(70) release from actively transcribing complexes. σ(70) release from mature elongation complexes was slow (0.0038 s(-1)); a substantial subpopulation of elongation complexes retained σ(70) throughout transcript elongation, and this fraction depended on the sequence of the initially transcribed region. We also show that elongation complexes containing σ(70) manifest enhanced recognition of a promoter-like pause element positioned hundreds of nucleotides downstream of the promoter. Together, the results provide a quantitative framework for understanding the postinitiation roles of σ(70) during transcription.

  3. RNA-directed DNA methylation induces transcriptional activation in plants

    PubMed Central

    Shibuya, Kenichi; Fukushima, Setsuko; Takatsuji, Hiroshi


    A class-C floral homeotic gene of Petunia, pMADS3, is specifically expressed in the stamen and carpels of developing flowers. We had previously reported the ect-pMADS3 phenomenon in which introduction of a part of the pMADS3 genomic sequence, including intron 2, induces ectopic expression of endogenous pMADS3. Unlike transcriptional or posttranscriptional gene silencing triggered by the introduction of homologous sequences, this observation is unique in that the gene expression is up-regulated. In this study, we demonstrated that the ect-pMADS3 phenomenon is due to transcriptional activation based on RNA-directed DNA methylation (RdDM) occurring in a particular CG in a putative cis-element in pMADS3 intron 2. The CG methylation was maintained over generations, along with pMADS3 ectopic expression, even in the absence of RNA triggers. These results demonstrate a previously undescribed transcriptional regulatory mechanism that could lead to the generation of a transcriptionally active epiallele, thereby contributing to plant evolution. Our results also reveal a putative negative cis-element for organ-specific transcriptional regulation of class-C floral homeotic genes, which could be difficult to identify by other approaches. PMID:19164525

  4. Post-transcriptional gene regulation by mRNA modifications

    PubMed Central

    Zhao, Boxuan Simen; Roundtree, Ian A.; He, Chuan


    The recent discovery of reversible mRNA methylation has opened a new realm of post-transcriptional gene regulation in eukaryotes. The identification and functional characterization of proteins that specifically recognize RNA N6-methyladenosine (m6A) unveiled it as a modification that cells utilize to accelerate mRNA metabolism and translation. N6-adenosine methylation directs mRNAs to distinct fates by grouping them for differential processing, translation and decay in processes such as cell differentiation, embryonic development and stress responses. Other mRNA modifications, including N1-methyladenosine (m1A), 5-methylcytosine (m5C) and pseudouridine, together with m6A form the epitranscriptome and collectively code a new layer of information that controls protein synthesis. PMID:27808276

  5. RNA-eXpress annotates novel transcript features in RNA-seq data.


    Forster, Samuel C; Finkel, Alexander M; Gould, Jodee A; Hertzog, Paul J


    Next-generation sequencing is rapidly becoming the approach of choice for transcriptional analysis experiments. Substantial advances have been achieved in computational approaches to support these technologies. These approaches typically rely on existing transcript annotations, introducing a bias towards known genes, require specific experimental design and computational resources, or focus only on identification of splice variants (ignoring other biologically relevant transcribed features contained within the data that may be important for downstream analysis). Biologically relevant transcribed features also include large and small non-coding RNA, new transcription start sites, alternative promoters, RNA editing and processing of coding transcripts. Also, many existing solutions lack accessible interfaces required for wide scale adoption. We present a user-friendly, rapid and computation-efficient feature annotation framework (RNA-eXpress) that enables identification of transcripts and other genomic and transcriptional features independently of current annotations. RNA-eXpress accepts mapped reads in the standard binary alignment (BAM) format and produces a study-specific feature annotation in GTF format, comparison statistics, sequence extraction and feature counts. The framework is designed to be easily accessible while allowing advanced users to integrate new feature-identification algorithms through simple class extension, thus facilitating expansion to novel feature types or identification of study-specific feature types.

  6. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L


    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  7. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa


    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  8. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.


    Leśniewska, Ewa; Boguta, Magdalena


    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  9. Hepatic HNF1 transcription factors control the induction of PCSK9 mediated by rosuvastatin in normolipidemic hamsters.


    Dong, Bin; Singh, Amar Bahadur; Shende, Vikram Ravindra; Liu, Jingwen


    Proprotein convertase subtilisin/kexin type 9 (PCSK9) impedes low‑density lipoprotein (LDL) receptor (LDLR)-mediated LDL-cholesterol uptake and has hence emerged as a critical regulator of serum cholesterol levels and a new therapeutic target for the treatment of hypercholesterolemia. Statins have been shown to elevate circulating PCSK9 levels by stimulating PCSK9 gene transcription, which reduces the clinical efficacy of statin in LDL‑cholesterol reduction. The transcription of PCSK9 is partially controlled by the hepatocyte nuclear factor 1 (HNF1) binding site embedded in the proximal region of its promoter. In this study, we utilized adenoviral shRNA delivery vectors to generate liver-specific knockdown of HNF1α (Ad‑shHNF1α) or HNF1β (Ad‑shHNF1β) in hamsters to examine the impact of reduced hepatic expression of HNF1 transcription factors on statin‑induced elevation of PCSK9 expression and serum cholesterol levels. We showed that the administration of rosuvastatin (RSV) to normolipidemic hamsters significantly augmented hepatic PCSK9 expression and serum PCSK9 levels. In addition, RSV treatment increased hepatic HNF1α protein levels without a clear effect on HNF1α mRNA expression. Injection of Ad-shHNF1α or Ad‑shHNF1β into hamsters both blunted RSV‑induced elevation of PCSK9 serum concentration and hepatic mRNA and protein levels, which led to significant increases in liver LDLR protein abundance. Furthermore, hepatic depletion of HNF1 factors lowered circulating total cholesterol and non‑high density lipoprotein cholesterol levels in RSV‑treated hamsters. Our study demonstrates that both HNF1α and HNF1β are positive regulators of hepatic PCSK9 transcription in hamster species and that transient, liver-specific knockdown of either HNF1α or HNF1β could antagonize the RSV‑induced elevation of serum PCSK9 and reduce circulating cholesterol levels.

  10. Hepatic HNF1 transcription factors control the induction of PCSK9 mediated by rosuvastatin in normolipidemic hamsters.


    Dong, Bin; Singh, Amar Bahadur; Shende, Vikram Ravindra; Liu, Jingwen


    Proprotein convertase subtilisin/kexin type 9 (PCSK9) impedes low‑density lipoprotein (LDL) receptor (LDLR)-mediated LDL-cholesterol uptake and has hence emerged as a critical regulator of serum cholesterol levels and a new therapeutic target for the treatment of hypercholesterolemia. Statins have been shown to elevate circulating PCSK9 levels by stimulating PCSK9 gene transcription, which reduces the clinical efficacy of statin in LDL‑cholesterol reduction. The transcription of PCSK9 is partially controlled by the hepatocyte nuclear factor 1 (HNF1) binding site embedded in the proximal region of its promoter. In this study, we utilized adenoviral shRNA delivery vectors to generate liver-specific knockdown of HNF1α (Ad‑shHNF1α) or HNF1β (Ad‑shHNF1β) in hamsters to examine the impact of reduced hepatic expression of HNF1 transcription factors on statin‑induced elevation of PCSK9 expression and serum cholesterol levels. We showed that the administration of rosuvastatin (RSV) to normolipidemic hamsters significantly augmented hepatic PCSK9 expression and serum PCSK9 levels. In addition, RSV treatment increased hepatic HNF1α protein levels without a clear effect on HNF1α mRNA expression. Injection of Ad-shHNF1α or Ad‑shHNF1β into hamsters both blunted RSV‑induced elevation of PCSK9 serum concentration and hepatic mRNA and protein levels, which led to significant increases in liver LDLR protein abundance. Furthermore, hepatic depletion of HNF1 factors lowered circulating total cholesterol and non‑high density lipoprotein cholesterol levels in RSV‑treated hamsters. Our study demonstrates that both HNF1α and HNF1β are positive regulators of hepatic PCSK9 transcription in hamster species and that transient, liver-specific knockdown of either HNF1α or HNF1β could antagonize the RSV‑induced elevation of serum PCSK9 and reduce circulating cholesterol levels.

  11. Transcription by RNA polymerase III: insights into mechanism and regulation

    PubMed Central

    Turowski, Tomasz W.; Tollervey, David


    The highly abundant, small stable RNAs that are synthesized by RNA polymerase III (RNAPIII) have key functional roles, particularly in the protein synthesis apparatus. Their expression is metabolically demanding, and is therefore coupled to changing demands for protein synthesis during cell growth and division. Here, we review the regulatory mechanisms that control the levels of RNAPIII transcripts and discuss their potential physiological relevance. Recent analyses have revealed differential regulation of tRNA expression at all steps on its biogenesis, with significant deregulation of mature tRNAs in cancer cells. PMID:27911719

  12. Replication of poliovirus RNA and subgenomic RNA transcripts in transfected cells.

    PubMed Central

    Collis, P S; O'Donnell, B J; Barton, D J; Rogers, J A; Flanegan, J B


    Full-length and subgenomic poliovirus RNAs were transcribed in vitro and transfected into HeLa cells to study viral RNA replication in vivo. RNAs with deletion mutations were analyzed for the ability to replicate in either the absence or the presence of helper RNA by using a cotransfection procedure and Northern (RNA) blot analysis. An advantage of this approach was that viral RNA replication and genetic complementation could be characterized without first isolating conditional-lethal mutants. A subgenomic RNA with a large in-frame deletion in the capsid coding region (P1) replicated more efficiently than full-length viral RNA transcripts. In cotransfection experiments, both the full-length and subgenomic RNAs replicated at slightly reduced levels and appeared to interfere with each other's replication. In contrast, a subgenomic RNA with a similarly sized out-of-frame deletion in P1 did not replicate in transfected cells, either alone or in the presence of helper RNA. Similar results were observed with an RNA transcript containing a large in-frame deletion spanning the P1, P2, and P3 coding regions. A mutant RNA with an in-frame deletion in the P1-2A coding sequence was self-replicating but at a significantly reduced level. The replication of this RNA was fully complemented after cotransfection with a helper RNA that provided 2A in trans. A P1-2A-2B in-frame deletion, however, totally blocked RNA replication and was not complemented. Control experiments showed that all of the expected viral proteins were both synthesized and processed when the RNA transcripts were translated in vitro. Thus, our results indicated that 2A was a trans-acting protein and that 2B and perhaps other viral proteins were cis acting during poliovirus RNA replication in vivo. Our data support a model for poliovirus RNA replication which directly links the translation of a molecule of plus-strand RNA with the formation of a replication complex for minus-strand RNA synthesis. Images PMID

  13. Laser-mediated, site-specific inactivation of RNA transcripts

    PubMed Central

    Grate, Dilara; Wilson, Charles


    The biological function of specific gene products often is determined experimentally by blocking their expression in an organism and observing the resulting phenotype. Chromophore-assisted laser inactivation using malachite green (MG)-tagged antibodies makes it possible to inactivate target proteins in a highly restricted manner, probing their temporally and spatially resolved functions. In this report, we describe the isolation and in vitro characterization of a MG-binding RNA motif that may enable the same high-resolution analysis of gene function specifically at the RNA level (RNA-chromophore-assisted laser inactivation). A well-defined asymmetric internal bulge within an RNA duplex allows high affinity and high specificity binding by MG. Laser irradiation in the presence of low concentrations of MG induces destruction of the MG-binding RNA but not of coincubated control RNA. Laser-induced hydrolysis of the MG-binding RNA is restricted predominantly to a single nucleotide within the bulge. By appropriately incorporating this motif into a target gene, transcripts generated by the gene may be effectively tagged for laser-mediated destruction. PMID:10339553

  14. Antisense Transcript and RNA Processing Alterations Suppress Instability of Polyadenylated mRNA in Chlamydomonas Chloroplasts

    PubMed Central

    Nishimura, Yoshiki; Kikis, Elise A.; Zimmer, Sara L.; Komine, Yutaka; Stern, David B.


    In chloroplasts, the control of mRNA stability is of critical importance for proper regulation of gene expression. The Chlamydomonas reinhardtii strain Δ26pAtE is engineered such that the atpB mRNA terminates with an mRNA destabilizing polyadenylate tract, resulting in this strain being unable to conduct photosynthesis. A collection of photosynthetic revertants was obtained from Δ26pAtE, and gel blot hybridizations revealed RNA processing alterations in the majority of these suppressor of polyadenylation (spa) strains, resulting in a failure to expose the atpB mRNA 3′ poly(A) tail. Two exceptions were spa19 and spa23, which maintained unusual heteroplasmic chloroplast genomes. One genome type, termed PS+, conferred photosynthetic competence by contributing to the stability of atpB mRNA; the other, termed PS−, was required for viability but could not produce stable atpB transcripts. Based on strand-specific RT-PCR, S1 nuclease protection, and RNA gel blots, evidence was obtained that the PS+ genome stabilizes atpB mRNA by generating an atpB antisense transcript, which attenuates the degradation of the polyadenylated form. The accumulation of double-stranded RNA was confirmed by insensitivity of atpB mRNA from PS+ genome-containing cells to S1 nuclease digestion. To obtain additional evidence for antisense RNA function in chloroplasts, we used strain Δ26, in which atpB mRNA is unstable because of the lack of a 3′ stem-loop structure. In this context, when a 121-nucleotide segment of atpB antisense RNA was expressed from an ectopic site, an elevated accumulation of atpB mRNA resulted. Finally, when spa19 was placed in a genetic background in which expression of the chloroplast exoribonuclease polynucleotide phosphorylase was diminished, the PS+ genome and the antisense transcript were no longer required for photosynthesis. Taken together, our results suggest that antisense RNA in chloroplasts can protect otherwise unstable transcripts from 3′→5

  15. Correlation between hepatitis B virus protein and microRNA processor Drosha in cells expressing HBV.


    Ren, Min; Qin, Dongdong; Li, Kai; Qu, Jialin; Wang, Liying; Wang, Zengchan; Huang, Ailong; Tang, Hua


    Drosha regulates the biogenesis of microRNAs (miRNAs) and plays an essential role in the regulation of gene expression. Infection with hepatitis B virus (HBV) causes chronic hepatitis and liver cirrhosis. It is also a major risk factor for hepatocellular carcinoma. Emerging evidence suggests that HBV alters miRNA expression profiles, but the mechanisms underlying this process have not yet been fully elucidated. We therefore examined how HBV affected the production of miRNAs. We found that Drosha mRNA and protein expression were downregulated in cells expressing the HBV genome. This was associated with a reduction in the activity of the Drosha gene promoter. Gene silencing of HBx by RNA interference significantly restored the expression of Drosha. In conclusion, our data show that HBV could downregulate Drosha expression by inhibiting promoter activity, and the transcription factors SP1 and AP-2α may be involved in this process. This provides a new understanding of the mechanism of HBV-induced miRNAs dysregulation.

  16. Prevalence of hepatitis A viral RNA and antibodies among Chinese blood donors.


    Sun, P; Su, N; Lin, F Z; Ma, L; Wang, H J; Rong, X; Dai, Y D; Li, J; Jian, Z W; Tang, L H; Xiao, W; Li, C Q


    Like other developing countries, China was reported to have a relatively high seroprevalence of anti-hepatitis A antibodies (anti-HAV). However, no studies have evaluated the prevalence of anti-HAV and HAV RNA among voluntary blood donors with or without elevated serum alanine transaminase (ALT) levels. Anti-HAV antibodies were detected using an enzyme-linked immunosorbent assay, and reverse transcription quantitative polymerase chain reaction was carried out for detection of HAV RNA. In the current study, we analyzed a total of 450 serum samples with elevated ALT levels (≥40 U/L) and 278 serum samples with non-elevated ALT levels. Seroprevalence rates of anti-HAV were 51.6% in donors with elevated ALT and 41.4% in donors with non-elevated ALT; however, none of the samples was positive for HAV RNA. The results of our study showed lower seroprevalence rates of anti-HAV in blood donors (irrespective of ALT levels) than those in published data on Chinese populations. Although donors with elevated ALT had statistically higher prevalence rates of anti- HAV than did those with non-elevated ALT, none of the serum samples had detectable levels of the active virus. In conclusion, our results demonstrate that the transmission of hepatitis A by blood transfusion will occur rarely.

  17. Affinity capture and identification of host cell factors associated with hepatitis C virus (+) strand subgenomic RNA.


    Upadhyay, Alok; Dixit, Updesh; Manvar, Dinesh; Chaturvedi, Nootan; Pandey, Virendra N


    Hepatitis C virus (HCV) infection leading to chronic hepatitis is a major factor in the causation of liver cirrhosis, hepatocellular carcinoma, and liver failure. This process may involve the interplay of various host cell factors, as well as the interaction of these factors with viral RNA and proteins. We report a novel strategy using a sequence-specific biotinylated peptide nucleic acid (PNA)-neamine conjugate targeted to HCV RNA for the in situ capture of subgenomic HCV (+) RNA, along with cellular and viral factors associated with it in MH14 host cells. Using this affinity capture system in conjunction with LC/MS/MS, we have identified 83 cellular factors and three viral proteins (NS5B, NS5A, and NS3-4a protease-helicase) associated with the viral genome. The capture was highly specific. These proteins were not scored with cured MH14 cells devoid of HCV replicons because of the absence of the target sequence in cells for the PNA-neamine probe and also because, unlike oligomeric DNA, cellular proteins have no affinity for PNA. The identified cellular factors belong to different functional groups, including signaling, oncogenic, chaperonin, transcriptional regulators, and RNA helicases as well as DEAD box proteins, ribosomal proteins, translational regulators/factors, and metabolic enzymes, that represent a diverse set of cellular factors associated with the HCV RNA genome. Small interfering RNA-mediated silencing of a diverse class of selected proteins in an HCV replicon cell line either enhanced or inhibited HCV replication/translation, suggesting that these cellular factors have regulatory roles in HCV replication.

  18. Transcription Start Site Scanning and the Requirement for ATP during Transcription Initiation by RNA Polymerase II.


    Fishburn, James; Galburt, Eric; Hahn, Steven


    Saccharomyces cerevisiae RNA polymerase (Pol) II locates transcription start sites (TSS) at TATA-containing promoters by scanning sequences downstream from the site of preinitiation complex formation, a process that involves the translocation of downstream promoter DNA toward Pol II. To investigate a potential role of yeast Pol II transcription in TSS scanning, HIS4 promoter derivatives were generated that limited transcripts in the 30-bp scanned region to two nucleotides in length. Although we found that TSS scanning does not require RNA synthesis, our results revealed that transcription in the purified yeast basal system is largely ATP-independent despite a requirement for the TFIIH DNA translocase subunit Ssl2. This result is rationalized by our finding that, although they are poorer substrates, UTP and GTP can also be utilized by Ssl2. ATPγS is a strong inhibitor of rNTP-fueled translocation, and high concentrations of ATPγS make transcription completely dependent on added dATP. Limiting Pol II function with low ATP concentrations shifted the TSS position downstream. Combined with prior work, our results show that Pol II transcription plays an important role in TSS selection but is not required for the scanning reaction.

  19. Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds

    PubMed Central

    Zalatan, Jesse G.; Lee, Michael E.; Almeida, Ricardo; Gilbert, Luke A.; Whitehead, Evan H.; La Russa, Marie; Tsai, Jordan C.; Weissman, Jonathan S.; Dueber, John E.; Qi, Lei S.; Lim, Wendell A.


    Summary Eukaryotic cells execute complex transcriptional programs in which specific loci throughout the genome are regulated in distinct ways by targeted regulatory assemblies. We have applied this principle to generate synthetic CRISPR-based transcriptional programs in yeast and human cells. By extending guide RNAs to include effector protein recruitment sites, we construct modular scaffold RNAs that encode both target locus and regulatory action. Sets of scaffold RNAs can be used to generate synthetic multi-gene transcriptional programs in which some genes are activated and others are repressed. We apply this approach to flexibly redirect flux through a complex branched metabolic pathway in yeast. Moreover, these programs can be executed by inducing expression of the dCas9 protein, which acts as a single master regulatory control point. CRISPR-associated RNA scaffolds provide a powerful way to construct synthetic gene expression programs for a wide range of applications including rewiring cell fates or engineering metabolic pathways. PMID:25533786

  20. In vitro and ex vivo delivery of short hairpin RNAs for control of hepatitis C viral transcript expression.


    Lonze, Bonnie E; Holzer, Horatio T; Knabel, Matthew K; Locke, Jayme E; DiCamillo, Gregory A; Karhadkar, Sunil S; Montgomery, Robert A; Sun, Zhaoli; Warren, Daniel S; Cameron, Andrew M


    Recurrent hepatitis C virus (HCV) infection is the most common cause of graft loss and patient death after transplantation for HCV cirrhosis. Transplant surgeons have access to uninfected explanted livers before transplantation and an opportunity to deliver RNA interference-based protective gene therapy to uninfected grafts. Conserved HCV sequences were used to design short interfering RNAs and test their ability to knockdown HCV transcript expression in an in vitro model, both by transfection and when delivered via an adeno-associated viral vector. In a rodent model of liver transplantation, portal venous perfusion of explanted grafts with an adeno-associated viral vector before transplantation produced detectable short hairpin RNA transcript expression after transplantation. The ability to deliver anti-HCV short hairpin RNAs to uninfected livers before transplantation and subsequent exposure to HCV offers hope for the possibility of preventing the currently inevitable subsequent infection of liver grafts with HCV.

  1. The RNA Epistructurome: Uncovering RNA Function by Studying Structure and Post-Transcriptional Modifications.


    Incarnato, Danny; Oliviero, Salvatore


    A large fraction of higher metazoan genomes transcribe RNA molecules whose functions extend far beyond carrying instructions for protein synthesis. Although RNA is apparently a simple molecule, the ways in which it performs many of its functions have remained highly elusive for decades. As learned from studying ribosomal and transfer RNAs, two of the key features influencing the function of RNA are its structure and post-transcriptional modifications. A deep understanding of RNA function therefore requires rapid and straightforward approaches to study the complex and intricate landscape of RNA structures and modifications. In this review we summarize and discuss the most recent methods and findings in the field of RNA biology, with an eye toward new frontiers and open questions.

  2. Hepatitis C virus RNA detection in serum and peripheral blood mononuclear cells of patients with hepatitis C

    PubMed Central

    Zhou, Ping; Cai, Qing; Chen, You-Chun; Zhang, Mu-Sen; Guan, Jian; Li, Xiao-Juan


    AIM: To investigate the existence and clinical significance of hepatitis C virus (HCV) RNA in the serum and peripheral blood mononuclear cells (PBMC) of patients with hepatitis C. METHODS: HCV RNA was detected by nested polymerase chain reaction (Nested PCR) in serum and in PBMC of 46 patients with acute hepatitis C (AHC) and in 42 patients with chronic hepatitis C (CHC). RESULTS: The positive rate of HCV RNA in PBMC of patients with CHC was markedly higher than that of patients with AHC (P < 0.01). The positive rates of HCV RNA in serum of patients with AHC and CHC and in PBMC of patients with CHC were significantly higher than those of anti-HCV positive patients with normal alanine aminotransferase (ALT) levels (P < 0.01). HCV RNA was negative in the serum of two patients, but could be detected in PBMC. In 12 patients, anti HCV was negative while HCV RNA was positive in serum. CONCLUSION: (1) detection of serum HCV RNA by nested PCR might be helpful in the early diagnosis of anti-HCV negative hepatitis C; (2) liver damage in patients with hepatitis C might be correlated with HCV-viremia; (3) infection of PBMC by HCV might play an important role in chronic liver damage in patients with HCV and in the chronicity of its clinical course; and (4) PBMC might be considered as a “reservoir” for HCV. PMID:27041960

  3. Fast transcription rates of RNA polymerase II in human cells

    PubMed Central

    Maiuri, Paolo; Knezevich, Anna; De Marco, Alex; Mazza, Davide; Kula, Anna; McNally, Jim G; Marcello, Alessandro


    Averaged estimates of RNA polymerase II (RNAPII) elongation rates in mammalian cells have been shown to range between 1.3 and 4.3 kb min−1. In this work, nascent RNAs from an integrated human immunodeficiency virus type 1-derived vector were detectable at the single living cell level by fluorescent RNA tagging. At steady state, a constant number of RNAs was measured corresponding to a minimal density of polymerases with negligible fluctuations over time. Recovery of fluorescence after photobleaching was complete within seconds, indicating a high rate of RNA biogenesis. The calculated transcription rate above 50 kb min−1 points towards a wide dynamic range of RNAPII velocities in living cells. PMID:22015688

  4. Structural Basis of RNA Polymerase I Transcription Initiation.


    Engel, Christoph; Gubbey, Tobias; Neyer, Simon; Sainsbury, Sarah; Oberthuer, Christiane; Baejen, Carlo; Bernecky, Carrie; Cramer, Patrick


    Transcription initiation at the ribosomal RNA promoter requires RNA polymerase (Pol) I and the initiation factors Rrn3 and core factor (CF). Here, we combine X-ray crystallography and cryo-electron microscopy (cryo-EM) to obtain a molecular model for basal Pol I initiation. The three-subunit CF binds upstream promoter DNA, docks to the Pol I-Rrn3 complex, and loads DNA into the expanded active center cleft of the polymerase. DNA unwinding between the Pol I protrusion and clamp domains enables cleft contraction, resulting in an active Pol I conformation and RNA synthesis. Comparison with the Pol II system suggests that promoter specificity relies on a distinct "bendability" and "meltability" of the promoter sequence that enables contacts between initiation factors, DNA, and polymerase.

  5. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    PubMed Central

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan


    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3’ proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  6. The conserved protein Seb1 drives transcription termination by binding RNA polymerase II and nascent RNA.


    Wittmann, Sina; Renner, Max; Watts, Beth R; Adams, Oliver; Huseyin, Miles; Baejen, Carlo; El Omari, Kamel; Kilchert, Cornelia; Heo, Dong-Hyuk; Kecman, Tea; Cramer, Patrick; Grimes, Jonathan M; Vasiljeva, Lidia


    Termination of RNA polymerase II (Pol II) transcription is an important step in the transcription cycle, which involves the dislodgement of polymerase from DNA, leading to release of a functional transcript. Recent studies have identified the key players required for this process and showed that a common feature of these proteins is a conserved domain that interacts with the phosphorylated C-terminus of Pol II (CTD-interacting domain, CID). However, the mechanism by which transcription termination is achieved is not understood. Using genome-wide methods, here we show that the fission yeast CID-protein Seb1 is essential for termination of protein-coding and non-coding genes through interaction with S2-phosphorylated Pol II and nascent RNA. Furthermore, we present the crystal structures of the Seb1 CTD- and RNA-binding modules. Unexpectedly, the latter reveals an intertwined two-domain arrangement of a canonical RRM and second domain. These results provide important insights into the mechanism underlying eukaryotic transcription termination.

  7. In Vitro Assays for RNA Binding and Protein Priming of Hepatitis B Virus Polymerase.


    Clark, Daniel N; Jones, Scott A; Hu, Jianming


    The hepatitis B virus (HBV) polymerase synthesizes the viral DNA genome from the pre-genomic RNA (pgRNA) template through reverse transcription. Initiation of viral DNA synthesis is accomplished via a novel protein priming mechanism, so named because the polymerase itself acts as a primer, whereby the initiating nucleotide becomes covalently linked to a tyrosine residue on the viral polymerase. Protein priming, in turn, depends on specific recognition of the packaging signal on pgRNA called epsilon. These early events in viral DNA synthesis can now be dissected in vitro as described here.The polymerase is expressed in mammalian cells and purified by immunoprecipitation. The purified protein is associated with host cell factors, is enzymatically active, and its priming activity is epsilon dependent. A minimal epsilon RNA construct from pgRNA is co-expressed with the polymerase in cells. This RNA binds to and co-immunoprecipitates with the polymerase. Modifications can be made to either the epsilon RNA or the polymerase protein by manipulating the expression plasmids. Also, the priming reaction itself can be modified to assay for the initiation or subsequent DNA synthesis during protein priming, the susceptibility of the polymerase to chemical inhibitors, and the precise identification of the DNA products upon their release from the polymerase. The identity of associated host factors can also be evaluated. This protocol closely mirrors our current understanding of the RNA binding and protein priming steps of the HBV replication cycle, and it is amenable to modification. It should therefore facilitate both basic research and drug discovery.

  8. De Novo Initiation of RNA Synthesis by the RNA-Dependent RNA Polymerase (NS5B) of Hepatitis C Virus

    PubMed Central

    Luo, Guangxiang; Hamatake, Robert K.; Mathis, Danielle M.; Racela, Jason; Rigat, Karen L.; Lemm, Julie; Colonno, Richard J.


    Hepatitis C virus (HCV) NS5B protein possesses an RNA-dependent RNA polymerase (RdRp) activity, a major function responsible for replication of the viral RNA genome. To further characterize the RdRp activity, NS5B proteins were expressed from recombinant baculoviruses, purified to near homogeneity, and examined for their ability to synthesize RNA in vitro. As a result, a highly active NS5B RdRp (1b-42), which contains an 18-amino acid C-terminal truncation resulting from a newly created stop codon, was identified among a number of independent isolates. The RdRp activity of the truncated NS5B is comparable to the activity of the full-length protein and is 20 times higher in the presence of Mn2+ than in the presence of Mg2+. When a 384-nucleotide RNA was used as the template, two major RNA products were synthesized by 1b-42. One is a complementary RNA identical in size to the input RNA template (monomer), while the other is a hairpin dimer RNA synthesized by a “copy-back” mechanism. Substantial evidence derived from several experiments demonstrated that the RNA monomer was synthesized through de novo initiation by NS5B rather than by a terminal transferase activity. Synthesis of the RNA monomer requires all four ribonucleotides. The RNA monomer product was verified to be the result of de novo RNA synthesis, as two expected RNA products were generated from monomer RNA by RNase H digestion. In addition, modification of the RNA template by the addition of the chain terminator cordycepin at the 3′ end did not affect synthesis of the RNA monomer but eliminated synthesis of the self-priming hairpin dimer RNA. Moreover, synthesis of RNA on poly(C) and poly(U) homopolymer templates by 1b-42 NS5B did not require the oligonucleotide primer at high concentrations (≥50 μM) of GTP and ATP, further supporting a de novo initiation mechanism. These findings suggest that HCV NS5B is able to initiate RNA synthesis de novo. PMID:10623748

  9. Thyroid hormone negatively regulates CDX2 and SOAT2 mRNA expression via induction of miRNA-181d in hepatic cells

    SciTech Connect

    Yap, Chui Sun; Sinha, Rohit Anthony; Ota, Sho; Katsuki, Masahito; Yen, Paul Michael


    Highlights: •Thyroid hormone induces miR-181d expression in human hepatic cells and mouse livers. •Thyroid hormone downregulates CDX2 and SOAT2 (or ACAT2) via miR-181d. •miR-181d reduces cholesterol output from human hepatic cells. -- Abstract: Thyroid hormones (THs) regulate transcription of many metabolic genes in the liver through its nuclear receptors (TRs). Although the molecular mechanisms for positive regulation of hepatic genes by TH are well understood, much less is known about TH-mediated negative regulation. Recently, several nuclear hormone receptors were shown to downregulate gene expression via miRNAs. To further examine the potential role of miRNAs in TH-mediated negative regulation, we used a miRNA microarray to identify miRNAs that were directly regulated by TH in a human hepatic cell line. In our screen, we discovered that miRNA-181d is a novel hepatic miRNA that was regulated by TH in hepatic cell culture and in vivo. Furthermore, we identified and characterized two novel TH-regulated target genes that were downstream of miR-181d signaling: caudal type homeobox 2 (CDX2) and sterol O-acyltransferase 2 (SOAT2 or ACAT2). CDX2, a known positive regulator of hepatocyte differentiation, was regulated by miR-181d and directly activated SOAT2 gene expression. Since SOAT2 is an enzyme that generates cholesteryl esters that are packaged into lipoproteins, our results suggest miR-181d plays a significant role in the negative regulation of key metabolic genes by TH in the liver.

  10. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro


    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  11. Rescue of Mtp siRNA-induced hepatic steatosis by DGAT2 siRNA silencing.


    Tep, Samnang; Mihaila, Radu; Freeman, Alexander; Pickering, Victoria; Huynh, Felicia; Huyhn, Felicia; Tadin-Strapps, Marija; Stracks, Allison; Hubbard, Brian; Caldwell, Jeremy; Flanagan, W Michael; Kuklin, Nelly A; Ason, Brandon


    Microsomal triglyceride transfer protein (Mtp) inhibitors represent a novel therapeutic approach to lower circulating LDL cholesterol, although therapeutic development has been hindered by the observed increase in hepatic triglycerides and liver steatosis following treatment. Here, we used small interfering RNAs (siRNA) targeting Mtp to achieve target-specific silencing to study this phenomenon and to determine to what extent liver steatosis is induced by changes in Mtp expression. We observed that Mtp silencing led to a decrease in many genes involved in hepatic triglyceride synthesis. Given the role of diacylglycerol O-acyltransferase 2 (Dgat2) in regulating hepatic triglyceride synthesis, we then evaluated whether target-specific silencing of both Dgat2 and Mtp were sufficient to attenuate Mtp silencing-induced liver steatosis. We showed that the simultaneous inhibition of Dgat2 and Mtp led to a decrease in plasma cholesterol and a reduction in the accumulation of hepatic triglycerides caused by the inhibition of Mtp. Collectively, these findings provide a proof-of-principle for a triglyceride synthesis/Mtp inhibitor combination and represent a potentially novel approach for therapeutic development in which targeting multiple pathways can achieve the desired response.

  12. RNA polymerase active center: the molecular engine of transcription.


    Nudler, Evgeny


    RNA polymerase (RNAP) is a complex molecular machine that governs gene expression and its regulation in all cellular organisms. To accomplish its function of accurately producing a full-length RNA copy of a gene, RNAP performs a plethora of chemical reactions and undergoes multiple conformational changes in response to cellular conditions. At the heart of this machine is the active center, the engine, which is composed of distinct fixed and moving parts that serve as the ultimate acceptor of regulatory signals and as the target of inhibitory drugs. Recent advances in the structural and biochemical characterization of RNAP explain the active center at the atomic level and enable new approaches to understanding the entire transcription mechanism, its exceptional fidelity and control.

  13. Termination of Transcription of Short Noncoding RNAs by RNA Polymerase II.


    Arndt, Karen M; Reines, Daniel


    The RNA polymerase II transcription cycle is often divided into three major stages: initiation, elongation, and termination. Research over the last decade has blurred these divisions and emphasized the tightly regulated transitions that occur as RNA polymerase II synthesizes a transcript from start to finish. Transcription termination, the process that marks the end of transcription elongation, is regulated by proteins that interact with the polymerase, nascent transcript, and/or chromatin template. The failure to terminate transcription can cause accumulation of aberrant transcripts and interfere with transcription at downstream genes. Here, we review the mechanism, regulation, and physiological impact of a termination pathway that targets small noncoding transcripts produced by RNA polymerase II. We emphasize the Nrd1-Nab3-Sen1 pathway in yeast, in which the process has been extensively studied. The importance of understanding small RNA termination pathways is underscored by the need to control noncoding transcription in eukaryotic genomes.

  14. Conformational changes accompany activation of reovirus RNA-dependent RNA transcription

    PubMed Central

    Mendez, Israel I.; Weiner, Scott G.; She, Yi-Min; Yeager, Mark; Coombs, Kevin M.


    Many critical biologic processes involve dynamic interactions between proteins and nucleic acids. Such dynamic processes are often difficult to delineate by conventional static methods. For example, while a variety of nucleic acid polymerase structures have been determined at atomic resolution, the details of how some multi-protein transcriptase complexes actively produce mRNA, as well as conformational changes associated with activation of such complexes, remain poorly understood. The mammalian reovirus innermost capsid (core) manifests all enzymatic activities necessary to produce mRNA from each of the 10 encased double-stranded RNA genes. We used rapid freezing and electron cryo-microscopy to trap and visualize transcriptionally active reovirus core particles and compared them to inactive core images. Rod-like density centered within actively transcribing core spike channels was attributed to exiting nascent mRNA. Comparative radial density plots of active and inactive core particles identified several structural changes in both internal and external regions of the icosahedral core capsid. Inactive and transcriptionally active cores were partially digested with trypsin and identities of initial tryptic peptides determined by mass spectrometry. Differentially-digested peptides, which also suggest transcription-associated conformational changes, were placed within the known 3-dimensional structures of major core proteins. PMID:18321727

  15. Packaging of hepatitis delta virus RNA via the RNA-binding domain of hepatitis delta antigens: different roles for the small and large delta antigens.

    PubMed Central

    Wang, H W; Chen, P J; Lee, C Z; Wu, H L; Chen, D S


    Hepatitis delta virus (HDV) is composed of four specific components. The first component is envelope protein which contains hepatitis B surface antigens. The second and third components are nucleocapsid proteins, referred to as small and large hepatitis delta antigens (HDAgs). The final component is a single-stranded circular RNA molecule known as the viral genome. In order to study the mechanism of HDV RNA packaging, a four-plasmid cotransfection system in which each viral component was provided by a separate plasmid was employed. Virus-like particles released from Huh-7 cells receiving such a cotransfection were found to contain HDV RNA along with three proteins. Therefore, the four-plasmid cotransfection system could lead to successful HDV RNA packaging in vitro. The system was then used to show that the large HDAg alone was able to achieve a low level of HDV RNA packaging. Analysis of a variety of large HDAg mutants revealed that the RNA-binding domain was essential for viral RNA packaging. By increasing the incorporation of small HDAg into virus-like particles, we found a three- to fourfold enhancement of HDV RNA packaging. This effect was probably through a direct binding of HDV RNA, independent from that of large HDAg, with the small HDAg. The subsequent RNA-protein complex was packaged into particles. The results provided insight into the roles and functional domains of small and large HDAgs in HDV RNA packaging. Images PMID:8083975

  16. Noncoding RNA. piRNA-guided slicing specifies transcripts for Zucchini-dependent, phased piRNA biogenesis.


    Mohn, Fabio; Handler, Dominik; Brennecke, Julius


    In animal gonads, PIWI-clade Argonaute proteins repress transposons sequence-specifically via bound Piwi-interacting RNAs (piRNAs). These are processed from single-stranded precursor RNAs by largely unknown mechanisms. Here we show that primary piRNA biogenesis is a 3'-directed and phased process that, in the Drosophila germ line, is initiated by secondary piRNA-guided transcript cleavage. Phasing results from consecutive endonucleolytic cleavages catalyzed by Zucchini, implying coupled formation of 3' and 5' ends of flanking piRNAs. Unexpectedly, Zucchini also participates in 3' end formation of secondary piRNAs. Its function can, however, be bypassed by downstream piRNA-guided precursor cleavages coupled to exonucleolytic trimming. Our data uncover an evolutionarily conserved piRNA biogenesis mechanism in which Zucchini plays a central role in defining piRNA 5' and 3' ends.

  17. Posttranscriptional regulation of collagen alpha1(I) mRNA in hepatic stellate cells.

    PubMed Central

    Stefanovic, B; Hellerbrand, C; Holcik, M; Briendl, M; Aliebhaber, S; Brenner, D A


    The hepatic stellate cell (HSC) is the primary cell responsible for the dramatic increase in the synthesis of type I collagen in the cirrhotic liver. Quiescent HSCs contain a low level of collagen alpha1(I) mRNA, while activated HSCs contain about 60- to 70-fold more of this mRNA. The transcription rate of the collagen alpha1(I) gene is only two fold higher in activated HSCs than in quiescent HSCs. In assays using actinomycin D or 5,6-dichlorobenzimidazole riboside collagen alpha1(I) mRNA has estimated half-lives of 1.5 h in quiescent HSCs and 24 h in activated HSCs. Thus, this 16-fold change in mRNA stability is primarily responsible for the increase in collagen alpha1(I) mRNA steady-state level in activated HSCs. We have identified a novel RNA-protein interaction targeted to the C-rich sequence in the collagen alpha1(I) mRNA 3' untranslated region (UTR). This sequence is localized 24 nucleotides 3' to the stop codon. In transient transfection experiments, mutation of this sequence diminished accumulation of an mRNA transcribed from a collagen alpha1(I) minigene and in stable transfections decreased the half-life of collagen alpha1(I) minigene mRNA. Binding to the collagen alpha1(I) 3' UTR is present in cytoplasmic extracts of activated but not quiescent HSCs. It contains as a subunit alphaCP, which is also found in the complex involved in stabilization of alpha-globin mRNA. The auxiliary factors necessary to promote binding of alphaCP to the collagen 3' UTR are distinct from the factors necessary for binding to the alpha-globin sequence. Since alphaCP is expressed in both quiescent and activated HSCs, these auxiliary factors are responsible for the differentially expressed RNA-protein interaction at the collagen alpha1(I) mRNA 3' UTR. PMID:9271398

  18. Quantification of co-transcriptional splicing from RNA-Seq data.


    Herzel, Lydia; Neugebauer, Karla M


    During gene expression, protein-coding transcripts are shaped by multiple processing events: 5' end capping, pre-mRNA splicing, RNA editing, and 3' end cleavage and polyadenylation. These events are required to produce mature mRNA, which can be subsequently translated. Nearly all of these RNA processing steps occur during transcription, while the nascent RNA is still attached to the DNA template by RNA polymerase II (i.e. co-transcriptionally). Polyadenylation occurs after 3' end cleavage or post-transcriptionally. Pre-mRNA splicing - the removal of introns and ligation of exons - can be initiated and concluded co-transcriptionally, although this is not strictly required. Recently, a number of studies using global methods have shown that the majority of splicing is co-transcriptional, yet not all published studies agree in their conclusions. Short read sequencing of RNA (RNA-Seq) is the prevailing approach to measuring splicing levels in nascent RNA, mRNA or total RNA. Here, we compare four different strategies for analyzing and quantifying co-transcriptional splicing. To do so, we reanalyze two nascent RNA-Seq datasets of the same species, but different cell type and RNA isolation procedure. Average co-transcriptional splicing values calculated on a per intron basis are similar, independent of the strategy used. We emphasize the technical requirements for identifying co-transcriptional splicing events with high confidence, e.g. how to calculate co-transcriptional splicing from nascent RNA- versus mRNA-Seq data, the number of biological replicates needed, depletion of polyA+RNA, and appropriate normalization. Finally, we present guidelines for planning a nascent RNA-Seq experiment.

  19. Vitamin C modulates cadmium-induced hepatic antioxidants' gene transcripts and toxicopathic changes in Nile tilapia, Oreochromis niloticus.


    El-Sayed, Yasser S; El-Gazzar, Ahmed M; El-Nahas, Abeer F; Ashry, Khaled M


    Cadmium (Cd) is one of the naturally occurring heavy metals having adverse effects, while vitamin C (L-ascorbic acid) is an essential micronutrient for fish, which can attenuate tissue damage owing to its chain-breaking antioxidant and free radical scavenger properties. The adult Nile tilapia fish were exposed to Cd at 5 mg/l with and without vitamin C (500 mg/kg diet) for 45 days in addition to negative and positive controls fed with the basal diet and basal diet supplemented with vitamin C, respectively. Hepatic relative mRNA expression of genes involved in antioxidant function, metallothionein (MT), glutathione S-transferase (GST-α1), and glutathione peroxidase (GPx1), was assessed using real-time reverse transcription polymerase chain reaction (RT-PCR). Hepatic architecture was also histopathologically examined. Tilapia exposed to Cd exhibited upregulated antioxidants' gene transcript levels, GST-⍺1, GPx1, and MT by 6.10-, 4.60-, and 4.29-fold, respectively. Histopathologically, Cd caused severe hepatic changes of multifocal hepatocellular and pancreatic acinar necrosis, and lytic hepatocytes infiltrated with eosinophilic granular cells. Co-treatment of Cd-exposed fish with vitamin C overexpressed antioxidant enzyme-related genes, GST-⍺1 (16.26-fold) and GPx1 (18.68-fold), and maintained the expression of MT gene close to control (1.07-fold), averting the toxicopathic lesions induced by Cd. These results suggested that vitamin C has the potential to protect Nile tilapia from Cd hepatotoxicity via sustaining hepatic antioxidants' genes transcripts and normal histoarchitecture.

  20. Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.


    Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla


    Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

  1. Retargeting a Dual-Acting sRNA for Multiple mRNA Transcript Regulation.


    Lahiry, Ashwin; Stimple, Samuel D; Wood, David W; Lease, Richard A


    Multitargeting small regulatory RNAs (sRNAs) represent a potentially useful tool for metabolic engineering applications. Natural multitargeting sRNAs govern bacterial gene expression by binding to the translation initiation regions of protein-coding mRNAs through base pairing. We designed an Escherichia coli based genetic system to create and assay dual-acting retargeted-sRNA variants. The variants can be assayed for coordinate translational regulation of two alternate mRNA leaders fused to independent reporter genes. Accordingly, we began with the well-characterized E. coli native DsrA sRNA. The merits of using DsrA include its well-characterized separation of function into two independently folded stem-loop domains, wherein alterations at one stem do not necessarily abolish activity at the other stem. Expression of the sRNA and each reporter mRNA was independently controlled by small inducer molecules, allowing precise quantification of the regulatory effects of each sRNA:mRNA interaction in vivo with a microtiter plate assay. Using this system, we semirationally designed DsrA variants screened in E. coli for their ability to regulate key mRNA leader sequences from the Clostridium acetobutylicum n-butanol synthesis pathway. To coordinate intervention at two points in a metabolic pathway, we created bifunctional sRNA prototypes by combining sequences from two singly retargeted DsrA variants. This approach constitutes a platform for designing sRNAs to specifically target arbitrary mRNA transcript sequences, and thus provides a generalizable tool for retargeting and characterizing multitarget sRNAs for metabolic engineering.

  2. Complex regulation of transcription from the hepatitis B virus major surface antigen promoter in human hepatoma cell lines.

    PubMed Central

    Raney, A K; Milich, D R; McLachlan, A


    A detailed mutational analysis of the regulatory DNA sequence elements that control expression of the hepatitis B virus major surface antigen gene was performed in the human hepatoma cell lines HepG2.1 and Huh7, using transient transfection assays. Seven regions (A to G) of the major surface antigen promoter located within 200 nucleotides of the RNA initiation site have been identified which influence the level of transcription from this promoter. The three distal regions (A to C), located between -188 and -68, appear to possess a level of redundancy in their ability to influence the transcriptional activity from the major surface antigen promoter. The simultaneous deletion of regions A, B, and C resulted in an approximately fourfold reduction in transcription from the major surface antigen promoter. Region D, located between -67 and -49, is an essential element of the major surface antigen promoter. The three proximal regions (E to G) are located within 45 nucleotides of the major transcription initiation site. Region E prevents the negative influence of region F and can compensate for the effect of mutation of region G on transcription from the major surface antigen promoter. Region G can compensate for the effect of the loss of a functional region E sequence on the transcriptional activity of the major surface antigen promoter only in the absence of a functional region F sequence. These results imply that the level of expression of the major surface antigen gene is controlled by the complex interplay between a minimum of six transcription factors which activate and one transcription factor which represses transcription from this gene. PMID:1651407

  3. MicroRNA-34a Promotes Hepatic Stellate Cell Activation via Targeting ACSL1

    PubMed Central

    Yan, Gangli; Li, Binbin; Xin, Xuan; Xu, Midie; Ji, Guoqing; Yu, Hongyu


    Background The incidence of liver fibrosis remains high due to the lack of effective therapies. Our previous work found that microRNA (miR)-34a expression was increased, while acy1-CoA synthetase long-chain family member1 (ACSL1) was decreased, in a dimethylnitrosamine (DNS)-induced hepatic fibrosis rat model. We hypothesized that miR-34a may play a role in the process of hepatic fibrosis by targeting ACSL1. Material/Methods From days 2 to 14, cultured primary hepatic stellate cells (HSCs) underwent cell morphology, immunocytochemical staining, and quantitative reverse transcription PCR (RT-qPCR) for alpha smooth muscle actin (α-SMA), desmin, rno-miR-34a, and ACSL1 expression. Wild-type and mutant luciferase reporter plasmids were constructed according to the predicted miR-34a binding site on the 3′-untranslated region (UTR) of the ACSL1 mRNA and then transfected into HEK293 cells. rno-miR-34a was silenced in HSCs to confirm that rno-miR-34a negatively regulates ACSL1 expression. mRNA and protein expression of α-SMA, type I collagen, and desmin were assayed in miR-34a-silenced HSCs. Results HSCs were deemed quiescent during the first 3 days and activated after 10 days. rno-miR-34a expression increased, and ACSL1 expression decreased, from day 2 to 7 to 14. rno-miR-34a was shown to specifically bind to the 3′-UTR of ACSL1. miR-34a-silenced HSCs showed higher ACSL1and lower α-SMA, type I collagen, and desmin expression than that of matching negative controls and non-transfected cells. Conclusions miR-34a appears to play an important role in the process of liver fibrosis by targeting ACSL1 and may show promise as a therapeutic molecular target for hepatic fibrosis. PMID:26437572

  4. Inhibition of RNA binding to hepatitis C virus RNA-dependent RNA polymerase: a new mechanism for antiviral intervention

    PubMed Central

    Ahmed-Belkacem, Abdelhakim; Guichou, Jean-François; Brillet, Rozenn; Ahnou, Nazim; Hernandez, Eva; Pallier, Coralie; Pawlotsky, Jean-Michel


    The hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) is a key target for antiviral intervention. The goal of this study was to identify the binding site and unravel the molecular mechanism by which natural flavonoids efficiently inhibit HCV RdRp. Screening identified the flavonol quercetagetin as the most potent inhibitor of HCV RdRp activity. Quercetagetin was found to inhibit RdRp through inhibition of RNA binding to the viral polymerase, a yet unknown antiviral mechanism. X-ray crystallographic structure analysis of the RdRp-quercetagetin complex identified quercetagetin's binding site at the entrance of the RNA template tunnel, confirming its original mode of action. This antiviral mechanism was associated with a high barrier to resistance in both site-directed mutagenesis and long-term selection experiments. In conclusion, we identified a new mechanism for non-nucleoside inhibition of HCV RdRp through inhibition of RNA binding to the enzyme, a mechanism associated with broad genotypic activity and a high barrier to resistance. Our results open the way to new antiviral approaches for HCV and other viruses that use an RdRp based on RNA binding inhibition, that could prove to be useful in human, animal or plant viral infections. PMID:25053847

  5. Sex-related differences in murine hepatic transcriptional and proteomic responses to TCDD

    SciTech Connect

    Prokopec, Stephenie D.; Watson, John D.; Lee, Jamie; Pohjanvirta, Raimo; Boutros, Paul C.


    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is an environmental contaminant that produces myriad toxicities in most mammals. In rodents alone, there is a huge divergence in the toxicological response across species, as well as among different strains within a species. But there are also significant differences between males and females animals of a single strain. These differences are inconsistent across model systems: the severity of toxicity is greater in female rats than males, while male mice and guinea pigs are more sensitive than females. Because the specific events that underlie this difference remain unclear, we characterized the hepatic transcriptional response of adult male and female C57BL/6 mice to 500 μg/kg TCDD at multiple time-points. The transcriptional profile diverged significantly between the sexes. Female mice demonstrated a large number of altered transcripts as early as 6 h following treatment, suggesting a large primary response. Conversely, male animals showed the greatest TCDD-mediated response 144 h following exposure, potentially implicating significant secondary responses. Nr1i3 was statistically significantly induced at all time-points in the sensitive male animals. This mRNA encodes the constitutive androstane receptor (CAR), a transcription factor involved in the regulation of xenobiotic metabolism, lipid metabolism, cell cycle and apoptosis. Surprisingly though, changes at the protein level (aside from the positive control, CYP1A1) were modest, with only FMO3 showing clear induction, and no genes with sex-differences. Thus, while male and female mice show transcriptional differences in their response to TCDD, their association with TCDD-induced toxicities remains unclear. - Highlights: • Differences exist between the toxicity phenotypes to TCDD in male and female mice. • TCDD-mediated transcriptomic differences were identified between the sexes. • Resistant female mice displayed a large, early-onset, transcriptomic response.

  6. Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

    SciTech Connect

    Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.; Dasgupta, A.


    The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription of RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.

  7. Multiplex real-time reverse transcription-PCR assay for determination of hepatitis C virus genotypes.


    Cook, Linda; Sullivan, KaWing; Krantz, Elizabeth M; Bagabag, Arthur; Jerome, Keith R


    A variety of methods have been used to determine hepatitis C virus (HCV) genotypes. Because therapeutic decisions for chronic HCV-related hepatitis are made on the basis of genotype, it is important that genotype be accurately determined by clinical laboratories. Existing methods are often subjective, inaccurate, manual, time-consuming, and contamination prone. We therefore evaluated real-time reverse transcription-PCR (RT-PCR) reagents that have recently become commercially available (Abbott HCV Genotype ASR). The assay developed by our laboratory starts with purified RNA and can be performed in 4 to 5 h. An initial evaluation of 479 samples was done with a restriction fragment length polymorphism (RFLP) method and the RT-PCR assay, and discrepant samples were sequenced. An additional 1,200 samples were then tested, and data from all assays were used to evaluate the efficiency and specificity of each genotype-specific reaction. Good correlation between results by the two methods was seen. Discrepant samples included those indeterminate by the RT-PCR assay (n = 110) and a subset that were incorrectly called 2a by the RFLP method (n = 75). The real-time RT-PCR assay performed well with genotype 1, 2, and 3 samples. Inadequate numbers of samples were available to evaluate fully genotypes 4, 5, and 6. Analysis of each primer-probe set demonstrated that weak cross-reactive amplifications were common but usually did not interfere with the genotype determination. However, in about 1% of samples, two or more genotypes amplified at roughly equivalent amounts. Further studies are necessary to determine whether these mixed-genotype samples are true mixtures or a reflection of occasional cross-reactive amplifications.

  8. TATA elements direct bi-directional transcription by RNA polymerases II and III.

    PubMed Central

    Huang, W; Wong, J M; Bateman, E


    Eukaryotic promoter elements specify the direction and efficiency of transcription, as well as the type of RNA polymerase to be used. One such element, the TATA box, is thought to participate in determining the direction of transcription and can function within promoters for RNA polymerase II or III, depending on the sequence context. In this report the ability of four different TATA boxes to support transcription in vitro was determined. It was found that TATA elements are not directional. However, they support transcription by RNA polymerases II and III. An upstream activating sequence was found to stimulate downstream transcription by RNA polymerase II and to inhibit upstream transcription by RNA polymerases II and III. Thus a promoter necessarily consists of a TATA element and upstream sequences in order to specify the direction of transcription and the type of polymerase to be used. PMID:8604352

  9. Species-specificity of rRNA gene transcription in plants manifested as a switch in RNA polymerase specificity.

    PubMed Central

    Doelling, J H; Pikaard, C S


    Rapid evolution of ribosomal RNA (rRNA) gene promoters often prevents their recognition in a foreign species. Unlike animal systems, we show that foreign plant rRNA gene promoters are recognized in an alien species, but tend to program transcription by a different polymerase. In plants, RNA polymerase I transcripts initiate at a TATATA element (+1 is underlined) important for promoter strength and start-site selection. However, transcripts initiate from +32 following transfection of a tomato promoter into Arabidopsis. The rRNA gene promoter of a more closely related species, Brassica oleracea, programs both +1 and +29 transcription. A point mutation at +2 improving the identity between the Brassica and Arabidopsis promoters increases +1 transcription, indicating a role for the initiator element in species-specificity. Brassica +29 transcripts can be translated to express a luciferase reporter gene, implicating RNA polymerase II. TATA mutations that disrupt TATA-binding protein (TBP) interactions inhibit +29 transcription and luciferase expression. Co-expressed TBP proteins bearing compensatory mutations restore +29 transcription and luciferase activity, suggesting a direct TBP-TATA interaction. Importantly, +1 transcription is unaffected by the TATA mutations, suggesting that in the context of pol I recognition, the TATA-containing initiator element serves a function other than TBP binding. PMID:8972859

  10. Quantitative Analysis of Transcription Elongation by RNA Polymerase I In Vitro

    PubMed Central

    Schneider, David Alan


    The elongation step in transcription has gained attention for its roles in regulation of eukaryotic gene expression and for its influence on RNA processing. Sophisticated genetic analyses have identified factors and/or conditions that may affect transcription elongation rate or processivity; however, differentiation of direct and indirect effects on transcription is difficult using in vivo strategies. Therefore, effective, reproducible in vitro assays have been developed to test whether a given factor or condition can have a direct effect on the kinetics of transcription elongation. We have adapted a fully reconstituted transcription system for RNA polymerase I (Pol I) for kinetic analysis of transcription elongation rate in vitro. The assay described here has proven to be effective in the characterization of defects or enhancement of wild-type transcription elongation by RNA Pol I. Since transcription elongation by RNA Pol I has only recently gained significant attention, this assay will be a valuable resource for years to come. PMID:22113301

  11. Integrated analysis of microRNA and mRNA expression profiles in HBx-expressing hepatic cells

    PubMed Central

    Chen, Ruo-Chan; Wang, Juan; Kuang, Xu-Yuan; Peng, Fang; Fu, Yong-Ming; Huang, Yan; Li, Ning; Fan, Xue-Gong


    AIM To identify the miRNA-mRNA regulatory network in hepatitis B virus X (HBx)-expressing hepatic cells. METHODS A stable HBx-expressing human liver cell line L02 was established. The mRNA and miRNA expression profiles of L02/HBx and L02/pcDNA liver cells were identified by RNA-sequencing analysis. Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis was performed to investigate the function of candidate biomarkers, and the relationship between miRNA and mRNA was studied by network analysis. RESULTS Compared with L02/pcDNA cells, 742 unregulated genes and 501 downregulated genes were determined as differentially expressed in L02/HBx cells. Gene ontology analysis suggested that the differentially expressed genes were relevant to different biological processes. Concurrently, 22 differential miRNAs were also determined in L02/HBx cells. Furthermore, integrated analysis of miRNA and mRNA expression profiles identified a core miRNA-mRNA regulatory network that is correlated with the carcinogenic role of HBx. CONCLUSION Collectively, the miRNA-mRNA network-based analysis could be useful to elucidate the potential role of HBx in liver cell malignant transformation and shed light on the underlying molecular mechanism and novel therapy targets for hepatocellular carcinoma. PMID:28348484

  12. Widespread anti-sense transcription in apple is correlated with siRNA production and indicates a large potential for transcriptional and/or post-transcriptional control.


    Celton, Jean-Marc; Gaillard, Sylvain; Bruneau, Maryline; Pelletier, Sandra; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Navarro, Lionel; Laurens, François; Renou, Jean-Pierre


    Characterizing the transcriptome of eukaryotic organisms is essential for studying gene regulation and its impact on phenotype. The realization that anti-sense (AS) and noncoding RNA transcription is pervasive in many genomes has emphasized our limited understanding of gene transcription and post-transcriptional regulation. Numerous mechanisms including convergent transcription, anti-correlated expression of sense and AS transcripts, and RNAi remain ill-defined. Here, we have combined microarray analysis and high-throughput sequencing of small RNAs (sRNAs) to unravel the complexity of transcriptional and potential post-transcriptional regulation in eight organs of apple (Malus × domestica). The percentage of AS transcript expression is higher than that identified in annual plants such as rice and Arabidopsis thaliana. Furthermore, we show that a majority of AS transcripts are transcribed beyond 3'UTR regions, and may cover a significant portion of the predicted sense transcripts. Finally we demonstrate at a genome-wide scale that anti-sense transcript expression is correlated with the presence of both short (21-23 nt) and long (> 30 nt) siRNAs, and that the sRNA coverage depth varies with the level of AS transcript expression. Our study provides a new insight on the functional role of anti-sense transcripts at the genome-wide level, and a new basis for the understanding of sRNA biogenesis in plants.

  13. Clearance of HCV RNA following acute hepatitis A superinfection.


    Cacopardo, B; Nunnari, G; Nigro, L


    A transient reduction of hepatitis C virus replication during the course of acute hepatitis A virus infection has already been reported in the literature. The present study reports the case study of a subject with chronic hepatitis due to hepatitis C virus who went on to develop an acute hepatitis A. From the early onset of acute disease, hepatitis C virus ribonucleic acid became undetectable. Following recovery from acute hepatitis, alanine amino-transferase levels became persistently normal and liver biopsy revealed a reduction in the Knodell histological activity index score. Hepatitis C virus ribonucleic acid clearance was maintained up to 4 years after the onset of acute hepatitis A. During the course of the acute disease, a sharp increase in interferon gamma levels was detected in serum and in the supernatant of both unstimulated and phytoemagglutinin/lipopolysaccharide-stimulated peripheral blood mononuclear cells. Interferon gamma levels were still high 3 months later. We hypothesize that acute hepatitis A virus superinfection during the course of chronic hepatitis C may lead to hepatitis C virus ribonucleic acid clearance through an immunological mechanism related to interferon gamma production.

  14. Pol I Transcription and Pre-rRNA Processing Are Coordinated in a Transcription-dependent Manner in Mammalian Cells

    PubMed Central

    Kopp, K.; Gasiorowski, J. Z.; Chen, D.; Gilmore, R.; Norton, J. T.; Wang, C.; Leary, D. J.; Chan, E.K.L.; Dean, D. A.


    Pre-rRNA synthesis and processing are key steps in ribosome biogenesis. Although recent evidence in yeast suggests that these two processes are coupled, the nature of their association is unclear. In this report, we analyze the coordination between rDNA transcription and pre-rRNA processing in mammalian cells. We found that pol I transcription factor UBF interacts with pre-rRNA processing factors as analyzed by immunoprecipitations, and the association depends on active rRNA synthesis. In addition, injections of plasmids containing the human rDNA promoter and varying lengths of 18S rDNA into HeLa nuclei show that pol I transcription machinery can be recruited to rDNA promoters regardless of the product that is transcribed, whereas subgroups of pre-rRNA processing factors are recruited to plasmids only when specific pre-rRNA fragments are produced. Our observations suggest a model for sequential recruitment of pol I transcription factors and pre-rRNA processing factors to elongating pre-rRNA on an as-needed basis rather than corecruitment to sites of active transcription. PMID:17108330

  15. Transcription inactivation through local refolding of the RNA polymerase structure

    SciTech Connect

    Belogurov, Georgiy A.; Vassylyeva, Marina N.; Sevostyanova, Anastasiya; Appleman, James R.; Xiang, Alan X.; Lira, Ricardo; Webber, Stephen E.; Klyuyev, Sergiy; Nudler, Evgeny; Artsimovitch, Irina; Vassylyev, Dmitry G.


    Structural studies of antibiotics not only provide a shortcut to medicine allowing for rational structure-based drug design, but may also capture snapshots of dynamic intermediates that become 'frozen' after inhibitor binding. Myxopyronin inhibits bacterial RNA polymerase (RNAP) by an unknown mechanism. Here we report the structure of dMyx - a desmethyl derivative of myxopyronin B - complexed with a Thermus thermophilus RNAP holoenzyme. The antibiotic binds to a pocket deep inside the RNAP clamp head domain, which interacts with the DNA template in the transcription bubble. Notably, binding of dMyx stabilizes refolding of the {beta}'-subunit switch-2 segment, resulting in a configuration that might indirectly compromise binding to, or directly clash with, the melted template DNA strand. Consistently, footprinting data show that the antibiotic binding does not prevent nucleation of the promoter DNA melting but instead blocks its propagation towards the active site. Myxopyronins are thus, to our knowledge, a first structurally characterized class of antibiotics that target formation of the pre-catalytic transcription initiation complex - the decisive step in gene expression control. Notably, mutations designed in switch-2 mimic the dMyx effects on promoter complexes in the absence of antibiotic. Overall, our results indicate a plausible mechanism of the dMyx action and a stepwise pathway of open complex formation in which core enzyme mediates the final stage of DNA melting near the transcription start site, and that switch-2 might act as a molecular checkpoint for DNA loading in response to regulatory signals or antibiotics. The universally conserved switch-2 may have the same role in all multisubunit RNAPs.

  16. Snf1-Dependent Transcription Confers Glucose-Induced Decay upon the mRNA Product

    PubMed Central

    Braun, Katherine A.; Dombek, Kenneth M.


    In the yeast Saccharomyces cerevisiae, the switch from respiratory metabolism to fermentation causes rapid decay of transcripts encoding proteins uniquely required for aerobic metabolism. Snf1, the yeast ortholog of AMP-activated protein kinase, has been implicated in this process because inhibiting Snf1 mimics the addition of glucose. In this study, we show that the SNF1-dependent ADH2 promoter, or just the major transcription factor binding site, is sufficient to confer glucose-induced mRNA decay upon heterologous transcripts. SNF1-independent expression from the ADH2 promoter prevented glucose-induced mRNA decay without altering the start site of transcription. SNF1-dependent transcripts are enriched for the binding motif of the RNA binding protein Vts1, an important mediator of mRNA decay and mRNA repression whose expression is correlated with decreased abundance of SNF1-dependent transcripts during the yeast metabolic cycle. However, deletion of VTS1 did not slow the rate of glucose-induced mRNA decay. ADH2 mRNA rapidly dissociated from polysomes after glucose repletion, and sequences bound by RNA binding proteins were enriched in the transcripts from repressed cells. Inhibiting the protein kinase A pathway did not affect glucose-induced decay of ADH2 mRNA. Our results suggest that Snf1 may influence mRNA stability by altering the recruitment activity of the transcription factor Adr1. PMID:26667037

  17. A Land Plant-Specific Transcription Factor Directly Enhances Transcription of a Pathogenic Noncoding RNA Template by DNA-Dependent RNA Polymerase II[OPEN

    PubMed Central

    Qu, Jie; Ji, Shaoyi; Wallace, Andrew J.; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao


    Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP. PSTVd replication in the nucleoplasm generates (−)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (−)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774

  18. Identification and characterization of multiple TRIM proteins that inhibit hepatitis B virus transcription.


    Zhang, Shijian; Guo, Ju-Tao; Wu, Jim Z; Yang, Guang


    Tripartite motif (TRIM) proteins constitute a family of over 100 members that share conserved tripartite motifs and exhibit diverse biological functions. Several TRIM proteins have been shown to restrict viral infections and regulate host cellular innate immune responses. In order to identify TRIM proteins that modulate the infection of hepatitis B virus (HBV), we tested 38 human TRIMs for their effects on HBV gene expression, capsid assembly and DNA synthesis in human hepatoma cells (HepG2). The study revealed that ectopic expression of 8 TRIM proteins in HepG2 cells potently reduced the amounts of secreted HBV surface and e antigens as well as intracellular capsid and capsid DNA. Mechanistic analyses further demonstrated that the 8 TRIMs not only reduced the expression of HBV mRNAs, but also inhibited HBV enhancer I and enhancer II activities. Studies focused on TRIM41 revealed that a HBV DNA segment spanning nucleotide 1638 to nucleotide 1763 was essential for TRIM41-mediated inhibition of HBV enhancer II activity and the inhibitory effect depended on the E3 ubiquitin ligase activity of TRIM41 as well as the integrity of TRIM41 C-terminal domain. Moreover, knockdown of endogenous TRIM41 in a HepG2-derived stable cell line significantly increased the level of HBV preC/C RNA, leading to an increase in viral core protein, capsid and capsid DNA. Our studies have thus identified eight TRIM proteins that are able to inhibit HBV transcription and provided strong evidences suggesting the endogenous role of TRIM41 in regulating HBV transcription in human hepatoma cells.

  19. A novel transcriptional element in circular DNA monomers of the duck hepatitis B virus.

    PubMed Central

    Beckel-Mitchener, A; Summers, J


    We report the presence of two elements, pet and net, that are required for proper transcription of the duck hepatitis B virus (DHBV). These regions were previously identified by using plasmid clones of the virus in transient expression assays (M. Huang and J. Summers, J. Virol. 68:1564-1572, 1994). In this study, we further analyzed these regions by using in vitro-synthesized circular DHBV DNA monomers to mimic the authentic transcriptional template. We observed that pet was required for pregenome transcription from circular viral monomers, and in the absence of pet-dependent transcription, expression of the viral envelope genes was increased. We found that deletion of net in circularized DNA monomers led to the production of abnormally long transcripts due to a failure to form 3' ends during transcription. In addition, we report the presence of a net-like region in the mammalian hepadnavirus woodchuck hepatitis virus. These results are consistent with a model that net is a region involved in transcription termination and that in DHBV, pet is required for transcription complexes to read through this region during the first pass through net. PMID:9311882

  20. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone.


    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza; Waxman, David J


    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  1. Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA

    PubMed Central

    Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio


    Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting. PMID:27924870

  2. Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA

    NASA Astrophysics Data System (ADS)

    Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio


    Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting.

  3. MicroRNA-939 restricts Hepatitis B virus by targeting Jmjd3-mediated and C/EBPα-coordinated chromatin remodeling

    PubMed Central

    Chen, Cuncun; Wu, Min; Zhang, Wen; Lu, Wei; Zhang, Min; Zhang, Zhanqing; Zhang, Xiaonan; Yuan, Zhenghong


    Multi-layered mechanisms of virus host interaction exist for chronic hepatitis B virus (HBV) infection, which have been typically manifested at the microRNA level. Our previous study suggested that miRNA-939 (miR-939) may play a potential role in regulating HBV replication. Here we further investigated the mechanism by which miR-939 regulates HBV life cycle. We found that miR-939 inhibited the abundance of viral RNAs without direct miRNA-mRNA base pairing, but via host factors. Expression profiling and functional validation identified Jmjd3 as a target responsible for miR-939 induced anti-HBV effect. Jmjd3 appeared to enhance the transcription efficiency of HBV enhancer II/core promoter (En II) in a C/EBPα-dependent manner. However, the demethylase activity of Jmjd3 was not required in this process. Rather, Jmjd3’s transactivation activity depended on its interaction with C/EBPα. This coordinated action further recruited the Brm containing SWI/SNF chromatin remodeling complex which promoted the transcription of HBV RNAs. Taken together, we propose that the miR-939-Jmjd3 axis perturbs the accessibility of En II promoter to essential nuclear factors (C/EBPα and SWI/SNF complex) therefore leading to compromised viral RNA synthesis and hence restricted viral multiplication. PMID:27779233

  4. Identification and characterization of lncRNA mediated transcriptional dysregulation dictates lncRNA roles in glioblastoma

    PubMed Central

    Zhao, Zheng; Zhang, Jinwen; Lu, Jianping; Xu, Juan; Li, Xia


    Long non-coding RNAs (lncRNAs) modulate gene expression, and lncRNA misregulation is associated with cancer. However, precise functional roles in biological and disease processes have been described for only a few lncRNAs. Identification of genome-wide lncRNA-mediated transcriptional dysregulations may improve cancer treatments. In the present study, we used a computational framework that combined lncRNA and gene expression profiles with transcription factor (TF)-target relationships to comprehensively identify dysregulatory lncRNA-TF-gene triplets. In glioblastoma (GBM), we found that most lncRNAs affect multiple targets and primarily affect TF activity in trans. Six different classes of lncRNA-mediated transcriptional dysregulations were identified, with most lncRNAs either enhancing or attenuating target gene expression. Functional analysis of lncRNAs via their dysregulated targets implicated lncRNA modulators in some hallmarks of cancer, providing a new way to predict lncRNA function. Finally, we identified several lncRNA-TF-gene triplets (including HOTAIR-MXI1-CD58/PRKCE and HOTAIR-ATF5-NCAM1) that are associated with glioblastoma prognosis. The integration of lncRNA modulators into transcriptional regulatory networks will further enhance our understanding of lncRNA functions in cancer. PMID:26943771

  5. Conditional knockdown of target gene expression by tetracycline regulated transcription of double strand RNA.


    Hou, Xubin; Omi, Minoru; Harada, Hidekiyo; Ishii, Shunsuke; Takahashi, Yoshiko; Nakamura, Harukazu


    In vivo electroporation has served as an effective tool for the study of developmental biology. Here we report tetracycline inducible gene knockdown by electroporation. Our system consists of genome integration of a cassette encoding long double strand RNA (dsRNA) of a gene of interest by electroporation, transcription of which is assured by RNA polymerase II, and induction of transcription of dsRNA by tetracyclin. Long dsRNA decapped by ribozyme in the cassette and without poly A tail is processed into siRNA within nuclei. We could successfully induce knockdown of En2 and Coactosin by Dox administration.

  6. JMJD3 aids in reprogramming of bone marrow progenitor cells to hepatic phenotype through epigenetic activation of hepatic transcription factors

    PubMed Central

    Kochat, Veena; Equbal, Zaffar; Baligar, Prakash; Kumar, Vikash; Srivastava, Madhulika; Mukhopadhyay, Asok


    The strictly regulated unidirectional differentiation program in some somatic stem/progenitor cells has been found to be modified in the ectopic site (tissue) undergoing regeneration. In these cases, the lineage barrier is crossed by either heterotypic cell fusion or direct differentiation. Though studies have shown the role of coordinated genetic and epigenetic mechanisms in cellular development and differentiation, how the lineage fate of adult bone marrow progenitor cells (BMPCs) is reprogrammed during liver regeneration and whether this lineage switch is stably maintained are not clearly understood. In the present study, we wanted to decipher genetic and epigenetic mechanisms that involve in lineage reprogramming of BMPCs into hepatocyte-like cells. Here we report dynamic transcriptional change during cellular reprogramming of BMPCs to hepatocytes and dissect the epigenetic switch mechanism of BM cell-mediated liver regeneration after acute injury. Genome-wide gene expression analysis in BM-derived hepatocytes, isolated after 1 month and 5 months of transplantation, showed induction of hepatic transcriptional program and diminishing of donor signatures over the time. The transcriptional reprogramming of BM-derived cells was found to be the result of enrichment of activating marks (H3K4me3 and H3K9Ac) and loss of repressive marks (H3K27me3 and H3K9me3) at the promoters of hepatic transcription factors (HTFs). Further analyses showed that BMPCs possess bivalent histone marks (H3K4me3 and H3K27me3) at the promoters of crucial HTFs. H3K27 methylation dynamics at the HTFs was antagonistically regulated by EZH2 and JMJD3. Preliminary evidence suggests a role of JMJD3 in removal of H3K27me3 mark from promoters of HTFs, thus activating epigenetically poised hepatic genes in BMPCs prior to partial nuclear reprogramming. The importance of JMJD3 in reprogramming of BMPCs to hepatic phenotype was confirmed by inhibiting catalytic function of the enzyme using small molecule

  7. An efficient antiviral strategy for targeting hepatitis B virus genome using transcription activator-like effector nucleases.


    Chen, Jieliang; Zhang, Wen; Lin, Junyu; Wang, Fan; Wu, Min; Chen, Cuncun; Zheng, Ye; Peng, Xiuhua; Li, Jianhua; Yuan, Zhenghong


    The hepatitis B virus (HBV) is a DNA virus that can cause chronic hepatitis B (CHB) in humans. Current therapies for CHB infection are limited in efficacy and do not target the pre-existing viral genomic DNA, which are present in the nucleus as a covalently closed circular DNA (cccDNA) form. The transcription activator-like (TAL) effector nucleases (TALENs) are newly developed enzymes that can cleave sequence-specific DNA targets. Here, TALENs targeting the conserved regions of the viral genomic DNA among different HBV genotypes were constructed. The expression of TALENs in Huh7 cells transfected with monomeric linear full-length HBV DNA significantly reduced the viral production of HBeAg, HBsAg, HBcAg, and pgRNA, resulted in a decreased cccDNA level and misrepaired cccDNAs without apparent cytotoxic effects. The anti-HBV effect of TALENs was further demonstrated in a hydrodynamic injection-based mouse model. In addition, an enhanced antiviral effect with combinations of TALENs and interferon-α (IFN-α) treatment was observed and expression of TALENs restored HBV suppressed IFN-stimulated response element-directed transcription. Taken together, these data indicate that TALENs can specifically target and successfully inactivate the HBV genome and are potently synergistic with IFN-α, thus providing a potential therapeutic strategy for treating CHB infection.

  8. Suppression of long chain acyl-CoA synthetase 3 decreases hepatic de novo fatty acid synthesis through decreased transcriptional activity.


    Bu, So Young; Mashek, Mara T; Mashek, Douglas G


    Long chain acyl-CoA synthetases (ACSL) and fatty acid transport proteins (FATP) activate fatty acids to acyl-CoAs in the initial step of fatty acid metabolism. Numerous isoforms of ACSL and FATP exist with different tissue distribution patterns, intracellular locations, and substrate preferences, suggesting that each isoform has distinct functions in channeling fatty acids into different metabolic pathways. Because fatty acids, acyl-CoAs, and downstream lipid metabolites regulate various transcription factors that control hepatic energy metabolism, we hypothesized that ACSL or FATP isoforms differentially regulate hepatic gene expression. Using small interference RNA (siRNA), we knocked down each liver-specific ACSL and FATP isoform in rat primary hepatocyte cultures and subsequently analyzed reporter gene activity of numerous transcription factors and performed quantitative mRNA analysis of their target genes. Compared with control cells, which were transfected with control siRNA, knockdown of acyl-CoA synthetase 3 (ACSL3) significantly decreased reporter gene activity of several lipogenic transcription factors such as peroxisome proliferator activation receptor-gamma, carbohydrate-responsive element-binding protein, sterol regulatory element-binding protein-1c, and liver X receptor-alpha and the expression of their target genes. These findings were further supported by metabolic labeling studies that showed [1-(14)C]acetate incorporation into lipid extracts was decreased in cells treated with ACSL3 siRNAs and that ACSL3 expression is up-regulated in ob/ob mice and mice fed a high sucrose diet. ACSL3 knockdown decreased total acyl-CoA synthetase activity without substantially altering the expression of other ACSL isoforms. In summary, these results identify a novel role for ACSL3 in mediating transcriptional control of hepatic lipogenesis.

  9. Hepatitis A virus detection in oysters (Crassostrea gigas) in Santa Catarina State, Brazil, by reverse transcription-polymerase chain reaction.


    Coelho, C; Heinert, A P; Simões, C M O; Barardi, C R M


    Shellfish are readily contaminated with viruses present in water containing sewage because of the concentration effect of filter feeding. Hepatitis A virus (HAV) is the main cause of acute hepatitis worldwide and may lead to severe illness or even death. It is transmitted through fecal and oral routes and causes widespread endemic and asymptomatic infections in young children. Here we describe a method for the detection of HAV RNA in shellfish involving the extraction of total RNA from oyster meat followed by reverse transcription-polymerase chain reaction (RT-PCR). Virus recovery from oyster extracts artificially seeded with HAV strain HM 175 was examined by RT-PCR. The minimum detection limit was 3.3 focus-forming units of HAV, and the recovery rate was 75.7%. This method was used to assess the viral contamination of four shellfish beds in Santa Catarina State, Brazil, over a 1-year period. Six (22%) of 27 samples collected in autumn and winter from one shellfish bed tested positive for HAV.

  10. Ribonuclease T1 generates circular RNA molecules from viroid-specific RNA transcripts by cleavage and intramolecular ligation.

    PubMed Central

    Tsagris, M; Tabler, M; Sänger, H L


    A 406 nucleotide long potato spindle tuber viroid (PSTVd)-specific linear RNA transcript was synthesized in vitro and subjected to limited digestion with ribonuclease (RNase) T1. Under certain conditions this guanosine-specific endoribonuclease proved to be capable of processing the longer-than-unit-length, precursor-like viroid RNA transcript by cleaving out a linear 358 nucleotide long product and ligating that to a circular RNA molecule. The new finding that RNase T1 acts as an RNA processing enzyme and, in particular, as an RNA 'circulase' can be explained by the unique structural preconditions inherent in the viroid-specific substrate and by the well characterized two-step cleavage mechanism of the enzyme. These in vitro potentials of RNase T1 suggest that also in vivo procaryotic and eucaryotic RNases with a similar reaction mechanism might not only be involved in RNA degradation and trimming, but also in processing, ligation and recombination of RNA. Images PMID:1709278

  11. Landscape of post-transcriptional gene regulation during hepatitis C virus infection

    PubMed Central

    Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram


    Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065

  12. Molecular basis of RNA polymerase promoter specificity switch revealed through studies of Thermus bacteriophage transcription regulator

    PubMed Central

    Severinov, Konstantin; Minakhin, Leonid; Sekine, Shun-ichi; Lopatina, Anna; Yokoyama, Shigeyuki


    Transcription initiation is the central point of gene expression regulation. Understanding of molecular mechanism of transcription regulation requires, ultimately, the structural understanding of consequences of transcription factors binding to DNA-dependent RNA polymerase (RNAP), the enzyme of transcription. We recently determined a structure of a complex between transcription factor gp39 encoded by a Thermus bacteriophage and Thermus RNAP holoenzyme. In this addendum to the original publication, we highlight structural insights that explain the ability of gp39 to act as an RNAP specificity switch which inhibits transcription initiation from a major class of bacterial promoters, while allowing transcription from a minor promoter class to continue. PMID:25105059

  13. Principles for RNA metabolism and alternative transcription initiation within closely spaced promoters

    PubMed Central

    Chen, Yun; Pai, Athma A.; Herudek, Jan; Lubas, Michal; Meola, Nicola; Järvelin, Aino I.; Andersson, Robin; Pelechano, Vicent; Steinmetz, Lars M.; Heick Jensen, Torben; Sandelin, Albin


    Mammalian transcriptomes are complex and formed by extensive promoter activity. In addition, gene promoters are largely divergent and initiate transcription of reverse-oriented promoter upstream transcripts (PROMPTs). Although PROMPTs are commonly terminated early, influenced by polyadenylation sites, promoters often cluster so that the divergent activity of one might impact another. Here, we find that the distance between promoters strongly correlates with the expression, stability and length of their associated PROMPTs. Adjacent promoters driving divergent mRNA transcription support PROMPT formation, but due to polyadenylation site constraints, these transcripts tend to spread into the neighboring mRNA on the same strand. This mechanism to derive new alternative mRNA transcription start sites (TSSs) is also evident at closely spaced promoters supporting convergent mRNA transcription. We suggest that basic building blocks of divergently transcribed core promoter pairs, in combination with the wealth of TSSs in mammalian genomes, provides a framework with which evolution shapes transcriptomes. PMID:27455346

  14. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  15. The thumb subdomain of yeast mitochondrial RNA polymerase is involved in processivity, transcript fidelity and mitochondrial transcription factor binding.


    Velazquez, Gilberto; Sousa, Rui; Brieba, Luis G


    Single subunit RNA polymerases have evolved 2 mechanisms to synthesize long transcripts without falling off a DNA template: binding of nascent RNA and interactions with an RNA:DNA hybrid. Mitochondrial RNA polymerases share a common ancestor with T-odd bacteriophage single subunit RNA polymerases. Herein we characterized the role of the thumb subdomain of the yeast mtRNA polymerase gene (RPO41) in complex stability, processivity, and fidelity. We found that deletion and point mutants of the thumb subdomain of yeast mtRNA polymerase increase the synthesis of abortive transcripts and the probability that the polymerase will disengage from the template during the formation of the late initial transcription and elongation complexes. Mutations in the thumb subdomain increase the amount of slippage products from a homopolymeric template and, unexpectedly, thumb subdomain deletions decrease the binding affinity for mitochondrial transcription factor (Mtf1). The latter suggests that the thumb subdomain is part of an extended binding surface area involved in binding Mtf1.

  16. A new way to start: nanoRNA-mediated priming of transcription initiation.


    Nickels, Bryce E


    A recent study provides evidence that RNA polymerase uses 2- to ~4-nt RNAs, species termed "nanoRNAs," to prime transcription initiation in Escherichia coli. Priming of transcription initiation with nanoRNAs represents a previously undocumented component of transcription start site selection and gene expression.

  17. Single-molecule imaging reveals a switch between spurious and functional ncRNA transcription

    PubMed Central

    Lenstra, Tineke L.; Coulon, Antoine; Chow, Carson C.; Larson, Daniel R.


    Summary Eukaryotic transcription is pervasive, and many of the resulting RNAs are non-coding. It is unknown if ubiquitous transcription is functional or simply reflects stochastic transcriptional noise. By single-molecule visualization of the dynamic interplay between coding and non-coding transcription at the GAL locus in living yeast cells, we show that antisense GAL10 ncRNA transcription can switch between functional and spurious under different conditions. During galactose induction, GAL10 sense transcription occurs in short stochastic bursts which are unaffected by transcription of antisense GAL10 ncRNA, even when both are present simultaneously at the same locus. In contrast, when GAL10 is not induced, ncRNA transcription is critical to prevent transcriptional leakage of GAL1 and GAL10. Suppression of ncRNA transcription by strand-specific CRISPR/dCas9 results in transcriptional leakage of the inducer GAL1, leading to a more sensitive transcription activation threshold, an alteration of metabolic switching, and a fitness defect in competition experiments. PMID:26549684

  18. Post-transcriptional regulation tends to attenuate the mRNA noise and to increase the mRNA gain

    NASA Astrophysics Data System (ADS)

    Shi, Changhong; Wang, Shuqiang; Zhou, Tianshou; Jiang, Yiguo


    Post-transcriptional regulation is ubiquitous in prokaryotic and eukaryotic cells, but how it impacts gene expression remains to be fully explored. Here, we analyze a simple gene model in which we assume that mRNAs are produced in a constitutive manner but are regulated post-transcriptionally by a decapping enzyme that switches between the active state and the inactive state. We derive the analytical mRNA distribution governed by a chemical master equation, which can be well used to analyze the mechanism of how post-transcription regulation influences the mRNA expression level including the mRNA noise. We demonstrate that the mean mRNA level in the stochastic case is always higher than that in the deterministic case due to the stochastic effect of the enzyme, but the size of the increased part depends mainly on the switching rates between two enzyme states. More interesting is that we find that in contrast to transcriptional regulation, post-transcriptional regulation tends to attenuate noise in mRNA. Our results provide insight into the role of post-transcriptional regulation in controlling the transcriptional noise.

  19. The metabolic activator FOXO1 binds hepatitis B virus DNA and activates its transcription

    SciTech Connect

    Shlomai, Amir; Shaul, Yosef


    Hepatitis B virus (HBV) is a small DNA virus that targets the liver and infects humans worldwide. Recently we have shown that the metabolic regulator PGC-1{alpha} coactivates HBV transcription thereby rendering the virus susceptible to fluctuations in the nutritional status of the liver. PGC-1{alpha} coactivation of HBV is mediated through the liver-enriched nuclear receptor HNF4{alpha} and through another yet unknown transcription factor(s). Here we show that the forkhead transcription factor FOXO1, a known target for PGC-1{alpha} coactivation and a central mediator of glucose metabolism in the liver, binds HBV core promoter and activates its transcription. This activation is further enhanced in the presence of PGC-1{alpha}, implying that FOXO1 is a target for PGC-1{alpha} coactivation of HBV transcription. Thus, our results identify another key metabolic regulator as an activator of HBV transcription, thereby supporting the principle that HBV gene expression is regulated in a similar way to key hepatic metabolic genes.

  20. Role of Hepatic-Specific Transcription Factors and Polycomb Repressive Complex 2 during Induction of Fibroblasts to Hepatic Fate

    PubMed Central

    Wee, Ping; Yaqubi, Moein


    Direct reprogramming using defined sets of transcription factors (TFs) is a recent strategy for generating induced hepatocytes (iHeps) from fibroblasts for use in regenerative medicine and drug development. Comprehensive studies detailing the regulatory role of TFs during this reprogramming process could help increase its efficiency. This study aimed to find the TFs with the greatest influences on the generation of iHeps from fibroblasts, and to further understand their roles in the regulation of the gene expression program. Here, we used systems biology approaches to analyze high quality expression data sets in combination with TF-binding sites data and protein-protein interactions data during the direct reprogramming of fibroblasts to iHeps. Our results revealed two main patterns for differentially expressed genes (DEGs): up-regulated genes were categorized as hepatic-specific pattern, and down-regulated genes were categorized as mesoderm- and fibroblast-specific pattern. Interestingly, hepatic-specific genes co-expressed and were regulated by hepatic-specific TFs, specifically Hnf4a and Foxa2. Conversely, the mesoderm- and fibroblast-specific pattern was mainly silenced by polycomb repressive complex 2 (PRC2) members, including Suz12, Mtf2, Ezh2, and Jarid2. Independent analysis of both the gene and core regulatory network of DE-TFs showed significant roles for Hnf4a, Foxa2, and PRC2 members in the regulation of the gene expression program and in biological processes during the direct conversion process. Altogether, using systems biology approaches, we clarified the role of Hnf4a and Foxa2 as hepatic-specific TFs, and for the first time, introduced the PRC2 complex as the main regulator that favors the direct reprogramming process in cooperation with hepatic-specific factors. PMID:27902735

  1. Bacillus subtilis 6S-2 RNA serves as a template for short transcripts in vivo.


    Hoch, Philipp G; Schlereth, Julia; Lechner, Marcus; Hartmann, Roland K


    The global transcriptional regulator 6S RNA is abundant in a broad range of bacteria. The RNA competes with DNA promoters for binding to the housekeeping RNA polymerase (RNAP) holoenzyme. When bound to RNAP, 6S RNA serves as a transcription template for RNAP in an RNA-dependent RNA polymerization reaction. The resulting short RNA transcripts (so-called product RNAs = pRNAs) can induce a stable structural rearrangement of 6S RNA when reaching a certain length. This rearrangement leads to the release of RNAP and thus the recovery of transcription at DNA promoters. While most bacteria express a single 6S RNA, some harbor a second 6S RNA homolog (termed 6S-2 RNA in Bacillus subtilis). Bacillus subtilis 6S-2 RNA was recently shown to exhibit essentially all hallmark features of a bona fide 6S RNA in vitro, but evidence for the synthesis of 6S-2 RNA-derived pRNAs in vivo has been lacking so far. This raised the question of whether the block of RNAP by 6S-2 RNA might be lifted by a mechanism other than pRNA synthesis. However, here we demonstrate that 6S-2 RNA is able to serve as a template for pRNA synthesis in vivo. We verify this finding by using three independent approaches including a novel primer extension assay. Thus, we demonstrate the first example of an organism that expresses two distinct 6S RNAs that both exhibit all mechanistic features defined for this type of regulatory RNA.

  2. The structure of RNA-free Rho termination factor indicates a dynamic mechanism of transcript capture.


    Canals, Albert; Usón, Isabel; Coll, Miquel


    The Rho factor is a ring-shaped ATP-dependent helicase that mediates transcription termination in most prokaryotic cells by disengaging the transcription elongation complex formed by the RNA polymerase, DNA, and the nascent RNA transcript. The crystal structures of key intermediates along the kinetic pathway of RNA binding to Rho unveiled an unprecedented mode of helicase loading and provided a model for the ATP turnover coupled to coordinated strand movement. Here we report the structure of the early RNA-free state of Rho, which had eluded crystallization for many years but now completes the series. The structure allows the characterization of the apo-form Rho from Thermotoga maritima to 2.3 A resolution, reveals an RNA-recruiting site that becomes hidden after occupancy of the adjacent specific primary RNA-binding site, and suggests an enriched model for mRNA capture that is consistent with previous data.

  3. MORPHEUS' MOLECULE1 is required to prevent aberrant RNA transcriptional read-through in Arabidopsis.


    Zhou, Yue; Zhang, Jun; Lin, Huixin; Guo, Guangqin; Guo, Yan


    Several pathways function to remove aberrant mRNA in eukaryotic cells; however, the exact mechanisms underlying the restriction of aberrant mRNA transcription are poorly understood. In this study, we found that MORPHEUS' MOLECULE1 (MOM1) is a key component of this regulatory machinery. The Arabidopsis (Arabidopsis thaliana) mom1-44 mutation was identified by luciferase imaging in transgenic plants harboring a cauliflower mosaic virus 35S promoter-LUCIFERASE transgene lacking the 3'-untranslated region. In the mom1-44 mutant, transcriptional read-though occurred in genes with an aberrant RNA structure. Analysis of an RNA-dependent RNA polymerase2 mom1 double mutant revealed that the RNA-directed DNA methylation pathway is not involved in this regulatory process. Moreover, the prevention of aberrant mRNA transcriptional read-through by MOM1 is gene locus and transgene copy number independent.

  4. A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells

    PubMed Central

    Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.


    PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381

  5. Beneficial effect of berberine on hepatic insulin resistance in diabetic hamsters possibly involves in SREBPs, LXRα and PPARα transcriptional programs.


    Liu, Xuhan; Li, Guosheng; Zhu, Hua; Huang, Lan; Liu, Yali; Ma, Chunmei; Qin, Chuan


    The "lipotoxicity" hypothesis holds that fat-induced hepatic insulin resistance (FIHIR) may play a major role in the pathogenesis of type 2 diabetes. Berberine has been reported to have antidiabetic properties. However, the molecular mechanisms for this action are not fully clarified. Therefore, we will investigate the gene expression alterations involved in the therapeutic effect of berberine on FIHIR in diabetic hamsters and possible mechanisms. In this study, type 2 diabetic hamsters were induced by high-fat diet with streptozotocin injection. After 9 weeks of berberine-treatment, the gene expression alterations involved in the therapeutic molecular mechanisms of berberine on FIHIR will be studied by microarray technology and real time RT-PCR. Our study demonstrates berberine significantly improved fat-induced insulin resistance and diabetic phenotype in type 2 diabetic hamsters. The alterations of certain metabolism related genes and their main regulators: Liver X receptor (LXR) α, Peroxisome proliferator-activated receptor (PPAR) α and Sterol regulatory element-binding protein (SREBPs) are observed in the liver of treated and untreated diabetic hamsters. Compared with diabetic hamsters, the increased mRNA levels of LXRα and PPARα and the decreased mRNA levels of SREBPs are observed in berberine-treated diabetic hamster. The statistical significance of the expression of hepatic LXRα, SREBPs and PPARα and their certain target genes is found between treated and untreated diabetic hamsters. These results suggest that altered hepatic SREBPs, LXRα and PPARα transcriptional programs possibly involve in the therapeutic mechanisms of berberine on FIHIR in type 2 diabetic hamsters.

  6. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen


    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  7. A novel peroxisome proliferator response element modulates hepatic low-density lipoprotein receptor gene transcription in response to PPARδ activation.


    Shende, Vikram R; Singh, Amar Bahadur; Liu, Jingwen


    The hepatic expression of low-density lipoprotein (LDL) receptor (LDLR) gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative peroxisome proliferator-activated receptor (PPAR)-response element (PPRE) sequence motif located at -768 to -752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin (RSV)-mediated transactivation. EMSA and ChIP assay further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression.

  8. Detergent-induced activation of the hepatitis C virus genotype 1b RNA polymerase.


    Weng, Leiyun; Kohara, Michinori; Wakita, Takaji; Shimotohno, Kunitada; Toyoda, Tetsuya


    Recently, we found that sphingomyelin bound and activated hepatitis C virus (HCV) 1b RNA polymerase (RdRp), thereby recruiting the HCV replication complex into lipid raft structures. Detergents are commonly used for resolving lipids and purifying proteins, including HCV RdRp. Here, we tested the effect of detergents on HCV RdRp activity in vitro and found that non-ionic (Triton X-100, NP-40, Tween 20, Tween 80, and Brij 35) and twitterionic (CHAPS) detergents activated HCV 1b RdRps by 8-16.6 folds, but did not affect 1a or 2a RdRps. The maximum effect of these detergents was observed at around their critical micelle concentrations. On the other hand, ionic detergents (SDS and DOC) completely inactivated polymerase activity at 0.01%. In the presence of Triton X-100, HCV 1b RdRp did not form oligomers, but recruited more template RNA and increased the speed of polymerization. Comparison of polymerase and RNA-binding activity between JFH1 RdRp and Triton X-100-activated 1b RdRp indicated that monomer RdRp showed high activity because JFH1 RdRp was a monomer in physiological conditions of transcription. Besides, 502H plays a key role on oligomerization of 1b RdRp, while 2a RdRps which have the amino acid S at position 502 are monomers. This oligomer formed by 502H was disrupted both by high salt and Triton X-100. On the contrary, HCV 1b RdRp completely lost fidelity in the presence of 0.02% Triton X-100, which suggests that caution should be exercised while using Triton X-100 in anti-HCV RdRp drug screening tests.

  9. Rapid Amplification of cDNA Ends for RNA Transcript Sequencing in Staphylococcus.


    Miller, Eric


    Rapid amplification of cDNA ends (RACE) is a technique that was developed to swiftly and efficiently amplify full-length RNA molecules in which the terminal ends have not been characterized. Current usage of this procedure has been more focused on sequencing and characterizing RNA 5' and 3' untranslated regions. Herein is described an adapted RACE protocol to amplify bacterial RNA transcripts.

  10. Transcription profile of boar spermatozoa as revealed by RNA-sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput RNA sequencing (RNA-Seq) overcomes the limitations of the current hybridization-based techniques to detect the actual pool of RNA transcripts in spermatozoa. The application of this technology in livestock can speed the discovery of potential predictors of male fertility. As a first ...

  11. The transcription cycle in eukaryotes: from productive initiation to RNA polymerase II recycling.


    Shandilya, Jayasha; Roberts, Stefan G E


    The cycle of eukaryotic transcription, from initiation to elongation and termination is regulated at multiple steps. Coordinated action of regulatory factors keeps in check the transcriptional competence of RNA polymerase II (RNAPII) at different stages. Productive transcription requires the escape of the paused RNAPII from the promoter and transition to rapid elongation of the transcript. Numerous studies have identified diverse mechanisms of initiating transcription by overriding inhibitory signals at the gene promoter. The general theme that has emerged is that the balance between positive and negative regulatory factors determines the overall rate of transcription. Recently transcription termination has emerged as an important area of transcriptional regulation that is coupled with the efficient recycling of RNAPII. The factors associated with transcription termination can also mediate gene looping and thereby determine the efficiency of re-initiation. This review highlights these regulatory steps, the key modulators involved in transcription dynamics, and the emerging tools to analyze them.

  12. Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

    PubMed Central

    Mishima, Y; Mitsuma, T; Ogata, K


    An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

  13. Transcription and Maturation of mRNA in Dinoflagellates

    PubMed Central

    Roy, Sougata; Morse, David


    Dinoflagellates are of great importance to the marine ecosystem, yet scant details of how gene expression is regulated at the transcriptional level are available. Transcription is of interest in the context of the chromatin structure in the dinoflagellates as it shows many differences from more typical eukaryotic cells. Here we canvas recent transcriptome profiles to identify the molecular building blocks available for the construction of the transcriptional machinery and contrast these with those used by other systems. Dinoflagellates display a clear paucity of specific transcription factors, although surprisingly, the rest of the basic transcriptional machinery is not markedly different from what is found in the close relatives to the dinoflagellates. PMID:27694765

  14. Degraded RNA transcript stable regions (StaRs) as targets for enhanced forensic RNA body fluid identification.


    Lin, Meng-Han; Albani, Patricia P; Fleming, Rachel


    The detection of messenger RNA (mRNA) using reverse transcriptase PCR (RT-PCR) is becoming common practice for forensic body fluid identification. However, the degraded and scarce nature of RNA from forensic samples mean that mRNA transcripts are not consistently detected or remain undetected in practice. Conventional primer design for RT-PCR (and quantitative RT-PCR) includes targeting primers to span exon-exon boundaries or by having the primers on two separate exons, and satisfying common primer thermodynamic criteria. We have found that the conventional placement of primers is not always optimal for obtaining reproducible results from degraded samples. Using massively parallel sequencing data from degraded body fluids, we designed primers to amplify transcript regions of high read coverage, hence, higher stability, and compared these with primers designed using conventional methodology. Our findings are that primers designed for transcript regions of higher read coverage resulted in vastly improved detection of mRNA transcripts that were not previously detected or were not consistently detected in the same samples using conventional primers. We developed a new concept whereby primers targeted to transcript stable regions (StaRs) are able to consistently and specifically amplify a wide range of RNA biomarkers in various body fluids of varying degradation levels.

  15. Elevated serum microRNA-122/222 levels are potential diagnostic biomarkers in Egyptian patients with chronic hepatitis C but not hepatic cancer.


    Motawi, Tarek M K; Sadik, Nermin A H; Shaker, Olfat G; Ghaleb, Maggy H


    MicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs that regulate gene expression at the post-transcriptional level. Because of their size, specificity, and relative stability in plasma, miRNAs can be used as diagnostic and prognostic biomarkers to monitor liver injury, such as that caused by hepatitis C virus (HCV) and liver cancer. In this study, we investigated miRNA expression patterns from the serum of Egyptian patients with HCV and liver cancer compared with matched healthy controls. Using microarray-based expression profiling followed by real-time quantitative polymerase chain reaction validation, we compared the levels of circulating miRNA-122 and miRNA-222 in serum from patients with hepatitis C virus (n = 40) and liver cancer (n = 60) to matched healthy controls (n = 30). MiRNA SNORD68 was the housekeeping endogenous control. We found that the serum levels of miR-122 and miR-222 were significantly elevated in HCV patients, but not in liver cancer patients, compared with controls. Receiver operating characteristic analysis revealed that miR-122 and miR-222 have a high diagnostic potential in discriminating patients with HCV from controls. Serum miR-222 was significantly higher in HCV patients compared to liver cancer patients. Our results indicate that serum miR-122 and miR-222 are elevated in Egyptian patients with chronic HCV, and these miRNAs have a strong potential to serve as novel biomarkers for liver injury but not specifically for liver cancer.

  16. Antisense Transcription of Retrotransposons in Drosophila: An Origin of Endogenous Small Interfering RNA Precursors

    PubMed Central

    Russo, Joseph; Harrington, Andrew W.; Steiniger, Mindy


    Movement of transposons causes insertions, deletions, and chromosomal rearrangements potentially leading to premature lethality in Drosophila melanogaster. To repress these elements and combat genomic instability, eukaryotes have evolved several small RNA-mediated defense mechanisms. Specifically, in Drosophila somatic cells, endogenous small interfering (esi)RNAs suppress retrotransposon mobility. EsiRNAs are produced by Dicer-2 processing of double-stranded RNA precursors, yet the origins of these precursors are unknown. We show that most transposon families are transcribed in both the sense (S) and antisense (AS) direction in Dmel-2 cells. LTR retrotransposons Dm297, mdg1, and blood, and non-LTR retrotransposons juan and jockey transcripts, are generated from intraelement transcription start sites with canonical RNA polymerase II promoters. We also determined that retrotransposon antisense transcripts are less polyadenylated than sense. RNA-seq and small RNA-seq revealed that Dicer-2 RNA interference (RNAi) depletion causes a decrease in the number of esiRNAs mapping to retrotransposons and an increase in expression of both S and AS retrotransposon transcripts. These data support a model in which double-stranded RNA precursors are derived from convergent transcription and processed by Dicer-2 into esiRNAs that silence both sense and antisense retrotransposon transcripts. Reduction of sense retrotransposon transcripts potentially lowers element-specific protein levels to prevent transposition. This mechanism preserves genomic integrity and is especially important for Drosophila fitness because mobile genetic elements are highly active. PMID:26534950

  17. Preparation of long templates for RNA in vitro transcription by recursive PCR.


    Bowman, Jessica C; Azizi, Bahareh; Lenz, Timothy K; Roy, Poorna; Williams, Loren Dean


    Preparing conventional DNA templates for in vitro RNA transcription involves PCR amplification of the DNA gene coding for the RNA of interest from plasmid or genomic DNA, subsequent amplification with primers containing a 5' T7 promoter region, and confirmation of the amplified DNA sequence. Complications arise in applications where long, nonnative sequences are desired in the final RNA transcript. Here we describe a ligase-independent method for the preparation of long synthetic DNA templates for in vitro RNA transcription. In Recursive PCR, partially complementary DNA oligonucleotides coding for the RNA sequence of interest are annealed, extended into the full-length double-stranded DNA, and amplified in a single PCR. Long insertions, mutations, or deletions are accommodated prior to in vitro transcription by simple substitution of oligonucleotides.

  18. Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering.


    Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko


    Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

  19. Single-molecule RNA observation in vivo reveals dynamics of co-transcriptional splicing

    NASA Astrophysics Data System (ADS)

    Ferguson, M. L.; Coulon, A.; de Turris, V.; Palangat, M.; Chow, C. C.; Singer, R. H.; Larson, D. R.


    The synthesis of pre-mRNA and the splicing of that pre-mRNA to form completed transcripts requires coordination between two large multi-subunit complexes (the transcription elongation complex and the spliceosome). How this coordination occurs in vivo is unknown. Here we report the first experimental observation of transcription and splicing occurring at the same gene in living cells. By utilizing the PP7/MS2 fluorescent RNA reporter system, we can directly observe two distinct regions of the nascent RNA, allowing us to measure the rise and fall time of the intron and exon of a reporter gene stably integrated into a human cell line. The reporter gene consists of a beta globin gene where we have inserted a 24 RNA hairpin cassette into the intron/exon. Upon synthesis, the RNA hairpins are tightly bound by fluorescently-labeled PP7/MS2 bacteriophage coat proteins. After gene induction, a single locus of active transcription in the nucleus shows fluorescence intensity changes characteristic of the synthesis and excision of the intron/exon. Using fluctuation analysis, we determine the elongation rate to be 1.5 kb/min. From the temporal cross correlation function, we determine that splicing of this gene must be co-transcriptional with a splicing time of ~100 seconds before termination and a ~200 second pause at termination. We propose that dual-color RNA imaging may be extended to investigate other mechanisms of transcription, gene regulation, and RNA processing.

  20. MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH

    PubMed Central

    Portal, Maximiliano M.


    General transcription factor IIH (TFIIH) is a complex RNA polymerase II basal transcription factor comprising 10 different polypeptides that display activities involved in transcription and DNA repair processes. Although biochemical studies have uncovered TFIIH importance, little is known about how the mRNAs that code for TFIIH subunits are regulated. Here it is shown that mRNAs encoding seven of the TFIIH subunits (p34, p44, p52, p62, XPB, CDK7, and p8) are regulated at the posttranscriptional level in a Dicer-dependent manner. Indeed, abolition of the miRNA pathway induces abnormal accumulation, stabilization, and translational activation of these seven mRNAs. Herein, miR-27a was identified as a key regulator of p44 mRNA. Moreover, miR-27a was shown to destabilize the p44 subunit of the TFIIH complex during the G2-M phase, thereby modulating the transcriptional shutdown observed during this transition. This work is unique in providing a demonstration of global transcriptional regulation through the action of a single miRNA. PMID:21558443

  1. An RNA enhancer in a phage transcriptional antitermination complex functions as a structural switch

    PubMed Central

    Su, Leila; Radek, James T.; Labeots, Laura A.; Hallenga, Klaas; Hermanto, Patrick; Chen, Huifen; Nakagawa, Satoe; Zhao, Ming; Kates, Steve; Weiss, Michael A.


    Antitermination protein N regulates the transcriptional program of phage λ through recognition of RNA enhancer elements. Binding of an arginine-rich peptide to one face of an RNA hairpin organizes the other, which in turn binds to the host antitermination complex. The induced RNA structure mimics a GNRA hairpin, an organizational element of rRNA and ribozymes. The two faces of the RNA, bridged by a sheared GA base pair, exhibit a specific pattern of base stacking and base flipping. This pattern is extended by stacking of an aromatic amino acid side chain with an unpaired adenine at the N-binding surface. Such extended stacking is coupled to induction of a specific internal RNA architecture and is blocked by RNA mutations associated in vivo with loss of transcriptional antitermination activity. Mimicry of a motif of RNA assembly by an RNA–protein complex permits its engagement within the antitermination machinery. PMID:9303537

  2. Transcript Abundance Explains mRNA Mobility Data in Arabidopsis thaliana.


    Calderwood, Alexander; Kopriva, Stanislav; Morris, Richard J


    Recently, a large population of mRNA was shown to be able to travel between plant organs via sieve elements as a putative long-distance signaling molecule. However, a mechanistic basis by which transcripts are selected for transport has not yet been identified. Here, we show that experimental mRNA mobility data in Arabidopsis can be explained by transcript abundance and half-life. This suggests that the majority of identified mobile transcripts can be accounted for by non-sequence-specific movement of mRNA from companion cells into sieve elements.

  3. Preparation of Small RNAs Using Rolling Circle Transcription and Site-Specific RNA Disconnection

    PubMed Central

    Wang, Xingyu; Li, Can; Gao, Xiaomeng; Wang, Jing; Liang, Xingguo


    A facile and robust RNA preparation protocol was developed by combining rolling circle transcription (RCT) with RNA cleavage by RNase H. Circular DNA with a complementary sequence was used as the template for promoter-free transcription. With the aid of a 2′-O-methylated DNA, the RCT-generated tandem repeats of the desired RNA sequence were disconnected at the exact end-to-end position to harvest the desired RNA oligomers. Compared with the template DNA, more than 4 × 103 times the amount of small RNA products were obtained when modest cleavage was carried out during transcription. Large amounts of RNA oligomers could easily be obtained by simply increasing the reaction volume. PMID:25584899

  4. RNA Structural Elements of Hepatitis C Virus Controlling Viral RNA Translation and the Implications for Viral Pathogenesis

    PubMed Central

    Piñeiro, David; Martinez-Salas, Encarnación


    Hepatitis C virus (HCV) genome multiplication requires the concerted action of the viral RNA, host factors and viral proteins. Recent studies have provided information about the requirement of specific viral RNA motifs that play an active role in the viral life cycle. RNA regulatory motifs controlling translation and replication of the viral RNA are mostly found at the 5' and 3' untranslated regions (UTRs). In particular, viral protein synthesis is under the control of the internal ribosome entry site (IRES) element, a complex RNA structure located at the 5'UTR that recruits the ribosomal subunits to the initiator codon. Accordingly, interfering with this RNA structural motif causes the abrogation of the viral cycle. In addition, RNA translation initiation is modulated by cellular factors, including miRNAs and RNA-binding proteins. Interestingly, a RNA structural motif located at the 3'end controls viral replication and establishes long-range RNA-RNA interactions with the 5'UTR, generating functional bridges between both ends on the viral genome. In this article, we review recent advances on virus-host interaction and translation control modulating viral gene expression in infected cells. PMID:23202462

  5. Effects of single-base substitutions within the acanthamoeba castellanii rRNA promoter on transcription and on binding of transcription initiation factor and RNA polymerase I

    SciTech Connect

    Kownin, P.; Bateman, E.; Paule, M.R.


    Single-point mutations were introduced into the promoter region of the Acanthamoeba castellanii rRNA gene by chemical mutagen treatment of a single-stranded clone in vitro, followed by reverse transcription and cloning of the altered fragment. The promoter mutants were tested for transcription initiation factor (TIF) binding by a template commitment assay plus DNase I footprinting and for transcription by an in vitro runoff assay. Point mutations within the previously identified TIF interaction region (between -20 and -47, motifs A and B) indicated that TIF interacts most strongly with a sequence centered at -29 and less tightly with sequences upstream and downstream. Some alterations of the base sequence closer to the transcription start site (and outside the TIF-protected site) also significantly decrease specific RNA synthesis in vitro. These were within the region which is protected from DNAse I digestion by polymerase I, but these mutations did not detectably affect the binding of polymerase to the promoter.

  6. Prevalence of hepatitis G virus RNA in a monocentric population of French haemophiliacs.


    Gerolami, V; Halfon, P; Chambost, H; Sicardi, F; Thuret, I; Planells, R; Halimi, G; Fossat, C; Michel, G; Cartouzou, G


    Hepatitis G virus (HGV) and hepatitis GB virus (GBV-C) have been reported as possible causes of non-A-E transfusional hepatitis. To assess the prevalence of hepatitis G virus infection in haemophiliacs we retrospectively investigated the presence of viral RNA in 92 patients with and without HCV infection. HGV/GBV-C RNA was reverse transcribed and amplified with primers from the 5' non-coding region of the genome. RNA was detected in 16/92 patients (17.4%). Restriction enzyme analysis revealed that the 16 patients belonged to the HGV-like genotype. Serology with E2-specific antibodies demonstrated that HGV viraemia underestimates previous infection by HGV. 33 patients were positive for HGV; all but two have cleared HGV RNA. 47/92 patients had a marker of prior infection by HGV. No difference between HGV RNA positive and negative patients was observed concerning age, diagnosis, HIV and HCV status. Previous HBV infection correlated with the frequency of HGV infection. There was no difference in alanine aminotransferase levels between HGV positive and negative patients. All 18 patients exposed to only virally inactivated plasma-derived concentrates were negative for both HGV RNA and anti E2 antibodies. Prior exposure to untreated concentrates correlated with HGV viraemia (P=0.03), HGV seropositivity (P=0.0002), and markers of HGV infection (P<0.0001). In haemophiliacs with a past exposure to non-inactivated concentrates, persistence of HCV RNA (53/74 patients) was more frequent than HGV RNA persistence (16/74 patients) although HGV viraemia is more frequent than HCV viraemia in blood donors. This may be related to a greater ability of individuals to clear HGV infection and suggests that hepatitis G virus infection in multi-transfused patients has a better outcome than infection with other blood-borne viruses.

  7. Transcription by the multifunctional RNA polymerase I in Trypanosoma brucei functions independently of RPB7.


    Park, Sung Hee; Nguyen, Tu N; Kirkham, Justin K; Lee, Ju Huck; Günzl, Arthur


    Trypanosoma brucei has a multifunctional RNA polymerase (pol) I that transcribes ribosomal gene units (RRNA) and units encoding its major cell surface proteins variant surface glycoprotein (VSG) and procyclin. Previous analysis of tandem affinity-purified, transcriptionally active RNA pol I identified ten subunits including an apparently trypanosomatid-specific protein termed RPA31. Another ortholog was identified in silico. No orthologs of the yeast subunit doublet RPA43/RPA14 have been identified yet. Instead, a recent report presented evidence that RPB7, the RNA pol II paralog of RPA43, is an RNA pol I subunit and essential for RRNA and VSG transcription in bloodstream form trypanosomes [18]. Revisiting this attractive hypothesis, we were unable to detect a stable interaction between RPB7 and RNA pol I in either reciprocal co-immunoprecipitation or tandem affinity purification. Furthermore, immunodepletion of RPB7 from extract virtually abolished RNA pol II transcription in vitro but had no effect on RRNA or VSG ES promoter transcription in the same reactions. Accordingly, chromatin immunoprecipitation analysis revealed cross-linking of RPB7 to known RNA pol II transcription units but not to the VSG ES promoter or to the 18S rRNA coding region. Interestingly, RPB7 did crosslink to the RRNA promoter but so did the RNA pol II-specific subunit RPB9 suggesting that RNA pol II is recruited to this promoter. Overall, our data led to the conclusion that RNA pol I transcription in T. brucei does not require the RNA pol II subunit RPB7.

  8. A small RNA targets pokeweed antiviral protein transcript.


    Klenov, Alexander; Neller, Kira C M; Burns, Lydia A; Krivdova, Gabriela; Hudak, Katalin A


    Ribosome-inactivating proteins (RIPs) are a class of plant defense proteins with N-glycosidase activity (EC Pokeweed antiviral protein (PAP) is a Type I RIP isolated from the pokeweed plant, Phytolacca americana, thought to confer broad-spectrum virus resistance in this plant. Through a combination of standard molecular techniques and RNA sequencing analysis, we report here that a small RNA binds and cleaves the open reading frame of PAP mRNA. Additionally, sRNA targeting of PAP is dependent on jasmonic acid (JA), a plant hormone important for defense against pathogen infection and herbivory. Levels of small RNA increased with JA treatment, as did levels of PAP mRNA and protein, suggesting that the small RNA functions to moderate the expression of PAP in response to this hormone. The association between JA and PAP expression, mediated by sRNA299, situates PAP within a signaling pathway initiated by biotic stress. The consensus sequence of sRNA299 was obtained through bioinformatic analysis of pokeweed small RNA sequencing. To our knowledge, this is the first account of a sRNA targeting a RIP gene.

  9. Effect of Soil Clay Content on RNA Isolation and on Detection and Quantification of Bacterial Gene Transcripts in Soil by Quantitative Reverse Transcription-PCR ▿†

    PubMed Central

    Novinscak, A.; Filion, M.


    In this study, we evaluated the effect of soil clay content on RNA isolation and on quantitative reverse transcription-PCR (qRT-PCR) quantification of microbial gene transcripts. The amount of clay significantly altered RNA isolation yields and qRT-PCR analyses. Recommendations are made for quantifying microbial gene transcripts in soil samples varying in clay content. PMID:21724880

  10. Human cellular CYBA UTR sequences increase mRNA translation without affecting the half-life of recombinant RNA transcripts.


    Ferizi, Mehrije; Aneja, Manish K; Balmayor, Elizabeth R; Badieyan, Zohreh Sadat; Mykhaylyk, Olga; Rudolph, Carsten; Plank, Christian


    Modified nucleotide chemistries that increase the half-life (T1/2) of transfected recombinant mRNA and the use of non-native 5'- and 3'-untranslated region (UTR) sequences that enhance protein translation are advancing the prospects of transcript therapy. To this end, a set of UTR sequences that are present in mRNAs with long cellular T1/2 were synthesized and cloned as five different recombinant sequence set combinations as upstream 5'-UTR and/or downstream 3'-UTR regions flanking a reporter gene. Initial screening in two different cell systems in vitro revealed that cytochrome b-245 alpha chain (CYBA) combinations performed the best among all other UTR combinations and were characterized in detail. The presence or absence of CYBA UTRs had no impact on the mRNA stability of transfected mRNAs, but appeared to enhance the productivity of transfected transcripts based on the measurement of mRNA and protein levels in cells. When CYBA UTRs were fused to human bone morphogenetic protein 2 (hBMP2) coding sequence, the recombinant mRNA transcripts upon transfection produced higher levels of protein as compared to control transcripts. Moreover, transfection of human adipose mesenchymal stem cells with recombinant hBMP2-CYBA UTR transcripts induced bone differentiation demonstrating the osteogenic and therapeutic potential for transcript therapy based on hybrid UTR designs.

  11. Human cellular CYBA UTR sequences increase mRNA translation without affecting the half-life of recombinant RNA transcripts

    PubMed Central

    Ferizi, Mehrije; Aneja, Manish K.; Balmayor, Elizabeth R.; Badieyan, Zohreh Sadat; Mykhaylyk, Olga; Rudolph, Carsten; Plank, Christian


    Modified nucleotide chemistries that increase the half-life (T1/2) of transfected recombinant mRNA and the use of non-native 5′- and 3′-untranslated region (UTR) sequences that enhance protein translation are advancing the prospects of transcript therapy. To this end, a set of UTR sequences that are present in mRNAs with long cellular T1/2 were synthesized and cloned as five different recombinant sequence set combinations as upstream 5′-UTR and/or downstream 3′-UTR regions flanking a reporter gene. Initial screening in two different cell systems in vitro revealed that cytochrome b-245 alpha chain (CYBA) combinations performed the best among all other UTR combinations and were characterized in detail. The presence or absence of CYBA UTRs had no impact on the mRNA stability of transfected mRNAs, but appeared to enhance the productivity of transfected transcripts based on the measurement of mRNA and protein levels in cells. When CYBA UTRs were fused to human bone morphogenetic protein 2 (hBMP2) coding sequence, the recombinant mRNA transcripts upon transfection produced higher levels of protein as compared to control transcripts. Moreover, transfection of human adipose mesenchymal stem cells with recombinant hBMP2-CYBA UTR transcripts induced bone differentiation demonstrating the osteogenic and therapeutic potential for transcript therapy based on hybrid UTR designs. PMID:27974853

  12. Ubiquitin mRNA is a major stress-induced transcript in mammalian cells.

    PubMed Central

    Fornace, A J; Alamo, I; Hollander, M C; Lamoreaux, E


    Ubiquitin mRNA was found to be an abundant transcript which was induced by heat shock (HS), and certain other stresses in mammalian cells. In Chinese hamster cells, the 2 major ubiquitin transcripts of 2.6 kb and 1.7 kb were induced coordinately, while a minor ubiquitin transcript of 0.8 kb was not induced; the response was similar in human cells with induction of the 2.5 kb Ub C and 1.0 kb Ub B transcripts. A representative ubiquitin cDNA clone, isolated from a cDNA library derived from HS-treated Chinese hamster cells, coded for a typical tandem repeat polyubiquitin transcript. Only a portion of the 5' nontranslated sequence of this clone had homology with the previously published corresponding region in human Ub B mRNA. Oligonucleotide probes complementary to the portion of the 5' nontranslated sequence with homology to the human sequence and also portions with no homology hybridized only to the 1.7 kb transcript. There was coordinate induction of ubiquitin, HSP27, and HSP70 mRNA by HS as determined by both increased RNA and increased transcription. Ubiquitin mRNA was induced by certain DNA damaging agents, in particular the alkylating agent methylmethane sulfonate, or incubation in isoleucine-deficient medium under conditions where the other HSP mRNA were not. Images PMID:2537950

  13. Importance of steric effects on the efficiency and fidelity of transcription by T7 RNA polymerase.


    Ulrich, Sébastien; Kool, Eric T


    DNA-dependent RNA polymerases such as T7 RNA polymerase (T7 RNAP) perform the transcription of DNA into mRNA with high efficiency and high fidelity. Although structural studies have provided a detailed account of the molecular basis of transcription, the relative importance of factors like hydrogen bonds and steric effects remains poorly understood. We report herein the first study aimed at systematically probing the importance of steric and electrostatic effects on the efficiency and fidelity of DNA transcription by T7 RNAP. We used synthetic nonpolar analogues of thymine with sizes varying in subangstrom increments to probe the steric requirements of T7 RNAP during the elongation mode of transcription. Enzymatic assays with internal radiolabeling were performed to compare the efficiency of transcription of modified DNA templates with a natural template containing thymine as a reference. Furthermore, we analyzed effects on the fidelity by measuring the composition of RNA transcripts by enzymatic digestion followed by two-dimensional thin layer chromatography separation. Our results demonstrate that hydrogen bonds play an important role in the efficiency of transcription but, interestingly, do not appear to be required for faithful transcription. Steric effects (size and shape variations) are found to be significant both in insertion of a new RNA base and in extension beyond it.

  14. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells.


    Min, Irene M; Waterfall, Joshua J; Core, Leighton J; Munroe, Robert J; Schimenti, John; Lis, John T


    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, "bivalent" ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5' proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation.

  15. Epigenetic repression of ribosomal RNA transcription by ROCK-dependent aberrant cytoskeletal organization

    PubMed Central

    Wu, Tse-Hsiang; Kuo, Yuan-Yeh; Lee, Hsiao-Hui; Kuo, Jean-Cheng; Ou, Meng-Hsin; Chang, Zee-Fen


    It is known that ribosomal RNA (rRNA) synthesis is regulated by cellular energy and proliferation status. In this study, we investigated rRNA gene transcription in response to cytoskeletal stress. Our data revealed that the cell shape constrained by isotropic but not elongated micropatterns in HeLa cells led to a significant reduction in rRNA transcription dependent on ROCK. Expression of a dominant-active form of ROCK also repressed rRNA transcription. Isotropic constraint and ROCK over-activation led to different types of aberrant F-actin organization, but their suppression effects on rRNA transcription were similarly reversed by inhibition of histone deacetylase (HDAC) or overexpression of a dominant negative form of Nesprin, which shields the signal transmitted from actin filament to the nuclear interior. We further showed that the binding of HDAC1 to the active fraction of rDNA genes is increased by ROCK over-activation, thus reducing H3K9/14 acetylation and suppressing transcription. Our results demonstrate an epigenetic control of active rDNA genes that represses rRNA transcription in response to the cytoskeletal stress. PMID:27350000

  16. A possible mechanism for the inhibition of ribosomal RNA gene transcription during mitosis.


    Weisenberger, D; Scheer, U


    When cells enter mitosis, RNA synthesis ceases. Yet the RNA polymerase I (pol I) transcription machinery involved in the production of pre-rRNA remains bound to the nucleolus organizing region (NOR), the chromosome site harboring the tandemly repeated rRNA genes. Here we examine whether rDNA transcription units are transiently blocked or "frozen" during mitosis. By using fluorescent in situ hybridization we were unable to detect nascent pre-rRNA chains on the NORs of mouse 3T3 and rat kangaroo PtK2 cells. Appropriate controls showed that our approach was sensitive enough to visualize, at the light microscopic level, individual transcriptionally active rRNA genes both in situ after experimental unfolding of nucleoli and in chromatin spreads ("Miller spreads"). Analysis of the cell cycle-dependent redistribution of transcript-associated components also revealed that most transcripts are released from the rDNA at mitosis. Upon disintegration of the nucleolus during mitosis, U3 small nucleolar RNA (snoRNA) and the nucleolar proteins fibrillarin and nucleolin became dispersed throughout the cytoplasm and were excluded from the NORs. Together, our data rule out the presence of "frozen Christmas-trees" at the mitotic NORs but are compatible with the view that inactive pol I remains on the rDNA. We propose that expression of the rRNA genes is regulated during mitosis at the level of transcription elongation, similarly to what is known for a number of genes transcribed by pol II. Such a mechanism may explain the decondensed state of the NOR chromatin and the immediate transcriptional reactivation of the rRNA genes following mitosis.

  17. A Comparative Study of RNA Polymerase II Transcription Machinery in Yeasts

    NASA Astrophysics Data System (ADS)

    Sharma, Nimisha; Mehta, Surbhi

    The control of gene expression, predominantly at the level of transcription, plays a fundamental role in biological processes determining the phenotypic changes in cells and organisms. The eukaryotes have evolved a complex and sophisticated transcription machinery to transcribe DNA into RNA. RNA polymerase II enzyme lies at the centre of the transcription apparatus that comprises nearly 60 polypeptides and is responsible for the expression and regulation of proteinencoding genes. Much of our present understanding and knowledge of the RNA polymerase II transcription apparatus in eukaryotes has been derived from studies in Saccharomyces cerevisiae. More recently, Schizosaccharomyces pombe has emerged as a better model system to study transcription because the transcription mechanism in this yeast is closer to that in higher eukaryotes. Also, studies on components of the basal transcription machinery have revealed a number of properties that are common with other eukaryotes, but have also highlighted some features unique to S. pombe. In fact, the fungal transcription associated protein families show greater species specificity and only 15% of these proteins contain homologues shared between both S. cerevisiae and S. pombe. In this chapter, we compare the RNA polymerase II transcription apparatus in different yeasts.

  18. Mechanism of transcription initiation by the yeast mitochondrial RNA polymerase.


    Deshpande, Aishwarya P; Patel, Smita S


    Mitochondria are the major supplier of cellular energy in the form of ATP. Defects in normal ATP production due to dysfunctions in mitochondrial gene expression are responsible for many mitochondrial and aging related disorders. Mitochondria carry their own DNA genome which is transcribed by relatively simple transcriptional machinery consisting of the mitochondrial RNAP (mtRNAP) and one or more transcription factors. The mtRNAPs are remarkably similar in sequence and structure to single-subunit bacteriophage T7 RNAP but they require accessory transcription factors for promoter-specific initiation. Comparison of the mechanisms of T7 RNAP and mtRNAP provides a framework to better understand how mtRNAP and the transcription factors work together to facilitate promoter selection, DNA melting, initiating nucleotide binding, and promoter clearance. This review focuses primarily on the mechanistic characterization of transcription initiation by the yeast Saccharomyces cerevisiae mtRNAP (Rpo41) and its transcription factor (Mtf1) drawing insights from the homologous T7 and the human mitochondrial transcription systems. We discuss regulatory mechanisms of mitochondrial transcription and the idea that the mtRNAP acts as the in vivo ATP "sensor" to regulate gene expression. This article is part of a Special Issue entitled: Mitochondrial Gene Expression.

  19. RNA editing of the Drosophila para Na(+) channel transcript. Evolutionary conservation and developmental regulation.

    PubMed Central

    Hanrahan, C J; Palladino, M J; Ganetzky, B; Reenan, R A


    Post-transcriptional editing of pre-mRNAs through the action of dsRNA adenosine deaminases results in the modification of particular adenosine (A) residues to inosine (I), which can alter the coding potential of the modified transcripts. We describe here three sites in the para transcript, which encodes the major voltage-activated Na(+) channel polypeptide in Drosophila, where RNA editing occurs. The occurrence of RNA editing at the three sites was found to be developmentally regulated. Editing at two of these sites was also conserved across species between the D. melanogaster and D. virilis. In each case, a highly conserved region was found in the intron downstream of the editing site and this region was shown to be complementary to the region of the exonic editing site. Thus, editing at these sites would appear to involve a mechanism whereby the edited exon forms a base-paired secondary structure with the distant conserved noncoding sequences located in adjacent downstream introns, similar to the mechanism shown for A-to-I RNA editing of mammalian glutamate receptor subunits (GluRs). For the third site, neither RNA editing nor the predicted RNA secondary structures were evolutionarily conserved. Transcripts from transgenic Drosophila expressing a minimal editing site construct for this site were shown to faithfully undergo RNA editing. These results demonstrate that Na(+) channel diversity in Drosophila is increased by RNA editing via a mechanism analogous to that described for transcripts encoding mammalian GluRs. PMID:10880477

  20. The role of the lid element in transcription by E. coli RNA polymerase.


    Toulokhonov, Innokenti; Landick, Robert


    The recently described crystal structures of multi-subunit RNA polymerases (RNAPs) reveal a conserved loop-like feature called the lid. The lid projects from the clamp domain and contacts the flap, thereby enclosing the RNA transcript in RNAP's RNA-exit channel and forming the junction between the exit channel and the main channel, which holds the RNA:DNA hybrid. In the initiating form of bacterial RNAP (holoenzyme containing sigma), the lid interacts with sigma region 3 and encloses an extended linker between sigma region 3 and sigma region 4 in place of the RNA in the exit channel. During initiation, the lid may be important for holding open the transcription bubble and may help displace the RNA from the template DNA strand. To test these ideas, we constructed and characterized a mutant RNAP from which the lid element was deleted. Deltalid RNAP exhibited dramatically reduced activity during initiation from -35-dependent and -35-independent promoters, verifying that the lid is important for stabilizing the open promoter complex during initiation. However, transcript elongation, RNA displacement, and, surprisingly, transcriptional termination all occurred normally in Deltalid RNAP. Importantly, Deltalid RNAP behaved differently from wild-type RNAP when transcribing single-stranded DNA templates where it synthesized long, persistent RNA:DNA hybrids, in contrast to efficient transcriptional arrest by wild-type RNAP.

  1. Gene regulation by the act of long non-coding RNA transcription

    PubMed Central


    Long non-protein-coding RNAs (lncRNAs) are proposed to be the largest transcript class in the mouse and human transcriptomes. Two important questions are whether all lncRNAs are functional and how they could exert a function. Several lncRNAs have been shown to function through their product, but this is not the only possible mode of action. In this review we focus on a role for the process of lncRNA transcription, independent of the lncRNA product, in regulating protein-coding-gene activity in cis. We discuss examples where lncRNA transcription leads to gene silencing or activation, and describe strategies to determine if the lncRNA product or its transcription causes the regulatory effect. PMID:23721193

  2. Transcriptional properties and splicing of the flamenco piRNA cluster

    PubMed Central

    Goriaux, Coline; Desset, Sophie; Renaud, Yoan; Vaury, Chantal; Brasset, Emilie


    In Drosophila, the piRNA cluster, flamenco, produces most of the piRNAs (PIWI-interacting RNAs) that silence transposable elements in the somatic follicle cells during oogenesis. These piRNAs are thought to be processed from a long single-stranded precursor transcript. Here, we demonstrate that flamenco transcription is initiated from an RNA polymerase II promoter containing an initiator motif (Inr) and downstream promoter element (DPE) and requires the transcription factor, Cubitus interruptus. We show that the flamenco precursor transcript undergoes differential alternative splicing to generate diverse RNA precursors that are processed to piRNAs. Our data reveal dynamic processing steps giving rise to piRNA cluster precursors. PMID:24562610

  3. Production of infectious RNA transcripts from full-length cDNA clones representing two subgroups of peanut stunt virus strains: mapping satellite RNA support to RNA1.


    Hu, C C; Sanger, M; Ghabrial, S A


    Full-length cDNA clones from which infectious transcripts could be generated were constructed from the genomic RNAs of two distinct strains of peanut stunt cucumovirus (PSV), PSV-ER and PSV-W. PSV-ER, a subgroup I strain, is known to support efficient replication of satellite RNA (satRNA) in infected plants, whereas PSV-W, a subgroup II strain, does not support satRNA replication. Although artificial reassortants (pseudorecombinants) of all possible combinations of infectious transcripts representing RNA1, RNA2 and RNA3 were infectious, only those having RNA1 from PSV-ER supported the replication of satRNA. These results demonstrate conclusively that support of PSV satRNA replication maps to RNA1. Comparisons of secondary structure predictions of the C-terminal helicase-like domain of the 1a proteins of four PSV strains belonging to two subgroups did not reveal any obvious differences between strains that differ in satRNA support. The complete nucleotide sequence of RNA1 from strains PSV-ER and PSV-W were determined and found to be 79% identical. Sequence comparison analysis of RNA1 sequences of cucumoviruses confirmed the placement of the PSV strains into two distinct subgroups.

  4. The active site of RNA polymerase II participates in transcript cleavage within arrested ternary complexes.

    PubMed Central

    Rudd, M D; Izban, M G; Luse, D S


    RNA polymerase II may become arrested during transcript elongation, in which case the ternary complex remains intact but further RNA synthesis is blocked. To relieve arrest, the nascent transcript must be cleaved from the 3' end. RNAs of 7-17 nt are liberated and transcription continues from the newly exposed 3' end. Factor SII increases elongation efficiency by strongly stimulating the transcript cleavage reaction. We show here that arrest relief can also occur by the addition of pyrophosphate. This generates the same set of cleavage products as factor SII, but the fragments produced with pyrophosphate have 5'-triphosphate termini. Thus, the active site of RNA polymerase II, in the presence of pyrophosphate, appears to be capable of cleaving phosphodiester linkages as far as 17 nt upstream of the original site of polymerization, leaving the ternary complex intact and transcriptionally active. Images PMID:8058756

  5. The Sm-like RNA chaperone Hfq mediates transcription antitermination at Rho-dependent terminators

    PubMed Central

    Rabhi, Makhlouf; Espéli, Olivier; Schwartz, Annie; Cayrol, Bastien; Rahmouni, A Rachid; Arluison, Véronique; Boudvillain, Marc


    In Escherichia coli, the essential motor protein Rho promotes transcription termination in a tightly controlled manner that is not fully understood. Here, we show that the general post-transcriptional regulatory protein Hfq associates with Rho to regulate Rho function. The Hfq:Rho complex can be further stabilized by RNA bridging both factors in a configuration that inhibits the ATP hydrolysis and duplex unwinding activities of Rho and that mediates transcription antitermination at Rho-dependent terminators in vitro and in vivo. Antitermination at a prototypical terminator (λtR1) requires Hfq binding to an A/U-rich transcript region directly upstream from the terminator. Antitermination is modulated by trans-acting factors (NusG or nucleic acid competitors) that affect Hfq association with Rho or RNA. These data unveil a new Hfq function and a novel transcription regulatory mechanism with potentially important implications for bacterial RNA metabolism, gene silencing, and pathogenicity. PMID:21673658

  6. The Werner Syndrome Protein Is Involved in RNA Polymerase II Transcription

    PubMed Central

    Balajee, Adayabalam S.; Machwe, Amrita; May, Alfred; Gray, Matthew D.; Oshima, Junko; Martin, George M.; Nehlin, Jan O.; Brosh, Robert; Orren, David K.; Bohr, Vilhelm A.


    Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)–dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40–60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II–dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid–protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype

  7. Intergenic and Repeat Transcription in Human, Chimpanzee and Macaque Brains Measured by RNA-Seq

    PubMed Central

    Xu, Ying; Li, Mingfeng; Fu, Xing; Yan, Zheng; Yuan, Yuan; Menzel, Corinna; Li, Na; Somel, Mehmet; Hu, Hao; Chen, Wei; Pääbo, Svante; Khaitovich, Philipp


    Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq) to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20–28% of non-ribosomal transcripts correspond to annotated exons and 20–23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40–48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20%) represents 3′UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits. PMID:20617162

  8. Intergenic and repeat transcription in human, chimpanzee and macaque brains measured by RNA-Seq.


    Xu, Augix Guohua; He, Liu; Li, Zhongshan; Xu, Ying; Li, Mingfeng; Fu, Xing; Yan, Zheng; Yuan, Yuan; Menzel, Corinna; Li, Na; Somel, Mehmet; Hu, Hao; Chen, Wei; Pääbo, Svante; Khaitovich, Philipp


    Transcription is the first step connecting genetic information with an organism's phenotype. While expression of annotated genes in the human brain has been characterized extensively, our knowledge about the scope and the conservation of transcripts located outside of the known genes' boundaries is limited. Here, we use high-throughput transcriptome sequencing (RNA-Seq) to characterize the total non-ribosomal transcriptome of human, chimpanzee, and rhesus macaque brain. In all species, only 20-28% of non-ribosomal transcripts correspond to annotated exons and 20-23% to introns. By contrast, transcripts originating within intronic and intergenic repetitive sequences constitute 40-48% of the total brain transcriptome. Notably, some repeat families show elevated transcription. In non-repetitive intergenic regions, we identify and characterize 1,093 distinct regions highly expressed in the human brain. These regions are conserved at the RNA expression level across primates studied and at the DNA sequence level across mammals. A large proportion of these transcripts (20%) represents 3'UTR extensions of known genes and may play roles in alternative microRNA-directed regulation. Finally, we show that while transcriptome divergence between species increases with evolutionary time, intergenic transcripts show more expression differences among species and exons show less. Our results show that many yet uncharacterized evolutionary conserved transcripts exist in the human brain. Some of these transcripts may play roles in transcriptional regulation and contribute to evolution of human-specific phenotypic traits.

  9. RNA secondary structures regulate three steps of Rho-dependent transcription termination within a bacterial mRNA leader.


    Kriner, Michelle A; Groisman, Eduardo A


    Transcription termination events in bacteria often require the RNA helicase Rho. Typically, Rho promotes termination at the end of coding sequences, but it can also terminate transcription within leader regions to implement regulatory decisions. Rho-dependent termination requires initial recognition of a Rho utilization (rut) site on a nascent RNA by Rho's primary binding surface. However, it is presently unclear what factors determine the location of transcription termination, how RNA secondary structures influence this process and whether mechanistic differences distinguish constitutive from regulated Rho-dependent terminators. We previously demonstrated that the 5' leader mRNA of the Salmonella corA gene can adopt two mutually exclusive conformations that dictate accessibility of a rut site to Rho. We now report that the corA leader also controls two subsequent steps of Rho-dependent termination. First, the RNA conformation that presents an accessible rut site promotes pausing of RNA polymerase (RNAP) at a single Rho-dependent termination site over 100 nt downstream. Second, an additional RNA stem-loop promotes Rho activity and controls the location at which Rho-dependent termination occurs, despite having no effect on initial Rho binding to the corA leader. Thus, the multi-step nature of Rho-dependent termination may facilitate regulation of a given coding region by multiple cytoplasmic signals.

  10. RNA secondary structures regulate three steps of Rho-dependent transcription termination within a bacterial mRNA leader

    PubMed Central

    Kriner, Michelle A.; Groisman, Eduardo A.


    Transcription termination events in bacteria often require the RNA helicase Rho. Typically, Rho promotes termination at the end of coding sequences, but it can also terminate transcription within leader regions to implement regulatory decisions. Rho-dependent termination requires initial recognition of a Rho utilization (rut) site on a nascent RNA by Rho's primary binding surface. However, it is presently unclear what factors determine the location of transcription termination, how RNA secondary structures influence this process and whether mechanistic differences distinguish constitutive from regulated Rho-dependent terminators. We previously demonstrated that the 5′ leader mRNA of the Salmonella corA gene can adopt two mutually exclusive conformations that dictate accessibility of a rut site to Rho. We now report that the corA leader also controls two subsequent steps of Rho-dependent termination. First, the RNA conformation that presents an accessible rut site promotes pausing of RNA polymerase (RNAP) at a single Rho-dependent termination site over 100 nt downstream. Second, an additional RNA stem-loop promotes Rho activity and controls the location at which Rho-dependent termination occurs, despite having no effect on initial Rho binding to the corA leader. Thus, the multi-step nature of Rho-dependent termination may facilitate regulation of a given coding region by multiple cytoplasmic signals. PMID:28123036

  11. MicroRNA-378 limits activation of hepatic stellate cells and liver fibrosis by suppressing Gli3 expression

    PubMed Central

    Hyun, Jeongeun; Wang, Sihyung; Kim, Jieun; Rao, Kummara Madhusudana; Park, Soo Yong; Chung, Ildoo; Ha, Chang-Sik; Kim, Sang-Woo; Yun, Yang H.; Jung, Youngmi


    Hedgehog (Hh) signalling regulates hepatic fibrogenesis. MicroRNAs (miRNAs) mediate various cellular processes; however, their role in liver fibrosis is unclear. Here we investigate regulation of miRNAs in chronically damaged fibrotic liver. MiRNA profiling shows that expression of miR-378 family members (miR-378a-3p, miR-378b and miR-378d) declines in carbon tetrachloride (CCl4)-treated compared with corn-oil-treated mice. Overexpression of miR-378a-3p, directly targeting Gli3 in activated hepatic stellate cells (HSCs), reduces expression of Gli3 and profibrotic genes but induces gfap, the inactivation marker of HSCs, in CCl4-treated liver. Smo blocks transcriptional expression of miR-378a-3p by activating the p65 subunit of nuclear factor-κB (NF-κB). The hepatic level of miR-378a-3p is inversely correlated with the expression of Gli3 in tumour and non-tumour tissues in human hepatocellular carcinoma. Our results demonstrate that miR-378a-3p suppresses activation of HSCs by targeting Gli3 and its expression is regulated by Smo-dependent NF-κB signalling, suggesting miR-378a-3p has therapeutic potential for liver fibrosis. PMID:27001906

  12. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR

    PubMed Central


    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver. PMID:28164071

  13. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR.


    Lee, Jae Man


    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver.

  14. Sequence organization of the Acanthamoeba rRNA intergenic spacer: identification of transcriptional enhancers.

    PubMed Central

    Yang, Q; Zwick, M G; Paule, M R


    The primary sequence of the entire 2330 bp intergenic spacer of the A.castellanii ribosomal RNA gene was determined. Repeated sequence elements averaging 140 bp were identified and found to bind a protein required for optimum initiation at the core promoter. These repeated elements were shown to stimulate rRNA transcription by RNA polymerase I in vitro. The repeats inhibited transcription when placed in trans, and stimulated transcription when in cis, in either orientation, but only when upstream of the core promoter. Thus, these repeated elements have characteristics similar to polymerase I enhancers found in higher eukaryotes. The number of rRNA repeats in Acanthamoeba cells was determined to be 24 per haploid genome, the lowest number so far identified in any eukaryote. However, because Acanthamoeba is polyploid, each cell contains approximately 600 rRNA genes. Images PMID:7984432

  15. Detecting Pyronin Y labeled RNA transcripts in live cell microenvironments by phasor-FLIM analysis.


    Andrews, Laura M; Jones, Mark R; Digman, Michelle A; Gratton, Enrico


    Pyronin Y is an environment-sensitive probe which labels all double-stranded RNA in live cells. Methods to determine which RNA species Pyronin Y may be labeling are limited due to the lack of studies aimed at determining whether this probe has different spectroscopic properties when bound to specific transcripts. A major issue is that transcripts are difficult to isolate and study individually. We detected transcripts directly in their biological environment allowing us to identify RNA species on the basis of their location in the cell. We show that the phasor approach to lifetime analysis has the sensitivity to determine at least six different RNA species in live fibroblast cells. The detected lifetime differences were consistent among cells. To our knowledge this is the first application of a spectroscopic technique aimed at identifying Pyronin Y labeled RNA subtypes in living cells.

  16. Detecting Pyronin Y labeled RNA transcripts in live cell microenvironments by phasor-FLIM analysis

    NASA Astrophysics Data System (ADS)

    Andrews, Laura M.; Jones, Mark R.; Digman, Michelle A.; Gratton, Enrico


    Pyronin Y is an environment-sensitive probe which labels all double-stranded RNA in live cells. Methods to determine which RNA species Pyronin Y may be labeling are limited due to the lack of studies aimed at determining whether this probe has different spectroscopic properties when bound to specific transcripts. A major issue is that transcripts are difficult to isolate and study individually. We detected transcripts directly in their biological environment allowing us to identify RNA species on the basis of their location in the cell. We show that the phasor approach to lifetime analysis has the sensitivity to determine at least six different RNA species in live fibroblast cells. The detected lifetime differences were consistent among cells. To our knowledge this is the first application of a spectroscopic technique aimed at identifying Pyronin Y labeled RNA subtypes in living cells.

  17. Genome-wide modeling of transcription kinetics reveals patterns of RNA production delays.


    Honkela, Antti; Peltonen, Jaakko; Topa, Hande; Charapitsa, Iryna; Matarese, Filomena; Grote, Korbinian; Stunnenberg, Hendrik G; Reid, George; Lawrence, Neil D; Rattray, Magnus


    Genes with similar transcriptional activation kinetics can display very different temporal mRNA profiles because of differences in transcription time, degradation rate, and RNA-processing kinetics. Recent studies have shown that a splicing-associated RNA production delay can be significant. To investigate this issue more generally, it is useful to develop methods applicable to genome-wide datasets. We introduce a joint model of transcriptional activation and mRNA accumulation that can be used for inference of transcription rate, RNA production delay, and degradation rate given data from high-throughput sequencing time course experiments. We combine a mechanistic differential equation model with a nonparametric statistical modeling approach allowing us to capture a broad range of activation kinetics, and we use Bayesian parameter estimation to quantify the uncertainty in estimates of the kinetic parameters. We apply the model to data from estrogen receptor α activation in the MCF-7 breast cancer cell line. We use RNA polymerase II ChIP-Seq time course data to characterize transcriptional activation and mRNA-Seq time course data to quantify mature transcripts. We find that 11% of genes with a good signal in the data display a delay of more than 20 min between completing transcription and mature mRNA production. The genes displaying these long delays are significantly more likely to be short. We also find a statistical association between high delay and late intron retention in pre-mRNA data, indicating significant splicing-associated production delays in many genes.

  18. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.


    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin


    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  19. siRNA-mediated heterochromatin establishment requires HP1 and is associated with antisense transcription

    PubMed Central

    Iida, Tetsushi; Nakayama, Jun-ichi; Moazed, Danesh


    Summary Heterochromatic gene silencing at the pericentromeric DNA repeats in fission yeast requires the RNA interference (RNAi) machinery. The RNA-Induced Transcriptional Silencing (RITS) complex mediates histone H3 lysine 9 (H3K9) methylation and recruits the RNA-Dependent RNA Polymerase Complex (RDRC) to promote double-strand RNA (dsRNA) synthesis and siRNA generation. Here we show that ectopic expression of a long hairpin RNA bypasses the requirement for chromatin-dependent steps in siRNA generation. The ability of hairpin-produced siRNAs to silence homologous sequences in trans is subject to local chromatin structure, requires HP1, and correlates with antisense transcription at the target locus. Furthermore, although hairpin siRNAs can be produced in the absence of RDRC, trans-silencing of reporter genes by hairpin-produced siRNAs is completely dependent on the dsRNA synthesis activity of RDRC. These results provide new insights into the regulation of siRNA action and reveal roles for cis-dsRNA synthesis and HP1 in siRNA-mediated heterochromatin assembly. PMID:18657501

  20. piRNA-directed cleavage of meiotic transcripts regulates spermatogenesis.


    Goh, Wee Siong Sho; Falciatori, Ilaria; Tam, Oliver H; Burgess, Ralph; Meikar, Oliver; Kotaja, Noora; Hammell, Molly; Hannon, Gregory J


    MIWI catalytic activity is required for spermatogenesis, indicating that piRNA-guided cleavage is critical for germ cell development. To identify meiotic piRNA targets, we augmented the mouse piRNA repertoire by introducing a human meiotic piRNA cluster. This triggered a spermatogenesis defect by inappropriately targeting the piRNA machinery to mouse mRNAs essential for germ cell development. Analysis of such de novo targets revealed a signature for pachytene piRNA target recognition. This enabled identification of both transposable elements and meiotically expressed protein-coding genes as targets of native piRNAs. Cleavage of genic targets began at the pachytene stage and resulted in progressive repression through meiosis, driven at least in part via the ping-pong cycle. Our data support the idea that meiotic piRNA populations must be strongly selected to enable successful spermatogenesis, both driving the response away from essential genes and directing the pathway toward mRNA targets that are regulated by small RNAs in meiotic cells.

  1. Characterization of murine hepatitis virus (JHM) RNA from rats with experimental encephalomyelitis.


    Jackson, D P; Percy, D H; Morris, V L


    When Wistar Furth rats are inoculated intracerebrally with the murine hepatitis virus JHM they often develop a demyelinating disease with resulting hind leg paralysis. Using an RNA transfer procedure and hybridization kinetic analysis, the virus-specific RNA in these rats was characterized. The pattern of JHM-specific RNA varied with individual infections of Wistar Furth rats. However, two species of JHM-specific RNA, the nucleocapsid and a 2.1-2.4 X 10(6)-Da RNA species were generally present. A general decrease in JHM-specific RNA in brains and spinal cord samples taken later than 20 days postinoculation was observed; however, JHM-specific RNA persisted in the spinal cord longer than in the brain of these rats.

  2. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation.


    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J


    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development.

  3. Viral miRNA targeting of bicistronic and polycistronic transcripts.


    Zhu, Ying; Huang, Yufei; Jung, Jae U; Lu, Chun; Gao, Shou-Jiang


    Successful viral infection entails a choreographic regulation of viral gene expression program. Kaposi's sarcoma-associated herpesvirus (KSHV) encodes numerous miRNAs that regulate viral life cycle. However, few viral targets have been identified due to the lack of information on KSHV 3' untranslated regions (3'UTRs). Recent genome-wide mapping of KSHV transcripts and 3'UTRs has revealed abundant bicistronic and polycistronic transcripts. The extended 3'UTRs of the 5' proximal genes of bicistronic and polycistronic transcripts offer additional regulatory targets. Indeed, a genome-wide screening of KSHV 3'UTRs has identified several bicistronic and polycistronic transcripts as the novel targets of viral miRNAs. Together, these works have expanded our knowledge of the unique features of KSHV gene regulation program and provided valuable resources for the research community.

  4. Viral miRNA Targeting of Bicistronic and Polycistronic Transcripts

    PubMed Central

    Zhu, Ying; Huang, Yufei; Jung, Jae U.; Lu, Chun; Gao, Shou-Jiang


    Successful viral infection entails a choreographic regulation of viral gene expression program. Kaposi’s sarcoma–associated herpesvirus (KSHV) encodes numerous miRNAs that regulate viral life cycle. However, few viral targets have been identified due to the lack of information on KSHV 3′ untranslated regions (3′UTRs). Recent genome-wide mapping of KSHV transcripts and 3′UTRs has revealed abundant bicistronic and polycistronic transcripts. The extended 3′UTRs of the 5′ proximal genes of bicistronic and polycistronic transcripts offer additional regulatory targets. Indeed, a genome-wide screening of KSHV 3′UTRs has identified several bicistronic and polycistronic transcripts as the novel targets of viral miRNAs. Together, these works have expanded our knowledge of the unique features of KSHV gene regulation program and provided valuable resources for the research community. PMID:24821460

  5. Coupled pre-mRNA and mRNA dynamics unveil operational strategies underlying transcriptional responses to stimuli

    PubMed Central

    Zeisel, Amit; Köstler, Wolfgang J; Molotski, Natali; Tsai, Jonathan M; Krauthgamer, Rita; Jacob-Hirsch, Jasmine; Rechavi, Gideon; Soen, Yoav; Jung, Steffen; Yarden, Yosef; Domany, Eytan


    Transcriptional responses to extracellular stimuli involve tuning the rates of transcript production and degradation. Here, we show that the time-dependent profiles of these rates can be inferred from simultaneous measurements of precursor mRNA (pre-mRNA) and mature mRNA profiles. Transcriptome-wide measurements demonstrate that genes with similar mRNA profiles often exhibit marked differences in the amplitude and onset of their production rate. The latter is characterized by a large dynamic range, with a group of genes exhibiting an unexpectedly strong transient production overshoot, thereby accelerating their induction and, when combined with time-dependent degradation, shaping transient responses with precise timing and amplitude. PMID:21915116

  6. Distributed biotin-streptavidin transcription roadblocks for mapping cotranscriptional RNA folding.


    Strobel, Eric J; Watters, Kyle E; Nedialkov, Yuri; Artsimovitch, Irina; Lucks, Julius B


    RNA folding during transcription directs an order of folding that can determine RNA structure and function. However, the experimental study of cotranscriptional RNA folding has been limited by the lack of easily approachable methods that can interrogate nascent RNA structure at nucleotide resolution. To address this, we previously developed cotranscriptional selective 2΄-hydroxyl acylation analyzed by primer extension sequencing (SHAPE-Seq) to simultaneously probe all intermediate RNA transcripts during transcription by stalling elongation complexes at catalytically dead EcoRIE111Q roadblocks. While effective, the distribution of elongation complexes using EcoRIE111Q requires laborious PCR using many different oligonucleotides for each sequence analyzed. Here, we improve the broad applicability of cotranscriptional SHAPE-Seq by developing a sequence-independent biotin-streptavidin (SAv) roadblocking strategy that simplifies the preparation of roadblocking DNA templates. We first determine the properties of biotin-SAv roadblocks. We then show that randomly distributed biotin-SAv roadblocks can be used in cotranscriptional SHAPE-Seq experiments to identify the same RNA structural transitions related to a riboswitch decision-making process that we previously identified using EcoRIE111Q. Lastly, we find that EcoRIE111Q maps nascent RNA structure to specific transcript lengths more precisely than biotin-SAv and propose guidelines to leverage the complementary strengths of each transcription roadblock in cotranscriptional SHAPE-Seq.


    PubMed Central

    Xu, Heng; Sepúlveda, Leonardo A.; Figard, Lauren; Sokac, Anna Marie; Golding, Ido


    We combine immunofluorescence and single-molecule fluorescence in situ hybridization (smFISH), followed by automated image analysis, to quantify the concentration of nuclear transcription factors, number of transcription factors bound, and number of nascent mRNAs synthesized at individual gene loci. A theoretical model is used to decipher how transcription-factor binding modulates the stochastic kinetics of mRNA production. We demonstrate this approach by examining the regulation of hunchback in the early Drosophila embryo. PMID:26098021

  8. Structural basis for transcription elongation by bacterial RNA polymerase.


    Vassylyev, Dmitry G; Vassylyeva, Marina N; Perederina, Anna; Tahirov, Tahir H; Artsimovitch, Irina


    The RNA polymerase elongation complex (EC) is both highly stable and processive, rapidly extending RNA chains for thousands of nucleotides. Understanding the mechanisms of elongation and its regulation requires detailed information about the structural organization of the EC. Here we report the 2.5-A resolution structure of the Thermus thermophilus EC; the structure reveals the post-translocated intermediate with the DNA template in the active site available for pairing with the substrate. DNA strand separation occurs one position downstream of the active site, implying that only one substrate at a time can specifically bind to the EC. The upstream edge of the RNA/DNA hybrid stacks on the beta'-subunit 'lid' loop, whereas the first displaced RNA base is trapped within a protein pocket, suggesting a mechanism for RNA displacement. The RNA is threaded through the RNA exit channel, where it adopts a conformation mimicking that of a single strand within a double helix, providing insight into a mechanism for hairpin-dependent pausing and termination.

  9. Profilin Is Required for Optimal Actin-Dependent Transcription of Respiratory Syncytial Virus Genome RNA

    PubMed Central

    Burke, Emily; Mahoney, Nicole M.; Almo, Steven C.; Barik, Sailen


    Transcription of human respiratory syncytial virus (RSV) genome RNA exhibited an obligatory need for the host cytoskeletal protein actin. Optimal transcription, however, required the participation of another cellular protein that was characterized as profilin by a number of criteria. The amino acid sequence of the protein, purified on the basis of its transcription-optimizing activity in vitro, exactly matched that of profilin. RSV transcription was inhibited 60 to 80% by antiprofilin antibody or poly-l-proline, molecules that specifically bind profilin. Native profilin, purified from extracts of lung epithelial cells by affinity binding to a poly-l-proline matrix, stimulated the actin-saturated RSV transcription by 2.5- to 3-fold. Recombinant profilin, expressed in bacteria, stimulated viral transcription as effectively as the native protein and was also inhibited by poly-l-proline. Profilin alone, in the absence of actin, did not activate viral transcription. It is estimated that at optimal levels of transcription, every molecule of viral genomic RNA associates with approximately the following number of protein molecules: 30 molecules of L, 120 molecules of phosphoprotein P, and 60 molecules each of actin and profilin. Together, these results demonstrated for the first time a cardinal role for profilin, an actin-modulatory protein, in the transcription of a paramyxovirus RNA genome. PMID:10623728

  10. In vitro translation of the full-length RNA transcript of figwort mosaic virus (Caulimovirus).


    Ranu, R S; Gowda, S; Scholthof, H; Wu, F C; Shepherd, R J


    The circular DNA genome of FMV consists of seven tandemly arranged genes placed successively on a full-length RNA transcript that spans the entire circular viral genome. This transcript is a tentative mRNA for at least five of the six major conserved genes of this virus (genes I-V) that are positioned on this transcript. The sixth major gene (gene VI) is expressed as a separate monocistronic transcript. A long 5'-nontranslated leader (598 nucleotides), a small nonconserved gene (VII), and a short intergenic region (57 nucleotides) precede the five major conserved genes (I through V) on the full-length transcript. A reporter gene (CAT), as a separate cistron or fused in-frame, to viral cistrons in various downstream positions in cloned versions of the viral genome was used in a transcription vector to generate artificial full-length transcripts of FMV. When these mRNAs were translated in vitro (rabbit reticulocyte lysate system), the reporter gene was translated efficiently in all positions. Translation of internal native viral gene positioned on the full-length transcript of FMV was also determined (the gene VI product). These observations suggest that the full-length FMV transcript functions as a polycistronic mRNA in plants. Results are best explained on the basis of translational coupling/relay race model.

  11. LIN-42, the Caenorhabditis elegans PERIOD homolog, negatively regulates microRNA transcription.


    Perales, Roberto; King, Dana M; Aguirre-Chen, Cristina; Hammell, Christopher M


    During C. elegans development, microRNAs (miRNAs) function as molecular switches that define temporal gene expression and cell lineage patterns in a dosage-dependent manner. It is critical, therefore, that the expression of miRNAs be tightly regulated so that target mRNA expression is properly controlled. The molecular mechanisms that function to optimize or control miRNA levels during development are unknown. Here we find that mutations in lin-42, the C. elegans homolog of the circadian-related period gene, suppress multiple dosage-dependent miRNA phenotypes including those involved in developmental timing and neuronal cell fate determination. Analysis of mature miRNA levels in lin-42 mutants indicates that lin-42 functions to attenuate miRNA expression. Through the analysis of transcriptional reporters, we show that the upstream cis-acting regulatory regions of several miRNA genes are sufficient to promote highly dynamic transcription that is coupled to the molting cycles of post-embryonic development. Immunoprecipitation of LIN-42 complexes indicates that LIN-42 binds the putative cis-regulatory regions of both non-coding and protein-coding genes and likely plays a role in regulating their transcription. Consistent with this hypothesis, analysis of miRNA transcriptional reporters in lin-42 mutants indicates that lin-42 regulates miRNA transcription. Surprisingly, strong loss-of-function mutations in lin-42 do not abolish the oscillatory expression patterns of lin-4 and let-7 transcription but lead to increased expression of these genes. We propose that lin-42 functions to negatively regulate the transcriptional output of multiple miRNAs and mRNAs and therefore coordinates the expression levels of genes that dictate temporal cell fate with other regulatory programs that promote rhythmic gene expression.

  12. Differential expression of viral PAMP receptors mRNA in peripheral blood of patients with chronic hepatitis C infection

    PubMed Central

    Atencia, Rafael; Bustamante, Francisco J; Valdivieso, Andrés; Arrieta, Arantza; Riñón, Marta; Prada, Alvaro; Maruri, Natalia


    Background Pathogen-associated molecular patterns (PAMP) receptors play a key role in the early host response to viruses. In this work, we determined mRNA levels of two members of the Toll-like Receptors family, (TLR3 and TLR7) and the helicase RIG-I, all of three recognizing viral RNA products, in peripheral blood of healthy donors and hepatitis C virus (HCV) patients, to observe if their transcripts are altered in this disease. Methods IFN-α, TLR3, TLR7 and RIG-I levels in peripheral blood from healthy controls (n = 18) and chronic HCV patients (n = 18) were quantified by real-time polymerase chain reaction. Results Our results show that IFN-α, TLR3, TLR7 and RIG-I mRNA levels are significantly down-regulated in patients with chronic HCV infection when compared with healthy controls. We also found that the measured levels of TLR3 and TLR7, but not RIG-I, correlated significantly with those of IFN-α Conclusion Monitoring the expression of RNA-sensing receptors like TLR3, TLR7 and RIG-I during the different clinical stages of infection could bring a new source of data about the prognosis of disease. PMID:18021446

  13. Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

    NASA Astrophysics Data System (ADS)

    Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi


    First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

  14. Hepatitis C Test


    ... Hepatitis C Antibody; Anti-HCV; HCV-PCR; HCV-RNA; Hepatitis C Viral Load Formal name: Viral Hepatitis C Antibody Screen; Viral Hepatitis C RNA by PCR; Hepatitis C Virus Genotype Related tests: ...

  15. MicroRNA panels as disease biomarkers distinguishing hepatitis B virus infection caused hepatitis and liver cirrhosis.


    Jin, Bo-Xun; Zhang, Yong-Hong; Jin, Wen-Jing; Sun, Xiang-Ying; Qiao, Gui-Fang; Wei, Ying-Ying; Sun, Li-Bo; Zhang, Wei-Hong; Li, Ning


    An important unresolved clinical issue is to distinguish hepatitis B virus (HBV) infection caused chronic hepatitis and their corresponding liver cirrhosis (LC). Recent research suggests that circulating microRNAs are useful biomarkers for a wide array of diseases. We analyzed microRNA profiles in the plasmas of a total of 495 chronic hepatitis B (CHB) patients, LC patients and healthy donors and identified 10 miRNAs that were differentially expressed between CHB and LC patients. Our logistic models show that three panels of miRNAs have promising diagnostic performances in discriminating CHB from LC. Blinded tests were subsequently conducted to evaluate the diagnostic performances in clinical practice and a sensitivity of 85% and specificity of 70% have been achieved in separating CHB from LC pateints. The expression levels of some circulating miRNAs were significantly correlated with HBV DNA load and liver function, such as prothrombin activity (PTA) and levels of alanin aminotransferase (ALT), albumin (ALB) and cholinesterase (CHE). Our results provide important information for developing novel diagnostic tools for distinguishing chronic HBV hepatitis and their corresponding cirrhosis.

  16. Influence of secondary structure on recovery from pauses during early stages of RNA transcription.


    Klopper, A V; Bois, J S; Grill, S W


    The initial stages of transcription by RNA polymerase are frequently marked by pausing and stalling events. These events have been linked to an inactive backtracked state in which the polymerase diffuses along the template DNA. We investigate theoretically the influence of RNA secondary structure in confining this diffusion. The effective confinement length peaks at transcript lengths commensurate with early stalling. This finite-size effect accounts for slow progress at the beginning of transcription, which we illustrate via stochastic hopping models for backtracking polymerases.

  17. Influence of secondary structure on recovery from pauses during early stages of RNA transcription

    NASA Astrophysics Data System (ADS)

    Klopper, A. V.; Bois, J. S.; Grill, S. W.


    The initial stages of transcription by RNA polymerase are frequently marked by pausing and stalling events. These events have been linked to an inactive backtracked state in which the polymerase diffuses along the template DNA. We investigate theoretically the influence of RNA secondary structure in confining this diffusion. The effective confinement length peaks at transcript lengths commensurate with early stalling. This finite-size effect accounts for slow progress at the beginning of transcription, which we illustrate via stochastic hopping models for backtracking polymerases.

  18. Studying the association of microRNA-210 level with chronic hepatitis B progression.


    Song, G; Jia, H; Xu, H; Liu, W; Zhu, H; Li, S; Shi, J; Li, Z; He, J; Chen, Z


    We studied the relationship between hypoxia and microRNA-210 (miR-210) levels, the miR-210 levels in patients with hepatitis B and the roles of miR-210 in liver inflammation. We used the concanavalin A (Con A) murine hepatitis model and inflammation, hypoxia and miR-210 levels were examined. In these patients, we studied serum miR-210 levels and clinical indexes related to hepatitis in 90 patients with different stages of chronic hepatitis B and 30 controls. Two functional assays of miR-210 in vitro under hypoxic condition were conducted. The animal experiments indicated that the liver and serum miR-210 levels significantly increased with liver hypoxia and inflammation. In humans, serum miR-210 levels enhanced with hepatitis severity and were related to serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TB) and prothrombin activity (PTA) levels. The miR-210 functional assays showed that miR-210 elevation might be related to the decreases in HepG2.2.15 cell dehydrogenase activity and HBV replication under hypoxic conditions. Because the liver inflammation causes liver hypoxia which also results in liver and serum miR-210 level elevation, the serum miR-210 level may serve as a molecular biomarker for the severity of hepatitis and increases in liver miR-210 that we see may be a response of hepatocytes to hypoxia during hepatitis progression.

  19. Genetically regulated hepatic transcripts and pathways orchestrate haematological, biochemical and body composition traits

    PubMed Central

    Ponsuksili, Siriluck; Trakooljul, Nares; Hadlich, Frieder; Haack, Fiete; Murani, Eduard; Wimmers, Klaus


    The liver is the central metabolic organ and exhibits fundamental functions in haematological traits. Hepatic expression, haematological, plasma biochemical, and body composition traits were assessed in a porcine model (n = 297) to establish tissue-specific genetic variations that influence the function of immune-metabolism-correlated expression networks. At FDR (false discovery rate) <1%, more than 3,600 transcripts were jointly correlated (r = |0.22–0.48|) with the traits. Functional enrichment analysis demonstrated common links of metabolic and immune traits. To understand how immune and metabolic traits are affected via genetic regulation of gene expression, eQTLs were assessed. 20517 significant (FDR < 5%) eQTLs for 1401 transcripts were identified, among which 443 transcripts were associated with at least one of the examined traits and had cis-eQTL (such as ACO1 (6.52 × 10−7) and SOD1 (6.41 × 10−30). The present study establishes a comprehensive view of hepatic gene activity which links together metabolic and immune traits in a porcine model for medical research. PMID:28000754

  20. EGR1 regulates hepatic clock gene amplitude by activating Per1 transcription

    PubMed Central

    Tao, Weiwei; Wu, Jing; Zhang, Qian; Lai, Shan-Shan; Jiang, Shan; Jiang, Chen; Xu, Ying; Xue, Bin; Du, Jie; Li, Chao-Jun


    The mammalian clock system is composed of a master clock and peripheral clocks. At the molecular level, the rhythm-generating mechanism is controlled by a molecular clock composed of positive and negative feedback loops. However, the underlying mechanisms for molecular clock regulation that affect circadian clock function remain unclear. Here, we show that Egr1 (early growth response 1), an early growth response gene, is expressed in mouse liver in a circadian manner. Consistently, Egr1 is transactivated by the CLOCK/BMAL1 heterodimer through a conserved E-box response element. In hepatocytes, EGR1 regulates the transcription of several core clock genes, including Bmal1, Per1, Per2, Rev-erbα and Rev-erbβ, and the rhythm amplitude of their expression is dependent on EGR1’s transcriptional function. Further mechanistic studies indicated that EGR1 binds to the proximal region of the Per1 promoter to activate its transcription directly. When the peripheral clock is altered by light or feeding behavior transposition in Egr1-deficient mice, the expression phase of hepatic clock genes shifts normally, but the amplitude is also altered. Our data reveal a critical role for EGR1 in the regulation of hepatic clock circuitry, which may contribute to the rhythm stability of peripheral clock oscillators. PMID:26471974

  1. Targeted Sterically Stabilized Phospholipid siRNA Nanomedicine for Hepatic and Renal Fibrosis

    PubMed Central

    Khaja, Fatima; Jayawardena, Dulari; Kuzmis, Antonina; Önyüksel, Hayat


    Since its discovery, small interfering RNA (siRNA) has been considered a potent tool for modulating gene expression. It has the ability to specifically target proteins via selective degradation of messenger RNA (mRNA) not easily accessed by conventional drugs. Hence, RNA interference (RNAi) therapeutics have great potential in the treatment of many diseases caused by faulty protein expression such as fibrosis and cancer. However, for clinical application siRNA faces a number of obstacles, such as poor in vivo stability, and off-target effects. Here we developed a unique targeted nanomedicine to tackle current siRNA delivery issues by formulating a biocompatible, biodegradable and relatively inexpensive nanocarrier of sterically stabilized phospholipid nanoparticles (SSLNPs). This nanocarrier is capable of incorporating siRNA in its core through self-association with a novel cationic lipid composed of naturally occuring phospholipids and amino acids. This overall assembly protects and delivers sufficient amounts of siRNA to knockdown over-expressed protein in target cells. The siRNA used in this study, targets connective tissue growth factor (CTGF), an important regulator of fibrosis in both hepatic and renal cells. Furthermore, asialoglycoprotein receptors are targeted by attaching the galactosamine ligand to the nanocarries which enhances the uptake of nanoparticles by hepatocytes and renal tubular epithelial cells, the major producers of CTGF in fibrosis. On animals this innovative nanoconstruct, small interfering RNA in sterically stabilized phospholipid nanoparticles (siRNA-SSLNP), showed favorable pharmacokinetic properties and accumulated mostly in hepatic and renal tissues making siRNA-SSLNP a suitable system for targeting liver and kidney fibrotic diseases.

  2. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.


    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor ( Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  3. Optimized rapid amplification of cDNA ends (RACE) for mapping bacterial mRNA transcripts.


    Tillett, D; Burns, B P; Neilan, B A


    A simple, efficient and sensitive RACE-based procedure was developed for the determination of unknown 5' regions from bacterial cDNA. A number of critical modifications were made to the standard RACE method, including the optimization of the RNA extraction, reverse transcription and PCR conditions. This procedure was used to accurately determine the site of transcript initiation and structure of the promoter region of the Helicobacter pylori aspartate carbamoyltransferase gene (pyrB). The technique avoids many of the difficulties associated with established bacterial transcript mapping protocols and can be performed in two days starting with less than 1 microgram of total RNA. The modifications described here have significant potential for the identification of transcript start sites of bacterial genes and non-polyadenylated eukaryotic RNA.

  4. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells

    PubMed Central

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A.; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine


    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression. PMID

  5. Snapshots of a viral RNA polymerase switching gears from transcription initiation to elongation.


    Theis, Karsten


    During transcription initiation, RNA polymerase binds tightly to the promoter DNA defining the start of transcription, transcribes comparatively slowly, and frequently releases short transcripts (3-8 nucleotides) in a process called abortive cycling. Transitioning to elongation, the second phase of transcription, the polymerase dissociates from the promoter while RNA synthesis continues. Elongation is characterized by higher rates of transcription and tight binding to the RNA transcript. The RNA polymerase from enterophage T7 (T7 RNAP) has been used as a model to understand the mechanism of transcription in general, and the transition from initiation to elongation specifically. This single-subunit enzyme undergoes dramatic conformational changes during this transition to support the changing requirements of nucleic acid interactions while continuously maintaining polymerase function. Crystal structures, available of multiple stages of the initiation complex and of the elongation complex, combined with biochemical and biophysical data, offer molecular detail of the transition. Some of the crystal structures contain a variant of T7 RNAP where proline 266 is substituted by leucine. This variant shows less abortive products and altered timing of transition, and is a valuable tool to study these processes. The structural transitions from early to late initiation are well understood and are consistent with solution data. The timing of events and the structural intermediates in the transition from late initiation to elongation are less well understood, but the available data allows one to formulate testable models of the transition to guide further research.

  6. Genetic analysis of glucose regulation in saccharomyces cerevisiae: control of transcription versus mRNA turnover.

    PubMed Central

    Cereghino, G P; Scheffler, I E


    A major determinant of the steady-state level of the mRNA encoding the iron protein (Ip) subunit of succinate dehydrogenase of yeast is its rate of turnover. This mRNA is significantly more stable in glycerol than in glucose media. Many other genes, for example, SUC2, that are repressed in the presence of glucose are believed to be controlled at the level of transcription. The present study elucidates differences in the regulatory mechanisms by which glucose controls the transcription and turnover of the SUC2 and Ip mRNAs. The signaling pathway for glucose repression at the transcriptional level has been associated with a number of gene products linking glucose uptake with nuclear events. We have investigated whether the same genes are involved in the control of Ip mRNA stability. Phosphorylation of glucose or fructose is critical in triggering the transcript's degradation, but any hexokinase will do. Of the other known genes examined, most, with the exception of REG1, are not involved in determining the differential stability of the Ip transcript. Finally, our results indicate that differential stability on different carbon sources also plays a role in determining the steady-state level of the SUC2 mRNA. Thus, glucose repression includes both transcriptional and post-transcriptional mechanisms. Images PMID:8617211

  7. Novel Transcription Factor Variants through RNA-Sequencing: The Importance of Being “Alternative”

    PubMed Central

    Scarpato, Margherita; Federico, Antonio; Ciccodicola, Alfredo; Costa, Valerio


    Alternative splicing is a pervasive mechanism of RNA maturation in higher eukaryotes, which increases proteomic diversity and biological complexity. It has a key regulatory role in several physiological and pathological states. The diffusion of Next Generation Sequencing, particularly of RNA-Sequencing, has exponentially empowered the identification of novel transcripts revealing that more than 95% of human genes undergo alternative splicing. The highest rate of alternative splicing occurs in transcription factors encoding genes, mostly in Krüppel-associated box domains of zinc finger proteins. Since these molecules are responsible for gene expression, alternative splicing is a crucial mechanism to “regulate the regulators”. Indeed, different transcription factors isoforms may have different or even opposite functions. In this work, through a targeted re-analysis of our previously published RNA-Sequencing datasets, we identified nine novel transcripts in seven transcription factors genes. In silico analysis, combined with RT-PCR, cloning and Sanger sequencing, allowed us to experimentally validate these new variants. Through computational approaches we also predicted their novel structural and functional properties. Our findings indicate that alternative splicing is a major determinant of transcription factor diversity, confirming that accurate analysis of RNA-Sequencing data can reliably lead to the identification of novel transcripts, with potentially new functions. PMID:25590302

  8. Serum hepatitis C virus RNA and hepatitis B virus DNA in non-A, non-B post-transfusional and sporadic chronic hepatitis.


    Porchon, C; Kremsdorf, D; Pol, S; Lunel-Fabianni, F; Driss, F; Opolon, P; Berthelot, P; Bréchot, C


    The sera of 36 French patients with post-transfusional and sporadic non-A, non-B chronic hepatitis were investigated, for HBV and HCV infections using a combination of serological and polymerase chain reaction (PCR) assays. Anti-HCV was detected in 75% (27/36) of the patients by ELISA1 and/or RIBA2 tests. HCV-RNA sequences were found in 75% (27/36) of the sera by a single step PCR, using a set of primers located in the 5' non-coding region. Altogether, 89% (32/36) of the patients were found positive with serological and/or molecular tests. Among the positive patients, 68% (22/32) were found positive for both anti-HCV and HCV-RNA, 16% (5/32) and 16% (5/32) were found positive for either anti-HCV or HCV-RNA, respectively. HBV-DNA sequences were detected in two patients associated to the HCV viraemia. This study confirms the extremely high prevalence of HCV infection in NANB chronic hepatitis in France. It also shows possible co-infection by HCV and HBV in hepatitis.

  9. Intra-tRNA distance measurements for nucleocapsid proteindependent tRNA unwinding during priming of HIV reverse transcription.


    Chan, B; Weidemaier, K; Yip, W T; Barbara, P F; Musier-Forsyth, K


    We report here the direct measurement of intra-tRNA distances during annealing of the tRNA primer to the HIV RNA genome. This key step in the initiation of retroviral reverse transcription involves hybridization of one strand of the acceptor arm of a specific lysine tRNA to the primer binding site on the RNA genome. Although the mechanism of tRNA unwinding and annealing is not known, previous studies have shown that HIV nucleocapsid protein (NC) greatly accelerates primer/template binary complex formation in vitro. An open question is whether NC alone unwinds the primer or whether unwinding by NC requires the RNA genome. We monitored the annealing process in solution by using fluorescence resonance energy transfer (FRET). Distance measurements demonstrate unequivocally that the tRNA acceptor stem is not substantially unwound by NC in the absence of the RNA genome, that is, unwinding is not separable from hybridization. Moreover, FRET measurements show that both heat- and NC-mediated annealing result in an approximately 40-A increase in the separation of the two ends of the tRNA acceptor arm on binding to the template. This large increase in separation of the two ends suggests a complete displacement of the nonhybridized strand of the acceptor stem in the initiation complex.

  10. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.


    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  11. Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

    PubMed Central

    Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M


    A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

  12. The pathway of hepatitis C virus mRNA recruitment to the human ribosome.


    Fraser, Christopher S; Hershey, John W B; Doudna, Jennifer A


    Eukaryotic protein synthesis begins with mRNA positioning in the ribosomal decoding channel in a process typically controlled by translation-initiation factors. Some viruses use an internal ribosome entry site (IRES) in their mRNA to harness ribosomes independently of initiation factors. We show here that a ribosome conformational change that is induced upon hepatitis C viral IRES binding is necessary but not sufficient for correct mRNA positioning. Using directed hydroxyl radical probing to monitor the assembly of IRES-containing translation-initiation complexes, we have defined a crucial step in which mRNA is stabilized upon initiator tRNA binding. Unexpectedly, however, this stabilization occurs independently of the AUG codon, underscoring the importance of initiation factor-mediated interactions that influence the configuration of the decoding channel. These results reveal how an IRES RNA supplants some, but not all, of the functions normally carried out by protein factors during initiation of protein synthesis.

  13. Nuclear rRNA transcript processing versus internal transcribed spacer secondary structure.


    Coleman, Annette W


    rRNA is one of the few universal features of life, making it uniquely suited to assess phylogenetic relationships. The processing of the initial polycistronic rRNA transcript is also a conserved process, involving numerous cleavage events and the generation of secondary structures. The secondary structure of the internal transcribed spacer (ITS) regions of nuclear rRNA transcripts are well known for a wide variety of eukaryotes and have been used to aid in the alignment of these sequences for phylogenetic comparisons. By contrast, study of the processing of the initial rRNA transcripts has been largely limited to yeast, mice, rats, and humans. Here I examine the known cleavage sites in the two ITS regions and their positions relative to the secondary structure. A better understanding of the conservation of secondary structures and cleavage sites within the ITS regions will improve evolutionary inferences based on these sequences.

  14. Kaposi's Sarcoma-associated Herpesvirus Hijacks RNA Polymerase II to Create a Viral Transcriptional Factory.


    Chen, Christopher Phillip; Lyu, Yuanzhi; Chuang, Frank; Nakano, Kazushi; Izumiya, Chie; Jin, Di; Campbell, Mel; Izumiya, Yoshihiro


    Locally concentrated nuclear factors ensure efficient binding to the DNA templates, facilitating RNA polymerase II recruitment and frequent reutilization of stable pre-initiation complexes. Here we have uncovered a mechanism for effective viral transcription by focal assembly of RNA polymerase II around KSHV genomes in the host cell nucleus. Using immunofluorescent labeling of latent nuclear antigen (LANA) protein, together with fluorescence in situ RNA hybridization (RNA-FISH) of the intron region of immediate-early transcripts, we visualized active transcription of viral genomes in naturally infected cells. At single cell level, we found that not all episomes were uniformly transcribed following stimuli. However, those episomes that were being transcribed, would spontaneously aggregate to form transcriptional "factories", which recruited a significant fraction of cellular RNA polymerase II. Focal assembly of "viral transcriptional factories" decreased the pool of cellular RNA polymerase II available for cellular genes transcription, which consequently impaired cellular gene expression globally, with the exception of selected ones. The viral transcriptional factories localized with replicating viral genomic DNAs. The observed colocalization of viral transcriptional factories with replicating viral genomic DNA suggests that KSHV assembles an "all-in-one" factory for both gene transcription and DNA replication. We propose that the assembly of RNA polymerase II around viral episomes in the nucleus may be a previously unexplored aspect of KSHV gene regulation by confiscation of a limited supply of RNA polymerase II in infected cells.IMPORTANCE B-cells infected with Kaposi's sarcoma-associated herpesvirus (KSHV) harbor multiple copies of the KSHV genome in the form of episomes. 3D imaging of viral gene expression in the nucleus allows us to study interactions and changes in the physical distribution of these episomes following stimulation. The results showed

  15. Inhibition of RNA Polymerase II Transcription in Human Cells by Synthetic DNA-Binding Ligands

    NASA Astrophysics Data System (ADS)

    Dickinson, Liliane A.; Gulizia, Richard J.; Trauger, John W.; Baird, Eldon E.; Mosier, Donald E.; Gottesfeld, Joel M.; Dervan, Peter B.


    Sequence-specific DNA-binding small molecules that can permeate human cells potentially could regulate transcription of specific genes. Multiple cellular DNA-binding transcription factors are required by HIV type 1 for RNA synthesis. Two pyrrole--imidazole polyamides were designed to bind DNA sequences immediately adjacent to binding sites for the transcription factors Ets-1, lymphoid-enhancer binding factor 1, and TATA-box binding protein. These synthetic ligands specifically inhibit DNA-binding of each transcription factor and HIV type 1 transcription in cell-free assays. When used in combination, the polyamides inhibit virus replication by >99% in isolated human peripheral blood lymphocytes, with no detectable cell toxicity. The ability of small molecules to target predetermined DNA sequences located with RNA polymerase II promoters suggests a general approach for regulation of gene expression, as well as a mechanism for the inhibition of viral replication.

  16. Chromatin-dependent regulation of RNA polymerases II and III activity throughout the transcription cycle.


    Jordán-Pla, Antonio; Gupta, Ishaan; de Miguel-Jiménez, Lola; Steinmetz, Lars M; Chávez, Sebastián; Pelechano, Vicent; Pérez-Ortín, José E


    The particular behaviour of eukaryotic RNA polymerases along different gene regions and amongst distinct gene functional groups is not totally understood. To cast light onto the alternative active or backtracking states of RNA polymerase II, we have quantitatively mapped active RNA polymerases at a high resolution following a new biotin-based genomic run-on (BioGRO) technique. Compared with conventional profiling with chromatin immunoprecipitation, the analysis of the BioGRO profiles in Saccharomyces cerevisiae shows that RNA polymerase II has unique activity profiles at both gene ends, which are highly dependent on positioned nucleosomes. This is the first demonstration of the in vivo influence of positioned nucleosomes on transcription elongation. The particular features at the 5' end and around the polyadenylation site indicate that this polymerase undergoes extensive specific-activity regulation in the initial and final transcription elongation phases. The genes encoding for ribosomal proteins show distinctive features at both ends. BioGRO also provides the first nascentome analysis for RNA polymerase III, which indicates that transcription of tRNA genes is poorly regulated at the individual copy level. The present study provides a novel perspective of the transcription cycle that incorporates inactivation/reactivation as an important aspect of RNA polymerase dynamics.

  17. The use of Molecular Beacons to Directly Measure Bacterial mRNA Abundances and Transcript Degradation

    PubMed Central

    Kuechenmeister, Lisa J.; Anderson, Kelsi L.; Morrison, John M.; Dunman, Paul M.


    The regulation of mRNA turnover is a dynamic means by which bacteria regulate gene expression. Although current methodologies allow characterization of the stability of individual transcripts, procedures designed to measure alterations in transcript abundance/turnover on a high throughput scale are lacking. In the current report, we describe the development of a rapid and simplified molecular beacon-based procedure to directly measure the mRNA abundances and mRNA degradation properties of well-characterized Staphylococcus aureus pathogenicity factors. This method does not require any PCR-based amplification, can monitor the abundances of multiple transcripts within a single RNA sample, and was successfully implemented into a high throughput screen of transposon mutant library members to detect isolates with altered mRNA turnover properties. It is expected that the described methodology will provide great utility in characterizing components of bacterial RNA degradation processes and can be used to directly measure the mRNA levels of virtually any bacterial transcript. PMID:18992285

  18. A cell-based screening system for influenza A viral RNA transcription/replication inhibitors

    PubMed Central

    Ozawa, Makoto; Shimojima, Masayuki; Goto, Hideo; Watanabe, Shinji; Hatta, Yasuko; Kiso, Maki; Furuta, Yousuke; Horimoto, Taisuke; Peters, Noel R.; Hoffmann, F. Michael; Kawaoka, Yoshihiro


    Although two classes of antivirals, NA inhibitors and M2 ion channel blockers, are licensed for influenza treatment, dual resistant mutants, including highly pathogenic H5N1 viruses, have appeared. Alternative treatment options are, therefore, needed. Influenza A viral RNA (vRNA) transcription/replication is a promising target for antiviral development, since it is essential for virus replication. Accordingly, an efficient and reliable method to identify vRNA transcription/replication inhibitors is desirable. Here, we developed a cell-based screening system by establishing a cell line that stably expresses influenza viral ribonucleoprotein complex (vRNP). Compound library screening using this cell line allowed us to identify a compound that inhibits vRNA transcription/replication by using reporter protein expression from virus-like RNA as a readout and virus replication in vitro. vRNP-expressing cells have potential as a simple and convenient high-throughput screening (HTS) system, and, thus, are promising to identify vRNA transcription/replication inhibitors for various RNA viruses, especially for primary screens. PMID:23346363

  19. p53 inhibits RNA polymerase III-directed transcription in a promoter-dependent manner.

    PubMed Central

    Chesnokov, I; Chu, W M; Botchan, M R; Schmid, C W


    Wild-type p53 represses Alu template activity in vitro and in vivo. However, upstream activating sequence elements from both the 7SL RNA gene and an Alu source gene relieve p53-mediated repression. p53 also represses the template activity of the U6 RNA gene both in vitro and in vivo but has no effect on in vitro transcription of genes encoding 5S RNA, 7SL RNA, adenovirus VAI RNA, and tRNA. The N-terminal activation domain of p53, which binds TATA-binding protein (TBP), is sufficient for repressing Alu transcription in vitro, and mutation of positions 22 and 23 in this region impairs p53-mediated repression of an Alu template both in vitro and in vivo. p53's N-terminal domain binds TFIIIB, presumably through its known interaction with TBP, and mutation of positions 22 and 23 interferes with TFIIIB binding. These results extend p53's transcriptional role to RNA polymerase III-directed templates and identify an additional level of Alu transcriptional regulation. PMID:8943363

  20. Nucleolin provides a link between RNA polymerase I transcription and pre-ribosome assembly.


    Roger, Benoit; Moisand, André; Amalric, François; Bouvet, Philippe


    Despite the identification of numerous factors involved in ribosomal RNA synthesis and maturation, the molecular mechanisms of ribosome biogenesis, and in particular the relationship between the different steps, are still largely unknown. We have investigated the consequences of an increased amount of a major nucleolar non-ribosomal protein, nucleolin, in Xenopus laevisstage VI oocytes on the production of ribosomal subunits. We show that a threefold increase in nucleolin leads to the complete absence of pre-rRNA maturation in addition to significant repression of RNA polymerase I transcription. Observation of "Christmas trees" by electron microscopy and analysis of the sedimentation properties of 40S pre-ribosomal particles suggest that an increased amount of nucleolin leads to incorrect packaging of the 40S particle. Interestingly, nucleolin affects the maturation of the 40S particle only when it is present at the time of transcription. These results indicate that nucleolin participates in the co-transcriptional packaging of the pre-rRNA, and that the quality of this packaging will determine whether the 40S precursor undergoes maturation or is degraded. The interaction of nucleolin with nascent pre-rRNA could help the co-transcriptional assembly on pre-rRNA of factors necessary for the subsequent maturation of the pre-ribosomal particle containing the 40S pre-rRNA.

  1. Repression of host RNA polymerase II transcription by herpes simplex virus type 1.

    PubMed Central

    Spencer, C A; Dahmus, M E; Rice, S A


    Lytic infection of mammalian cells with herpes simplex virus type 1 (HSV-1) results in rapid repression of host gene expression and selective activation of the viral genome. This transformation in gene expression is thought to involve repression of host transcription and diversion of the host RNA polymerase (RNAP II) transcription machinery to the viral genome. However, the extent of virus-induced host transcription repression and the mechanisms responsible for these major shifts in transcription specificities have not been examined. To determine how HSV-1 accomplishes repression of host RNAP II transcription, we assayed transcription patterns on several cellular genes in cells infected with mutant and wild-type HSV-1. Our results suggest that HSV-1 represses RNAP II transcription on most cellular genes. However, each cellular gene we examined responds differently to the transcription repressive effects of virus infection, both quantitatively and with respect to the involvement of viral gene products. Virus-induced shutoff of host RNAP II transcription requires expression of multiple immediate-early genes. In contrast, expression of delayed-early and late genes and viral DNA replication appear to contribute little to repression of host cell RNAP II transcription. Modification of RNAP II to the intermediately phosphorylated (II(I)) form appears unlinked to virus-induced repression of host cell transcription. However, full repression of host transcription is correlated with depletion of the hyperphosphorylated (IIO) form of RNAP II. PMID:9032335

  2. Control of gluconeogenic genes during intense/prolonged exercise: hormone-independent effect of muscle-derived IL-6 on hepatic tissue and PEPCK mRNA.


    Banzet, Sébastien; Koulmann, Nathalie; Simler, Nadine; Sanchez, Hervé; Chapot, Rachel; Serrurier, Bernard; Peinnequin, André; Bigard, Xavier


    Prolonged intense exercise is challenging for the liver to maintain plasma glucose levels. Hormonal changes cannot fully account for exercise-induced hepatic glucose production (HGP). Contracting skeletal muscles release interleukin-6 (IL-6), a cytokine able to increase endogenous glucose production during exercise. However, whether this is attributable to a direct effect of IL-6 on liver remains unknown. Here, we studied hepatic glycogen, gluconeogenic genes, and IL-6 signaling in response to one bout of exhaustive running exercise in rats. To determine whether IL-6 can modulate gluconeogenic gene mRNA independently of exercise, we injected resting rats with recombinant IL-6. Exhaustive exercise resulted in a profound decrease in liver glycogen and an increase in gluconeogenic gene mRNA levels, phosphoenolpyruvate-carboxykinase (PEPCK), glucose-6-phosphatase (G6P), and peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1alpha), suggesting a key role for gluconeogenesis in hepatic glucose production. This was associated to an active IL-6 signaling in liver tissue, as shown by signal transducer and activator of transcription and CAAT/enhancer binding protein-beta phosphorylation and IL-6-responsive gene mRNA levels at the end of exercise. Recombinant IL-6 injection resulted in an increase in IL-6-responsive gene mRNA levels in the liver. We found a dose-dependent increase in PEPCK gene mRNA strongly correlated with IL-6-induced gene mRNA levels. No changes in G6P and PGC-1alpha mRNA levels were found. Taken together, our results suggest that, during very demanding exercise, muscle-derived IL-6 could help increase HGP by directly upregulating PEPCK mRNA abundance.

  3. Regulation of hepatic microRNA expression by hepatocyte nuclear factor 4 alpha

    PubMed Central

    Lu, Hong; Lei, Xiaohong; Liu, Jerry; Klaassen, Curtis


    AIM To uncover the role of hepatocyte nuclear factor 4 alpha (HNF4α) in regulating hepatic expression of microRNAs. METHODS Microarray and real-time PCR were used to determine hepatic expression of microRNAs in young-adult mice lacking Hnf4α expression in liver (Hnf4α-LivKO). Integrative genomics viewer software was used to analyze the public chromatin immunoprecipitation-sequencing datasets for DNA-binding of HNF4α, RNA polymerase-II, and histone modifications to loci of microRNAs in mouse liver and human hepatoma cells. Dual-luciferase reporter assay was conducted to determine effects of HNF4α on the promoters of mouse and human microRNAs as well as effects of microRNAs on the untranslated regions (3’UTR) of two genes in human hepatoma cells. RESULTS Microarray data indicated that most microRNAs remained unaltered by Hnf4α deficiency in Hnf4α-LivKO mice. However, certain liver-predominant microRNAs were down-regulated similarly in young-adult male and female Hnf4α-LivKO mice. The down-regulation of miR-101, miR-192, miR-193a, miR-194, miR-215, miR-802, and miR-122 as well as induction of miR-34 and miR-29 in male Hnf4α-LivKO mice were confirmed by real-time PCR. Analysis of public chromatin immunoprecipitation-sequencing data indicates that HNF4α directly binds to the promoters of miR-101, miR-122, miR-194-2/miR-192 and miR-193, which is associated with histone marks of active transcription. Luciferase reporter assay showed that HNF4α markedly activated the promoters of mouse and human miR-101b/miR-101-2 and the miR-194/miR-192 cluster. Additionally, miR-192 and miR-194 significantly decreased activities of luciferase reporters for the 3’UTR of histone H3F3 and chromodomain helicase DNA binding protein 1 (CHD1), respectively, suggesting that miR-192 and miR-194 might be important in chromosome remodeling through directly targeting H3F3 and CHD1. CONCLUSION HNF4α is essential for hepatic basal expression of a group of liver-enriched micro

  4. RNA Polymerase II Elongation at the Crossroads of Transcription and Alternative Splicing

    PubMed Central

    de la Mata, Manuel; Muñoz, Manuel J.; Alló, Mariano; Fededa, Juan Pablo; Schor, Ignacio E.; Kornblihtt, Alberto R.


    The elongation phase of transcription lies at the core of several simultaneous and coupled events leading to alternative splicing regulation. Although underestimated in the past, it is at this phase of the transcription cycle where complexes affecting the transcription machinery itself, chromatin structure, posttranscriptional gene regulation and pre-mRNA processing converge to regulate each other or simply to consolidate higher-order complexes and functions. This paper focuses on the multiple processes that take place during transcription elongation which ultimately regulate the outcome of alternative splicing decisions. PMID:22567350

  5. RNA interference in the nucleus: roles for small RNAs in transcription, epigenetics and beyond.


    Castel, Stephane E; Martienssen, Robert A


    A growing number of functions are emerging for RNA interference (RNAi) in the nucleus, in addition to well-characterized roles in post-transcriptional gene silencing in the cytoplasm. Epigenetic modifications directed by small RNAs have been shown to cause transcriptional repression in plants, fungi and animals. Additionally, increasing evidence indicates that RNAi regulates transcription through interaction with transcriptional machinery. Nuclear small RNAs include small interfering RNAs (siRNAs) and PIWI-interacting RNAs (piRNAs) and are implicated in nuclear processes such as transposon regulation, heterochromatin formation, developmental gene regulation and genome stability.

  6. Structure of Hepatitis E Virion-Sized Particle Reveals an RNA-Dependent Viral Assembly Pathway

    SciTech Connect

    Xing, L.; Wall, J.; Li, T.-C.; Mayazaki, N.; Simon, M. N.; Moore, M.; Wang, C.-Y.; Takeda, N.; Wakita, T.; Miyamura, T.; Cheng, R. H.


    Hepatitis E virus (HEV) induces acute hepatitis in humans with a high fatality rate in pregnant women. There is a need for anti-HEV research to understand the assembly process of HEV native capsid. Here, we produced a large virion-sized and a small T=1 capsid by expressing the HEV capsid protein in insect cells with and without the N-terminal 111 residues, respectively, for comparative structural analysis. The virion-sized capsid demonstrates a T=3 icosahedral lattice and contains RNA fragment in contrast to the RNA-free T=1 capsid. However, both capsids shared common decameric organization. The in vitro assembly further demonstrated that HEV capsid protein had the intrinsic ability to form decameric intermediate. Our data suggest that RNA binding is the extrinsic factor essential for the assembly of HEV native capsids.

  7. Does RNA interference provide new hope for control of chronic hepatitis B infection?


    Wilson, Rachel; Purcell, Damian; Netter, Hans J; Revill, Peter A


    Hepatitis B virus (HBV) infection is a global human health problem, with an estimated 350 million people having chronic hepatitis B (CHB) infection worldwide. The majority of infections acquired during adulthood are resolved without intervention; however, infections acquired at birth or during early childhood have a 90% chance of progressing to CHB, leading to a host of adverse effects on the liver, including cirrhosis and cancer. CHB is currently treated with a combination of cytokines and/or nucleoside/nucleotide analogues; however, adverse side effects to cytokine therapy and the selection of resistance mutations to nucleoside analogues often abrogate the efficacy of treatment. The recent discovery that small interfering RNA and microRNA are active in mammalian cells suggests it might be possible to supplement existing HBV therapies with small RNA-based therapeutic(s).

  8. Cytokine mRNA expression in hepatitis C virus infection: TH1 predominance in patients with chronic hepatitis C and TH1-TH2 cytokine profile in subjects with self-limited disease.


    Gigi, E; Raptopoulou-Gigi, M; Kalogeridis, A; Masiou, S; Orphanou, E; Vrettou, E; Lalla, T H; Sinakos, E; Tsapas, V


    Many determinants of the immune response have been implied in the pathogenesis of chronic hepatitis C. TH1 and TH2 cytokines play a prominent role in viral infections and a dysregulation of these cytokines could account for viral persistence and evolution of chronic disease. To explore a possible TH1 and TH2 cytokine dysregulation resulting in the inability to terminate hepatitis C virus (HCV) infection, we studied TH1 [interferon (IFN)-gamma, interleukin (IL)-2] and TH2 (IL-4, IL-10) mRNA expression of peripheral blood mononuclear cells (PBMC) in response to NS3 HCV antigen stimulation, in 31 untreated patients with chronic hepatitis C and 29 subjects with self-limited disease. After a 48 h culture of PBMC, total RNA isolation was performed and complementary DNA was prepared by reverse transcription. mRNA levels were quantified by real-time polymerase chain reaction using a standard curve formed after cloning each cytokine gene and a reference gene using recombinant DNA technology in a specific plasmid vector. In the patients group, mRNA expression of IFN-gamma, IL-2 and IL-4 but not IL-10 was detected, IFN-gamma being the predominant cytokine expressed. All four cytokines were expressed in subjects with self limited disease, however levels of IFN-gamma were lower and a significant higher expression of IL-10 compared to patients was found. There was a significant correlation between IFN-gamma mRNA expression levels and stage of fibrosis. Our findings show that in chronic hepatitis C, TH1 cytokines predominate and correlate to liver immunopathology. Furthermore, subjects with self-limited disease, maintain the ability to respond to HCV antigens for a long time after disease resolution.

  9. Hypoxia-inducible factor 2 alpha is essential for hepatic outgrowth and functions via the regulation of leg1 transcription in the zebrafish embryo.


    Lin, Tzung-Yi; Chou, Chi-Fu; Chung, Hsin-Yu; Chiang, Chia-Yin; Li, Chung-Hao; Wu, Jen-Leih; Lin, Han-Jia; Pai, Tun-Wen; Hu, Chin-Hwa; Tzou, Wen-Shyong


    The liver plays a vital role in metabolism, detoxification, digestion, and the maintenance of homeostasis. During development, the vertebrate embryonic liver undergoes a series of morphogenic processes known as hepatogenesis. Hepatogenesis can be separated into three interrelated processes: endoderm specification, hepatoblast differentiation, and hepatic outgrowth. Throughout this process, signaling molecules and transcription factors initiate and regulate the coordination of cell proliferation, apoptosis, differentiation, intercellular adhesion, and cell migration. Hifs are already recognized to be essential in embryonic development, but their role in hepatogenesis remains unknown. Using the zebrafish embryo as a model organism, we report that the lack of Hif2-alpha but not Hif1-alpha blocks hepatic outgrowth. While Hif2-alpha is not involved in hepatoblast specification, this transcription factor regulates hepatocyte cell proliferation during hepatic outgrowth. Furthermore, we demonstrated that the lack of Hif2-alpha can reduce the expression of liver-enriched gene 1 (leg1), which encodes a secretory protein essential for hepatic outgrowth. Additionally, exogenous mRNA expression of leg1 can rescue the small liver phenotype of hif2-alpha morphants. We also showed that Hif2-alpha directly binds to the promoter region of leg1 to control leg1 expression. Interestingly, we discovered overrepresented, high-density Hif-binding sites in the potential upstream regulatory sequences of leg1 in teleosts but not in terrestrial mammals. We concluded that hif2-alpha is a key factor required for hepatic outgrowth and regulates leg1 expression in zebrafish embryos. We also proposed that the hif2-alpha-leg1 axis in liver development may have resulted from the adaptation of teleosts to their environment.

  10. Hypoxia-Inducible Factor 2 Alpha Is Essential for Hepatic Outgrowth and Functions via the Regulation of leg1 Transcription in the Zebrafish Embryo

    PubMed Central

    Lin, Tzung-Yi; Chou, Chi-Fu; Chung, Hsin-Yu; Chiang, Chia-Yin; Li, Chung-Hao; Wu, Jen-Leih; Lin, Han-Jia; Pai, Tun-Wen; Hu, Chin-Hwa; Tzou, Wen-Shyong


    The liver plays a vital role in metabolism, detoxification, digestion, and the maintenance of homeostasis. During development, the vertebrate embryonic liver undergoes a series of morphogenic processes known as hepatogenesis. Hepatogenesis can be separated into three interrelated processes: endoderm specification, hepatoblast differentiation, and hepatic outgrowth. Throughout this process, signaling molecules and transcription factors initiate and regulate the coordination of cell proliferation, apoptosis, differentiation, intercellular adhesion, and cell migration. Hifs are already recognized to be essential in embryonic development, but their role in hepatogenesis remains unknown. Using the zebrafish embryo as a model organism, we report that the lack of Hif2-alpha but not Hif1-alpha blocks hepatic outgrowth. While Hif2-alpha is not involved in hepatoblast specification, this transcription factor regulates hepatocyte cell proliferation during hepatic outgrowth. Furthermore, we demonstrated that the lack of Hif2-alpha can reduce the expression of liver-enriched gene 1 (leg1), which encodes a secretory protein essential for hepatic outgrowth. Additionally, exogenous mRNA expression of leg1 can rescue the small liver phenotype of hif2-alpha morphants. We also showed that Hif2-alpha directly binds to the promoter region of leg1 to control leg1 expression. Interestingly, we discovered overrepresented, high-density Hif-binding sites in the potential upstream regulatory sequences of leg1 in teleosts but not in terrestrial mammals. We concluded that hif2-alpha is a key factor required for hepatic outgrowth and regulates leg1 expression in zebrafish embryos. We also proposed that the hif2-alpha-leg1 axis in liver development may have resulted from the adaptation of teleosts to their environment. PMID:25000307

  11. Varying Rate of RNA Chain Elongation during rrn Transcription in Escherichia coli▿

    PubMed Central

    Dennis, P. P.; Ehrenberg, M.; Fange, D.; Bremer, H.


    The value of the rRNA chain elongation rate in bacteria is an important physiological parameter, as it affects not only the rRNA promoter activity but also the free-RNA polymerase concentration and thereby the transcription of all genes. On average, rRNA chains elongate at a rate of 80 to 90 nucleotides (nt) per s, and the transcription of an entire rrn operon takes about 60 s (at 37°C). Here we have analyzed a reported distribution obtained from electron micrographs of RNA polymerase molecules along rrn operons in E. coli growing at 2.5 doublings per hour (S. Quan, N. Zhang, S. French, and C. L. Squires, J. Bacteriol. 187:1632-1638, 2005). The distribution exhibits two peaks of higher polymerase density centered within the 16S and 23S rRNA genes. An evaluation of this distribution indicates that RNA polymerase transcribes the 5′ leader region at speeds up to or greater than 250 nt/s. Once past the leader, transcription slows down to about 65 nt/s within the 16S gene, speeds up in the spacer region between the 16S and 23S genes, slows again to about 65 nt/s in the 23S region, and finally speeds up to a rate greater than 400 nt/s near the end of the operon. We suggest that the slowing of transcript elongation in the 16S and 23S sections is the result of transcriptional pauses, possibly caused by temporary interactions of the RNA polymerase with secondary structures in the nascent rRNA. PMID:19329648

  12. B2 RNA and 7SK RNA, RNA polymerase III transcripts, have a cap-like structure at their 5' end.

    PubMed Central

    Shumyatsky, G P; Tillib, S V; Kramerov, D A


    We found that hydrolysates of poly(A)+ RNA from Ehrlich ascites carcinoma cells which were transcribed by RNA polymerase III contained an unusual component designated as X. It was part of B2 RNA representing a transcript of B2 retroposon, typical of rodents. The component X possesses a cap-like structure, xppp5'G, where x has a non-nucleotide structure. About half of all B2 RNAs contained this group at the 5' end. Previously, Epstein et al. (1) detected a similar structure at the 5' end of small nuclear U6 RNA. Later, Singh and Reddy (2) showed methyl to be the blocking group in the component x of U6 RNA. Besides B2 RNA, we found 5' ends containing methyl groups in 7SK RNA. Images PMID:1700854

  13. Changes in rRNA transcription influence proliferation and cell fate within a stem cell lineage.


    Zhang, Qiao; Shalaby, Nevine A; Buszczak, Michael


    Ribosome biogenesis drives cell growth and proliferation, but mechanisms that modulate this process within specific lineages remain poorly understood. Here, we identify a Drosophila RNA polymerase I (Pol I) regulatory complex composed of Under-developed (Udd), TAF1B, and a TAF1C-like factor. Disruption of udd or TAF1B results in reduced ovarian germline stem cell (GSC) proliferation. Female GSCs display high levels of ribosomal RNA (rRNA) transcription, and Udd becomes enriched in GSCs relative to their differentiating daughters. Increasing Pol I transcription delays differentiation, whereas reducing rRNA production induces both morphological changes that accompany multicellular cyst formation and specific decreased expression of the bone morphogenetic protein (BMP) pathway component Mad. These findings demonstrate that modulating rRNA synthesis fosters changes in the cell fate, growth, and proliferation of female Drosophila GSCs and their daughters.

  14. Ellagic acid improves hepatic steatosis and serum lipid composition through reduction of serum resistin levels and transcriptional activation of hepatic ppara in obese, diabetic KK-A(y) mice.


    Yoshimura, Yukihiro; Nishii, Saori; Zaima, Nobuhiro; Moriyama, Tatsuya; Kawamura, Yukio


    Ellagic acid (EA) is a polyphenol found in a wide variety of plant foods that not only exhibits free radical-scavenging activity, but also confers protective effects against liver injury. Previously, we reported that pomegranate fruit extract (PFE) had an inhibitory effect on resistin secretion from differentiated murine 3T3-L1 adipocytes and identified EA contained in PFE as a potent suppressor of resistin secretion. Resistin, an adipocytokine, is considered the link between obesity and type 2 diabetes. In this study, we explored whether EA supplementation reduces serum resistin and improves hepatic steatosis and serum lipid profile by using KK-A(y) mice fed high-fat diet as a model for obese type 2 diabetes. We found that EA supplementation improved serum lipid profile and hepatic steatosis, and reduced serum resistin levels without altering mRNA expression levels in adipose tissue. Moreover, EA supplementation upregulated mRNA expression of apoa1, ldlr, cpt1a, and ppara genes in the liver. In conclusion, our findings indicate that EA is a potent suppressor of resistin secretion in vivo and a transcriptional activator of ppara in the liver, suggesting a possibility for improving obesity-induced dyslipidemia and hepatic steatosis in KK-A(y) mice.

  15. Live imaging of nascent RNA dynamics reveals distinct types of transcriptional pulse regulation

    PubMed Central

    Muramoto, Tetsuya; Cannon, Danielle; Gierliński, Marek; Corrigan, Adam; Barton, Geoffrey J.; Chubb, Jonathan R.


    Transcription of genes can be discontinuous, occurring in pulses or bursts. It is not clear how properties of transcriptional pulses vary between different genes. We compared the pulsing of five housekeeping and five developmentally induced genes by direct imaging of single gene transcriptional events in individual living Dictyostelium cells. Each gene displayed its own transcriptional signature, differing in probability of firing and pulse duration, frequency, and intensity. In contrast to the prevailing view from both prokaryotes and eukaryotes that transcription displays binary behavior, strongly expressed housekeeping genes altered the magnitude of their transcriptional pulses during development. These nonbinary “tunable” responses may be better suited than stochastic switch behavior for housekeeping functions. Analysis of RNA synthesis kinetics using fluorescence recovery after photobleaching implied modulation of housekeeping-gene pulse strength occurs at the level of transcription initiation rather than elongation. In addition, disparities between single cell and population measures of transcript production suggested differences in RNA stability between gene classes. Analysis of stability using RNAseq revealed no major global differences in stability between developmental and housekeeping transcripts, although strongly induced RNAs showed unusually rapid decay, indicating tight regulation of expression. PMID:22529358

  16. Live imaging of nascent RNA dynamics reveals distinct types of transcriptional pulse regulation.


    Muramoto, Tetsuya; Cannon, Danielle; Gierlinski, Marek; Corrigan, Adam; Barton, Geoffrey J; Chubb, Jonathan R


    Transcription of genes can be discontinuous, occurring in pulses or bursts. It is not clear how properties of transcriptional pulses vary between different genes. We compared the pulsing of five housekeeping and five developmentally induced genes by direct imaging of single gene transcriptional events in individual living Dictyostelium cells. Each gene displayed its own transcriptional signature, differing in probability of firing and pulse duration, frequency, and intensity. In contrast to the prevailing view from both prokaryotes and eukaryotes that transcription displays binary behavior, strongly expressed housekeeping genes altered the magnitude of their transcriptional pulses during development. These nonbinary "tunable" responses may be better suited than stochastic switch behavior for housekeeping functions. Analysis of RNA synthesis kinetics using fluorescence recovery after photobleaching implied modulation of housekeeping-gene pulse strength occurs at the level of transcription initiation rather than elongation. In addition, disparities between single cell and population measures of transcript production suggested differences in RNA stability between gene classes. Analysis of stability using RNAseq revealed no major global differences in stability between developmental and housekeeping transcripts, although strongly induced RNAs showed unusually rapid decay, indicating tight regulation of expression.

  17. Repairing RNA Transcripts that Mediate Breast Cancer Susceptibility

    DTIC Science & Technology


    the ribozyme (Barfod and Cech 1989; Doudna et al. 1989; Testa et al. 1997; Bell et al. 2002). The guanosine following the inserted uridine is equivalent...trans-splicing. Nat Med 9:1015-1019. Doudna , J.A., Cormack, B.P., and Szostak, J.W. 1989. RNA structure, not sequence, determines the 5’ splice-site

  18. In Medicago truncatula, water deficit modulates the transcript accumulation of components of small RNA pathways

    PubMed Central


    Background Small RNAs (sRNAs) are 20-24 nucleotide (nt) RNAs and are involved in plant development and response to abiotic stresses. Plants have several sRNA pathways implicated in the transcriptional and post-transcriptional silencing of gene expression. Two key enzyme families common to all pathways are the Dicer-like (DCL) proteins involved in sRNAs maturation and the Argonautes (AGOs) involved in the targeting and functional action of sRNAs. Post-transcriptional silencing mediated by AGOs may occur by cleavage or translational repression of target mRNA's, while transcriptional silencing may be controlled by DNA methylation and chromatin remodeling. Thus far, these gene families have not been characterized in legumes, nor has their involvement in adaptation to water deficit been studied. Results A bioinformatic search in Medicago truncatula genome databases, using Arabidopsis thaliana AGO and DCL cDNA and protein sequences, identified three sequences encoding for putative Dicer-like genes and twelve sequences encoding for putative Argonaute genes. Under water deficit conditions and mainly in roots, MtDCL1 and MtAGO1, two enzymes probably involved in the processing and activation of microRNAs (miRNAs), increased their transcript levels. mir162 which target DCL1 mRNA and mir168 which target AGO1 mRNA reduced their expression in the roots of plants subjected to water deficit. Three putative genes, MtDCL3, MtAGO4b and MtAGO4c probably involved in DNA methylation mechanisms, increased their mRNA levels. However, the mRNA levels of MtAGO6 reduced, which probably encodes a protein with functions similar to MtAGO4. MtAGO7 mRNA levels increased and possibly encodes a protein involved in the production of trans-acting small interfering RNAs. The transcript abundance of MtAGO12a, MtAGO12b and MtAGO12c reduced under water deprivation. Plants recovered from water deprivation reacquire the mRNA levels of the controls. Conclusions Our work demonstrates that in M. truncatula

  19. Plasmid ColE1 incompatibility determined by interaction of RNA I with primer transcript.

    PubMed Central

    Tomizawa, J; Itoh, T


    Mutants of plasmid pNT7 that can coexist with plasmid pMB9 in growing bacteria have been isolated. These mutants show altered incompatibility properties and increased copy numbers. Each mutant has a single base change at or near the center of one of the three palindromes in the region that specifies two RNA species: a larger one (primer transcripts) that provides a primer for DNA replication and a smaller one (RNA I) that is the incompatibility-specific inhibitor of primer formation. In vitro transcription studies show that the single base changes affect both the ability of RNA I to inhibit primer formation and the sensitivity of primer formation to inhibition by RNA I. RNA I hybridizes to the primer transcript, and the rate of hybridization is reduced by the single base changes. Based on analyses of inhibition of in vitro primer formation by RNA I and of in vivo properties of the mutant plasmids, we conclude that incompatibility between two plasmids can be attributed to inhibition of primer formation on one of the plasmids by the RNA I of the other. Inhibition of primer formation by RNA I appears to be the mechanism that determines the copy number of pNT7 and its derivatives. Images PMID:6171811

  20. Selective inhibition of RNA polymerase I transcription as a potential approach to treat African trypanosomiasis

    PubMed Central

    Kerry, Louise E.; Pegg, Elaine E.; Cameron, Donald P.; Budzak, James; Poortinga, Gretchen; Hannan, Katherine M.; Hannan, Ross D.


    Trypanosoma brucei relies on an essential Variant Surface Glycoprotein (VSG) coat for survival in the mammalian bloodstream. High VSG expression within an expression site body (ESB) is mediated by RNA polymerase I (Pol I), which in other eukaryotes exclusively transcribes ribosomal RNA genes (rDNA). As T. brucei is reliant on Pol I for VSG transcription, we investigated Pol I transcription inhibitors for selective anti-trypanosomal activity. The Pol I inhibitors quarfloxin (CX-3543), CX-5461, and BMH-21 are currently under investigation for treating cancer, as rapidly dividing cancer cells are particularly dependent on high levels of Pol I transcription compared with nontransformed cells. In T. brucei all three Pol I inhibitors have IC50 concentrations for cell proliferation in the nanomolar range: quarfloxin (155 nM), CX-5461 (279 nM) or BMH-21 (134 nM) compared with IC50 concentrations in the MCF10A human breast epithelial cell line (4.44 μM, 6.89 μM or 460 nM, respectively). T. brucei was therefore 29-fold more sensitive to quarfloxin, 25-fold more sensitive to CX-5461 and 3.4-fold more sensitive to BMH-21. Cell death in T. brucei was due to rapid inhibition of Pol I transcription, as within 15 minutes treatment with the inhibitors rRNA precursor transcript was reduced 97-98% and VSG precursor transcript 91-94%. Incubation with Pol I transcription inhibitors also resulted in disintegration of the ESB as well as the nucleolus subnuclear structures, within one hour. Rapid ESB loss following the block in Pol I transcription argues that the ESB is a Pol I transcription nucleated structure, similar to the nucleolus. In addition to providing insight into Pol I transcription and ES control, Pol I transcription inhibitors potentially also provide new approaches to treat trypanosomiasis. PMID:28263991

  1. Selective inhibition of RNA polymerase I transcription as a potential approach to treat African trypanosomiasis.


    Kerry, Louise E; Pegg, Elaine E; Cameron, Donald P; Budzak, James; Poortinga, Gretchen; Hannan, Kate; Hannan, Ross D; Rudenko, Gloria


    Trypanosoma brucei relies on an essential Variant Surface Glycoprotein (VSG) coat for survival in the mammalian bloodstream. High VSG expression within an expression site body (ESB) is mediated by RNA polymerase I (Pol I), which in other eukaryotes exclusively transcribes ribosomal RNA genes (rDNA). As T. brucei is reliant on Pol I for VSG transcription, we investigated Pol I transcription inhibitors for selective anti-trypanosomal activity. The Pol I inhibitors quarfloxin (CX-3543), CX-5461, and BMH-21 are currently under investigation for treating cancer, as rapidly dividing cancer cells are particularly dependent on high levels of Pol I transcription compared with nontransformed cells. In T. brucei all three Pol I inhibitors have IC50 concentrations for cell proliferation in the nanomolar range: quarfloxin (155 nM), CX-5461 (279 nM) or BMH-21 (134 nM) compared with IC50 concentrations in the MCF10A human breast epithelial cell line (4.44 μM, 6.89 μM or 460 nM, respectively). T. brucei was therefore 29-fold more sensitive to quarfloxin, 25-fold more sensitive to CX-5461 and 3.4-fold more sensitive to BMH-21. Cell death in T. brucei was due to rapid inhibition of Pol I transcription, as within 15 minutes treatment with the inhibitors rRNA precursor transcript was reduced 97-98% and VSG precursor transcript 91-94%. Incubation with Pol I transcription inhibitors also resulted in disintegration of the ESB as well as the nucleolus subnuclear structures, within one hour. Rapid ESB loss following the block in Pol I transcription argues that the ESB is a Pol I transcription nucleated structure, similar to the nucleolus. In addition to providing insight into Pol I transcription and ES control, Pol I transcription inhibitors potentially also provide new approaches to treat trypanosomiasis.

  2. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.


    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  3. E. coli 6S RNA: a universal transcriptional regulator within the centre of growth adaptation.


    Geissen, René; Steuten, Benedikt; Polen, Tino; Wagner, Rolf


    Bacterial 6S RNA has been shown to bind with high affinity to σ(70)-containing RNA polymerase, suppressing σ(70)-dependent transcription during stationary phase, when 6S RNA concentrations are highest. We recently reported a genome-wide transcriptional comparison of wild-type and 6S RNA deficient E. coli strains. Contrary to the expected σ(70)- and stationary phase-specific regulatory effect of 6S RNA it turned out that mRNA levels derived from many alternative sigma factors, including σ(38) or σ(32), were affected during exponential and stationary growth. Among the most noticeably down-regulated genes at stationary growth are ribosomal proteins and factors involved in translation. In addition, a striking number of mRNA levels coding for enzymes involved in the purine metabolism, for transporters and stress regulators are altered both during log- and stationary phase. During the study we discovered a link between 6S RNA and the general stress alarmone ppGpp, which has a higher basal level in cells deficient in 6S RNA. This finding points to a functional interrelation of 6S RNA and the global network of stress and growth adaptation.

  4. The identification of a novel role for BRCA1 in regulating RNA polymerase I transcription

    PubMed Central

    Johnston, Rebecca; D'Costa, Zenobia; Ray, Swagat; Gorski, Julia; Harkin, D. Paul; Mullan, Paul; Panov, Konstantin I.


    The unrestrained proliferation of cancer cells requires a high level of ribosome biogenesis. The first stage of ribosome biogenesis is the transcription of the large ribosomal RNAs (rRNAs); the structural and functional components of the ribosome. Transcription of rRNA is carried out by RNA polymerase I (Pol-I) and its associated holoenzyme complex. Here we report that BRCA1, a nuclear phosphoprotein, and a known tumour suppressor involved in variety of cellular processes such as DNA damage response, transcriptional regulation, cell cycle control and ubiquitylation, is associated with rDNA repeats, in particular with the regulatory regions of the rRNA gene. We demonstrate that BRCA1 interacts directly with the basal Pol-I transcription factors; upstream binding factor (UBF), selectivity factor-1 (SL1) as well as interacting with RNA Pol-I itself. We show that in response to DNA damage, BRCA1 occupancy at the rDNA repeat is decreased and the observed BRCA1 interactions with the Pol-I transcription machinery are weakened. We propose, therefore, that there is a rDNA associated fraction of BRCA1 involved in DNA damage dependent regulation of Pol-I transcription, regulating the stability and formation of the Pol-I holoenzyme during initiation and/or elongation in response to DNA damage. PMID:27589844

  5. An RNA motif advances transcription by preventing Rho-dependent termination

    PubMed Central

    Sevostyanova, Anastasia; Groisman, Eduardo A.


    The transcription termination factor Rho associates with most nascent bacterial RNAs as they emerge from RNA polymerase. However, pharmacological inhibition of Rho derepresses only a small fraction of these transcripts. What, then, determines the specificity of Rho-dependent transcription termination? We now report the identification of a Rho-antagonizing RNA element (RARE) that hinders Rho-dependent transcription termination. We establish that RARE traps Rho in an inactive complex but does not prevent Rho binding to its recruitment sites. Although translating ribosomes normally block Rho access to an mRNA, inefficient translation of an open reading frame in the leader region of the Salmonella mgtCBR operon actually enables transcription of its associated coding region by favoring an RNA conformation that sequesters RARE. The discovery of an RNA element that inactivates Rho signifies that the specificity of nucleic-acid binding proteins is defined not only by the sequences that recruit these proteins but also by sequences that antagonize their activity. PMID:26630006

  6. Possible Formation of Mitochondrial-RNA Containing Chimeric or Trimeric RNA Implies a Post-Transcriptional and Post-Splicing Mechanism for RNA Fusion

    PubMed Central

    Yang, Wei; Wu, Jian-min; Bi, An-ding; Ou-yang, Yong-chang; Shen, Hai-hong; Chirn, Gung-wei; Zhou, Jian-hua; Weiss, Emily; Holman, Emily Pauline; Liao, D. Joshua


    Human cells are known to express many chimeric RNAs, i.e. RNAs containing two genes' sequences. Wondering whether there also is trimeric RNA, i.e. an RNA containing three genes' sequences, we wrote simple computer code to screen human expression sequence tags (ESTs) deposited in different public databases, and obtained hundreds of putative trimeric ESTs. We then used NCBI Blast and UCSC Blat browsers to further analyze their sequences, and identified 61 trimeric and two tetrameric ESTs (one EST containing four different sequences). We also identified 57 chimeric, trimeric or teterameric ESTs that contained both mitochondrial (mt) RNA and nuclear RNA (nRNA), i.e. were mtRNA-nRNA fusions. In some trimeric ESTs, the downstream partner was fused to the poly-A tail of the upstream partner, which, together with the mtRNA-nRNA fusions, suggests a possible new mechanism for RNA fusion that occurs after both transcription and splicing have been terminated, and possibly outside the nucleus, in contrast to the two current hypothetical mechanisms, trans-splicing and transcriptional-slippage, that occur in the nucleus. The mt-sequences in the mtRNA-nRNA fusions had pseudogenes in the nucleus but, surprisingly, localized mainly in chromosomes 1 and 5. In some mtRNA-nRNA fusions, as well as in some ESTs that were derived only from mtRNA, the mt-sequences might be cis- or trans-spliced. Actually, we cloned a new cis-spliced mtRNA, coined as 16SrRNA-s. Hence, mtDNA may not always be intron-less. Fusion of three or more RNAs to one, fusion of nRNA to mtRNA, and cis- or trans-splicing of mtRNA should all enlarge the cellular RNA repertoire, in turn enlarging the cellular functions. Therefore, future experimental verification of the existence of these novel classes of fusion RNAs and spliced mtRNAs in human cells should significantly advance our understanding of biology and medicine. PMID:24204722

  7. Possible formation of mitochondrial-RNA containing chimeric or trimeric RNA implies a post-transcriptional and post-splicing mechanism for RNA fusion.


    Yang, Wei; Wu, Jian-min; Bi, An-ding; Ou-Yang, Yong-chang; Shen, Hai-hong; Chirn, Gung-wei; Zhou, Jian-hua; Weiss, Emily; Holman, Emily Pauline; Liao, D Joshua


    Human cells are known to express many chimeric RNAs, i.e. RNAs containing two genes' sequences. Wondering whether there also is trimeric RNA, i.e. an RNA containing three genes' sequences, we wrote simple computer code to screen human expression sequence tags (ESTs) deposited in different public databases, and obtained hundreds of putative trimeric ESTs. We then used NCBI Blast and UCSC Blat browsers to further analyze their sequences, and identified 61 trimeric and two tetrameric ESTs (one EST containing four different sequences). We also identified 57 chimeric, trimeric or teterameric ESTs that contained both mitochondrial (mt) RNA and nuclear RNA (nRNA), i.e. were mtRNA-nRNA fusions. In some trimeric ESTs, the downstream partner was fused to the poly-A tail of the upstream partner, which, together with the mtRNA-nRNA fusions, suggests a possible new mechanism for RNA fusion that occurs after both transcription and splicing have been terminated, and possibly outside the nucleus, in contrast to the two current hypothetical mechanisms, trans-splicing and transcriptional-slippage, that occur in the nucleus. The mt-sequences in the mtRNA-nRNA fusions had pseudogenes in the nucleus but, surprisingly, localized mainly in chromosomes 1 and 5. In some mtRNA-nRNA fusions, as well as in some ESTs that were derived only from mtRNA, the mt-sequences might be cis- or trans-spliced. Actually, we cloned a new cis-spliced mtRNA, coined as 16SrRNA-s. Hence, mtDNA may not always be intron-less. Fusion of three or more RNAs to one, fusion of nRNA to mtRNA, and cis- or trans-splicing of mtRNA should all enlarge the cellular RNA repertoire, in turn enlarging the cellular functions. Therefore, future experimental verification of the existence of these novel classes of fusion RNAs and spliced mtRNAs in human cells should significantly advance our understanding of biology and medicine.

  8. Development, Evaluation, and Standardization of a Real-Time TaqMan Reverse Transcription-PCR Assay for Quantification of Hepatitis A Virus in Clinical and Shellfish Samples

    PubMed Central

    Costafreda, M. Isabel; Bosch, Albert; Pintó, Rosa M.


    A standardized real-time reverse transcription-PCR (RT-PCR) assay has been developed for an accurate estimation of the number of genome copies of hepatitis A virus (HAV) in clinical and shellfish samples. Real-time procedures were based on the amplification of a fragment of the highly conserved 5′ noncoding region and detection through an internal fluorescent probe, including TaqMan and beacon chemistries, in one- and two-step RT-PCR formats. The best performance in terms of sensitivity and reproducibility was achieved by a one-step TaqMan RT-PCR, with a sensitivity enabling the detection of 0.05 infectious unit and 10 copies of a single-stranded RNA (ssRNA) synthetic transcript. Standard reagents, such as a mengovirus strain and an ssRNA transcript, were employed as controls of nucleic acid extraction and RT-PCR, respectively. The test proved to be highly specific after a broad panel of enteric viruses was tested. Sequence alignment of target regions of the primers and probe proved them to be adequate for the quantification of all HAV genotypes. In addition, a quasispecies analysis of the mutant spectrum indicated that these regions are not prone to variability, thus confirming their robustness. PMID:16751488

  9. mRNA-specific reverse transcription-polymerase chain reaction from human tissue extracts.


    Hurteau, Gregory J; Spivack, Simon D


    Reverse transcription-polymerase chain reaction (RT-PCR) has become the method of choice for detection of mRNA transcripts, including those of low abundance obtained from small precious samples of human tissue. A major confounding problem for standard reverse-transcription-priming strategies is the presence of contaminating genomic DNA (gDNA) carried over from the original "RNA" extract into the RT and PCR steps. The contaminating gDNA contains a processed pseudogene sequence-which lacks introns but contains a poly(A) tail-for commonly studied internal reference genes beta-actin and GAPDH, and target genes GSTM1, GSTP1, and others. These pseudogene sequences therefore confound standard-design "RNA-specific" PCR primer pairs which rely, for cDNA versus gDNA specificity, on the pair-spanning introns, or one of the individual primer oligos spanning an exon/exon splice site, because these features are lacking in processed pseudogene sequences. The result is false RT-PCR positives for these "housekeeper" genes in total RNA extracts; the gDNA processed pseudogene is mistaken for mRNA gene transcript. A universal RT primer has been designed that targets the poly(A) tail of mRNA and adds a unique tag sequence not otherwise existing in the human genome. Genomic DNA does not incorporate this RT-inserted unique tag. PCR is then performed using a transcript-specific forward primer and a reverse primer that is identical to the unique tag incorporated at RT. Only cDNA made with this RT primer is compatible with this reverse PCR primer, thus eliminating confounding signal from contaminating gDNA. This method performs RNA-specific qualitative and quantitative evaluation of gene expression, while preserving the sensitivity of standard RT-PCR techniques. Applications to low-copy transcripts in human samples are demonstrated.

  10. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3.

    PubMed Central

    Wang, X W; Forrester, K; Yeh, H; Feitelson, M A; Gu, J R; Harris, C C


    Chronic active hepatitis caused by infection with hepatitis B virus, a DNA virus, is a major risk factor for human hepatocellular carcinoma. Since the oncogenicity of several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene products, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX complexes with the wild-type p53 protein and inhibits its sequence-specific DNA binding in vitro. HBX expression also inhibits p53-mediated transcriptional activation in vivo and the in vitro association of p53 and ERCC3, a general transcription factor involved in nucleotide excision repair. Therefore, HBX may affect a wide range of p53 functions and contribute to the molecular pathogenesis of human hepatocellular carcinoma. Images PMID:8134379

  11. Rescue of Mtp siRNA-induced hepatic steatosis by DGAT2 siRNA silencing[S

    PubMed Central

    Tep, Samnang; Mihaila, Radu; Freeman, Alexander; Pickering, Victoria; Huynh, Felicia; Tadin-Strapps, Marija; Stracks, Allison; Hubbard, Brian; Caldwell, Jeremy; Flanagan, W. Michael; Kuklin, Nelly A.; Ason, Brandon


    Microsomal triglyceride transfer protein (Mtp) inhibitors represent a novel therapeutic approach to lower circulating LDL cholesterol, although therapeutic development has been hindered by the observed increase in hepatic triglycerides and liver steatosis following treatment. Here, we used small interfering RNAs (siRNA) targeting Mtp to achieve target-specific silencing to study this phenomenon and to determine to what extent liver steatosis is induced by changes in Mtp expression. We observed that Mtp silencing led to a decrease in many genes involved in hepatic triglyceride synthesis. Given the role of diacylglycerol O-acyltransferase 2 (Dgat2) in regulating hepatic triglyceride synthesis, we then evaluated whether target-specific silencing of both Dgat2 and Mtp were sufficient to attenuate Mtp silencing-induced liver steatosis. We showed that the simultaneous inhibition of Dgat2 and Mtp led to a decrease in plasma cholesterol and a reduction in the accumulation of hepatic triglycerides caused by the inhibition of Mtp. Collectively, these findings provide a proof-of-principle for a triglyceride synthesis/Mtp inhibitor combination and represent a potentially novel approach for therapeutic development in which targeting multiple pathways can achieve the desired response. PMID:22355095

  12. Hepatitis


    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Hepatitis KidsHealth > For Teens > Hepatitis Print A A A ... to a liver condition called hepatitis . What Is Hepatitis? The liver is one of the body's powerhouses. ...

  13. Hepatitis


    ... de los dientes Video: Getting an X-ray Hepatitis KidsHealth > For Kids > Hepatitis Print A A A ... an important digestive liquid called bile . What Is Hepatitis? Hepatitis is an inflammation (say: in-fluh-MAY- ...

  14. RNA-Seq profiling of single bovine oocyte transcript abundance and its modulation by cytoplasmic polyadenylation

    PubMed Central

    Reyes, Juan M; Chitwood, James L; Ross, Pablo J


    Molecular changes occurring during mammalian oocyte maturation are partly regulated by cytoplasmic polyadenylation (CP) and affect oocyte quality, yet the extent of CP activity during oocyte maturation remains unknown. Single bovine oocyte RNA sequencing (RNA-Seq) was performed to examine changes in transcript abundance during in vitro oocyte maturation in cattle. Polyadenylated RNA from individual germinal-vesicle and metaphase-II oocytes was amplified and processed for Illumina sequencing, producing approximately 30 million reads per replicate for each sample type. A total of 10,494 genes were found to be expressed, of which 2,455 were differentially expressed (adjusted P<0.05 and fold change >2) between stages, with 503 and 1,952 genes respectively increasing and decreasing in abundance. Differentially expressed genes with complete 3’-untranslated-region sequence (279 increasing and 918 decreasing in polyadenylated transcript abundance) were examined for the presence, position, and distribution of motifs mediating CP, revealing enrichment (85%) and lack there of (18%) in up- and down-regulated genes, respectively. Examination of total and polyadenylated RNA abundance by quantitative PCR validated these RNA-Seq findings. The observed increases in polyadenylated transcript abundance within the RNA-Seq data are likely due to CP, providing novel insight into targeted transcripts and resultant differential gene expression profiles that contribute to oocyte maturation. PMID:25560149

  15. RNA-Seq profiling of single bovine oocyte transcript abundance and its modulation by cytoplasmic polyadenylation.


    Reyes, Juan M; Chitwood, James L; Ross, Pablo J


    Molecular changes occurring during mammalian oocyte maturation are partly regulated by cytoplasmic polyadenylation (CP) and affect oocyte quality, yet the extent of CP activity during oocyte maturation remains unknown. Single bovine oocyte RNA sequencing (RNA-Seq) was performed to examine changes in transcript abundance during in vitro oocyte maturation in cattle. Polyadenylated RNA from individual germinal-vesicle and metaphase-II oocytes was amplified and processed for Illumina sequencing, producing approximately 30 million reads per replicate for each sample type. A total of 10,494 genes were found to be expressed, of which 2,455 were differentially expressed (adjusted P < 0.05 and fold change >2) between stages, with 503 and 1,952 genes respectively increasing and decreasing in abundance. Differentially expressed genes with complete 3'-untranslated-region sequence (279 increasing and 918 decreasing in polyadenylated transcript abundance) were examined for the presence, position, and distribution of motifs mediating CP, revealing enrichment (85%) and lack thereof (18%) in up- and down-regulated genes, respectively. Examination of total and polyadenylated RNA abundance by quantitative PCR validated these RNA-Seq findings. The observed increases in polyadenylated transcript abundance within the RNA-Seq data are likely due to CP, providing novel insight into targeted transcripts and resultant differential gene expression profiles that contribute to oocyte maturation.

  16. Active transcription and essential role of RNA polymerase II at the centromere during mitosis

    PubMed Central

    Chan, F. Lyn; Marshall, Owen J.; Saffery, Richard; Won Kim, Bo; Earle, Elizabeth; Choo, K. H. Andy; Wong, Lee H.


    Transcription of the centromeric regions has been reported to occur in G1 and S phase in different species. Here, we investigate whether transcription also occurs and plays a functional role at the mammalian centromere during mitosis. We show the presence of actively transcribing RNA polymerase II (RNAPII) and its associated transcription factors, coupled with the production of centromere satellite transcripts at the mitotic kinetochore. Specific inhibition of RNAPII activity during mitosis leads to a decrease in centromeric α-satellite transcription and a concomitant increase in anaphase-lagging cells, with the lagging chromosomes showing reduced centromere protein C binding. These findings demonstrate an essential role of RNAPII in the transcription of α-satellite DNA, binding of centromere protein C, and the proper functioning of the mitotic kinetochore. PMID:22308327

  17. Transforming growth factor β-activated kinase 1 transcriptionally suppresses hepatitis B virus replication

    PubMed Central

    Pang, Jinke; Zhang, Geng; Lin, Yong; Xie, Zhanglian; Liu, Hongyan; Tang, Libo; Lu, Mengji; Yan, Ran; Guo, Haitao; Sun, Jian; Hou, Jinlin; Zhang, Xiaoyong


    Hepatitis B Virus (HBV) replication in hepatocytes is restricted by the host innate immune system and related intracellular signaling pathways. Transforming growth factor β-activated kinase 1 (TAK1) is a key mediator of toll-like receptors and pro-inflammatory cytokine signaling pathways. Here, we report that silencing or inhibition of endogenous TAK1 in hepatoma cell lines leads to an upregulation of HBV replication, transcription, and antigen expression. In contrast, overexpression of TAK1 significantly suppresses HBV replication, while an enzymatically inactive form of TAK1 exerts no effect. By screening TAK1-associated signaling pathways with inhibitors and siRNAs, we found that the MAPK-JNK pathway was involved in TAK1-mediated HBV suppression. Moreover, TAK1 knockdown or JNK pathway inhibition induced the expression of farnesoid X receptor α, a transcription factor that upregulates HBV transcription. Finally, ectopic expression of TAK1 in a HBV hydrodynamic injection mouse model resulted in lower levels of HBV DNA and antigens in both liver and serum. In conclusion, our data suggest that TAK1 inhibits HBV primarily at viral transcription level through activation of MAPK-JNK pathway, thus TAK1 represents an intrinsic host restriction factor for HBV replication in hepatocytes. PMID:28045080

  18. Quantification of C4d deposition and hepatitis C virus RNA in tissue in cases of graft rejection and hepatitis C recurrence after liver transplantation

    PubMed Central

    Song, Alice Tung Wan; de Mello, Evandro Sobroza; Alves, Venâncio Avancini Ferreira; Cavalheiro, Norma de Paula; Melo, Carlos Eduardo; Bonazzi, Patricia Rodrigues; Tengan, Fatima Mitiko; Freire, Maristela Pinheiro; Barone, Antonio Alci; D'Albuquerque, Luiz Augusto Carneiro; Abdala, Edson


    Histology is the gold standard for diagnosing acute rejection and hepatitis C recurrence after liver transplantation. However, differential diagnosis between the two can be difficult. We evaluated the role of C4d staining and quantification of hepatitis C virus (HCV) RNA levels in liver tissue. This was a retrospective study of 98 liver biopsy samples divided into four groups by histological diagnosis: acute rejection in patients undergoing liver transplant for hepatitis C (RejHCV+), HCV recurrence in patients undergoing liver transplant for hepatitis C (HCVTx+), acute rejection in patients undergoing liver transplant for reasons other than hepatitis C and chronic hepatitis C not transplanted (HCVTx-). All samples were submitted for immunohistochemical staining for C4d and HCV RNA quantification. Immunoexpression of C4d was observed in the portal vessels and was highest in the HCVTx- group. There was no difference in C4d expression between the RejHCV+ and HCVTx+ groups. However, tissue HCV RNA levels were higher in the HCVTx+ group samples than in the RejHCV+ group samples. Additionally, there was a significant correlation between tissue and serum levels of HCV RNA. The quantification of HCV RNA in liver tissue might prove to be an efficient diagnostic test for the recurrence of HCV infection. PMID:25742264

  19. An interdomain RNA binding site on the hepadnaviral polymerase that is essential for reverse transcription.


    Badtke, Matthew P; Khan, Irfan; Cao, Feng; Hu, Jianming; Tavis, John E


    The T3 motif on the duck hepatitis B virus reverse transcriptase (P) is proposed to be a binding site essential for viral replication, but its ligand and roles in DNA synthesis are unknown. Here, we found that T3 is needed for P to bind the viral RNA, the first step in DNA synthesis. A second motif, RT-1, was predicted to assist T3. T3 and RT-1 appear to form a composite RNA binding site because mutating T3 and RT-1 had similar effects on RNA binding, exposure of antibody epitopes on P, and DNA synthesis. The T3 and RT-1 motifs bound RNA non-specifically, yet they were essential for specific interactions between P and the viral RNA. This implies that specificity for the viral RNA is provided by a post-binding step. The T3:RT-1 motifs are conserved with the human hepatitis B virus and may be an attractive target for novel antiviral drug development.

  20. Stemness-Related Transcriptional Factors and Homing Gene Expression Profiles in Hepatic Differentiation and Cancer

    PubMed Central

    Toraih, Eman A; Fawzy, Manal S; El-Falouji, Abdullah I; Hamed, Elham O; Nemr, Nader A; Hussein, Mohammad H; Fadeal, Noha M Abd El


    Stem cell transcriptional signature activation is an essential event in the development of cancer. This study aimed to investigate the differential expression profiles of three pluripotency-associated genes, OCT4, NANOG and SOX2, G-protein-coupled chemokine receptor 4 (CXCR4) and the ligand CXCL2, and alpha-fetoprotein (AFP) in hepatogenic differentiated stem cells and in sera of hepatitis C virus (HCV) and HCV-induced hepatocellular carcinoma (HCC) patients. Mesenchymal stem cells derived from umbilical cord blood were differentiated using hepatogenic differentiation media. Serum specimens were collected from 96 patients (32 cirrhotic HCV, 32 early HCC and 32 late HCC) and 96 controls. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed for relative quantification of the six target genes using the Livak method. In silico network analysis was also executed to explore the pluripotency and tumorigenetic regulatory circuits in liver cancer. The expression levels of all genes declined gradually during the stages of stem cell differentiation. On univariate and multivariate analyses, NANOG, CXCR4 and AFP were significantly upregulated in late clinical stage HCC patients. In contrast, SOX2 and CXCL2 were markedly overexpressed in cirrhotic patients and could be used for clear demarcation between cirrhotic and HCC patients in our cases. In conclusion, our data highlight the potential role of the SOX2 stem cell marker and CXCL2 chemokine in liver cell degeneration and fibrogenesis in HCV-induced hepatic cirrhosis in our sample of the Egyptian population. In addition, the significant association of NANOG and CXCR4 high expression with late HCC could contribute to the acquisition of stem cell–like properties in hepatic cancer and dissemination in late stages, respectively. Taken together, our results could have potential application in HCC prognosis and treatment. PMID:27623812

  1. Natural Antisense Transcripts and Long Non-Coding RNA in Neurospora crassa

    PubMed Central

    Arthanari, Yamini; Heintzen, Christian; Griffiths-Jones, Sam; Crosthwaite, Susan K.


    The prevalence of long non-coding RNAs (lncRNA) and natural antisense transcripts (NATs) has been reported in a variety of organisms. While a consensus has yet to be reached on their global importance, an increasing number of examples have been shown to be functional, regulating gene expression at the transcriptional and post-transcriptional level. Here, we use RNA sequencing data from the ABI SOLiD platform to identify lncRNA and NATs obtained from samples of the filamentous fungus Neurospora crassa grown under different light and temperature conditions. We identify 939 novel lncRNAs, of which 477 are antisense to annotated genes. Across the whole dataset, the extent of overlap between sense and antisense transcripts is large: 371 sense/antisense transcripts are complementary over 500 nts or more and 236 overlap by more than 1000 nts. Most prevalent are 3′ end overlaps between convergently transcribed sense/antisense pairs, but examples of divergently transcribed pairs and nested transcripts are also present. We confirm the expression of a subset of sense/antisense transcript pairs by qPCR. We examine the size, types of overlap and expression levels under the different environmental stimuli of light and temperature, and identify 11 lncRNAs that are up-regulated in response to light. We also find differences in transcript length and the position of introns between protein-coding transcripts that have antisense expression and transcripts with no antisense expression. These results demonstrate the ability of N. crassa lncRNAs and NATs to be regulated by different environmental stimuli and provide the scope for further investigation into the function of NATs. PMID:24621812

  2. A Robust Method for Transcript Quantification with RNA-Seq Data

    PubMed Central

    Huang, Yan; Hu, Yin; Jones, Corbin D.; MacLeod, James N.; Chiang, Derek Y.; Liu, Yufeng; Prins, Jan F.


    Abstract The advent of high throughput RNA-seq technology allows deep sampling of the transcriptome, making it possible to characterize both the diversity and the abundance of transcript isoforms. Accurate abundance estimation or transcript quantification of isoforms is critical for downstream differential analysis (e.g., healthy vs. diseased cells) but remains a challenging problem for several reasons. First, while various types of algorithms have been developed for abundance estimation, short reads often do not uniquely identify the transcript isoforms from which they were sampled. As a result, the quantification problem may not be identifiable, i.e., lacks a unique transcript solution even if the read maps uniquely to the reference genome. In this article, we develop a general linear model for transcript quantification that leverages reads spanning multiple splice junctions to ameliorate identifiability. Second, RNA-seq reads sampled from the transcriptome exhibit unknown position-specific and sequence-specific biases. We extend our method to simultaneously learn bias parameters during transcript quantification to improve accuracy. Third, transcript quantification is often provided with a candidate set of isoforms, not all of which are likely to be significantly expressed in a given tissue type or condition. By resolving the linear system with LASSO, our approach can infer an accurate set of dominantly expressed transcripts while existing methods tend to assign positive expression to every candidate isoform. Using simulated RNA-seq datasets, our method demonstrated better quantification accuracy and the inference of dominant set of transcripts than existing methods. The application of our method on real data experimentally demonstrated that transcript quantification is effective for differential analysis of transcriptomes. PMID:23461570

  3. Specific transcription and RNA splicing defects in five cloned beta-thalassaemia genes.


    Treisman, R; Orkin, S H; Maniatis, T


    Transcriptional analysis of five different cloned beta-thalassaemia genes introduced into cultured mammalian cells revealed specific defects in transcription and RNA splicing. A single base change 87 base pairs to the 5' side of the mRNA cap site significantly lowers the level of transcription and therefore appears to represent a promoter mutation. Three genes contain different single base changes in the first intervening sequence (IVS) 5' splice site. One mutation, at IVS1 position 1, inactivates the splice site completely; the other two, at IVS1 positions 5 and 6, reduce its activity. Each mutation activates the same three cryptic splice sites. The fifth gene contains a single base change within IVS2 at position 745, which results in the formation of abnormal beta-globin RNA that contains an extra exon.

  4. Definition of global and transcript-specific mRNA export pathways in metazoans.


    Farny, Natalie G; Hurt, Jessica A; Silver, Pamela A


    Eukaryotic gene expression requires export of messenger RNAs (mRNAs) from their site of transcription in the nucleus to the cytoplasm where they are translated. While mRNA export has been studied in yeast, the complexity of gene structure and cellular function in metazoan cells has likely led to increased diversification of these organisms' export pathways. Here we report the results of a genome-wide RNAi screen in which we identify 72 factors required for polyadenylated [poly-(A(+))] mRNA export from the nucleus in Drosophila cells. Using structural and functional conservation analysis of yeast and Drosophila mRNA export factors, we expose the evolutionary divergence of eukaryotic mRNA export pathways. Additionally, we demonstrate the differential export requirements of two endogenous heat-inducible transcripts--intronless heat-shock protein 70 (HSP70) and intron-containing HSP83--and identify novel export factors that participate in HSP83 mRNA splicing. We characterize several novel factors and demonstrate their participation in interactions with known components of the Drosophila export machinery. One of these factors, Drosophila melanogaster PCI domain-containing protein 2 (dmPCID2), associates with polysomes and may bridge the transition between exported messenger ribonucleoprotein particles (mRNPs) and polysomes. Our results define the global network of factors involved in Drosophila mRNA export, reveal specificity in the export requirements of different transcripts, and expose new avenues for future work in mRNA export.

  5. Ccr4-Not Regulates RNA Polymerase I Transcription and Couples Nutrient Signaling to the Control of Ribosomal RNA Biogenesis

    PubMed Central

    Laribee, R. Nicholas; Hosni-Ahmed, Amira; Workman, Jason J.; Chen, Hongfeng


    Ribosomal RNA synthesis is controlled by nutrient signaling through the mechanistic target of rapamycin complex 1 (mTORC1) pathway. mTORC1 regulates ribosomal RNA expression by affecting RNA Polymerase I (Pol I)-dependent transcription of the ribosomal DNA (rDNA) but the mechanisms involved remain obscure. This study provides evidence that the Ccr4-Not complex, which regulates RNA Polymerase II (Pol II) transcription, also functions downstream of mTORC1 to control Pol I activity. Ccr4-Not localizes to the rDNA and physically associates with the Pol I holoenzyme while Ccr4-Not disruption perturbs rDNA binding of multiple Pol I transcriptional regulators including core factor, the high mobility group protein Hmo1, and the SSU processome. Under nutrient rich conditions, Ccr4-Not suppresses Pol I initiation by regulating interactions with the essential transcription factor Rrn3. Additionally, Ccr4-Not disruption prevents reduced Pol I transcription when mTORC1 is inhibited suggesting Ccr4-Not bridges mTORC1 signaling with Pol I regulation. Analysis of the non-essential Pol I subunits demonstrated that the A34.5 subunit promotes, while the A12.2 and A14 subunits repress, Ccr4-Not interactions with Pol I. Furthermore, ccr4Δ is synthetically sick when paired with rpa12Δ and the double mutant has enhanced sensitivity to transcription elongation inhibition suggesting that Ccr4-Not functions to promote Pol I elongation. Intriguingly, while low concentrations of mTORC1 inhibitors completely inhibit growth of ccr4Δ, a ccr4Δ rpa12Δ rescues this growth defect suggesting that the sensitivity of Ccr4-Not mutants to mTORC1 inhibition is at least partially due to Pol I deregulation. Collectively, these data demonstrate a novel role for Ccr4-Not in Pol I transcriptional regulation that is required for bridging mTORC1 signaling to ribosomal RNA synthesis. PMID:25815716

  6. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    PubMed Central

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.


    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  7. Acetylation of RNA polymerase II regulates growth-factor-induced gene transcription in mammalian cells.


    Schröder, Sebastian; Herker, Eva; Itzen, Friederike; He, Daniel; Thomas, Sean; Gilchrist, Daniel A; Kaehlcke, Katrin; Cho, Sungyoo; Pollard, Katherine S; Capra, John A; Schnölzer, Martina; Cole, Philip A; Geyer, Matthias; Bruneau, Benoit G; Adelman, Karen; Ott, Melanie


    Lysine acetylation regulates transcription by targeting histones and nonhistone proteins. Here we report that the central regulator of transcription, RNA polymerase II, is subject to acetylation in mammalian cells. Acetylation occurs at eight lysines within the C-terminal domain (CTD) of the largest polymerase subunit and is mediated by p300/KAT3B. CTD acetylation is specifically enriched downstream of the transcription start sites of polymerase-occupied genes genome-wide, indicating a role in early stages of transcription initiation or elongation. Mutation of lysines or p300 inhibitor treatment causes the loss of epidermal growth-factor-induced expression of c-Fos and Egr2, immediate-early genes with promoter-proximally paused polymerases, but does not affect expression or polymerase occupancy at housekeeping genes. Our studies identify acetylation as a new modification of the mammalian RNA polymerase II required for the induction of growth factor response genes.

  8. RNA editing of androgen receptor gene transcripts in prostate cancer cells.


    Martinez, Harryl D; Jasavala, Rohini J; Hinkson, Izumi; Fitzgerald, Latricia D; Trimmer, James S; Kung, Hsing-Jien; Wright, Michael E


    Reactivation of the androgen receptor (AR) signaling pathway represents a critical step in the growth and survival of androgen-independent (AI) prostate cancer (CaP). In this study we show the DU145 and PC3 AI human CaP cell lines respond to androgens and require AR expression for optimal proliferation in vitro. Interestingly, AR gene transcripts in DU145 and PC3 cells harbored a large number of single base pair nucleotide transitions that resulted in missense mutations in selected AR codons. The most notable lesion detected in AR gene transcripts included the oncogenic codon 877T-->A gain-of-function mutation. Surprisingly, AR gene transcript nucleotide transitions were not genome-encoded substitutions, but instead the mutations co-localized to putative A-to-I, U-to-C, C-to-U, and G-to-A RNA editing sites, suggesting the lesions were mediated through RNA editing mechanisms. Higher levels of mRNA encoding the A-to-I RNA editing enzymes ADAR1 and ADARB1 were observed in DU145 and PC3 cells relative to the androgen-responsive LNCaP and 22Rv1 human CaP cell lines, which correlated with higher levels of AR gene transcript A-to-I editing detected in DU145 and PC3 cells. Our results suggest that AR gene transcripts are targeted by different RNA editing enzymes in DU145 and PC3 cells. Thus RNA editing of AR gene transcripts may contribute to the etiology of hormone-refractory phenotypes in advanced stage AI CaP.

  9. The function of MicroRNA in hepatitis B virus-related liver diseases: from Dim to Bright.


    Yu, Kangkang; Shi, Guangfeng; Li, Ning


    MicroRNAs represent a class of non-coding RNA molecules that negatively regulate gene expression either by repressing translation or by inducing degradation of messenger RNA. Studies have shown that, as regulators of gene expression, microRNAs are widely involved in various human diseases, including hepatitis B virus-related liver diseases. By modulating hepatitis B virus replication, regulating extracellular matrix formation, as well as silencing tumor suppressor genes, these small molecules are implicated in the development of chronic hepatitis, liver fibrosis/cirrhosis, and hepatocellular carcinoma caused by hepatitis B virus infection. In addition, current researches indicated a potential role of microRNA as diagnostic markers and therapeutic targets. In conclusion, microRNAs are promising tools in the diagnosis and treatment of hepatitis B virus -related liver diseases.

  10. Differential transcription of multiple copies of a silk worm gene encoding tRNA(Gly1).


    Fournier, A; Taneja, R; Gopalkrishnan, R; Prudhomme, J C; Gopinathan, K P


    Ten different tRNA(Gly1) genes from the silk worm, Bombyx mori, have been cloned and characterized. These genes were transcribed in vitro in homologous nuclear extracts from the posterior silk gland (PSG) or nuclear extracts derived from the middle silk gland or ovarian tissues. Although the transcription levels were much higher in the PSG nuclear extracts, the transcriptional efficiency of the individual genes followed a similar pattern in all the extracts. Based on the levels of in vitro transcription, the ten tRNA(Gly1) genes could be divided into three groups, viz., those which were transcribed at very high levels (e.g., clone pR8), high to medium levels (e.g., pBmi1, pBmp1, pBmh1, pBmt1) and low to barely detectable levels (e.g., pBms1, pBmj1 and pBmk1). The coding sequences of all these tRNA genes being identical, the differential transcription suggested that the flanking sequences modulate their transcriptional efficiency. The presence of positive and negative regulatory elements in the 5' flanking regions of these genes was confirmed by transcription competition experiments. A positive element was present in the immediate upstream A+T-rich sequences in all the genes, but no consensus sequences correlating to the transcriptional status could be generated. The presence of negative elements on the other hand was indicated only in some of the genes and therefore may have a role in the differential transcription of these tRNA(Gly1) genes in vivo.

  11. The Paf1 Complex: Platform or Player in RNA Polymerase II Transcription?

    PubMed Central

    Jaehning, Judith A.


    The Paf1 complex (Paf1C), composed of the proteins Paf1, Ctr9, Cdc73, Rtf1, and Leo1, accompanies RNA polymerase II (pol II) from the promoter to the 3' end formation site of mRNA and snoRNA encoding genes; it is also found associated with RNA polymerase I (pol I) on rDNA. The Paf1C is found in simple and complex eukaryotes; in human cells hSki8 is also part of the complex. The Paf1C has been linked to a large and growing list of transcription related processes including: communication with transcriptional activators; recruitment and activation of histone modification factors; facilitation of elongation on chromatin templates; and the recruitment of 3' end processing factors necessary for accurate termination of transcription. Absence of, or mutations in, Paf1C factors result in alterations in gene expression that can result in misregulation of developmental programs and loss of control of cell division leading to cancer in humans. This review considers recent information that may help to resolve whether the Paf1C is primarily a “platform” on pol II that coordinates the association of many critical transcription factors, or if the complex itself plays a more direct role in one or more steps in transcription. PMID:20060942

  12. Genome-wide antisense transcription drives mRNA processing in bacteria

    PubMed Central

    Lasa, Iñigo; Toledo-Arana, Alejandro; Dobin, Alexander; Villanueva, Maite; de los Mozos, Igor Ruiz; Vergara-Irigaray, Marta; Segura, Víctor; Fagegaltier, Delphine; Penadés, José R.; Valle, Jaione; Solano, Cristina; Gingeras, Thomas R.


    RNA deep sequencing technologies are revealing unexpected levels of complexity in bacterial transcriptomes with the discovery of abundant noncoding RNAs, antisense RNAs, long 5′ and 3′ untranslated regions, and alternative operon structures. Here, by applying deep RNA sequencing to both the long and short RNA fractions (<50 nucleotides) obtained from the major human pathogen Staphylococcus aureus, we have detected a collection of short RNAs that is generated genome-wide through the digestion of overlapping sense/antisense transcripts by RNase III endoribonuclease. At least 75% of sense RNAs from annotated genes are subject to this mechanism of antisense processing. Removal of RNase III activity reduces the amount of short RNAs and is accompanied by the accumulation of discrete antisense transcripts. These results suggest the production of pervasive but hidden antisense transcription used to process sense transcripts by means of creating double-stranded substrates. This process of RNase III-mediated digestion of overlapping transcripts can be observed in several evolutionarily diverse Gram-positive bacteria and is capable of providing a unique genome-wide posttranscriptional mechanism to adjust mRNA levels. PMID:22123973

  13. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome

    PubMed Central

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine


    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3′LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5′LTR promoter. PMID:27545598

  14. RNA sequence and transcriptional properties of the 3' end of the Newcastle disease virus genome

    SciTech Connect

    Kurilla, M.G.; Stone, H.O.; Keene, J.D.


    The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminal 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.

  15. The Ess1 prolyl isomerase: Traffic cop of the RNA polymerase II transcription

    PubMed Central

    Hanes, Steven D.


    Ess1 is a prolyl isomerase that regulates the structure and function of eukaryotic RNA polymerase II. Ess1 works by catalyzing the cis/trans conversion of pSer5–Pro6 bonds, and to a lesser extent pSer2–Pro3 bonds, within the carboxy-terminal domain (CTD) of Rpb1, the largest subunit of RNA pol II. Ess1 is conserved in organisms ranging from yeast to humans. In budding yeast, Ess1 is essential for growth and is required for efficient transcription initiation and termination, RNA processing, and suppression of cryptic transcription. In mammals, Ess1 (called Pin1) functions in a variety of pathways, including transcription, but it is not essential. Recent work has shown that Ess1 coordinates the binding and release of CTD-binding proteins that function as co-factors in the RNA pol II complex. In this way, Ess1 plays an integral role in writing (and reading) the so-called CTD code to promote production of mature RNA pol II transcripts including non-coding RNAs and mRNAs. PMID:24530645

  16. Post-transcriptional regulation of satellite cell quiescence by TTP-mediated mRNA decay

    PubMed Central

    Hausburg, Melissa A; Doles, Jason D; Clement, Sandra L; Cadwallader, Adam B; Hall, Monica N; Blackshear, Perry J; Lykke-Andersen, Jens; Olwin, Bradley B


    Skeletal muscle satellite cells in their niche are quiescent and upon muscle injury, exit quiescence, proliferate to repair muscle tissue, and self-renew to replenish the satellite cell population. To understand the mechanisms involved in maintaining satellite cell quiescence, we identified gene transcripts that were differentially expressed during satellite cell activation following muscle injury. Transcripts encoding RNA binding proteins were among the most significantly changed and included the mRNA decay factor Tristetraprolin. Tristetraprolin promotes the decay of MyoD mRNA, which encodes a transcriptional regulator of myogenic commitment, via binding to the MyoD mRNA 3′ untranslated region. Upon satellite cell activation, p38α/β MAPK phosphorylates MAPKAP2 and inactivates Tristetraprolin, stabilizing MyoD mRNA. Satellite cell specific knockdown of Tristetraprolin precociously activates satellite cells in vivo, enabling MyoD accumulation, differentiation and cell fusion into myofibers. Regulation of mRNAs by Tristetraprolin appears to function as one of several critical post-transcriptional regulatory mechanisms controlling satellite cell homeostasis. DOI: PMID:25815583

  17. Upstream Binding of Idling RNA Polymerase Modulates Transcription Initiation from a Nearby Promoter*

    PubMed Central

    Gerganova, Veneta; Maurer, Sebastian; Stoliar, Liubov; Japaridze, Aleksandre; Dietler, Giovanni; Nasser, William; Kutateladze, Tamara; Travers, Andrew; Muskhelishvili, Georgi


    The bacterial gene regulatory regions often demonstrate distinctly organized arrays of RNA polymerase binding sites of ill-defined function. Previously we observed a module of closely spaced polymerase binding sites upstream of the canonical promoter of the Escherichia coli fis operon. FIS is an abundant nucleoid-associated protein involved in adjusting the chromosomal DNA topology to changing cellular physiology. Here we show that simultaneous binding of the polymerase at the canonical fis promoter and an upstream transcriptionally inactive site stabilizes a RNAP oligomeric complex in vitro. We further show that modulation of the upstream binding of RNA polymerase affects the fis promoter activity both in vivo and in vitro. The effect of the upstream RNA polymerase binding on the fis promoter activity depends on the spatial arrangement of polymerase binding sites and DNA supercoiling. Our data suggest that a specific DNA geometry of the nucleoprotein complex stabilized on concomitant binding of RNA polymerase molecules at the fis promoter and the upstream region acts as a topological device regulating the fis transcription. We propose that transcriptionally inactive RNA polymerase molecules can act as accessory factors regulating the transcription initiation from a nearby promoter. PMID:25648898

  18. Distinct transcriptional responses of RNA polymerases I, II and III to aptamers that bind TBP

    PubMed Central

    Fan, Xiaochun; Shi, Hua; Lis, John T.


    The TATA-binding protein (TBP) is a general factor that is involved in transcription by all three types of nuclear RNA polymerase. To delineate the roles played by the DNA-binding surface of TBP in these transcription reactions, we used a set of RNA aptamers directed against TBP and examined their ability to perturb transcription in vitro by the different RNA polymerases. Distinct responses to the TBP aptamers were observed for transcription by different types of polymerase at either the initiation, reinitiation or both stages of the transcription cycle. We further probed the TBP interactions in the TFIIIB•DNA complex to elucidate the mechanism for the different sensitivity of Pol III dependent transcription before and after preinitiation complex (PIC) formation. Lastly, the aptamers were employed to measure the time required for Pol III PIC formation in vitro. This approach can be generalized to define the involvement of a particular region on the surface of a protein at particular stages in a biological process. PMID:15701755

  19. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges

    PubMed Central

    Liu, Libin; Pilch, Paul F


    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae–independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. DOI: PMID:27528195

  20. In vitro transcription of human T-cell leukemia virus type 1 is RNA polymerase II dependent.

    PubMed Central

    Lenzmeier, B A; Nyborg, J K


    The HTLV-1 promoter directs RNA polymerase II transcription of viral genomic RNA in vivo. However, it has been reported that in vitro, a unique RNA polymerase, with characteristics of RNA polymerases II and III, is capable of HTLV-1 transcription (G. Piras, F. Kashanchi, M. F. Radonovich, J. F. Duvall, and J. N. Brady, J. Virol. 68:6170-6179, 1994). To further characterize the polymerase involved in HTLV-1 transcription in vitro, runoff transcription assays were performed with a variety of extracts and RNA polymerase inhibitors. Under all in vitro reaction conditions tested, RNA polymerase II appeared to be the only polymerase capable of correct transcriptional initiation from the HTLV-1 promoter. Synthesis of the specific HTLV-1 RNA transcript showed sensitivities to the RNA polymerase inhibitors tagetitoxin and alpha-amanitin that are consistent with RNA polymerase II transcription. Together, these data indicate that in vitro, as in vivo, the HTLV-1 promoter directs transcription by RNA polymerase II. PMID:9032404

  1. RNA polymerase II subunit RPB3 is an essential component of the mRNA transcription apparatus.

    PubMed Central

    Kolodziej, P; Young, R A


    To improve our understanding of RNA polymerase II, the gene that encodes its third-largest subunit, RPB3, was isolated from a lambda gt11 DNA library by using antibody probes. The RPB3 DNA sequence predicts a 318-amino-acid protein whose sequence was confirmed, in part, by microsequence analysis of the gel-purified RNA polymerase II subunit. RPB3 was found to be an essential single-copy gene that is tightly linked to HIS6 on chromosome IX. An RPB3 temperature-sensitive mutant that arrested growth after three to four generations at the restrictive temperature was isolated. When the mutant was shifted to the restrictive temperature, RNA polymerase II could no longer assemble, previously assembled functional enzyme was depleted, and mRNA levels were consequently reduced. These results demonstrate that RPB3 is an essential component of the mRNA transcription apparatus. Finally, the RPB3 protein is similar in sequence and length to RPC5, a subunit common to RNA polymerases I and III, suggesting that these subunits may play similar roles in RNA polymerases I, II, and III. Images PMID:2685562

  2. Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis.


    Devers, Emanuel A; Branscheid, Anja; May, Patrick; Krajinski, Franziska


    The majority of plants are able to form the arbuscular mycorrhizal (AM) symbiosis in association with AM fungi. During symbiosis development, plant cells undergo a complex reprogramming resulting in profound morphological and physiological changes. MicroRNAs (miRNAs) are important components of the regulatory network of plant cells. To unravel the impact of miRNAs and miRNA-mediated mRNA cleavage on root cell reprogramming during AM symbiosis, we carried out high-throughput (Illumina) sequencing of small RNAs and degradome tags of Medicago truncatula roots. This led to the annotation of 243 novel miRNAs. An increased accumulation of several novel and conserved miRNAs in mycorrhizal roots suggest a role of these miRNAs during AM symbiosis. The degradome analysis led to the identification of 185 root transcripts as mature miRNA and also miRNA*-mediated mRNA cleavage targets. Several of the identified miRNA targets are known to be involved in root symbioses. In summary, the increased accumulation of specific miRNAs and the miRNA-mediated cleavage of symbiosis-relevant genes indicate that miRNAs are an important part of the regulatory network leading to symbiosis development.

  3. Synthetic RNA-cleaving molecules mimicking ribonuclease A active center. Design and cleavage of tRNA transcripts.

    PubMed Central

    Podyminogin, M A; Vlassov, V V; Giegé, R


    RNA cleaving molecules were synthesized by conjugating imidazole residues imitating the essential imidazoles in the active center of pancreatic ribonuclease to an intercalating compound, derivative of phenazine capable of binding to the double stranded regions of polynucleotides. Action of the molecules on tRNA was investigated. It was found, that some of the compounds bearing two imidazole residues cleave tRNA under physiological conditions. The cleavage reaction shows a bell-shaped pH dependence with a maximum at pH 7.0 indicating participation of protonated and non-protonated imidazole residues in the process. Under the conditions stabilizing the tRNA structure, a tRNAAsp transcript was cleaved preferentially at the junctions of the stem and loop regions of the cloverleaf tRNA fold, at the five positions C56, C43, C20.1, U13, and U8, with a marked preference for C56. This cleavage pattern is consistent with a hydrolysis mechanism involving non-covalent binding of the compounds to the double-stranded regions of tRNA followed by an attack of the imidazole residues at the juxtaposed flexible single-stranded regions of the molecule. The compounds provide new probes for the investigation of RNA structure in solution and potential reactive groups for antisense oligonucleotide derivatives. Images PMID:7507235

  4. Detection of Babesia microti parasites by highly sensitive 18S rRNA reverse transcription PCR.


    Hanron, Amelia E; Billman, Zachary P; Seilie, Annette M; Chang, Ming; Murphy, Sean C


    Babesia are increasingly appreciated as a cause of transfusion-transmitted infection. Sensitive methods are needed to screen blood products. We report herein that B. microti 18S rRNA is over 1,000-fold more abundant than its coding genes, making reverse transcription PCR (RT-PCR) much more sensitive than PCR. Babesia 18S rRNA may be useful for screening the blood supply.

  5. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria


    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  6. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.


    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria


    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  7. Rapid detection of duck hepatitis A virus genotype C using reverse transcription loop-mediated isothermal amplification.


    Li, Chuanfeng; Chen, Zongyan; Meng, Chunchun; Liu, Guangqing


    A one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was used and optimized to develop a rapid and sensitive detection system for duck hepatitis A virus genotype C (DHAV-C) RNA. A set of four specific primers was designed against highly conserved sequences located within the 3D gene from DHAV (strain GX1201). Under optimal reaction conditions, the sensitivity of DHAV-C-specific RT-LAMP was 100-fold higher than that of reverse transcriptase-polymerase chain reaction (RT-PCR), with a detection limit of 0.3pg (6.59×10(4) copies) per reaction. No cross-reactivity was observed from the samples of other duck viruses, which is in good accordance with RT-PCR. Furthermore, a positive reaction can be visually inspected by observing turbidity or color change after the addition of SYBR green I dye. The DHAV-C-specific RT-LAMP assay was applied to the samples and compared with RT-PCR. The positive-sample ratios were 26.7% (12 of 45) by RT-LAMP and 20% (9 of 45) by RT-PCR. Therefore, the newly developed RT-LAMP assay is a rapid, specific, sensitive, and cost-effective method of DHAV-C detection. This assay has potential applications in both clinical diagnosis and field surveillance of DHAV-C infection.

  8. CTCF Regulates Kaposi's Sarcoma-Associated Herpesvirus Latency Transcription by Nucleosome Displacement and RNA Polymerase Programming

    PubMed Central

    Cho, Hyosun; Sung, Gi-Ho


    CCCTC-binding factor (CTCF) has been implicated in various aspects of viral and host chromatin organization and transcriptional control. We showed previously that CTCF binds to a cluster of three sites in the first intron of the Kaposi's sarcoma-associated herpesvirus (KSHV) multicistronic latency-associated transcript that encodes latency-associated nuclear antigen (LANA), viral cyclin (vCyclin), vFLIP, viral microRNAs, and kaposin. We show here that these CTCF binding sites regulate mRNA production, RNA polymerase II (RNAPII) programming, and nucleosome organization of the KSHV latency transcript control region. We also show that KSHV bacmids lacking these CTCF binding sites have elevated and altered ratios of spliced latency transcripts. CTCF binding site mutations altered RNAPII and RNAPII-accessory factor interactions with the latency control region. CTCF binding sites were required for the in vitro recruitment of RNAPII to the latency control region, suggesting that direct interactions between CTCF and RNAPII contribute to transcription regulation. Histone modifications in the latency control region were also altered by mutations in the CTCF binding sites. Finally, we show that CTCF binding alters the regular phasing of nucleosomes in the latency gene transcript and intron, suggesting that nucleosome positioning can be an underlying biochemical mechanism of CTCF function. We propose that RNAPII interactions and nucleosome displacement serve as a biochemical basis for programming RNAPII in the KSHV transcriptional control region. PMID:23192870

  9. Chromatin-associated RNA interference components contribute to transcriptional regulation in Drosophila.


    Cernilogar, Filippo M; Onorati, Maria Cristina; Kothe, Greg O; Burroughs, A Maxwell; Parsi, Krishna Mohan; Breiling, Achim; Lo Sardo, Federica; Saxena, Alka; Miyoshi, Keita; Siomi, Haruhiko; Siomi, Mikiko C; Carninci, Piero; Gilmour, David S; Corona, Davide F V; Orlando, Valerio


    RNA interference (RNAi) pathways have evolved as important modulators of gene expression that operate in the cytoplasm by degrading RNA target molecules through the activity of short (21-30 nucleotide) RNAs. RNAi components have been reported to have a role in the nucleus, as they are involved in epigenetic regulation and heterochromatin formation. However, although RNAi-mediated post-transcriptional gene silencing is well documented, the mechanisms of RNAi-mediated transcriptional gene silencing and, in particular, the role of RNAi components in chromatin dynamics, especially in animal multicellular organisms, are elusive. Here we show that the key RNAi components Dicer 2 (DCR2) and Argonaute 2 (AGO2) associate with chromatin (with a strong preference for euchromatic, transcriptionally active, loci) and interact with the core transcription machinery. Notably, loss of function of DCR2 or AGO2 showed that transcriptional defects are accompanied by the perturbation of RNA polymerase II positioning on promoters. Furthermore, after heat shock, both Dcr2 and Ago2 null mutations, as well as missense mutations that compromise the RNAi activity, impaired the global dynamics of RNA polymerase II. Finally, the deep sequencing of the AGO2-associated small RNAs (AGO2 RIP-seq) revealed that AGO2 is strongly enriched in small RNAs that encompass the promoter regions and other regions of heat-shock and other genetic loci on both the sense and antisense DNA strands, but with a strong bias for the antisense strand, particularly after heat shock. Taken together, our results show that DCR2 and AGO2 are globally associated with transcriptionally active loci and may have a pivotal role in shaping the transcriptome by controlling the processivity of RNA polymerase II.

  10. The antifibrotic effects of TGF-{beta}1 siRNA on hepatic fibrosis in rats

    SciTech Connect

    Lang, Qing; Liu, Qi; Xu, Ning; Qian, Ke-Li; Qi, Jing-Hu; Sun, Yin-Chun; Xiao, Lang; Shi, Xiao-Feng


    Highlights: {yields} We constructed CCL4 induced liver fibrosis model successfully. {yields} We proofed that the TGF-{beta}1 siRNA had a definite therapy effect to CCL4 induced liver fibrosis. {yields} The therapy effect of TGF-{beta}1 siRNA had dose-dependent. -- Abstract: Background/aims: Hepatic fibrosis results from the excessive secretion of matrix proteins by hepatic stellate cells (HSCs), which proliferate during fibrotic liver injury. Transforming growth factor (TGF)-{beta}1 is the dominant stimulus for extracellular matrix (ECM) production by stellate cells. Our study was designed to investigate the antifibrotic effects of using short interference RNA (siRNA) to target TGF-{beta}1 in hepatic fibrosis and its mechanism in rats exposed to a high-fat diet and carbon tetrachloride (CCL4). Methods: A total of 40 healthy, male SD (Sprague-Dawley) rats were randomly divided into five even groups containing of eight rats each: normal group, model group, TGF-{beta}1 siRNA 0.125 mg/kg treatment group, TGF-{beta}1 siRNA 0.25 mg/kg treatment group and TGF-{beta}1 siRNA negative control group (0.25 mg/kg). CCL4 and a high-fat diet were used for 8 weeks to induce hepatic fibrosis. All the rats were then sacrificed to collect liver tissue samples. A portion of the liver samples were soaked in formalin for Hematoxylin-Eosin staining, classifying the degree of liver fibrosis, and detecting the expression of type I and III collagen and TGF-{beta}1; the remaining liver samples were stored in liquid nitrogen to be used for detecting TGF-{beta}1 by Western blotting and for measuring the mRNA expression of type I and III collagen and TGF-{beta}1 by quantitative real-time polymerase chain reaction. Results: Comparing the TGF-{beta}1 siRNA 0.25 mg/kg treatment group to the model group, the TGF-{beta}1 siRNA negative control group and the TGF-{beta}1 siRNA 0.125 mg/kg treatment group showed significantly reduced levels of pathological changes, protein expression and the mRNA

  11. Zinc metallothionein (MT) induction by parenteral iron and endotoxin: A temporal analysis of hepatic MT mRNA changes

    SciTech Connect

    McCormick, C.C. )


    The present study was undertaken to compare the temporal characteristics of iron-induced hepatic MT mRNA accumulation to that effected by endotoxin. Young chicks were given (ip) either endotoxin, ferrous gluconate or an equivalent volume of saline. At various times following injections, liver was obtained from 5 chicks per treatment for total RNA extraction. Equal amounts of total hepatic RNA from each chick were pooled and 10 {mu}g separated by denaturing agarose gel electrophoresis. Hepatic MT mRNA and albumin mRNA were analyzed by Northern blot analysis using synthetic oligonucleotides. The results indicated little temporal difference in the accumulation of hepatic MT mRNA as affected by either endotoxin or iron. In both treatments, MT mRNA was minimally affected at 3 hours post-injection. Maximum accumulation was achieved during a 6 h period from 6 to 12 hours post-injection. At 24 hours, MT mRNA was considerably higher in liver of endotoxin-injected chicks when compared to that of iron-injection chicks. Albumin expression appeared not to be substantially affected by either treatment. The results suggest that the induction of hepatic MT by iron injection is not substantially different than that observed following endotoxin administration. It would be speculative to suggest that the processes by which MT is induced under these conditions are also similar.

  12. Analysis of allele-specific RNA transcription in FSHD by RNA-DNA FISH in single myonuclei.


    Masny, Peter S; Chan, On Ying A; de Greef, Jessica C; Bengtsson, Ulla; Ehrlich, Melanie; Tawil, Rabi; Lock, Leslie F; Hewitt, Jane E; Stocksdale, Jennifer; Martin, Jorge H; van der Maarel, Silvere M; Winokur, Sara T


    Autosomal dominant facioscapulohumeral muscular dystrophy (FSHD) is likely caused by epigenetic alterations in chromatin involving contraction of the D4Z4 repeat array near the telomere of chromosome 4q. The precise mechanism by which deletions of D4Z4 influence gene expression in FSHD is not yet resolved. Regulatory models include a cis effect on proximal gene transcription (position effect), DNA looping, non-coding RNA, nuclear localization and trans-effects. To directly test whether deletions of D4Z4 affect gene expression in cis, nascent RNA was examined in single myonuclei so that transcription from each allele could be measured independently. FSHD and control myotubes (differentiated myoblasts) were subjected to sequential RNA-DNA FISH. A total of 16 genes in the FSHD region (FRG2, TUBB4Q, FRG1, FAT1, F11, KLKB1, CYP4V2, TLR3, SORBS2, PDLIM3 (ALP), LRP2BP, ING2, SNX25, SLC25A4 (ANT1), HELT and IRF2) were examined for interallelic variation in RNA expression within individual myonuclei. Sequential DNA hybridization with a unique 4q35 chromosome probe was then applied to confirm the localization of nascent RNA to 4q. A D4Z4 probe, labeled with a third fluorochrome, distinguished between the deleted and normal allele in FSHD nuclei. Our data do not support an FSHD model in which contracted D4Z4 arrays induce altered transcription in cis from 4q35 genes, even for those genes (FRG1, FRG2 and SLC25A4 (ANT1)) for which such an effect has been proposed.

  13. mRNA decapping factors and the exonuclease Xrn2 function in widespread premature termination of RNA polymerase II transcription.


    Brannan, Kris; Kim, Hyunmin; Erickson, Benjamin; Glover-Cutter, Kira; Kim, Soojin; Fong, Nova; Kiemele, Lauren; Hansen, Kirk; Davis, Richard; Lykke-Andersen, Jens; Bentley, David L


    We report a function of human mRNA decapping factors in control of transcription by RNA polymerase II. Decapping proteins Edc3, Dcp1a, and Dcp2 and the termination factor TTF2 coimmunoprecipitate with Xrn2, the nuclear 5'-3' exonuclease "torpedo" that facilitates transcription termination at the 3' ends of genes. Dcp1a, Xrn2, and TTF2 localize near transcription start sites (TSSs) by ChIP-seq. At genes with 5' peaks of paused pol II, knockdown of decapping or termination factors Xrn2 and TTF2 shifted polymerase away from the TSS toward upstream and downstream distal positions. This redistribution of pol II is similar in magnitude to that caused by depletion of the elongation factor Spt5. We propose that coupled decapping of nascent transcripts and premature termination by the "torpedo" mechanism is a widespread mechanism that limits bidirectional pol II elongation. Regulated cotranscriptional decapping near promoter-proximal pause sites followed by premature termination could control productive pol II elongation.

  14. Transcriptional bypass of regioisomeric ethylated thymidine lesions by T7 RNA polymerase and human RNA polymerase II

    PubMed Central

    You, Changjun; Wang, Pengcheng; Dai, Xiaoxia; Wang, Yinsheng


    Alkylative damage to DNA can be induced by environmental chemicals, endogenous metabolites and some commonly prescribed chemotherapeutic agents. The regioisomeric N3-, O2- and O4-ethylthymidine (N3-, O2- and O4-EtdT, respectively) represent an important class of ethylated DNA lesions. Using nonreplicative double-stranded vectors containing an N3-EtdT, O2-EtdT or O4-EtdT at a defined site in the template strand, herein we examined the effects of these lesions on DNA transcription mediated by single-subunit T7 RNA polymerase or multisubunit human RNA polymerase II in vitro and in human cells. We found that O4-EtdT is highly mutagenic and exclusively induces the misincorporation of guanine opposite the lesion, whereas N3-EtdT and O2-EtdT display promiscuous miscoding properties during transcription. In addition, N3-EtdT and O2-EtdT were found to inhibit strongly DNA transcription in vitro and in certain human cells. Moreover, N3-EtdT, but not O2-EtdT or O4-EtdT, is an efficient substrate for transcription-coupled nucleotide excision repair. These findings provide new important insights into how these alkylated DNA lesions compromise the flow of genetic information, which may help to understand the risk of these lesions in living cells. PMID:25404131

  15. Nuclear export of human hepatitis B virus core protein and pregenomic RNA depends on the cellular NXF1-p15 machinery.


    Yang, Ching-Chun; Huang, Er-Yi; Li, Hung-Cheng; Su, Pei-Yi; Shih, Chiaho


    Hepatitis B virus (HBV) core protein (HBc) can shuttle between nucleus and cytoplasm. Cytoplasm-predominant HBc is clinically associated with severe liver inflammation. Previously, we found that HBc arginine-rich domain (ARD) can associate with a host factor NXF1 (TAP) by coimmunoprecipitation. It is well known that NXF1-p15 heterodimer can serve as a major export receptor of nuclear mRNA as a ribonucleoprotein complex (RNP). In the NXF1-p15 pathway, TREX (transcription/export) complex plays an important role in coupling nuclear pre-mRNA processing with mRNA export in mammalian cells. Here, we tested the hypothesis whether HBc and HBV specific RNA can be exported via the TREX and NXF1-p15 mediated pathway. We demonstrated here that HBc can physically and specifically associate with TREX components, and the NXF1-p15 export receptor by coimmunoprecipitation. Accumulation of HBc protein in the nucleus can be induced by the interference with TREX and NXF1-p15 mediated RNA export machinery. HBV transcripts encodes a non-spliced 3.5 kb pregenomic RNA (pgRNA) which can serve as a template for reverse transcription. Cytoplasmic HBV pgRNA appeared to be reduced by siRNA treatment specific for the NXF1-p15 complex by quantitative RT-qPCR and Northern blot analyses. This result suggests that the pgRNA was also exported via the NXF1-p15 machinery. We entertain the hypothesis that HBc protein can be exported as an RNP cargo via the mRNA export pathway by hijacking the TREX and NXF1-p15 complex. In our current and previous studies, HBc is not required for pgRNA accumulation in the cytoplasm. Furthermore, HBc ARD can mediate nuclear export of a chimeric protein containing HBc ARD in a pgRNA-independent manner. Taken together, it suggests that while both pgRNA and HBc protein exports are dependent on NXF1-p15, they are using the same export machinery in a manner independent of each other.

  16. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.


    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  17. Environmental Contaminants and microRNA Regulation: Transcription Factors as Regulators of Toxicant-Altered microRNA Expression

    PubMed Central

    Sollome, James; Martin, Elizabeth; Sethupathy, Praveen; Fry, Rebecca C.


    MicroRNAs (miRNAs) regulate gene expression by binding mRNA transcripts and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized in silico bioinformatic analysis to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n=847) were identified and promoter regions were defined as −1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n=128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. PMID:27292125

  18. [Analysis of protein-on-DNA binding profiles, detected with chIP-seq method, reveals possible interaction of specific transcription factors with RNA polymerase II in the process of transcription elongation].


    Belostotskiĭ, A A


    It is thought that in the course of mRNA transcription almost all transcription factors stay on a promoter while RNA polymerase II "clears" the promoter and "proceeds" to elongation. However, analysis of some specific transcription factors and RNA polymerase II binding profiles on DNA, detected with ChIP-seq method, revealed the possibility of interaction between transcription factors and RNA polymerase II in the process of transcription elongation.

  19. Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

    PubMed Central

    Brennan, V E; Bobek, L A; Bruenn, J A


    ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH. Images PMID:7031603

  20. Synthesis of RNA probes by the direct in vitro transcription of PCR-generated DNA templates.


    Urrutia, R; McNiven, M A; Kachar, B


    We describe a novel method for the generation of RNA probes based on the direct in vitro transcription of DNA templates amplified by polymerase chain reaction (PCR) using primers with sequence hybrids between the target gene and those of the T7 and T3 RNA polymerases promoters. This method circumvents the need for cloning and allows rapid generation of strand-specific RNA molecules that can be used for the identification of genes in hybridization experiments. We have successfully applied this method to the identification of DNA sequences by Southern blot analysis and library screening.

  1. Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors of mRNA transcription

    SciTech Connect

    Dreyfuss, G.; Adam, S.A.; Choi, Y.D.


    Exposure of intact cells to UV light brings about cross-linking of polyadenylated mRNA to a set of cytoplasmic proteins which are in direct contact with the mRNA in vivo. Substantial amounts of an additional protein of molecular weight 38,000 become cross-linked to the mRNA when cells are treated with inhibitors of mRNA synthesis (actinomycin D, camptothecin, and 5,6-dichloro-1-beta-D-ribofuranosyl benzimidazole) or after infection with vesicular stomatitis virus. Cordycepin, which inhibits polyadenylation but not mRNA synthesis, has no such effect. Inhibitors of protein synthesis and of rRNA synthesis are also without effect on 38K cross-linking to mRNA. The onset of the effect of inhibitors of mRNA synthesis on the UV cross-linkable interaction between mRNA and 38K is rapid and reaches a maximal level in less than 60 min, and it is completely and rapidly reversible. In cells treated with actinomycin D, the amount of 38K which becomes cross-linked to mRNA is proportional to the extent of inhibition of mRNA synthesis. The association of 38K with mRNA during transcriptional arrest does not require protein synthesis because simultaneous treatment with the protein synthesis inhibitor emetine does not interfere with it. The effectors which promote the interaction of 38K with mRNA do not affect the proteins which are in contact with polyadenylated heterogeneous nuclear RNA and do not markedly affect protein synthesis in the cell. The 38K protein can be isolated with the polyribosomal polyadenylated fraction from which it was purified, and monoclonal antibodies against it were prepared.

  2. RNA transcript sequencing reveals inorganic sulfur compound oxidation pathways in the acidophile Acidithiobacillus ferrivorans.


    Christel, Stephan; Fridlund, Jimmy; Buetti-Dinh, Antoine; Buck, Moritz; Watkin, Elizabeth L; Dopson, Mark


    Acidithiobacillus ferrivorans is an acidophile implicated in low-temperature biomining for the recovery of metals from sulfide minerals. Acidithiobacillus ferrivorans obtains its energy from the oxidation of inorganic sulfur compounds, and genes encoding several alternative pathways have been identified. Next-generation sequencing of At. ferrivorans RNA transcripts identified the genes coding for metabolic and electron transport proteins for energy conservation from tetrathionate as electron donor. RNA transcripts suggested that tetrathionate was hydrolyzed by the tetH1 gene product to form thiosulfate, elemental sulfur and sulfate. Despite two of the genes being truncated, RNA transcripts for the SoxXYZAB complex had higher levels than for thiosulfate quinone oxidoreductase (doxDAgenes). However, a lack of heme-binding sites in soxX suggested that DoxDA was responsible for thiosulfate metabolism. Higher RNA transcript counts also suggested that elemental sulfur was metabolized by heterodisulfide reductase (hdrgenes) rather than sulfur oxygenase reductase (sor). The sulfite produced as a product of heterodisulfide reductase was suggested to be oxidized by a pathway involving the sat gene product or abiotically react with elemental sulfur to form thiosulfate. Finally, several electron transport complexes were involved in energy conservation. This study has elucidated the previously unknown At. ferrivorans tetrathionate metabolic pathway that is important in biomining.

  3. Achieving large dynamic range control of gene expression with a compact RNA transcription-translation regulator.


    Westbrook, Alexandra M; Lucks, Julius B


    RNA transcriptional regulators are emerging as versatile components for genetic network construction. However, these regulators suffer from incomplete repression in their OFF state, making their dynamic range less than that of their protein counterparts. This incomplete repression causes expression leak, which impedes the construction of larger synthetic regulatory networks as leak propagation can interfere with desired network function. To address this, we demonstrate how naturally derived antisense RNA-mediated transcriptional regulators can be configured to regulate both transcription and translation in a single compact RNA mechanism that functions in Escherichia coli. Using in vivo gene expression assays, we show that a combination of transcriptional termination and ribosome binding site sequestration increases repression from 85% to 98%, or activation from 10-fold to over 900-fold, in response to cognate antisense RNAs. We also show that orthogonal repressive versions of this mechanism can be created through engineering minimal antisense RNAs. Finally, to demonstrate the utility of this mechanism, we use it to reduce network leak in an RNA-only cascade. We anticipate these regulators will find broad use as synthetic biology moves beyond parts engineering to the design and construction of more sophisticated regulatory networks.

  4. POSTAR: a platform for exploring post-transcriptional regulation coordinated by RNA-binding proteins

    PubMed Central

    Hu, Boqin; Yang, Yu-Cheng T.; Huang, Yiming; Zhu, Yumin; Lu, Zhi John


    We present POSTAR (, a resource of POST-trAnscriptional Regulation coordinated by RNA-binding proteins (RBPs). Precise characterization of post-transcriptional regulatory maps has accelerated dramatically in the past few years. Based on new studies and resources, POSTAR supplies the largest collection of experimentally probed (∼23 million) and computationally predicted (approximately 117 million) RBP binding sites in the human and mouse transcriptomes. POSTAR annotates every transcript and its RBP binding sites using extensive information regarding various molecular regulatory events (e.g., splicing, editing, and modification), RNA secondary structures, disease-associated variants, and gene expression and function. Moreover, POSTAR provides a friendly, multi-mode, integrated search interface, which helps users to connect multiple RBP binding sites with post-transcriptional regulatory events, phenotypes, and diseases. Based on our platform, we were able to obtain novel insights into post-transcriptional regulation, such as the putative association between CPSF6 binding, RNA structural domains, and Li-Fraumeni syndrome SNPs. In summary, POSTAR represents an early effort to systematically annotate post-transcriptional regulatory maps and explore the putative roles of RBPs in human diseases. PMID:28053162

  5. Transcription initiation factor DksA has diverse effects on RNA chain elongation

    PubMed Central

    Furman, Ran; Sevostyanova, Anastasiya; Artsimovitch, Irina


    Bacterial transcription factors DksA and GreB belong to a family of coiled-coil proteins that bind within the secondarychannel of RNA polymerase (RNAP). These proteins display structural homology but play different regulatory roles. DksA disrupts RNAP interactions with promoter DNA and inhibits formation of initiation complexes, sensitizing rRNA synthesis to changes in concentrations of ppGpp and NTPs. Gre proteins remodel the RNAP active site and facilitate cleavage of the nascent RNA in elongation complexes. However, DksA and GreB were shown to have overlapping effects during initiation, and in vivo studies suggested that DksA may also function at post-initiation steps. Here we show that DksA has many features of an elongation factor: it inhibits both RNA chain extension and RNA shortening by exonucleolytic cleavage or pyrophosphorolysis and increases intrinsic termination in vitro and in vivo. However, DksA has no effect on Rho- or Mfd-mediated RNA release or nascent RNA cleavage in backtracked complexes, the regulatory target of Gre factors. Our results reveal that DksA effects on elongating RNAP are very different from those of GreB, suggesting that these regulators recognize distinct states of the transcription complex. PMID:22210857

  6. mRNA quality control is bypassed for immediate export of stress-responsive transcripts.


    Zander, Gesa; Hackmann, Alexandra; Bender, Lysann; Becker, Daniel; Lingner, Thomas; Salinas, Gabriela; Krebber, Heike


    Cells grow well only in a narrow range of physiological conditions. Surviving extreme conditions requires the instantaneous expression of chaperones that help to overcome stressful situations. To ensure the preferential synthesis of these heat-shock proteins, cells inhibit transcription, pre-mRNA processing and nuclear export of non-heat-shock transcripts, while stress-specific mRNAs are exclusively exported and translated. How cells manage the selective retention of regular transcripts and the simultaneous rapid export of heat-shock mRNAs is largely unknown. In Saccharomyces cerevisiae, the shuttling RNA adaptor proteins Npl3, Gbp2, Hrb1 and Nab2 are loaded co-transcriptionally onto growing pre-mRNAs. For nuclear export, they recruit the export-receptor heterodimer Mex67-Mtr2 (TAP-p15 in humans). Here we show that cellular stress induces the dissociation of Mex67 and its adaptor proteins from regular mRNAs to prevent general mRNA export. At the same time, heat-shock mRNAs are rapidly exported in association with Mex67, without the need for adapters. The immediate co-transcriptional loading of Mex67 onto heat-shock mRNAs involves Hsf1, a heat-shock transcription factor that binds to heat-shock-promoter elements in stress-responsive genes. An important difference between the export modes is that adaptor-protein-bound mRNAs undergo quality control, whereas stress-specific transcripts do not. In fact, regular mRNAs are converted into uncontrolled stress-responsive transcripts if expressed under the control of a heat-shock promoter, suggesting that whether an mRNA undergoes quality control is encrypted therein. Under normal conditions, Mex67 adaptor proteins are recruited for RNA surveillance, with only quality-controlled mRNAs allowed to associate with Mex67 and leave the nucleus. Thus, at the cost of error-free mRNA formation, heat-shock mRNAs are exported and translated without delay, allowing cells to survive extreme situations.

  7. Integrated analysis of transcription factor, microRNA and LncRNA in an animal model of obliterative bronchiolitis

    PubMed Central

    Dong, Ming; Wang, Xin; Zhao, Hong-Lin; Chen, Xing-Long; Yuan, Jing-Hua; Guo, Jiu-Yi; Li, Ke-Qiu; Li, Guang


    Obliterative bronchiolitis (OB) is characterized by sub-epithelial inflammatory and fibrotic narrowing of the bronchioles, and it is the predominant factor limiting long-term survival after lung transplantation. To explore molecular mechanism of OB, we investigated the interaction of transcription factor (TF), microRNA, long noncoding RNA (lncRNA), and gene expression in the mice model of OB by integrated analysis of TF array, miRNA microarray, and lncRNA and mRNA microarray. After 28 days of orthotopic tracheal transplantation in mice, 42 TFs were significantly up-regulated in allogeneic graft compared to syngeneic graft; 62 miRNAs including miR-376-5p were up-regulated and 17 miRNAs including miR-338-3p were down-regulated over 2-fold; 137 mRNAs were down-regulated and 129 mRNAs were up-regulated over 2-fold; 234 lncRNAs were up-regulated and 212 lncRNAs were down-regulated over 2-fold in the allogeneic model compared to that in the syngeneic control group. We further analyzed potential interaction between TFs, miRNAs, lncRNAs and target genes by different algorithms. Four differentially expressed TFs (Myc/Max, FOXO1, FOXM1, and SMAD) were predicted to regulate 3 different miRNAs, 17 mRNAs, and 16 lncRNAs. These findings suggest that modulation of altered transcription factors such as Myc/Max and FOXO1, and miRNAs such as miR-376-5p and miR-338-3p may become a preventive or therapeutic targets in the chronic lung allograft dysfunction. PMID:26261598

  8. LncRNA profiling of human lymphoid progenitors reveals transcriptional divergence of B and T lineages

    PubMed Central

    Casero, David; Sandoval, Salemiz; Seet, Christopher S.; Scholes, Jessica; Zhu, Yuhua; Ha, Vi Luan; Luong, Annie; Parekh, Chintan; Crooks, Gay M.


    To elucidate the transcriptional landscape that regulates human lymphoid commitment during postnatal life, we used RNA sequencing to assemble the long non-coding transcriptome across human bone marrow and thymic progenitors spanning the earliest stages of B and T lymphoid specification. Over 3000 novel long non-coding RNA genes (lncRNAs) were revealed through the analysis of these rare populations. Lymphoid commitment was characterized by lncRNA expression patterns that were highly stage-specific and more lineage-specific than protein coding patterns. Protein-coding genes co-expressed with neighboring lncRNA genes were enriched for ontologies related to lymphoid differentiation. The exquisite cell-type specificity of global lncRNA expression patterns independently revealed new developmental relationships between the earliest progenitors in the human bone marrow and thymus. PMID:26502406

  9. Transcriptional Activity of rRNA Genes in Barley Cells after Mutagenic Treatment

    PubMed Central


    In the present study, the combination of the micronucleus test with analysis of the activity of the rRNA genes in mutagen-treated Hordeum vulgare (barley) by maleic hydrazide (MH) cells was performed. Simultaneously fluorescence in situ hybridization (FISH) with 25S rDNA as probes and an analysis of the transcriptional activity of 35S rRNA genes with silver staining were performed. The results showed that transcriptional activity is always maintained in the micronuclei although they are eliminated during the next cell cycle. The analysis of the transcriptional activity was extended to barley nuclei. MH influenced the fusion of the nucleoli in barley nuclei. The silver staining enabled detection of the nuclear bodies which arose after MH treatment. The results confirmed the usefulness of cytogenetic techniques in the characterization of micronuclei. Similar analyses can be now extended to other abiotic stresses to study the response of plant cells to the environment. PMID:27257817

  10. Comparison Analysis of Dysregulated LncRNA Profile in Mouse Plasma and Liver after Hepatic Ischemia/Reperfusion Injury.


    Chen, Zhenzhen; Luo, Yanjin; Yang, Weili; Ding, Liwei; Wang, Junpei; Tu, Jian; Geng, Bin; Cui, Qinghua; Yang, Jichun


    Long noncoding RNAs (LncRNAs) have been believed to be the major transcripts in various tissues and organs, and may play important roles in regulation of many biological processes. The current study determined the LncRNA profile in mouse plasma after liver ischemia/reperfusion injury (IRI) using microarray technology. Microarray assays revealed that 64 LncRNAs were upregulated, and 244 LncRNAs were downregulated in the plasma of liver IRI mouse. Among these dysregulated plasma LncRNAs, 59-61% were intergenic, 22-25% were antisense overlap, 8-12% were sense overlap and 6-7% were bidirectional. Ten dysregulated plasma LncRNAs were validated by quantitative PCR assays, confirming the accuracy of microarray analysis result. Comparison analysis between dysregulated plasma and liver LncRNA profile after liver IRI revealed that among the 308 dysregulated plasma LncRNAs, 245 LncRNAs were present in the liver, but remained unchanged. In contrast, among the 98 dysregulated liver LncRNAs after IRI, only 19 were present in the plasma, but remained unchanged. LncRNA AK139328 had been previously reported to be upregulated in the liver after IRI, and silencing of hepatic AK139328 ameliorated liver IRI. Both microarray and RT-PCR analyses failed to detect the presence of AK139328 in mouse plasma. In summary, the current study compared the difference between dysregulated LncRNA profile in mouse plasma and liver after liver IRI, and suggested that a group of dysregulated plasma LncRNAs have the potential of becoming novel biomarkers for evaluation of ischemic liver injury.

  11. Transcriptional bursting explains the noise–versus–mean relationship in mRNA and protein levels

    SciTech Connect

    Dar, Roy; Shaffer, Sydney M.; Singh, Abhyudai; Razooky, Brandon S.; Simpson, Michael L.; Raj, Arjun; Weinberger, Leor S.


    Recent analysis demonstrates that the HIV-1 Long Terminal Repeat (HIV LTR) promoter exhibits a range of possible transcriptional burst sizes and frequencies for any mean-expression level. However, these results have also been interpreted as demonstrating that cell-tocell expression variability (noise) and mean are uncorrelated, a significant deviation from previous results. Here, we re-examine the available mRNA and protein abundance data for the HIV LTR and find that noise in mRNA and protein expression scales inversely with the mean along analytically predicted transcriptional burst-size manifolds. We then experimentally perturb transcriptional activity to test a prediction of the multiple burst-size model: that increasing burst frequency will cause mRNA noise to decrease along given burst-size lines as mRNA levels increase. In conclusion, the data show that mRNA and protein noise decrease as mean expression increases, supporting the canonical inverse correlation between noise and mean.

  12. Transcriptional bursting explains the noise–versus–mean relationship in mRNA and protein levels


    Dar, Roy; Shaffer, Sydney M.; Singh, Abhyudai; ...


    Recent analysis demonstrates that the HIV-1 Long Terminal Repeat (HIV LTR) promoter exhibits a range of possible transcriptional burst sizes and frequencies for any mean-expression level. However, these results have also been interpreted as demonstrating that cell-tocell expression variability (noise) and mean are uncorrelated, a significant deviation from previous results. Here, we re-examine the available mRNA and protein abundance data for the HIV LTR and find that noise in mRNA and protein expression scales inversely with the mean along analytically predicted transcriptional burst-size manifolds. We then experimentally perturb transcriptional activity to test a prediction of the multiple burst-size model: thatmore » increasing burst frequency will cause mRNA noise to decrease along given burst-size lines as mRNA levels increase. In conclusion, the data show that mRNA and protein noise decrease as mean expression increases, supporting the canonical inverse correlation between noise and mean.« less

  13. NusG inhibits RNA polymerase backtracking by stabilizing the minimal transcription bubble

    PubMed Central

    Turtola, Matti; Belogurov, Georgiy A


    Universally conserved factors from NusG family bind at the upstream fork junction of transcription elongation complexes and modulate RNA synthesis in response to translation, processing, and folding of the nascent RNA. Escherichia coli NusG enhances transcription elongation in vitro by a poorly understood mechanism. Here we report that E. coli NusG slows Gre factor-stimulated cleavage of the nascent RNA, but does not measurably change the rates of single nucleotide addition and translocation by a non-paused RNA polymerase. We demonstrate that NusG slows RNA cleavage by inhibiting backtracking. This activity is abolished by mismatches in the upstream DNA and is independent of the gate and rudder loops, but is partially dependent on the lid loop. Our comprehensive mapping of the upstream fork junction by base analogue fluorescence and nucleic acids crosslinking suggests that NusG inhibits backtracking by stabilizing the minimal transcription bubble. DOI: PMID:27697152

  14. Hepatitis


    ... clotting problems or chronic liver disease. previous continue Hepatitis B and Hepatitis C Although hep A is a ... does — through direct contact with infected body fluids. Hepatitis B and C are even more easily passed in ...

  15. Hepatitis


    ... A if they've been vaccinated against it. Hepatitis B Hepatitis B is a more serious infection. It may lead ... of which cause severe illness and even death. Hepatitis B virus (HBV) is transmitted from person to person ...

  16. Hepatitis


    ... Issues Listen Español Text Size Email Print Share Hepatitis Page Content Article Body Hepatitis means “inflammation of ... it has been associated with drinking contaminated water. Hepatitis Viruses Type Transmission Prognosis A Fecal-oral (stool ...

  17. Regulation of glucose metabolism via hepatic forkhead transcription factor 1 (FoxO1) by Morinda citrifolia (noni) in high-fat diet-induced obese mice.


    Nerurkar, Pratibha V; Nishioka, Adrienne; Eck, Philip O; Johns, Lisa M; Volper, Esther; Nerurkar, Vivek R


    Renewed interest in alternative medicine among diabetic individuals prompted us to investigate anti-diabetic effects of Morinda citrifolia (noni) in high-fat diet (HFD)-fed mice. Type 2 diabetes is associated with increased glucose production due to the inability of insulin to suppress hepatic gluconeogenesis and promote glycolysis. Insulin inhibits gluconeogenesis by modulating transcription factors such as forkhead box O (FoxO1). Based on microarray analysis data, we tested the hypothesis that fermented noni fruit juice (fNJ) improves glucose metabolism via FoxO1 phosphorylation. C57BL/6 male mice were fed a HFD and fNJ for 12 weeks. Body weights and food intake were monitored daily. FoxO1 expression was analysed by real-time PCR and Western blotting. Specificity of fNJ-associated FoxO1 regulation of gluconeogenesis was confirmed by small interfering RNA (siRNA) studies using human hepatoma cells, HepG2. Supplementation with fNJ inhibited weight gain and improved glucose and insulin tolerance and fasting glucose in HFD-fed mice. Hypoglycaemic properties of fNJ were associated with the inhibition of hepatic FoxO1 mRNA expression, with a concomitant increase in FoxO1 phosphorylation and nuclear expulsion of the proteins. Gluconeogenic genes, phosphoenolpyruvate C kinase (PEPCK) and glucose-6-phosphatase (G6P), were significantly inhibited in mice fed a HFD+fNJ. HepG2 cells demonstrated more than 80 % inhibition of PEPCK and G6P mRNA expression in cells treated with FoxO1 siRNA and fNJ. These data suggest that fNJ improves glucose metabolism via FoxO1 regulation in HFD-fed mice.

  18. RNA-binding proteins involved in post-transcriptional regulation in bacteria

    PubMed Central

    Van Assche, Elke; Van Puyvelde, Sandra; Vanderleyden, Jos; Steenackers, Hans P.


    Post-transcriptional regulation is a very important mechanism to control gene expression in changing environments. In the past decade, a lot of interest has been directed toward the role of small RNAs (sRNAs) in bacterial post-transcriptional regulation. However, sRNAs are not the only molecules controlling gene expression at this level, RNA-binding proteins (RBPs) play an important role as well. CsrA and Hfq are the two best studied bacterial proteins of this type, but recently, additional proteins involved in post-transcriptional control have been identified. This review focuses on the general working mechanisms of post-transcriptionally active RBPs, which include (i) adaptation of the susceptibility of mRNAs and sRNAs to RNases, (ii) modulating the accessibility of the ribosome binding site of mRNAs, (iii) recruiting and assisting in the interaction of mRNAs with other molecules and (iv) regulating transcription terminator/antiterminator formation, and gives an overview of both the well-studied and the newly identified proteins that are involved in post-transcriptional regulatory processes. Additionally, the post-transcriptional mechanisms by which the expression or the activity of these proteins is regulated, are described. For many of the newly identified proteins, however, mechanistic questions remain. Most likely, more post-transcriptionally active proteins will be identified in the future. PMID:25784899

  19. Drosophila factor 2, an RNA polymerase II transcript release factor, has DNA-dependent ATPase activity.


    Xie, Z; Price, D


    Drosophila factor 2 has been identified as a component of negative transcription elongation factor (N-TEF) that causes the release of RNA polymerase II transcripts in an ATP-dependent manner (Xie, Z. and Price D. H. (1996) J. Biol. Chem. 271, 11043-11046). We show here that the transcript release activity of factor 2 requires ATP or dATP and that adenosine 5'-O-(thiotriphosphate) (ATPgammaS), adenosine 5'-(beta,gamma-imino)triphosphate (AMP-PNP), or other NTPs do not support the activity. Factor 2 demonstrated a strong DNA-dependent ATPase activity that correlated with its transcript release activity. At 20 microg/ml DNA, the ATPase activity of factor 2 had an apparent Km(ATP) of 28 microM and an estimated Kcat of 140 min-1. Factor 2 caused the release of nascent transcripts associated with elongation complexes generated by RNA polymerase II on a dC-tailed template. Therefore, no other protein cofactors are required for the transcript release activity of factor 2. Using the dC-tailed template assay, it was found that renaturation of the template was required for factor 2 function.

  20. RNA-seq analysis of equine conceptus transcripts during embryo fixation and capsule disappearance.


    Tachibana, Yurika; Sakurai, Toshihiro; Bai, Hanako; Shiota, Kunio; Nambo, Yasuo; Nagaoka, Kentaro; Imakawa, Kazuhiko


    Extensive studies have been conducted to characterize the unique phenomena of equine pregnancy. Most studies have focused on embryo transmigration when the embryo is covered with a mucin-like glycoprotein capsule and on the characterization of the chorionic girdle and chorionic gonadotropin (CG) secretion. However, the events preceding and following capsule disappearance have not been well studied. In this study, the mRNA expression in conceptus membranes at days 19, 21, and 25 (day 0 = day of ovulation) was analyzed by RNA-seq (SOLiD3), and transcript levels on these three days and day 13 were confirmed by real-time PCR. Of the 26,416 equine genes registered, 20,436 transcripts were aligned to sequences in the Ensembl database, from which 4,625 transcripts were registered in both Ensembl and the KEGG pathway. Each of the 4,625 transcripts was examined through KEGG pathway analysis, and 12 transcripts of integrins (ITGs) and collagens (COLs) were confirmed through real-time PCR. Our data indicated that extracellular matrix (ECM)-related mRNAs were highly expressed in day 19, 21, and 25 conceptus membranes. In combination with previous results, which confirmed a lack of laminin and fibronectin transcript expression in the endometrium, these observations suggest that in contrast to attachment through focal adhesion, conceptus chorionic membrane ECMs function as a scaffold-like structure to possibly maintain the shape of the conceptus and a separation between chorionic membranes and the uterine luminal epithelium.

  1. Pervasive transcription read-through promotes aberrant expression of oncogenes and RNA chimeras in renal carcinoma

    PubMed Central

    Grosso, Ana R; Leite, Ana P; Carvalho, Sílvia; Matos, Mafalda R; Martins, Filipa B; Vítor, Alexandra C; Desterro, Joana MP; Carmo-Fonseca, Maria; de Almeida, Sérgio F


    Aberrant expression of cancer genes and non-canonical RNA species is a hallmark of cancer. However, the mechanisms driving such atypical gene expression programs are incompletely understood. Here, our transcriptional profiling of a cohort of 50 primary clear cell renal cell carcinoma (ccRCC) samples from The Cancer Genome Atlas (TCGA) reveals that transcription read-through beyond the termination site is a source of transcriptome diversity in cancer cells. Amongst the genes most frequently mutated in ccRCC, we identified SETD2 inactivation as a potent enhancer of transcription read-through. We further show that invasion of neighbouring genes and generation of RNA chimeras are functional outcomes of transcription read-through. We identified the BCL2 oncogene as one of such invaded genes and detected a novel chimera, the CTSC-RAB38, in 20% of ccRCC samples. Collectively, our data highlight a novel link between transcription read-through and aberrant expression of oncogenes and chimeric transcripts that is prevalent in cancer. DOI: PMID:26575290

  2. Transcription termination within the iron transport-biosynthesis operon of Vibrio anguillarum requires an antisense RNA.


    Stork, Michiel; Di Lorenzo, Manuela; Welch, Timothy J; Crosa, Jorge H


    The iron transport-biosynthesis (ITB) operon in Vibrio anguillarum includes four genes for ferric siderophore transport, fatD, -C, -B, and -A, and two genes for siderophore biosynthesis, angR and angT. This cluster plays an important role in the virulence mechanisms of this bacterium. Despite being part of the same polycistronic mRNA, the relative levels of transcription for the fat portion and for the whole ITB message differ profoundly, the levels of the fat transcript being about 17-fold higher. Using S1 nuclease mapping, lacZ transcriptional fusions, and in vitro studies, we were able to show that the differential gene expression within the ITB operon is due to termination of transcription between the fatA and angR genes, although a few transcripts proceeded beyond the termination site to the end of this operon. This termination process requires a 427-nucleotide antisense RNA that spans the intergenic region and acts as a novel transcriptional terminator.

  3. Rational design of chemical genetic probes of RNA function and lead therapeutics targeting repeating transcripts

    PubMed Central

    Disney, Matthew D.


    RNA is an important yet vastly underexploited target for small molecule chemical probes or lead therapeutics. Small molecules have been used successfully to modulate the function of the bacterial ribosome, viral RNAs and riboswitches. These RNAs are either highly expressed or can be targeted using substrate mimicry, a mainstay in the design of enzyme inhibitors. However, most cellular RNAs are neither highly expressed nor have a lead small molecule inhibitor, a significant challenge for drug discovery efforts. Herein, I describe the design of small molecules targeting expanded repeating transcripts that cause myotonic muscular dystrophy (DM). These test cases illustrate the challenges of designing small molecules that target RNA and the advantages of targeting repeating transcripts. Lastly, I discuss how small molecules might be more advantageous than oligonucleotides for targeting RNA. PMID:23939337

  4. Rational design of chemical genetic probes of RNA function and lead therapeutics targeting repeating transcripts.


    Disney, Matthew D


    RNA is an important yet vastly underexploited target for small molecule chemical probes or lead therapeutics. Small molecules have been used successfully to modulate the function of the bacterial ribosome, viral RNAs and riboswitches. These RNAs are either highly expressed or can be targeted using substrate mimicry, a mainstay in the design of enzyme inhibitors. However, most cellular RNAs are neither highly expressed nor have a lead small molecule inhibitor, a significant challenge for drug discovery efforts. Herein, I describe the design of small molecules targeting expanded repeating transcripts that cause myotonic muscular dystrophy (DM). These test cases illustrate the challenges of designing small molecules that target RNA and the advantages of targeting repeating transcripts. Lastly, I discuss how small molecules might be more advantageous than oligonucleotides for targeting RNA.

  5. Deciphering the mRNP Code: RNA-Bound Determinants of Post-Transcriptional Gene Regulation.


    Gehring, Niels H; Wahle, Elmar; Fischer, Utz


    Eukaryotic cells determine the final protein output of their genetic program not only by controlling transcription but also by regulating the localization, translation and turnover rates of their mRNAs. Ultimately, the fate of any given mRNA is determined by the ensemble of all associated RNA-binding proteins (RBPs), non-coding RNAs and metabolites collectively known as the messenger ribonucleoprotein particle (mRNP). Although many mRNA-associated factors have been identified over the past years, little is known about the composition of individual mRNPs and the cooperation of their constituents. In this review we discuss recent progress that has been made on how this 'mRNP code' is established on individual transcripts and how it is interpreted during gene expression in eukaryotic cells.

  6. Processing of microRNA primary transcripts requires heme in mammalian cells.


    Weitz, Sara H; Gong, Ming; Barr, Ian; Weiss, Shimon; Guo, Feng


    DiGeorge syndrome critical region gene 8 (DGCR8) is the RNA-binding partner protein of the nuclease Drosha. DGCR8 and Drosha recognize and cleave primary transcripts of microRNAs (pri-miRNAs) in the maturation of canonical microRNAs (miRNAs) in animals. We previously reported that human, frog, and starfish DGCR8 bind heme when expressed in Escherichia coli and that Fe(III) heme activates apoDGCR8 in reconstituted pri-miRNA processing assays. However, the physiological relevance of heme in miRNA maturation has not been clear. Here, we present a live-cell pri-miRNA processing assay that produces robust signals and faithfully indicates DGCR8 and Drosha activities. We demonstrate that all known heme-binding-deficient DGCR8 mutants are defective in pri-miRNA processing in HeLa cells. DGCR8 contains a previously uncharacterized heme-binding motif, "IPCL," that is also required for its activity. Heme availability and biosynthesis in HeLa cells positively affect pri-miRNA processing and production of mature miRNA. These results establish an essential function for heme in pri-miRNA processing in mammalian cells. Our study suggests that abnormal heme biosynthesis and degradation may contribute to diseases via miRNA-mediated gene regulation networks.

  7. Gene Expression in Archaea: Studies of Transcriptional Promoters, Messenger RNA Processing, and Five Prime Untranslated Regions in "Methanocaldococcus Jannashchii"

    ERIC Educational Resources Information Center

    Zhang, Jian


    Gene expression in Archaea is less understood than those in Bacteria and Eucarya. In general, three steps are involved in gene expression--transcription, RNA processing, and translation. To expand our knowledge of these processes in Archaea, I have studied transcriptional promoters, messenger RNA processing, and 5'-untranslated regions in…

  8. Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

    PubMed Central

    Ronander, Elena; Bengtsson, Dominique C.; Joergensen, Louise; Jensen, Anja T. R.; Arnot, David E.


    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE1. Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System2 (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types. PMID:23070076

  9. Analysis of single-cell gene transcription by RNA fluorescent in situ hybridization (FISH).


    Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise; Jensen, Anja T R; Arnot, David E


    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors and the consequence of differential binding on the clinical outcome of P. falciparum infections. Recently, the mutually exclusive transcription paradigm has been called into doubt by transcription assays based on individual P. falciparum transcript identification in single infected erythrocytic cells using RNA fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human erythrocytes. The method is based on the use of digoxigenin- and biotin- labeled antisense RNA probes using the TSA Plus Fluorescence Palette System(2) (Perkin Elmer), microscopic analyses and freshly selected P. falciparum IE. The in situ hybridization method can be used to monitor transcription and regulation of a variety of genes expressed during the different stages of the P. falciparum life cycle and is adaptable to other malaria parasite species and other organisms and cell types.

  10. Role of RNA secondary structure in emergence of compartment specific hepatitis B virus immune escape variants

    PubMed Central

    Datta, Sibnarayan; Chakravarty, Runu


    AIM To investigate the role of subgenotype specific RNA secondary structure in the compartment specific selection of hepatitis B virus (HBV) immune escape mutations. METHODS This study was based on the analysis of the specific observation of HBV subgenotype A1 in the serum/plasma, while subgenotype A2 with G145R mutation in the peripheral blood leukocytes (PBLs). Genetic variability found among the two subgenotypes was used for prediction and comparison of the full length pregenomic RNA (pgRNA) secondary structure and base pairings. RNA secondary structures were predicted for 37 °C using the Vienna RNA fold server, using default parameters. Visualization and detailed analysis was done using RNA shapes program. RESULTS In this analysis, using similar algorithm and conditions, entirely different pgRNA secondary structures for subgenotype A1 and subgenotype A2 were predicted, suggesting different base pairing patterns within the two subgenotypes of genotype A, specifically, in the HBV genetic region encoding the major hydrophilic loop. We observed that for subgenotype A1 specific pgRNA, nucleotide 358U base paired with 1738A and nucleotide 587G base paired with 607C. However in sharp contrast, in subgenotype A2 specific pgRNA, nucleotide 358U was opposite to nucleotide 588G, while 587G was opposite to 359U, hence precluding correct base pairing and thereby lesser stability of the stem structure. When the nucleotides at 358U and 587G were replaced with 358C and 587A respectively (as observed specifically in the PBL associated A2 sequences), these nucleotides base paired correctly with 588G and 359U, respectively. CONCLUSION The results of this study show that compartment specific mutations are associated with HBV subgenotype specific alterations in base pairing of the pgRNA, leading to compartment specific selection and preponderance of specific HBV subgenotype with unique mutational pattern. PMID:27878103

  11. Transcription factors that influence RNA polymerases I and II: To what extent is mechanism of action conserved?


    Zhang, Yinfeng; Najmi, Saman M; Schneider, David A


    In eukaryotic cells, nuclear RNA synthesis is accomplished by at least three unique, multisubunit RNA polymerases. The roles of these enzymes are generally partitioned into the synthesis of the three major classes of RNA: rRNA, mRNA, and tRNA for RNA polymerases I, II, and III respectively. Consistent with their unique cellular roles, each enzyme has a complement of specialized transcription factors and enzymatic properties. However, not all transcription factors have evolved to affect only one eukaryotic RNA polymerase. In fact, many factors have been shown to influence the activities of multiple nuclear RNA polymerases. This review focuses on a subset of these factors, specifically addressing the mechanisms by which these proteins influence RNA polymerases I and II.

  12. DNAPKcs-dependent arrest of RNA polymerase II transcription in the presence of DNA breaks.


    Pankotai, Tibor; Bonhomme, Céline; Chen, David; Soutoglou, Evi


    DNA double-strand break (DSB) repair interferes with ongoing cellular processes, including replication and transcription. Although the process of replication stalling upon collision of replication forks with damaged DNA has been extensively studied, the fate of elongating RNA polymerase II (RNAPII) that encounters a DSB is not well understood. We show that the occurrence of a single DSB at a human RNAPII-transcribed gene leads to inhibition of transcription elongation and reinitiation. Upon inhibition of DNA protein kinase (DNAPK), RNAPII bypasses the break and continues transcription elongation, suggesting that it is not the break per se that inhibits the processivity of RNAPII, but the activity of DNAPK. We also show that the mechanism of DNAPK-mediated transcription inhibition involves the proteasome-dependent pathway. The results point to the pivotal role of DNAPK activity in the eviction of RNAPII from DNA upon encountering a DNA lesion.

  13. Localization of RNA transcription sites in insect oocytes using microinjections of 5-bromouridine 5'-triphosphate.


    Bogolyubov, Dmitry


    In the present study we used 5-bromouridine 5'-triphosphate (BrUTP) microinjections to localize the transcription sites in oocytes of insects with different types of the ovarium structure: panoistic, meroistic polytrophic, and meroistic telotrophic. We found that in an insect with panoistic ovaries (Acheta domesticus), oocyte nuclei maintain their transcription activity during the long period of oocyte growth. In insects with meroistic ovaries (Tenebrio molitor and Panorpa communis), early oocyte chromosomes were found to be transcriptionally active, and some transcription activity still persist while the karyosphere, a compact structure formed by all condensed oocyte chromosomes, begins to develop. At the latest stages of karyosphere development, no anti-Br-RNA signal was registered in the karyosphere.

  14. Structural mimicry in transcription regulation of human RNA polymerase II by the DNA helicase RECQL5

    PubMed Central

    Kassube, Susanne A.; Jinek, Martin; Fang, Jie; Tsutakawa, Susan; Nogales, Eva


    RECQL5 is a member of the highly conserved RecQ family of DNA helicases involved in DNA repair. RECQL5 interacts with RNA polymerase II (Pol II) and inhibits transcription of protein–coding genes by an unknown mechanism. We show that RECQL5 contacts the Rpb1 jaw domain of Pol II at a site that overlaps with the binding site for the transcription elongation factor TFIIS. Our cryo–electron microscopy structure of elongating Pol II arrested in complex with RECQL5 shows that the RECQL5 helicase domain is positioned to sterically block elongation. The crystal structure of the RECQL5 KIX domain reveals similarities with TFIIS, and binding of RECQL5 to Pol II interferes with the ability of TFIIS to promote transcriptional read–through in vitro. Together, our findings reveal a dual mode of transcriptional repression by RECQL5 that includes structural mimicry of the Pol II–TFIIS interaction. PMID:23748380

  15. The interaction between bacterial transcription factors and RNA polymerase during the transition from initiation to elongation.


    Yang, Xiao; Lewis, Peter J


    There are three stages of transcription: initiation, elongation and termination, and traditionally there has been a clear distinction between the stages. The specificity factor sigma is completely released from bacterial RNA polymerase after initiation, and then recycled for another round of transcription. Elongation factors then associate with the polymerase followed by termination factors (where necessary). These factors dissociate prior to initiation of a new round of transcription. However, there is growing evidence suggesting that sigma factors can be retained in the elongation complex. The structure of bacterial RNAP in complex with an essential elongation factor NusA has recently been published, which suggested rather than competing for the major σ binding site, NusA binds to a discrete region on RNAP. A model was proposed to help explain the way in which both factors could be associated with RNAP during the transition from transcription initiation to elongation.

  16. Does the linear Sry transcript function as a ceRNA for miR-138? The sense of antisense.


    Granados-Riveron, Javier Tadeo; Aquino-Jarquin, Guillermo


    Recently, the sex determining region Y ( Sry) and the cerebellar degeneration-related protein 1 ( CDR1as) RNA transcripts have been described to function as a new class of post-transcriptional regulatory RNAs that behave as circular endogenous RNA sponges for the micro RNAs (miRNAs) miR-138 and miR-7, respectively. A special feature of the Sry gene is its ability to generate linear and circular transcripts, both transcribed in the sense orientation. Here we remark that both sense (e.g. Sry RNA) and antisense (e.g. CDR1as) transcripts could circularize and behave as miRNAs sponges, and importantly, that also protein-coding segments of mRNAs could also assume this role. Thus, it is reasonable to think that the linear Sry sense transcript could additionally act as a miRNA sponge, or as an endogenous competing RNA for miR-138.

  17. Does the linear Sry transcript function as a ceRNA for miR-138? The sense of antisense

    PubMed Central

    Granados-Riveron, Javier Tadeo; Aquino-Jarquin, Guillermo


    Recently, the sex determining region Y ( Sry) and the cerebellar degeneration-related protein 1 ( CDR1as) RNA transcripts have been described to function as a new class of post-transcriptional regulatory RNAs that behave as circular endogenous RNA sponges for the micro RNAs (miRNAs) miR-138 and miR-7, respectively. A special feature of the Sry gene is its ability to generate linear and circular transcripts, both transcribed in the sense orientation. Here we remark that both sense (e.g. Sry RNA) and antisense (e.g. CDR1as) transcripts could circularize and behave as miRNAs sponges, and importantly, that also protein-coding segments of mRNAs could also assume this role. Thus, it is reasonable to think that the linear Sry sense transcript could additionally act as a miRNA sponge, or as an endogenous competing RNA for miR-138. PMID:25580223

  18. World Health Organization International Standard to Harmonize Assays for Detection of Hepatitis E Virus RNA

    PubMed Central

    Blümel, Johannes; Mizusawa, Saeko; Matsubayashi, Keiji; Sakata, Hidekatsu; Okada, Yoshiaki; Nübling, C. Micha; Hanschmann, Kay-Martin O.


    Nucleic acid amplification technique–based assays are a primary method for the detection of acute hepatitis E virus (HEV) infection, but assay sensitivity can vary widely. To improve interlaboratory results for the detection and quantification of HEV RNA, a candidate World Health Organization (WHO) International Standard (IS) strain was evaluated in a collaborative study involving 23 laboratories from 10 countries. The IS, code number 6329/10, was formulated by using a genotype 3a HEV strain from a blood donation, diluted in pooled human plasma and lyophilized. A Japanese national standard, representing a genotype 3b HEV strain, was prepared and evaluated in parallel. The potencies of the standards were determined by qualitative and quantitative assays. Assay variability was substantially reduced when HEV RNA concentrations were expressed relative to the IS. Thus, WHO has established 6329/10 as the IS for HEV RNA, with a unitage of 250,000 International Units per milliliter. PMID:23647659

  19. Interference of hepatitis C virus RNA replication by short interfering RNAs

    NASA Astrophysics Data System (ADS)

    Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.


    Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

  20. Effect of Dynamic Interaction between microRNA and Transcription Factor on Gene Expression

    PubMed Central

    Liu, Hongsheng; Yao, Chenggui


    MicroRNAs (miRNAs) are endogenous noncoding RNAs which participate in diverse biological processes in animals and plants. They are known to join together with transcription factors and downstream gene, forming a complex and highly interconnected regulatory network. To recognize a few overrepresented motifs which are expected to perform important elementary regulatory functions, we constructed a computational model of miRNA-mediated feedforward loops (FFLs) in which a transcription factor (TF) regulates miRNA and targets gene. Based on the different dynamic interactions between miRNA and TF on gene expression, four possible structural topologies of FFLs with two gate functions (AND gate and OR gate) are introduced. We studied the dynamic behaviors of these different motifs. Furthermore, the relationship between the response time and maximal activation velocity of miRNA was investigated. We found that the curve of response time shows nonmonotonic behavior in Co1 loop with OR gate. This may help us to infer the mechanism of miRNA binding to the promoter region. At last we investigated the influence of important parameters on the dynamic response of system. We identified that the stationary levels of target gene in all loops were insensitive to the initial value of miRNA. PMID:27957492

  1. Effect of Dynamic Interaction between microRNA and Transcription Factor on Gene Expression.


    Zhao, Qi; Liu, Hongsheng; Yao, Chenggui; Shuai, Jianwei; Sun, Xiaoqiang


    MicroRNAs (miRNAs) are endogenous noncoding RNAs which participate in diverse biological processes in animals and plants. They are known to join together with transcription factors and downstream gene, forming a complex and highly interconnected regulatory network. To recognize a few overrepresented motifs which are expected to perform important elementary regulatory functions, we constructed a computational model of miRNA-mediated feedforward loops (FFLs) in which a transcription factor (TF) regulates miRNA and targets gene. Based on the different dynamic interactions between miRNA and TF on gene expression, four possible structural topologies of FFLs with two gate functions (AND gate and OR gate) are introduced. We studied the dynamic behaviors of these different motifs. Furthermore, the relationship between the response time and maximal activation velocity of miRNA was investigated. We found that the curve of response time shows nonmonotonic behavior in Co1 loop with OR gate. This may help us to infer the mechanism of miRNA binding to the promoter region. At last we investigated the influence of important parameters on the dynamic response of system. We identified that the stationary levels of target gene in all loops were insensitive to the initial value of miRNA.

  2. tRNA processing defects induce replication stress and Chk2-dependent disruption of piRNA transcription.


    Molla-Herman, Anahi; Vallés, Ana Maria; Ganem-Elbaz, Carine; Antoniewski, Christophe; Huynh, Jean-René


    RNase P is a conserved endonuclease that processes the 5' trailer of tRNA precursors. We have isolated mutations in Rpp30, a subunit of RNase P, and find that these induce complete sterility in Drosophila females. Here, we show that sterility is not due to a shortage of mature tRNAs, but that atrophied ovaries result from the activation of several DNA damage checkpoint proteins, including p53, Claspin, and Chk2. Indeed, we find that tRNA processing defects lead to increased replication stress and de-repression of transposable elements in mutant ovaries. We also report that transcription of major piRNA sources collapse in mutant germ cells and that this correlates with a decrease in heterochromatic H3K9me3 marks on the corresponding piRNA-producing loci. Our data thus link tRNA processing, DNA replication, and genome defense by small RNAs. This unexpected connection reveals constraints that could shape genome organization during evolution.

  3. Minor Contribution of Chimeric Host-HIV Readthrough Transcripts to the Level of HIV Cell-Associated gag RNA.


    Pasternak, Alexander O; DeMaster, Laura K; Kootstra, Neeltje A; Reiss, Peter; O'Doherty, Una; Berkhout, Ben


    Cell-associated HIV unspliced RNA is an important marker of the viral reservoir. HIV gag RNA-specific assays are frequently used to monitor reservoir activation. Because HIV preferentially integrates into actively transcribed genes, some of the transcripts detected by these assays may not represent genuine HIV RNA but rather chimeric host-HIV readthrough transcripts. Here, we demonstrate that in HIV-infected patients on suppressive combination antiretroviral therapy, such host-derived transcripts do not significantly contribute to the HIV gag RNA level.

  4. Oestradiol reduces liver receptor homolog-1 mRNA transcript stability in breast cancer cell lines.


    Lazarus, Kyren A; Zhao, Zhe; Knower, Kevin C; To, Sarah Q; Chand, Ashwini L; Clyne, Colin D


    The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E2), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER- cells. However, the presence of LRH-1 protein in ER- cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER- breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER- compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E2, showed increased mRNA stability in ER- versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E2 treatment, this effect mediated by ERα. Our data demonstrates that in ER- cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER- cells as well as ER- tumors suggests a possible role in the development of ER- tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER- and ER+ breast cancer.

  5. DIANA-LncBase v2: indexing microRNA targets on non-coding transcripts.


    Paraskevopoulou, Maria D; Vlachos, Ioannis S; Karagkouni, Dimitra; Georgakilas, Georgios; Kanellos, Ilias; Vergoulis, Thanasis; Zagganas, Konstantinos; Tsanakas, Panayiotis; Floros, Evangelos; Dalamagas, Theodore; Hatzigeorgiou, Artemis G


    microRNAs (miRNAs) are short non-coding RNAs (ncRNAs) that act as post-transcriptional regulators of coding gene expression. Long non-coding RNAs (lncRNAs) have been recently reported to interact with miRNAs. The sponge-like function of lncRNAs introduces an extra layer of complexity in the miRNA interactome. DIANA-LncBase v1 provided a database of experimentally supported and in silico predicted miRNA Recognition Elements (MREs) on lncRNAs. The second version of LncBase ( presents an extensive collection of miRNA:lncRNA interactions. The significantly enhanced database includes more than 70 000 low and high-throughput, (in)direct miRNA:lncRNA experimentally supported interactions, derived from manually curated publications and the analysis of 153 AGO CLIP-Seq libraries. The new experimental module presents a 14-fold increase compared to the previous release. LncBase v2 hosts in silico predicted miRNA targets on lncRNAs, identified with the DIANA-microT algorithm. The relevant module provides millions of predicted miRNA binding sites, accompanied with detailed metadata and MRE conservation metrics. LncBase v2 caters information regarding cell type specific miRNA:lncRNA regulation and enables users to easily identify interactions in 66 different cell types, spanning 36 tissues for human and mouse. Database entries are also supported by accurate lncRNA expression information, derived from the analysis of more than 6 billion RNA-Seq reads.

  6. Mechanism of transcription initiation and promoter escape by E. coli RNA polymerase.


    Henderson, Kate L; Felth, Lindsey C; Molzahn, Cristen M; Shkel, Irina; Wang, Si; Chhabra, Munish; Ruff, Emily F; Bieter, Lauren; Kraft, Joseph E; Record, M Thomas


    To investigate roles of the discriminator and open complex (OC) lifetime in transcription initiation by Escherichia coli RNA polymerase (RNAP; α2ββ'ωσ(70)), we compare productive and abortive initiation rates, short RNA distributions, and OC lifetime for the λPR and T7A1 promoters and variants with exchanged discriminators, all with the same transcribed region. The discriminator determines the OC lifetime of these promoters. Permanganate reactivity of thymines reveals that strand backbones in open regions of long-lived λPR-discriminator OCs are much more tightly held than for shorter-lived T7A1-discriminator OCs. Initiation from these OCs exhibits two kinetic phases and at least two subpopulations of ternary complexes. Long RNA synthesis (constrained to be single round) occurs only in the initial phase (<10 s), at similar rates for all promoters. Less than half of OCs synthesize a full-length RNA; the majority stall after synthesizing a short RNA. Most abortive cycling occurs in the slower phase (>10 s), when stalled complexes release their short RNA and make another without escaping. In both kinetic phases, significant amounts of 8-nt and 10-nt transcripts are produced by longer-lived, λPR-discriminator OCs, whereas no RNA longer than 7 nt is produced by shorter-lived T7A1-discriminator OCs. These observations and the lack of abortive RNA in initiation from short-lived ribosomal promoter OCs are well described by a quantitative model in which ∼1.0 kcal/mol of scrunching free energy is generated per translocation step of RNA synthesis to overcome OC stability and drive escape. The different length-distributions of abortive RNAs released from OCs with different lifetimes likely play regulatory roles.

  7. Nonsense-Mediated mRNA Decay Immunity Can Help Identify Human Polycistronic Transcripts

    PubMed Central

    Shahaf, Guy; Shweiki, Dorit


    Eukaryotic polycistronic transcription units are rare and only a few examples are known, mostly being the outcome of serendipitous discovery. We claim that nonsense-mediated mRNA decay (NMD) immune structure is a common characteristic of polycistronic transcripts, and that this immunity is an emergent property derived from all functional CDSs. The human RefSeq transcriptome was computationally screened for transcripts capable of eliciting NMD, and which contain an additional ORF(s) potentially capable of rescuing the transcript from NMD. Transcripts were further analyzed implementing domain-based strategies in order to estimate the potential of the candidate ORF to encode a functional protein. Consequently, we predict the existence of forty nine novel polycistronic transcripts. Experimental verification was carried out utilizing two different types of analyses. First, five Gene Expression Omnibus (GEO) datasets from published NMD-inhibition studies were used, aiming to explore whether a given mRNA is indeed insensitive to NMD. All known bicistronic transcripts and eleven out of the twelve predicted genes that were analyzed, displayed NMD insensitivity using various NMD inhibitors. For three genes, a mixed expression pattern was observed presenting both NMD sensitivity and insensitivity in different cell types. Second, we used published global translation initiation sequencing data from HEK293 cells to verify the existence of translation initiation sites in our predicted polycistronic genes. In five of our genes, the predicted rescuing uORFs are indeed identified as translation initiation sites, and in two additional genes, one of two predicted rescuing uORF is verified. These results validate our computational analysis and reinforce the possibility that NMD-immune architecture is a parameter by which polycistronic genes can be identified. Moreover, we present evidence for NMD-mediated regulation controlling the production of one or more proteins encoded in the

  8. RNA-Seq Quantification of Hepatic Drug Processing Genes in Germ-Free Mice

    PubMed Central

    Selwyn, Felcy Pavithra; Cui, Julia Yue


    Intestinal bacteria have been shown to be important in regulating host intermediary metabolism and contributing to obesity. However, relatively less is known about the effect of intestinal bacteria on the expression of hepatic drug-processing genes in the host. This study characterizes the expression of hepatic drug-processing genes in germ-free (GF) mice using RNA-Seq. Total RNA were isolated from the livers of adult male conventional and GF C57BL/6J mice (n = 3 per group). In the livers of GF mice, the mRNA of the aryl hydrocarbon receptor target gene Cyp1a2 was increased 51%, and the mRNA of the peroxisome proliferator-activated receptor α (PPARα) target gene Cyp4a14 was increased 202%. Conversely, the mRNA of the constitutive androstane receptor (CAR) target gene Cyp2b10 was decreased 57%, and the mRNA of the pregnane X receptor target gene Cyp3a11 was decreased 87% in GF mice. Although other non-Cyp phase-1 enzymes in the livers of GF mice were only moderately affected, there was a marked down-regulation in the phase-2 enzymes glutathione S-transferases p1 and p2, as well as a marked up-regulation in the major bile acid transporters Na+-taurocholate cotransporting polypeptide and organic anion-transporting polypeptide 1b2, and the cholesterol transporter ATP-binding cassette transporter Abcg5/Abcg8. This study demonstrates that intestinal bacteria regulate the expression of a large number of drug-processing genes, which suggests that intestinal bacteria are responsible for some individual differences in drug responses. PMID:25956306


    PubMed Central

    Burkhead, Jason L.; Ralle, Martina; Wilmarth, Phillip; David, Larry; Lutsenko, Svetlana


    Copper is essential to mammalian physiology and its homeostasis is tightly regulated. In humans, genetic defects in copper excretion result in copper overload and Wilson's disease (WD). Previous studies in the mouse model for WD (Atp7b-/-) revealed copper accumulation in hepatic nuclei and specific changes in the mRNA profile prior to pathology onset. To find a molecular link between nuclear copper elevation and changes in hepatic transcriptome we utilized quantitative ionomic and proteomic approaches. X-ray fluorescence and ICP-MS analysis indicate that copper in Atp7b-/- nucleus, while highly elevated, does not markedly alter nuclear ion content. Widespread protein oxidation is also not observed, although glutathione reductase SelH is upregulated, likely to maintain redox balance. We further demonstrate that accumulating copper affects abundance and/or modification of a distinct subset of nuclear proteins. These proteins populate pathways most significantly associated with RNA processing. An alteration in the splicing pattern was observed for hnRNP A2/B1, itself the RNA shuttling factor and spliceosome component. Analysis of hnRNP A2/B1 mRNA and protein revealed an increased retention of exon 2 and a selective 2-fold upregulation of a corresponding protein spliced variant. Mass-spectrometry measurements suggest that the nucleo-cytoplasmic distribution of RNA binding proteins, including A2/B1, is altered in the Atp7b-/- liver. We conclude that remodeling of RNA processing machinery is an important component in cells’ response to elevated copper that may guide pathology development in early stages of WD. PMID:21146535

  10. RNA polymerase I transcription factors in active yeast rRNA gene promoters enhance UV damage formation and inhibit repair.


    Meier, Andreas; Thoma, Fritz


    UV photofootprinting and repair of pyrimidine dimers by photolyase was used to investigate chromatin structure, protein-DNA interactions, and DNA repair in the spacer and promoter of Saccharomyces cerevisiae rRNA genes. Saccharomyces cerevisiae contains about 150 copies of rRNA genes separated by nontranscribed spacers. Under exponential growth conditions about half of the genes are transcribed by RNA polymerase I (RNAP-I). Initiation of transcription requires the assembly of the upstream activating factor (UAF), the core factor (CF), TATA binding protein, and RNAP-I with Rrn3p on the upstream element and core promoter. We show that UV irradiation of wild-type cells and transcription factor mutants generates photofootprints in the promoter elements. The core footprint depends on UAF, while the UAF footprint was also detected in absence of the CFs. Fractionation of active and inactive promoters showed the core footprint mainly in the active fraction and similar UAF footprints in both fractions. DNA repair by photolyase was strongly inhibited in active promoters but efficient in inactive promoters. The data suggest that UAF is present in vivo in active and inactive promoters and that recruitment of CF and RNAP-I to active promoters generates a stable complex which inhibits repair.

  11. Evidence implicating Ku antigen as a structural factor in RNA polymerase II-mediated transcription.


    Bertinato, Jesse; Tomlinson, Julianna J; Schild-Poulter, Caroline; Haché, Robert J G


    Ku antigen is an abundant nuclear protein with multiple functions that depend mainly on Ku's prolific and highly verstatile interactions with DNA. We have shown previously that the direct binding of Ku in vitro to negative regulatory element 1 (NRE1), a transcriptional regulatory element in the long terminal repeat of mouse mammary tumour virus, correlates with the regulation of viral transcription by Ku. In this study, we have sought to explore the interaction of Ku with NRE1 in vivo in yeast one-hybrid experiments. Unexpectedly, we observed that human Ku70 carrying a transcriptional activation domain from the yeast Gal4 protein induced transcription of yeast reporter genes pleiotrophically, independent of NRE1, promoter, reporter gene and chromosomal location. Ku80 with the same activation domain had no effect on transcription when expressed alone, but reconstituted activation when co-expressed with native human Ku70. The requirements for transcriptional activation by Ku-Gal4 activation domain proteins correlated with previous descriptions of the requirements for DNA sequence-independent DNA binding by Ku, but were distinct from determinants for DNA-end binding by a truncated Ku heterodimer determined recently by crystallography. These results suggest a preferential targeting of Ku to transcriptionally active chromatin that indicate a possible function for Ku within the RNA polymerase II holoenzyme.

  12. Real-time observation of the initiation of RNA polymerase II transcription.


    Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M


    Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.

  13. RNA-seq Analysis of Early Hepatic Response to Handling and Confinement Stress in Rainbow Trout

    PubMed Central

    Liu, Sixin; Gao, Guangtu; Palti, Yniv; Cleveland, Beth M.; Weber, Gregory M.; Rexroad, Caird E.


    Fish under intensive rearing conditions experience various stressors which have negative impacts on survival, growth, reproduction and fillet quality. Identifying and characterizing the molecular mechanisms underlying stress responses will facilitate the development of strategies that aim to improve animal welfare and aquaculture production efficiency. In this study, we used RNA-seq to identify transcripts which are differentially expressed in the rainbow trout liver in response to handling and confinement stress. These stressors were selected due to their relevance in aquaculture production. Total RNA was extracted from the livers of individual fish in five tanks having eight fish each, including three tanks of fish subjected to a 3 hour handling and confinement stress and two control tanks. Equal amount of total RNA of six individual fish was pooled by tank to create five RNA-seq libraries which were sequenced in one lane of Illumina HiSeq 2000. Three sequencing runs were conducted to obtain a total of 491,570,566 reads which were mapped onto the previously generated stress reference transcriptome to identify 316 differentially expressed transcripts (DETs). Twenty one DETs were selected for qPCR to validate the RNA-seq approach. The fold changes in gene expression identified by RNA-seq and qPCR were highly correlated (R2 = 0.88). Several gene ontology terms including transcription factor activity and biological process such as glucose metabolic process were enriched among these DETs. Pathways involved in response to handling and confinement stress were implicated by mapping the DETs to reference pathways in the KEGG database. Accession Numbers Raw RNA-seq reads have been submitted to the NCBI Short Read Archive under accession number SRP022881. Customized Perl Scripts All customized scripts described in this paper are available from Dr. Guangtu Gao or the corresponding author. PMID:24558395

  14. Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation

    PubMed Central

    Selinger, Douglas W.; Saxena, Rini Mukherjee; Cheung, Kevin J.; Church, George M.; Rosenow, Carsten


    Subgenic-resolution oligonucleotide microarrays were used to study global RNA degradation in wild-type Escherichia coli MG1655. RNA chemical half-lives were measured for 1036 open reading frames (ORFs) and for 329 known and predicted operons. The half-life of total mRNA was 6.8 min under the conditions tested. We also observed significant relationships between gene functional assignments and transcript stability. Unexpectedly, transcription of a single operon (tdcABCDEFG) was relatively rifampicin-insensitive and showed significant increases 2.5 min after rifampicin addition. This supports a novel mechanism of transcription for the tdc operon, whose promoter lacks any recognizable ς binding sites. Probe by probe analysis of all known and predicted operons showed that the 5′ ends of operons degrade, on average, more quickly than the rest of the transcript, with stability increasing in a 3′ direction, supporting and further generalizing the current model of a net 5′ to 3′ directionality of degradation. Hierarchical clustering analysis of operon degradation patterns revealed that this pattern predominates but is not exclusive. We found a weak but highly significant correlation between the degradation of adjacent operon regions, suggesting that stability is determined by a combination of local and operon-wide stability determinants. The 16 ORF dcw gene cluster, which has a complex promoter structure and a partially characterized degradation pattern, was studied at high resolution, allowing a detailed and integrated description of its abundance and degradation. We discuss the application of subgenic resolution DNA microarray analysis to study global mechanisms of RNA transcription and processing. PMID:12566399

  15. A small circular TAR RNA decoy specifically inhibits Tat-activated HIV-1 transcription.

    PubMed Central

    Bohjanen, P R; Colvin, R A; Puttaraju, M; Been, M D; Garcia-Blanco, M A


    Linear TAR RNA has previously been used as a decoy to inhibit HIV-1 transcription in vitro and HIV-1 replication in vivo. A 48 nucleotide circular RNA containing the stem, bulge and loop of the HIV-1 TAR element was synthesized using the self-splicing activity of a group I permuted intron-exon and was tested for its ability to function as a TAR decoy in vitro. This small circular TAR molecule was exceptionally stable in HeLa nuclear extracts, whereas a similar linear TAR molecule was rapidly degraded. The TAR circle bound specifically to Tfr38, a peptide containing the TAR-binding region of Tat. The ability of Tat to trans-activate transcription from the HIV-1 promoter in vitro was efficiently inhibited by circular TAR RNA but not by TAR circles that contained either bulge or loop mutations. TAR circles did not inhibit transactivation exclusively by binding to Tat since this inhibition was not reversed by adding excess Tat to the transcription reaction. Together, these data suggest that TAR circles act as decoys that inhibit transactivation by binding to Tat and at least one cellular factor. These data also demonstrate the utility of small circular RNA molecules as tools for biochemical studies. PMID:8871552

  16. Improving fold activation of small transcription activating RNAs (STARs) with rational RNA engineering strategies.


    Meyer, Sarai; Chappell, James; Sankar, Sitara; Chew, Rebecca; Lucks, Julius B


    Regulatory RNAs have become integral components of the synthetic biology and bioengineering toolbox for controlling gene expression. We recently expanded this toolbox by creating small transcription activating RNAs (STARs) that act by disrupting the formation of a target transcriptional terminator hairpin placed upstream of a gene. While STARs are a promising addition to the repertoire of RNA regulators, much work remains to be done to optimize the fold activation of these systems. Here we apply rational RNA engineering strategies to improve the fold activation of two STAR regulators. We demonstrate that a combination of promoter strength tuning and multiple RNA engineering strategies can improve fold activation from 5.4-fold to 13.4-fold for a STAR regulator derived from the pbuE riboswitch terminator. We then validate the generality of our approach and show that these same strategies improve fold activation from 2.1-fold to 14.6-fold for an unrelated STAR regulator, opening the door to creating a range of additional STARs to use in a broad array of biotechnologies. We also establish that the optimizations preserve the orthogonality of these STARs between themselves and a set of RNA transcriptional repressors, enabling these optimized STARs to be used in sophisticated circuits.

  17. RNA replication kinetics, genetic polymorphism and selection in the case of the hepatitis C virus.

    PubMed Central

    Stumpf, M. P.; Zitzmann, N.


    We show in a simple theoretical quasispecies model that the replication dynamics of hepatitis C virus and a related model-system, the bovine viral diarrhoea virus, result in an effective reduction of RNA templates in infected cells. Viral fitness does not translate directly into RNA sequence replication efficiency, and hence the abundance of the viral master sequences diminishes over time. Our results suggest that genes not involved in RNA replication accumulate mutations over time because they do not undergo selection during this phase. The selection of viral RNA occurs not only during replication but also during the ensuing stages of the viral life cycle: (i) envelopment of viral RNA and (ii) successful infection of other cells, which also requires functionality of non-replicative genes. In particular, viral fitness requires the ability of the genome to encode structural proteins which do not encounter selective pressure during RNA replication. We conclude by discussing the potential value of antiviral drugs which inhibit selection on parts of the viral genome. PMID:11571045

  18. Reduced genetic distance and high replication levels increase the RNA recombination rate of hepatitis delta virus.


    Lin, Chia-Chi; Yang, Zhi-Wei; Iang, Shan-Bei; Chao, Mei


    Hepatitis delta virus (HDV) replication is carried out by host RNA polymerases. Since homologous inter-genotypic RNA recombination is known to occur in HDV, possibly via a replication-dependent process, we hypothesized that the degree of sequence homology and the replication level should be related to the recombination frequency in cells co-expressing two HDV sequences. To confirm this, we separately co-transfected cells with three different pairs of HDV genomic RNAs and analyzed the obtained recombinants by RT-PCR followed by restriction fragment length polymorphism and sequencing analyses. The sequence divergence between the clones ranged from 24% to less than 0.1%, and the difference in replication levels was as high as 100-fold. As expected, significant differences were observed in the recombination frequencies, which ranged from 0.5% to 47.5%. Furthermore, varying the relative amounts of parental RNA altered the dominant recombinant species produced, suggesting that template switching occurs frequently during the synthesis of genomic HDV RNA. Taken together, these data suggest that during the host RNA polymerase-driven RNA recombination of HDV, both inter- and intra-genotypic recombination events are important in shaping the genetic diversity of HDV.

  19. On-chip purification and detection of hepatitis C virus RNA from human plasma.


    Vaghi, V; Potrich, C; Pasquardini, L; Lunelli, L; Vanzetti, L; Ebranati, E; Lai, A; Zehender, G; Mombello, D; Cocuzza, M; Pirri, C F; Pederzolli, C


    Hepatitis C virus (HCV) is one of the main causes of chronic liver disease worldwide. The diagnosis and monitoring of HCV infection is a crucial need in the clinical management. The conventional diagnostic technologies are challenged when trying to address molecular diagnostics, especially because they require a complex and time-consuming sample preparation phase. Here, a new concept based on surface functionalization was applied to viral RNA purification: first of all polydimethylsiloxane (PDMS) flat surfaces were modified to hold RNA adsorption. After a careful chemical and morphological analysis of the modified surfaces, the functionalization protocols giving the best RNA adsorbing surfaces were applied to PDMS microdevices. The functionalized microdevices were then used for RNA purification from HCV infected human plasma samples. RNA purification and RT were successfully performed in the same microdevice chamber, saving time of analysis, reagents, and labor. The PCR protocol for HCV cDNA amplification was also implemented in the microdevice, demonstrating that the entire process of HCV analysis, from plasma to molecular readout, could be performed on-chip. Not only HCV but also other microdevice-based viral RNA detection could therefore result in a successful Point-of-Care (POC) diagnostics for resource-limited settings.

  20. Dissecting the expression relationships between RNA-binding proteins and their cognate targets in eukaryotic post-transcriptional regulatory networks

    NASA Astrophysics Data System (ADS)

    Nishtala, Sneha; Neelamraju, Yaseswini; Janga, Sarath Chandra


    RNA-binding proteins (RBPs) are pivotal in orchestrating several steps in the metabolism of RNA in eukaryotes thereby controlling an extensive network of RBP-RNA interactions. Here, we employed CLIP (cross-linking immunoprecipitation)-seq datasets for 60 human RBPs and RIP-ChIP (RNP immunoprecipitation-microarray) data for 69 yeast RBPs to construct a network of genome-wide RBP- target RNA interactions for each RBP. We show in humans that majority (~78%) of the RBPs are strongly associated with their target transcripts at transcript level while ~95% of the studied RBPs were also found to be strongly associated with expression levels of target transcripts when protein expression levels of RBPs were employed. At transcript level, RBP - RNA interaction data for the yeast genome, exhibited a strong association for 63% of the RBPs, confirming the association to be conserved across large phylogenetic distances. Analysis to uncover the features contributing to these associations revealed the number of target transcripts and length of the selected protein-coding transcript of an RBP at the transcript level while intensity of the CLIP signal, number of RNA-Binding domains, location of the binding site on the transcript, to be significant at the protein level. Our analysis will contribute to improved modelling and prediction of post-transcriptional networks.

  1. Old drug, new target: ellipticines selectively inhibit RNA polymerase I transcription.


    Andrews, William J; Panova, Tatiana; Normand, Christophe; Gadal, Olivier; Tikhonova, Irina G; Panov, Konstantin I


    Transcription by RNA polymerase I (Pol-I) is the main driving force behind ribosome biogenesis, a fundamental cellular process that requires the coordinated transcription of all three nuclear polymerases. Increased Pol-I transcription and the concurrent increase in ribosome biogenesis has been linked to the high rates of proliferation in cancers. The ellipticine family contains a number of potent anticancer therapeutic agents, some having progressed to stage I and II clinical trials; however, the mechanism by which many of the compounds work remains unclear. It has long been thought that inhibition of Top2 is the main reason behind the drugs antiproliferative effects. Here we report that a number of the ellipticines, including 9-hydroxyellipticine, are potent and specific inhibitors of Pol-I transcription, with IC(50) in vitro and in cells in the nanomolar range. Essentially, the drugs did not affect Pol-II and Pol-III transcription, demonstrating a high selectivity. We have shown that Pol-I inhibition occurs by a p53-, ATM/ATR-, and Top2-independent mechanism. We discovered that the drug influences the assembly and stability of preinitiation complexes by targeting the interaction between promoter recognition factor SL1 and the rRNA promoter. Our findings will have an impact on the design and development of novel therapeutic agents specifically targeting ribosome biogenesis.

  2. DNA structural variation affects complex formation and promoter melting in ribosomal RNA transcription.


    Marilley, M; Radebaugh, C A; Geiss, G K; Laybourn, P J; Paule, M R


    Eukaryotic ribosomal RNA promoters exhibit an unusual conservation of non-canonical DNA structure (curvature, twist angle and duplex stability) despite a lack of primary sequence conservation. This raises the possibility that rRNA transcription factors might utilize structural anomalies in their sequence recognition process. We have analyzed in detail the interaction of the polymerase I transcription factor TIF-IB from Acanthmoeba castellanii with the CORE promoter. TIF-IB interacts primarily with the minor groove of the promoter. By correlating the effects on transcription and on DNA structure of promoter point mutations, we show that the TIF-IB interaction is strongly inhibited by increases in minor groove width. This suggests that a particular DNA structure is required for interaction with the transcription factor. In addition, TIF-IB induces a small bend in the promoter upon binding. Modeling of this bend reveals that it requires an additional narrowing of the minor groove, which would favor binding to mutants with narrower grooves. We also discuss how this narrowing would induce a small destabilization of the helix upstream of the transcription start site. Telestability predicts this would result in destabilization of the sequence that melts during initiation, suggesting that TIF-IB may have a role in stimulating melting.

  3. sRNA-Mediated Control of Transcription Termination in E. coli.


    Sedlyarova, Nadezda; Shamovsky, Ilya; Bharati, Binod K; Epshtein, Vitaly; Chen, Jiandong; Gottesman, Susan; Schroeder, Renée; Nudler, Evgeny


    Bacterial small RNAs (sRNAs) have been implicated in various aspects of post-transcriptional gene regulation. Here, we demonstrate that sRNAs also act at the level of transcription termination. We use the rpoS gene, which encodes a general stress sigma factor σ(S), as a model system, and show that sRNAs DsrA, ArcZ, and RprA bind the rpoS 5'UTR to suppress premature Rho-dependent transcription termination, both in vitro and in vivo. sRNA-mediated antitermination markedly stimulates transcription of rpoS during the transition to the stationary phase of growth, thereby facilitating a rapid adjustment of bacteria to global metabolic changes. Next generation RNA sequencing and bioinformatic analysis indicate that Rho functions as a global "attenuator" of transcription, acting at the 5'UTR of hundreds of bacterial genes, and that its suppression by sRNAs is a widespread mode of bacterial gene regulation.

  4. The elongation factor Spt4/5 regulates RNA polymerase II transcription through the nucleosome.


    Crickard, John B; Lee, Jaehyoun; Lee, Tae-Hee; Reese, Joseph C


    RNA polymerase II (RNAPII) passes through the nucleosome in a coordinated manner, generating several intermediate nucleosomal states as it breaks and then reforms histone-DNA contacts ahead of and behind it, respectively. Several studies have defined transcription-induced nucleosome intermediates using only RNA Polymerase. However, RNAPII is decorated with elongation factors as it transcribes the genome. One such factor, Spt4/5, becomes an integral component of the elongation complex, making direct contact with the 'jaws' of RNAPII and nucleic acids in the transcription scaffold. We have characterized the effect of incorporating Spt4/5 into the elongation complex on transcription through the 601R nucleosome. Spt4/5 suppressed RNAPII pausing at the major H3/H4-induced arrest point, resulting in downstream re-positioning of RNAPII further into the nucleosome. Using a novel single molecule FRET system, we found that Spt4/5 affected the kinetics of DNA re-wrapping and stabilized a nucleosomal intermediate with partially unwrapped DNA behind RNAPII. Comparison of nucleosomes of different sequence polarities suggest that the strength of the DNA-histone interactions behind RNAPII specifies the Spt4/5 requirement. We propose that Spt4/5 may be important to coordinate the mechanical movement of RNAPII through the nucleosome with co-transcriptional chromatin modifications during transcription, which is affected by the strength of histone-DNA interactions.

  5. Transcription of the non-coding RNA upperhand controls Hand2 expression and heart development

    PubMed Central

    Anderson, Kelly M.; Anderson, Douglas M.; McAnally, John R.; Shelton, John M.; Bassel-Duby, Rhonda; Olson, Eric N.


    HAND2 is an ancestral regulator of heart development and one of four transcription factors that control the reprogramming of fibroblasts into cardiomyocytes1–4. Deletion of Hand2 in mice results in right ventricle hypoplasia and embryonic lethality1,5. Hand2 expression is tightly regulated by upstream enhancers6,7 that reside within a super-enhancer delineated by histone H3 acetyl Lys27 (H3K27ac) modifications8. Here we show that transcription of a Hand2-associated long non-coding RNA, which we named upperhand (Uph), is required to maintain the super-enhancer signature and elongation of RNA polymerase II through the Hand2 enhancer locus. Blockade of Uph transcription, but not knockdown of the mature transcript, abolished Hand2 expression, causing right ventricular hypoplasia and embryonic lethality in mice. Given the substantial number of uncharacterized promoter-associated long non-coding RNAs encoded by the mammalian genome9, the Uph–Hand2 regulatory partnership offers a mechanism by which divergent non-coding transcription can establish a permissive chromatin environment. PMID:27783597

  6. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints.


    Ambrosone, Alfredo; Costa, Antonello; Leone, Antonella; Grillo, Stefania


    RNA-binding proteins (RBPs) govern many aspects of RNA metabolism, including pre-mRNA processing, transport, stability/decay and translation. Although relatively few plant RNA-binding proteins have been characterized genetically and biochemically, more than 200 RBP genes have been predicted in Arabidopsis and rice genomes, suggesting that they might serve specific plant functions. Besides their role in normal cellular functions, RBPs are emerging also as an interesting class of proteins involved in a wide range of post-transcriptional regulatory events that are important in providing plants with the ability to respond rapidly to changes in environmental conditions. Here, we review the most recent results and evidence on the functional role of RBPs in plant adaptation to various unfavourable environmental conditions and their contribution to enhance plant tolerance to abiotic stresses, with special emphasis on osmotic and temperature stress.

  7. Catching RNA Polymerase in the act of Binding: Intermediates in Transcription Illuminated by Synchrotron Footprinting

    SciTech Connect

    Brenowitz,M.; Erie, D.; Chance, M.


    The article by Sclavi et al. in this issue of PNAS addresses 'initiation, ' the first step in transcription. Gene transcription is catalyzed in cells by large multisubunit proteins called RNA polymerases (RNAP). The eubacteria holoenzyme of RNAP is composed of five core subunits ({alpha}, {alpha}2, {beta}, {beta}', and {omega}) that contain the amino acid residues required for the enzyme's catalytic activity. A sixth subunit ({sigma}) guides RNAP to specific sequences on the genomic DNA (promoters) that mark the beginning of a gene or group of genes.

  8. Genesis of ancestral haplotypes: RNA modifications and reverse transcription-mediated polymorphisms.


    Steele, Edward J; Williamson, Joseph F; Lester, Susan; Stewart, Brent J; Millman, John A; Carnegie, Pat; Lindley, Robyn A; Pain, Geoff N; Dawkins, Roger L


    Understanding the genesis of the block haplotype structure of the genome is a major challenge. With the completion of the sequencing of the Human Genome and the initiation of the HapMap project the concept that the chromosomes of the mammalian genome are a mosaic, or patchwork, of conserved extended block haplotype sequences is now accepted by the mainstream genomics research community. Ancestral Haplotypes (AHs) can be viewed as a recombined string of smaller Polymorphic Frozen Blocks (PFBs). How have such variant extended DNA sequence tracts emerged in evolution? Here the relevant literature on the problem is reviewed from various fields of molecular and cell biology particularly molecular immunology and comparative and functional genomics. Based on our synthesis we then advance a testable molecular and cellular model. A critical part of the analysis concerns the origin of the strand biased mutation signatures in the transcribed regions of the human and higher primate genome, A-to-G versus T-to-C (ratio ∼ 1.5 fold) and C-to-T versus G-to-A (≥ 1.5 fold). A comparison and evaluation of the current state of the fields of immunoglobulin Somatic Hypermutation (SHM) and Transcription-Coupled DNA Repair focused on how mutations in newly synthesized RNA might be copied back to DNA thus accounting for some of the genome-wide strand biases (e.g., the A-to-G vs T-to-C component of the strand biased spectrum). We hypothesize that the genesis of PFBs and extended AHs occurs during mutagenic episodes in evolution (e.g., retroviral infections) and that many of the critical DNA sequence diversifying events occur first at the RNA level, e.g., recombination between RNA strings resulting in tandem and dispersed RNA duplications (retroduplications), RNA mutations via adenosine-to-inosine pre-mRNA editing events as well as error prone RNA synthesis. These are then copied back into DNA by a cellular reverse transcription process (also likely to be error-prone) that we have called

  9. Cleavage of tRNA within the mature tRNA sequence by the catalytic RNA of RNase P: implication for the formation of the primer tRNA fragment for reverse transcription in copia retrovirus-like particles.

    PubMed Central

    Kikuchi, Y; Sasaki, N; Ando-Yamagami, Y


    The retrovirus-like particles of Drosophila are intermediates of retrotransposition of the transposable element copia. In these particles, a 39-nucleotide-long fragment from the 5' region of Drosophila initiator methionine tRNA (tRNA(iMet) is used as the primer for copia minus-strand reverse transcription. To function as primer for this reverse transcription, the Drosophila tRNA(iMet) must be cleaved in vivo at the site between nucleotides 39 and 40. When a synthetic Drosophila tRNA(iMet) precursor was incubated with M1RNA, the catalytic RNA of Escherichia coli RNase P, other cleavages within the mature tRNA sequence were detected in addition to the efficient removal of the 5' leader sequence of this tRNA precursor. One of these cleavage sites is between nucleotides 39 and 40 of Drosophila tRNA(iMet). Based on this result, we propose a model for formation of the primer tRNA fragment for reverse transcription in copia retrovirus-like particles. Images PMID:1700426

  10. Transcription-dependent nucleolar cap localization and possible nuclear function of DExH RNA helicase RHAU

    SciTech Connect

    Iwamoto, Fumiko; Stadler, Michael; Chalupnikova, Katerina; Oakeley, Edward; Nagamine, Yoshikuni


    RHAU (RNA helicase associated with AU-rich element) is a DExH protein originally identified as a factor accelerating AU-rich element-mediated mRNA degradation. The discovery that RHAU is predominantly localized in the nucleus, despite mRNA degradation occurring in the cytoplasm, prompted us to consider the nuclear functions of RHAU. In HeLa cells, RHAU was found to be localized throughout the nucleoplasm with some concentrated in nuclear speckles. Transcriptional arrest altered the localization to nucleolar caps, where RHAU is closely localized with RNA helicases p68 and p72, suggesting that RHAU is involved in transcription-related RNA metabolism in the nucleus. To see whether RHAU affects global gene expression transcriptionally or posttranscriptionally, we performed microarray analysis using total RNA from RHAU-depleted HeLa cell lines, measuring both steady-state mRNA levels and mRNA half-lives by actinomycin D chase. There was no change in the half-lives of most transcripts whose steady-state levels were affected by RHAU knockdown, suggesting that these transcripts are subjected to transcriptional regulation. We propose that RHAU has a dual function, being involved in both the synthesis and degradation of mRNA in different subcellular compartments.

  11. Global Analysis of mRNA Half-Lives and de novo Transcription in a Dinoflagellate, Karenia brevis

    PubMed Central

    Morey, Jeanine S.; Van Dolah, Frances M.


    Dinoflagellates possess many physiological processes that appear to be under post-transcriptional control. However, the extent to which their genes are regulated post-transcriptionally remains unresolved. To gain insight into the roles of differential mRNA stability and de novo transcription in dinoflagellates, we biosynthetically labeled RNA with 4-thiouracil to isolate newly transcribed and pre-existing RNA pools in Karenia brevis. These isolated fractions were then used for analysis of global mRNA stability and de novo transcription by hybridization to a K. brevis microarray. Global K. brevis mRNA half-lives were calculated from the ratio of newly transcribed to pre-existing RNA for 7086 array features using the online software HALO (Half-life Organizer). Overall, mRNA half-lives were substantially longer than reported in other organisms studied at the global level, ranging from 42 minutes to greater than 144 h, with a median of 33 hours. Consistent with well-documented trends observed in other organisms, housekeeping processes, including energy metabolism and transport, were significantly enriched in the most highly stable messages. Shorter-lived transcripts included a higher proportion of transcriptional regulation, stress response, and other response/regulatory processes. One such family of proteins involved in post-transcriptional regulation in chloroplasts and mitochondria, the pentatricopeptide repeat (PPR) proteins, had dramatically shorter half-lives when compared to the arrayed transcriptome. As transcript abundances for PPR proteins were previously observed to rapidly increase in response to nutrient addition, we queried the newly synthesized RNA pools at 1 and 4 h following nitrate addition to N-depleted cultures. Transcriptome-wide there was little evidence of increases in the rate of de novo transcription during the first 4 h, relative to that in N-depleted cells, and no evidence for increased PPR protein transcription. These results lend support to

  12. Mutational analysis of hepatitis E virus ORF1 "Y-domain": Effects on RNA replication and virion infectivity

    PubMed Central

    Parvez, Mohammad Khalid


    AIM To investigate the role of non-structural open reading frame 1 “Y-domain” sequences in the hepatitis E virus (HEV) life cycle. METHODS Sequences of human HEV Y-domain (amino acid sequences 216-442) and closely-related viruses were analyzed in silico. Site-directed mutagenesis of the Y-domain (HEV SAR55) was carried out and studied in the replicon-baculovirus-hepatoma cell model. In vitro transcribed mRNA (pSK-GFP) constructs were transfected into S10-3 cells and viral RNA replicating GFP-positive cells were scored by flow cytometry. Mutant virions’ infectivity was assayed on naïve HepG2/C3A cells. RESULTS In silico analysis identified a potential palmitoylation-site (C336C337) and an α-helix segment (L410Y411S412W413L414F415E416) in the HEV Y-domain. Molecular characterization of C336A, C337A and W413A mutants of the three universally conserved residues showed non-viability. Further, of the 10 consecutive saturation mutants covering the entire Y-domain nucleotide sequences (nts 650-1339), three constructs (nts 788-994) severely affected virus replication. This revealed the indispensability of the internal sequences but not of the up- or downstream sequences at the transcriptional level. Interestingly, the three mutated residues corresponded to the downstream codons that tolerated saturation mutation, indicating their post-translational functional/structural essentiality. In addition, RNA secondary structure prediction revealed formation of stable hairpins (nts 788-994) where saturation mutation drastically inhibited virion infectivity. CONCLUSION This is the first demonstration of the critical role of Y-domain sequences in HEV life cycle, which may involve gene regulation and/or membrane binding in intracellular replication complexes. PMID:28216965

  13. lncScore: alignment-free identification of long noncoding RNA from assembled novel transcripts

    PubMed Central

    Zhao, Jian; Song, Xiaofeng; Wang, Kai


    RNA-Seq based transcriptome assembly has been widely used to identify novel lncRNAs. However, the best-performing transcript reconstruction methods merely identified 21% of full-length protein-coding transcripts from H. sapiens. Those partial-length protein-coding transcripts are more likely to be classified as lncRNAs due to their incomplete CDS, leading to higher false positive rate for lncRNA identification. Furthermore, potential sequencing or assembly error that gain or abolish stop codons also complicates ORF-based prediction of lncRNAs. Therefore, it remains a challenge to identify lncRNAs from the assembled transcripts, particularly the partial-length ones. Here, we present a novel alignment-free tool, lncScore, which uses a logistic regression model with 11 carefully selected features. Compared to other state-of-the-art alignment-free tools (e.g. CPAT, CNCI, and PLEK), lncScore outperforms them on accurately distinguishing lncRNAs from mRNAs, especially partial-length mRNAs in the human and mouse datasets. In addition, lncScore also performed well on transcripts from five other species (Zebrafish, Fly, C. elegans, Rat, and Sheep). To speed up the prediction, multithreading is implemented within lncScore, and it only took 2 minute to classify 64,756 transcripts and 54 seconds to train a new model with 21,000 transcripts with 12 threads, which is much faster than other tools. lncScore is available at PMID:27708423

  14. Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines

    SciTech Connect

    Lazarus, Kyren A.; Zhao, Zhe; Knower, Kevin C.; To, Sarah Q.; Chand, Ashwini L.; Clyne, Colin D.


    Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E{sub 2}), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E{sub 2}, showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E{sub 2} treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer.

  15. Robust detection of immune transcripts in FFPE samples using targeted RNA sequencing.


    Paluch, Benjamin E; Glenn, Sean T; Conroy, Jeffrey M; Papanicolau-Sengos, Antonios; Bshara, Wiam; Omilian, Angela R; Brese, Elizabeth; Nesline, Mary; Burgher, Blake; Andreas, Jonathan; Odunsi, Kunle; Eng, Kevin; He, Ji; Qin, Maochun; Gardner, Mark; Galluzzi, Lorenzo; Morrison, Carl D


    Current criteria for identifying cancer patients suitable for immunotherapy with immune checkpoint blockers (ICBs) are subjective and prone to misinterpretation, as they mainly rely on the visual assessment of CD274 (best known as PD-L1) expression levels by immunohistochemistry (IHC). To address this issue, we developed a RNA sequencing (RNAseq)-based approach that specifically measures the abundance of immune transcripts in formalin-fixed paraffin embedded (FFPE) specimens. Besides exhibiting superior sensitivity as compared to whole transcriptome RNAseq, our assay requires little starting material, implying that it is compatible with RNA degradation normally caused by formalin. Here, we demonstrate that a targeted RNAseq panel reliably profiles mRNA expression levels in FFPE samples from a cohort of ovarian carcinoma patients. The expression profile of immune transcripts as measured by targeted RNAseq in FFPE versus freshly frozen (FF) samples from the same tumor was highly concordant, in spite of the RNA quality issues associated with formalin fixation. Moreover, the results of targeted RNAseq on FFPE specimens exhibited a robust correlation with mRNA expression levels as measured on the same samples by quantitative RT-PCR, as well as with protein abundance as determined by IHC. These findings demonstrate that RNAseq profiling on archival FFPE tissues can be used reliably in studies assessing the efficacy of cancer immunotherapy.

  16. Structure of the initiation-competent RNA polymerase I and its implication for transcription

    PubMed Central

    Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick


    Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation. PMID:27418187

  17. RNA Surveillance: Molecular Approaches in Transcript Quality Control and their Implications in Clinical Diseases

    PubMed Central

    Moraes, Karen CM


    Production of mature mRNAs that encode functional proteins involves highly complex pathways of synthesis, processing and surveillance. At numerous steps during the maturation process, the mRNA transcript undergoes scrutiny by cellular quality control machinery. This extensive RNA surveillance ensures that only correctly processed mature mRNAs are translated and precludes production of aberrant transcripts that could encode mutant or possibly deleterious proteins. Recent advances in elucidating the molecular mechanisms of mRNA processing have demonstrated the existence of an integrated network of events, and have revealed that a variety of human diseases are caused by disturbances in the well-coordinated molecular equilibrium of these events. From a medical perspective, both loss and gain of function are relevant, and a considerable number of different diseases exemplify the importance of the mechanistic function of RNA surveillance in a cell. Here, mechanistic hallmarks of mRNA processing steps are reviewed, highlighting the medical relevance of their deregulation and how the understanding of such mechanisms can contribute to the development of therapeutic strategies. PMID:19829759

  18. Structure of the initiation-competent RNA polymerase I and its implication for transcription

    NASA Astrophysics Data System (ADS)

    Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick


    Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation.

  19. MiRNA-Target Interaction Reveals Cell-Specific Post-Transcriptional Regulation in Mammalian Cell Lines

    PubMed Central

    Kulkarni, Varun; Naqvi, Afsar Raza; Uttamani, Juhi Raju; Nares, Salvador


    MicroRNAs are 18–22 nucleotides long, non-coding RNAs that bind transcripts with complementary sequences leading to either mRNA degradation or translational suppression. However, the inherent differences in preferred mode of miRNA regulation among cells of different origin have not been examined. In our previous transcriptome profiling studies, we observed that post-transcriptional regulation can differ substantially depending on the cell in context. Here we examined mechanistic differences in the regulation of a let-7a targeted (wild type) or resistant (mutant) engineered renilla transcript across various mammalian cell lines of diverse origin. Dual luciferase assays show that compared to mutant (mut), the reporter gene containing wild type (wt) let-7a binding sites was efficiently suppressed upon transfection in various cell lines. Importantly, the strength of miRNA regulation varied across the cell lines. Total RNA analysis demonstrates that wt renilla mRNA was expressed to similar or higher levels compared to mut suggesting that translation repression is a predominant mode of miRNA regulation. Nonetheless, transcript degradation was observed in some cell lines. Ago-2 immunoprecipitation show that miRNA repressed renilla mRNA are associated with functional mi-RISC (miRNA-RNA induced silencing complex). Given the immense potential of miRNA as a therapeutic option, these findings highlight the necessity to thoroughly examine the mode of mRNA regulation in order to achieve the beneficial effects in targeting cells. PMID:26761000

  20. Ghrelin modulates fatty acid synthase and related transcription factor mRNA levels in a tissue-specific manner in neonatal broiler chicks.


    Buyse, Johan; Janssen, Sara; Geelissen, Sofie; Swennen, Quirine; Kaiya, Hiroyuki; Darras, Veerle M; Dridi, Sami


    The endogenous ligand for the growth hormone (GH) secretagogue receptor ghrelin is a peptide secreted by the stomach of mammals and stimulates food intake and enhances adiposity. In avian species, ghrelin is mainly produced by the proventriculus but reduces food intake whereas its effect on lipogenesis in different tissues is unknown. We therefore investigated the effects of a single intravenous injection of 2.8 microg (1 nmol per chick) recombinant chicken ghrelin in neonatal broiler chicks. Besides food intake and plasma corticosterone levels, mRNA levels of the key lipogenic enzyme fatty acid synthase (FAS) and its related transcription factors sterol regulatory element binding protein-1 (SREBP-1) and peroxisome proliferator-activated receptor-gamma (PPARgamma) were determined in diencephalon, liver and quadriceps femoris muscle before, and 15, 30, and 60 min after injection. Chicken ghrelin administration induced a significant short-term (<30 min) reduction in food intake and markedly elevated plasma corticosterone levels. In diencephalon, FAS, SREBP-1 and PPARgamma mRNA levels were significantly increased within 15 min after ghrelin injection. These observations suggest that central fatty acid metabolism is involved in the anorectic effects of ghrelin. In contrast, hepatic mRNA levels of FAS and both transcription factors were significantly reduced within 30 min after ghrelin injection. In muscle, FAS and transcription factor gene expression was very low and not affected by ghrelin. Overall, our results indicate that ghrelin has opposite effects on FAS and transcription factor mRNA amounts with increased levels in diencephalon (central anorectic effect) and decreased levels in liver (peripheral anti-lipogenic effect) in chickens.

  1. Unveiling Clusters of RNA Transcript Pairs Associated with Markers of Alzheimer’s Disease Progression

    PubMed Central

    Arefin, Ahmed Shamsul; Mathieson, Luke; Johnstone, Daniel; Berretta, Regina; Moscato, Pablo


    Background One primary goal of transcriptomic studies is identifying gene expression patterns correlating with disease progression. This is usually achieved by considering transcripts that independently pass an arbitrary threshold (e.g. p<0.05). In diseases involving severe perturbations of multiple molecular systems, such as Alzheimer’s disease (AD), this univariate approach often results in a large list of seemingly unrelated transcripts. We utilised a powerful multivariate clustering approach to identify clusters of RNA biomarkers strongly associated with markers of AD progression. We discuss the value of considering pairs of transcripts which, in contrast to individual transcripts, helps avoid natural human transcriptome variation that can overshadow disease-related changes. Methodology/Principal Findings We re-analysed a dataset of hippocampal transcript levels in nine controls and 22 patients with varying degrees of AD. A large-scale clustering approach determined groups of transcript probe sets that correlate strongly with measures of AD progression, including both clinical and neuropathological measures and quantifiers of the characteristic transcriptome shift from control to severe AD. This enabled identification of restricted groups of highly correlated probe sets from an initial list of 1,372 previously published by our group. We repeated this analysis on an expanded dataset that included all pair-wise combinations of the 1,372 probe sets. As clustering of this massive dataset is unfeasible using standard computational tools, we adapted and re-implemented a clustering algorithm that uses external memory algorithmic approach. This identified various pairs that strongly correlated with markers of AD progression and highlighted important biological pathways potentially involved in AD pathogenesis. Conclusions/Significance Our analyses demonstrate that, although there exists a relatively large molecular signature of AD progression, only a small number of

  2. A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination.

    PubMed Central

    Piruat, J I; Aguilera, A


    We have identified two novel yeast genes, THO1 and THO2, that partially suppress the transcription defects of hpr1Delta mutants by overexpression. We show by in vivo transcriptional and recombinational analysis of tho2Delta cells that THO2 plays a role in RNA polymerase II (RNA pol II)-dependent transcription and is required for the stability of DNA repeats, as previously shown for HPR1. The tho2Delta mutation reduces the transcriptional efficiency of yeast DNA sequences down to 25% of the wild-type levels and abolishes transcription of the lacZ sequence. In addition, tho2Delta causes a strong increase in the frequency of recombination between direct repeats (>2000-fold above wild-type levels). Some DNA repeats cannot even be maintained in the cell. This hyper-recombination phenotype is dependent on transcription and is not observed in DNA repeats that are not transcribed. The higher the impairment of transcription caused by tho2Delta, the higher the frequency of recombination of a particular DNA region. The tho2Delta mutation also increases the frequency of plasmid loss. Our work not only identifies a novel yeast gene, THO2, with similar function to HPR1, but also provides new evidence for transcriptional blocks as a source of recombination. We propose that there is a set of proteins including Hpr1p and Tho2p, in the absence of which RNA pol II transcription is stalled or blocked, causing genetic instability. PMID:9707445

  3. Function and Control of RNA Polymerase II C-Terminal Domain Phosphorylation in Vertebrate Transcription and RNA Processing

    PubMed Central

    Hsin, Jing-Ping; Xiang, Kehui


    The C-terminal domain of the RNA polymerase II largest subunit (the Rpb1 CTD) is composed of tandem heptad repeats of the consensus sequence Y1S2P3T4S5P6S7. We reported previously that Thr 4 is phosphorylated and functions in histone mRNA 3′-end formation in chicken DT40 cells. Here, we have extended our studies on Thr 4 and to other CTD mutations by using these cells. We found that an Rpb1 derivative containing only the N-terminal half of the CTD, as well as a similar derivative containing all-consensus repeats (26r), conferred full viability, while the C-terminal half, with more-divergent repeats, did not, reflecting a strong and specific defect in snRNA 3′-end formation. Mutation in 26r of all Ser 2 (S2A) or Ser 5 (S5A) residues resulted in lethality, while Ser 7 (S7A) mutants were fully viable. While S2A and S5A cells displayed defects in transcription and RNA processing, S7A cells behaved identically to 26r cells in all respects. Finally, we found that Thr 4 was phosphorylated by cyclin-dependent kinase 9 in cells and dephosphorylated both in vitro and in vivo by the phosphatase Fcp1. PMID:24752900

  4. Long Non-coding RNA Growth Arrest-specific Transcript 5 (GAS5) Inhibits Liver Fibrogenesis through a Mechanism of Competing Endogenous RNA*

    PubMed Central

    Yu, Fujun; Zheng, Jianjian; Mao, Yuqing; Dong, Peihong; Lu, Zhongqiu; Li, Guojun; Guo, Chuanyong; Liu, Zhanju; Fan, Xiaoming


    Effective control of hepatic stellate cell (HSC) activation and proliferation is critical to the treatment of liver fibrosis. Long non-coding RNAs have been shown to play a pivotal role in the regulation of cellular processes. It has been reported that growth arrest-specific transcript 5 (GAS5) acts as a crucial mediator in the control of cell proliferation and growth. However, little is known about the role and underlying mechanism of GAS5 in liver fibrosis. In this study, our results indicated that GAS5 expression was reduced in mouse, rat, and human fibrotic liver samples and in activated HSCs. Overexpression of GAS5 suppressed the activation of primary HSCs in vitro and alleviated the accumulation of collagen in fibrotic liver tissues in vivo. We identified GAS5 as a target of microRNA-222 (miR-222) and showed that miR-222 could inhibit the expression of GAS5. Interestingly, GAS5 could also repress miR-222 expression. A pulldown assay further validated that GAS5 could directly bind to miR-222. As a competing endogenous RNAs, GAS5 had no effect on primary miR-222 expression. In addition, GAS5 was mainly localized in the cytoplasm. Quantitative RT-PCR further demonstrated that the copy numbers of GAS5 per cell are higher than those of miR-222. GAS5 increased the level of p27 protein by functioning as a competing endogenous RNA for miR-222, thereby inhibiting the activation and proliferation of HSCs. Taken together, a new regulatory circuitry in liver fibrosis has been identified in which RNAs cross-talk by competing for shared microRNAs. Our findings may provide a new therapeutic strategy for liver fibrosis. PMID:26446789

  5. Critical analysis of rhinovirus RNA load quantification by real-time reverse transcription-PCR.


    Schibler, Manuel; Yerly, Sabine; Vieille, Gaël; Docquier, Mylène; Turin, Lara; Kaiser, Laurent; Tapparel, Caroline


    Rhinoviruses are the most frequent cause of human respiratory infections, and quantitative rhinovirus diagnostic tools are needed for clinical investigations. Although results obtained by real-time reverse-transcription PCR (RT-PCR) assays are frequently converted to viral RNA loads, this presents several limitations regarding accurate virus RNA quantification, particularly given the need to reliably quantify all known rhinovirus genotypes with a single assay. Using an internal extraction control and serial dilutions of an in vitro-transcribed rhinovirus RNA reference standard, we validated a quantitative one-step real-time PCR assay. We then used chimeric rhinovirus genomes with 5'-untranslated regions (5'UTRs) originating from the three rhinovirus species and from one enterovirus to estimate the impact of the 5'UTR diversity. Respiratory specimens from infected patients were then also analyzed. The assay quantification ability ranged from 4.10 to 9.10 log RNA copies/ml, with an estimated error margin of ±10%. This variation was mainly linked to target variability and interassay variability. Taken together, our results indicate that our assay can reliably estimate rhinovirus RNA load, provided that the appropriate error margin is used. In contrast, due to the lack of a universal rhinovirus RNA standard and the variability related to sample collection procedures, accurate absolute rhinovirus RNA quantification in respiratory specimens is currently hardly feasible.

  6. De novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity

    PubMed Central

    Yassour, Moran; Grabherr, Manfred; Blood, Philip D.; Bowden, Joshua; Couger, Matthew Brian; Eccles, David; Li, Bo; Lieber, Matthias; MacManes, Matthew D.; Ott, Michael; Orvis, Joshua; Pochet, Nathalie; Strozzi, Francesco; Weeks, Nathan; Westerman, Rick; William, Thomas; Dewey, Colin N.; Henschel, Robert; LeDuc, Richard D.; Friedman, Nir; Regev, Aviv


    De novo assembly of RNA-Seq data allows us to study transcriptomes without the need for a genome sequence, such as in non-model organisms of ecological and evolutionary importance, cancer samples, or the microbiome. In this protocol, we describe the use of the Trinity platform for de novo transcriptome assembly from RNA-Seq data in non-model organisms. We also present Trinity’s supported companion utilities for downstream applications, including RSEM for transcript abundance estimation, R/Bioconductor packages for identifying differentially expressed transcripts across samples, and approaches to identify protein coding genes. In an included tutorial we provide a workflow for genome-independent transcriptome analysis leveraging the Trinity platform. The software, documentation and demonstrations are freely available from PMID:23845962

  7. A Conserved Nuclear Cyclophilin Is Required for Both RNA Polymerase II Elongation and Co-transcriptional Splicing in Caenorhabditis elegans

    PubMed Central

    Ahn, Jeong H.; Rechsteiner, Andreas; Strome, Susan; Kelly, William G.


    The elongation phase of transcription by RNA Polymerase II (Pol II) involves numerous events that are tightly coordinated, including RNA processing, histone modification, and chromatin remodeling. RNA splicing factors are associated with elongating Pol II, and the interdependent coupling of splicing and elongation has been documented in several systems. Here we identify a conserved, multi-domain cyclophilin family member, SIG-7, as an essential factor for both normal transcription elongation and co-transcriptional splicing. In embryos depleted for SIG-7, RNA levels for over a thousand zygotically expressed genes are substantially reduced, Pol II becomes significantly reduced at the 3’ end of genes, marks of transcription elongation are reduced, and unspliced mRNAs accumulate. Our findings suggest that SIG-7 plays a central role in both Pol II elongation and co-transcriptional splicing and may provide an important link for their coordination and regulation. PMID:27541139

  8. RNA polymerase II contributes to preventing transcription-mediated replication fork stalls.


    Felipe-Abrio, Irene; Lafuente-Barquero, Juan; García-Rubio, María L; Aguilera, Andrés


    Transcription is a major contributor to genome instability. A main cause of transcription-associated instability relies on the capacity of transcription to stall replication. However, we know little of the possible role, if any, of the RNA polymerase (RNAP) in this process. Here, we analyzed 4 specific yeast RNAPII mutants that show different phenotypes of genetic instability including hyper-recombination, DNA damage sensitivity and/or a strong dependency on double-strand break repair functions for viability. Three specific alleles of the RNAPII core, rpb1-1, rpb1-S751F and rpb9∆, cause a defect in replication fork progression, compensated for by additional origin firing, as the main action responsible for instability. The transcription elongation defects of rpb1-S751F and rpb9∆ plus our observation that rpb1-1 causes RNAPII retention on chromatin suggest that RNAPII could participate in facilitating fork progression upon a transcription-replication encounter. Our results imply that the RNAPII or ancillary factors actively help prevent transcription-associated genome instability.

  9. A Chromatin-Focused siRNA Screen for Regulators of p53-Dependent Transcription

    PubMed Central

    Sammons, Morgan A.; Zhu, Jiajun; Berger, Shelley L.


    The protein product of the Homo sapiens TP53 gene is a transcription factor (p53) that regulates the expression of genes critical for the response to DNA damage and tumor suppression, including genes involved in cell cycle arrest, apoptosis, DNA repair, metabolism, and a number of other tumorigenesis-related pathways. Differential transcriptional regulation of these genes is believed to alter the balance between two p53-dependent cell fates: cell cycle arrest or apoptosis. A number of previously identified p53 cofactors covalently modify and alter the function of both the p53 protein and histone proteins. Both gain- and loss-of-function mutations in chromatin modifiers have been strongly implicated in cancer development; thus, we sought to identify novel chromatin regulatory proteins that affect p53-dependent transcription and the balance between the expression of pro-cell cycle arrest and proapoptotic genes. We utilized an siRNA library designed against predicted chromatin regulatory proteins, and identified known and novel chromatin-related factors that affect both global p53-dependent transcription and gene-specific regulators of p53 transcriptional activation. The results from this screen will serve as a comprehensive resource for those interested in further characterizing chromatin and epigenetic factors that regulate p53 transcription. PMID:27334938

  10. RNA-sequencing reveals oligodendrocyte and neuronal transcripts in microglia relevant to central nervous system disease

    PubMed Central

    Walker, Jason; Wylie, Todd; Magrini, Vincent; Apicelli, Anthony J.; Griffith, Malachi; Griffith, Obi L.; Kohsaka, Shinichi; Wu, Gregory F.; Brody, David L.; Mardis, Elaine R.; Gutmann, David H.


    Expression profiling of distinct central nervous system (CNS) cell populations has been employed to facilitate disease classification and to provide insights into the molecular basis of brain pathology. One important cell type implicated in a wide variety of CNS disease states is the resident brain macrophage (microglia). In these studies, microglia are often isolated from dissociated brain tissue by flow sorting procedures (FACS) or from postnatal glial cultures by mechanic isolation. Given the highly dynamic and state-dependent functions of these cells, the use of FACS or short-term culture methods may not accurately capture the biology of brain microglia. In the current study, we performed RNA-sequencing using Cx3cr1+/GFP labeled microglia isolated from the brainstem of 6-week old mice to compare the transcriptomes of FACS-sorted versus laser-captured (LCM) microglia. While both isolation techniques resulted in a large number of shared (common) transcripts, we identified transcripts unique to FACS-isolated and LCM-captured microglia. In particular, ~50% of these LCM-isolated microglial transcripts represented genes typically associated with neurons and glia. While these transcripts clearly localized to microglia using complementary methods, they were not translated into protein. Following the induction of murine experimental autoimmune encephalomyelitis (EAE), increased oligodendrocyte and neuronal transcripts were detected in microglia, while only the myelin basic protein oligodendrocyte transcript was increased in microglia after traumatic brain injury (TBI). Collectively, these findings have implications for the design and interpretation of microglia transcriptome-based investigations. PMID:25258010

  11. RNA polymerase II contributes to preventing transcription-mediated replication fork stalls

    PubMed Central

    Felipe-Abrio, Irene; Lafuente-Barquero, Juan; García-Rubio, María L; Aguilera, Andrés


    Transcription is a major contributor to genome instability. A main cause of transcription-associated instability relies on the capacity of transcription to stall replication. However, we know little of the possible role, if any, of the RNA polymerase (RNAP) in this process. Here, we analyzed 4 specific yeast RNAPII mutants that show different phenotypes of genetic instability including hyper-recombination, DNA damage sensitivity and/or a strong dependency on double-strand break repair functions for viability. Three specific alleles of the RNAPII core, rpb1-1, rpb1-S751F and rpb9Δ, cause a defect in replication fork progression, compensated for by additional origin firing, as the main action responsible for instability. The transcription elongation defects of rpb1-S751F and rpb9Δ plus our observation that rpb1-1 causes RNAPII retention on chromatin suggest that RNAPII could participate in facilitating fork progression upon a transcription-replication encounter. Our results imply that the RNAPII or ancillary factors actively help prevent transcription-associated genome instability. PMID:25452497

  12. The regulation of mammalian mRNA transcription by lncRNAs: recent discoveries and current concepts.


    Kugel, Jennifer F; Goodrich, James A


    Transcription by RNA Pol II is a tightly controlled process that is critical to normal cellular metabolism. Understanding how transcriptional regulation is orchestrated has mainly involved identifying and characterizing proteins that function as transcription factors. During the past decade, however, an increasing number of lncRNAs have been identified as transcriptional regulators. This revelation has spurred new discoveries, novel techniques and paradigm shifts, which together are redefining our understanding of transcriptional control and broadening our view of RNA function. Here, we summarize recent discoveries concerning the role of lncRNAs as regulators of mammalian mRNA transcription, with a focus on key concepts that are guiding current research in the field.

  13. The landscape of fusion transcripts in spitzoid melanoma and biologically indeterminate spitzoid tumors by RNA sequencing

    PubMed Central

    Wu, Gang; Barnhill, Raymond L.; Lee, Seungjae; Li, Yongjin; Shao, Ying; Easton, John; Dalton, James; Zhang, Jinghui; Pappo, Alberto; Bahrami, Armita


    Kinase activation by chromosomal translocations is a common mechanism that drives tumorigenesis in spitzoid neoplasms. To explore the landscape of fusion transcripts in these tumors, we performed whole-transcriptome sequencing using formalin-fixed paraffin-embedded tissues in malignant or biologically indeterminate spitzoid tumors from 7 patients (age 2–14 years). RNA sequence libraries enriched for coding regions were prepared and the sequencing was analyzed by a novel assembly-based algorithm designed for detecting complex fusions. In addition, tumor samples were screened for hotspot TERT promoter mutations, and telomerase expression was assessed by TERT mRNA in situ hybridization (ISH). Two patients had widespread metastasis and subsequently died of disease, and 5 patients had a benign clinical course on limited follow-up (mean: 30 months). RNA sequencing and TERT mRNA ISH were successful in 6 tumors and unsuccessful in 1 disseminating tumor due to low RNA quality. RNA sequencing identified a kinase fusion in 5 of the 6 sequenced tumors: TPM3–NTRK1 (2 tumors), complex rearrangements involving TPM3, ALK, and IL6R (1 tumor), BAIAP2L1–BRAF (1 tumor), and EML4–BRAF (1 disseminating tumor). All predicted chimeric transcripts were expressed at high levels and contained the intact kinase domain. In addition, 2 tumors each contained a second fusion gene, ARID1B-SNX9 or PTPRZ1-NFAM1. The detected chimeric genes were validated by home-brew break-apart or fusion fluorescence in situ hybridization. The 2 disseminating tumors each harbored the TERT promoter −124C>T (Chr 5:1,295,228 hg19 coordinate) mutation whereas the remaining 5 tumors retained the wild-type gene. The presence of the −124C>T mutation correlated with telomerase expression by TERT mRNA ISH. In summary, we demonstrated complex fusion transcripts and novel partner genes for BRAF by RNA sequencing of FFPE samples. The diversity of gene fusions demonstrated by RNA sequencing defines the molecular

  14. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription.

    PubMed Central

    Lemm, J A; Rice, C M


    Using vaccinia virus to express Sindbis virus (SIN) nonstructural proteins (nsPs) and template RNAs, we showed previously that synthesis of all three viral RNAs occurred only during expression of either the entire nonstructural coding region or the polyprotein precursors P123 and P34. In this report, the vaccinia virus system was used to express cleavage-defective polyproteins and nsP4 proteins containing various N-terminal extensions to directly examine the roles of the P123 and P34 polyproteins in RNA replication. Replication and subgenomic mRNA transcription occurred during coexpression of P34 and P123 polyproteins in which cleavage was blocked at either or both of the 1/2 and 2/3 sites. For all cleavage-defective P123 polyproteins, however, the ratio of subgenomic to genomic RNA was decreased, suggesting that both the 1/2 and 2/3 cleavages are required for efficient subgenomic RNA transcription. These studies indicate that the uncleaved P123 polyprotein can function as a component of the viral replicase capable of synthesizing both plus- and minus-strand RNAs. In contrast, cleavage-defective P34 was unable to function in RNA replication, even in complementation experiments in which minus-strand RNAs were provided by nsP4. A P34 polyprotein whose cleavage site was not altered could only function in RNA replication in the presence of an active nsP2 protease. Although nsP4, the putative RNA polymerase, was capable of synthesizing only minus-strand RNAs during coexpression with P123, the addition of only 22 upstream residues to nsP4 allowed both replication and transcription of subgenomic RNA to occur. These data show that the conserved domains of both nsP3 and the nsP4 polymerase do not need to be present in a P34 polyprotein to form a functional plus-strand replicase-transcriptase and suggest that the presence of an active nsP2 protease and a cleavable 3/4 site correlates with synthesis of all virus-specific RNA species. Images PMID:8445717

  15. [The potential use of serum HBV RNA to guide the functional cure of chronic hepatitis B].


    Lu, F M; Wang, J; Chen, X M; Jiang, J N; Zhang, W H; Zhao, J M; Ren, H; Hou, J L; Xia, N S


    Hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) in infected hepatocytes is the main cause of off-therapy viral rebound. The half-life of cccDNA is only 33-50 days, so the conversion