Comprehensive analysis of the T-cell receptor beta chain gene in rhesus monkey by high throughput sequencing

PubMed Central

Li, Zhoufang; Liu, Guangjie; Tong, Yin; Zhang, Meng; Xu, Ying; Qin, Li; Wang, Zhanhui; Chen, Xiaoping; He, Jiankui

2015-01-01

Profiling immune repertoires by high throughput sequencing enhances our understanding of immune system complexity and immune-related diseases in humans. Previously, cloning and Sanger sequencing identified limited numbers of T cell receptor (TCR) nucleotide sequences in rhesus monkeys, thus their full immune repertoire is unknown. We applied multiplex PCR and Illumina high throughput sequencing to study the TCRβ of rhesus monkeys. We identified 1.26 million TCRβ sequences corresponding to 643,570 unique TCRβ sequences and 270,557 unique complementarity-determining region 3 (CDR3) gene sequences. Precise measurements of CDR3 length distribution, CDR3 amino acid distribution, length distribution of N nucleotide of junctional region, and TCRV and TCRJ gene usage preferences were performed. A comprehensive profile of rhesus monkey immune repertoire might aid human infectious disease studies using rhesus monkeys. PMID:25961410

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

PubMed

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

T box transcription antitermination riboswitch: Influence of nucleotide sequence and orientation on tRNA binding by the antiterminator element

PubMed Central

Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.

2008-01-01

Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

High speed nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2011-05-17

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.

Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.

PubMed

Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm

2016-04-22

Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

PubMed

Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2014-08-01

Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

[Study on the genetic difference of SEO type Hantaviruses].

PubMed

Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

2000-10-01

To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

Sequence diversity within the reovirus S2 gene: reovirus genes reassort in nature, and their termini are predicted to form a panhandle motif.

PubMed Central

Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S

1994-01-01

To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378

Molecular characterization of a novel Nucleorhabdovirus from black currant identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

PubMed

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Molecular characterization of a novel Luteovirus from peach identified by high-throughput sequencing

USDA-ARS?s Scientific Manuscript database

Contigs with sequence homologies to Cherry-associated luteovirus were identified by high-throughput sequencing analysis of two peach accessions undergoing quarantine testing. The complete genomic sequences of the two isolates of this virus are 5,819 and 5,814 nucleotides. Their genome organization i...

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

PubMed

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Detection of a new bat gammaherpesvirus in the Philippines.

PubMed

Watanabe, Shumpei; Ueda, Naoya; Iha, Koichiro; Masangkay, Joseph S; Fujii, Hikaru; Alviola, Phillip; Mizutani, Tetsuya; Maeda, Ken; Yamane, Daisuke; Walid, Azab; Kato, Kentaro; Kyuwa, Shigeru; Tohya, Yukinobu; Yoshikawa, Yasuhiro; Akashi, Hiroomi

2009-08-01

A new bat herpesvirus was detected in the spleen of an insectivorous bat (Hipposideros diadema, family Hipposideridae) collected on Panay Island, the Philippines. PCR analyses were performed using COnsensus-DEgenerate Hybrid Oligonucleotide Primers (CODEHOPs) targeting the herpesvirus DNA polymerase (DPOL) gene. Although we obtained PCR products with CODEHOPs, direct sequencing using the primers was not possible because of high degree of degeneracy. Direct sequencing technology developed in our rapid determination system of viral RNA sequences (RDV) was applied in this study, and a partial DPOL nucleotide sequence was determined. In addition, a partial gB gene nucleotide sequence was also determined using the same strategy. We connected the partial gB and DPOL sequences with long-distance PCR, and a 3741-bp nucleotide fragment, including the 3' part of the gB gene and the 5' part of the DPOL gene, was finally determined. Phylogenetic analysis showed that the sequence was novel and most similar to those of the subfamily Gammaherpesvirinae.

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

Long-term excretion of vaccine-derived poliovirus by a healthy child.

PubMed

Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

2004-12-01

A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.

PubMed

Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris

2010-07-15

The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net

Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

PubMed

Lee, L; Anderson, E J

1998-01-01

SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-29

... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...

High Degree of Interlaboratory Reproducibility of Human Immunodeficiency Virus Type 1 Protease and Reverse Transcriptase Sequencing of Plasma Samples from Heavily Treated Patients

PubMed Central

Shafer, Robert W.; Hertogs, Kurt; Zolopa, Andrew R.; Warford, Ann; Bloor, Stuart; Betts, Bradley J.; Merigan, Thomas C.; Harrigan, Richard; Larder, Brendon A.

2001-01-01

We assessed the reproducibility of human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) and protease sequencing using cryopreserved plasma aliquots obtained from 46 heavily treated HIV-1-infected individuals in two laboratories using dideoxynucleotide sequencing. The rates of complete sequence concordance between the two laboratories were 99.1% for the protease sequence and 99.0% for the RT sequence. Approximately 90% of the discordances were partial, defined as one laboratory detecting a mixture and the second laboratory detecting only one of the mixture's components. Only 0.1% of the nucleotides were completely discordant between the two laboratories, and these were significantly more likely to occur in plasma samples with lower plasma HIV-1 RNA levels. Nucleotide mixtures were detected at approximately 1% of the nucleotide positions, and in every case in which one laboratory detected a mixture, the second laboratory either detected the same mixture or detected one of the mixture's components. The high rate of concordance in detecting mixtures and the fact that most discordances between the two laboratories were partial suggest that most discordances were caused by variation in sampling of the HIV-1 quasispecies by PCR rather than by technical errors in the sequencing process itself. PMID:11283081

Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

PubMed

Seward, Emily A; Kelly, Steven

2016-11-15

Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

Deletion within the metallothionein locus of cadmium-tolerant Synechococcus PCC 6301 involving a highly iterated palindrome (HIP1).

PubMed

Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J

1993-01-01

Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.

Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

PubMed

Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

2001-11-05

Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX

2009-02-24

Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Brucella and methods for the detection of Brucella

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L

Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

E2FM: an encrypted and compressed full-text index for collections of genomic sequences.

PubMed

Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto

2017-09-15

Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

PubMed Central

Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

2015-01-01

Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

Mosaic organization of DNA nucleotides

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

1994-01-01

Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

SNP discovery through de novo deep sequencing using the next generation of DNA sequencers

USDA-ARS?s Scientific Manuscript database

The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....

Characterization of durum wheat high molecular weight glutenin subunits Bx20 and By20 sequences by a molecular and proteomic approach.

PubMed

Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania

2016-07-01

Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

NASA Astrophysics Data System (ADS)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, David B.; Lao, Guifang

1998-01-01

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.

PubMed Central

Schnare, M N; Gray, M W

1982-01-01

In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176

Ancient diversity and geographical sub-structuring in African buffalo Theileria parva populations revealed through metagenetic analysis of antigen-encoding loci.

PubMed

Hemmink, Johanneke D; Sitt, Tatjana; Pelle, Roger; de Klerk-Lorist, Lin-Mari; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Weir, William

2018-03-01

An infection and treatment protocol involving infection with a mixture of three parasite isolates and simultaneous treatment with oxytetracycline is currently used to vaccinate cattle against Theileria parva. While vaccination results in high levels of protection in some regions, little or no protection is observed in areas where animals are challenged predominantly by parasites of buffalo origin. A previous study involving sequencing of two antigen-encoding genes from a series of parasite isolates indicated that this is associated with greater antigenic diversity in buffalo-derived T. parva. The current study set out to extend these analyses by applying high-throughput sequencing to ex vivo samples from naturally infected buffalo to determine the extent of diversity in a set of antigen-encoding genes. Samples from two populations of buffalo, one in Kenya and the other in South Africa, were examined to investigate the effect of geographical distance on the nature of sequence diversity. The results revealed a number of significant findings. First, there was a variable degree of nucleotide sequence diversity in all gene segments examined, with the percentage of polymorphic nucleotides ranging from 10% to 69%. Second, large numbers of allelic variants of each gene were found in individual animals, indicating multiple infection events. Third, despite the observed diversity in nucleotide sequences, several of the gene products had highly conserved amino acid sequences, and thus represent potential candidates for vaccine development. Fourth, although compelling evidence for population differentiation between the Kenyan and South African T. parva parasites was identified, analysis of molecular variance for each gene revealed that the majority of the underlying nucleotide sequence polymorphism was common to both areas, indicating that much of this aspect of genetic variation in the parasite population arose prior to geographic separation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2007-02-06

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

DOEpatents

McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA

2009-02-24

Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

Unlinking the methylome pattern from nucleotide sequence, revealed by large-scale in vivo genome engineering and methylome editing in medaka fish

PubMed Central

Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki

2017-01-01

The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed for the generalization of our observations made in medaka. PMID:29267279

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Nucleotide sequences encoding a thermostable alkaline protease

DOEpatents

Wilson, D.B.; Lao, G.

1998-01-06

Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A

PubMed Central

Ndhlovu, Andrew; Durand, Pierre M.; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. Database URL: http://www.bioinf.wits.ac.za/software/fire/evodb PMID:26140928

EvoDB: a database of evolutionary rate profiles, associated protein domains and phylogenetic trees for PFAM-A.

PubMed

Ndhlovu, Andrew; Durand, Pierre M; Hazelhurst, Scott

2015-01-01

The evolutionary rate at codon sites across protein-coding nucleotide sequences represents a valuable tier of information for aligning sequences, inferring homology and constructing phylogenetic profiles. However, a comprehensive resource for cataloguing the evolutionary rate at codon sites and their corresponding nucleotide and protein domain sequence alignments has not been developed. To address this gap in knowledge, EvoDB (an Evolutionary rates DataBase) was compiled. Nucleotide sequences and their corresponding protein domain data including the associated seed alignments from the PFAM-A (protein family) database were used to estimate evolutionary rate (ω = dN/dS) profiles at codon sites for each entry. EvoDB contains 98.83% of the gapped nucleotide sequence alignments and 97.1% of the evolutionary rate profiles for the corresponding information in PFAM-A. As the identification of codon sites under positive selection and their position in a sequence profile is usually the most sought after information for molecular evolutionary biologists, evolutionary rate profiles were determined under the M2a model using the CODEML algorithm in the PAML (Phylogenetic Analysis by Maximum Likelihood) suite of software. Validation of nucleotide sequences against amino acid data was implemented to ensure high data quality. EvoDB is a catalogue of the evolutionary rate profiles and provides the corresponding phylogenetic trees, PFAM-A alignments and annotated accession identifier data. In addition, the database can be explored and queried using known evolutionary rate profiles to identify domains under similar evolutionary constraints and pressures. EvoDB is a resource for evolutionary, phylogenetic studies and presents a tier of information untapped by current databases. © The Author(s) 2015. Published by Oxford University Press.

Effects of transcriptional start site sequence and position on nucleotide-sensitive selection of alternative start sites at the pyrC promoter in Escherichia coli.

PubMed Central

Liu, J; Turnbough, C L

1994-01-01

In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

PubMed

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Pstl repeat: a family of short interspersed nucleotide element (SINE)-like sequences in the genomes of cattle, goat, and buffalo.

PubMed

Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar

2002-02-01

The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.

Dynamics of actin evolution in dinoflagellates.

PubMed

Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

2011-04-01

Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

PubMed

Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

1997-01-01

SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

RNA Editing in Plant Mitochondria

NASA Astrophysics Data System (ADS)

Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

1989-12-01

Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

Simian immunodeficiency viruses from African green monkeys display unusual genetic diversity.

PubMed Central

Johnson, P R; Fomsgaard, A; Allan, J; Gravell, M; London, W T; Olmsted, R A; Hirsch, V M

1990-01-01

African green monkeys are asymptomatic carriers of simian immunodeficiency viruses (SIV), commonly called SIVagm. As many as 50% of African green monkeys in the wild may be SIV seropositive. This high seroprevalence rate and the potential for genetic variation of lentiviruses suggested to us that African green monkeys may harbor widely differing genotypes of SIVagm. To investigate this hypothesis, we determined the entire nucleotide sequence of an infectious proviral molecular clone of SIVagm (155-4) and partial sequences (long terminal repeat and Gag) of three other distinct SIVagm isolates (90, gri-1, and ver-1). Comparisons among the SIVagm isolates revealed extreme diversity at the nucleotide and amino acid levels. Long terminal repeat nucleotide sequences varied up to 35% and Gag protein sequences varied up to 30%. The variability among SIVagm isolates exceeded the variability among any other group of primate lentiviruses. Our data suggest that SIVagm has been in the African green monkey population for a long time and may be the oldest primate lentivirus group in existence. PMID:2304139

Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

PubMed

Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

2013-07-01

Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Zn-metalloprotease sequences in extremophiles

NASA Astrophysics Data System (ADS)

Holden, T.; Dehipawala, S.; Golebiewska, U.; Cheung, E.; Tremberger, G., Jr.; Williams, E.; Schneider, P.; Gadura, N.; Lieberman, D.; Cheung, T.

2010-09-01

The Zn-metalloprotease family contains conserved amino acid structures such that the nucleotide fluctuation at the DNA level would exhibit correlated randomness as described by fractal dimension. A nucleotide sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. The structure's vibration modes can also be studied using a Gaussian Network Model. The vibration measure and fractal dimension values form a two-dimensional plot with a standard vector metric that can be used for comparison of structures. The preference for amino acid usage in extremophiles may suppress nucleotide fluctuations that could be analyzed in terms of fractal dimension and Shannon entropy. A protein level cold adaptation study of the thermolysin Zn-metalloprotease family using molecular dynamics simulation was reported recently and our results show that the associated nucleotide fluctuation suppression is consistent with a regression pattern generated from the sequences's fractal dimension and entropy values (R-square { 0.98, N =5). It was observed that cold adaptation selected for high entropy and low fractal dimension values. Extension to the Archaemetzincin M54 family in extremophiles reveals a similar regression pattern (R-square = 0.98, N = 6). It was observed that the metalloprotease sequences of extremely halophilic organisms possess high fractal dimension and low entropy values as compared with non-halophiles. The zinc atom is usually bonded to the histidine residue, which shows limited levels of vibration in the Gaussian Network Model. The variability of the fractal dimension and entropy for a given protein structure suggests that extremophiles would have evolved after mesophiles, consistent with the bias usage of non-prebiotic amino acids by extremophiles. It may be argued that extremophiles have the capacity to offer extinction protection during drastic changes in astrobiological environments.

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Modular and configurable optimal sequence alignment software: Cola.

PubMed

Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G

2014-01-01

The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.

PubMed

Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W

2016-01-01

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

USDA-ARS?s Scientific Manuscript database

Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

PubMed

Rurek, M; Oczkowski, M; Augustyniak, H

1998-01-01

A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

PubMed

Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

2015-01-01

Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

454-pyrosequencing: A tool for discovery and biomarker development

USDA-ARS?s Scientific Manuscript database

The Roche GS-FLX (454) sequencer has made possible what was thought impossible just a few years ago: sequence >1 million high-quality nucleotide reads (mean 400 bp) in less than 12 h. This technology provides valuable species-specific sequence information, and is a valuable tool to discover and und...

37 CFR 5.31-5.33 - [Reserved

Code of Federal Regulations, 2011 CFR

2011-07-01

... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes

PubMed Central

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-01-01

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica, about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both “Zheda 23” and “Zheda 83”. Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species. PMID:28891982

WEB-server for search of a periodicity in amino acid and nucleotide sequences

NASA Astrophysics Data System (ADS)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

RNA expression in a cartilaginous fish cell line reveals ancient 3′ noncoding regions highly conserved in vertebrates

PubMed Central

Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J.; Barnes, David W.

2007-01-01

We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3′ UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3′ mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology. PMID:17227856

Repeated sequence sets in mitochondrial DNA molecules of root knot nematodes (Meloidogyne): nucleotide sequences, genome location and potential for host-race identification.

PubMed Central

Okimoto, R; Chamberlin, H M; Macfarlane, J L; Wolstenholme, D R

1991-01-01

Within a 7 kb segment of the mtDNA molecule of the root knot nematode, Meloidogyne javanica, that lacks standard mitochondrial genes, are three sets of strictly tandemly arranged, direct repeat sequences: approximately 36 copies of a 102 ntp sequence that contains a TaqI site; 11 copies of a 63 ntp sequence, and 5 copies of an 8 ntp sequence. The 7 kb repeat-containing segment is bounded by putative tRNAasp and tRNAf-met genes and the arrangement of sequences within this segment is: the tRNAasp gene; a unique 1,528 ntp segment that contains two highly stable hairpin-forming sequences; the 102 ntp repeat set; the 8 ntp repeat set; a unique 1,068 ntp segment; the 63 ntp repeat set; and the tRNAf-met gene. The nucleotide sequences of the 102 ntp copies and the 63 ntp copies have been conserved among the species examined. Data from Southern hybridization experiments indicate that 102 ntp and 63 ntp repeats occur in the mtDNAs of three, two and two races of M.incognita, M.hapla and M.arenaria, respectively. Nucleotide sequences of the M.incognita Race-3 102 ntp repeat were found to be either identical or highly similar to those of the M.javanica 102 ntp repeat. Differences in migration distance and number of 102 ntp repeat-containing bands seen in Southern hybridization autoradiographs of restriction-digested mtDNAs of M.javanica and the different host races of M.incognita, M.hapla and M.arenaria are sufficient to distinguish the different host races of each species. Images PMID:2027769

Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

PubMed

Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

2015-09-01

The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

PubMed

Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

2015-03-13

To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

PubMed Central

Feldman, Sanford H; Ntenda, Abraham M

2011-01-01

We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

The genome-wide DNA sequence specificity of the anti-tumour drug bleomycin in human cells.

PubMed

Murray, Vincent; Chen, Jon K; Tanaka, Mark M

2016-07-01

The cancer chemotherapeutic agent, bleomycin, cleaves DNA at specific sites. For the first time, the genome-wide DNA sequence specificity of bleomycin breakage was determined in human cells. Utilising Illumina next-generation DNA sequencing techniques, over 200 million bleomycin cleavage sites were examined to elucidate the bleomycin genome-wide DNA selectivity. The genome-wide bleomycin cleavage data were analysed by four different methods to determine the cellular DNA sequence specificity of bleomycin strand breakage. For the most highly cleaved DNA sequences, the preferred site of bleomycin breakage was at 5'-GT* dinucleotide sequences (where the asterisk indicates the bleomycin cleavage site), with lesser cleavage at 5'-GC* dinucleotides. This investigation also determined longer bleomycin cleavage sequences, with preferred cleavage at 5'-GT*A and 5'- TGT* trinucleotide sequences, and 5'-TGT*A tetranucleotides. For cellular DNA, the hexanucleotide DNA sequence 5'-RTGT*AY (where R is a purine and Y is a pyrimidine) was the most highly cleaved DNA sequence. It was striking that alternating purine-pyrimidine sequences were highly cleaved by bleomycin. The highest intensity cleavage sites in cellular and purified DNA were very similar although there were some minor differences. Statistical nucleotide frequency analysis indicated a G nucleotide was present at the -3 position (relative to the cleavage site) in cellular DNA but was absent in purified DNA.

Nucleotide cleaving agents and method

DOEpatents

Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

2000-01-01

The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

PubMed

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

L1-mediated retrotransposition of murine B1 and B2 SINEs recapitulated in cultured cells.

PubMed

Dewannieux, Marie; Heidmann, Thierry

2005-06-03

SINEs are short interspersed nucleotide elements with transpositional activity, present at a high copy number (up to a million) in mammalian genomes. They are 80-400 bp long, non-coding sequences which derive either from the 7SL RNA (e.g. human Alus, murine B1s) or tRNA (e.g. murine B2s) polymerase III-driven genes. We have previously demonstrated that Alus very efficiently divert the enzymatic machinery of the autonomous L1 LINE (long interspersed nucleotide element) retrotransposons to transpose at a high rate. Here we show, using an ex vivo assay for transposition, that both B1 and B2 SINEs can be mobilized by murine LINEs, with the hallmarks of a bona fide retrotransposition process, including target site duplications of varying lengths and integrations into A-rich sequences. Despite different phylogenetic origins, transposition of the tRNA-derived B2 sequences is as efficient as that of the human Alus, whereas that of B1s is 20-100-fold lower despite a similar high copy number of these elements in the mouse genome. We provide evidence, via an appropriate nucleotide substitution within the B1 sequence in a domain essential for its intracellular targeting, that the current B1 SINEs are not optimal for transposition, a feature most probably selected for the host sake in the course of evolution.

The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L.

PubMed Central

Zúñiga, M C; Steitz, J A

1977-01-01

The nucleotide sequence of tRNA1Gly isolated from the posterior silk gland of Bombyx mori has been determined. This transfer RNA is present in high amounts in the posterior silk gland during the fifth larval instar. It has a GCC anticodon, capable of decoding a major glycine codon in the fibroin messenger RNA, GGU. Structural features of Bombyx tRNA1Gly and its homology to other eukaryotic glycine tRNAs are discussed. Images PMID:414206

Nucleic acid analysis using terminal-phosphate-labeled nucleotides

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-04-22

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

PubMed

Watters, Kyle E; Lucks, Julius B

2016-01-01

Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data.

PubMed

Li, Peipei; Piao, Yongjun; Shon, Ho Sun; Ryu, Keun Ho

2015-10-28

Recently, rapid improvements in technology and decrease in sequencing costs have made RNA-Seq a widely used technique to quantify gene expression levels. Various normalization approaches have been proposed, owing to the importance of normalization in the analysis of RNA-Seq data. A comparison of recently proposed normalization methods is required to generate suitable guidelines for the selection of the most appropriate approach for future experiments. In this paper, we compared eight non-abundance (RC, UQ, Med, TMM, DESeq, Q, RPKM, and ERPKM) and two abundance estimation normalization methods (RSEM and Sailfish). The experiments were based on real Illumina high-throughput RNA-Seq of 35- and 76-nucleotide sequences produced in the MAQC project and simulation reads. Reads were mapped with human genome obtained from UCSC Genome Browser Database. For precise evaluation, we investigated Spearman correlation between the normalization results from RNA-Seq and MAQC qRT-PCR values for 996 genes. Based on this work, we showed that out of the eight non-abundance estimation normalization methods, RC, UQ, Med, TMM, DESeq, and Q gave similar normalization results for all data sets. For RNA-Seq of a 35-nucleotide sequence, RPKM showed the highest correlation results, but for RNA-Seq of a 76-nucleotide sequence, least correlation was observed than the other methods. ERPKM did not improve results than RPKM. Between two abundance estimation normalization methods, for RNA-Seq of a 35-nucleotide sequence, higher correlation was obtained with Sailfish than that with RSEM, which was better than without using abundance estimation methods. However, for RNA-Seq of a 76-nucleotide sequence, the results achieved by RSEM were similar to without applying abundance estimation methods, and were much better than with Sailfish. Furthermore, we found that adding a poly-A tail increased alignment numbers, but did not improve normalization results. Spearman correlation analysis revealed that RC, UQ, Med, TMM, DESeq, and Q did not noticeably improve gene expression normalization, regardless of read length. Other normalization methods were more efficient when alignment accuracy was low; Sailfish with RPKM gave the best normalization results. When alignment accuracy was high, RC was sufficient for gene expression calculation. And we suggest ignoring poly-A tail during differential gene expression analysis.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera

PubMed Central

Kluge, M.; Franco, A. C.; Giongo, A.; Valdez, F. P.; Saddi, T. M.; Brito, W. M. E. D.; Roehe, P. M.

2016-01-01

A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. PMID:26823583

Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

USDA-ARS?s Scientific Manuscript database

Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2014 CFR

2014-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2013 CFR

2013-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

Code of Federal Regulations, 2012 CFR

2012-07-01

...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...

Overproduction and nucleotide sequence of the respiratory D-lactate dehydrogenase of Escherichia coli.

PubMed Central

Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C

1985-01-01

Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Human ribosomal RNA gene: nucleotide sequence of the transcription initiation region and comparison of three mammalian genes.

PubMed Central

Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M

1982-01-01

The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460

Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

PubMed Central

Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

1984-01-01

The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

Reference genotype and exome data from an Australian Aboriginal population for health-based research

PubMed Central

Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

2016-01-01

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

Reference genotype and exome data from an Australian Aboriginal population for health-based research.

PubMed

Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

2016-04-12

Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

Parsimony and Model-Based Analyses of Indels in Avian Nuclear Genes Reveal Congruent and Incongruent Phylogenetic Signals

PubMed Central

Yuri, Tamaki; Kimball, Rebecca T.; Harshman, John; Bowie, Rauri C. K.; Braun, Michael J.; Chojnowski, Jena L.; Han, Kin-Lan; Hackett, Shannon J.; Huddleston, Christopher J.; Moore, William S.; Reddy, Sushma; Sheldon, Frederick H.; Steadman, David W.; Witt, Christopher C.; Braun, Edward L.

2013-01-01

Insertion/deletion (indel) mutations, which are represented by gaps in multiple sequence alignments, have been used to examine phylogenetic hypotheses for some time. However, most analyses combine gap data with the nucleotide sequences in which they are embedded, probably because most phylogenetic datasets include few gap characters. Here, we report analyses of 12,030 gap characters from an alignment of avian nuclear genes using maximum parsimony (MP) and a simple maximum likelihood (ML) framework. Both trees were similar, and they exhibited almost all of the strongly supported relationships in the nucleotide tree, although neither gap tree supported many relationships that have proven difficult to recover in previous studies. Moreover, independent lines of evidence typically corroborated the nucleotide topology instead of the gap topology when they disagreed, although the number of conflicting nodes with high bootstrap support was limited. Filtering to remove short indels did not substantially reduce homoplasy or reduce conflict. Combined analyses of nucleotides and gaps resulted in the nucleotide topology, but with increased support, suggesting that gap data may prove most useful when analyzed in combination with nucleotide substitutions. PMID:24832669

A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

PubMed

Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

2004-03-01

We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

PubMed Central

Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

2015-01-01

Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

Switchgrass ubiquitin promoter (PVUBI2) and uses thereof

DOEpatents

Stewart, C. Neal; Mann, David George James

2013-12-10

The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

PubMed

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

Treesearch

D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

2013-01-01

The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

PubMed Central

Parker, K A; Steitz, J A

1987-01-01

The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Extension of the COG and arCOG databases by amino acid and nucleotide sequences

PubMed Central

Meereis, Florian; Kaufmann, Michael

2008-01-01

Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

PubMed

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.

DNA Nucleotide Sequence Restricted by the RI Endonuclease

PubMed Central

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera.

PubMed

Campos, F S; Kluge, M; Franco, A C; Giongo, A; Valdez, F P; Saddi, T M; Brito, W M E D; Roehe, P M

2016-01-28

A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. Copyright © 2016 Campos et al.

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

PubMed Central

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

PubMed

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Developing 100K Affymetrix Axiom SNP Array for Polyploid Sugarcane

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genomes. With the advance of next generation sequencing (NGS) technologies, ...

Sequence analysis of a few species of termites (Order: Isoptera) on the basis of partial characterization of COII gene.

PubMed

Sobti, Ranbir Chander; Kumari, Mamtesh; Sharma, Vijay Lakshmi; Sodhi, Monika; Mukesh, Manishi; Shouche, Yogesh

2009-11-01

The present study was aimed to get the nucleotide sequences of a part of COII mitochondrial gene amplified from individuals of five species of Termites (Isoptera: Termitidae: Macrotermitinae). Four of them belonged to the genus Odontotermes (O. obesus, O. horni, O. bhagwatii and Odontotermes sp.) and one to Microtermes (M. obesi). Partial COII gene fragments were amplified by using specific primers. The sequences so obtained were characterized to calculate the frequencies of each nucleotide bases and a high A + T content was observed. The interspecific pairwise sequence divergence in Odontotermes species ranged from 6.5% to 17.1% across COII fragment. M. obesi sequence diversity ranged from 2.5 with Odontotermes sp. to 19.0% with O. bhagwatii. Phylogenetic trees drawn on the basis of distance neighbour-joining method revealed three main clades clustering all the individuals according to their genera and families.

Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

PubMed Central

Stewart, A F; Willis, I M; Mackinlay, A G

1984-01-01

The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less

Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy

DOE PAGES

Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.; ...

2016-05-05

DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less

A comparison of coding sequence and cytogenetic localization of the myostatin gene in the dog, red fox, arctic fox and Chinese raccoon dog.

PubMed

Grzes, M; Nowacka-Woszuk, J; Szczerbal, I; Czerwinska, J; Gracz, J; Switonski, M

2009-01-01

The gene encoding myostatin (MSTN), due to its crucial function for growth of skeletal muscle mass, is an important candidate for muscularity. In this study we analyzed the nucleotide sequence and FISH localization of this gene in 4 canids, including 3 farm species. The nucleotide sequence of the MSTN coding fragment turned out to be highly conserved, since its identity among the studied species was very high and varied between 99.4 and 99.7%. Only 1, widely spread, silent single nucleotide polymorphism (SNP) was found in exon 1 of the Chinese raccoon dog. The MSTN gene was localized close to the centromere in one-armed chromosomes of the dog (37q11) and bi-armed chromosomes of the red fox (16p11) and arctic fox (10q11), with an exception of the Chinese raccoon dog chromosome (2q14-q21). This chromosome is orthologous to 3 canine chromosomes and thus the MSTN was found more interstitially. Our results are in agreement with the hypothesis that karyotypes of the canids evolved mainly through centric fusion/fission events, while tandem fusions occurred rarely. (c) 2009 S. Karger AG, Basel.

Molecular characterization of a distinct monopartite begomovirus associated with betasatellites and alphasatellites infecting Pisum sativum in Nepal.

PubMed

Shahid, M S; Pudashini, B J; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2017-04-01

Pea (Pisum sativum) plants exhibiting leaf distortion, yellowing, stunted growth and reduction in leaf size from Rampur, Nepal were shown to be infected by a begomovirus in association with betasatellites and alphasatellites. The begomovirus associated with the disease showed only low levels of nucleotide sequence identity (<91%) to previously characterized begomoviruses. This finding indicates that the pea samples were infected with an as yet undescribed begomovirus for which the name Pea leaf distortion virus (PLDV) is proposed. Two species of betasatellite were identified in association with PLDV. One group of sequences had high (>78%) nucleotide sequence identity to isolates of Ludwigia leaf distortion betasatellite (LuLDB), and the second group had less than 78% to all other betasatellite sequences. This showed PLDV to be associated with either LuLDB or a previously undescribed betasatellite for which the name Pea leaf distortion betasatellite is proposed. Two types of alphasatellites were identified in the PLDV-infected pea plants. The first type showed high levels of sequence identity to Ageratum yellow vein alphasatellite, and the second type showed high levels of identity to isolates of Sida yellow vein China alphasatellite. These are the first begomovirus, betasatellites and alphasatellites isolated from pea.

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

PubMed

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles

USGS Publications Warehouse

Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.

1998-01-01

Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.

High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology

PubMed Central

Lijavetzky, Diego; Cabezas, José Antonio; Ibáñez, Ana; Rodríguez, Virginia; Martínez-Zapater, José M

2007-01-01

Background Single-nucleotide polymorphisms (SNPs) are the most abundant type of DNA sequence polymorphisms. Their higher availability and stability when compared to simple sequence repeats (SSRs) provide enhanced possibilities for genetic and breeding applications such as cultivar identification, construction of genetic maps, the assessment of genetic diversity, the detection of genotype/phenotype associations, or marker-assisted breeding. In addition, the efficiency of these activities can be improved thanks to the ease with which SNP genotyping can be automated. Expressed sequence tags (EST) sequencing projects in grapevine are allowing for the in silico detection of multiple putative sequence polymorphisms within and among a reduced number of cultivars. In parallel, the sequence of the grapevine cultivar Pinot Noir is also providing thousands of polymorphisms present in this highly heterozygous genome. Still the general application of those SNPs requires further validation since their use could be restricted to those specific genotypes. Results In order to develop a large SNP set of wide application in grapevine we followed a systematic re-sequencing approach in a group of 11 grape genotypes corresponding to ancient unrelated cultivars as well as wild plants. Using this approach, we have sequenced 230 gene fragments, what represents the analysis of over 1 Mb of grape DNA sequence. This analysis has allowed the discovery of 1573 SNPs with an average of one SNP every 64 bp (one SNP every 47 bp in non-coding regions and every 69 bp in coding regions). Nucleotide diversity in grape (π = 0.0051) was found to be similar to values observed in highly polymorphic plant species such as maize. The average number of haplotypes per gene sequence was estimated as six, with three haplotypes representing over 83% of the analyzed sequences. Short-range linkage disequilibrium (LD) studies within the analyzed sequences indicate the existence of a rapid decay of LD within the selected grapevine genotypes. To validate the use of the detected polymorphisms in genetic mapping, cultivar identification and genetic diversity studies we have used the SNPlex™ genotyping technology in a sample of grapevine genotypes and segregating progenies. Conclusion These results provide accurate values for nucleotide diversity in coding sequences and a first estimate of short-range LD in grapevine. Using SNPlex™ genotyping we have shown the application of a set of discovered SNPs as molecular markers for cultivar identification, linkage mapping and genetic diversity studies. Thus, the combination a highly efficient re-sequencing approach and the SNPlex™ high throughput genotyping technology provide a powerful tool for grapevine genetic analysis. PMID:18021442

Plant nitrogen regulatory P-PII genes

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2001-01-01

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the

Synthesis and evaluations of an acid-cleavable, fluorescently labeled nucleotide as a reversible terminator for DNA sequencing.

PubMed

Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng

2016-02-11

An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.

Production of a highly active, soluble form of the cytochrome P450 reductase (CPR A) from Candida tropicalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Donnelly, Mark

2006-08-01

The present invention provides soluble cytochrome p450 reductase (CPR) proteins from Candida sp. having an altered N-terminal region which results in reduced hydrophobicity of the N-terminal region. Also provided are host cells comprising the subject soluble CPR proteins. In addition, the present invention provides nucleotide and corresponding amino acid sequences for soluble CPR proteins and vectors comprising the nucleotide sequences. Methods for producing a soluble CPR, for increasing production of a dicarboxylic acid, and for detecting a cytochrome P450 are also provided.

Rapid differentiation of citrus Hop stunt viroid variants by real-time RT-PCR and high resolution melting analysis.

PubMed

Loconsole, Giuliana; Onelge, Nuket; Yokomi, Raymond K; Kubaa, Raied Abou; Savino, Vito; Saponari, Maria

2013-01-01

The RNA genome of pathogenic and non-pathogenic variants of citrus Hop stunt viroid (HSVd) differ by five to six nucleotides located within the variable (V) domain referred to as the "cachexia expression motif". Sensitive hosts such as mandarin and its hybrids are seriously affected by cachexia disease. Current methods to differentiate HSVd variants rely on lengthy greenhouse biological indexing on Parson's Special mandarin and/or direct nucleotide sequence analysis of amplicons from RT-PCR of HSVd-infected plants. Two independent high throughput assays to segregate HSVd variants by real-time RT-PCR and High-Resolution Melting Temperature (HRM) analysis were developed: one based on EVAGreen dye; the other based on TaqMan probes. Primers for both assays targeted three differentiating nucleotides in the V domain which separated HSVd variants into three clusters by distinct melting temperatures with a confidence level higher than 98%. The accuracy of the HRM assays were validated by nucleotide sequencing of representative samples within each HRM cluster and by testing 45 HSVd-infected field trees from California, Italy, Spain, Syria and Turkey. To our knowledge, this is the first report of a rapid and sensitive approach to detect and differentiate HSVd variants associated with different biological behaviors. Although, HSVd is found in several crops including citrus, cachexia variants are restricted to some citrus-growing areas, particularly the Mediterranean Region. Rapid diagnosis for cachexia and non-cachexia variants is, thus, important for the management of HSVd in citrus and reduces the need for bioindexing and sequencing analysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

USDA-ARS?s Scientific Manuscript database

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.

PubMed Central

Ina, Y; Gojobori, T

1994-01-01

To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

40 CFR 174.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...

Development and utilization of 100K SNP array in Saccharum Spp.

USDA-ARS?s Scientific Manuscript database

Sugarcane genotyping or fingerprinting has long been a daunting task due to its high polyploidy level with large number of chromosomes. Single nucleotide polymorphisms (SNPs) are very abundant DNA sequence variations in the genome. With the advance of next generation sequencing (NGS) technologies, m...

Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

PubMed Central

Laehnemann, David; Borkhardt, Arndt

2016-01-01

Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

The Complete Nucleotide Sequence of the Mitochondrial Genome of Bactrocera minax (Diptera: Tephritidae)

PubMed Central

Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

2014-01-01

The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the poly(T) stretch among the ten tephritid species and two tandem repeats were present in the CR. PMID:24964138

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Identifying N6-methyladenosine sites using multi-interval nucleotide pair position specificity and support vector machine

NASA Astrophysics Data System (ADS)

Xing, Pengwei; Su, Ran; Guo, Fei; Wei, Leyi

2017-04-01

N6-methyladenosine (m6A) refers to methylation of the adenosine nucleotide acid at the nitrogen-6 position. It plays an important role in a series of biological processes, such as splicing events, mRNA exporting, nascent mRNA synthesis, nuclear translocation and translation process. Numerous experiments have been done to successfully characterize m6A sites within sequences since high-resolution mapping of m6A sites was established. However, as the explosive growth of genomic sequences, using experimental methods to identify m6A sites are time-consuming and expensive. Thus, it is highly desirable to develop fast and accurate computational identification methods. In this study, we propose a sequence-based predictor called RAM-NPPS for identifying m6A sites within RNA sequences, in which we present a novel feature representation algorithm based on multi-interval nucleotide pair position specificity, and use support vector machine classifier to construct the prediction model. Comparison results show that our proposed method outperforms the state-of-the-art predictors on three benchmark datasets across the three species, indicating the effectiveness and robustness of our method. Moreover, an online webserver implementing the proposed predictor has been established at http://server.malab.cn/RAM-NPPS/. It is anticipated to be a useful prediction tool to assist biologists to reveal the mechanisms of m6A site functions.

High-Throughput SNP Discovery through Deep Resequencing of a Reduced Representation Library to Anchor and Orient Scaffolds in the Soybean Whole Genome Sequence

USDA-ARS?s Scientific Manuscript database

The soybean Consensus Map 4.0 facilitated the anchoring of 95.6% of the soybean whole genome sequence developed by the Joint Genome Institute, Department of Energy but only properly oriented 66% of the sequence scaffolds. To find additional single nucleotide polymorphism (SNP) markers for additiona...

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-03-01

Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nucleotide sequence of the Saccharomyces cerevisiae PUT4 proline-permease-encoding gene: similarities between CAN1, HIP1 and PUT4 permeases.

PubMed

Vandenbol, M; Jauniaux, J C; Grenson, M

1989-11-15

The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

Genetic structure of Plasmodium vivax using the merozoite surface protein 1 icb5-6 fragment reveals new hybrid haplotypes in southern Mexico

PubMed Central

2014-01-01

Background Plasmodium vivax is a protozoan parasite with an extensive worldwide distribution, being highly prevalent in Asia as well as in Mesoamerica and South America. In southern Mexico, P. vivax transmission has been endemic and recent studies suggest that these parasites have unique biological and genetic features. The msp1 gene has shown high rate of nucleotide substitutions, deletions, insertions, and its mosaic structure reveals frequent events of recombination, maybe between highly divergent parasite isolates. Methods The nucleotide sequence variation in the polymorphic icb5-6 fragment of the msp1 gene of Mexican and worldwide isolates was analysed. To understand how genotype diversity arises, disperses and persists in Mexico, the genetic structure and genealogical relationships of local isolates were examined. To identify new sequence hybrids and their evolutionary relationships with other P. vivax isolates circulating worldwide two haplotype networks were constructed questioning that two portions of the icb5-6 have different evolutionary history. Results Twelve new msp1 icb5-6 haplotypes of P. vivax from Mexico were identified. These nucleotide sequences show mosaic structure comprising three partially conserved and two variable subfragments and resulted into five different sequence types. The variable subfragment sV1 has undergone recombination events and resulted in hybrid sequences and the haplotype network allocated the Mexican haplotypes to three lineages, corresponding to the Sal I and Belem types, and other more divergent group. In contrast, the network from icb5-6 fragment but not sV1 revealed that the Mexican haplotypes belong to two separate lineages, none of which are closely related to Sal I or Belem sequences. Conclusions These results suggest that the new hybrid haplotypes from southern Mexico were the result of at least three different recombination events. These rearrangements likely resulted from the recombination between haplotypes of highly divergent lineages that are frequently distributed in South America and Asia and diversified rapidly. PMID:24472213

The EMBL nucleotide sequence database

PubMed Central

Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann

2001-01-01

The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039

Interactive computer programs for the graphic analysis of nucleotide sequence data.

PubMed Central

Luckow, V A; Littlewood, R K; Rownd, R H

1984-01-01

A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

Senescence responsive transcriptional element

DOEpatents

Campisi, Judith; Testori, Alessandro

1999-01-01

Recombinant polynucleotides have expression control sequences that have a senescence responsive element and a minimal promoter, and which are operatively linked to a heterologous nucleotide sequence. The molecules are useful for achieving high levels of expression of genes in senescent cells. Methods of inhibiting expression of genes in senescent cells also are provided.

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

USDA-ARS?s Scientific Manuscript database

A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences.

PubMed

Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong; Warnow, Tandy

2015-05-01

We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate--slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory.

DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

PubMed

Barkan, A; Mertz, J E

1981-02-01

The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

Optimized Next-Generation Sequencing Genotype-Haplotype Calling for Genome Variability Analysis

PubMed Central

Navarro, Javier; Nevado, Bruno; Hernández, Porfidio; Vera, Gonzalo; Ramos-Onsins, Sebastián E

2017-01-01

The accurate estimation of nucleotide variability using next-generation sequencing data is challenged by the high number of sequencing errors produced by new sequencing technologies, especially for nonmodel species, where reference sequences may not be available and the read depth may be low due to limited budgets. The most popular single-nucleotide polymorphism (SNP) callers are designed to obtain a high SNP recovery and low false discovery rate but are not designed to account appropriately the frequency of the variants. Instead, algorithms designed to account for the frequency of SNPs give precise results for estimating the levels and the patterns of variability. These algorithms are focused on the unbiased estimation of the variability and not on the high recovery of SNPs. Here, we implemented a fast and optimized parallel algorithm that includes the method developed by Roesti et al and Lynch, which estimates the genotype of each individual at each site, considering the possibility to call both bases from the genotype, a single one or none. This algorithm does not consider the reference and therefore is independent of biases related to the reference nucleotide specified. The pipeline starts from a BAM file converted to pileup or mpileup format and the software outputs a FASTA file. The new program not only reduces the running times but also, given the improved use of resources, it allows its usage with smaller computers and large parallel computers, expanding its benefits to a wider range of researchers. The output file can be analyzed using software for population genetics analysis, such as the R library PopGenome, the software VariScan, and the program mstatspop for analysis considering positions with missing data. PMID:28894353

Systematic and stochastic influences on the performance of the MinION nanopore sequencer across a range of nucleotide bias

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.

Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less

Systematic and stochastic influences on the performance of the MinION nanopore sequencer across a range of nucleotide bias

DOE PAGES

Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.; ...

2018-02-16

Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina

2007-12-11

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-08-10

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2011-04-12

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Antifungal polypeptides

DOEpatents

Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA

2012-04-03

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

PubMed

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

PubMed Central

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-01-01

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2011 CFR

2011-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2013 CFR

2013-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2012 CFR

2012-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2010 CFR

2010-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Code of Federal Regulations, 2014 CFR

2014-07-01

... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Genetic characterization of strains of Saccharomyces uvarum from New Zealand wineries.

PubMed

Zhang, Hanyao; Richards, Keith D; Wilson, Sandra; Lee, Soon A; Sheehan, Hester; Roncoroni, Miguel; Gardner, Richard C

2015-04-01

We present a genetic characterization of 65 isolates of Saccharomyces uvarum isolated from wineries in New Zealand, along with the complete nucleotide sequence of a single sulfite-tolerant isolate. The genome of the New Zealand isolate averaged 99.85% nucleotide identity to CBS7001, the previously sequenced strain of S. uvarum. However, three genomic segments (37-87 kb) showed 10% nucleotide divergence from CBS7001 but 99% identity to Saccharomyces eubayanus. We conclude that these three segments appear to have been introgressed from that species. The nucleotide sequence of the internal transcribed spacer (ITS) region from other New Zealand isolates were also very similar to that of CBS7001, and hybrids showed complete genetic compatibility for some strains, with tetrads giving four viable progeny that showed 2:2 segregations of marker genes. Some strains showed high tolerance to sulfite, with genetic analysis indicating linkage of this trait to the transcription factor FZF1, but not to SSU1, the sulfite efflux pump that it regulates in order to confer sulfite tolerance in Saccharomyces cerevisiae. The fermentation characteristics of selected strains of S. uvarum showed exceptionally good cold fermentation characteristics, superior to the best commercially available strains of S. cerevisiae. Copyright © 2014 Elsevier Ltd. All rights reserved.

Biological nanopore MspA for DNA sequencing

NASA Astrophysics Data System (ADS)

Manrao, Elizabeth A.

Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

Genetic discovery in Xylella fastidiosa through sequence analysis of selected randomly amplified polymorphic DNAs.

PubMed

Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C

2005-02-01

Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

PubMed Central

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-01-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

PubMed

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

De novo assembly of pen shell ( Atrina pectinata) transcriptome and screening of its genic microsatellites

NASA Astrophysics Data System (ADS)

Sun, Xiujun; Li, Dongming; Liu, Zhihong; Zhou, Liqing; Wu, Biao; Yang, Aiguo

2017-10-01

The pen shell ( Atrina pectinata) is a large wedge-shaped bivalve, which belongs to family Pinnidae. Due to its large and nutritious adductor muscle, it is the popular seafood with high commercial value in Asia-Pacific countries. However, limiting genomic and transcriptomic data have hampered its genetic investigations. In this study, the transcriptome of A. pectinata was deeply sequenced using Illumina pair-end sequencing technology. After assembling, a total of 127263 unigenes were obtained. Functional annotation indicated that the highest percentage of unigenes (18.60%) was annotated on GO database, followed by 18.44% on PFAM database and 17.04% on NR database. There were 270 biological pathways matched with those in KEGG database. Furthermore, a total of 23452 potential simple sequence repeats (SSRs) were identified, of them the most abundant type was mono-nucleotide repeats (12902, 55.01%), which was followed by di-nucleotide (8132, 34.68%), tri-nucleotide (2010, 8.57%), tetra-nucleotide (401, 1.71%), and penta-nucleotide (7, 0.03%) repeats. Sixty SSRs were selected for validating and developing genic SSR markers, of them 23 showed polymorphism in a cultured population with the average observed and expected heterozygosities of 0.412 and 0.579, respectively. In this study, we established the first comprehensive transcript dataset of A. pectinata genes. Our results demonstrated that RNA-Seq is a fast and cost-effective method for genic SSR development in non-model species.

Genomic organization and sequence of the Gus-s/sup a/ allele of the murine. beta. -glucuronidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funkenstein, B.; Leary, S.L.; Stein, J.C.

1988-03-01

The Gus-s/sup ..cap alpha../ allele of the mouse ..beta..-glucuronidase gene exhibits a high degree of inducibility by androgens due to its linkage with the Gus-r/sup ..cap alpha../ regulatory locus. The authors isolated Gus-s/sup ..cap alpha../ on a 28-kilobase pair fragment of mouse chromosome 5 and found that it contains 12 exons and 11 intervening sequences spanning 14 kilobase pairs of this genomic segment. The mRNA cap site was identified by ribonuclease protection and primer extension analyses which revealed an unusually short 5' noncoding sequence of 12 nucleotides. Proximal regulatory sequences in the 5'-flanking DNA and the complete sequence of themore » Gus-s/sup ..cap alpha../ mRNA transcript were also determined. Comparison of the amino acid sequence determined from the Gus-s/sup ..cap alpha../ nucleotide sequence with that of human ..beta..-glucuronidase indicated that the two human mRNA species differ due to alternate splicing of an exon homologous to exon 6 of the mouse gene.« less

CLAST: CUDA implemented large-scale alignment search tool.

PubMed

Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken

2014-12-11

Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Short-read, high-throughput sequencing technology for STR genotyping

PubMed Central

Bornman, Daniel M.; Hester, Mark E.; Schuetter, Jared M.; Kasoji, Manjula D.; Minard-Smith, Angela; Barden, Curt A.; Nelson, Scott C.; Godbold, Gene D.; Baker, Christine H.; Yang, Boyu; Walther, Jacquelyn E.; Tornes, Ivan E.; Yan, Pearlly S.; Rodriguez, Benjamin; Bundschuh, Ralf; Dickens, Michael L.; Young, Brian A.; Faith, Seth A.

2013-01-01

DNA-based methods for human identification principally rely upon genotyping of short tandem repeat (STR) loci. Electrophoretic-based techniques for variable-length classification of STRs are universally utilized, but are limited in that they have relatively low throughput and do not yield nucleotide sequence information. High-throughput sequencing technology may provide a more powerful instrument for human identification, but is not currently validated for forensic casework. Here, we present a systematic method to perform high-throughput genotyping analysis of the Combined DNA Index System (CODIS) STR loci using short-read (150 bp) massively parallel sequencing technology. Open source reference alignment tools were optimized to evaluate PCR-amplified STR loci using a custom designed STR genome reference. Evaluation of this approach demonstrated that the 13 CODIS STR loci and amelogenin (AMEL) locus could be accurately called from individual and mixture samples. Sensitivity analysis showed that as few as 18,500 reads, aligned to an in silico referenced genome, were required to genotype an individual (>99% confidence) for the CODIS loci. The power of this technology was further demonstrated by identification of variant alleles containing single nucleotide polymorphisms (SNPs) and the development of quantitative measurements (reads) for resolving mixed samples. PMID:25621315

An outbreak of food-borne gastroenteritis due to sapovirus among junior high school students.

PubMed

Usuku, Shuzo; Kumazaki, Makoto; Kitamura, Katsuhiko; Tochikubo, Osamu; Noguchi, Yuzo

2008-11-01

The human sapovirus (SaV) causes acute gastroenteritis mainly in infants and young children. A food-borne outbreak of gastroenteritis associated with SaV occurred among junior high school students in Yokohama, Japan, during and after a study trip. The nucleotide sequences of the partial capsid gene derived from the students exhibited 98% homology to a SaV genogroup IV strain, Hu/Angelholm/SW278/2004/SE, which was isolated from an adult with gastroenteritis in Solna, Sweden. An identical nucleotide sequence was detected from a food handler at the hotel restaurant, suggesting that the causative agent of the outbreak was transmitted from the food handler. This is the first description of a food-borne outbreak associated with the SaV genogroup IV strain in Japan.

Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

PubMed

Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

2017-02-01

Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peters, J.; Peters, M.; Lottspeich, F.

1987-11-01

The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less

Sequencing artifacts in the type A influenza databases and attempts to correct them.

PubMed

Suarez, David L; Chester, Nikki; Hatfield, Jason

2014-07-01

There are over 276 000 influenza gene sequences in public databases, with the quality of the sequences determined by the contributor. As part of a high school class project, influenza sequences with possible errors were identified in the public databases based on the size of the gene being longer than expected, with the hypothesis that these sequences would have an error. Students contacted sequence submitters alerting them of the possible sequence issue(s) and requested they the suspect sequence(s) be correct as appropriate. Type A influenza viruses were screened, and gene segments longer than the accepted size were identified for further analysis. Attention was placed on sequences with additional nucleotides upstream or downstream of the highly conserved non-coding ends of the viral segments. A total of 1081 sequences were identified that met this criterion. Three types of errors were commonly observed: non-influenza primer sequence wasn't removed from the sequence; PCR product was cloned and plasmid sequence was included in the sequence; and Taq polymerase added an adenine at the end of the PCR product. Internal insertions of nucleotide sequence were also commonly observed, but in many cases it was unclear if the sequence was correct or actually contained an error. A total of 215 sequences, or 22.8% of the suspect sequences, were corrected in the public databases in the first year of the student project. Unfortunately 138 additional sequences with possible errors were added to the databases in the second year. Additional awareness of the need for data integrity of sequences submitted to public databases is needed to fully reap the benefits of these large data sets. © 2014 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

Identification and characterization of Theileria ovis surface protein (ToSp) resembled TaSp in Theileria annulata.

PubMed

Shayan, P; Jafari, S; Fattahi, R; Ebrahimzade, E; Amininia, N; Changizi, E

2016-05-01

Ovine theileriosis is an important hemoprotozoal disease of sheep and goats in tropical and subtropical regions which caused high economic loses in the livestock industry. Theileria annulata surface protein (TaSp) was used previously as a tool for serological analysis in livestock. Since the amino acid sequences of TaSp is, at least, in part very conserved in T. annulata, Theileria lestoquardi and Theileria china I and II, it is very important to determine the amino acid sequence of this protein in Theileria ovis as well, to avoid false interpretation of serological data based on this protein in small animal. In the present study, the nucleotide sequence and amino acid sequence of T. ovis surface protein (ToSp) were determined. The comparison of the nucleotide sequence of ToSp showed 96, 96, 99, and 86 % homology to the corresponding nucleotide sequence of TaSp genes by T. annulata, T. China I, T. China II and T. lestoquardi, previously registered in GenBank under accession nos. AJ316260.1, AY274329.1, DQ120058.1, and EF092924.1 respectively. The amino acid sequence analysis showed 95, 81, 98 and 70 % homology to the corresponding amino acid sequence of T. annulata, T chinaI, T china II and T. lestoquardi, registered in GenBank under accession nos. CAC87478.1, AAP36993.1, AAZ30365.1 and AAP36999.11, respectively. Interestingly, in contrast to the C terminus, a significant difference in amino acid sequence in the N teminus of the ToSp protein could be determined compared to the other known corresponding TaSp sequences, which make this region attractive for designing of a suitable tool for serological diagnosis.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

PubMed

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

PubMed Central

Dasgupta, R; Kaesberg, P

1982-01-01

The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

Nucleotide sequence analysis of the 3' terminal region of a wasabi strain of crucifer tobamovirus genomic RNA: subgrouping of crucifer tobamoviruses.

PubMed

Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M

1998-01-01

The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pallan, Pradeep S.; Marshall, William S.; Harp, Joel

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter.more » Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.« less

Molecular evidence of father-to-child transmission of hepatitis B virus.

PubMed

Tajiri, Hitoshi; Tanaka, Yasuhito; Kagimoto, Seiiti; Murakami, Jun; Tokuhara, Daisuke; Mizokami, Masashi

2007-07-01

At present in Japan, only high-risk infants born to chronic hepatitis B virus (HBV)-infected mothers are given HBV vaccine. However, children can contract the virus from other HBV-infected family members, including fathers. The aim of this study is to present substantial and unequivocal evidence of father-to-child transmission of HBV infection using techniques including homology analysis and phylogenetic analysis. Thirteen chronic HBV-infected members of five families that included eight children and their respective fathers were enrolled in this study. Homology analysis and phylogenetic analyses of 2 coding region, the S gene and X gene, from the HBV genome were performed comparing the 13 nucleotide sequences from the 13 subjects. The nucleotide homology among the five sets of fathers and children was quite high (99.3-100%). A phylogenetic tree constructed on the 13 nucleotide sequences showed that all 5 sets of fathers and children were grouped into the same cluster with high bootstrap values. These results strongly indicate that father-to-child transmission is an important route of HBV infection in Japan and it is recommend that universal vaccination against HBV infection be instituted immediately in Japan for all children, in accordance with the WHO recommendation of 1997.

PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences

PubMed Central

Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong

2015-01-01

Abstract We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate—slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory. PMID:25549288

Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

NASA Astrophysics Data System (ADS)

Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

2011-10-01

Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency.

PubMed

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J; Burnett, John C; Zhou, Jiehua

2016-09-22

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct "biased sequences" and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the "biased sequences" was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy.

Differential recognition of the ORF2 region in a complete genome sequence of porcine circovirus type 2 (PCV2) isolated from boar bone marrow in Korea.

PubMed

Kweon, Chang-Hee; Nguyen, Lien Thi Kim; Yoo, Mi-Sun; Kang, Seung-Won

2015-09-15

Porcine circovirus type 2 (PCV2) is the causative agent of post-weaning multisystemic wasting syndrome (PMWS) in swine. Here, a phylogenetic tree was constructed using PCV2 nucleotide sequences derived from the bone marrow of Korean boar and previously reported PCV2 sequences isolated from various countries. PCV2 from Korean boar bone marrow (KC188796) was classified into the group containing PCV2a-Canada and other PCV2 strain from Korea. While the ORF1 region of the PCV2 genome was highly conserved, ORF2 (the capsid protein coding region) was relatively variable. The nucleotide sequences for bone marrow-derived PCV2 were 93.4-99.0% homologous to the other reference sequences. The deduced amino acid sequences for the ORF1 and ORF2 coding regions were 97.4-99.3% and 84.5-97.4% homologous with the other reference strains, respectively, indicating that KC188796 did not differ markedly from the other PCV2 strains. Phylogenetic analysis demonstrated that bone marrow-derived PCV2 was highly similar to PCV2a from Canada and may be related to persistent PCV2 infections in swine. Copyright © 2015 Elsevier B.V. All rights reserved.

Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

PubMed

Seal, B S; Neill, J D; Ridpath, J F

1994-07-01

Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

PubMed Central

Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

1982-01-01

The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server

PubMed Central

Cannone, Jamie J.; Sweeney, Blake A.; Petrov, Anton I.; Gutell, Robin R.; Zirbel, Craig L.; Leontis, Neocles

2015-01-01

The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. PMID:26048960

Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

PubMed Central

Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

2018-01-01

Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

PubMed

Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

2008-08-01

In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

PubMed

Faragher, S G; Dalgarno, L

1986-07-20

The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

PubMed Central

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

PubMed

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

PubMed

Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

1993-05-01

The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

[Molecular epidemiological analysis of rubella virus isolates from 2001 to 2011 in Shanghai, China].

PubMed

Li, Chong-Shan; Yang, Yu-Ying; Wang, Jian-Guo; Zhu, Zhen; Tang, Wei; Li, Zhi; Sun, Xiao-Dong; Xu, Wen-Bo

2012-03-01

Throat swabs collected from patients whose serum was measles IgM negative and rubella IgM positive during 2001-2011 were used to conduct cell culture for rubella virus. After identification of cell culture with RT-PCR, nucleotide of gene E1 of rubella virus was amplified and sequenced, followed by molecular epidemiological analysis. A total of 31 rubella viruses were isolated from 60 throat swabs. Compared 27 isolates with the WHO reference strains of all genotypes, phylogenetic tree was constructed based on the amplified 739 nucleotide fragment. These isolates belonged to two different genotypes respectively. Isolates 11009, 11052 and 11106 in 2011 belonged to genotype 2B, and others belonged to genotype 1E. Most of mutations were nonsense mutation, and sequence of amino acid was highly conserved. Amino acid sequence of most isolates of genotype 1E was identical, which suggested rubella viruses from same transmission chain might be transmitted continually since 2001. Rubella virus genotype 2B was found to be popular for the first time in Shanghai in 2011. The nucleotide sequences of these genotype 2B isolates showed 99% identity compared with that of isolates recently from Vietnam, Japan and Argentina. The resources of these strains were not confirmed due to the absence of rubella virus surveillance before.

Molecular cloning and nucleotide sequences of the genes for two essential proteins constituting a novel enzyme system for heptaprenyl diphosphate synthesis.

PubMed

Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K

1995-08-04

The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

PubMed

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome

USDA-ARS?s Scientific Manuscript database

Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a mor...

Genome Comparisons Reveal a Dominant Mechanism of Chromosome Number Reduction in Grasses and Accelerated Genome Evolution in Triticeae

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphism was employed in the construction of a high-resolution, expressed sequence tag (EST) map of Aegilops tauschii, the diploid source of the wheat D genome. Comparison of the map with the rice and sorghum genome sequences revealed 50 inversions and translocations; 2, 8, and...

Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

PubMed Central

2012-01-01

The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

Nucleotide sequence variation at two genes of the phenylpropanoid pathway, the FAH1 and F3H genes, in Arabidopsis thaliana.

PubMed

Aguadé, M

2001-01-01

The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.

Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cairns, S.S.

1987-01-01

In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Energy efficiency trade-offs drive nucleotide usage in transcribed regions

PubMed Central

Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.

2016-01-01

Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217

Consequences of Normalizing Transcriptomic and Genomic Libraries of Plant Genomes Using a Duplex-Specific Nuclease and Tetramethylammonium Chloride

PubMed Central

Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088

Consequences of normalizing transcriptomic and genomic libraries of plant genomes using a duplex-specific nuclease and tetramethylammonium chloride.

PubMed

Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard

2013-01-01

Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.

Phylogenetic and nucleotide sequence analysis of influenza A (H1N1) HA and NA genes of strains isolated from Saudi Arabia.

PubMed

Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N

2017-01-30

In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.

Sequencing the Connectome

PubMed Central

Zador, Anthony M.; Dubnau, Joshua; Oyibo, Hassana K.; Zhan, Huiqing; Cao, Gang; Peikon, Ian D.

2012-01-01

Connectivity determines the function of neural circuits. Historically, circuit mapping has usually been viewed as a problem of microscopy, but no current method can achieve high-throughput mapping of entire circuits with single neuron precision. Here we describe a novel approach to determining connectivity. We propose BOINC (“barcoding of individual neuronal connections”), a method for converting the problem of connectivity into a form that can be read out by high-throughput DNA sequencing. The appeal of using sequencing is that its scale—sequencing billions of nucleotides per day is now routine—is a natural match to the complexity of neural circuits. An inexpensive high-throughput technique for establishing circuit connectivity at single neuron resolution could transform neuroscience research. PMID:23109909

Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)

USGS Publications Warehouse

Nishizawa, T.; Kurath, G.; Winton, J.R.

1997-01-01

We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.

The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

PubMed

He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

2011-06-01

The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

A high-throughput approach to profile RNA structure.

PubMed

Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano

2017-03-17

Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions.

PubMed

Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M

2005-07-20

While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Exploring single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes in the jellyfish (Rhopilema esculentum) by transcriptome sequencing.

PubMed

Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo

2017-08-01

In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of the reliability of maize reference assays for GMO quantification.

PubMed

Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

2010-03-01

A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

High levels of MHC class II allelic diversity in lake trout from Lake Superior

USGS Publications Warehouse

Dorschner, M.O.; Duris, T.; Bronte, C.R.; Burnham-Curtis, M. K.; Phillips, R.B.

2000-01-01

Sequence variation in a 216 bp portion of the major histocompatibility complex (MHC) II B1 domain was examined in 74 individual lake trout (Salvelinus namaycush) from different locations in Lake Superior. Forty-three alleles were obtained which encoded 71-72 amino acids of the mature protein. These sequences were compared with previous data obtained from five Pacific salmon species and Atlantic salmon using the same primers. Although all of the lake trout alleles clustered together in the neighbor-joining analysis of amino acid sequences, one amino acid allelic lineage was shared with Atlantic salmon (Salmo salar), a species in another genus which probably diverged from Salvelinus more than 10-20 million years ago. As shown previously in other salmonids, the level of nonsynonymous nucleotide substitution (d(N)) exceeded the level of synonymous substitution (d(S)). The level of nucleotide diversity at the MHC class II B1 locus was considerably higher in lake trout than in the Pacific salmon (genus Oncorhynchus). These results are consistent with the hypothesis that lake trout colonized Lake Superior from more than one refuge following the Wisconsin glaciation. Recent population bottlenecks may have reduced nucleotide diversity in Pacific salmon populations.

37 CFR 1.824 - Form and format for nucleotide and/or amino acid sequence submissions in computer readable form.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

PubMed Central

Hori, H; Osawa, S; Iwabuchi, M

1980-01-01

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

PubMed Central

Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

1993-01-01

Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

PubMed

Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

2017-09-14

The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.

PubMed

Alkhateeb, Abedalrhman; Rueda, Luis

2017-08-01

Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.

E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China

PubMed Central

Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man

2017-01-01

Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822

Control of total GFP expression by alterations to the 3′ region nucleotide sequence

PubMed Central

2013-01-01

Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

PubMed

Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

2018-06-01

Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

The CD8α gene in duck (Anatidae): cloning, characterization, and expression during viral infection.

PubMed

Xu, Qi; Chen, Yang; Zhao, Wen Ming; Huang, Zheng Yang; Duan, Xiu Jun; Tong, Yi Yu; Zhang, Yang; Li, Xiu; Chang, Guo Bin; Chen, Guo Hong

2015-02-01

Cluster of differentiation 8 alpha (CD8α) is critical for cell-mediated immune defense and T-cell development. Although CD8α sequences have been reported for several species, very little is known about CD8α in ducks. To elucidate the mechanisms involved in the innate and adaptive immune responses of ducks, we cloned CD8α coding sequences from domestic, Muscovy, Mallard, and Spotbill ducks using reverse transcription polymerase chain reaction (RT-PCR). Each sequence consisted of 714 nucleotides and encoded a signal peptide, an IgV-like domain, a stalk region, a transmembrane region, and a cytoplasmic tail. We identified 58 nucleotide differences and 37 amino acid differences among the four types of duck; of these, 53 nucleotide and 33 amino acid differences were between Muscovy ducks and the other duck species. The CD8α cDNA sequence from domestic duck consisted of a 61-nucleotide 5' untranslated region (UTR), a 714-nucleotide open reading frame, and an 849-nucleotide 3' UTR. Multiple sequence alignments showed that the amino acid sequence of CD8α is conserved in vertebrates. RT-PCR revealed that expression of CD8α mRNA of domestic ducks was highest in the thymus and very low in the kidney, cerebrum, cerebellum, and muscle. Immunohistochemical analyses detected CD8α on the splenic corpuscle and periarterial lymphatic sheath of the spleen. CD8α mRNA in domestic ducklings was initially up-regulated, and then down-regulated, in the thymus, spleen, and liver after treatment with duck hepatitis virus type I (DHV-1) or the immunostimulant polyriboinosinic polyribocytidylic acid (poly I:C).

CNG and HCN channels: two peas, one pod.

PubMed

Craven, Kimberley B; Zagotta, William N

2006-01-01

Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

PubMed Central

2010-01-01

Background Infectious hematopoietic necrosis virus (IHNV) is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939) with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American and other strains. Determination of the complete nucleotide sequence is essential for future studies on pathogenesis of IHNV using a reverse genetics approach and developing efficient control strategies. PMID:20085652

Updating Our View of Organelle Genome Nucleotide Landscape

PubMed Central

Smith, David Roy

2012-01-01

Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Nucleotide sequences of Japanese isolates of citrus vein enation virus.

PubMed

Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru

2017-03-01

The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.

Detecting and Analyzing Genetic Recombination Using RDP4.

PubMed

Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

2017-01-01

Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

Molecular characterization of beta-tubulin from Phakopsora pachyrhizi, the causal agent of Asian soybean rust

PubMed Central

2010-01-01

β-tubulins are structural components of microtubules and the targets of benzimidazole fungicides used to control many diseases of agricultural importance. Intron polymorphisms in the intron-rich genes of these proteins have been used in phylogeographic investigations of phytopathogenic fungi. In this work, we sequenced 2764 nucleotides of the β-tubulin gene (Pp tubB) in samples of Phakopsora pachyrhizi collected from seven soybean fields in Brazil. Pp tubB contained an open reading frame of 1341 nucleotides, including nine exons and eight introns. Exon length varied from 14 to 880 nucleotides, whereas intron length varied from 76 to 102 nucleotides. The presence of only four polymorphic sites limited the usefulness of Pp tubB for phylogeographic studies in P. pachyrhizi. The gene structures of Pp tubB and orthologous β-tubulin genes of Melampsora lini and Uromyces viciae-fabae were highly conserved. The amino acid substitutions in β-tubulin proteins associated with the onset of benzimidazole resistance in model organisms, especially at His 6 , Glu 198 and Phe 200 , were absent from the predicted sequence of the P. pachyrhizi β-tubulin protein. PMID:21637494

An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

PubMed

Chen, Sherry Xi; Seelig, Georg

2016-04-20

Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

PubMed

Winterhagen, Patrick; Wünsche, Jens-Norbert

2016-05-01

Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection

PubMed Central

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike

2018-01-01

ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

PubMed

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

R3D-2-MSA: the RNA 3D structure-to-multiple sequence alignment server.

PubMed

Cannone, Jamie J; Sweeney, Blake A; Petrov, Anton I; Gutell, Robin R; Zirbel, Craig L; Leontis, Neocles

2015-07-01

The RNA 3D Structure-to-Multiple Sequence Alignment Server (R3D-2-MSA) is a new web service that seamlessly links RNA three-dimensional (3D) structures to high-quality RNA multiple sequence alignments (MSAs) from diverse biological sources. In this first release, R3D-2-MSA provides manual and programmatic access to curated, representative ribosomal RNA sequence alignments from bacterial, archaeal, eukaryal and organellar ribosomes, using nucleotide numbers from representative atomic-resolution 3D structures. A web-based front end is available for manual entry and an Application Program Interface for programmatic access. Users can specify up to five ranges of nucleotides and 50 nucleotide positions per range. The R3D-2-MSA server maps these ranges to the appropriate columns of the corresponding MSA and returns the contents of the columns, either for display in a web browser or in JSON format for subsequent programmatic use. The browser output page provides a 3D interactive display of the query, a full list of sequence variants with taxonomic information and a statistical summary of distinct sequence variants found. The output can be filtered and sorted in the browser. Previous user queries can be viewed at any time by resubmitting the output URL, which encodes the search and re-generates the results. The service is freely available with no login requirement at http://rna.bgsu.edu/r3d-2-msa. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

PubMed

Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

2015-04-01

Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

Plant nitrogen regulatory P-PII polypeptides

DOEpatents

Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

2004-11-23

The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

PubMed

Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

2014-08-01

The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

PubMed

Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

2012-08-06

Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

Detection and molecular characterization of tomato yellow leaf curl virus naturally infecting Lycopersicon esculentum in Egypt.

PubMed

Rabie, M; Ratti, C; Abdel Aleem, E; Fattouh, F

Tomato yellow leaf curl virus (TYLCV) infections of tomato crops in Egypt were widely spread in 2014. Infected symptomatic tomato plants from different governorates were sampled. TYLCV strains Israel and Mild (TYLCV-IL, TYLCV-Mild) were identified by multiplex and real-time PCR. In addition, nucleotide sequence analysis of the V1 and V2 protein genes, revealed ten TYLCV Egyptian isolates (TYLCV from TY1 to 10). Phylogenetic analysis showed their high degree of relatedness with TYLCV-IL Jordan isolate (98%). Here we have showed the complete nucleotide sequence of the TYLCV Egyptian isolate TY10, sampled from El Beheira. A high degree of similarity to other previously reported Egyptian isolates and isolates from Jordan and Japan reflect the importance of phylogenetic analysis in monitoring virus genetic diversity and possibilities for divergence of more virulent strains or genotypes.

Sequence analysis of Jembrana disease virus strains reveals a genetically stable lentivirus.

PubMed

Desport, Moira; Stewart, Meredith E; Mikosza, Andrew S; Sheridan, Carol A; Peterson, Shane E; Chavand, Olivier; Hartaningsih, Nining; Wilcox, Graham E

2007-06-01

Jembrana disease virus (JDV) is a lentivirus associated with an acute disease syndrome with a 20% case fatality rate in Bos javanicus (Bali cattle) in Indonesia, occurring after a short incubation period and with no recurrence of the disease after recovery. Partial regions of gag and pol and the entire env were examined for sequence variation in DNA samples from cases of Jembrana disease obtained from Bali, Sumatra and South Kalimantan in Indonesian Borneo. A high level of nucleotide conservation (97-100%) was observed in gag sequences from samples taken in Bali and Sumatra, indicating that the source of JDV in Sumatra was most likely to have originated from Bali. The pol sequences and, unexpectedly, the env sequences from Bali samples were also well conserved with low nucleotide (96-99%) and amino acid substitutions (95-99%). However, the sample from South Kalimantan (JDV(KAL/01)) contained more divergent sequences, particularly in env (88% identity). Phylogenetic analysis revealed that the JDV(KAL/01)env sequences clustered with the sequence from the Pulukan sample (Bali) from 2001. JDV appears to be remarkably stable genetically and has undergone minor genetic changes over a period of nearly 20 years in Bali despite becoming endemic in the cattle population of the island.

Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

NASA Technical Reports Server (NTRS)

Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

1986-01-01

Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

Information capacity of nucleotide sequences and its applications.

PubMed

Sadovsky, M G

2006-05-01

The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

PubMed

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Torella, JP; Lienert, F; Boehm, CR

2014-08-07

Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked withmore » UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.« less

Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications

PubMed Central

Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.

2016-01-01

Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822

A comprehensive bioinformatic analysis of hepatitis D virus full-length genomes.

PubMed

Delfino, C M; Cerrudo, C S; Biglione, M; Oubiña, J R; Ghiringhelli, P D; Mathet, V L

2018-02-06

In association with hepatitis B virus (HBV), hepatitis delta virus (HDV) is a subviral agent that may promote severe acute and chronic forms of liver disease. Based on the percentage of nucleotide identity of the genome, HDV was initially classified into three genotypes. However, since 2006, the original classification has been further expanded into eight clades/genotypes. The intergenotype divergence may be as high as 35%-40% over the entire RNA genome, whereas sequence heterogeneity among the isolates of a given genotype is <20%; furthermore, HDV recombinants have been clearly demonstrated. The genetic diversity of HDV is related to the geographic origin of the isolates. This study shows the first comprehensive bioinformatic analysis of the complete available set of HDV sequences, using both nucleotide and protein phylogenies (based on an evolutionary model selection, gamma distribution estimation, tree inference and phylogenetic distance estimation), protein composition analysis and comparison (based on the presence of invariant residues, molecular signatures, amino acid frequencies and mono- and di-amino acid compositional distances), as well as amino acid changes in sequence evolution. Taking into account the congruent and consistent results of both nucleotide and amino acid analyses of GenBank available sequences (recorded as of January, 2017), we propose that the eight hepatitis D virus genotypes may be grouped into three large genogroups fully supported by their shared characteristics. © 2018 John Wiley & Sons Ltd.

Drosophila Melanogaster Mitochondrial DNA: Gene Organization and Evolutionary Considerations

PubMed Central

Garesse, R.

1988-01-01

The sequence of a 8351-nucleotide mitochondrial DNA (mtDNA) fragment has been obtained extending the knowledge of the Drosophila melanogaster mitochondrial genome to 90% of its coding region. The sequence encodes seven polypeptides, 12 tRNAs and the 3' end of the 16S rRNA and CO III genes. The gene organization is strictly conserved with respect to the Drosophila yakuba mitochondrial genome, and different from that found in mammals and Xenopus. The high A + T content of D. melanogaster mitochondrial DNA is reflected in a reiterative codon usage, with more than 90% of the codons ending in T or A, G + C rich codons being practically absent. The average level of homology between the D. melanogaster and D. yakuba sequences is very high (roughly 94%), although insertion and deletions have been detected in protein, tRNA and large ribosomal genes. The analysis of nucleotide changes reveals a similar frequency for transitions and transversions, and reflects a strong bias against G+C on both strands. The predominant type of transition is strand specific. PMID:3130291

Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

2018-04-01

Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

The nucleotide sequence and genome organization of Plasmopara halstedii virus.

PubMed

Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

2011-03-17

Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

PubMed

Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

2017-10-01

The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

Manipulation of lignin composition in plants using a tissue-specific promoter

DOEpatents

Chapple, Clinton C. S.

2003-08-26

The present invention relates to methods and materials in the field of molecular biology, the manipulation of the phenylpropanoid pathway and the regulation of proteins synthesis through plant genetic engineering. More particularly, the invention relates to the introduction of a foreign nucleotide sequence into a plant genome, wherein the introduction of the nucleotide sequence effects an increase in the syringyl content of the plant's lignin. In one specific aspect, the invention relates to methods for modifying the plant lignin composition in a plant cell by the introduction there into of a foreign nucleotide sequence comprising at issue specific plant promoter sequence and a sequence encoding an active ferulate-5-hydroxylase (F5H) enzyme. Plant transformants harboring an inventive promoter-F5H construct demonstrate increased levels of syringyl monomer residues in their lignin, rendering the polymer more readily delignified and, thereby, rendering the plant more readily pulped or digested.

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

PubMed

Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Molecular Characterization of an Avian Astrovirus

PubMed Central

Koci, Matthew D.; Seal, Bruce S.; Schultz-Cherry, Stacey

2000-01-01

Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease. PMID:10846102

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

PubMed

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

1995-01-01

Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

PCV: An Alignment Free Method for Finding Homologous Nucleotide Sequences and its Application in Phylogenetic Study.

PubMed

Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar

2017-06-01

Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

Choice of Reference Sequence and Assembler for Alignment of Listeria monocytogenes Short-Read Sequence Data Greatly Influences Rates of Error in SNP Analyses

PubMed Central

Pightling, Arthur W.; Petronella, Nicholas; Pagotto, Franco

2014-01-01

The wide availability of whole-genome sequencing (WGS) and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs) in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs) are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps) are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i) depth of sequencing coverage, ii) choice of reference-guided short-read sequence assembler, iii) choice of reference genome, and iv) whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT), using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming). We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers should test a variety of conditions to achieve optimal results. PMID:25144537

The diploid genome sequence of an Asian individual

PubMed Central

Wang, Jun; Wang, Wei; Li, Ruiqiang; Li, Yingrui; Tian, Geng; Goodman, Laurie; Fan, Wei; Zhang, Junqing; Li, Jun; Zhang, Juanbin; Guo, Yiran; Feng, Binxiao; Li, Heng; Lu, Yao; Fang, Xiaodong; Liang, Huiqing; Du, Zhenglin; Li, Dong; Zhao, Yiqing; Hu, Yujie; Yang, Zhenzhen; Zheng, Hancheng; Hellmann, Ines; Inouye, Michael; Pool, John; Yi, Xin; Zhao, Jing; Duan, Jinjie; Zhou, Yan; Qin, Junjie; Ma, Lijia; Li, Guoqing; Yang, Zhentao; Zhang, Guojie; Yang, Bin; Yu, Chang; Liang, Fang; Li, Wenjie; Li, Shaochuan; Li, Dawei; Ni, Peixiang; Ruan, Jue; Li, Qibin; Zhu, Hongmei; Liu, Dongyuan; Lu, Zhike; Li, Ning; Guo, Guangwu; Zhang, Jianguo; Ye, Jia; Fang, Lin; Hao, Qin; Chen, Quan; Liang, Yu; Su, Yeyang; san, A.; Ping, Cuo; Yang, Shuang; Chen, Fang; Li, Li; Zhou, Ke; Zheng, Hongkun; Ren, Yuanyuan; Yang, Ling; Gao, Yang; Yang, Guohua; Li, Zhuo; Feng, Xiaoli; Kristiansen, Karsten; Wong, Gane Ka-Shu; Nielsen, Rasmus; Durbin, Richard; Bolund, Lars; Zhang, Xiuqing; Li, Songgang; Yang, Huanming; Wang, Jian

2009-01-01

Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J. D. Watson and J. C. Venter), and structural variation identification. These variations were considered for their potential biological impact. Our sequence data and analyses demonstrate the potential usefulness of next-generation sequencing technologies for personal genomics. PMID:18987735

Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

PubMed

Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

2014-08-01

In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

High-throughput SNP genotyping of historical and modern samples of five bird species via sequence capture of ultraconserved elements.

PubMed

Lim, Haw Chuan; Braun, Michael J

2016-09-01

Sample availability limits population genetics research on many species, especially taxa from regions with high diversity. However, many such species are well represented in museum collections assembled before the molecular era. Development of techniques to recover genetic data from these invaluable specimens will benefit biodiversity science. Using a mixture of freshly preserved and historical tissue samples, and a sequence capture probe set targeting >5000 loci, we produced high-confidence genotype calls on thousands of single nucleotide polymorphisms (SNPs) in each of five South-East Asian bird species and their close relatives (N = 27-43). On average, 66.2% of the reads mapped to the pseudo-reference genome of each species. Of these mapped reads, an average of 52.7% was identified as PCR or optical duplicates. We achieved deeper effective sequencing for historical samples (122.7×) compared to modern samples (23.5×). The number of nucleotide sites with at least 8× sequencing depth was high, with averages ranging from 0.89 × 10(6)  bp (Arachnothera, modern samples) to 1.98 × 10(6)  bp (Stachyris, modern samples). Linear regression revealed that the amount of sequence data obtained from each historical sample (represented by per cent of the pseudo-reference genome recovered with ≥8× sequencing depth) was positively and significantly (P ≤ 0.013) related to how recently the sample was collected. We observed characteristic post-mortem damage in the DNA of historical samples. However, we were able to reduce the error rate significantly by truncating ends of reads during read mapping (local alignment) and conducting stringent SNP and genotype filtering. © 2016 John Wiley & Sons Ltd.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

PubMed

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

ISRNA: an integrative online toolkit for short reads from high-throughput sequencing data.

PubMed

Luo, Guan-Zheng; Yang, Wei; Ma, Ying-Ke; Wang, Xiu-Jie

2014-02-01

Integrative Short Reads NAvigator (ISRNA) is an online toolkit for analyzing high-throughput small RNA sequencing data. Besides the high-speed genome mapping function, ISRNA provides statistics for genomic location, length distribution and nucleotide composition bias analysis of sequence reads. Number of reads mapped to known microRNAs and other classes of short non-coding RNAs, coverage of short reads on genes, expression abundance of sequence reads as well as some other analysis functions are also supported. The versatile search functions enable users to select sequence reads according to their sub-sequences, expression abundance, genomic location, relationship to genes, etc. A specialized genome browser is integrated to visualize the genomic distribution of short reads. ISRNA also supports management and comparison among multiple datasets. ISRNA is implemented in Java/C++/Perl/MySQL and can be freely accessed at http://omicslab.genetics.ac.cn/ISRNA/.

IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

PubMed

Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

2017-06-26

IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino changes). The functionality is generic and can analyse any IG or TR single chain nucleotide sequence containing two V domains, provided that the corresponding species IMGT reference directory is available. The "Analysis of single chain Fragment variable (scFv)" implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST provides the identification and full characterization of the two V domains of full-length scFv (~850 bp) nucleotide sequences from combinatorial libraries. The analysis can also be performed on concatenated paired chains of expressed antigen receptor IG or TR repertoires.

Molecular detection of viral agents in free-ranging and captive neotropical felids in Brazil.

PubMed

Furtado, Mariana M; Taniwaki, Sueli A; de Barros, Iracema N; Brandão, Paulo E; Catão-Dias, José L; Cavalcanti, Sandra; Cullen, Laury; Filoni, Claudia; Jácomo, Anah T de Almeida; Jorge, Rodrigo S P; Silva, Nairléia Dos Santos; Silveira, Leandro; Ferreira Neto, José S

2017-09-01

We describe molecular testing for felid alphaherpesvirus 1 (FHV-1), carnivore protoparvovirus 1 (CPPV-1), feline calicivirus (FCV), alphacoronavirus 1 (feline coronavirus [FCoV]), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), and canine distemper virus (CDV) in whole blood samples of 109 free-ranging and 68 captive neotropical felids from Brazil. Samples from 2 jaguars ( Panthera onca) and 1 oncilla ( Leopardus tigrinus) were positive for FHV-1; 2 jaguars, 1 puma ( Puma concolor), and 1 jaguarundi ( Herpairulus yagouaroundi) tested positive for CPPV-1; and 1 puma was positive for FIV. Based on comparison of 103 nucleotides of the UL24-UL25 gene, the FHV-1 sequences were 99-100% similar to the FHV-1 strain of domestic cats. Nucleotide sequences of CPPV-1 were closely related to sequences detected in other wild carnivores, comparing 294 nucleotides of the VP1 gene. The FIV nucleotide sequence detected in the free-ranging puma, based on comparison of 444 nucleotides of the pol gene, grouped with other lentiviruses described in pumas, and had 82.4% identity with a free-ranging puma from Yellowstone Park and 79.5% with a captive puma from Brazil. Our data document the circulation of FHV-1, CPPV-1, and FIV in neotropical felids in Brazil.

A low molecular weight artificial RNA of unique size with multiple probe target regions

NASA Technical Reports Server (NTRS)

Pitulle, C.; Dsouza, L.; Fox, G. E.

1997-01-01

Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.

A space-efficient algorithm for local similarities.

PubMed

Huang, X Q; Hardison, R C; Miller, W

1990-10-01

Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.

Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

PubMed

Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

2013-10-01

Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

USGS Publications Warehouse

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates.

PubMed

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David; Lagarrigue, Sandrine; Pitel, Frédérique

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome.

Genome-Wide Characterization of RNA Editing in Chicken Embryos Reveals Common Features among Vertebrates

PubMed Central

Frésard, Laure; Leroux, Sophie; Roux, Pierre-François; Klopp, Christophe; Fabre, Stéphane; Esquerré, Diane; Dehais, Patrice; Djari, Anis; Gourichon, David

2015-01-01

RNA editing results in a post-transcriptional nucleotide change in the RNA sequence that creates an alternative nucleotide not present in the DNA sequence. This leads to a diversification of transcription products with potential functional consequences. Two nucleotide substitutions are mainly described in animals, from adenosine to inosine (A-to-I) and from cytidine to uridine (C-to-U). This phenomenon is described in more details in mammals, notably since the availability of next generation sequencing technologies allowing whole genome screening of RNA-DNA differences. The number of studies recording RNA editing in other vertebrates like chicken is still limited. We chose to use high throughput sequencing technologies to search for RNA editing in chicken, and to extend the knowledge of its conservation among vertebrates. We performed sequencing of RNA and DNA from 8 embryos. Being aware of common pitfalls inherent to sequence analyses that lead to false positive discovery, we stringently filtered our datasets and found fewer than 40 reliable candidates. Conservation of particular sites of RNA editing was attested by the presence of 3 edited sites previously detected in mammals. We then characterized editing levels for selected candidates in several tissues and at different time points, from 4.5 days of embryonic development to adults, and observed a clear tissue-specificity and a gradual increase of editing level with time. By characterizing the RNA editing landscape in chicken, our results highlight the extent of evolutionary conservation of this phenomenon within vertebrates, attest to its tissue and stage specificity and provide support of the absence of non A-to-I events from the chicken transcriptome. PMID:26024316

MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments

PubMed Central

Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin

2017-01-01

Motivation: With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. Results: We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. Availability and implementation: MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator. The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. Contact: igs@sanger.ac.uk or mh26@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27605100

MPRAnator: a web-based tool for the design of massively parallel reporter assay experiments.

PubMed

Georgakopoulos-Soares, Ilias; Jain, Naman; Gray, Jesse M; Hemberg, Martin

2017-01-01

With the rapid advances in DNA synthesis and sequencing technologies and the continuing decline in the associated costs, high-throughput experiments can be performed to investigate the regulatory role of thousands of oligonucleotide sequences simultaneously. Nevertheless, designing high-throughput reporter assay experiments such as massively parallel reporter assays (MPRAs) and similar methods remains challenging. We introduce MPRAnator, a set of tools that facilitate rapid design of MPRA experiments. With MPRA Motif design, a set of variables provides fine control of how motifs are placed into sequences, thereby allowing the investigation of the rules that govern transcription factor (TF) occupancy. MPRA single-nucleotide polymorphism design can be used to systematically examine the functional effects of single or combinations of single-nucleotide polymorphisms at regulatory sequences. Finally, the Transmutation tool allows for the design of negative controls by permitting scrambling, reversing, complementing or introducing multiple random mutations in the input sequences or motifs. MPRAnator tool set is implemented in Python, Perl and Javascript and is freely available at www.genomegeek.com and www.sanger.ac.uk/science/tools/mpranator The source code is available on www.github.com/hemberg-lab/MPRAnator/ under the MIT license. The REST API allows programmatic access to MPRAnator using simple URLs. igs@sanger.ac.uk or mh26@sanger.ac.ukSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

PubMed

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America.

PubMed

Nagai, Alice; Duarte, Lígia M L; Chaves, Alexandre L R; Alexandre, Maria A V; Ramos-González, Pedro L; Chabi-Jesus, Camila; Harakava, Ricardo; Dos Santos, Déborah Y A C

2018-05-10

The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States. Copyright © 2018 Nagai et al.

A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

USDA-ARS?s Scientific Manuscript database

Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

PubMed

Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

2014-05-04

The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

Molecular detection and characterization of Theileria species in the Philippines.

PubMed

Belotindos, Lawrence P; Lazaro, Jonathan V; Villanueva, Marvin A; Mingala, Claro N

2014-09-01

Theileriosis is a tick-borne disease of domestic and wild animals that cause devastating economic loss in livestock in tropical and subtropical regions. Theileriosis is not yet documented in the Philippines as compared to babesiosis and anaplasmosis which are considered major tick-borne diseases that infect livestock in the country and contribute major losses to the livestock industry. The study was aimed to detect Theileria sp. at genus level in blood samples of cattle using polymerase chain reaction (PCR) assay. Specifically, it determined the phylogenetic relationship of Theileria species affecting cattle in the Philippines to other Theileria sp. registered in the GenBank. A total of 292 blood samples of cattle that were collected from various provinces were used. Theileria sp. was detected in 43/292 from the cattle blood samples using PCR assay targeting the major piroplasm surface protein (MPSP) gene. DNA sequence showed high similarity (90-99%) among the reported Theileria sp. isolates in the GenBank and the Philippine isolates of Theileria. Phylogenetic tree construction using nucleotide sequence classified the Philippine isolates of Theileria as benign. However, nucleotide polymorphism was observed in the new isolate based on nucleotide sequence alignment. It revealed that the new isolate can be a new species of Theileria.

Analyzing Somatic Genome Rearrangements in Human Cancers by Using Whole-Exome Sequencing | Office of Cancer Genomics

Cancer.gov

Although exome sequencing data are generated primarily to detect single-nucleotide variants and indels, they can also be used to identify a subset of genomic rearrangements whose breakpoints are located in or near exons. Using >4,600 tumor and normal pairs across 15 cancer types, we identified over 9,000 high confidence somatic rearrangements, including a large number of gene fusions.

A population study of the minicircles in Trypanosoma cruzi: predicting guide RNAs in the absence of empirical RNA editing.

PubMed

Thomas, Sean; Martinez, L L Isadora Trejo; Westenberger, Scott J; Sturm, Nancy R

2007-05-24

The structurally complex network of minicircles and maxicircles comprising the mitochondrial DNA of kinetoplastids mirrors the complexity of the RNA editing process that is required for faithful expression of encrypted maxicircle genes. Although a few of the guide RNAs that direct this editing process have been discovered on maxicircles, guide RNAs are mostly found on the minicircles. The nuclear and maxicircle genomes have been sequenced and assembled for Trypanosoma cruzi, the causative agent of Chagas disease, however the complement of 1.4-kb minicircles, carrying four guide RNA genes per molecule in this parasite, has been less thoroughly characterised. Fifty-four CL Brener and 53 Esmeraldo strain minicircle sequence reads were extracted from T. cruzi whole genome shotgun sequencing data. With these sequences and all published T. cruzi minicircle sequences, 108 unique guide RNAs from all known T. cruzi minicircle sequences and two guide RNAs from the CL Brener maxicircle were predicted using a local alignment algorithm and mapped onto predicted or experimentally determined sequences of edited maxicircle open reading frames. For half of the sequences no statistically significant guide RNA could be assigned. Likely positions of these unidentified gRNAs in T. cruzi minicircle sequences are estimated using a simple Hidden Markov Model. With the local alignment predictions as a standard, the HMM had an ~85% chance of correctly identifying at least 20 nucleotides of guide RNA from a given minicircle sequence. Inter-minicircle recombination was documented. Variable regions contain species-specific areas of distinct nucleotide preference. Two maxicircle guide RNA genes were found. The identification of new minicircle sequences and the further characterization of all published minicircles are presented, including the first observation of recombination between minicircles. Extrapolation suggests a level of 4% recombinants in the population, supporting a relatively high recombination rate that may serve to minimize the persistence of gRNA pseudogenes. Characteristic nucleotide preferences observed within variable regions provide potential clues regarding the transcription and maturation of T. cruzi guide RNAs. Based on these preferences, a method of predicting T. cruzi guide RNAs using only primary minicircle sequence data was created.

The DNA Data Bank of Japan launches a new resource, the DDBJ Omics Archive of functional genomics experiments.

PubMed

Kodama, Yuichi; Mashima, Jun; Kaminuma, Eli; Gojobori, Takashi; Ogasawara, Osamu; Takagi, Toshihisa; Okubo, Kousaku; Nakamura, Yasukazu

2012-01-01

The DNA Data Bank of Japan (DDBJ; http://www.ddbj.nig.ac.jp) maintains and provides archival, retrieval and analytical resources for biological information. The central DDBJ resource consists of public, open-access nucleotide sequence databases including raw sequence reads, assembly information and functional annotation. Database content is exchanged with EBI and NCBI within the framework of the International Nucleotide Sequence Database Collaboration (INSDC). In 2011, DDBJ launched two new resources: the 'DDBJ Omics Archive' (DOR; http://trace.ddbj.nig.ac.jp/dor) and BioProject (http://trace.ddbj.nig.ac.jp/bioproject). DOR is an archival database of functional genomics data generated by microarray and highly parallel new generation sequencers. Data are exchanged between the ArrayExpress at EBI and DOR in the common MAGE-TAB format. BioProject provides an organizational framework to access metadata about research projects and the data from the projects that are deposited into different databases. In this article, we describe major changes and improvements introduced to the DDBJ services, and the launch of two new resources: DOR and BioProject.

Porcine parvovirus: DNA sequence and genome organization.

PubMed

Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

1989-10-01

We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

PubMed

Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

2013-10-01

The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

High throughput sequencing analysis of RNA libraries reveals the influences of initial library and PCR methods on SELEX efficiency

PubMed Central

Takahashi, Mayumi; Wu, Xiwei; Ho, Michelle; Chomchan, Pritsana; Rossi, John J.; Burnett, John C.; Zhou, Jiehua

2016-01-01

The systemic evolution of ligands by exponential enrichment (SELEX) technique is a powerful and effective aptamer-selection procedure. However, modifications to the process can dramatically improve selection efficiency and aptamer performance. For example, droplet digital PCR (ddPCR) has been recently incorporated into SELEX selection protocols to putatively reduce the propagation of byproducts and avoid selection bias that result from differences in PCR efficiency of sequences within the random library. However, a detailed, parallel comparison of the efficacy of conventional solution PCR versus the ddPCR modification in the RNA aptamer-selection process is needed to understand effects on overall SELEX performance. In the present study, we took advantage of powerful high throughput sequencing technology and bioinformatics analysis coupled with SELEX (HT-SELEX) to thoroughly investigate the effects of initial library and PCR methods in the RNA aptamer identification. Our analysis revealed that distinct “biased sequences” and nucleotide composition existed in the initial, unselected libraries purchased from two different manufacturers and that the fate of the “biased sequences” was target-dependent during selection. Our comparison of solution PCR- and ddPCR-driven HT-SELEX demonstrated that PCR method affected not only the nucleotide composition of the enriched sequences, but also the overall SELEX efficiency and aptamer efficacy. PMID:27652575

Analysis of the beak and feather disease viral genome indicates the existence of several genotypes which have a complex psittacine host specificity.

PubMed

de Kloet, E; de Kloet, S R

2004-12-01

A study was made of the phylogenetic relationships between fifteen complete nucleotide sequences as well as 43 nucleotide sequences of the putative coat protein gene of different strains belonging to the virus species Beak and feather disease virus obtained from 39 individuals of 16 psittacine species. The species included among others, cockatoos ( Cacatuini), African grey parrots ( Psittacus erithacus) and peach-faced lovebirds ( Agapornis roseicollis), which were infected at different geographical locations, within and outside Australia, the native origin of the virus. The derived amino acid sequences of the putative coat protein were highly diverse, with differences between some strains amounting to 50 of the 250 amino acids. Phylogenetic analysis demonstrated that the putative coat gene sequences form six clusters which show a varying degree of psittacine species specificity. Most, but not all strains infecting African grey parrots formed a single cluster as did the strains infecting the cockatoos. Strains infecting the lovebirds clustered with those infecting such Australasian species as Eclectus roratus, Psittacula kramerii and Psephotus haematogaster. Although individual birds included in this study were, where studied, often infected by closely related strains, infection by highly diverged trains was also detected. The possible relationship between BFD viral strains and clinical disease signs is discussed.

High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

PubMed Central

Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

2015-01-01

The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

Tidying Up International Nucleotide Sequence Databases: Ecological, Geographical and Sequence Quality Annotation of ITS Sequences of Mycorrhizal Fungi

PubMed Central

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797

Gause's Principle and the Effect of Resource Partitioning on the Dynamical Coexistence of Replicating Templates

PubMed Central

Szilágyi, András; Zachar, István; Szathmáry, Eörs

2013-01-01

Models of competitive template replication, although basic for replicator dynamics and primordial evolution, have not yet taken different sequences explicitly into account, neither have they analyzed the effect of resource partitioning (feeding on different resources) on coexistence. Here we show by analytical and numerical calculations that Gause's principle of competitive exclusion holds for template replicators if resources (nucleotides) affect growth linearly and coexistence is at fixed point attractors. Cases of complementary or homologous pairing between building blocks with parallel or antiparallel strands show no deviation from the rule that the nucleotide compositions of stably coexisting species must be different and there cannot be more coexisting replicator species than nucleotide types. Besides this overlooked mechanism of template coexistence we show also that interesting sequence effects prevail as parts of sequences that are copied earlier affect coexistence more strongly due to the higher concentration of the corresponding replication intermediates. Template and copy always count as one species due their constraint of strict stoichiometric coupling. Stability of fixed-point coexistence tends to decrease with the length of sequences, although this effect is unlikely to be detrimental for sequences below 100 nucleotides. In sum, resource partitioning (niche differentiation) is the default form of competitive coexistence for replicating templates feeding on a cocktail of different nucleotides, as it may have been the case in the RNA world. Our analysis of different pairing and strand orientation schemes is relevant for artificial and potentially astrobiological genetics. PMID:23990769

Selection rhizosphere-competent microbes for development of microbial products as biocontrol agents

NASA Astrophysics Data System (ADS)

Mashinistova, A. V.; Elchin, A. A.; Gorbunova, N. V.; Muratov, V. S.; Kydralieva, K. A.; Khudaibergenova, B. M.; Shabaev, V. P.; Jorobekova, Sh. J.

2009-04-01

Rhizosphere-borne microorganisms reintroduced to the soil-root interface can establish without inducing permanent disturbance in the microbial balance and effectively colonise the rhizosphere due to carbon sources of plant root exudates. A challenge for future development of microbial products for use in agriculture will be selection of rhizosphere-competent microbes that both protect the plant from pathogens and improve crop establishment and persistence. In this study screening, collection, identification and expression of stable and technological microbial strains living in soils and in the rhizosphere of abundant weed - couch-grass Elytrigia repens L. Nevski were conducted. A total of 98 bacteria isolated from the rhizosphere were assessed for biocontrol activity in vitro against phytopathogenic fungi including Fusarium culmorum, Fusarium heterosporum, Fusarium oxysporum, Drechslera teres, Bipolaris sorokiniana, Piricularia oryzae, Botrytis cinerea, Colletothrichum atramentarium and Cladosporium sp., Stagonospora nodorum. Biocontrol activity were performed by the following methods: radial and parallel streaks, "host - pathogen" on the cuts of wheat leaves. A culture collection comprising 64 potential biocontrol agents (BCA) against wheat and barley root diseases has been established. Of these, the most effective were 8 isolates inhibitory to at least 4 out of 5 phytopathogenic fungi tested. The remaining isolates inhibited at least 1 of 5 fungi tested. Growth stimulating activity of proposed rhizobacteria-based preparations was estimated using seedling and vegetative pot techniques. Seeds-inoculation and the tests in laboratory and field conditions were conducted for different agricultural crops - wheat and barley. Intact cells, liquid culture filtrates and crude extracts of the four beneficial bacterial strains isolated from the rhizosphere of weed were studied to stimulate plant growth. As a result, four bacterial strains selected from rhizosphere of weed - couch-grass Elytrigia repens L. Nevski were chosen as a core of collection of 98 pure cultures with high fungicidal and plant growth-stimulating potentials. Partial determination of nucleotide sequence of 16S ribosomes of tested bacteria indicated that Pseudomonas and Bacillus species were the most dominant bacteria exhibiting biocontrol activity. Typing of bacterial strains was performed on the basis of partial determination of nucleotide sequence 16S ribosome of the studying strain. For this purpose polymerase chain reaction (PCR), using specific primers was provided with chromosomal DNA of bacterial strain under study. After determination of nucleotide sequences of the obtained PCR-fragments, the data obtained was compared with the sequences available in the bank of data (GENEBANK: http://www.ncbi.nlm.nih.gov), with the aim to determine close related strain to the organism under study. When the level of homology exceeded the level of 98%, one could conclude that the strain under study was identical to the available in the bank of data. Amplification and sequencing of gene 16S pDNA was performed using universal for the majority of prokaryotes primers. Thermopolimerase Long PCR Enzyme Mix «Fermentas», dNTP -«Fermentas» was used for amplification. While performing PCR, reagent concentrations corresponded to the protocols described in a set Long PCR Enzyme Mix «Fermentas». DNA separation from the sample was performed with DNeasy Plant Mini Kit «QIAGEN». DNA separation from gel was performed with QIAquick Gel Extraction Kit«QIAGEN». Phylogenetic affinity was determined on the basis of the comparison of nucleotide sequence - 400 nucleotides that approximately corresponded to the positions from 500 to 907 nucleotides by nomenclature of E.coli. Primary analysis of the similarity of nucleotide sequences of genes 16S рDNA of the strains under study was performed on the basis of data Genbank. Sequences were aligned according to nucleotide sequences of those bacteria, which had the highest degree of homology with the strains under study, applying the program ClustalX 1.83. Building of rootless phylogenetic trees of the studying bacteria was carried out with the help of the program Njplot. Acknowledgement. This research was supported by the grant of ISTC KR-993.2.

Identification of novel mutations and sequence variants in the SOX2 and CHX10 genes in patients with anophthalmia/microphthalmia

PubMed Central

Zhou, Jie; Kherani, Femida; Bardakjian, Tanya M.; Katowitz, James; Hughes, Nkecha; Schimmenti, Lisa A.; Schneider, Adele

2008-01-01

Purpose Mutations in the SOX2 and CHX10 genes have been reported in patients with anophthalmia and/or microphthalmia. In this study, we evaluated 34 anophthalmic/microphthalmic patient DNA samples (two sets of siblings included) for mutations and sequence variants in SOX2 and CHX10. Methods Conformational sensitive gel electrophoresis (CSGE) was used for the initial SOX2 and CHX10 screening of 34 affected individuals (two sets of siblings), five unaffected family members, and 80 healthy controls. Patient samples containing heteroduplexes were selected for sequence analysis. Base pair changes in SOX2 and CHX10 were confirmed by sequencing bidirectionally in patient samples. Results Two novel heterozygous mutations and two sequence variants (one known) in SOX2 were identified in this cohort. Mutation c.310 G>T (p. Glu104X), found in one patient, was in the region encoding the high mobility group (HMG) DNA-binding domain and resulted in a change from glutamic acid to a stop codon. The second mutation, noted in two affected siblings, was a single nucleotide deletion c.549delC (p. Pro184ArgfsX19) in the region encoding the activation domain, resulting in a frameshift and premature termination of the coding sequence. The shortened protein products may result in the loss of function. In addition, a novel nucleotide substitution c.*557G>A was identified in the 3′-untranslated region in one patient. The relationship between the nucleotide change and the protein function is indeterminate. A known single nucleotide polymorphism (c. *469 C>A, SNP rs11915160) was also detected in 2 of the 34 patients. Screening of CHX10 identified two synonymous sequence variants, c.471 C>T (p.Ser157Ser, rs35435463) and c.579 G>A (p. Gln193Gln, novel SNP), and one non-synonymous sequence variant, c.871 G>A (p. Asp291Asn, novel SNP). The non-synonymous polymorphism was also present in healthy controls, suggesting non-causality. Conclusions These results support the role of SOX2 in ocular development. Loss of SOX2 function results in severe eye malformation. CHX10 was not implicated with microphthalmia/anophthalmia in our patient cohort. PMID:18385794

DNA sequence-based comparative studies between non-extremophile and extremophile organisms with implications in exobiology

NASA Astrophysics Data System (ADS)

Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.

2008-08-01

We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Inactivation of the first nucleotide-binding fold of the sulfonylurea receptor, and familial persistent hyperinsulinemic hypoglycemia of infancy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, P.M.; Wohllk, N.; Huang, E.

1996-09-01

Familial persistent hyperinsulinemic hypoglycemia of infancy is a disorder of glucose homeostasis and is characterized by unregulated insulin secretion and profound hypoglycemia. Loss-of-function mutations in the second nucleotide-binding fold of the sulfonylurea receptor, a subunit of the pancreatic-islet {beta}-cell ATP-dependent potassium channel, has been demonstrated to be causative for persistent hyperinsulinemic hypoglycemia of infancy. We now describe three additional mutations in the first nucleotide-binding fold of the sulfonylurea-receptor gene. One point mutation disrupts the highly conserved Walker A motif of the first nucleotide-binding-fold region. The other two mutations occur in noncoding sequences required for RNA processing and are predicted tomore » disrupt the normal splicing pathway of the sulfonylurea-receptor mRNA precursor. These data suggest that both nucleotide-binding-fold regions of the sulfortylurea receptor are required for normal regulation of {beta}-cell ATP-dependent potassium channel activity and insulin secretion. 32 refs., 4 figs., 1 tab.« less

Automated sequence analysis and editing software for HIV drug resistance testing.

PubMed

Struck, Daniel; Wallis, Carole L; Denisov, Gennady; Lambert, Christine; Servais, Jean-Yves; Viana, Raquel V; Letsoalo, Esrom; Bronze, Michelle; Aitken, Sue C; Schuurman, Rob; Stevens, Wendy; Schmit, Jean Claude; Rinke de Wit, Tobias; Perez Bercoff, Danielle

2012-05-01

Access to antiretroviral treatment in resource-limited-settings is inevitably paralleled by the emergence of HIV drug resistance. Monitoring treatment efficacy and HIV drugs resistance testing are therefore of increasing importance in resource-limited settings. Yet low-cost technologies and procedures suited to the particular context and constraints of such settings are still lacking. The ART-A (Affordable Resistance Testing for Africa) consortium brought together public and private partners to address this issue. To develop an automated sequence analysis and editing software to support high throughput automated sequencing. The ART-A Software was designed to automatically process and edit ABI chromatograms or FASTA files from HIV-1 isolates. The ART-A Software performs the basecalling, assigns quality values, aligns query sequences against a set reference, infers a consensus sequence, identifies the HIV type and subtype, translates the nucleotide sequence to amino acids and reports insertions/deletions, premature stop codons, ambiguities and mixed calls. The results can be automatically exported to Excel to identify mutations. Automated analysis was compared to manual analysis using a panel of 1624 PR-RT sequences generated in 3 different laboratories. Discrepancies between manual and automated sequence analysis were 0.69% at the nucleotide level and 0.57% at the amino acid level (668,047 AA analyzed), and discordances at major resistance mutations were recorded in 62 cases (4.83% of differences, 0.04% of all AA) for PR and 171 (6.18% of differences, 0.03% of all AA) cases for RT. The ART-A Software is a time-sparing tool for pre-analyzing HIV and viral quasispecies sequences in high throughput laboratories and highlighting positions requiring attention. Copyright © 2012 Elsevier B.V. All rights reserved.

Nucleotide Sequence Database Comparison for Routine Dermatophyte Identification by Internal Transcribed Spacer 2 Genetic Region DNA Barcoding.

PubMed

Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

2018-05-01

Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

Discovery of 100K SNP array and its utilization in sugarcane

USDA-ARS?s Scientific Manuscript database

Next generation sequencing (NGS) enable us to identify thousands of single nucleotide polymorphisms (SNPs) marker for genotyping and fingerprinting. However, the process requires very precise bioinformatics analysis and filtering process. High throughput SNP array with predefined genomic location co...

Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment

PubMed Central

Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

PubMed Central

Paulsrud, Per; Lindblad, Peter

1998-01-01

We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

PubMed

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

PubMed Central

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Mapping copy number variation by population-scale genome sequencing.

PubMed

Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

2011-02-03

Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

DNA sequence alignment by microhomology sampling during homologous recombination

PubMed Central

Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

2015-01-01

Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

Molecular systematics of higher primates: genealogical relations and classification.

PubMed Central

Miyamoto, M M; Koop, B F; Slightom, J L; Goodman, M; Tennant, M R

1988-01-01

We obtained 5' and 3' flanking sequences (5.4 kilobase pairs) from the psi eta-globin gene region of the rhesus macaque (Macaca mulatta) and combined them with available nucleotide data. The completed sequence, representing 10.8 kilobase pairs of contiguous noncoding DNA, was compared to the same orthologous regions available for human (Homo sapiens, as represented by five different alleles), common chimpanzee (Pan troglodytes), gorilla (Gorilla gorilla), and orangutan (Pongo pygmaeus). The nucleotide sequence for Macaca mulatta provided the outgroup perspective needed to evaluate better the relationships of humans and great apes. Pairwise comparisons and parsimony analysis of these orthologues clearly demonstrated (i) that humans and great apes share a high degree of genetic similarity and (ii) that humans, chimpanzees, and gorillas form a natural monophyletic group. These conclusions strongly favor a genealogical classification for higher primates consisting of a single family (Hominidae) with two subfamilies (Homininae for Homo, Pan, and Gorilla and Ponginae for Pongo). PMID:3174657

Phylogeny of North American Powassan virus.

PubMed

Ebel, G D; Spielman, A; Telford, S R

2001-07-01

To determine whether Powassan virus (POW) and deer tick virus (DTV) constitute distinct flaviviral populations transmitted by ixodid ticks in North America, we analysed diverse nucleotide sequences from 16 strains of these viruses. Two distinct genetic lineages are evident, which may be defined by geographical and host associations. The nucleotide and amino acid sequences of lineage one (comprising New York and Canadian POW isolates) are highly conserved across time and space, but those of lineage two (comprising isolates from deer ticks and a fox) are more variable. The divergence between lineages is much greater than the variation within either lineage, and lineage two appears to be more diverse genetically than is lineage one. Application of McDonald-Kreitman tests to the sequences of these strains indicates that adaptive evolution of the envelope protein separates lineage one from lineage two. The two POW lineages circulating in North America possess a pattern of genetic diversity suggesting that they comprise distinct subtypes that may perpetuate in separate enzootic cycles.

The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames.

PubMed Central

Benne, R; De Vries, B F; Van den Burg, J; Klaver, B

1983-01-01

The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266

Characterization and Epidemiology of Pigeon Paramyxovirus Type-1 Viruses (PPMV-1) Isolated in Macedonia.

PubMed

Dodovski, A; Cvetkovikj, I; Krstevski, K; Naletoski, I; Savić, Vladimir

2017-06-01

We have characterized in this study 10 PPMV-1 isolated from domestic pigeons and one PPMV-1 isolated from a feral pigeon in the period 2007-2012, using both classical methods (HI test and ICPI test) and molecular methods (RT-qPCR, RT-PCR, and nucleotide sequencing). Using phylogenetic analysis of partial fusion gene sequences, these viruses clustered with recent European PPMV-1 isolates (EU/re) within the genotype VIb/1. All isolates possessed virulent cleavage site motifs with variable morbidity and mortality in pigeons. The intracerebral pathogenecity indices of the five isolates ranged from 0.59 to 1.53. The repetitive isolation of PPMV-1 viruses for several consecutive years led toward establishing enzootic presence of the disease in pigeons. A high nucleotide sequence homology between the Macedonian isolates and EU/re isolates was shown. Co-circulation of different isolates in the same holdings was detected. This is the first study to extensively describe the molecular epidemiology of PPMV-1 isolated in Macedonia.

Identification of IBV QX vaccine markers : Should vaccine acceptance by authorities require similar identifications for all live IBV vaccines?

PubMed

Listorti, Valeria; Laconi, Andrea; Catelli, Elena; Cecchinato, Mattia; Lupini, Caterina; Naylor, Clive J

2017-10-09

IBV genotype QX causes sufficient disease in Europe for several commercial companies to have started developing live attenuated vaccines. Here, one of those vaccines (L1148) was fully consensus sequenced alongside its progenitor field strain (1148-A) to determine vaccine markers, thereby enabling detection on farms. Twenty-eight single nucleotide substitutions were associated with the 1148-A attenuation, of which any combination can identify vaccine L1148 in the field. Sixteen substitutions resulted in amino acid coding changes of which half were in spike. One change in the 1b gene altered the normally highly conserved final 5 nucleotides of the transcription regulatory sequence of the S gene, common to all IBV QX genes. No mutations can currently be associated with the attenuation process. Field vaccination strategies would greatly benefit by such comparative sequence data being mandatorily submitted to regulators prior to vaccine release following a successful registration process. Copyright © 2017. Published by Elsevier Ltd.

Typing and comparative genome analysis of Brucella melitensis isolated from Lebanon.

PubMed

Abou Zaki, Natalia; Salloum, Tamara; Osman, Marwan; Rafei, Rayane; Hamze, Monzer; Tokajian, Sima

2017-10-16

Brucella melitensis is the main causative agent of the zoonotic disease brucellosis. This study aimed at typing and characterizing genetic variation in 33 Brucella isolates recovered from patients in Lebanon. Bruce-ladder multiplex PCR and PCR-RFLP of omp31, omp2a and omp2b were performed. Sixteen representative isolates were chosen for draft-genome sequencing and analyzed to determine variations in virulence, resistance, genomic islands, prophages and insertion sequences. Comparative whole-genome single nucleotide polymorphism analysis was also performed. The isolates were confirmed to be B. melitensis. Genome analysis revealed multiple virulence determinants and efflux pumps. Genome comparisons and single nucleotide polymorphisms divided the isolates based on geographical distribution but revealed high levels of similarity between the strains. Sequence divergence in B. melitensis was mainly due to lateral gene transfer of mobile elements. This is the first report of an in-depth genomic characterization of B. melitensis in Lebanon. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

PubMed

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Insights Into Upland Cotton (Gossypium hirsutum L.) Genetic Recombination Based on 3 High-Density Single-Nucleotide Polymorphism and a Consensus Map Developed Independently With Common Parents. Genomics Insights

USDA-ARS?s Scientific Manuscript database

High-density linkage maps are vital to supporting the correct placement of scaffolds and gene sequences on chromosomes and fundamental to contemporary organismal research and scientific approaches to genetic improvement; high-density linkage maps are especially important in paleopolyploids with exce...

Recognition Tunneling of Canonical and Modified RNA Nucleotides for Their Identification with the Aid of Machine Learning.

PubMed

Im, JongOne; Sen, Suman; Lindsay, Stuart; Zhang, Peiming

2018-06-28

In the present study, we demonstrate a tunneling nanogap technique to identify individual RNA nucleotides, which can be used as a mechanism to read the nucleobases for direct sequencing of RNA in a solid-state nanopore. The tunneling nanogap is composed of two electrodes separated by a distance of <3 nm and functionalized with a recognition molecule. When a chemical entity is captured in the gap, it generates electron tunneling currents, a process we call recognition tunneling (RT). Using RT nanogaps created in a scanning tunneling microscope (STM), we acquired the electron tunneling signals for the canonical and two modified RNA nucleotides. To call the individual RNA nucleotides from the RT data, we adopted a machine learning algorithm, support vector machine (SVM), for the data analysis. Through the SVM, we were able to identify the individual RNA nucleotides and distinguish them from their DNA counterparts with reasonably high accuracy. Since each RNA nucleoside contains a hydroxyl group at the 2'-position of its sugar ring in an RNA strand, it allows for the formation of a tunneling junction at a larger nanogap compared to the DNA nucleoside in a DNA strand, which lacks the 2' hydroxyl group. It also proves advantageous for the manufacture of RT devices. This study is a proof-of-principle demonstration for the development of an RT nanopore device for directly sequencing single RNA molecules, including those bearing modifications.

Spontaneous Chloroplast Mutants Mostly Occur by Replication Slippage and Show a Biased Pattern in the Plastome of Oenothera[OPEN

PubMed Central

Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S.; Johnson, Marc T.J.; Wright, Stephen I.; Pellizzer, Tommaso; Sobanski, Johanna; Greiner, Stephan

2016-01-01

Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. PMID:27053421

Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

PubMed

Howe, J G; Shu, M D

1988-08-01

Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

Cloning the promoter for transforming growth factor-beta type III receptor. Basal and conditional expression in fetal rat osteoblasts

NASA Technical Reports Server (NTRS)

Ji, C.; Chen, Y.; McCarthy, T. L.; Centrella, M.

1999-01-01

Transforming growth factor-beta binds to three high affinity cell surface molecules that directly or indirectly regulate its biological effects. The type III receptor (TRIII) is a proteoglycan that lacks significant intracellular signaling or enzymatic motifs but may facilitate transforming growth factor-beta binding to other receptors, stabilize multimeric receptor complexes, or segregate growth factor from activating receptors. Because various agents or events that regulate osteoblast function rapidly modulate TRIII expression, we cloned the 5' region of the rat TRIII gene to assess possible control elements. DNA fragments from this region directed high reporter gene expression in osteoblasts. Sequencing showed no consensus TATA or CCAAT boxes, whereas several nuclear factors binding sequences within the 3' region of the promoter co-mapped with multiple transcription initiation sites, DNase I footprints, gel mobility shift analysis, or loss of activity by deletion or mutation. An upstream enhancer was evident 5' proximal to nucleotide -979, and a silencer region occurred between nucleotides -2014 and -2194. Glucocorticoid sensitivity mapped between nucleotides -687 and -253, whereas bone morphogenetic protein 2 sensitivity co-mapped within the silencer region. Thus, the TRIII promoter contains cooperative basal elements and dispersed growth factor- and hormone-sensitive regulatory regions that can control TRIII expression by osteoblasts.

DNAAlignEditor: DNA alignment editor tool

PubMed Central

Sanchez-Villeda, Hector; Schroeder, Steven; Flint-Garcia, Sherry; Guill, Katherine E; Yamasaki, Masanori; McMullen, Michael D

2008-01-01

Background With advances in DNA re-sequencing methods and Next-Generation parallel sequencing approaches, there has been a large increase in genomic efforts to define and analyze the sequence variability present among individuals within a species. For very polymorphic species such as maize, this has lead to a need for intuitive, user-friendly software that aids the biologist, often with naïve programming capability, in tracking, editing, displaying, and exporting multiple individual sequence alignments. To fill this need we have developed a novel DNA alignment editor. Results We have generated a nucleotide sequence alignment editor (DNAAlignEditor) that provides an intuitive, user-friendly interface for manual editing of multiple sequence alignments with functions for input, editing, and output of sequence alignments. The color-coding of nucleotide identity and the display of associated quality score aids in the manual alignment editing process. DNAAlignEditor works as a client/server tool having two main components: a relational database that collects the processed alignments and a user interface connected to database through universal data access connectivity drivers. DNAAlignEditor can be used either as a stand-alone application or as a network application with multiple users concurrently connected. Conclusion We anticipate that this software will be of general interest to biologists and population genetics in editing DNA sequence alignments and analyzing natural sequence variation regardless of species, and will be particularly useful for manual alignment editing of sequences in species with high levels of polymorphism. PMID:18366684

Molecular characterisation of Atlantic salmon paramyxovirus (ASPV): A novel paramyxovirus associated with proliferative gill inflammation

USGS Publications Warehouse

Falk, K.; Batts, W.N.; Kvellestad, A.; Kurath, G.; Wiik-Nielsen, J.; Winton, J.R.

2008-01-01

Atlantic salmon paramyxovirus (ASPV) was isolated in 1995 from gills of farmed Atlantic salmon suffering from proliferative gill inflammation. The complete genome sequence of ASPV was determined, revealing a genome 16,968 nucleotides in length consisting of six non-overlapping genes coding for the nucleo- (N), phospho- (P), matrix- (M), fusion- (F), haemagglutinin-neuraminidase- (HN) and large polymerase (L) proteins in the order 3???-N-P-M-F-HN-L-5???. The various conserved features related to virus replication found in most paramyxoviruses were also found in ASPV. These include: conserved and complementary leader and trailer sequences, tri-nucleotide intergenic regions and highly conserved transcription start and stop signal sequences. The P gene expression strategy of ASPV was like that of the respiro-, morbilli- and henipaviruses, which express the P and C proteins from the primary transcript and edit a portion of the mRNA to encode V and W proteins. Sequence similarities among various features related to virus replication, pairwise comparisons of all deduced ASPV protein sequences with homologous regions from other members of the family Paramyxoviridae, and phylogenetic analyses of these amino acid sequences suggested that ASPV was a novel member of the sub-family Paramyxovirinae, most closely related to the respiroviruses. ?? 2008 Elsevier B.V. All rights reserved.

Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

PubMed Central

2014-01-01

Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Genetic diversity of Plasmodium Vivax revealed by the merozoite surface protein-1 icb5-6 fragment.

PubMed

Ruan, Wei; Zhang, Ling-Ling; Feng, Yan; Zhang, Xuan; Chen, Hua-Liang; Lu, Qiao-Yi; Yao, Li-Nong; Hu, Wei

2017-06-05

Plasmodium vivax remains a potential cause of morbidity and mortality for people living in its endemic areas. Understanding the genetic diversity of P. vivax from different regions is valuable for studying population dynamics and tracing the origins of parasites. The PvMSP-1 gene is highly polymorphic and has been used as a marker in many P. vivax population studies. The aim of this study was to investigate the genetic diversity of the PvMSP-1 gene icb5-6 fragment and to provide more genetic polymorphism data for further studies on P. vivax population structure and tracking of the origin of clinical cases. Nested PCR and sequencing of the PvMSP-1 icb5-6 marker were performed to obtain the nucleotide sequences of 95 P. vivax isolates collected from Zhejiang province, China. To investigate the genetic diversity of PvMSP-1, the 95 nucleotide sequences of the PvMSP-1 icb5-6 fragment were genotyped and analyzed using DnaSP v5, MEGA software. The 95 P. vivax isolates collected from Zhejiang province were either indigenous cases or imported cases from different regions around the world. A total of 95 sequences ranging from 390 to 460 bp were obtained. The 95 sequences were genotyped into four allele-types (Sal I, Belem, R-III and R-IV) and 17 unique haplotypes. R-III and Sal I were the predominant allele-types. The haplotype diversity (Hd) and nucleotide diversity (Pi) were estimated to be 0.729 and 0.062, indicating that the PvMSP-1 icb5-6 fragment had the highest level of polymorphism due to frequent recombination processes and single nucleotide polymorphism. The values of dN/dS and Tajima's D both suggested neutral selection for the PvMSP-1icb5-6 fragment. In addition, a rare recombinant style of R-IV type was identified. This study presented high genetic diversity in the PvMSP-1 marker among P. vivax strains from around the world. The genetic data is valuable for expanding the polymorphism information on P. vivax, which could be helpful for further study on population dynamics and tracking the origin of P. vivax.

Molecular identification of Trichuris vulpis and Trichuris suis isolated from different hosts.

PubMed

Cutillas, Cristina; de Rojas, Manuel; Ariza, Concepción; Ubeda, José Manuel; Guevara, Diego

2007-01-01

Trichuris suis was isolated from the cecum of two different hosts (Sus scrofa domestica -- swine and Sus scrofa scrofa -- wild boar) and Trichuris vulpis from dogs in Sevilla, Spain. Genomic DNA was isolated and internal transcribed spacers (ITS)1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced using polymerase chain reaction techniques. The sequence of T. suis from both hosts was 1,396 bp in length while that of T. vulpis was 1,044 bp. ITS1 of both populations isolated of T. suis was 661 nucleotides in length, while the ITS2 was 534 nucleotides in length. Furthermore, the ITS1 of T. vulpis was 410 nucleotides in length, while the ITS2 was 433 nucleotides in length. One hundred fifty-four nucleotides were observed along the 5.8S gene of T. suis and T. vulpis. Intraindividual and intraspecific variations were detected in the rDNA of both species. The presence of microsatellites was observed in all the individuals assayed. Sequence analysis of the ITSs and the 5.8S gene has demonstrated no sequence differences between T. suis isolated from both hosts (S. scrofa domestica -- swine and S. scrofa scrofa -- wild boar). Nevertheless, clear differences were detected between the ITS1 and ITS2 of T. suis and T. vulpis. Furthermore, a comparative molecular analysis between both species and the previously published ITS1-5.8S-ITS2 sequence data of Trichuris ovis, Trichuris leporis, Trichuris muris, Trichuris arvicolae, and Trichuris skrjabini was carried out. A common homology zone was detected in the ITS1 sequence of all species of trichurids.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Detection of a novel herpesvirus from bats in the Philippines.

PubMed

Sano, Kaori; Okazaki, Sachiko; Taniguchi, Satoshi; Masangkay, Joseph S; Puentespina, Roberto; Eres, Eduardo; Cosico, Edison; Quibod, Niña; Kondo, Taisuke; Shimoda, Hiroshi; Hatta, Yuuki; Mitomo, Shumpei; Oba, Mami; Katayama, Yukie; Sassa, Yukiko; Furuya, Tetsuya; Nagai, Makoto; Une, Yumi; Maeda, Ken; Kyuwa, Shigeru; Yoshikawa, Yasuhiro; Akashi, Hiroomi; Omatsu, Tsutomu; Mizutani, Tetsuya

2015-08-01

Bats are natural hosts of many zoonotic viruses. Monitoring bat viruses is important to detect novel bat-borne infectious diseases. In this study, next generation sequencing techniques and conventional PCR were used to analyze intestine, lung, and blood clot samples collected from wild bats captured at three locations in Davao region, in the Philippines in 2012. Different viral genes belonging to the Retroviridae and Herpesviridae families were identified using next generation sequencing. The existence of herpesvirus in the samples was confirmed by PCR using herpesvirus consensus primers. The nucleotide sequences of the resulting PCR amplicons were 166-bp. Further phylogenetic analysis identified that the virus from which this nucleotide sequence was obtained belonged to the Gammaherpesvirinae subfamily. PCR using primers specific to the nucleotide sequence obtained revealed that the infection rate among the captured bats was 30 %. In this study, we present the partial genome of a novel gammaherpesvirus detected from wild bats. Our observations also indicate that this herpesvirus may be widely distributed in bat populations in Davao region.

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Isolated nucleic acids encoding antipathogenic polypeptides and uses thereof

DOEpatents

Altier, Daniel J.; Crane, Virginia C.; Ellanskaya, Irina; Ellanskaya, Natalia; Gilliam, Jacob T.; Hunter-Cevera, Jennie; Presnail, James K.; Schepers, Eric J.; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser

2010-04-20

Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from fungal fermentation broths. Nucleic acids that encode the antipathogenic polypeptides are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention are also disclosed.

Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

PubMed Central

Hammond, R; Smith, D R; Diener, T O

1989-01-01

The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts

PubMed Central

Naito, Yuki; Bono, Hidemasa

2012-01-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users. PMID:22641850

GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.

PubMed

Naito, Yuki; Bono, Hidemasa

2012-07-01

GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.

The C-terminal Helix of Pseudomonas aeruginosa Elongation Factor Ts Tunes EF-Tu Dynamics to Modulate Nucleotide Exchange.

PubMed

De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim

2016-10-28

Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.

2004-05-01

We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha withinmore » the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.« less

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

Deconstruction of the Ras switching cycle through saturation mutagenesis

PubMed Central

Bandaru, Pradeep; Shah, Neel H; Bhattacharyya, Moitrayee; Barton, John P; Kondo, Yasushi; Cofsky, Joshua C; Gee, Christine L; Chakraborty, Arup K; Kortemme, Tanja; Ranganathan, Rama; Kuriyan, John

2017-01-01

Ras proteins are highly conserved signaling molecules that exhibit regulated, nucleotide-dependent switching between active and inactive states. The high conservation of Ras requires mechanistic explanation, especially given the general mutational tolerance of proteins. Here, we use deep mutational scanning, biochemical analysis and molecular simulations to understand constraints on Ras sequence. Ras exhibits global sensitivity to mutation when regulated by a GTPase activating protein and a nucleotide exchange factor. Removing the regulators shifts the distribution of mutational effects to be largely neutral, and reveals hotspots of activating mutations in residues that restrain Ras dynamics and promote the inactive state. Evolutionary analysis, combined with structural and mutational data, argue that Ras has co-evolved with its regulators in the vertebrate lineage. Overall, our results show that sequence conservation in Ras depends strongly on the biochemical network in which it operates, providing a framework for understanding the origin of global selection pressures on proteins. DOI: http://dx.doi.org/10.7554/eLife.27810.001 PMID:28686159

Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

PubMed

Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

2017-10-01

The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

A genome sequence resource for the aye-aye (Daubentonia madagascariensis), a nocturnal lemur from Madagascar.

PubMed

Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav

2012-01-01

We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.

Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

PubMed

Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

1993-01-01

DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

Development and evaluation of a high density genotyping 'Axiom_Arachis' array with 58K SNPs for accelerating genetics and breeding in groundnut

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are the most abundant DNA sequence variation in the genomes which can be used to associate genotypic variation to the phenotype. Therefore, availability of a high-density SNP array with uniform genome coverage can advance genetic studies and breeding applicatio...

LSGermOPA, a custom OPA of 384 EST-derived SNPs for high-throughput lettuce (Lactuca sativa L.) germplasm fingerprinting

USDA-ARS?s Scientific Manuscript database

We assessed the genetic diversity and population structure among 148 cultivated lettuce (Lactuca sativa L.) accessions using the high-throughput GoldenGate assay and 384 EST (Expressed Sequence Tag)-derived SNP (single nucleotide polymorphism) markers. A custom OPA (Oligo Pool All), LSGermOPA was fo...

Deep whole-genome sequencing of 90 Han Chinese genomes.

PubMed

Lan, Tianming; Lin, Haoxiang; Zhu, Wenjuan; Laurent, Tellier Christian Asker Melchior; Yang, Mengcheng; Liu, Xin; Wang, Jun; Wang, Jian; Yang, Huanming; Xu, Xun; Guo, Xiaosen

2017-09-01

Next-generation sequencing provides a high-resolution insight into human genetic information. However, the focus of previous studies has primarily been on low-coverage data due to the high cost of sequencing. Although the 1000 Genomes Project and the Haplotype Reference Consortium have both provided powerful reference panels for imputation, low-frequency and novel variants remain difficult to discover and call with accuracy on the basis of low-coverage data. Deep sequencing provides an optimal solution for the problem of these low-frequency and novel variants. Although whole-exome sequencing is also a viable choice for exome regions, it cannot account for noncoding regions, sometimes resulting in the absence of important, causal variants. For Han Chinese populations, the majority of variants have been discovered based upon low-coverage data from the 1000 Genomes Project. However, high-coverage, whole-genome sequencing data are limited for any population, and a large amount of low-frequency, population-specific variants remain uncharacterized. We have performed whole-genome sequencing at a high depth (∼×80) of 90 unrelated individuals of Chinese ancestry, collected from the 1000 Genomes Project samples, including 45 Northern Han Chinese and 45 Southern Han Chinese samples. Eighty-three of these 90 have been sequenced by the 1000 Genomes Project. We have identified 12 568 804 single nucleotide polymorphisms, 2 074 210 short InDels, and 26 142 structural variations from these 90 samples. Compared to the Han Chinese data from the 1000 Genomes Project, we have found 7 000 629 novel variants with low frequency (defined as minor allele frequency < 5%), including 5 813 503 single nucleotide polymorphisms, 1 169 199 InDels, and 17 927 structural variants. Using deep sequencing data, we have built a greatly expanded spectrum of genetic variation for the Han Chinese genome. Compared to the 1000 Genomes Project, these Han Chinese deep sequencing data enhance the characterization of a large number of low-frequency, novel variants. This will be a valuable resource for promoting Chinese genetics research and medical development. Additionally, it will provide a valuable supplement to the 1000 Genomes Project, as well as to other human genome projects. © The Authors 2017. Published by Oxford University Press.

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

PubMed Central

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128

A novel representation of the conformational structure of transfer RNAs. Correlation of the folding patterns of the polynucleotide chain with the base sequence and the nucleotide backbone torsions.

PubMed Central

Srinivasan, A R; Yathindra, N

1977-01-01

A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206

A Bioluminometric Method of DNA Sequencing

NASA Technical Reports Server (NTRS)

Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

2001-01-01

Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

Information Entropy Analysis of the H1N1 Genetic Code

NASA Astrophysics Data System (ADS)

Martwick, Andy

2010-03-01

During the current H1N1 pandemic, viral samples are being obtained from large numbers of infected people world-wide and are being sequenced on the NCBI Influenza Virus Resource Database. The information entropy of the sequences was computed from the probability of occurrence of each nucleotide base at every position of each set of sequences using Shannon's definition of information entropy, [ H=∑bpb,2( 1pb ) ] where H is the observed information entropy at each nucleotide position and pb is the probability of the base pair of the nucleotides A, C, G, U. Information entropy of the current H1N1 pandemic is compared to reference human and swine H1N1 entropy. As expected, the current H1N1 entropy is in a low entropy state and has a very large mutation potential. Using the entropy method in mature genes we can identify low entropy regions of nucleotides that generally correlate to critical protein function.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

PubMed

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

Complete genomic sequence of an infectious pancreatic necrosis virus isolated from rainbow trout (Oncorhynchus mykiss) in China.

PubMed

Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming

2017-04-01

Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.

Fluorescent signatures for variable DNA sequences

PubMed Central

Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

2012-01-01

Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

VarDetect: a nucleotide sequence variation exploratory tool

PubMed Central

Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades

2008-01-01

Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032

A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

ERIC Educational Resources Information Center

Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

2016-01-01

The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

Highly selective detection of single-nucleotide polymorphisms using a quartz crystal microbalance biosensor based on the toehold-mediated strand displacement reaction.

PubMed

Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng

2012-08-21

Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.

Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

PubMed

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

2018-01-09

Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of LDH as a therapeutic drug target.

QQ-SNV: single nucleotide variant detection at low frequency by comparing the quality quantiles.

PubMed

Van der Borght, Koen; Thys, Kim; Wetzels, Yves; Clement, Lieven; Verbist, Bie; Reumers, Joke; van Vlijmen, Herman; Aerssens, Jeroen

2015-11-10

Next generation sequencing enables studying heterogeneous populations of viral infections. When the sequencing is done at high coverage depth ("deep sequencing"), low frequency variants can be detected. Here we present QQ-SNV (http://sourceforge.net/projects/qqsnv), a logistic regression classifier model developed for the Illumina sequencing platforms that uses the quantiles of the quality scores, to distinguish true single nucleotide variants from sequencing errors based on the estimated SNV probability. To train the model, we created a dataset of an in silico mixture of five HIV-1 plasmids. Testing of our method in comparison to the existing methods LoFreq, ShoRAH, and V-Phaser 2 was performed on two HIV and four HCV plasmid mixture datasets and one influenza H1N1 clinical dataset. For default application of QQ-SNV, variants were called using a SNV probability cutoff of 0.5 (QQ-SNV(D)). To improve the sensitivity we used a SNV probability cutoff of 0.0001 (QQ-SNV(HS)). To also increase specificity, SNVs called were overruled when their frequency was below the 80(th) percentile calculated on the distribution of error frequencies (QQ-SNV(HS-P80)). When comparing QQ-SNV versus the other methods on the plasmid mixture test sets, QQ-SNV(D) performed similarly to the existing approaches. QQ-SNV(HS) was more sensitive on all test sets but with more false positives. QQ-SNV(HS-P80) was found to be the most accurate method over all test sets by balancing sensitivity and specificity. When applied to a paired-end HCV sequencing study, with lowest spiked-in true frequency of 0.5%, QQ-SNV(HS-P80) revealed a sensitivity of 100% (vs. 40-60% for the existing methods) and a specificity of 100% (vs. 98.0-99.7% for the existing methods). In addition, QQ-SNV required the least overall computation time to process the test sets. Finally, when testing on a clinical sample, four putative true variants with frequency below 0.5% were consistently detected by QQ-SNV(HS-P80) from different generations of Illumina sequencers. We developed and successfully evaluated a novel method, called QQ-SNV, for highly efficient single nucleotide variant calling on Illumina deep sequencing virology data.

Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

PubMed

Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

2016-08-05

This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

Expansion of the Preimmune Antibody Repertoire by Junctional Diversity in Bos taurus

PubMed Central

Liljavirta, Jenni; Niku, Mikael; Pessa-Morikawa, Tiina; Ekman, Anna; Iivanainen, Antti

2014-01-01

Cattle have a limited range of immunoglobulin genes which are further diversified by antigen independent somatic hypermutation in fetuses. Junctional diversity generated during somatic recombination contributes to antibody diversity but its relative significance has not been comprehensively studied. We have investigated the importance of terminal deoxynucleotidyl transferase (TdT) -mediated junctional diversity to the bovine immunoglobulin repertoire. We also searched for new bovine heavy chain diversity (IGHD) genes as the information of the germline sequences is essential to define the junctional boundaries between gene segments. New heavy chain variable genes (IGHV) were explored to address the gene usage in the fetal recombinations. Our bioinformatics search revealed five new IGHD genes, which included the longest IGHD reported so far, 154 bp. By genomic sequencing we found 26 new IGHV sequences that represent potentially new IGHV genes or allelic variants. Sequence analysis of immunoglobulin heavy chain cDNA libraries of fetal bone marrow, ileum and spleen showed 0 to 36 nontemplated N-nucleotide additions between variable, diversity and joining genes. A maximum of 8 N nucleotides were also identified in the light chains. The junctional base profile was biased towards A and T nucleotide additions (64% in heavy chain VD, 52% in heavy chain DJ and 61% in light chain VJ junctions) in contrast to the high G/C content which is usually observed in mice. Sequence analysis also revealed extensive exonuclease activity, providing additional diversity. B-lymphocyte specific TdT expression was detected in bovine fetal bone marrow by reverse transcription-qPCR and immunofluorescence. These results suggest that TdT-mediated junctional diversity and exonuclease activity contribute significantly to the size of the cattle preimmune antibody repertoire already in the fetal period. PMID:24926997

Fast and accurate phylogeny reconstruction using filtered spaced-word matches

PubMed Central

Sohrabi-Jahromi, Salma; Morgenstern, Burkhard

2017-01-01

Abstract Motivation: Word-based or ‘alignment-free’ algorithms are increasingly used for phylogeny reconstruction and genome comparison, since they are much faster than traditional approaches that are based on full sequence alignments. Existing alignment-free programs, however, are less accurate than alignment-based methods. Results: We propose Filtered Spaced Word Matches (FSWM), a fast alignment-free approach to estimate phylogenetic distances between large genomic sequences. For a pre-defined binary pattern of match and don’t-care positions, FSWM rapidly identifies spaced word-matches between input sequences, i.e. gap-free local alignments with matching nucleotides at the match positions and with mismatches allowed at the don’t-care positions. We then estimate the number of nucleotide substitutions per site by considering the nucleotides aligned at the don’t-care positions of the identified spaced-word matches. To reduce the noise from spurious random matches, we use a filtering procedure where we discard all spaced-word matches for which the overall similarity between the aligned segments is below a threshold. We show that our approach can accurately estimate substitution frequencies even for distantly related sequences that cannot be analyzed with existing alignment-free methods; phylogenetic trees constructed with FSWM distances are of high quality. A program run on a pair of eukaryotic genomes of a few hundred Mb each takes a few minutes. Availability and Implementation: The program source code for FSWM including a documentation, as well as the software that we used to generate artificial genome sequences are freely available at http://fswm.gobics.de/ Contact: chris.leimeister@stud.uni-goettingen.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28073754

Fast and accurate phylogeny reconstruction using filtered spaced-word matches.

PubMed

Leimeister, Chris-André; Sohrabi-Jahromi, Salma; Morgenstern, Burkhard

2017-04-01

Word-based or 'alignment-free' algorithms are increasingly used for phylogeny reconstruction and genome comparison, since they are much faster than traditional approaches that are based on full sequence alignments. Existing alignment-free programs, however, are less accurate than alignment-based methods. We propose Filtered Spaced Word Matches (FSWM) , a fast alignment-free approach to estimate phylogenetic distances between large genomic sequences. For a pre-defined binary pattern of match and don't-care positions, FSWM rapidly identifies spaced word-matches between input sequences, i.e. gap-free local alignments with matching nucleotides at the match positions and with mismatches allowed at the don't-care positions. We then estimate the number of nucleotide substitutions per site by considering the nucleotides aligned at the don't-care positions of the identified spaced-word matches. To reduce the noise from spurious random matches, we use a filtering procedure where we discard all spaced-word matches for which the overall similarity between the aligned segments is below a threshold. We show that our approach can accurately estimate substitution frequencies even for distantly related sequences that cannot be analyzed with existing alignment-free methods; phylogenetic trees constructed with FSWM distances are of high quality. A program run on a pair of eukaryotic genomes of a few hundred Mb each takes a few minutes. The program source code for FSWM including a documentation, as well as the software that we used to generate artificial genome sequences are freely available at http://fswm.gobics.de/. chris.leimeister@stud.uni-goettingen.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

PubMed

Campo, Daniel; García-Vázquez, Eva

2012-01-01

The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

Analysing grouping of nucleotides in DNA sequences using lumped processes constructed from Markov chains.

PubMed

Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude

2006-03-01

The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.

Identification of Biomolecular Building Blocks by Recognition Tunneling: Stride towards Nanopore Sequencing of Biomolecules

NASA Astrophysics Data System (ADS)

Sen, Suman

DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition, Pyrene reader showed higher DNA base-calling accuracy compare to Imidazole reader, the workhorse in our previous projects. In my other projects, various amino acids and RNA nucleoside monophosphates were also classified with significantly high accuracy using RT. Twenty naturally occurring amino acids and various RNA nucleosides (four canonical and two modified) were successfully identified. Thus, we envision nanopore sequencing biomolecules using Recognition Tunneling (RT) that should provide comprehensive betterment over current technologies in terms of time, chemical and instrumental cost and capability of de novo sequencing.

Incidence of three Kudoa spp., K. neothunni, K. hexapunctata, and K. thunni (Myxosporea: Multivalvulida), in Thunnus tunas distributed in the western Pacific Ocean.

PubMed

Kasai, Akihiro; Tsuduki, Hideaki; Jimenez, Lea Angsinco; Li, Ying-Chun; Tanaka, Shuhei; Sato, Hiroshi

2017-04-01

A variety of tunas of the genus Thunnus are consumed daily in Japan as sliced raw fish (sashimi and sushi). The consumption of fresh sliced raw fish, i.e., unfrozen or uncooked, can sometimes cause food poisoning that is manifested by transient diarrhea and vomiting for a single day. One of the causes of this type of food poisoning has been identified as live Kudoa septempunctata (Myxosporea: Multivalvulida) in the olive flounder (Paralichthys olivaceus). Furthermore, raw slices of fresh tunas are highly suspected to be a possible causative fish of similar food poisoning in Japan. In the present study, we conducted a survey of kudoid infections in tunas (the yellowfin tuna Thunnus albacares, the Pacific bluefin tuna Thunnus orientalis, and the longtail tuna Thunnus tonggol) fished in the western Pacific Ocean off Japan and several East Asian countries and characterized morphologically and genetically the kudoid myxospores in pseudocysts or cysts dispersed in the trunk muscles. Pseudocysts of solely Kudoa hexapunctata were identified in the Pacific bluefin tuna (four isolates), whereas in the yellowfin tuna (21 isolates) pseudocysts of Kudoa neothunni and K. hexapunctata were detected at a ratio of 15:6, respectively, in addition to cyst-forming Kudoa thunni in five yellowfin tunas. In the trunk muscles of six longtail tunas examined, pseudocysts of K. neothunni (all six fish) and K. hexapunctata (two fish) were densely dispersed. The myxospores of K. neothunni found in these longtail tunas had seven shell valves and polar capsules (SV/PC) instead of the more common six SV/PC arranged symmetrically. Nucleotide sequences of the 18S and 28S ribosomal RNA gene (rDNA), some with the internal transcribed spacer regions as well, of K. hexapunctata and K. neothunni from the three Thunnus spp., including the seven-SV/PC morphotype, were very similar to previously characterized nucleotide sequences of each species, whereas the 18S and 28S rDNA of four isolates of K. thunni from yellowfin tunas showed a range of nucleotide variations of 99.0-99.9% identity over 1752-1763-bp long partial 18S rDNA and 97.4-99.9% identity over 797-802-bp long partial 28S rDNA. Therefore, this rather high variation of the rDNA nucleotide sequences of K. thunni proved to be contrary to the few variations of K. neothunni and K. hexapunctata rDNA nucleotide sequences. The present study provides a new host record of the longtail tuna for K. neothunni and K. hexapunctata and reveals a high prevalence of the seven-SV/PC myxospore morphotype of K. neothunni in this tuna host.

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed Central

Bergman, Casey M.; Haddrill, Penelope R.

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center. PMID:25717372

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

PubMed

Bergman, Casey M; Haddrill, Penelope R

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

PubMed

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

PubMed

Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

2017-04-01

Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

Identification and nucleotide sequence analysis of the repetitive DNA element in the genome of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G

1987-12-01

The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).

Assembly and diploid architecture of an individual human genome via single-molecule technologies

PubMed Central

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-01-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality. PMID:26121404

Assembly and diploid architecture of an individual human genome via single-molecule technologies.

PubMed

Pendleton, Matthew; Sebra, Robert; Pang, Andy Wing Chun; Ummat, Ajay; Franzen, Oscar; Rausch, Tobias; Stütz, Adrian M; Stedman, William; Anantharaman, Thomas; Hastie, Alex; Dai, Heng; Fritz, Markus Hsi-Yang; Cao, Han; Cohain, Ariella; Deikus, Gintaras; Durrett, Russell E; Blanchard, Scott C; Altman, Roger; Chin, Chen-Shan; Guo, Yan; Paxinos, Ellen E; Korbel, Jan O; Darnell, Robert B; McCombie, W Richard; Kwok, Pui-Yan; Mason, Christopher E; Schadt, Eric E; Bashir, Ali

2015-08-01

We present the first comprehensive analysis of a diploid human genome that combines single-molecule sequencing with single-molecule genome maps. Our hybrid assembly markedly improves upon the contiguity observed from traditional shotgun sequencing approaches, with scaffold N50 values approaching 30 Mb, and we identified complex structural variants (SVs) missed by other high-throughput approaches. Furthermore, by combining Illumina short-read data with long reads, we phased both single-nucleotide variants and SVs, generating haplotypes with over 99% consistency with previous trio-based studies. Our work shows that it is now possible to integrate single-molecule and high-throughput sequence data to generate de novo assembled genomes that approach reference quality.

OncoNEM: inferring tumor evolution from single-cell sequencing data.

PubMed

Ross, Edith M; Markowetz, Florian

2016-04-15

Single-cell sequencing promises a high-resolution view of genetic heterogeneity and clonal evolution in cancer. However, methods to infer tumor evolution from single-cell sequencing data lag behind methods developed for bulk-sequencing data. Here, we present OncoNEM, a probabilistic method for inferring intra-tumor evolutionary lineage trees from somatic single nucleotide variants of single cells. OncoNEM identifies homogeneous cellular subpopulations and infers their genotypes as well as a tree describing their evolutionary relationships. In simulation studies, we assess OncoNEM's robustness and benchmark its performance against competing methods. Finally, we show its applicability in case studies of muscle-invasive bladder cancer and essential thrombocythemia.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

PubMed

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Nucleotide sequence of the 3' terminal region of lettuce mosaic potyvirus RNA shows a Gln/Val dipeptide at the cleavage site between the polymerase and the coat protein.

PubMed

Dinant, S; Lot, H; Albouy, J; Kuziak, C; Meyer, M; Astier-Manifacier, S

1991-01-01

DNA complementary to the 3' terminal 1651 nucleotides of the genome of the common strain of lettuce mosaic virus (LMV-O) has been cloned and sequenced. Microsequencing of the N-terminus enabled localization of the coat protein gene in this sequence. It showed also that the LMV coat protein coding region is at the 3' end of the genome, and that the coat protein is processed from a larger protein by cleavage at an unusual Q/V dipeptide between the polymerase and the coat protein. This is the first report of such a site for cleavage of a potyvirus polyprotein, where only Q/A, Q/S, and Q/G cleavage sites have been reported. The LMV coat protein gene encodes a 278 amino acid polypeptide with a calculated Mr of 31,171 and is flanked by a region which has a high degree of homology with the putative polymerase and a 3' untranslated region of 211 nucleotides in length. Percentage of homology with the coat protein of other potyviruses confirms that LMV is a distinct member of this group. Moreover, amino acid homologies noticed with the coat protein of potexvirus, bymovirus, and carlavirus elongated plant viruses suggest a functional significance for the conserved domains.

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Museum genomics: low-cost and high-accuracy genetic data from historical specimens.

PubMed

Rowe, Kevin C; Singhal, Sonal; Macmanes, Matthew D; Ayroles, Julien F; Morelli, Toni Lyn; Rubidge, Emily M; Bi, Ke; Moritz, Craig C

2011-11-01

Natural history collections are unparalleled repositories of geographical and temporal variation in faunal conditions. Molecular studies offer an opportunity to uncover much of this variation; however, genetic studies of historical museum specimens typically rely on extracting highly degraded and chemically modified DNA samples from skins, skulls or other dried samples. Despite this limitation, obtaining short fragments of DNA sequences using traditional PCR amplification of DNA has been the primary method for genetic study of historical specimens. Few laboratories have succeeded in obtaining genome-scale sequences from historical specimens and then only with considerable effort and cost. Here, we describe a low-cost approach using high-throughput next-generation sequencing to obtain reliable genome-scale sequence data from a traditionally preserved mammal skin and skull using a simple extraction protocol. We show that single-nucleotide polymorphisms (SNPs) from the genome sequences obtained independently from the skin and from the skull are highly repeatable compared to a reference genome. © 2011 Blackwell Publishing Ltd.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

LISTA, a comprehensive compilation of nucleotide sequences encoding proteins from the yeast Saccharomyces.

PubMed Central

Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P

1993-01-01

The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521

Isolation and characterization of NBS–LRR resistance gene analogues from mango

PubMed Central

Lei, Xintao; Yao, Quansheng; Xu, Xuerong; Liu, Yang

2014-01-01

The nucleotide-binding site (NBS)–leucine-rich repeat (LRR) gene family is a class of R genes in plants. NBS genes play a very important role in disease defence. To further study the variation and homology of mango NBS–LRR genes, 16 resistance gene analogues (RGAs) (GenBank accession number HM446507-22) were isolated from the polymerase chain reaction fragments and sequenced by using two degenerate primer sets. The total nucleotide diversity index Pi was 0.362, and 236 variation sites were found among 16 RGAs. The degree of homology between the RGAs varied from 44.4% to 98.5%. Sixteen RGAs could be translated into amino sequences. The high level of this homology in the protein sequences of the P-loop and kinase-2 of the NBS domain between the RGAs isolated in this study and previously characterized R genes indicated that these cloned sequences belonged to the NBS–LRR gene family. Moreover, these 16 RGAs could be classified into the non-TIR–NBS–LRR gene family because only tryptophan (W) could be claimed as the final residual of the kinase-2 domain of all RGAs isolated here. From our results, we concluded that our mango NBS–LRR genes possessed a high level of variation from the mango genome, which may allow mango to recognize many different pathogenic virulence factors. PMID:26740762

Complete sequence of Tvv1, a family of Ty 1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.

PubMed

Pelsy, F.; Merdinoglu, D.

2002-09-01

A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

PubMed

Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

2012-11-20

Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable resources for marker development, comparative genomic studies and candidate gene approaches. Next generation sequencing of leaf transcriptome is very effective; however, deeper sequencing and using more tissues and stages is advisable for extended comparative studies.

[Phylogenetic relationship of street rabies virus strains and their antigenic reactivity with antibodies induced by vaccine strains. I. Analysis of phylogenetic relationship of street rabies virus strains isolated in Poland].

PubMed

Sadkowska-Todys, M

2000-01-01

The aims of these studies were: genetic characteristic of street rabies virus strains isolated from different animal species in Poland and determination of phylogenetic relationships to reference laboratory strains of the street rabies viruses belonging to genotype 1 and 5. The variability of rabies isolates and their phylogenetic relationship were studied by comparing the nucleotide sequence of the virus genome fragment. The Polish strains of genotype 1 belong to four phylogenetic groups (NE, CE, NEE, EE) corresponding to four variants: fox-racoon dog (F-RD); European fox 1 (F1); European fox 2 (F2) and European fox 3 (F3). On the Polish territories there are no rabies strains representing the variant dog-wolf and typical for arctic fox variant. The similarity of nucleotide and amino acid sequences of street rabies strains belonging to genotype 1 and laboratory strain CVS is very high. It is about 91% similarity at nucleotide level and 95% at amino acid level. Rabies strain CVS is similar to genotype 5 bat strains (EBL 1) only in about 69% and 74% at nucleotide and amino acid level, respectively. The genetic divergence of rabies strains circulating in Poland raised the need of permanent epidemiological and virological surveillance. The genotype and variant of isolated strains should be determined (using PCR and RLFP methods).

The human myelin oligodendrocyte glycoprotein (MOG) gene: Complete nucleotide sequence and structural characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paule Roth, M.; Malfroy, L.; Offer, C.

1995-07-20

Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less

cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoefler, G.; Forstner, M.; Hulla, W.

1994-01-01

Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

PubMed

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

Cloning and expression of UDP-glucose: flavonoid 7-O-glucosyltransferase from hairy root cultures of Scutellaria baicalensis.

PubMed

Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T

2000-05-01

A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.

Characterization of Hungarian isolates of zucchini yellow mosaic virus (ZYMV, potyvirus) transmitted by seeds of Cucurbita pepo var Styriaca.

PubMed

Tóbiás, István; Palkovics, László

2003-04-01

Zucchini yellow mosaic virus (ZYMV) has emerged as an important pathogen of cucurbits within the last few years in Hungary. The Hungarian isolates show a high biological variability, have specific nucleotide and amino acid sequences in the N-terminal region of coat protein and form a distinct branch in the phylogenetic tree. The virus is spread very efficiently in the field by several aphid species in a non-persistent manner. It can be transmitted by seed in holl-less seeded oil pumpkin (Cucurbita pepo (L) var Styriaca), although at a very low rate. Three isolates from seed transmission assay experiments were chosen and their nucleotide sequences of coat proteins have been compared with the available CP sequences of ZYMV. According to the sequence analysis, the Hungarian isolates belong to the Central European branch in the phylogenetic tree and, together with the ZYMV isolates from Austria and Slovenia, share specific amino acids at positions 16, 17, 27 and 37 which are characteristic only to these isolates. The phylogenetic tree suggests the common origin of distantly distributed isolates which can be attributed to widespread seed transmission.

Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in Saccharomyces cerevisiae

PubMed Central

Piazza, Aurèle; Cui, Xiaojie; Adrian, Michael; Samazan, Frédéric; Heddi, Brahim; Phan, Anh-Tuan; Nicolas, Alain G

2017-01-01

G-quadruplexes (G4) are polymorphic four-stranded structures formed by certain G-rich nucleic acids in vitro, but the sequence and structural features dictating their formation and function in vivo remains uncertain. Here we report a structure-function analysis of the complex hCEB1 G4-forming sequence. We isolated four G4 conformations in vitro, all of which bear unusual structural features: Form 1 bears a V-shaped loop and a snapback guanine; Form 2 contains a terminal G-triad; Form 3 bears a zero-nucleotide loop; and Form 4 is a zero-nucleotide loop monomer or an interlocked dimer. In vivo, Form 1 and Form 2 differently account for 2/3rd of the genomic instability of hCEB1 in two G4-stabilizing conditions. Form 3 and an unidentified form contribute to the remaining instability, while Form 4 has no detectable effect. This work underscores the structural polymorphisms originated from a single highly G-rich sequence and demonstrates the existence of non-canonical G4s in cells, thus broadening the definition of G4-forming sequences. DOI: http://dx.doi.org/10.7554/eLife.26884.001 PMID:28661396

Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

USGS Publications Warehouse

Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

1996-01-01

Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

A nine-scaffold genome assembly of the nine chromosome sugar beet

USDA-ARS?s Scientific Manuscript database

A sugar beet genome sequence is required to take full advantage of the increasingly powerful approaches directed a single nucleotide resolution across the whole genome. A high quality reference genome serves as a benchmark from which other genotypes might be compared and exploited for sugar beet imp...

The Role of ABC Proteins in Drug-Resistant Breast Cancer Cells

DTIC Science & Technology

2007-04-01

and a biotin acceptor domain) under control of the alcohol oxidase promoter (Figure 2). Upon methanol induction, the yeast expressed high levels of...as native cDNA. Therefore, we backtranslated the protein into a nucleotide sequence codon-optimized for expression in Pichia pastoris yeast. Yeast

Molecular epidemiology of infectious laryngotracheitis: a review

USDA-ARS?s Scientific Manuscript database

Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...

Genome-wide annotation of mutations in a phenotyped mutant library provides an efficient platform for discovery of casual gene mutations

USDA-ARS?s Scientific Manuscript database

Ethyl methanesulfonate (EMS) efficiently generates high-density mutations in genomes. Conventionally, these mutations are identified by techniques that can detect single-nucleotide mismatches in heteroduplexes of individual PCR amplicons. We applied whole-genome sequencing to 256-phenotyped mutant l...

Genetic variation and virulence of nucleopolyhedroviruses isolated worldwide from the heliothine pests Helicoverpa armigera, Helicoverpa zea, and Heliothis virescens

USDA-ARS?s Scientific Manuscript database

A PCR-based method was used to classify 90 samples of nucleopolyhedrovirus (NPV; Baculoviridae: Alphabaculovirus) obtained worldwide from larvae of Heliothis virescens, Helicoverpa zea, and Helicoverpa armigera. Partial nucleotide sequencing and phylogenetic analysis of three highly conserved genes...

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Natural History of Human Respiratory Syncytial Virus Inferred from Phylogenetic Analysis of the Attachment (G) Glycoprotein with a 60-Nucleotide Duplication

PubMed Central

Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.

2006-01-01

A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999

UrQt: an efficient software for the Unsupervised Quality trimming of NGS data.

PubMed

Modolo, Laurent; Lerat, Emmanuelle

2015-04-29

Quality control is a necessary step of any Next Generation Sequencing analysis. Although customary, this step still requires manual interventions to empirically choose tuning parameters according to various quality statistics. Moreover, current quality control procedures that provide a "good quality" data set, are not optimal and discard many informative nucleotides. To address these drawbacks, we present a new quality control method, implemented in UrQt software, for Unsupervised Quality trimming of Next Generation Sequencing reads. Our trimming procedure relies on a well-defined probabilistic framework to detect the best segmentation between two segments of unreliable nucleotides, framing a segment of informative nucleotides. Our software only requires one user-friendly parameter to define the minimal quality threshold (phred score) to consider a nucleotide to be informative, which is independent of both the experiment and the quality of the data. This procedure is implemented in C++ in an efficient and parallelized software with a low memory footprint. We tested the performances of UrQt compared to the best-known trimming programs, on seven RNA and DNA sequencing experiments and demonstrated its optimality in the resulting tradeoff between the number of trimmed nucleotides and the quality objective. By finding the best segmentation to delimit a segment of good quality nucleotides, UrQt greatly increases the number of reads and of nucleotides that can be retained for a given quality objective. UrQt source files, binary executables for different operating systems and documentation are freely available (under the GPLv3) at the following address: https://lbbe.univ-lyon1.fr/-UrQt-.html .

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases

PubMed Central

Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard

2000-01-01

We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515

Asystasia mosaic Madagascar virus: a novel bipartite begomovirus infecting the weed Asystasia gangetica in Madagascar.

PubMed

De Bruyn, Alexandre; Harimalala, Mireille; Hoareau, Murielle; Ranomenjanahary, Sahondramalala; Reynaud, Bernard; Lefeuvre, Pierre; Lett, Jean-Michel

2015-06-01

Here, we describe for the first time the complete genome sequence of a new bipartite begomovirus in Madagascar isolated from the weed Asystasia gangetica (Acanthaceae), for which we propose the tentative name asystasia mosaic Madagascar virus (AMMGV). DNA-A and -B nucleotide sequences of AMMGV were only distantly related to known begomovirus sequence and shared highest nucleotide sequence identity of 72.9 % (DNA-A) and 66.9 % (DNA-B) with a recently described bipartite begomovirus infecting Asystasia sp. in West Africa. Phylogenetic analysis demonstrated that this novel virus from Madagascar belongs to a new lineage of Old World bipartite begomoviruses.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.