Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

PubMed

Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

2005-05-01

Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

Sequence analysis of MHC class I α2 from sockeye salmon (Oncorhynchus nerka).

PubMed

McClelland, Erin K; Ming, Tobi J; Tabata, Amy; Miller, Kristina M

2011-09-01

Most studies assessing adaptive MHC diversity in salmon populations have focused on the classical class II DAB or DAA loci, as these have been most amenable to single PCR amplifications due to their relatively low level of sequence divergence. Herein, we report the characterization of the classical class I UBA α2 locus based on collections taken throughout the species range of sockeye salmon (Oncorhynchus nerka). Through use of multiple lineage-specific primer sets, denaturing gradient gel electrophoresis and sequencing, we identified thirty-four alleles from three highly divergent lineages. Sequence identity between lineages ranged from 30.0% to 56.8% but was relatively high within lineages. Allelic identity within the antigen recognition site (ARS) was greater than for the longer sequence. Global positive selection on UBA was seen at the sequence level (dN:dS = 1.012) with four codons under positive selection and 12 codons under negative selection. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

High resolution identity testing of inactivated poliovirus vaccines.

PubMed

Mee, Edward T; Minor, Philip D; Martin, Javier

2015-07-09

Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

Sequence Similarity Presenter: a tool for the graphic display of similarities of long sequences for use in presentations.

PubMed

Fröhlich, K U

1994-04-01

A new method for the presentation of alignments of long sequences is described. The degree of identity for the aligned sequences is averaged for sections of a fixed number of residues. The resulting values are converted to shades of gray, with white corresponding to lack of identity and black corresponding to perfect identity. A sequence alignment is represented as a bar filled with varying shades of gray. The display is compact and allows for a fast and intuitive recognition of the distribution of regions with a high similarity. It is well suited for the presentation of alignments of long sequences, e.g. of protein superfamilies, in plenary lectures. The method is implemented as a HyperCard stack for Apple Macintosh computers. Several options for the modification of the output are available (e.g. background reduction, size of the summation window, consideration of amino acid similarity, inclusion of graphic markers to indicate specific domains). The output is a PostScript file which can be printed, imported as EPS or processed further with Adobe Illustrator.

Phylogenetic analysis of phenotypically characterized Cryptococcus laurentii isolates reveals high frequency of cryptic species.

PubMed

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99-100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode.

First report of Beet western yellows virus infecting Epiphyllum spp

USDA-ARS?s Scientific Manuscript database

Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

PubMed Central

Naz, Sadia; Ngo, Tony; Farooq, Umar

2017-01-01

Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

PubMed

Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

2017-01-01

The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

Sarcocystis spp. in domestic sheep in Kunming City, China: prevalence, morphology, and molecular characteristics.

PubMed

Hu, Jun-Jie; Huang, Si; Wen, Tao; Esch, Gerald W; Liang, Yu; Li, Hong-Liang

2017-01-01

Sheep (Ovis aries) are intermediate hosts for at least six named species of Sarcocystis: S. tenella, S. arieticanis, S. gigantea, S. medusiformis, S. mihoensis, and S. microps. Here, only two species, S. tenella and S. arieticanis, were found in 79 of 86 sheep (91.9%) in Kunming, China, based on their morphological characteristics. Four genetic markers, i.e., 18S rRNA gene, 28S rRNA gene, mitochondrial cox1 gene, and ITS-1 region, were sequenced and characterized for the two species of Sarcocystis. Sequences of the three former markers for S. tenella shared high identities with those of S. capracanis in goats, i.e., 99.0%, 98.3%, and 93.6%, respectively; the same three marker sequences of S. arieticanis shared high identities with those of S. hircicanis in goats, i.e., 98.5%, 96.5%, and 92.5%, respectively. No sequences in GenBank were found to significantly resemble the ITS-1 regions of S. tenella and S. arieticanis. Identities of the four genetic markers for S. tenella and S. arieticanis were 96.3%, 95.4%, 82.5%, and 66.2%, respectively. © J.-J. Hu et al., published by EDP Sciences, 2017.

Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

PubMed

Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

2017-02-01

Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Phylogenetic analysis of simian Plasmodium spp. infecting Anopheles balabacensis Baisas in Sabah, Malaysia

PubMed Central

Manin, Benny O.; Daim, Sylvia; Vythilingam, Indra; Drakeley, Chris

2017-01-01

Background Anopheles balabacensis of the Leucospyrus group has been confirmed as the primary knowlesi malaria vector in Sabah, Malaysian Borneo for some time now. Presently, knowlesi malaria is the only zoonotic simian malaria in Malaysia with a high prevalence recorded in the states of Sabah and Sarawak. Methodology/Principal findings Anopheles spp. were sampled using human landing catch (HLC) method at Paradason village in Kudat district of Sabah. The collected Anopheles were identified morphologically and then subjected to total DNA extraction and polymerase chain reaction (PCR) to detect Plasmodium parasites in the mosquitoes. Identification of Plasmodium spp. was confirmed by sequencing the SSU rRNA gene with species specific primers. MEGA4 software was then used to analyse the SSU rRNA sequences and bulid the phylogenetic tree for inferring the relationship between simian malaria parasites in Sabah. PCR results showed that only 1.61% (23/1,425) of the screened An. balabacensis were infected with one or two of the five simian Plasmodium spp. found in Sabah, viz. Plasmodium coatneyi, P. inui, P. fieldi, P. cynomolgi and P. knowlesi. Sequence analysis of SSU rRNA of Plasmodium isolates showed high percentage of identity within the same Plasmodium sp. group. The phylogenetic tree based on the consensus sequences of P. knowlesi showed 99.7%–100.0% nucleotide identity among the isolates from An. balabacensis, human patients and a long-tailed macaque from the same locality. Conclusions/Significance This is the first study showing high molecular identity between the P. knowlesi isolates from An. balabacensis, human patients and a long-tailed macaque in Sabah. The other common simian Plasmodium spp. found in long-tailed macaques and also detected in An. balabacensis were P. coatneyi, P. inui, P. fieldi and P. cynomolgi. The high percentage identity of nucleotide sequences between the P. knowlesi isolates from the long-tailed macaque, An. balabacensis and human patients suggests a close genetic relationship between the parasites from these hosts. PMID:28968395

Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

PubMed

Luo, M; Mao, X; Plummer, F A

2005-02-01

We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

A gyrovirus infecting a sea bird

PubMed Central

Li, Linlin; Pesavento, Patricia A.; Gaynor, Anne M.; Duerr, Rebecca S.; Phan, Tung Gia; Zhang, Wen; Deng, Xutao

2015-01-01

We characterized the genome of a highly divergent gyrovirus (GyV8) in the spleen and uropygial gland tissues of a diseased northern fulmar (Fulmarus glacialis), a pelagic bird beached in San Francisco, California. No other exogenous viral sequences could be identified using viral metagenomics. The small circular DNA genome shared no significant nucleotide sequence identity, and only 38–42 % amino acid sequence identity in VP1, with any of the previously identified gyroviruses. GyV8 is the first member of the third major phylogenetic clade of this viral genus and the first gyrovirus detected in an avian species other than chicken. PMID:26036564

Complete Genome Sequences of Bacillus Phages Janet and OTooleKemple52

PubMed Central

2018-01-01

ABSTRACT We report here the genome sequences of two novel Bacillus cereus group-infecting bacteriophages, Janet and OTooleKemple52. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples. While their genomes share a high degree of sequence identity with one another, their host preferences are unique. PMID:29748396

Development and application of a PCR assay to detect chicken and turkey parvoviruses in commercial poultry flocks in the United States.

USDA-ARS?s Scientific Manuscript database

Comparative sequence analysis of six independent chicken and turkey parvovirus nonstructural (NS) genes revealed specific genomic regions with 100% nucleotide sequence identity. A PCR assay with primers targeting these conserved genome sequences proved to be highly specific and sensitive to detect p...

Radiolabeled Escherichia coli heat-stable enterotoxin analogs for in vivo imaging of colorectal cancer

NASA Astrophysics Data System (ADS)

Giblin, M. F.; Sieckman, G. L.; Owen, N. K.; Hoffman, T. J.; Forte, L. R.; Volkert, W. A.

2005-12-01

The human Escherichia coli heat-stable enterotoxin (STh, amino acid sequence N1SSNYCCELCCNPACTGCY19) binds specifically to the guanylate cyclase C (GC-C) receptor, which is present in high density on the apical surface of normal intestinal epithelial cells as well as on the surface of human colon cancer cells. In the current study, two STh analogs were synthesized and evaluated in vitro and in vivo. Both analogs shared identical 6-19 core sequences, and had N-terminal pendant DOTA moieties. The analogs differed in the identity of a 6 amino acid peptide sequence intervening between DOTA and the 6-19 core. In one analog, the peptide was an RGD-containing sequence found in human fibronectin (GRGDSP), while in the other this peptide sequence was randomly scrambled (GRDSGP). The results indicated that the presence of the human fibronectin sequence in the hybrid peptide did not affect tumor localization in vivo.

Phylogenetic Analysis of Phenotypically Characterized Cryptococcus laurentii Isolates Reveals High Frequency of Cryptic Species

PubMed Central

Ferreira-Paim, Kennio; Ferreira, Thatiana Bragine; Andrade-Silva, Leonardo; Mora, Delio Jose; Springer, Deborah J.; Heitman, Joseph; Fonseca, Fernanda Machado; Matos, Dulcilena; Melhem, Márcia Souza Carvalho; Silva-Vergara, Mario León

2014-01-01

Background Although Cryptococcus laurentii has been considered saprophytic and its taxonomy is still being described, several cases of human infections have already reported. This study aimed to evaluate molecular aspects of C. laurentii isolates from Brazil, Botswana, Canada, and the United States. Methods In this study, 100 phenotypically identified C. laurentii isolates were evaluated by sequencing the 18S nuclear ribosomal small subunit rRNA gene (18S-SSU), D1/D2 region of 28S nuclear ribosomal large subunit rRNA gene (28S-LSU), and the internal transcribed spacer (ITS) of the ribosomal region. Results BLAST searches using 550-bp, 650-bp, and 550-bp sequenced amplicons obtained from the 18S-SSU, 28S-LSU, and the ITS region led to the identification of 75 C. laurentii strains that shared 99–100% identity with C. laurentii CBS 139. A total of nine isolates shared 99% identity with both Bullera sp. VY-68 and C. laurentii RY1. One isolate shared 99% identity with Cryptococcus rajasthanensis CBS 10406, and eight isolates shared 100% identity with Cryptococcus sp. APSS 862 according to the 28S-LSU and ITS regions and designated as Cryptococcus aspenensis sp. nov. (CBS 13867). While 16 isolates shared 99% identity with Cryptococcus flavescens CBS 942 according to the 18S-SSU sequence, only six were confirmed using the 28S-LSU and ITS region sequences. The remaining 10 shared 99% identity with Cryptococcus terrestris CBS 10810, which was recently described in Brazil. Through concatenated sequence analyses, seven sequence types in C. laurentii, three in C. flavescens, one in C. terrestris, and one in the C. aspenensis sp. nov. were identified. Conclusions Sequencing permitted the characterization of 75% of the environmental C. laurentii isolates from different geographical areas and the identification of seven haplotypes of this species. Among sequenced regions, the increased variability of the ITS region in comparison to the 18S-SSU and 28S-LSU regions reinforces its applicability as a DNA barcode. PMID:25251413

Molecular characterisation of Sarcocystis lutrae n. sp. and Toxoplasma gondii from the musculature of two Eurasian otters (Lutra lutra) in Norway.

PubMed

Gjerde, Bjørn; Josefsen, Terje D

2015-03-01

Sarcocysts were detected in routinely processed histological sections of skeletal muscle, but not cardiac muscle, of two adult male otters (Lutra lutra; Mustelidae) from northern Norway following their post-mortem examination in 1999 and 2000. The sarcocysts were slender, spindle-shaped, up to 970 μm long and 35-70 μm in greatest diameter. The sarcocyst wall was thin (∼ 0.5 μm) and smooth with no visible protrusions. Portions of unfixed diaphragm of both animals were collected at the autopsies and kept frozen for about 14 years pending further examination. When the study was resumed in 2013, the thawed muscle samples were examined for sarcocysts under a stereo microscope, but none could be found. Genomic DNA was therefore extracted from a total of 36 small pieces of the diaphragm from both otters, and samples found to contain Sarcocystidae DNA were used selectively for PCR amplification and sequencing of the nuclear 18S and 28S ribosomal (r) RNA genes and internal transcribed spacer 1 (ITS1) region, as well as the mitochondrial cytochrome b (cytb) and cytochrome c oxidase subunit 1 (cox1) genes. Sequence comparisons revealed that both otters were infected by the same Sarcocystis sp. and that there was no genetic variation (100 % identity) among sequenced isolates at the 18S and 28S rRNA genes (six identical isolates at both loci) or at cox1 (13 identical isolates). PCR products comprising the ITS1 region, on the other hand, had to be cloned before sequencing due to intraspecific sequence variation. A total of 33 clones were sequenced, and the identities between them were 97.9-99.9 %. These sequences were most similar (93.7-96.0 % identity) to a sequence of Sarcocystis kalvikus from the wolverine in Canada, but the phylogenetic analyses placed all of them as a monophyletic sister group to S. kalvikus. Hence, they were considered to represent a novel species, which was named Sarcocystis lutrae. Sequence comparisons and phylogenetic analyses based on sequences of the 18S and 28S rRNA genes and cox1, for which little or no sequence data were available for S. kalvikus, revealed that S. lutrae otherwise was most closely related to various Sarcocystis spp. using birds or carnivores as intermediate hosts. The cox1 sequences of S. lutrae from the otters were identical to two sequences from an arctic fox, which in a previous study had been assigned to Sarcocystis arctica due to a high identity (99.4 %) with the latter species at this gene and a complete identity with S. arctica at three other loci when using the same DNA samples as templates for PCR reactions. Additional PCR amplifications and sequencing of cox1 (ten sequences) and the ITS1 region (four sequences) using four DNA samples from this fox as templates again generated cox1 sequences exclusively of S. lutrae, but ITS1 sequences of S. arctica, and thus confirmed that this arctic fox had acted as intermediate host for both S. arctica and S. lutrae. Based on the phylogenetic placement of S. lutrae, the geographical location of infected animals (otters, arctic fox) and the distribution of carnivores/raptors which may have interacted with them, the white-tailed eagle (Haliaeetus albicilla) seems to be a possible definitive host of S. lutrae. Some of the muscle samples from both otters were shown to harbour stages of Toxoplasma gondii through PCR amplification and sequencing of the entire ITS1 region (five isolates) and/or the partial cytb (eight isolates) and cox1 (one isolate). These sequences were identical to several previous sequences of T. gondii in GenBank. Thus, both otters had a dual infection with S. lutrae and T. gondii.

Structures of two Arabidopsis thaliana major latex proteins represent novel helix-grip folds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lytle, Betsy L.; Song, Jikui; de la Cruz, Norberto B.

2009-06-02

Here we report the first structures of two major latex proteins (MLPs) which display unique structural differences from the canonical Bet v 1 fold described earlier. MLP28 (SwissProt/TrEMBL ID Q9SSK9), the product of gene At1g70830.1, and the At1g24000.1 gene product (Swiss- Prot/TrEMBL ID P0C0B0), proteins which share 32% sequence identity, were independently selected as foldspace targets by the Center for Eukaryotic Structural Genomics. The structure of a single domain (residues 17-173) of MLP28 was solved by NMR spectroscopy, while the full-length At1g24000.1 structure was determined by X-ray crystallography. MLP28 displays greater than 30% sequence identity to at least eight MLPsmore » from other species. For example, the MLP28 sequence shares 64% identity to peach Pp-MLP119 and 55% identity to cucumber Csf2.20 In contrast, the At1g24000.1 sequence is highly divergent (see Fig. 1), containing a gap of 33 amino acids when compared with all other known MLPs. Even when the gap is excluded, the sequence identity with MLPs from other species is less than 30%. Unlike some of the MLPs from other species, none of the A. thaliana MLPs have been characterized biochemically. We show by NMR chemical shift mapping that At1g24000.1 binds progesterone, demonstrating that despite its sequence dissimilarity, the hydrophobic binding pocket is conserved and, therefore, may play a role in its biological function and that of the MLP family in general.« less

Nucleotide sequencing and identification of some wild mushrooms.

PubMed

Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

2013-01-01

The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

Mitochondrial DNA Evidence Supports the Hypothesis that Triodontophorus Species Belong to Cyathostominae

PubMed Central

Gao, Yuan; Zhang, Yan; Yang, Xin; Qiu, Jian-Hua; Duan, Hong; Xu, Wen-Wen; Chang, Qiao-Cheng; Wang, Chun-Ren

2017-01-01

Equine strongyles, the significant nematode pathogens of horses, are characterized by high quantities and species abundance, but classification of this group of parasitic nematodes is debated. Mitochondrial (mt) genome DNA data are often used to address classification controversies. Thus, the objectives of this study were to determine the complete mt genomes of three Cyathostominae nematode species (Cyathostomum catinatum, Cylicostephanus minutus, and Poteriostomum imparidentatum) of horses and reconstruct the phylogenetic relationship of Strongylidae with other nematodes in Strongyloidea to test the hypothesis that Triodontophorus spp. belong to Cyathostominae using the mt genomes. The mt genomes of Cy. catinatum, Cs. minutus, and P. imparidentatum were 13,838, 13,826, and 13,817 bp in length, respectively. Complete mt nucleotide sequence comparison of all Strongylidae nematodes revealed that sequence identity ranged from 77.8 to 91.6%. The mt genome sequences of Triodontophorus species had relatively high identity with Cyathostominae nematodes, rather than Strongylus species of the same subfamily (Strongylinae). Comparative analyses of mt genome organization for Strongyloidea nematodes sequenced to date revealed that members of this superfamily possess identical gene arrangements. Phylogenetic analyses using mtDNA data indicated that the Triodontophorus species clustered with Cyathostominae species instead of Strongylus species. The present study first determined the complete mt genome sequences of Cy. catinatum, Cs. minutus, and P. imparidentatum, which will provide novel genetic markers for further studies of Strongylidae taxonomy, population genetics, and systematics. Importantly, sequence comparison and phylogenetic analyses based on mtDNA sequences supported the hypothesis that Triodontophorus belongs to Cyathostominae. PMID:28824575

Complete Genome Sequences of Bacillus Phages Janet and OTooleKemple52.

PubMed

Kent, Brenna; Raymond, Thomas; Mosier, Philip D; Johnson, Allison A

2018-05-10

We report here the genome sequences of two novel Bacillus cereus group-infecting bacteriophages, Janet and OTooleKemple52. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples. While their genomes share a high degree of sequence identity with one another, their host preferences are unique. Copyright © 2018 Kent et al.

The "expanding universe" of piroplasms.

PubMed

Criado-Fornelio, A; Gónzalez-del-Río, M A; Buling-Saraña, A; Barba-Carretero, J C

2004-02-06

The present paper is the continuation of our previous studies dealing with the genetic characterization of piroplasmid species found in southern Europe. We report in this work new data concerning sequences of the 18s rRNA gene in Spanish piroplasms not studied (or not totally sequenced) in our former surveys. Molecular data analysis indicated that Spanish Cytauxzoon felis (cat isolate) has 98% identity with Cytauxzoon sp. from Mongolia and 95% identity compared to African C. felis. There are at least two main genetic variants of Babesia caballi in Spain: The first variety (isolate Spain 1) shows a relatively low homology with the African genotype (97% identity). The second variety (represented by two isolates, Spain 2 and Spain 3, differing by a single base) shows high genetic similarity with the African genotype (99.7-100% identity). There are also two genetic variants of Babesia equi (isolates Spain 1 and Spain 2, differing by four bases) in Spain, sharing 99% identity with the African genotype. At least one of them (Spain 1) can infect dogs. All of the phylogenetic analysis procedures employed indicated that Spanish isolates of C. felis, B. caballi (Spain 1) and B. equi (Spain 1 and Spain 2) are genetically different from their African relatives, all those dichotomies showing very high bootstrap support. Nonetheless, the lack of information on their morphology and the fact that the sequences were obtained in a single isolate preclude any conclusion about their definitive taxonomic status.

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

PubMed

Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

2018-03-15

The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA gene sequences at some threshold of nucleotide identity, typically 97% or 98.5%. Here, we explore how well this strategy reflects the more accurate whole-genome-based proxies and determine the frequency with which the high conservation of 16S rRNA sequences masks substantial species-level diversity. Copyright © 2018 American Society for Microbiology.

How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

NASA Technical Reports Server (NTRS)

Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

1992-01-01

16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

Identification of a novel vitivirus from grapevines in New Zealand.

PubMed

Blouin, Arnaud G; Keenan, Sandi; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

2018-01-01

We report a sequence of a novel vitivirus from Vitis vinifera obtained using two high-throughput sequencing (HTS) strategies on RNA. The initial discovery from small-RNA sequencing was confirmed by HTS of the total RNA and Sanger sequencing. The new virus has a genome structure similar to the one reported for other vitiviruses, with five open reading frames (ORFs) coding for the conserved domains described for members of that genus. Phylogenetic analysis of the complete genome sequence confirmed its affiliation to the genus Vitivirus, with the closest described viruses being grapevine virus E (GVE) and Agave tequilana leaf virus (ATLV). However, the virus we report is distinct and shares only 51% amino acid sequence identity with GVE in the replicase polyprotein and 66.8% amino acid sequence identity with ATLV in the coat protein. This is well below the threshold determined by the ICTV for species demarcation, and we propose that this virus represents a new species. It is provisionally named "grapevine virus G".

Molecular characterization of a novel rhabdovirus infecting blackcurrant identified by high-throughput sequencing.

PubMed

Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R

2018-05-01

A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.

Development and application of triple antibody sandwich enzyme-linked immunosorbent assays for begomovirus detection using monoclonal antibodies against Tomato yellow leaf curl Thailand virus.

PubMed

Seepiban, Channarong; Charoenvilaisiri, Saengsoon; Warin, Nuchnard; Bhunchoth, Anjana; Phironrit, Namthip; Phuangrat, Bencharong; Chatchawankanphanich, Orawan; Attathom, Supat; Gajanandana, Oraprapai

2017-05-30

Tomato yellow leaf curl Thailand virus, TYLCTHV, is a begomovirus that causes severe losses of tomato crops in Thailand as well as several countries in Southeast and East Asia. The development of monoclonal antibodies (MAbs) and serological methods for detecting TYLCTHV is essential for epidemiological studies and screening for virus-resistant cultivars. The recombinant coat protein (CP) of TYLCTHV was expressed in Escherichia coli and used to generate MAbs against TYLCTHV through hybridoma technology. The MAbs were characterized and optimized to develop triple antibody sandwich enzyme-linked immunosorbent assays (TAS-ELISAs) for begomovirus detection. The efficiency of TAS-ELISAs for begomovirus detection was evaluated with tomato, pepper, eggplant, okra and cucurbit plants collected from several provinces in Thailand. Molecular identification of begomoviruses in these samples was also performed through PCR and DNA sequence analysis of the CP gene. Two MAbs (M1 and D2) were generated and used to develop TAS-ELISAs for begomovirus detection. The results of begomovirus detection in 147 field samples indicated that MAb M1 reacted with 2 begomovirus species, TYLCTHV and Tobacco leaf curl Yunnan virus (TbLCYnV), whereas MAb D2 reacted with 4 begomovirus species, TYLCTHV, TbLCYnV, Tomato leaf curl New Delhi virus (ToLCNDV) and Squash leaf curl China virus (SLCCNV). Phylogenetic analyses of CP amino acid sequences from these begomoviruses revealed that the CP sequences of begomoviruses recognized by the narrow-spectrum MAb M1 were highly conserved, sharing 93% identity with each other but only 72-81% identity with MAb M1-negative begomoviruses. The CP sequences of begomoviruses recognized by the broad-spectrum MAb D2 demonstrated a wider range of amino acid sequence identity, sharing 78-96% identity with each other and 72-91% identity with those that were not detected by MAb D2. TAS-ELISAs using the narrow-specificity MAb M1 proved highly efficient for the detection of TYLCTHV and TbLCYnV, whereas TAS-ELISAs using the broad-specificity MAb D2 were highly efficient for the detection of TYLCTHV, TbLCYnV, ToLCNDV and SLCCNV. Both newly developed assays allow for sensitive, inexpensive, high-throughput detection of begomoviruses in field plant samples, as well as screening for virus-resistant cultivars.

Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

PubMed Central

Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

1998-01-01

The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

Analysis of 16S-23S intergenic spacer regions of the rRNA operons in Edwardsiella ictaluri and Edwardsiella tarda isolates from fish.

PubMed

Panangala, V S; van Santen, V L; Shoemaker, C A; Klesius, P H

2005-01-01

To analyse interspecies and intraspecies differences based on the 16S-23S rRNA intergenic spacer region (ISR) sequences of the fish pathogens Edwardsiella ictaluri and Edwardsiella tarda. The 16S-23S rRNA spacer regions of 19 Edw. ictaluri and four Edw. tarda isolates from four geographical regions were amplified by PCR with primers complementary to conserved sequences within the flanking 16S-23S rRNA coding sequences. Two products were generated from all isolates, without interspecies or intraspecific size polymorphisms. Sequence analysis of the amplified fragments revealed a smaller ISR of 350 bp, which contained a gene for tRNA(Glu), and a larger ISR of 441 bp, which contained genes for tRNA(Ile) and tRNA(Ala). The sequences of the smaller ISR of different Edw. ictaluri isolates were essentially identical to each other. Partial sequences of larger ISR from several Edw. ictaluri isolates also revealed no differences from the one complete Edw. ictaluri large ISR sequence obtained. The sequences of the smaller ISR of Edw. tarda were 97% identical to the Edw. ictaluri smaller ISR and the larger ISR were 96-98% identical to the Edw. ictaluri larger ISR sequence. The Edw. tarda isolates displayed limited ISR sequence heterogeneity, with > or =97% sequence identity among isolates for both small and large ISR. There is a high degree of size and sequence similarity of 16S-23S ISR both among isolates within Edw. ictaluri and Edw. tarda species and between the two species. Our results confirm a close genetic relationship between Edw. ictaluri and Edw. tarda and the relative homogeneity of Edw. ictaluri isolates compared with Edw. tarda isolates. Because no differences were found in ISR sequences among Edw. ictaluri isolates, sequence analysis of the ISR will not be useful to distinguish isolates of Edw. ictaluri. However, we identified restriction sites that differ between ISR sequences of Edw. ictaluri and Edw. tarda, which will be useful in distinguishing the two species.

Random Amplification and Pyrosequencing for Identification of Novel Viral Genome Sequences

PubMed Central

Hang, Jun; Forshey, Brett M.; Kochel, Tadeusz J.; Li, Tao; Solórzano, Víctor Fiestas; Halsey, Eric S.; Kuschner, Robert A.

2012-01-01

ssRNA viruses have high levels of genomic divergence, which can lead to difficulty in genomic characterization of new viruses using traditional PCR amplification and sequencing methods. In this study, random reverse transcription, anchored random PCR amplification, and high-throughput pyrosequencing were used to identify orthobunyavirus sequences from total RNA extracted from viral cultures of acute febrile illness specimens. Draft genome sequence for the orthobunyavirus L segment was assembled and sequentially extended using de novo assembly contigs from pyrosequencing reads and orthobunyavirus sequences in GenBank as guidance. Accuracy and continuous coverage were achieved by mapping all reads to the L segment draft sequence. Subsequently, RT-PCR and Sanger sequencing were used to complete the genome sequence. The complete L segment was found to be 6936 bases in length, encoding a 2248-aa putative RNA polymerase. The identified L segment was distinct from previously published South American orthobunyaviruses, sharing 63% and 54% identity at the nucleotide and amino acid level, respectively, with the complete Oropouche virus L segment and 73% and 81% identity at the nucleotide and amino acid level, respectively, with a partial Caraparu virus L segment. The result demonstrated the effectiveness of a sequence-independent amplification and next-generation sequencing approach for obtaining complete viral genomes from total nucleic acid extracts and its use in pathogen discovery. PMID:22468136

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand

PubMed Central

WATTHANAKAIWAN, Vichan; SUKMAK, Manakorn; HAMARIT, Kriengsak; KAOLIM, Nongnid; WAJJWALKU, Worawidh; MUANGKRAM, Yuttamol

2017-01-01

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3–99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis. PMID:28701623

Molecular characterization of the ribosomal DNA unit of Sarcocystis singaporensis, Sarcocystis zamani and Sarcocystis zuoi from rodents in Thailand.

PubMed

Watthanakaiwan, Vichan; Sukmak, Manakorn; Hamarit, Kriengsak; Kaolim, Nongnid; Wajjwalku, Worawidh; Muangkram, Yuttamol

2017-08-18

Sarcocystis species are heteroxenous cyst-forming coccidian protozoan parasites with a wide host range, including rodents. In this study, Sarcocystis spp. samples were isolated from Bandicota indica, Rattus argentiventer, R. tiomanicus and R. norvegicus across five provinces of Thailand. Two major groups of Sarcocystis cysts were determined in this study: large and small cysts. By sequence comparisons and phylogenetic analyses based on the partial sequences of 28S ribosomal DNA, the large cysts showed the highest identity value (99%) with the S. zamani in GenBank database. While the small cysts could be divided into 2 groups of Sarcocystis: S. singaporensis and presupposed S. zuoi. The further analysis on 18S rDNA supported that the 2 isolates (S2 and B6 no.2) were as identified as S. singaporensis shared a high sequence identity with the S. singaporensis in GenBank database and the unidentified Sarcocystis (4 isolates, i.e., B6 no.10, B6 no.12, B10 no.4 and B10 no.7) showed 96.3-99.5% identity to S. zuoi as well as high distinct identity from others Sarcocystis spp. (≤93%). The result indicated that these four samples should be S. zuoi. In this study, we provided complete sequence of internal transcribed spacer 1 (ITS1), 5.8S rDNA and internal transcribed spacer 2 (ITS2) of these three Sarcocystis species and our new primer set could be useful to study the evolution of Sarcocystis.

Some properties and cDNA cloning of proteinaceous toxins from two species of lionfish (Pterois antennata and Pterois volitans).

PubMed

Kiriake, Aya; Shiomi, Kazuo

2011-11-01

Lionfish, members of the genera Pterois, Parapterois and Dendrochirus, are well known to be venomous, having venomous glandular tissues in dorsal, pelvic and anal spines. The lionfish toxins have been shown to cross-react with the stonefish toxins by neutralization tests using the commercial stonefish antivenom, although their chemical properties including structures have been little characterized. In this study, an antiserum against neoverrucotoxin, the stonefish Synanceia verrucosa toxin, was first raised in a guinea pig and used in immunoblotting and inhibition immunoblotting to confirm that two species of Pterois lionfish (P. antennata and P. volitans) contain a 75kDa protein (corresponding to the toxin subunit) cross-reacting with neoverrucotoxin. Then, the amino acid sequences of the P. antennata and P. volitans toxins were successfully determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Notably, either α-subunits (699 amino acid residues) or β-subunits (698 amino acid residues) of the P. antennata and P. volitans toxins share as high as 99% sequence identity with each other. Furthermore, both α- and β-subunits of the lionfish toxins exhibit high sequence identity (70-80% identity) with each other and also with the β-subunits of the stonefish toxins. As reported for the stonefish toxins, the lionfish toxins also contain a B30.2/SPRY domain (comprising nearly 200 amino acid residues) in the C-terminal region of each subunit. Copyright © 2011 Elsevier Ltd. All rights reserved.

Visualizing bacterial tRNA identity determinants and antideterminants using function logos and inverse function logos

PubMed Central

Freyhult, Eva; Moulton, Vincent; Ardell, David H.

2006-01-01

Sequence logos are stacked bar graphs that generalize the notion of consensus sequence. They employ entropy statistics very effectively to display variation in a structural alignment of sequences of a common function, while emphasizing its over-represented features. Yet sequence logos cannot display features that distinguish functional subclasses within a structurally related superfamily nor do they display under-represented features. We introduce two extensions to address these needs: function logos and inverse logos. Function logos display subfunctions that are over-represented among sequences carrying a specific feature. Inverse logos generalize both sequence logos and function logos by displaying under-represented, rather than over-represented, features or functions in structural alignments. To make inverse logos, a compositional inverse is applied to the feature or function frequency distributions before logo construction, where a compositional inverse is a mathematical transform that makes common features or functions rare and vice versa. We applied these methods to a database of structurally aligned bacterial tDNAs to create highly condensed, birds-eye views of potentially all so-called identity determinants and antideterminants that confer specific amino acid charging or initiator function on tRNAs in bacteria. We recovered both known and a few potentially novel identity elements. Function logos and inverse logos are useful tools for exploratory bioinformatic analysis of structure–function relationships in sequence families and superfamilies. PMID:16473848

Molecular cloning, expression and characterization of Pru a 1, the major cherry allergen.

PubMed

Scheurer, S; Metzner, K; Haustein, D; Vieths, S

1997-06-01

A high percentage of birch pollen allergic patients experiences food hypersensitivity reactions after ingestion of several fruits and vegetables. Previous work demonstrated common epitopes on an allergen of Mr 18,000 from sweet cherry (Prunus avium) and Bet v 1, the major allergen from birch pollen. N-terminal amino acid sequencing showed a sequence identity of 67% with Bet v 1. Here we report the cloning and cDNA sequencing of this cherry allergen. The entire deduced amino acid sequence described a protein of Mr 17,700 with 59.1% identity to Bet v 1. High degrees of identity in the range of 40 to 60% were also found with related allergens from other kinds of tree pollen and plant foods as well as with stress-induced proteins from food plants such as parsley, potato and soya. The coding DNA of the cherry protein was cloned into vector pET-16b and expressed in E. coli strain BL21(DE3) as a His-tag fusion protein. As shown by SDS-PAGE, the apparent molecular masses of the nonfusion protein and the natural allergen were identical. The fusion protein showed high IgE binding potency when sera from patients allergic to cherry were tested by immunoblotting and enzyme allergosorbent tests. Moreover, it cross-reacted strongly with IgE specific for the natural counterpart and for Bet v 1. The high biological activity of the recombinant fusion protein was further confirmed by the induction of a strong histamine release in basophils from cherry-allergic patients. Since sera from 17/19 of such patients contained IgE against this allergen it was classified as a major allergen and named Pru a 1. Recombinant Pru a 1 mimics most of the allergenic potency of cherry extract and hence could be a useful tool for studying the molecular and immunological properties of pollen related food allergens.

Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

PubMed

Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

2014-02-01

Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

PubMed Central

Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

1998-01-01

By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

Sequencing of diverse mandarin, pummelo and orange genomes reveals complex history of admixture during citrus domestication

USDA-ARS?s Scientific Manuscript database

Cultivated citrus are selections from, or hybrids of, wild progenitor species whose identities and contributions to citrus domestication remain controversial. Here we sequence and compare citrus genomes—a high-quality reference haploid clementine genome and mandarin, pummelo, sweet-orange and sour-o...

Complete Genomic Sequence and Comparative Analysis of the Genome Segments of Sweet Potato Chlorotic Stunt Virus in China

PubMed Central

Qin, Yanhong; Wang, Li; Zhang, Zhenchen; Qiao, Qi; Zhang, Desheng; Tian, Yuting; Wang, Shuang; Wang, Yongjiang; Yan, Zhaoling

2014-01-01

Background Sweet potato chlorotic stunt virus (family Closteroviridae, genus Crinivirus) features a large bipartite, single-stranded, positive-sense RNA genome. To date, only three complete genomic sequences of SPCSV can be accessed through GenBank. SPCSV was first detected from China in 2011, only partial genomic sequences have been determined in the country. No report on the complete genomic sequence and genome structure of Chinese SPCSV isolates or the genetic relation between isolates from China and other countries is available. Methodology/Principal Findings The complete genomic sequences of five isolates from different areas in China were characterized. This study is the first to report the complete genome sequences of SPCSV from whitefly vectors. Genome structure analysis showed that isolates of WA and EA strains from China have the same coding protein as isolates Can181-9 and m2-47, respectively. Twenty cp genes and four RNA1 partial segments were sequenced and analyzed, and the nucleotide identities of complete genomic, cp, and RNA1 partial sequences were determined. Results indicated high conservation among strains and significant differences between WA and EA strains. Genetic analysis demonstrated that, except for isolates from Guangdong Province, SPCSVs from other areas belong to the WA strain. Genome organization analysis showed that the isolates in this study lack the p22 gene. Conclusions/Significance We presented the complete genome sequences of SPCSV in China. Comparison of nucleotide identities and genome structures between these isolates and previously reported isolates showed slight differences. The nucleotide identities of different SPCSV isolates showed high conservation among strains and significant differences between strains. All nine isolates in this study lacked p22 gene. WA strains were more extensively distributed than EA strains in China. These data provide important insights into the molecular variation and genomic structure of SPCSV in China as well as genetic relationships among isolates from China and other countries. PMID:25170926

Diversity of the P2 protein among nontypeable Haemophilus influenzae isolates.

PubMed Central

Bell, J; Grass, S; Jeanteur, D; Munson, R S

1994-01-01

The genes for outer membrane protein P2 of four nontypeable Haemophilus influenzae strains were cloned and sequenced. The derived amino acid sequences were compared with the outer membrane protein P2 sequence from H. influenzae type b MinnA and the sequences of P2 from three additional nontypeable H. influenzae strains. The sequences were 76 to 94% identical. The sequences had regions with considerable variability separated by regions which were highly conserved. The variable regions mapped to putative surface-exposed loops of the protein. PMID:8188390

In silico analysis of L-asparaginase from different source organisms.

PubMed

Dwivedi, Vivek Dhar; Mishra, Sarad Kumar

2014-06-01

L-asparaginases are widely distributed enzymes among plants, fungi and bacteria. This enzyme catalyzes the conversion of l-asparagine to l-aspartate and ammonia and to a lesser extent the formation of l-glutamate from l-glutamine. In the present study, forty-five full-length amino acid sequences of L-asparaginases from bacteria, fungi and plants were collected and subjected to multiple sequence alignment (MSA), domain identification, discovering individual amino acid composition, and phylogenetic tree construction. MSA revealed that two glycine residues were identically found in all analyzed species, two glycine residues were also identically found in all the fungal and bacterial sources and three glycine residues were identically found in all plant and bacterial sources while no residue was identically found in plant and fungal L-asparaginases. Two major sequence clusters were constructed by phylogenetic analysis. One cluster contains eleven species of fungi, twelve species of bacteria, and one species of plant, whereas the other one contains fourteen species of plant, four species of fungi and three species bacteria. The amino acid composition result revealed that the average frequency of amino acid alanine is 10.77 percent that is very high in comparison to other amino acids in all analyzed species.

Grapevine virus I, a putative new vitivirus detected in co-infection with grapevine virus G in New Zealand.

PubMed

Blouin, Arnaud G; Chooi, Kar Mun; Warren, Ben; Napier, Kathryn R; Barrero, Roberto A; MacDiarmid, Robin M

2018-05-01

A novel virus, with characteristics of viruses classified within the genus Vitivirus, was identified from a sample of Vitis vinifera cv. Chardonnay in New Zealand. The virus was detected with high throughput sequencing (small RNA and total RNA) and its sequence was confirmed by Sanger sequencing. Its genome is 7507 nt long (excluding the polyA tail) with an organisation similar to that described for other classifiable members of the genus Vitivirus. The closest relative of the virus is grapevine virus E (GVE) with 65% aa identity in ORF1 (65% nt identity) and 63% aa identity in the coat protein (66% nt identity). The relationship with GVE was confirmed with phylogenetic analysis, showing the new virus branching with GVE, Agave tequilina leaf virus and grapevine virus G (GVG). A limited survey revealed the presence of this virus in multiple plants from the same location where the newly described GVG was discovered, and in most cases both viruses were detected as co-infections. The genetic characteristics of this virus suggest it represents an isolate of a new species within the genus Vitivirus and following the current nomenclature, we propose the name "Grapevine virus I".

Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

PubMed

El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

2013-07-01

Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

PubMed

Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

2009-10-01

A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Devor, E.J.; Dill-Devor, R.M.

1994-09-01

We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less

Genome Sequence of the Novel Marine Member of the Gammaproteobacteria Strain HTCC5015▿

PubMed Central

Thrash, J. Cameron; Stingl, Ulrich; Cho, Jang-Cheon; Ferriera, Steve; Johnson, Justin; Vergin, Kevin L.; Giovannoni, Stephen J.

2010-01-01

HTCC5015 is a novel, highly divergent marine member of the Gammaproteobacteria, currently without a cultured representative with greater than 89% 16S rRNA gene identity to itself. The organism was isolated from water collected from Hydrostation S south of Bermuda using high-throughput dilution-to-extinction culturing techniques. Here we present the genome sequence of the unique Gammaproteobacterium strain HTCC5015. PMID:20472792

Strategies for high-altitude adaptation revealed from high-quality draft genome of non-violacein producing Janthinobacterium lividum ERGS5:01.

PubMed

Kumar, Rakshak; Acharya, Vishal; Singh, Dharam; Kumar, Sanjay

2018-01-01

A light pink coloured bacterial strain ERGS5:01 isolated from glacial stream water of Sikkim Himalaya was affiliated to Janthinobacterium lividum based on 16S rRNA gene sequence identity and phylogenetic clustering. Whole genome sequencing was performed for the strain to confirm its taxonomy as it lacked the typical violet pigmentation of the genus and also to decipher its survival strategy at the aquatic ecosystem of high elevation. The PacBio RSII sequencing generated genome of 5,168,928 bp with 4575 protein-coding genes and 118 RNA genes. Whole genome-based multilocus sequence analysis clustering, in silico DDH similarity value of 95.1% and, the ANI value of 99.25% established the identity of the strain ERGS5:01 (MCC 2953) as a non-violacein producing J. lividum . The genome comparisons across genus Janthinobacterium revealed an open pan-genome with the scope of the addition of new orthologous cluster to complete the genomic inventory. The genomic insight provided the genetic basis of freezing and frequent freeze-thaw cycle tolerance and, for industrially important enzymes. Extended insight into the genome provided clues of crucial genes associated with adaptation in the harsh aquatic ecosystem of high altitude.

Viral DNA sequences of genes encoding the ATPase and the major capsid protein of tropical iridovirus isolates which are pathogenic to fishes in Japan, South China Sea and Southeast Asian countries.

PubMed

Sudthongkong, C; Miyata, M; Miyazaki, T

2002-11-01

Tropical iridovirus infection causes severe epizootic resulting in mass mortalities and large economic losses in freshwater ornamental fishes cultured in Southeast Asian countries, in wild fish seedlings captured in South China Sea, and in marine fishes farmed in Japan, Singapore, and Thailand. All of tropical iridovirus-infected fishes histopathologically showed the systemic formation of inclusion body-bearing cells and necrosis of virus-infected splenocytes and hematopoietic cells. We designed primer sets for the ATPase gene and the major capsid protein (MCP) gene and sequenced the PCR products derived from 5 iridovirus isolates from sea bass in South China Sea, red sea bream in Japan, brown-spotted grouper with a grouper sleepy disease in Thailand, dwarf gourami from Malaysia and African lampeye from Sumatra Island, Indonesia. The ATPase gene and the MCP gene of these 5 viral isolates were highly homologous (> 95.8%, > 94.9% identity, respectively) and the deduced amino acid sequences of the ATPase and the MCP were also highly identical (> 98.1%, > 97.2% identity, respectively). Based on the high homology, these 5 isolates of tropical iridovirus from various fishes in geographically different regions were determined to have a single origin and to be native to Southeast Asian regions. However, these sequences were far different from those of members of the genera Ranavirus, Lymphocystivirus and Iridovirus in the Family Iridoviridae. We propose a new genus "Tropivirus" for tropical iridovirus in the Family Iridoviridae.

Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

PubMed

Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

2012-12-01

The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

Sequence determination and analysis of the NSs genes of two tospoviruses.

PubMed

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

High-throughput sequencing of forensic genetic samples using punches of FTA cards with buccal swabs.

PubMed

Kampmann, Marie-Louise; Buchard, Anders; Børsting, Claus; Morling, Niels

2016-01-01

Here, we demonstrate that punches from buccal swab samples preserved on FTA cards can be used for high-throughput DNA sequencing, also known as massively parallel sequencing (MPS). We typed 44 reference samples with the HID-Ion AmpliSeq Identity Panel using washed 1.2 mm punches from FTA cards with buccal swabs and compared the results with those obtained with DNA extracted using the EZ1 DNA Investigator Kit. Concordant profiles were obtained for all samples. Our protocol includes simple punch, wash, and PCR steps, reducing cost and hands-on time in the laboratory. Furthermore, it facilitates automation of DNA sequencing.

Evolution and virulence contributions of the autotransporter proteins YapJ and YapK of Yersinia pestis CO92 and their homologs in Y. pseudotuberculosis IP32953.

PubMed

Lenz, Jonathan D; Temple, Brenda R S; Miller, Virginia L

2012-10-01

Yersinia pestis, the causative agent of plague, evolved from the gastrointestinal pathogen Yersinia pseudotuberculosis. Both species have numerous type Va autotransporters, most of which appear to be highly conserved. In Y. pestis CO92, the autotransporter genes yapK and yapJ share a high level of sequence identity. By comparing yapK and yapJ to three homologous genes in Y. pseudotuberculosis IP32953 (YPTB0365, YPTB3285, and YPTB3286), we show that yapK is conserved in Y. pseudotuberculosis, while yapJ is unique to Y. pestis. All of these autotransporters exhibit >96% identity in the C terminus of the protein and identities ranging from 58 to 72% in their N termini. By extending this analysis to include homologous sequences from numerous Y. pestis and Y. pseudotuberculosis strains, we determined that these autotransporters cluster into a YapK (YPTB3285) class and a YapJ (YPTB3286) class. The YPTB3286-like gene of most Y. pestis strains appears to be inactivated, perhaps in favor of maintaining yapJ. Since autotransporters are important for virulence in many bacterial pathogens, including Y. pestis, any change in autotransporter content should be considered for its impact on virulence. Using established mouse models of Y. pestis infection, we demonstrated that despite the high level of sequence identity, yapK is distinct from yapJ in its contribution to disseminated Y. pestis infection. In addition, a mutant lacking both of these genes exhibits an additive attenuation, suggesting nonredundant roles for yapJ and yapK in systemic Y. pestis infection. However, the deletion of the homologous genes in Y. pseudotuberculosis does not seem to impact the virulence of this organism in orogastric or systemic infection models.

Structural analysis of the 5{prime} region of mouse and human Huntington disease genes reveals conservation of putative promoter region and Di- and trinucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Biaoyang; Nasir, J.; Kalchman, M.A.

1995-02-10

We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less

The characterisation of novel secreted Ly-6 proteins from rat urine by the combined use of two-dimensional gel electrophoresis, microbore high performance liquid chromatography and expressed sequence tag data.

PubMed

Southan, Christopher; Cutler, Paul; Birrell, Helen; Connell, John; Fantom, Kenneth G M; Sims, Matthew; Shaikh, Narjis; Schneider, Klaus

2002-02-01

A proteomic study of rat urine was undertaken using two-dimensional gel electrophoresis, microbore high performance liquid chromatography, mass spectrometry and N-terminal sequencing. Five known urinary proteins were identified but two novel peptide fragments matched a large number of rat expressed sequence tags (ESTs) from a liver library. By combining protein chemical and nucleotide data, two 101-residue open reading frames with 90% amino acid identity were determined, rat urinary protein 1 (RUP-1) and RUP-2. The data established signal peptide removal and provided evidence for N-glycosylation. A third related sequence, rat spleen protein (RSP-1) was confirmed from EST searches. These three proteins have been submitted to SWISS-PROT as P81827, P81828 and Q9QXN2, respectively. A fourth novel homologue was found in porcine and bovine ESTs from embryo libraries. Alignment with known homologues showed conserved cysteine positions characteristic of a secreted subfamily of Ly-6 proteins. In two cases, antineoplastic urinary protein and caltrin, these homologues have unverified functional annotations. The RUP sequences showed high scoring matches to three unrelated rat mRNAs subsequently established to be chimeric. Two of these share extended sectional identity to RUP-1 but the third may represent another novel Ly-6 homologue. These chimeras have caused serious annotation errors in secondary databases.

Chromobacterium spp. harbour Ambler class A β-lactamases showing high identity with KPC.

PubMed

Gudeta, Dereje Dadi; Bortolaia, Valeria; Jayol, Aurélie; Poirel, Laurent; Nordmann, Patrice; Guardabassi, Luca

2016-06-01

The origin of KPC is unknown. The aim of this study was to detect progenitors of KPC in silico and to functionally verify their β-lactam hydrolysis activity. The sequence of KPC-2 was used to mine the NCBI protein sequence database. The best non-KPC hits were analysed by amino acid (aa) alignment and phylogenetic tree construction. Genes encoding KPC-2 homologues were expressed in Escherichia coli. The carbapenemase activities of the recombinant strains were characterized by the CarbaNP test and UV spectrophotometry and MICs of selected β-lactams were determined. Genes encoding the closest KPC-2 homologues were identified on the chromosome of Chromobacterium piscinae strain ND17 (CRP-1, 76% aa identity), Chromobacterium sp. C-61 (CRS-1, 70% aa identity) and Chromobacterium haemolyticum DSM19808 (CRH-1, 69% aa identity). All three Chromobacterium β-lactamases were phylogenetically more related to KPC than to other Ambler class A β-lactamases. The 27 bp region preceding the start codon of blaCRP-1 displayed high nucleotide identity to the corresponding region upstream from blaKPC (74%). Heterologous expression of blaCRP-1 and to a lesser extent of blaCRH-1 in E. coli significantly increased the MICs of meropenem and most cephalosporins. The CarbaNP test was positive for both recombinant strains, but spectrophotometric analysis confirmed higher carbapenemase activity for CRP-1-producing clones. The recovery of three class A β-lactamases with up to 76% aa identity to KPC from distinct Chromobacterium species is highly indicative of the role played by this genus in the evolution of KPC. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Homology-based Modeling of Rhodopsin-like Family Members in the Inactive State: Structural Analysis and Deduction of Tips for Modeling and Optimization.

PubMed

Pappalardo, Matteo; Rayan, Mahmoud; Abu-Lafi, Saleh; Leonardi, Martha E; Milardi, Danilo; Guccione, Salvatore; Rayan, Anwar

2017-08-01

Modeling G-Protein Coupled Receptors (GPCRs) is an emergent field of research, since utility of high-quality models in receptor structure-based strategies might facilitate the discovery of interesting drug candidates. The findings from a quantitative analysis of eighteen resolved structures of rhodopsin family "A" receptors crystallized with antagonists and 153 pairs of structures are described. A strategy termed endeca-amino acids fragmentation was used to analyze the structures models aiming to detect the relationship between sequence identity and Root Mean Square Deviation (RMSD) at each trans-membrane-domain. Moreover, we have applied the leave-one-out strategy to study the shiftiness likelihood of the helices. The type of correlation between sequence identity and RMSD was studied using the aforementioned set receptors as representatives of membrane proteins and 98 serine proteases with 4753 pairs of structures as representatives of globular proteins. Data analysis using fragmentation strategy revealed that there is some extent of correlation between sequence identity and global RMSD of 11AA width windows. However, spatial conservation is not always close to the endoplasmic side as was reported before. A comparative study with globular proteins shows that GPCRs have higher standard deviation and higher slope in the graph with correlation between sequence identity and RMSD. The extracted information disclosed in this paper could be incorporated in the modeling protocols while using technique for model optimization and refinement. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bradyrhizobium paxllaeri sp. nov. and Bradyrhizobium icense sp. nov., nitrogen-fixing rhizobial symbionts of Lima bean (Phaseolus lunatus L.) in Peru.

PubMed

Durán, David; Rey, Luis; Mayo, Juan; Zúñiga-Dávila, Doris; Imperial, Juan; Ruiz-Argüeso, Tomás; Martínez-Romero, Esperanza; Ormeño-Orrillo, Ernesto

2014-06-01

A group of strains isolated from root nodules of Phaseolus lunatus (Lima bean) in Peru were characterized by genotypic, genomic and phenotypic methods. All strains possessed identical 16S rRNA gene sequences that were 99.9% identical to that of Bradyrhizobium lablabi CCBAU 23086(T). Despite having identical 16S rRNA gene sequences, the Phaseolus lunatus strains could be divided into two clades by sequence analysis of recA, atpD, glnII, dnaK and gyrB genes. The genome sequence of a representative of each clade was obtained and compared to the genomes of closely related species of the genus Bradyrhizobium. Average nucleotide identity values below the species circumscription threshold were obtained when comparing the two clades to each other (88.6%) and with all type strains of the genus Bradyrhizobium (≤92.9%). Phenotypes distinguishing both clades from all described and closely related species of the genus Bradyrhizobium were found. On the basis of the results obtained, two novel species, Bradyrhizobium paxllaeri sp. nov. (type strain LMTR 21(T) = DSM 18454(T) = HAMBI 2911(T)) and Bradyrhizobium icense sp. nov. (type strain LMTR 13(T) = HAMBI 3584(T) = CECT 8509(T) = CNPSo 2583(T)), are proposed to accommodate the uncovered clades of Phaseolus lunatus bradyrhizobia. These species share highly related but distinct nifH and nodC symbiosis genes. © 2014 IUMS.

Structural comparisons of two allelic variants of human placental alkaline phosphatase.

PubMed

Millán, J L; Stigbrand, T; Jörnvall, H

1985-01-01

A simple immunosorbent purification scheme based on monoclonal antibodies has been devised for human placental alkaline phosphatase. The two most common allelic variants, S and F, have similar amino acid compositions with identical N-terminal amino acid sequences through the first 13 residues. Both variants have identical lectin binding properties towards concanavalin A, lentil-lectin, wheat germ agglutinin, phytohemagglutinin and soybean agglutinin, and identical carbohydrate contents as revealed by methylation analysis. CNBr fragments of the variants demonstrate identical high performance liquid chromatography patterns. The carbohydrate containing fragment is different from the 32P-labeled active site fragment and the N-terminal fragment.

RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

PubMed

Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

2016-02-01

During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel molecular approach to define pest species status and tritrophic interactions from historical Bemisia specimens.

PubMed

Tay, W T; Elfekih, S; Polaszek, A; Court, L N; Evans, G A; Gordon, K H J; De Barro, P J

2017-03-27

Museum specimens represent valuable genomic resources for understanding host-endosymbiont/parasitoid evolutionary relationships, resolving species complexes and nomenclatural problems. However, museum collections suffer DNA degradation, making them challenging for molecular-based studies. Here, the mitogenomes of a single 1912 Sri Lankan Bemisia emiliae cotype puparium, and of a 1942 Japanese Bemisia puparium are characterised using a Next-Generation Sequencing approach. Whiteflies are small sap-sucking insects including B. tabaci pest species complex. Bemisia emiliae's draft mitogenome showed a high degree of homology with published B. tabaci mitogenomes, and exhibited 98-100% partial mitochondrial DNA Cytochrome Oxidase I (mtCOI) gene identity with the B. tabaci species known as Asia II-7. The partial mtCOI gene of the Japanese specimen shared 99% sequence identity with the Bemisia 'JpL' genetic group. Metagenomic analysis identified bacterial sequences in both Bemisia specimens, while hymenopteran sequences were also identified in the Japanese Bemisia puparium, including complete mtCOI and rRNA genes, and various partial mtDNA genes. At 88-90% mtCOI sequence identity to Aphelinidae wasps, we concluded that the 1942 Bemisia nymph was parasitized by an Eretmocerus parasitoid wasp. Our approach enables the characterisation of genomes and associated metagenomic communities of museum specimens using 1.5 ng gDNA, and to infer historical tritrophic relationships in Bemisia whiteflies.

Limited Genetic Diversity Preceded Extinction of the Tasmanian Tiger

PubMed Central

Menzies, Brandon R.; Renfree, Marilyn B.; Heider, Thomas; Mayer, Frieder; Hildebrandt, Thomas B.; Pask, Andrew J.

2012-01-01

The Tasmanian tiger or thylacine was the largest carnivorous marsupial when Europeans first reached Australia. Sadly, the last known thylacine died in captivity in 1936. A recent analysis of the genome of the closely related and extant Tasmanian devil demonstrated limited genetic diversity between individuals. While a similar lack of diversity has been reported for the thylacine, this analysis was based on just two individuals. Here we report the sequencing of an additional 12 museum-archived specimens collected between 102 and 159 years ago. We examined a portion of the mitochondrial DNA hyper-variable control region and determined that all sequences were on average 99.5% identical at the nucleotide level. As a measure of accuracy we also sequenced mitochondrial DNA from a mother and two offspring. As expected, these samples were found to be 100% identical, validating our methods. We also used 454 sequencing to reconstruct 2.1 kilobases of the mitochondrial genome, which shared 99.91% identity with the two complete thylacine mitochondrial genomes published previously. Our thylacine genomic data also contained three highly divergent putative nuclear mitochondrial sequences, which grouped phylogenetically with the published thylacine mitochondrial homologs but contained 100-fold more polymorphisms than the conserved fragments. Together, our data suggest that the thylacine population in Tasmania had limited genetic diversity prior to its extinction, possibly as a result of their geographic isolation from mainland Australia approximately 10,000 years ago. PMID:22530022

Sequence diversity of wheat mosaic virus isolates.

PubMed

Stewart, Lucy R

2016-02-02

Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.

Incorporation of unique molecular identifiers in TruSeq adapters improves the accuracy of quantitative sequencing.

PubMed

Hong, Jungeui; Gresham, David

2017-11-01

Quantitative analysis of next-generation sequencing (NGS) data requires discriminating duplicate reads generated by PCR from identical molecules that are of unique origin. Typically, PCR duplicates are identified as sequence reads that align to the same genomic coordinates using reference-based alignment. However, identical molecules can be independently generated during library preparation. Misidentification of these molecules as PCR duplicates can introduce unforeseen biases during analyses. Here, we developed a cost-effective sequencing adapter design by modifying Illumina TruSeq adapters to incorporate a unique molecular identifier (UMI) while maintaining the capacity to undertake multiplexed, single-index sequencing. Incorporation of UMIs into TruSeq adapters (TrUMIseq adapters) enables identification of bona fide PCR duplicates as identically mapped reads with identical UMIs. Using TrUMIseq adapters, we show that accurate removal of PCR duplicates results in improved accuracy of both allele frequency (AF) estimation in heterogeneous populations using DNA sequencing and gene expression quantification using RNA-Seq.

Complete genome sequence of an isolate of papaya leaf distortion mosaic virus from commercialized PRSV-resistant transgenic papaya in China.

PubMed

Tuo, D; Shen, W; Yan, P; Li, Ch; Gao, L; Li, X; Li, H; Zhou, P

2013-01-01

Papaya leaf distortion mosaic virus is highly destructive to commercial papaya production. Here, the complete genome sequence was determined for an isolate of papaya leaf distortion mosaic virus, designated PLDMV-DF, infecting the commercialized papaya ringspot virus (PRSV)-resistant transgenic papaya from China. Excluding the 3'-poly (A) tail, the sequence shares high sequence identity to several PLDMV isolates from Taiwan and Japan and is phylogenetically most closely related to the isolate from Japan. Infection of PLDMV-DF in transgenic PRSV-resistant papaya may indicate emergence of this disease in genetically engineered plants. The reported sequence for this isolate may help generate bi-transgenic papaya resistant to PRSV and PLDMV.

Antimicrobial activity predictors benchmarking analysis using shuffled and designed synthetic peptides.

PubMed

Porto, William F; Pires, Állan S; Franco, Octavio L

2017-08-07

The antimicrobial activity prediction tools aim to help the novel antimicrobial peptides (AMP) sequences discovery, utilizing machine learning methods. Such approaches have gained increasing importance in the generation of novel synthetic peptides by means of rational design techniques. This study focused on predictive ability of such approaches to determine the antimicrobial sequence activities, which were previously characterized at the protein level by in vitro studies. Using four web servers and one standalone software, we evaluated 78 sequences generated by the so-called linguistic model, being 40 designed and 38 shuffled sequences, with ∼60 and ∼25% of identity to AMPs, respectively. The ab initio molecular modelling of such sequences indicated that the structure does not affect the predictions, as both sets present similar structures. Overall, the systems failed on predicting shuffled versions of designed peptides, as they are identical in AMPs composition, which implies in accuracies below 30%. The prediction accuracy is negatively affected by the low specificity of all systems here evaluated, as they, on the other hand, reached 100% of sensitivity. Our results suggest that complementary approaches with high specificity, not necessarily high accuracy, should be developed to be used together with the current systems, overcoming their limitations. Copyright © 2017 Elsevier Ltd. All rights reserved.

MALDI Top-Down sequencing: calling N- and C-terminal protein sequences with high confidence and speed.

PubMed

Suckau, Detlev; Resemann, Anja

2009-12-01

The ability to match Top-Down protein sequencing (TDS) results by MALDI-TOF to protein sequences by classical protein database searching was evaluated in this work. Resulting from these analyses were the protein identity, the simultaneous assignment of the N- and C-termini and protein sequences of up to 70 residues from either terminus. In combination with de novo sequencing using the MALDI-TDS data, even fusion proteins were assigned and the detailed sequence around the fusion site was elucidated. MALDI-TDS allowed to efficiently match protein sequences quickly and to validate recombinant protein structures-in particular, protein termini-on the level of undigested proteins.

Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.

PubMed

Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R

2017-09-14

The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.

First isolation of hirame rhabdovirus from freshwater fish in Europe.

PubMed

Borzym, E; Matras, M; Maj-Paluch, J; Baud, M; De Boisséson, C; Talbi, C; Olesen, N J; Bigarré, L

2014-05-01

A rhabdovirus was isolated in cell culture inoculated with tissue material from diseased grayling, Thymallus thymallus (L.), originating from a fish farm affected by a mortality episode in Poland. Diagnostics tests showed that the virus was not related to novirhabdoviruses known in Europe, nor to vesiculovirus-like species, except perch rhabdovirus (PRhV) with which it shared moderate serological relations. However, RT-PCR with PRhV probes gave negative results. To identify the virus, a random-priming sequence-independent single primer amplification was adopted. Surprisingly, two of the obtained sequences exhibited a high identity (>99%) with hirame rhabdovirus (HIRRV), a novirhabdovirus usually found in fish in marine Asiatic countries, for instance Japan, China and Korea. The full-length sequence of the phosphoprotein gene (P) demonstrated a higher identity of the present isolate with HIRRV from China compared with the Korean isolate. An identical viral sequence was also found in brown trout, Salmo trutta trutta L., affected by mortalities in a second farm in the same region, after a likely contamination from the grayling farm. To our knowledge, this is the first report of HIRRV in Europe, and in two hosts from fresh water that have not been described before as susceptible species. © 2013 John Wiley & Sons Ltd.

Facilitated sequence counting and assembly by template mutagenesis

PubMed Central

Levy, Dan; Wigler, Michael

2014-01-01

Presently, inferring the long-range structure of the DNA templates is limited by short read lengths. Accurate template counts suffer from distortions occurring during PCR amplification. We explore the utility of introducing random mutations in identical or nearly identical templates to create distinguishable patterns that are inherited during subsequent copying. We simulate the applications of this process under assumptions of error-free sequencing and perfect mapping, using cytosine deamination as a model for mutation. The simulations demonstrate that within readily achievable conditions of nucleotide conversion and sequence coverage, we can accurately count the number of otherwise identical molecules as well as connect variants separated by long spans of identical sequence. We discuss many potential applications, such as transcript profiling, isoform assembly, haplotype phasing, and de novo genome assembly. PMID:25313059

Cloning and bioinformatics analysis of PDC genes from Hylocereus undatus

NASA Astrophysics Data System (ADS)

Wu, Yunli; Luo, Xian; Lu, Han; Shen, Yu; Yuan, Lei; Luo, Lan

2018-04-01

The cDNA of PDC1 and PDC2 were amplified from the seedling of Hylocereus undatus `Guangming 2' by the technique of RACE (rapid amplification of cDNA ends). The PDC1 and PDC2 had a length of 1191bp and 2046 bp, and an open reading frame that encoded a protein of 351 and 604 amino acids, respectively. PDC1 was similar to PDC2 in motif and domain, which indicated that the two protein was relatively conserved to some extent. The 3D structure prediction showed that both of the two proteins of PDC1 and PDC2 were homotetramers. Amino acid sequence comparisons suggested that PDC1 had high identity with Chenopodium quinoa PDC1 (88% identity), PDC2 had high identity with Beta vulgaris PDC2 (84% identity).

Whole genome sequences of Japanese porcine species C rotaviruses reveal a high diversity of genotypes of individual genes and will contribute to a comprehensive, generally accepted classification system.

PubMed

Niira, Kazutaka; Ito, Mika; Masuda, Tsuneyuki; Saitou, Toshiya; Abe, Tadatsugu; Komoto, Satoshi; Sato, Mitsuo; Yamasato, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Sano, Kaori; Tuchiaka, Shinobu; Okada, Takashi; Omatsu, Tsutomu; Furuya, Tetsuya; Aoki, Hiroshi; Katayama, Yukie; Oba, Mami; Shirai, Junsuke; Taniguchi, Koki; Mizutani, Tetsuya; Nagai, Makoto

2016-10-01

Porcine rotavirus C (RVC) is distributed throughout the world and is thought to be a pathogenic agent of diarrhea in piglets. Although, the VP7, VP4, and VP6 gene sequences of Japanese porcine RVCs are currently available, there is no whole-genome sequence data of Japanese RVC. Furthermore, only one to three sequences are available for porcine RVC VP1-VP3 and NSP1-NSP3 genes. Therefore, we determined nearly full-length whole-genome sequences of nine Japanese porcine RVCs from seven piglets with diarrhea and two healthy pigs and compared them with published RVC sequences from a database. The VP7 genes of two Japanese RVCs from healthy pigs were highly divergent from other known RVC strains and were provisionally classified as G12 and G13 based on the 86% nucleotide identity cut-off value. Pairwise sequence identity calculations and phylogenetic analyses revealed that candidate novel genotypes of porcine Japanese RVC were identified in the NSP1, NSP2 and NSP3 encoding genes, respectively. Furthermore, VP3 of Japanese porcine RVCs was shown to be closely related to human RVCs, suggesting a gene reassortment event between porcine and human RVCs and past interspecies transmission. The present study demonstrated that porcine RVCs show greater genetic diversity among strains than human and bovine RVCs. Copyright © 2016 Elsevier B.V. All rights reserved.

Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

PubMed

Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

1991-06-01

Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

PubMed

Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

1997-03-01

cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

Rapid and Accurate Sequencing of Enterovirus Genomes Using MinION Nanopore Sequencer.

PubMed

Wang, Ji; Ke, Yue Hua; Zhang, Yong; Huang, Ke Qiang; Wang, Lei; Shen, Xin Xin; Dong, Xiao Ping; Xu, Wen Bo; Ma, Xue Jun

2017-10-01

Knowledge of an enterovirus genome sequence is very important in epidemiological investigation to identify transmission patterns and ascertain the extent of an outbreak. The MinION sequencer is increasingly used to sequence various viral pathogens in many clinical situations because of its long reads, portability, real-time accessibility of sequenced data, and very low initial costs. However, information is lacking on MinION sequencing of enterovirus genomes. In this proof-of-concept study using Enterovirus 71 (EV71) and Coxsackievirus A16 (CA16) strains as examples, we established an amplicon-based whole genome sequencing method using MinION. We explored the accuracy, minimum sequencing time, discrimination and high-throughput sequencing ability of MinION, and compared its performance with Sanger sequencing. Within the first minute (min) of sequencing, the accuracy of MinION was 98.5% for the single EV71 strain and 94.12%-97.33% for 10 genetically-related CA16 strains. In as little as 14 min, 99% identity was reached for the single EV71 strain, and in 17 min (on average), 99% identity was achieved for 10 CA16 strains in a single run. MinION is suitable for whole genome sequencing of enteroviruses with sufficient accuracy and fine discrimination and has the potential as a fast, reliable and convenient method for routine use. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs.

PubMed

Busk, Peter Kamp; Lange, Lene

2013-06-01

Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion.

PubMed

Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris

2005-12-01

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.

Whole genome sequencing reveals mycobacterial microevolution among concurrent isolates from sputum and blood in HIV infected TB patients.

PubMed

Ssengooba, Willy; de Jong, Bouke C; Joloba, Moses L; Cobelens, Frank G; Meehan, Conor J

2016-08-05

In the context of advanced immunosuppression, M. tuberculosis is known to cause detectable mycobacteremia. However, little is known about the intra-patient mycobacterial microevolution and the direction of seeding between the sputum and blood compartments. From a diagnostic study of HIV-infected TB patients, 51 pairs of concurrent blood and sputum M. tuberculosis isolates from the same patient were available. In a previous analysis, we identified a subset with genotypic concordance, based on spoligotyping and 24 locus MIRU-VNTR. These paired isolates with identical genotypes were analyzed by whole genome sequencing and phylogenetic analysis. Of the 25 concordant pairs (49 % of the 51 paired isolates), 15 (60 %) remained viable for extraction of high quality DNA for whole genome sequencing. Two patient pairs were excluded due to poor quality sequence reads. The median CD4 cell count was 32 (IQR; 16-101)/mm(3) and ten (77 %) patients were on ART. No drug resistance mutations were identified in any of the sequences analyzed. Three (23.1 %) of 13 patients had SNPs separating paired isolates from blood and sputum compartments, indicating evidence of microevolution. Using a phylogenetic approach to identify the ancestral compartment, in two (15 %) patients the blood isolate was ancestral to the sputum isolate, in one (8 %) it was the opposite, and ten (77 %) of the pairs were identical. Among HIV-infected patients with poor cellular immunity, infection with multiple strains of M. tuberculosis was found in half of the patients. In those patients with identical strains, whole genome sequencing indicated that M. tuberculosis intra-patient microevolution does occur in a few patients, yet did not reveal a consistent direction of spread between sputum and blood. This suggests that these compartments are highly connected and potentially seed each other repeatedly.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T formed a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these ot...

Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina.

PubMed Central

Kuhls, K; Lieckfeldt, E; Samuels, G J; Kovacs, W; Meyer, W; Petrini, O; Gams, W; Börner, T; Kubicek, C P

1996-01-01

The relationship of the important cellulase producing asexual fungus Trichoderma reesei to its putative teleomorphic (sexual) ancestor Hypocrea jecorina and other species of the Trichoderma sect. Longibrachiatum was studied by PCR-fingerprinting and sequence analyses of the nuclear ribosomal DNA region containing the internal transcribed spacers (ITS-1 and ITS-2) and the 5.8S rRNA gene. The differences in the corresponding ITS sequences allowed a grouping of anamorphic (asexual) species of Trichoderma sect. Longibrachiatum into Trichoderma longibrachiatum, Trichoderma pseudokoningii, and Trichoderma reesei. The sexual species Hypocrea schweinitzii and H. jecorina were also clearly separated from each other. H. jecorina and T. reesei exhibited identical sequences, suggesting close relatedness or even species identity. Intraspecific and interspecific variation in the PCR-fingerprinting patterns supported the differentiation of species based on ITS sequences, the grouping of the strains, and the assignment of these strains to individual species. The variations between T. reesei and H. jecorina were at the same order of magnitude as found between all strains of H. jecorina, but much lower than the observed interspecific variations. Identical ITS sequences and the high similarity of PCR-fingerprinting patterns indicate a very close relationship between T. reesei and H. jecorina, whereas differences of the ITS sequences and the PCR-fingerprinting patterns show a clear phylogenetic distance between T. reesei/H. jecorina and T. longibrachiatum. T. reesei is considered to be an asexual, clonal line derived from a population of the tropical ascomycete H. jecorina. Images Fig. 2 PMID:8755548

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

MetaSeq: privacy preserving meta-analysis of sequencing-based association studies.

PubMed

Singh, Angad Pal; Zafer, Samreen; Pe'er, Itsik

2013-01-01

Human genetics recently transitioned from GWAS to studies based on NGS data. For GWAS, small effects dictated large sample sizes, typically made possible through meta-analysis by exchanging summary statistics across consortia. NGS studies groupwise-test for association of multiple potentially-causal alleles along each gene. They are subject to similar power constraints and therefore likely to resort to meta-analysis as well. The problem arises when considering privacy of the genetic information during the data-exchange process. Many scoring schemes for NGS association rely on the frequency of each variant thus requiring the exchange of identity of the sequenced variant. As such variants are often rare, potentially revealing the identity of their carriers and jeopardizing privacy. We have thus developed MetaSeq, a protocol for meta-analysis of genome-wide sequencing data by multiple collaborating parties, scoring association for rare variants pooled per gene across all parties. We tackle the challenge of tallying frequency counts of rare, sequenced alleles, for metaanalysis of sequencing data without disclosing the allele identity and counts, thereby protecting sample identity. This apparent paradoxical exchange of information is achieved through cryptographic means. The key idea is that parties encrypt identity of genes and variants. When they transfer information about frequency counts in cases and controls, the exchanged data does not convey the identity of a mutation and therefore does not expose carrier identity. The exchange relies on a 3rd party, trusted to follow the protocol although not trusted to learn about the raw data. We show applicability of this method to publicly available exome-sequencing data from multiple studies, simulating phenotypic information for powerful meta-analysis. The MetaSeq software is publicly available as open source.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

PubMed

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Detection of Rickettsia helvetica and Candidatus R. tarasevichiae DNA in Ixodes persulcatus ticks collected in Northeastern European Russia (Komi Republic).

PubMed

Kartashov, Mikhail Yu; Glushkova, Ludmila I; Mikryukova, Tamara P; Korabelnikov, Igor V; Egorova, Yulia I; Tupota, Natalia L; Protopopova, Elena V; Konovalova, Svetlana N; Ternovoi, Vladimir A; Loktev, Valery B

2017-06-01

The number of tick-borne infections in the northern European regions of Russia has increased considerably in the last years. In the present study, 676 unfed adult Ixodes persulcatus ticks were collected in the Komi Republic from 2011 to 2013 to study tick-borne rickettsioses. Rickettsia spp. DNA was detected by PCR in 51 (7.6%) ticks. The nucleotide sequence analysis of gltA fragments (765bp) from 51 ticks indicated that 60.8% and 39.2% of the ticks were infected with Rickettsia helvetica and Candidatus R. tarasevichiae, respectively. The gltA fragments showed 100% identity with those of Candidatus R. tarasevichiae previously discovered in Siberia and China, whereas R. helvetica showed 99.9% sequence identity with European isolates. The ompB had 8 nucleotide substitutions, 6 of which resulted in amino acid substitutions. In the sca9 gene, 3 nucleotide substitutions were detected, and only one resulted in amino acid substitution. The smpA, ompW, and β-lactamase genes of R. helvetica also showed a high level of sequence identity. Copyright © 2017 Elsevier GmbH. All rights reserved.

Complete cDNA sequence of SAP-like pentraxin from Limulus polyphemus: implications for pentraxin evolution.

PubMed

Tharia, Hazel A; Shrive, Annette K; Mills, John D; Arme, Chris; Williams, Gwyn T; Greenhough, Trevor J

2002-02-22

The serum amyloid P component (SAP)-like pentraxin Limulus polyphemus SAP is a recently discovered, distinct pentraxin species, of known structure, which does not bind phosphocholine and whose N-terminal sequence has been shown to differ markedly from the highly conserved N terminus of all other known horseshoe crab pentraxins. The complete cDNA sequence of Limulus SAP, and the derived amino acid sequence, the first invertebrate SAP-like pentraxin sequence, have been determined. Two sequences were identified that differed only in the length of the 3' untranslated region. Limulus SAP is synthesised as a precursor protein of 234 amino acid residues, the first 17 residues encoding a signal peptide that is absent from the mature protein. Phylogenetic analysis clusters Limulus SAP pentraxin with the horseshoe crab C-reactive proteins (CRPs) rather than the mammalian SAPs, which are clustered with mammalian CRPs. The deduced amino acid sequence shares 22% identity with both human SAP and CRP, which are 51% identical, and 31-35% with horseshoe crab CRPs. These analyses indicate that gene duplication of CRP (or SAP), followed by sequence divergence and the evolution of CRP and/or SAP function, occurred independently along the chordate and arthropod evolutionary lines rather than in a common ancestor. They further indicate that the CRP/SAP gene duplication event in Limulus occurred before both the emergence of the Limulus CRP variants and the mammalian CRP/SAP gene duplication. Limulus SAP, which does not exhibit the CRP characteristic of calcium-dependent binding to phosphocholine, is established as a pentraxin species distinct from all other known horseshoe crab pentraxins that exist in many variant forms sharing a high level of sequence homology. Copyright 2002 Elsevier Science Ltd.

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

Characterisation of Potential Antimicrobial Targets in Bacillus spp. I. Aminotransferases and Methionine Regeneration in Bacillus subtilis

DTIC Science & Technology

2002-07-01

DAAT and 45% identical to the Staphylococcus haemolyticus DAAT. The ybgE and ywaA sequences were found in the Illa subfamily, and were 59% identical to...halodurans BH1060 gene product. The two sequences also had a respective 40% and 37% identity to the Staphylococcus aureuts SAV2560 gene product. The 6

Enhancement of the Enterocin CRL35 Activity by a Synthetic Peptide Derived from the NH2-Terminal Sequence

PubMed Central

Saavedra, Lucila; Minahk, Carlos; de Ruiz Holgado, Aída P.; Sesma, Fernando

2004-01-01

The enterocin CRL35 biosynthetic gene cluster was cloned and sequenced. The sequence was revealed to be highly identical to that of the mundticin KS gene cluster (S. Kawamoto, J. Shima, R. Sato, T. Eguchi, S. Ohmomo, J. Shibato, N. Horikoshi, K. Takeshita, and T. Sameshima, Appl. Environ. Microbiol. 68:3830-3840, 2002). Short synthetic peptides were designed based on the bacteriocin sequence and were evaluated in antimicrobial competitive assays. The peptide KYYGNGVSCNKKGCS produced an enhancement of enterocin CRL35 antimicrobial activity in a buffer system. PMID:15215149

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China.

PubMed

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-02-23

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5-80.8% nucleotide identity and 95.4-97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China.

Phylogenetic Characterizations of Highly Mutated EV-B106 Recombinants Showing Extensive Genetic Exchanges with Other EV-B in Xinjiang, China

PubMed Central

Song, Yang; Zhang, Yong; Fan, Qin; Cui, Hui; Yan, Dongmei; Zhu, Shuangli; Tang, Haishu; Sun, Qiang; Wang, Dongyan; Xu, Wenbo

2017-01-01

Human enterovirus B106 (EV-B106) is a new member of the enterovirus B species. To date, only three nucleotide sequences of EV-B106 have been published, and only one full-length genome sequence (the Yunnan strain 148/YN/CHN/12) is available in the GenBank database. In this study, we conducted phylogenetic characterisation of four EV-B106 strains isolated in Xinjiang, China. Pairwise comparisons of the nucleotide sequences and the deduced amino acid sequences revealed that the four Xinjiang EV-B106 strains had only 80.5–80.8% nucleotide identity and 95.4–97.3% amino acid identity with the Yunnan EV-B106 strain, indicating high mutagenicity. Similarity plots and bootscanning analyses revealed that frequent intertypic recombination occurred in all four Xinjiang EV-B106 strains in the non-structural region. These four strains may share a donor sequence with the EV-B85 strain, which circulated in Xinjiang in 2011, indicating extensive genetic exchanges between these strains. All Xinjiang EV-B106 strains were temperature-sensitive. An antibody seroprevalence study against EV-B106 in two Xinjiang prefectures also showed low titres of neutralizing antibodies, suggesting limited exposure and transmission in the population. This study contributes the whole genome sequences of EV-B106 to the GenBank database and provides valuable information regarding the molecular epidemiology of EV-B106 in China. PMID:28230168

The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

PubMed Central

Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

1984-01-01

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

PubMed

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

PubMed

Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

2018-04-11

Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions. It also allows the definition of sequence length and sequence variability of the target region as well as the less variable flanking regions for tailoring to MPS platforms. As shown in this study, TIA can be used to discover identity-linked SNP islands within the human genome, useful for differentiating individuals by targeted resequencing on MPS technologies.

Phylogenetic analyses indicate little variation among reticuloendotheliosis viruses infecting avian species, including the endangered Attwater's prairie chicken.

PubMed

Bohls, Ryan L; Linares, Jose A; Gross, Shannon L; Ferro, Pam J; Silvy, Nova J; Collisson, Ellen W

2006-08-01

Reticuloendotheliosis virus infection, which typically causes systemic lymphomas and high mortality in the endangered Attwater's prairie chicken, has been described as a major obstacle in repopulation efforts of captive breeding facilities in Texas. Although antigenic relationships among reticuloendotheliosis virus (REV) strains have been previously determined, phylogenetic relationships have not been reported. The pol and env of REV proviral DNA from prairie chickens (PC-R92 and PC-2404), from poxvirus lesions in domestic chickens, the prototype poultry derived REV-A and chick syncytial virus (CSV), and duck derived spleen necrosis virus (SNV) were PCR amplified and sequenced. The 5032bp, that included the pol and most of env genes, of the PC-R92 and REV-A were 98% identical, and nucleotide sequence identities of smaller regions within the pol and env from REV strains examined ranged from 95 to 99% and 93 to 99%, respectively. The putative amino acid sequences were 97-99% identical in the polymerase and 90-98% in the envelope. Phylogenetic analyses of the nucleotide and amino acid sequences indicated the closest relationship among the recent fowl pox-associated chicken isolates, the prairie chicken isolates and the prototype CSV while only the SNV appeared to be distinctly divergent. While the origin of the naturally occurring viruses is not known, the avian poxvirus may be a critical component of transmission of these ubiquitous oncogenic viruses.

Effects of learning with explicit elaboration on implicit transfer of visuomotor sequence learning.

PubMed

Tanaka, Kanji; Watanabe, Katsumi

2013-08-01

Intervals between stimuli and/or responses have significant influences on sequential learning. In the present study, we investigated whether transfer would occur even when the intervals and the visual configurations in a sequence were drastically changed so that participants did not notice that the required sequences of responses were identical. In the experiment, two (or three) sequential button presses comprised a "set," and nine (or six) consecutive sets comprised a "hyperset." In the first session, participants learned either a 2 × 9 or 3 × 6 hyperset by trial and error until they completed it 20 times without error. In the second block, the 2 × 9 (3 × 6) hyperset was changed into the 3 × 6 (2 × 9) hyperset, resulting in different visual configurations and intervals between stimuli and responses. Participants were assigned into two groups: the Identical and Random groups. In the Identical group, the sequence (i.e., the buttons to be pressed) in the second block was identical to that in the first block. In the Random group, a new hyperset was learned. Even in the Identical group, no participants noticed that the sequences were identical. Nevertheless, a significant transfer of performance occurred. However, in the subsequent experiment that did not require explicit trial-and-error learning in the first session, implicit transfer in the second session did not occur. These results indicate that learning with explicit elaboration strengthens the implicit representation of the sequence order as a whole; this might occur independently of the intervals between elements and enable implicit transfer.

Hybrid error correction and de novo assembly of single-molecule sequencing reads

PubMed Central

Koren, Sergey; Schatz, Michael C.; Walenz, Brian P.; Martin, Jeffrey; Howard, Jason; Ganapathy, Ganeshkumar; Wang, Zhong; Rasko, David A.; McCombie, W. Richard; Jarvis, Erich D.; Phillippy, Adam M.

2012-01-01

Emerging single-molecule sequencing instruments can generate multi-kilobase sequences with the potential to dramatically improve genome and transcriptome assembly. However, the high error rate of single-molecule reads is challenging, and has limited their use to resequencing bacteria. To address this limitation, we introduce a novel correction algorithm and assembly strategy that utilizes shorter, high-identity sequences to correct the error in single-molecule sequences. We demonstrate the utility of this approach on Pacbio RS reads of phage, prokaryotic, and eukaryotic whole genomes, including the novel genome of the parrot Melopsittacus undulatus, as well as for RNA-seq reads of the corn (Zea mays) transcriptome. Our approach achieves over 99.9% read correction accuracy and produces substantially better assemblies than current sequencing strategies: in the best example, quintupling the median contig size relative to high-coverage, second-generation assemblies. Greater gains are predicted if read lengths continue to increase, including the prospect of single-contig bacterial chromosome assembly. PMID:22750884

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Identification of cDNAs encoding viper venom hyaluronidases: cross-generic sequence conservation of full-length and unusually short variant transcripts.

PubMed

Harrison, Robert A; Ibison, Frances; Wilbraham, Davina; Wagstaff, Simon C

2007-05-01

The immobilisation of prey by snakes is most efficiently achieved by the rapid dissemination of venom from its site of injection into the blood stream. Hyaluronidase is a common component of snake venoms and has been termed the "venom spreading factor". In the absence of nucleotide or protein sequence data to confirm the functional identity of this venom component, we interrogated a venom gland EST database for the saw-scaled viper, Echis ocellatus (Nigeria), using the gene ontology (GO) term "carbohydrate metabolism". A single hyalurononglucosaminadase-activity matching sequence (EOC00242) was found and used to design PCR primers to acquire the full-length cDNA sequence. Although very different from the bee venom and mammalian hyaluronidase sequences, the E. ocellatus sequence retained all the catalytic, positional and structural residues that characterise this class of carbohydrate metabolising hydrolases. An extraordinarily high level of sequence identity (>95%) was observed in analogous venom gland cDNA sequences isolated (by PCR) from another saw-scaled viper species, E. pyramidum leakeyi (Kenya), and from the sahara horned viper, Cerastes cerastes cerastes (Egypt) and the puff adder, Bitis arietans (Nigeria). Smaller amplicons, lacking hyaluronidase catalytic residues because of 768 bp or 855 bp central deletions, appear to encode either truncated peptides without hyaluronidase activity, or are non-translated transcripts because they lack consensus translation initiating motifs.

SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics.

PubMed

Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf

2015-08-01

RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of [Formula: see text]. Subsequently, numerous faster 'Sankoff-style' approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks down for RNAs with sequence identities below 60%. Alignment approaches like LocARNA that do not require sequence-based heuristics, have been limited to high complexity ([Formula: see text] quartic time). Breaking this barrier, we introduce the novel Sankoff-style algorithm 'sparsified prediction and alignment of RNAs based on their structure ensembles (SPARSE)', which runs in quadratic time without sequence-based heuristics. To achieve this low complexity, on par with sequence alignment algorithms, SPARSE features strong sparsification based on structural properties of the RNA ensembles. Following PMcomp, SPARSE gains further speed-up from lightweight energy computation. Although all existing lightweight Sankoff-style methods restrict Sankoff's original model by disallowing loop deletions and insertions, SPARSE transfers the Sankoff algorithm to the lightweight energy model completely for the first time. Compared with LocARNA, SPARSE achieves similar alignment and better folding quality in significantly less time (speedup: 3.7). At similar run-time, it aligns low sequence identity instances substantially more accurate than RAF, which uses sequence-based heuristics. © The Author 2015. Published by Oxford University Press.

Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

PubMed

Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

2017-10-01

The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

Mosaic Graphs and Comparative Genomics in Phage Communities

PubMed Central

Belcaid, Mahdi; Bergeron, Anne

2010-01-01

Abstract Comparing the genomes of two closely related viruses often produces mosaics where nearly identical sequences alternate with sequences that are unique to each genome. When several closely related genomes are compared, the unique sequences are likely to be shared with third genomes, leading to virus mosaic communities. Here we present comparative analysis of sets of Staphylococcus aureus phages that share large identical sequences with up to three other genomes, and with different partners along their genomes. We introduce mosaic graphs to represent these complex recombination events, and use them to illustrate the breath and depth of sequence sharing: some genomes are almost completely made up of shared sequences, while genomes that share very large identical sequences can adopt alternate functional modules. Mosaic graphs also allow us to identify breakpoints that could eventually be used for the construction of recombination networks. These findings have several implications on phage metagenomics assembly, on the horizontal gene transfer paradigm, and more generally on the understanding of the composition and evolutionary dynamics of virus communities. PMID:20874413

Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

PubMed

Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

2013-06-01

Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

PubMed

Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

2018-02-01

Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Genetic analysis of H9N2 avian influenza viruses circulated in broiler flocks: a case study in Iraq in 2014-2015.

PubMed

Kraidi, Qayssar Ali; Madadgar, Omid; Ghalyanchi Langeroudi, Arash; Karimi, Vahid

2017-04-01

H9N2 avian influenza viruses (AIVs) have been recorded in Eurasian for several years. Since 2004-2005, the disease has become endemic in Iraq, causing serious economic losses in the poultry industry. The hemagglutinin (HA) and neuraminidase (NA), two out of eight protein-coding genes, play an important role during the early stage of infection and hinder virus assembling. Little is known about the genetic information of the H9N2 viruses currently circulating in Iraq; thus, gene sequences of six AIVS of the H9N2 subtype have been detected and analyzed in the period of 2014-2015 from different outbreaks of broiler flocks in five provinces situated in the middle and southern parts of Iraq. Genetic comparison of the partial sequences of HA gene indicated that all Iraqi viruses are related to each other and could be divided into two subgroups. Viruses of the first and the second subgroups demonstrated a high similar identity with Pakistani and Iranian viruses, respectively. The nucleotide sequences of the NA protein of the all studied Iraqi viruses were very similar (95.2-100% identity), and shared high nucleotide sequence identity with Iranian, Pakistani, and Lebanese strains. All six recent viruses possessed histidine, alanine, and leucine at positions 183, 190, and 226, respectively, which are the key residues in receptor-binding sites. The Iraqi viruses were closely related to viruses of G1-like lineage isolated from poultry flocks of Iran and Pakistan, suggesting that possible epidemiological links could be derived from a common origin. Further investigations are required and should include the viral isolation and full-length molecular characterization of H9N2 AIVs in this area.

Cloning and Characterization of the Lactococcal Plasmid-Encoded Type II Restriction/Modification System, LlaDII

PubMed Central

Madsen, Annette; Josephsen, Jytte

1998-01-01

The LlaDII restriction/modification (R/M) system was found on the naturally occurring 8.9-kb plasmid pHW393 in Lactococcus lactis subsp. cremoris W39. A 2.4-kb PstI-EcoRI fragment inserted into the Escherichia coli-L. lactis shuttle vector pCI3340 conferred to L. lactis LM2301 and L. lactis SMQ86 resistance against representatives of the three most common lactococcal phage species: 936, P335, and c2. The LlaDII endonuclease was partially purified and found to recognize and cleave the sequence 5′-GC↓NGC-3′, where the arrow indicates the cleavage site. It is thus an isoschizomer of the commercially available restriction endonuclease Fnu4HI. Sequencing of the 2.4-kb PstI-EcoRI fragment revealed two open reading frames arranged tandemly and separated by a 105-bp intergenic region. The endonuclease gene of 543 bp preceded the methylase gene of 954 bp. The deduced amino acid sequence of the LlaDII R/M system showed high homology to that of its only sequenced isoschizomer, Bsp6I from Bacillus sp. strain RFL6, with 41% identity between the endonucleases and 60% identity between the methylases. The genetic organizations of the LlaDII and Bsp6I R/M systems are identical. Both methylases have two recognition sites (5′-GCGGC-3′ and 5′-GCCGC-3′) forming a putative stem-loop structure spanning part of the presumed −35 sequence and part of the intervening region between the −35 and −10 sequences. Alignment of the LlaDII and Bsp6I methylases with other m5C methylases showed that the protein primary structures possessed the same organization. PMID:9647810

Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand.

PubMed

Pohuang, Tawatchai; Chansiripornchai, Niwat; Tawatsin, Achara; Sasipreeyajan, Jiroj

2009-09-01

Thirteen field isolates of infectious bronchitis virus (IBV) were isolated from broiler flocks in Thailand between January and June 2008. The 878-bp of the S1 gene covering a hypervariable region was amplified and sequenced. Phylogenetic analysis based on that region revealed that these viruses were separated into two groups (I and II). IBV isolates in group I were not related to other IBV strains published in the GenBank database. Group 1 nucleotide sequence identities were less than 85% and amino acid sequence identities less than 84% in common with IBVs published in the GenBank database. This group likely represents the strains indigenous to Thailand. The isolates in group II showed a close relationship with Chinese IBVs. They had nucleotide sequence identities of 97-98% and amino acid sequence identities 96-98% in common with Chinese IBVs (strain A2, SH and QXIBV). This finding indicated that the recent Thai IBVs evolved separately and at least two groups of viruses are circulating in Thailand.

Identification of a novel herpesvirus associated with a penile proliferative lesion in a beluga (Delphinapterus leucas).

PubMed

Bellehumeur, Christian; Lair, Stéphane; Romero, Carlos H; Provost, Chantale; Nielsen, Ole; Gagnon, Carl A

2015-01-01

The carcass of an adult male beluga (Delphinapterus leucas) was found beach cast in 2008 on the shore of the St. Lawrence Estuary at Rivière-Ouelle, Quebec, Canada. The carcass was transported to the Faculté de médecine vétérinaire of the Université de Montréal for postmortem examination. Aspiration pneumonia was the probable cause of death. Necropsy revealed a focal papilloma-like penile lesion, characterized by focal mucosal thickening with disorganization of the epithelial layers and lymphoplasmacytic infiltration. A pan-herpesvirus nested PCR assay on frozen tissue from the penile lesion was positive. The PCR product sequencing revealed a partial herpesvirus DNA polymerase (DPOL) gene sequence of 600 nucleotides. Its nearest nucleotide identity was with the partial DPOL gene of an alphaherpesvirus, bovine herpesvirus 5 (79.5% identity). It also shared high identity with several other marine mammal herpesviruses (50.2 to 77.3% identity). This new herpesvirus was tentatively named beluga whale herpesvirus (BWHV). Virus isolation was unsuccessful. The pathogenic potential of BWHV is unknown, but the evaluation of archived tissues suggests that the virus is endemic in the St. Lawrence Estuary beluga population.

SCPRED: accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences.

PubMed

Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

2008-05-01

Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.

SCPRED: Accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences

PubMed Central

Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

2008-01-01

Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616

Glycoprotein-G-gene-based molecular and phylogenetic analysis of rabies viruses associated with a large outbreak of bovine rabies in southern Brazil.

PubMed

Cargnelutti, Juliana F; de Quadros, João M; Martins, Mathias; Batista, Helena B C R; Weiblen, Rudi; Flores, Eduardo F

2017-12-01

A large outbreak of hematophagous-bat-associated bovine rabies has been occurring in Rio Grande do Sul (RS), the southernmost Brazilian state, since 2011, with official estimates exceeding 50,000 cattle deaths. The present article describes a genetic characterization of rabies virus (RABV) recovered from 59 affected cattle and two sheep, from 56 herds in 16 municipalities (2012-2016). Molecular analysis was performed using the nucleotide (nt) and predicted amino acid (aa) sequences of RABV glycoprotein G (G). A high level of nt and aa sequence identity was observed among the examined G sequences, ranging from 98.4 to 100%, and from 97.3 to 100%, respectively. Likewise, high levels of nt and aa sequence identity were observed with bovine (nt, 99.8%; aa, 99.8%) and hematophagous bat (nt, 99.5%; aa, 99.4%) RABV sequences from GenBank, and lower levels were observed with carnivore RABV sequences (nt, 92.8%; aa, 88.1%). Some random mutations were observed in the analyzed sequences, and a few consistent mutations were observed in some sequences belonging to cluster 2, subcluster 2b. The clustering of the sequences was observed in a phylogenetic tree, where two distinct clusters were evident. Cluster 1 comprised RABV sequences covering the entire study period (2012 to 2016), but subclusters corresponding to different years could be identified, indicating virus evolution and/or introduction of new viruses into the population. In some cases, viruses from the same location obtained within a short period grouped into different subclusters, suggesting co-circulation of viruses of different origins. Subcluster segregation was also observed in sequences obtained in the same region during different periods, indicating the involvement of different viruses in the cases at different times. In summary, our results indicate that the outbreaks occurring in RS (2012 to 2016) probably involved RABV of different origins, in addition to a possible evolution of RABV isolates within this period.

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

PubMed

Wyszyńska-Koko, J; Kurył, J

2004-01-01

MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

High level of intergenera gene exchange shapes the evolution of haloarchaea in an isolated Antarctic lake.

PubMed

DeMaere, Matthew Z; Williams, Timothy J; Allen, Michelle A; Brown, Mark V; Gibson, John A E; Rich, John; Lauro, Federico M; Dyall-Smith, Michael; Davenport, Karen W; Woyke, Tanja; Kyrpides, Nikos C; Tringe, Susannah G; Cavicchioli, Ricardo

2013-10-15

Deep Lake in Antarctica is a globally isolated, hypersaline system that remains liquid at temperatures down to -20 °C. By analyzing metagenome data and genomes of four isolates we assessed genome variation and patterns of gene exchange to learn how the lake community evolved. The lake is completely and uniformly dominated by haloarchaea, comprising a hierarchically structured, low-complexity community that differs greatly to temperate and tropical hypersaline environments. The four Deep Lake isolates represent distinct genera (∼85% 16S rRNA gene similarity and ∼73% genome average nucleotide identity) with genomic characteristics indicative of niche adaptation, and collectively account for ∼72% of the cellular community. Network analysis revealed a remarkable level of intergenera gene exchange, including the sharing of long contiguous regions (up to 35 kb) of high identity (∼100%). Although the genomes of closely related Halobacterium, Haloquadratum, and Haloarcula (>90% average nucleotide identity) shared regions of high identity between species or strains, the four Deep Lake isolates were the only distantly related haloarchaea to share long high-identity regions. Moreover, the Deep Lake high-identity regions did not match to any other hypersaline environment metagenome data. The most abundant species, tADL, appears to play a central role in the exchange of insertion sequences, but not the exchange of high-identity regions. The genomic characteristics of the four haloarchaea are consistent with a lake ecosystem that sustains a high level of intergenera gene exchange while selecting for ecotypes that maintain sympatric speciation. The peculiarities of this polar system restrict which species can grow and provide a tempo and mode for accentuating gene exchange.

Complete mitochondrial genome of endangered Yellow-shouldered Amazon (Amazona barbadensis): two control region copies in parrot species of the Amazona genus.

PubMed

Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara

2013-08-01

Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.

Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea

PubMed Central

Didi, Jennifer; Ergani, Ayla; Lima, Sandra

2016-01-01

ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418

Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.

PubMed

Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry

2017-02-01

Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

PubMed

Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

2016-01-01

The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies

PubMed Central

Rickert, Keith W.; Grinberg, Luba; Woods, Robert M.; Wilson, Susan; Bowen, Michael A.; Baca, Manuel

2016-01-01

ABSTRACT The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3–5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

Evolutionary growth process of highly conserved sequences in vertebrate genomes.

PubMed

Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi

2012-08-01

Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

Sequence of a second gene encoding bovine submaxillary mucin: implication for mucin heterogeneity and cloning.

PubMed

Jiang, W; Woitach, J T; Gupta, D; Bhavanandan, V P

1998-10-20

Secreted epithelial mucins are extremely large and heterogeneous glycoproteins. We report the 5 kilobase DNA sequence of a second gene, BSM2, which encodes bovine submaxillary mucin. The determined nucleotide and deduced amino acid sequences of BSM2 are 95.2% and 92. 2% identical, respectively, to those of the previously described BSM1 gene isolated from the same cow. Further, the five predicted protein domains of the two genes are 100%, 94%, 93%, 77%, and 88% identical. Based on the above results, we propose that expression of multiple homologous core proteins from a single animal is a factor in generating diversity of saccharides in mucins and in providing resistance of the molecules to proteolysis. In addition, this work raises several important issues in mucin cloning such as assembling sequences from seemingly overlapping clones and deducing consensus sequences for nearly identical tandem repeats. Copyright 1998 Academic Press.

Identification of a new Apscaviroid from Japanese persimmon.

PubMed

Nakaune, Ryoji; Nakano, Masaaki

2008-01-01

Three viroid-like sequences were detected from Japanese persimmon (Diospyrus kaki Thunb.) by RT-PCR using primers specific for members of the genus Apscaviroid. Based on the sequences, we determined the complete genomic sequences. Two had 92.1-94.3% sequence identity with citrus viroid OS (CVd-OS) and 91.4-96.3% identity with apple fruit crinkle viroid (AFCVd), respectively. Another one, tentatively named persimmon viroid (PVd), had 396 nucleotides and less than 70% sequence identity with known viroids. The secondary structure of PVd is proposed to be rod-like with extensive base pairing and contains the terminal conserved region and the central conserved region characteristic of the genus Apscaviroid. Moreover, we confirmed that the viroids, including PVd, are graft transmissible from persimmon to persimmon and that persimmon is a natural host of these viroids. According to its molecular and biological properties, PVd should be considered a member of a new species in the genus Apscaviroid.

Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

PubMed

Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

2015-12-01

The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences.

PubMed

Mizianty, Marcin J; Kurgan, Lukasz

2009-12-13

Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/.

Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences

PubMed Central

2009-01-01

Background Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. Results The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. Conclusions The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/. PMID:20003388

Cytogenetic evidence for asexual evolution of bdelloid rotifers.

PubMed

Mark Welch, Jessica L; Mark Welch, David B; Meselson, Matthew

2004-02-10

DNA sequencing has shown individual bdelloid rotifer genomes to contain two or more diverged copies of every gene examined and has revealed no closely similar copies. These and other findings are consistent with long-term asexual evolution of bdelloids. It is not entirely ruled out, however, that bdelloid genomes consist of previously undetected pairs of sequences so similar as to be identical over the regions sequenced, as might result if bdelloids were highly inbred sexual diploids or polyploids. Here, we employ fluorescent in situ hybridization with cosmid probes to determine the copy number and chromosomal distribution of the heat shock gene hsp82 and adjacent sequences in the bdelloid Philodina roseola. We conclude that the four copies identified by sequencing are the only ones present and that each is on a separate chromosome. Bdelloids therefore are not highly homozygous sexually reproducing diploids or polyploids.

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain

DOE PAGES

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; ...

2017-09-25

Ensifer meliloti Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata. This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here in this paper, the features of E. meliloti Mlalz-1 are described, together with high-qualitymore » permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to Ensifer meliloti IAM 12611 T, Ensifer medicae A 321T and Ensifer numidicus ORS 1407 T, based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as E. meliloti . Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata-nodulating Ensifer strains, but ≤93% with nodC of Ensifer strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced E. meliloti strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In E. medicae strain WSM419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of E. medicae strains, which suggests genetic recombination between strain Mlalz-1 and E. medicae and the horizontal gene transfer of lpiA-acvB.« less

Donkey Orchid Symptomless Virus: A Viral ‘Platypus’ from Australian Terrestrial Orchids

PubMed Central

Wylie, Stephen J.; Li, Hua; Jones, Michael G. K.

2013-01-01

Complete and partial genome sequences of two isolates of an unusual new plant virus, designated Donkey orchid symptomless virus (DOSV) were identified using a high-throughput sequencing approach. The virus was identified from asymptomatic plants of Australian terrestrial orchid Diuris longifolia (Common donkey orchid) growing in a remnant forest patch near Perth, western Australia. DOSV was identified from two D. longifolia plants of 264 tested, and from at least one plant of 129 Caladenia latifolia (pink fairy orchid) plants tested. Phylogenetic analysis of the genome revealed open reading frames (ORF) encoding seven putative proteins of apparently disparate origins. A 69-kDa protein (ORF1) that overlapped the replicase shared low identity with MPs of plant tymoviruses (Tymoviridae). A 157-kDa replicase (ORF2) and 22-kDa coat protein (ORF4) shared 32% and 40% amino acid identity, respectively, with homologous proteins encoded by members of the plant virus family Alphaflexiviridae. A 44-kDa protein (ORF3) shared low identity with myosin and an autophagy protein from Squirrelpox virus. A 27-kDa protein (ORF5) shared no identity with described proteins. A 14-kDa protein (ORF6) shared limited sequence identity (26%) over a limited region of the envelope glycoprotein precursor of mammal-infecting Crimea-Congo hemorrhagic fever virus (Bunyaviridae). The putative 25-kDa movement protein (MP) (ORF7) shared limited (27%) identity with 3A-like MPs of members of the plant-infecting Tombusviridae and Virgaviridae. Transmissibility was shown when DOSV systemically infected Nicotiana benthamiana plants. Structure and organization of the domains within the putative replicase of DOSV suggests a common evolutionary origin with ‘potexvirus-like’ replicases of viruses within the Alphaflexiviridae and Tymoviridae, and the CP appears to be ancestral to CPs of allexiviruses (Alphaflexiviridae). The MP shares an evolutionary history with MPs of dianthoviruses, but the other putative proteins are distant from plant viruses. DOSV is not readily classified in current lower order virus taxa. PMID:24223974

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov

USDA-ARS?s Scientific Manuscript database

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with 5 other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these oth...

Characterization of acid-tolerant H/CO-utilizing methanogenic enrichment cultures from an acidic peat bog in New York State.

PubMed

Bräuer, Suzanna L; Yashiro, Erika; Ueno, Norikiyo G; Yavitt, Joseph B; Zinder, Stephen H

2006-08-01

Two methanogenic cultures were enriched from acidic peat soil using a growth medium buffered to c. pH 5. One culture, 6A, was obtained from peat after incubation with H(2)/CO(2), whereas culture NTA was derived from a 10(-4) dilution of untreated peat into a modified medium. 16S rRNA gene clone libraries from each culture contained one methanogen and two bacterial sequences. The methanogen 16S rRNA gene sequences were 99% identical with each other and belonged to the novel "R-10/Fen cluster" family of the Methanomicrobiales, whereas their mcrA sequences were 96% identical. One bacterial 16S rRNA gene sequence from culture 6A belonged to the Bacteroidetes and showed 99% identity with sequences from methanogenic enrichments from German and Russian bogs. The other sequence belonged to the Firmicutes and was identical to a thick rod-shaped citrate-utilizing organism isolated from culture 6A, the numbers of which decreased when the Ti (III) chelator was switched from citrate to nitrilotriacetate. Bacterial clones from the NTA culture clustered in the Delta- and Betaproteobacteria. Both cultures contained thin rods, presumably the methanogens, as the predominant morphotype, and represent a significant advance in characterization of the novel acidiphilic R-10 family methanogens.

Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

PubMed

Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

2016-11-01

Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

Bird ticks in Hungary reflect western, southern, eastern flyway connections and two genetic lineages of Ixodes frontalis and Haemaphysalis concinna.

PubMed

Hornok, S; Flaisz, B; Takács, N; Kontschán, J; Csörgő, T; Csipak, Á; Jaksa, B R; Kováts, D

2016-02-24

Birds play an important role in short- and long-distance transportation of ticks and tick-borne pathogens. The aim of the present study was to provide comprehensive information on the species and genetic diversity of ixodid ticks transported by migratory and non-migratory bird species in Central Europe, and to evaluate relevant data in a geographical, as well as in an ecological context. During a three year period (2012-2014), altogether 3339 ixodid ticks were collected from 1167 passerine birds (representatives of 47 species) at ringing stations in Hungary. These ticks were identified, and the tick-infestations of bird species were compared according to various traits. In addition, PCR and sequencing of part of the cytochrome oxidase subunit-I (COI) and 16S rDNA genes were performed from representatives of five tick species. The most abundant tick species found were Ixodes ricinus and Haemaphysalis concinna (with 2296 and 989 immature stages, respectively). In addition, 48 I. frontalis (all stages), three Hyalomma rufipes nymphs, one I. lividus and two I. festai females were collected. The majority of I. ricinus and I. frontalis specimens occurred on ground-feeding bird species, as contrasted to Ha. concinna. Hy. rufipes showed the highest degree of sequence identity to an Ethiopian hybrid of the same tick species. Based on both COI and 16S rDNA gene analyses, two genetic lineages of I. frontalis were recognized (with only 91.4 % identity in their partial COI gene). These were highly similar to South-Western European isolates of the same tick species. Phylogenetic analysis of Ha. concinna specimens collected from birds in Hungary also revealed two genetic lineages, one of which showed high (≥99 %) degree of 16S rDNA sequence identity to conspecific East Asian isolates. Two genetic lineages of I. frontalis and Ha. concinna are transported by birds in Central Europe, which reflect a high degree of sequence identity to South-Western European and East Asian isolates of the same tick species, respectively. In addition, I. festai was collected for the first time in Hungary. These findings highlight the importance of western and eastern migratory connections by birds (in addition to the southern direction), which are also relevant to the epidemiology of tick-borne diseases.

Acute diarrhea in West African children: diverse enteric viruses and a novel parvovirus genus.

PubMed

Phan, Tung G; Vo, Nguyen P; Bonkoungou, Isidore J O; Kapoor, Amit; Barro, Nicolas; O'Ryan, Miguel; Kapusinszky, Beatrix; Wang, Chunling; Delwart, Eric

2012-10-01

Parvoviruses cause a variety of mild to severe symptoms or asymptomatic infections in humans and animals. During a viral metagenomic analysis of feces from children with acute diarrhea in Burkina Faso, we identified in decreasing prevalence nucleic acids from anelloviruses, dependoviruses, sapoviruses, enteroviruses, bocaviruses, noroviruses, adenoviruses, parechoviruses, rotaviruses, cosavirus, astroviruses, and hepatitis B virus. Sequences from a highly divergent parvovirus, provisionally called bufavirus, were also detected whose NS1 and VP1 proteins showed <39% and <31% identities to those of previously known parvoviruses. Four percent of the fecal samples were PCR positive for this new parvovirus, including a related bufavirus species showing only 72% identity in VP1. The high degree of genetic divergence of these related genomes from those of other parvoviruses indicates the presence of a proposed new Parvoviridae genus containing at least two species. Studies of the tropism and pathogenicity of these novel parvoviruses will be facilitated by the availability of their genome sequences.

Acute Diarrhea in West African Children: Diverse Enteric Viruses and a Novel Parvovirus Genus

PubMed Central

Phan, Tung G.; Vo, Nguyen P.; Bonkoungou, Isidore J. O.; Kapoor, Amit; Barro, Nicolas; O'Ryan, Miguel; Kapusinszky, Beatrix; Wang, Chunling

2012-01-01

Parvoviruses cause a variety of mild to severe symptoms or asymptomatic infections in humans and animals. During a viral metagenomic analysis of feces from children with acute diarrhea in Burkina Faso, we identified in decreasing prevalence nucleic acids from anelloviruses, dependoviruses, sapoviruses, enteroviruses, bocaviruses, noroviruses, adenoviruses, parechoviruses, rotaviruses, cosavirus, astroviruses, and hepatitis B virus. Sequences from a highly divergent parvovirus, provisionally called bufavirus, were also detected whose NS1 and VP1 proteins showed <39% and <31% identities to those of previously known parvoviruses. Four percent of the fecal samples were PCR positive for this new parvovirus, including a related bufavirus species showing only 72% identity in VP1. The high degree of genetic divergence of these related genomes from those of other parvoviruses indicates the presence of a proposed new Parvoviridae genus containing at least two species. Studies of the tropism and pathogenicity of these novel parvoviruses will be facilitated by the availability of their genome sequences. PMID:22855485

A novel, highly divergent ssDNA virus identified in Brazil infecting apple, pear and grapevine.

PubMed

Basso, Marcos Fernando; da Silva, José Cleydson Ferreira; Fajardo, Thor Vinícius Martins; Fontes, Elizabeth Pacheco Batista; Zerbini, Francisco Murilo

2015-12-02

Fruit trees of temperate and tropical climates are of great economical importance worldwide and several viruses have been reported affecting their productivity and longevity. Fruit trees of different Brazilian regions displaying virus-like symptoms were evaluated for infection by circular DNA viruses. Seventy-four fruit trees were sampled and a novel, highly divergent, monopartite circular ssDNA virus was cloned from apple, pear and grapevine trees. Forty-five complete viral genomes were sequenced, with a size of approx. 3.4 kb and organized into five ORFs. Deduced amino acid sequences showed identities in the range of 38% with unclassified circular ssDNA viruses, nanoviruses and alphasatellites (putative Replication-associated protein, Rep), and begomo-, curto- and mastreviruses (putative coat protein, CP, and movement protein, MP). A large intergenic region contains a short palindromic sequence capable of forming a hairpin-like structure with the loop sequence TAGTATTAC, identical to the conserved nonanucleotide of circoviruses, nanoviruses and alphasatellites. Recombination events were not detected and phylogenetic analysis showed a relationship with circo-, nano- and geminiviruses. PCR confirmed the presence of this novel ssDNA virus in field plants. Infectivity tests using the cloned viral genome confirmed its ability to infect apple and pear tree seedlings, but not Nicotiana benthamiana. The name "Temperate fruit decay-associated virus" (TFDaV) is proposed for this novel virus. Copyright © 2015 Elsevier B.V. All rights reserved.

Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum.

PubMed

Yang, Yurong; Zheng, Jing; Chen, Jiaxin

2012-12-01

CDC-42 is a member of the Rho GTPase subfamily that is involved in many signaling pathways, including mitosis, cell polarity, cell migration and cytoskeleton remodeling. Here, we present the first characterization of a full-length cDNA encoding the small GTPase cdc-42, designated as Accdc-42, isolated from the parasitic nematode Ancylostoma caninum. The encoded protein contains 191 amino acid residues with a predicted molecular weight of 21 kDa and displays a high level of identity with the Rho-family GTPase protein CDC-42. Phylogenetic analysis revealed that Accdc-42 was most closely related to Caenorhabditis briggsae cdc-42. Comparison with selected sequences from the free-living nematode Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, Danio rerio, Mus musculus and human genomes showed that Accdc-42 is highly conserved. AcCDC-42 demonstrates the highest identity to CDC-42 from C. briggsae (94.2%), and it also exhibits 91.6% identity to CDC-42 from C. elegans and 91.1% from Brugia malayi. Additionally, the transcript of Accdc-42 was analyzed during the different developmental stages of the worm. Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adults of A. caninum. Copyright © 2012 Elsevier Inc. All rights reserved.

Genetic characterization of a novel astrovirus in Pekin ducks.

PubMed

Liao, Qinfeng; Liu, Ning; Wang, Xiaoyan; Wang, Fumin; Zhang, Dabing

2015-06-01

Three divergent groups of duck astroviruses (DAstVs), namely DAstV-1, DAstV-2 (formerly duck hepatitis virus type 3) and DAstV-3 (isolate CPH), and other avastroviruses are known to infect domestic ducks. To provide more data regarding the molecular epidemiology of astroviruses in domestic ducks, we examined the prevalence of astroviruses in 136 domestic duck samples collected from four different provinces of China. Nineteen goose samples were also included. Using an astrovirus-specific reverse transcription-PCR assay, two groups of astroviruses were detected from our samples. A group of astroviruses detected from Pekin ducks, Shaoxing ducks and Landes geese were highly similar to the newly discovered DAstV-3. More interestingly, a novel group of avastroviruses, which we named DAstV-4, was detected in Pekin ducks. Following full-length sequencing and sequence analysis, the variation between DAstV-4 and other avastroviruses in terms of lengths of genome and internal component was highlighted. Sequence identity and phylogenetic analyses based on the amino acid sequences of the three open reading frames (ORFs) clearly demonstrated that DAstV-4 was highly divergent from all other avastroviruses. Further analyses showed that DAstV-4 shared low levels of genome identities (50-58%) and high levels of mean amino acid genetic distances in the ORF2 sequences (0.520-0.801) with other avastroviruses, suggesting DAstV-4 may represent an additional avastrovirus species although the taxonomic relationship of DAstV-4 to DAstV-3 remains to be resolved. The present works contribute to the understanding of epidemiology, ecology and taxonomy of astroviruses in ducks. Copyright © 2015 Elsevier B.V. All rights reserved.

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

PubMed

Pool, John E; Aquadro, Charles F

2007-07-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

Coevolution analysis of Hepatitis C virus genome to identify the structural and functional dependency network of viral proteins

NASA Astrophysics Data System (ADS)

Champeimont, Raphaël; Laine, Elodie; Hu, Shuang-Wei; Penin, Francois; Carbone, Alessandra

2016-05-01

A novel computational approach of coevolution analysis allowed us to reconstruct the protein-protein interaction network of the Hepatitis C Virus (HCV) at the residue resolution. For the first time, coevolution analysis of an entire viral genome was realized, based on a limited set of protein sequences with high sequence identity within genotypes. The identified coevolving residues constitute highly relevant predictions of protein-protein interactions for further experimental identification of HCV protein complexes. The method can be used to analyse other viral genomes and to predict the associated protein interaction networks.

Diff-seq: A high throughput sequencing-based mismatch detection assay for DNA variant enrichment and discovery

PubMed Central

Karas, Vlad O; Sinnott-Armstrong, Nicholas A; Varghese, Vici; Shafer, Robert W; Greenleaf, William J; Sherlock, Gavin

2018-01-01

Abstract Much of the within species genetic variation is in the form of single nucleotide polymorphisms (SNPs), typically detected by whole genome sequencing (WGS) or microarray-based technologies. However, WGS produces mostly uninformative reads that perfectly match the reference, while microarrays require genome-specific reagents. We have developed Diff-seq, a sequencing-based mismatch detection assay for SNP discovery without the requirement for specialized nucleic-acid reagents. Diff-seq leverages the Surveyor endonuclease to cleave mismatched DNA molecules that are generated after cross-annealing of a complex pool of DNA fragments. Sequencing libraries enriched for Surveyor-cleaved molecules result in increased coverage at the variant sites. Diff-seq detected all mismatches present in an initial test substrate, with specific enrichment dependent on the identity and context of the variation. Application to viral sequences resulted in increased observation of variant alleles in a biologically relevant context. Diff-Seq has the potential to increase the sensitivity and efficiency of high-throughput sequencing in the detection of variation. PMID:29361139

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Genetic and antigenic characterization of Bungowannah virus, a novel pestivirus

USDA-ARS?s Scientific Manuscript database

Bungowannah virus, a possible new species of pestivirus, has been associated with a disease syndrome in pigs characterised by myocarditis with a high incidence of stillbirths. The current studies have identified the entire viral genome sequence, confirming the unique identity of this virus and sugge...

Orthologs in Arabidopsis thaliana of the Hsp70 interacting protein Hip

PubMed Central

Webb, Mary Alice; Cavaletto, John M.; Klanrit, Preekamol; Thompson, Gary A.

2001-01-01

The Hsp70-interacting protein Hip binds to the adenosine triphosphatase domain of Hsp70, stabilizing it in the adenosine 5′-diphosphate–ligated conformation and promoting binding of target polypeptides. In mammalian cells, Hip is a component of the cytoplasmic chaperone heterocomplex that regulates signal transduction via interaction with hormone receptors and protein kinases. Analysis of the complete genome sequence of the model flowering plant Arabidopsis thaliana revealed 2 genes encoding Hip orthologs. The deduced sequence of AtHip-1 consists of 441 amino acid residues and is 42% identical to human Hip. AtHip-1 contains the same functional domains characterized in mammalian Hip, including an N-terminal dimerization domain, an acidic domain, 3 tetratricopeptide repeats flanked by a highly charged region, a series of degenerate GGMP repeats, and a C-terminal region similar to the Sti1/Hop/p60 protein. The deduced amino acid sequence of AtHip-2 consists of 380 amino acid residues. AtHip-2 consists of a truncated Hip-like domain that is 46% identical to human Hip, followed by a C-terminal domain related to thioredoxin. AtHip-2 is 63% identical to another Hip-thioredoxin protein recently identified in Vitis labrusca (grape). The truncated Hip domain in AtHip-2 includes the amino terminus, the acidic domain, and tetratricopeptide repeats with flanking charged region. Analyses of expressed sequence tag databases indicate that both AtHip-1 and AtHip-2 are expressed in A thaliana and that orthologs of Hip are also expressed widely in other plants. The similarity between AtHip-1 and its mammalian orthologs is consistent with a similar role in plant cells. The sequence of AtHip-2 suggests the possibility of additional unique chaperone functions. PMID:11599566

Citrus leprosis virus N: A New Dichorhavirus Causing Citrus Leprosis Disease.

PubMed

Ramos-González, Pedro Luis; Chabi-Jesus, Camila; Guerra-Peraza, Orlene; Tassi, Aline Daniele; Kitajima, Elliot Watanabe; Harakava, Ricardo; Salaroli, Renato Barbosa; Freitas-Astúa, Juliana

2017-08-01

Citrus leprosis (CL) is a viral disease endemic to the Western Hemisphere that produces local necrotic and chlorotic lesions on leaves, branches, and fruit and causes serious yield reduction in citrus orchards. Samples of sweet orange (Citrus × sinensis) trees showing CL symptoms were collected during a survey in noncommercial citrus areas in the southeast region of Brazil in 2013 to 2016. Transmission electron microscopy analyses of foliar lesions confirmed the presence of rod-like viral particles commonly associated with CL in the nucleus and cytoplasm of infected cells. However, every attempt to identify these particles by reverse-transcription polymerase chain reaction tests failed, even though all described primers for the detection of known CL-causing cileviruses and dichorhaviruses were used. Next-generation sequencing of total RNA extracts from three symptomatic samples revealed the genome of distinct, although highly related (>92% nucleotide sequence identity), viruses whose genetic organization is similar to that of dichorhaviruses. The genome sequence of these viruses showed <62% nucleotide sequence identity with those of orchid fleck virus and coffee ringspot virus. Globally, the deduced amino acid sequences of the open reading frames they encode share 32.7 to 63.8% identity with the proteins of the dichorhavirids. Mites collected from both the naturally infected citrus trees and those used for the transmission of one of the characterized isolates to Arabidopsis plants were anatomically recognized as Brevipalpus phoenicis sensu stricto. Molecular and biological features indicate that the identified viruses belong to a new species of CL-associated dichorhavirus, which we propose to call Citrus leprosis N dichorhavirus. Our results, while emphasizing the increasing diversity of viruses causing CL disease, lead to a reevaluation of the nomenclature of those viruses assigned to the genus Dichorhavirus. In this regard, a comprehensive discussion is presented.

Sequence preservation of osteocalcin protein and mitochondrial DNA in bison bones older than 55 ka

NASA Astrophysics Data System (ADS)

Nielsen-Marsh, Christina M.; Ostrom, Peggy H.; Gandhi, Hasand; Shapiro, Beth; Cooper, Alan; Hauschka, Peter V.; Collins, Matthew J.

2002-12-01

We report the first complete sequences of the protein osteocalcin from small amounts (20 mg) of two bison bone (Bison priscus) dated to older than 55.6 ka and older than 58.9 ka. Osteocalcin was purified using new gravity columns (never exposed to protein) followed by microbore reversed-phase high-performance liquid chromatography. Sequencing of osteocalcin employed two methods of matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS): peptide mass mapping (PMM) and post-source decay (PSD). The PMM shows that ancient and modern bison osteocalcin have the same mass to charge (m/z) distribution, indicating an identical protein sequence and absence of diagenetic products. This was confirmed by PSD of the m/z 2066 tryptic peptide (residues 1 19); the mass spectra from ancient and modern peptides were identical. The 129 mass unit difference in the molecular ion between cow (Bos taurus) and bison is caused by a single amino-acid substitution between the taxa (Trp in cow is replaced by Gly in bison at residue 5). Bison mitochondrial control region DNA sequences were obtained from the older than 55.6 ka fossil. These results suggest that DNA and protein sequences can be used to directly investigate molecular phylogenies over a considerable time period, the absolute limit of which is yet to be determined.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

A survey and evaluations of histogram-based statistics in alignment-free sequence comparison.

PubMed

Luczak, Brian B; James, Benjamin T; Girgis, Hani Z

2017-12-06

Since the dawn of the bioinformatics field, sequence alignment scores have been the main method for comparing sequences. However, alignment algorithms are quadratic, requiring long execution time. As alternatives, scientists have developed tens of alignment-free statistics for measuring the similarity between two sequences. We surveyed tens of alignment-free k-mer statistics. Additionally, we evaluated 33 statistics and multiplicative combinations between the statistics and/or their squares. These statistics are calculated on two k-mer histograms representing two sequences. Our evaluations using global alignment scores revealed that the majority of the statistics are sensitive and capable of finding similar sequences to a query sequence. Therefore, any of these statistics can filter out dissimilar sequences quickly. Further, we observed that multiplicative combinations of the statistics are highly correlated with the identity score. Furthermore, combinations involving sequence length difference or Earth Mover's distance, which takes the length difference into account, are always among the highest correlated paired statistics with identity scores. Similarly, paired statistics including length difference or Earth Mover's distance are among the best performers in finding the K-closest sequences. Interestingly, similar performance can be obtained using histograms of shorter words, resulting in reducing the memory requirement and increasing the speed remarkably. Moreover, we found that simple single statistics are sufficient for processing next-generation sequencing reads and for applications relying on local alignment. Finally, we measured the time requirement of each statistic. The survey and the evaluations will help scientists with identifying efficient alternatives to the costly alignment algorithm, saving thousands of computational hours. The source code of the benchmarking tool is available as Supplementary Materials. © The Author 2017. Published by Oxford University Press.

Electron microscopic analysis and structural characterization of novel NADP(H)-containing methanol: N,N'-dimethyl-4-nitrosoaniline oxidoreductases from the gram-positive methylotrophic bacteria Amycolatopsis methanolica and Mycobacterium gastri MB19.

PubMed Central

Bystrykh, L V; Vonck, J; van Bruggen, E F; van Beeumen, J; Samyn, B; Govorukhina, N I; Arfman, N; Duine, J A; Dijkhuizen, L

1993-01-01

The quaternary protein structure of two methanol:N,N'-dimethyl-4-nitrosoaniline (NDMA) oxidoreductases purified from Amycolatopsis methanolica and Mycobacterium gastri MB19 was analyzed by electron microscopy and image processing. The enzymes are decameric proteins (displaying fivefold symmetry) with estimated molecular masses of 490 to 500 kDa based on their subunit molecular masses of 49 to 50 kDa. Both methanol:NDMA oxidoreductases possess a tightly but noncovalently bound NADP(H) cofactor at an NADPH-to-subunit molar ratio of 0.7. These cofactors are redox active toward alcohol and aldehyde substrates. Both enzymes contain significant amounts of Zn2+ and Mg2+ ions. The primary amino acid sequences of the A. methanolica and M. gastri MB19 methanol:NDMA oxidoreductases share a high degree of identity, as indicated by N-terminal sequence analysis (63% identity among the first 27 N-terminal amino acids), internal peptide sequence analysis, and overall amino acid composition. The amino acid sequence analysis also revealed significant similarity to a decameric methanol dehydrogenase of Bacillus methanolicus C1. Images PMID:8449887

Applying the Concept of Peptide Uniqueness to Anti-Polio Vaccination.

PubMed

Kanduc, Darja; Fasano, Candida; Capone, Giovanni; Pesce Delfino, Antonella; Calabrò, Michele; Polimeno, Lorenzo

2015-01-01

Although rare, adverse events may associate with anti-poliovirus vaccination thus possibly hampering global polio eradication worldwide. To design peptide-based anti-polio vaccines exempt from potential cross-reactivity risks and possibly able to reduce rare potential adverse events such as the postvaccine paralytic poliomyelitis due to the tendency of the poliovirus genome to mutate. Proteins from poliovirus type 1, strain Mahoney, were analyzed for amino acid sequence identity to the human proteome at the pentapeptide level, searching for sequences that (1) have zero percent of identity to human proteins, (2) are potentially endowed with an immunologic potential, and (3) are highly conserved among poliovirus strains. Sequence analyses produced a set of consensus epitopic peptides potentially able to generate specific anti-polio immune responses exempt from cross-reactivity with the human host. Peptide sequences unique to poliovirus proteins and conserved among polio strains might help formulate a specific and universal anti-polio vaccine able to react with multiple viral strains and exempt from the burden of possible cross-reactions with human proteins. As an additional advantage, using a peptide-based vaccine instead of current anti-polio DNA vaccines would eliminate the rare post-polio poliomyelitis cases and other disabling symptoms that may appear following vaccination.

An extremely thermophilic anaerobic bacterium Caldicellulosiruptor sp. F32 exhibits distinctive properties in growth and xylanases during xylan hydrolysis.

PubMed

Ying, Yu; Meng, Dongdong; Chen, Xiaohua; Li, Fuli

2013-08-15

An anaerobic, extremely thermophilic, and cellulose- and xylan-degrading bacterium F32 was isolated from biocompost. Sequence analysis of the 16S rRNA gene of this strain showed that it was closely related to Caldicellulosiruptor saccharolyticus DSM 8903 (99.0% identity). Physiological and biochemical data also supported that identification of strain F32 as a Caldicellulosiruptor species. The proteins secreted by Caldicellulosiruptor sp. F32 grown on xylan showed a xylanase activity of 7.74U/mg, which was 2.5 times higher than that of C. saccharolyticus DSM 8903. Based on the genomic sequencing data, 2 xylanase genes, JX030400 and JX030401, were identified in Caldicellulosiruptor sp. F32. The xylanase encoded by JX030401 shared 97% identity with Csac_0696 of C. saccharolyticus DSM 8903, while that encoded by JX030400 shared 94% identity with Athe_0089 of C. bescii DSM 6725, which was not found in the genome of strain DSM 8903. Xylanse encoded by JX030400 had 9-fold higher specific activity than JX030401. Our results indicated that although the 2 strains shared high identity, the xylanase system in Caldicellulosiruptor sp. F32 was more efficient than that in C. saccharolyticus DSM 8903. Copyright © 2013 Elsevier Inc. All rights reserved.

Biogeographic and phylogenetic diversity of thermoacidophilic cyanidiales in Yellowstone National Park, Japan, and New Zealand.

PubMed

Toplin, J A; Norris, T B; Lehr, C R; McDermott, T R; Castenholz, R W

2008-05-01

Members of the rhodophytan order Cyanidiales are unique among phototrophs in their ability to live in extreme environments that combine low pH levels ( approximately 0.2 to 4.0) and moderately high temperatures of 40 to 56 degrees C. These unicellular algae occur in far-flung volcanic areas throughout the earth. Three genera (Cyanidium, Galdieria, and Cyanidioschyzon) are recognized. The phylogenetic diversity of culture isolates of the Cyanidiales from habitats throughout Yellowstone National Park (YNP), three areas in Japan, and seven regions in New Zealand was examined by using the chloroplast RuBisCO large subunit gene (rbcL) and the 18S rRNA gene. Based on the nucleotide sequences of both genes, the YNP isolates fall into two groups, one with high identity to Galdieria sulphuraria (type II) and another that is by far the most common and extensively distributed Yellowstone type (type IA). The latter is a spherical, walled cell that reproduces by internal divisions, with a subsequent release of smaller daughter cells. This type, nevertheless, shows a 99 to 100% identity to Cyanidioschyzon merolae (type IB), which lacks a wall, divides by "fission"-like cytokinesis into two daughter cells, and has less than 5% of the cell volume of type IA. The evolutionary and taxonomic ramifications of this disparity are discussed. Although the 18S rRNA and rbcL genes did not reveal diversity among the numerous isolates of type IA, chloroplast short sequence repeats did show some variation by location within YNP. In contrast, Japanese and New Zealand strains showed considerable diversity when we examined only the sequences of 18S and rbcL genes. Most exhibited identities closer to Galdieria maxima than to other strains, but these identities were commonly as low as 91 to 93%. Some of these Japanese and New Zealand strains probably represent undescribed species that diverged after long-term geographic isolation.

Molecular identification of a new begomovirus infecting yellow passion fruit (Passiflora edulis) in Colombia.

PubMed

Vaca-Vaca, Juan Carlos; Carrasco-Lozano, Emerson Clovis; López-López, Karina

2017-02-01

The complete genome sequence of a bipartite begomovirus (genus Begomovirus, family Geminiviridae) infecting yellow passion fruit (Passiflora edulis) in the state of Valle del Cauca (Colombia) has been determined. The complete DNA-A and DNA-B components were determined to be 2600 and 2572 nt in length, respectively. The DNA-A showed the highest nucleotide sequence identity (87.2 %) to bean dwarf mosaic virus (M88179), a begomovirus found in common bean crops in Colombia, and only 77.4 % identity to passion fruit severe leaf distortion virus (FJ972767), a begomovirus identified infecting passion fruit in Brazil. Based on its sequence identity to all other begomoviruses known to date and in accordance with the ICTV species demarcation criterion for the genus Begomovirus (≥91 % sequence identity for the complete DNA-A), the name passion fruit leaf distortion virus is proposed for this new begomovirus. To our knowledge, this is the first report of a bipartite begomovirus affecting passion fruit in Colombia and the second report of a geminivirus affecting this crop worldwide.

Sequence identity and antigenic cross-reactivity of white face hornet venom allergen, also a hyaluronidase, with other proteins.

PubMed

Lu, G; Kochoumian, L; King, T P

1995-03-03

White face hornet (Dolichovespula maculata) venom has three known protein allergens which induce IgE response in susceptible people. They are antigen 5, phospholipase A1, and hyaluronidase, also known as Dol m 5, 1, and 2, respectively. We have cloned Dol m 2, a protein of 331 residues. When expressed in bacteria, a mixture of recombinant Dol m 2 and its fragments was obtained. The fragments were apparently generated by proteolysis of a Met-Met bond at residue 122, as they were not observed for a Dol m 2 mutant with a Leu-Met bond. Dol m 2 has 56% sequence identity with the honey bee venom allergen hyaluronidase and 27% identity with PH-20, a human sperm protein with hyaluronidase activity. A common feature of hornet venom allergens is their sequence identity with other proteins in our environment. We showed previously the sequence identity of Dol m 5 with a plant protein and a mammalian testis protein and of Dol m 1 with mammalian lipases. In BALB/c mice, Dol m 2 and bee hyaluronidase showed cross-reactivity at both antibody and T cell levels. These findings are relevant to some patients' multiple sensitivity to hornet and bee stings.

Optimization of identity operation in NMR spectroscopy via genetic algorithm: Application to the TEDOR experiment

NASA Astrophysics Data System (ADS)

Manu, V. S.; Veglia, Gianluigi

2016-12-01

Identity operation in the form of π pulses is widely used in NMR spectroscopy. For an isolated single spin system, a sequence of even number of π pulses performs an identity operation, leaving the spin state essentially unaltered. For multi-spin systems, trains of π pulses with appropriate phases and time delays modulate the spin Hamiltonian to perform operations such as decoupling and recoupling. However, experimental imperfections often jeopardize the outcome, leading to severe losses in sensitivity. Here, we demonstrate that a newly designed Genetic Algorithm (GA) is able to optimize a train of π pulses, resulting in a robust identity operation. As proof-of-concept, we optimized the recoupling sequence in the transferred-echo double-resonance (TEDOR) pulse sequence, a key experiment in biological magic angle spinning (MAS) solid-state NMR for measuring multiple carbon-nitrogen distances. The GA modified TEDOR (GMO-TEDOR) experiment with improved recoupling efficiency results in a net gain of sensitivity up to 28% as tested on a uniformly 13C, 15N labeled microcrystalline ubiquitin sample. The robust identity operation achieved via GA paves the way for the optimization of several other pulse sequences used for both solid- and liquid-state NMR used for decoupling, recoupling, and relaxation experiments.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

Polypeptide having or assisting in carbohydrate material degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2016-02-16

The invention relates to a polypeptide which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 76% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well asmore » the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.« less

Polypeptide having swollenin activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elizabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica D; Damveld, Robbertus Antonius

2015-11-04

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having beta-glucosidase activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; De Jong, Rene Marcel; Damveld, Robbertus Antonius

2015-09-01

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 70% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having cellobiohydrolase activity and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-09-15

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 93% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having acetyl xylan esterase activity and uses thereof

DOEpatents

Schoonneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 82% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Polypeptide having carbohydrate degrading activity and uses thereof

DOEpatents

Schooneveld-Bergmans, Margot Elisabeth Francoise; Heijne, Wilbert Herman Marie; Vlasie, Monica Diana; Damveld, Robbertus Antonius

2015-08-18

The invention relates to a polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 73% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional polypeptide and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow.

PubMed

Suryawanshi, Gajendra W; Xu, Song; Xie, Yiming; Chou, Tom; Kim, Namshin; Chen, Irvin S Y; Kim, Sanggu

2017-06-14

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

On the Role of Aggregation Prone Regions in Protein Evolution, Stability, and Enzymatic Catalysis: Insights from Diverse Analyses

PubMed Central

Buck, Patrick M.; Kumar, Sandeep; Singh, Satish K.

2013-01-01

The various roles that aggregation prone regions (APRs) are capable of playing in proteins are investigated here via comprehensive analyses of multiple non-redundant datasets containing randomly generated amino acid sequences, monomeric proteins, intrinsically disordered proteins (IDPs) and catalytic residues. Results from this study indicate that the aggregation propensities of monomeric protein sequences have been minimized compared to random sequences with uniform and natural amino acid compositions, as observed by a lower average aggregation propensity and fewer APRs that are shorter in length and more often punctuated by gate-keeper residues. However, evidence for evolutionary selective pressure to disrupt these sequence regions among homologous proteins is inconsistent. APRs are less conserved than average sequence identity among closely related homologues (≥80% sequence identity with a parent) but APRs are more conserved than average sequence identity among homologues that have at least 50% sequence identity with a parent. Structural analyses of APRs indicate that APRs are three times more likely to contain ordered versus disordered residues and that APRs frequently contribute more towards stabilizing proteins than equal length segments from the same protein. Catalytic residues and APRs were also found to be in structural contact significantly more often than expected by random chance. Our findings suggest that proteins have evolved by optimizing their risk of aggregation for cellular environments by both minimizing aggregation prone regions and by conserving those that are important for folding and function. In many cases, these sequence optimizations are insufficient to develop recombinant proteins into commercial products. Rational design strategies aimed at improving protein solubility for biotechnological purposes should carefully evaluate the contributions made by candidate APRs, targeted for disruption, towards protein structure and activity. PMID:24146608

First Report of an ST410 OXA-181 and CTX-M-15 Coproducing Escherichia coli Clone in Italy: A Whole-Genome Sequence Characterization.

PubMed

Piazza, Aurora; Comandatore, Francesco; Romeri, Francesca; Pagani, Cristina; Floriano, Anna Maria; Ridolfo, Annalisa; Antona, Carlo; Brilli, Matteo; Mattioni Marchetti, Vittoria; Bandi, Claudio; Gismondo, Maria Rita; Rimoldi, Sara Giordana

2018-02-23

We investigated an Italian OXA-181-producing Escherichia coli clinical isolate (ECS1_14) by whole-genome sequencing. The strain coharbored bla CTX-M-15 , bla CMY-2 , and qnrS1 genes; it belonged to ST410(Achtman)/ST692(Pasteur) and phylogroup A. The bla OXA-181 gene was harbored on a plasmid highly similar (99% identity) to the pOXA181_EC14828 plasmid, recently reported in China.

Deconvoluting simulated metagenomes: the performance of hard- and soft- clustering algorithms applied to metagenomic chromosome conformation capture (3C)

PubMed Central

DeMaere, Matthew Z.

2016-01-01

Background Chromosome conformation capture, coupled with high throughput DNA sequencing in protocols like Hi-C and 3C-seq, has been proposed as a viable means of generating data to resolve the genomes of microorganisms living in naturally occuring environments. Metagenomic Hi-C and 3C-seq datasets have begun to emerge, but the feasibility of resolving genomes when closely related organisms (strain-level diversity) are present in the sample has not yet been systematically characterised. Methods We developed a computational simulation pipeline for metagenomic 3C and Hi-C sequencing to evaluate the accuracy of genomic reconstructions at, above, and below an operationally defined species boundary. We simulated datasets and measured accuracy over a wide range of parameters. Five clustering algorithms were evaluated (2 hard, 3 soft) using an adaptation of the extended B-cubed validation measure. Results When all genomes in a sample are below 95% sequence identity, all of the tested clustering algorithms performed well. When sequence data contains genomes above 95% identity (our operational definition of strain-level diversity), a naive soft-clustering extension of the Louvain method achieves the highest performance. Discussion Previously, only hard-clustering algorithms have been applied to metagenomic 3C and Hi-C data, yet none of these perform well when strain-level diversity exists in a metagenomic sample. Our simple extension of the Louvain method performed the best in these scenarios, however, accuracy remained well below the levels observed for samples without strain-level diversity. Strain resolution is also highly dependent on the amount of available 3C sequence data, suggesting that depth of sequencing must be carefully considered during experimental design. Finally, there appears to be great scope to improve the accuracy of strain resolution through further algorithm development. PMID:27843713

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2–33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

The glycoprotein genes and gene junctions of the fish rhabdoviruses spring viremia of carp virus and hirame rhabdovirus: Analysis of relationships with other rhabdoviruses

USGS Publications Warehouse

Bjorklund, H.V.; Higman, K.H.; Kurath, G.

1996-01-01

The nucleotide sequences of the glycoprotein genes and all of the internal gene junctions of the fish pathogenic rhabdoviruses spring viremia of carp virus (SVCV) and hirame rhabdovirus (HIRRV) have been determined from cDNA clones generated from viral genomic RNA. The SVCV glycoprotein gene sequence is 1588 nucleotides (nt) long and encodes a 509 amino acid (aa) protein. The HIRRV glycoprotein gene sequence comprises 1612 nt, coding for a 508 aa protein. In sequence comparisons of 15 rhabdovirus glycoproteins, the SVCV glycoprotein gene showed the highest amino acid sequence identity (31.2-33.2%) with vesicular stomatitis New Jersey virus (VSNJV), Chandipura virus (CHPV) and vesicular stomatitis Indiana virus (VSIV). The HIRRV glycoprotein gene showed a very high amino acid sequence identity (74.3%) with the glycoprotein gene of another fish pathogenic rhabdovirus, infectious hematopoietic necrosis virus (IHNV), but no significant similarity with glycoproteins of VSIV or rabies virus (RABV). In phylogenetic analyses SVCV was grouped consistently with VSIV, VSNJV and CHPV in the Vesiculovirus genus of Rhabdoviridae. The fish rhabdoviruses HIRRV, IHNV and viral hemorrhagic septicemia virus (VHSV) showed close relationships with each other, but only very distant relationships with mammalian rhabdoviruses. The gene junctions are highly conserved between SVCV and VSIV, well conserved between IHNV and HIRRV, but not conserved between HIRRV/IHNV and RABV. Based on the combined results we suggest that the fish lyssa-type rhabdoviruses HIRRV, IHNV and VHSV may be grouped in their own genus within the family Rhabdoviridae. Aquarhabdovirus has been proposed for the name of this new genus.

Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

PubMed

Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

2013-12-01

The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

Full Genome Characterisation of Bluetongue Virus Serotype 6 from the Netherlands 2008 and Comparison to Other Field and Vaccine Strains

PubMed Central

Maan, Sushila; Maan, Narender S.; van Rijn, Piet A.; van Gennip, René G. P.; Sanders, Anna; Wright, Isabel M.; Batten, Carrie; Hoffmann, Bernd; Eschbaumer, Michael; Oura, Chris A. L.; Potgieter, Abraham C.; Nomikou, Kyriaki; Mertens, Peter P.C.

2010-01-01

In mid September 2008, clinical signs of bluetongue (particularly coronitis) were observed in cows on three different farms in eastern Netherlands (Luttenberg, Heeten, and Barchem), two of which had been vaccinated with an inactivated BTV-8 vaccine (during May-June 2008). Bluetongue virus (BTV) infection was also detected on a fourth farm (Oldenzaal) in the same area while testing for export. BTV RNA was subsequently identified by real time RT-PCR targeting genome-segment (Seg-) 10, in blood samples from each farm. The virus was isolated from the Heeten sample (IAH “dsRNA virus reference collection” [dsRNA-VRC] isolate number NET2008/05) and typed as BTV-6 by RT-PCR targeting Seg-2. Sequencing confirmed the virus type, showing an identical Seg-2 sequence to that of the South African BTV-6 live-vaccine-strain. Although most of the other genome segments also showed very high levels of identity to the BTV-6 vaccine (99.7 to 100%), Seg-10 showed greatest identity (98.4%) to the BTV-2 vaccine (RSAvvv2/02), indicating that NET2008/05 had acquired a different Seg-10 by reassortment. Although Seg-7 from NET2008/05 was also most closely related to the BTV-6 vaccine (99.7/100% nt/aa identity), the Seg-7 sequence derived from the blood sample of the same animal (NET2008/06) was identical to that of the Netherlands BTV-8 (NET2006/04 and NET2007/01). This indicates that the blood contained two different Seg-7 sequences, one of which (from the BTV-6 vaccine) was selected during virus isolation in cell-culture. The predominance of the BTV-8 Seg-7 in the blood sample suggests that the virus was in the process of reassorting with the northern field strain of BTV-8. Two genome segments of the virus showed significant differences from the BTV-6 vaccine, indicating that they had been acquired by reassortment event with BTV-8, and another unknown parental-strain. However, the route by which BTV-6 and BTV-8 entered northern Europe was not established. PMID:20428242

A germin-like protein with superoxide dismutase activity in pea nodules with high protein sequence identity to a putative rhicadhesin receptor.

PubMed

Gucciardo, Sébastian; Wisniewski, Jean-Pierre; Brewin, Nicholas J; Bornemann, Stephen

2007-01-01

The cDNAs encoding three germin-like proteins (PsGER1, PsGER2a, and PsGER2b) were isolated from Pisum sativum. The coding sequence of PsGER1 transiently expressed in tobacco leaves gave a protein with superoxide dismutase activity but no detectable oxalate oxidase activity according to in-gel activity stains. The transient expression of wheat germin gf-2.8 oxalate oxidase showed oxalate oxidase but no superoxide dismutase activity under the same conditions. The superoxide dismutase activity of PsGER1 was resistant to high temperature, denaturation by detergent, and high concentrations of hydrogen peroxide. In salt-stressed pea roots, a heat-resistant superoxide dismutase activity was observed with an electrophoretic mobility similar to that of the PsGER1 protein, but this activity was below the detection limit in non-stressed or H(2)O(2)-stressed pea roots. Oxalate oxidase activity was not detected in either pea roots or nodules. Following in situ hybridization in developing pea nodules, PsGER1 transcript was detected in expanding cells just proximal to the meristematic zone and also in the epidermis, but to a lesser extent. PsGER1 is the first known germin-like protein with superoxide dismutase activity to be associated with nodules. It shared protein sequence identity with the N-terminal sequence of a putative plant receptor for rhicadhesin, a bacterial attachment protein. However, its primary location in nodules suggests functional roles other than as a rhicadhesin receptor required for the first stage of bacterial attachment to root hairs.

Investigation of rare and low-frequency variants using high-throughput sequencing with pooled DNA samples

PubMed Central

Wang, Jingwen; Skoog, Tiina; Einarsdottir, Elisabet; Kaartokallio, Tea; Laivuori, Hannele; Grauers, Anna; Gerdhem, Paul; Hytönen, Marjo; Lohi, Hannes; Kere, Juha; Jiao, Hong

2016-01-01

High-throughput sequencing using pooled DNA samples can facilitate genome-wide studies on rare and low-frequency variants in a large population. Some major questions concerning the pooling sequencing strategy are whether rare and low-frequency variants can be detected reliably, and whether estimated minor allele frequencies (MAFs) can represent the actual values obtained from individually genotyped samples. In this study, we evaluated MAF estimates using three variant detection tools with two sets of pooled whole exome sequencing (WES) and one set of pooled whole genome sequencing (WGS) data. Both GATK and Freebayes displayed high sensitivity, specificity and accuracy when detecting rare or low-frequency variants. For the WGS study, 56% of the low-frequency variants in Illumina array have identical MAFs and 26% have one allele difference between sequencing and individual genotyping data. The MAF estimates from WGS correlated well (r = 0.94) with those from Illumina arrays. The MAFs from the pooled WES data also showed high concordance (r = 0.88) with those from the individual genotyping data. In conclusion, the MAFs estimated from pooled DNA sequencing data reflect the MAFs in individually genotyped samples well. The pooling strategy can thus be a rapid and cost-effective approach for the initial screening in large-scale association studies. PMID:27633116

ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams and Rogers, 1984 (Acanthocephala: Palaeacanthocephala).

PubMed

Král'ová-Hromadová, Iva; Tietz, David F; Shinn, Andrew P; Spakulová, Marta

2003-10-01

The internal transcribed spacers (ITS-1 and ITS-2) of the ribosomal RNA gene of Pomphorhynchus laevis (Zoega in Müller, 1776) (Acanthocephala) isolated from various fish species across Central and Southern Europe were compared with those of P. lucyi Williams and Rogers, 1984 collected from the largemouth bass Micropterus salmonoides Boulenger from the USA. The nucleotide sequences of ITS regions of P. laevis from minnows Phoxinus phoxinus (L.) and chub Leuciscus cephalus (L.) from two distant localities in the Slovak Republic were found to be 100% identical. The ITS-1 and ITS-2 of P. laevis from chub from the Czech Republic and Italy were also mutually identical, but significantly different from Slovak worms (88.7% identity for ITS-1, 91.3% identity for ITS-2). A fifth sample collected from Barbus tyberinus Bonaparte from Italy was very similar to the sympatric Italian isolate from chub, possessing four nucleotide substitutions in ITS-1 (98.4% identity). The ITS rDNA sequences of P. lucyi differed significantly from those of P. laevis; the values of identity were 51.8-56.1% for ITS-1 and 63.1-65.3% for ITS-2, and were significantly higher than the range of P. laevis within-species variability. The results based on the ITS sequences confirmed the occurrence of strains in P. laevis from Continental Europe which are well defined by molecules but reveal only slight differences in their morphology.

SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics

PubMed Central

Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf

2015-01-01

Motivation: RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of O(n6). Subsequently, numerous faster ‘Sankoff-style’ approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks down for RNAs with sequence identities below 60%. Alignment approaches like LocARNA that do not require sequence-based heuristics, have been limited to high complexity (≥ quartic time). Results: Breaking this barrier, we introduce the novel Sankoff-style algorithm ‘sparsified prediction and alignment of RNAs based on their structure ensembles (SPARSE)’, which runs in quadratic time without sequence-based heuristics. To achieve this low complexity, on par with sequence alignment algorithms, SPARSE features strong sparsification based on structural properties of the RNA ensembles. Following PMcomp, SPARSE gains further speed-up from lightweight energy computation. Although all existing lightweight Sankoff-style methods restrict Sankoff’s original model by disallowing loop deletions and insertions, SPARSE transfers the Sankoff algorithm to the lightweight energy model completely for the first time. Compared with LocARNA, SPARSE achieves similar alignment and better folding quality in significantly less time (speedup: 3.7). At similar run-time, it aligns low sequence identity instances substantially more accurate than RAF, which uses sequence-based heuristics. Availability and implementation: SPARSE is freely available at http://www.bioinf.uni-freiburg.de/Software/SPARSE. Contact: backofen@informatik.uni-freiburg.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25838465

Sequence of the structural gene for granule-bound starch synthase of potato (Solanum tuberosum L.) and evidence for a single point deletion in the amf allele.

PubMed

van der Leij, F R; Visser, R G; Ponstein, A S; Jacobsen, E; Feenstra, W J

1991-08-01

The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type sequence with a cDNA sequence from the literature and a newly isolated cDNA revealed the presence of 13 introns, the first of which is located in the untranslated leader. The promoter contains a G-box-like sequence. The deduced amino acid sequence of the precursor of GBSS shows a high degree of identity with monocot waxy protein sequences in the region corresponding to the mature form of the enzyme. The transit peptide of 77 amino acids, required for routing of the precursor to the plastids, shows much less identity with the transit peptides of the other waxy preproteins, but resembles the hydropathic distributions of these peptides. Alignment of the amino acid sequences of the four mature starch synthases with the Escherichia coli glgA gene product revealed the presence of at least three conserved boxes; there is no homology with previously proposed starch-binding domains of other enzymes involved in starch metabolism. We report the use of chimeric constructs with wild-type and amf sequences to localize, via complementation experiments, the region of the amf allele in which the mutation resides. Direct sequencing of polymerase chain reaction products confirmed that the amf mutation is a deletion of a single AT basepair in the region coding for the transit peptide.(ABSTRACT TRUNCATED AT 250 WORDS)

Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

PubMed

Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

2011-09-01

Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).

PubMed

Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong

2006-08-01

Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.

First isolation of Rickettsia monacensis from a patient in South Korea.

PubMed

Kim, Yeon-Sook; Choi, Yeon-Joo; Lee, Kyung-Min; Ahn, Kyu-Joong; Kim, Heung-Chul; Klein, Terry; Jiang, Ju; Richards, Allen; Park, Kyung-Hee; Jang, Won-Jong

2017-07-01

A Rickettsia sp. was isolated from the blood of a patient with an acute febrile illness using the shell vial technique; the isolate was named CN45Kr and was identified by molecular assay as Rickettsia monacensis, which was first recognized as a pathogen in Spain. Sequencing analysis showed that the gltA sequence of the isolate was identical to that of Rickettsia sp. IRS3. The ompA-5mp fragment sequence showed 100% identity to those of R. monacensis and Rickettsia sp. In56 and ompA-3pA In56 and 100% identity to that of Rickettsia sp. IRS3. The ompB sequence was found to have 99.9% similarity to that of R. monacensis IrR/Munich. This study confirms the pathogenicity of this agent and provides additional information about its geographic distribution. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis

PubMed Central

McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe

2001-01-01

Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223

A new begomovirus associated with alpha- and betasatellite molecules isolated from Vernonia cinerea in China.

PubMed

Zulfiqar, Awais; Zhang, Jie; Cui, Xiaofeng; Qian, Yajuan; Zhou, Xueping; Xie, Yan

2012-01-01

A begomovirus disease complex associated with Vernonia cinerea showing yellow vein symptoms was studied. The full-length genomic DNA was comprised of 2739 nucleotides (nt) and contained the typical genome structure of begomoviruses. Comparison analysis showed that it shared the highest (78.9%) nucleotide sequence identity with recently characterized Vernonia yellow vein virus (VeYVV) from India. For associated satellites, betasatellite showed the highest nucleotide sequence identity (52.1%) with Vernonia yellow vein virus betasatellite (VeYVVB) and alphasatellite shared the highest sequence identity (70.7%) with Gossypium mustelinium symptomless alphasatellite (GMusSLA). It is a member of a distinct species with cognate alpha- and betasatellites for which the name Vernonia yellow vein Fujian virus (VeYVFjV) is proposed.

Issues with RNA-seq analysis in non-model organisms: A salmonid example.

PubMed

Sundaram, Arvind; Tengs, Torstein; Grimholt, Unni

2017-10-01

High throughput sequencing (HTS) is useful for many purposes as exemplified by the other topics included in this special issue. The purpose of this paper is to look into the unique challenges of using this technology in non-model organisms where resources such as genomes, functional genome annotations or genome complexity provide obstacles not met in model organisms. To describe these challenges, we narrow our scope to RNA sequencing used to study differential gene expression in response to pathogen challenge. As a demonstration species we chose Atlantic salmon, which has a sequenced genome with poor annotation and an added complexity due to many duplicated genes. We find that our RNA-seq analysis pipeline deciphers between duplicates despite high sequence identity. However, annotation issues provide problems in linking differentially expressed genes to pathways. Also, comparing results between approaches and species are complicated due to lack of standardized annotation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nucleotide sequences of the tet(M) genes from the American and Dutch type tetracycline resistance plasmids of Neisseria gonorrhoeae.

PubMed

Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M

1993-11-01

High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.

alpha-Amylase gene of Streptomyces limosus: nucleotide sequence, expression motifs, and amino acid sequence homology to mammalian and invertebrate alpha-amylases.

PubMed Central

Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J

1987-01-01

The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166

NGSCheckMate: software for validating sample identity in next-generation sequencing studies within and across data types.

PubMed

Lee, Sejoon; Lee, Soohyun; Ouellette, Scott; Park, Woong-Yang; Lee, Eunjung A; Park, Peter J

2017-06-20

In many next-generation sequencing (NGS) studies, multiple samples or data types are profiled for each individual. An important quality control (QC) step in these studies is to ensure that datasets from the same subject are properly paired. Given the heterogeneity of data types, file types and sequencing depths in a multi-dimensional study, a robust program that provides a standardized metric for genotype comparisons would be useful. Here, we describe NGSCheckMate, a user-friendly software package for verifying sample identities from FASTQ, BAM or VCF files. This tool uses a model-based method to compare allele read fractions at known single-nucleotide polymorphisms, considering depth-dependent behavior of similarity metrics for identical and unrelated samples. Our evaluation shows that NGSCheckMate is effective for a variety of data types, including exome sequencing, whole-genome sequencing, RNA-seq, ChIP-seq, targeted sequencing and single-cell whole-genome sequencing, with a minimal requirement for sequencing depth (>0.5X). An alignment-free module can be run directly on FASTQ files for a quick initial check. We recommend using this software as a QC step in NGS studies. https://github.com/parklab/NGSCheckMate. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

PubMed

Strouhal, Michal; Mikalová, Lenka; Havlíčková, Pavla; Tenti, Paolo; Čejková, Darina; Rychlík, Ivan; Bruisten, Sylvia; Šmajs, David

2017-09-01

Treponema pallidum subsp. pertenue (TPE) is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier) and one TPE strain (Fribourg-Blanc) isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA) strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet. Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively). Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation. The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

Crystal structure of a triacylglycerol lipase from Penicillium expansum at 1.3 A determined by sulfur SAD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bian, Chuanbing; Yuan, Cai; Chen, Liqing

2010-04-05

Triacylglycerol lipases (EC 3.1.1.3) are present in many different organisms including animals, plants, and microbes. Lipases catalyze the hydrolysis of long-chain triglycerides into fatty acids and glycerol at the interface between the water insoluble substrate and the aqueous phase. Lipases can also catalyze the reverse esterification reaction to form glycerides under certain conditions. Lipases of microbial origin are of considerable commercial interest for wide variety of biotechnological applications in industries, including detergent, food, cosmetic, pharmaceutical, fine chemicals, and biodiesel. Nowadays, microbial lipases have become one of the most important industrial enzymes. PEL (Penicillium expansum lipase) is a fungal lipase frommore » Penicillium expansum strain PF898 isolated from Chinese soil that has been subjected to several generations of mutagenesis to increase its enzymatic activity. PEL belongs to the triacylglycerol lipases family, and its catalytic characteristics have been studied. The enzyme has been used in Chinese laundry detergent industry for several years (http://www.leveking.com). However, the poor thermal stability of the enzyme limits its application. To further study and improve this enzyme, PEL was cloned and sequenced. Furthermore, it was overexpressed in Pichia pastoris. PEL contains GHSLG sequence, which is the lipase consensus sequence Gly-X1-Ser-X2-Gly, but has a low amino acid sequence identities to other lipases. The most similar lipases are Rhizomucor miehei (PML) and Rhizopus niveus (PNL) with a 21% and 20% sequence identities to PEL, respectively. Interestingly, the similarity of PEL with the known esterases is somewhat higher with 24% sequence identity to feruloyl esterase A. Here, we report the 1.3 {angstrom} resolution crystal structure of PEL determined by sulfur SAD phasing. This structure not only presents a new lipase structure at high resolution, but also provides a structural platform to analyze the published mutagenesis results. The structure may also open up new avenues for future protein engineering study on PEL.« less

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

PubMed Central

Trebbien, Ramona; Chriel, Mariann; Struve, Tina; Hjulsager, Charlotte Kristiane; Larsen, Gitte; Larsen, Lars Erik

2014-01-01

A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% – 99.62%). The study furthermore revealed that fleas (Ceratophyllus sciurorum) contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks. PMID:24454897

Single-Genome Sequencing of Hepatitis C Virus in Donor-Recipient Pairs Distinguishes Modes and Models of Virus Transmission and Early Diversification.

PubMed

Li, Hui; Stoddard, Mark B; Wang, Shuyi; Giorgi, Elena E; Blair, Lily M; Learn, Gerald H; Hahn, Beatrice H; Alter, Harvey J; Busch, Michael P; Fierer, Daniel S; Ribeiro, Ruy M; Perelson, Alan S; Bhattacharya, Tanmoy; Shaw, George M

2016-01-01

Despite the recent development of highly effective anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and development of an effective vaccine. A precise molecular identification of transmitted/founder (T/F) HCV genomes that lead to productive clinical infection could play a critical role in vaccine research, as it has for HIV-1. However, the replication schema of these two RNA viruses differ substantially, as do viral responses to innate and adaptive host defenses. These differences raise questions as to the certainty of T/F HCV genome inferences, particularly in cases where multiple closely related sequence lineages have been observed. To clarify these issues and distinguish between competing models of early HCV diversification, we examined seven cases of acute HCV infection in humans and chimpanzees, including three examples of virus transmission between linked donors and recipients. Using single-genome sequencing (SGS) of plasma vRNA, we found that inferred T/F sequences in recipients were identical to viral sequences in their respective donors. Early in infection, HCV genomes generally evolved according to a simple model of random evolution where the coalescent corresponded to the T/F sequence. Closely related sequence lineages could be explained by high multiplicity infection from a donor whose viral sequences had undergone a pretransmission bottleneck due to treatment, immune selection, or recent infection. These findings validate SGS, together with mathematical modeling and phylogenetic analysis, as a novel strategy to infer T/F HCV genome sequences. Despite the recent development of highly effective, interferon-sparing anti-hepatitis C virus (HCV) drugs, the global burden of this pathogen remains immense. Control or eradication of HCV will likely require the broad application of antiviral drugs and the development of an effective vaccine, which could be facilitated by a precise molecular identification of transmitted/founder (T/F) viral genomes and their progeny. We used single-genome sequencing to show that inferred HCV T/F sequences in recipients were identical to viral sequences in their respective donors and that viral genomes generally evolved early in infection according to a simple model of random sequence evolution. Altogether, the findings validate T/F genome inferences and illustrate how T/F sequence identification can illuminate studies of HCV transmission, immunopathogenesis, drug resistance development, and vaccine protection, including sieving effects on breakthrough virus strains. Copyright © 2015 Li et al.

The tapeworm Atractolytocestus tenuicollis (Cestoda: Caryophyllidea)--a sister species or ancestor of an invasive A. huronensis?

PubMed

Králová-Hromadová, Ivica; Štefka, Jan; Bazsalovicsová, Eva; Bokorová, Silvia; Oros, Mikuláš

2013-10-01

Atractolytocestus tenuicollis (Li, 1964) Xi, Wang, Wu, Gao et Nie, 2009 is a monozoic, non-segmented tapeworm of the order Caryophyllidea, parasitizing exclusively common carp (Cyprinus carpio L.). In the current work, the first molecular data, in particular complete ribosomal internal transcribed spacer 2 (ITS2) and partial mitochondrial cytochrome c oxidase subunit I (cox1) on A. tenuicollis from Niushan Lake, Wuhan, China, are provided. In order to evaluate molecular interrelationships within Atractolytocestus, the data on A. tenuicollis were compared with relevant data on two other congeners, Atractolytocestus huronensis and Atractolytocestus sagittatus. Divergent intragenomic copies (ITS2 paralogues) were detected in the ITS2 ribosomal spacer of A. tenuicollis; the same phenomenon has previously been observed also in two other congeners. ITS2 structure of A. tenuicollis was very similar to that of A. huronensis from Slovakia, USA and UK; overall pairwise sequence identity was 91.7-95.2%. On the other hand, values of sequence identity between A. tenuicollis and A. sagittatus were lower, 69.7-70.9%. Cox1 sequence, analysed in five A. tenuicollis individuals, were 100 % identical and no intraspecific variation was observed. Comparison of A. tenuicollis cox1 with respective sequences of two other Atractolytocestus species showed that the mitochondrial haplotype found in Chinese A. tenuicollis is structurally specific (haplotype 4; Ha4) and differs from all so far determined Atractolytocestus haplotypes (Ha1 and Ha2 for A. huronensis; Ha3 for A. sagittatus). Pairwise sequence identity between A. tenuicollis cox1 haplotype and remaining three haplotypes followed the same pattern as in ITS2. The nucleotide and amino acide (aa) sequence comparison with A. huronensis Ha1 and Ha2 revealed higher sequence identity, 90.3-90.8% (96.9% in aa), while lower values were achieved between A. tenuicollis haplotype and Ha3 of Japanese A. sagittatus-75.2 % (81.9 % in aa). The phylogenetic analyses using cox1, ITS2 and combined cox1 + ITS2 sequences revealed close genetic interrelationship between A. tenuicollis and A. huronensis. Independently of a type of analysis and DNA region used, the topology of obtained trees was always identical; A. tenuicollis formed separate clade with A. huronensis forming a closely related sister group.

Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

PubMed

Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

2011-04-01

Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

Rondonin an antifungal peptide from spider (Acanthoscurria rondoniae) haemolymph

PubMed Central

Riciluca, K.C.T.; Sayegh, R.S.R.; Melo, R.L.; Silva, P.I.

2012-01-01

Antimicrobial activities were detected in the haemolymph of the spider Acanthoscurrria rondoniae. A novel antifungal peptide, rondonin, was purified by reverse phase high performance liquid chromatography (RP-HPLC). Rondonin has an amino acid sequence of IIIQYEGHKH and a molecular mass of 1236.776 Da. This peptide has identity to a C-terminal fragment of the “d” subunit of haemocyanin from the spiders Eurypelma californicum and Acanthoscurria gomesiana. A synthetic peptide mimicking rondonin had identical characteristics to those of the isolated material, confirming its sequence. The synthetic peptide was active only against fungus. These data led us to conclude that the antifungal activity detected in the plasma of these spiders is the result of enzymatic processing of a protein that delivers oxygen in the haemolymph of many chelicerate. Several studies have suggested that haemocyanins are involved in the arthropod immune system, and the activity of this haemocyanin fragment reinforces this idea. PMID:24371568

Comparative and Evolutionary Analyses of Meloidogyne spp. Based on Mitochondrial Genome Sequences

PubMed Central

García, Laura Evangelina; Sánchez-Puerta, M. Virginia

2015-01-01

Molecular taxonomy and evolution of nematodes have been recently the focus of several studies. Mitochondrial sequences were proposed as an alternative for precise identification of Meloidogyne species, to study intraspecific variability and to follow maternal lineages. We characterized the mitochondrial genomes (mtDNAs) of the root knot nematodes M. floridensis, M. hapla and M. incognita. These were AT rich (81–83%) and highly compact, encoding 12 proteins, 2 rRNAs, and 22 tRNAs. Comparisons with published mtDNAs of M. chitwoodi, M. incognita (another strain) and M. graminicola revealed that they share protein and rRNA gene order but differ in the order of tRNAs. The mtDNAs of M. floridensis and M. incognita were strikingly similar (97–100% identity for all coding regions). In contrast, M. floridensis, M. chitwoodi, M. hapla and M. graminicola showed 65–84% nucleotide identity for coding regions. Variable mitochondrial sequences are potentially useful for evolutionary and taxonomic studies. We developed a molecular taxonomic marker by sequencing a highly-variable ~2 kb mitochondrial region, nad5-cox1, from 36 populations of root-knot nematodes to elucidate relationships within the genus Meloidogyne. Isolates of five species formed monophyletic groups and showed little intraspecific variability. We also present a thorough analysis of the mitochondrial region cox2-rrnS. Phylogenies based on either mitochondrial region had good discrimination power but could not discriminate between M. arenaria, M. incognita and M. floridensis. PMID:25799071

NGS-based likelihood ratio for identifying contributors in two- and three-person DNA mixtures.

PubMed

Chan Mun Wei, Joshua; Zhao, Zicheng; Li, Shuai Cheng; Ng, Yen Kaow

2018-06-01

DNA fingerprinting, also known as DNA profiling, serves as a standard procedure in forensics to identify a person by the short tandem repeat (STR) loci in their DNA. By comparing the STR loci between DNA samples, practitioners can calculate a probability of match to identity the contributors of a DNA mixture. Most existing methods are based on 13 core STR loci which were identified by the Federal Bureau of Investigation (FBI). Analyses based on these loci of DNA mixture for forensic purposes are highly variable in procedures, and suffer from subjectivity as well as bias in complex mixture interpretation. With the emergence of next-generation sequencing (NGS) technologies, the sequencing of billions of DNA molecules can be parallelized, thus greatly increasing throughput and reducing the associated costs. This allows the creation of new techniques that incorporate more loci to enable complex mixture interpretation. In this paper, we propose a computation for likelihood ratio that uses NGS (next generation sequencing) data for DNA testing on mixed samples. We have applied the method to 4480 simulated DNA mixtures, which consist of various mixture proportions of 8 unrelated whole-genome sequencing data. The results confirm the feasibility of utilizing NGS data in DNA mixture interpretations. We observed an average likelihood ratio as high as 285,978 for two-person mixtures. Using our method, all 224 identity tests for two-person mixtures and three-person mixtures were correctly identified. Copyright © 2018 Elsevier Ltd. All rights reserved.

Computational Approaches for Decoding Select Odorant-Olfactory Receptor Interactions Using Mini-Virtual Screening

PubMed Central

Harini, K.; Sowdhamini, Ramanathan

2015-01-01

Olfactory receptors (ORs) belong to the class A G-Protein Coupled Receptor superfamily of proteins. Unlike G-Protein Coupled Receptors, ORs exhibit a combinatorial response to odors/ligands. ORs display an affinity towards a range of odor molecules rather than binding to a specific set of ligands and conversely a single odorant molecule may bind to a number of olfactory receptors with varying affinities. The diversity in odor recognition is linked to the highly variable transmembrane domains of these receptors. The purpose of this study is to decode the odor-olfactory receptor interactions using in silico docking studies. In this study, a ligand (odor molecules) dataset of 125 molecules was used to carry out in silico docking using the GLIDE docking tool (SCHRODINGER Inc Pvt LTD). Previous studies, with smaller datasets of ligands, have shown that orthologous olfactory receptors respond to similarly-tuned ligands, but are dramatically different in their efficacy and potency. Ligand docking results were applied on homologous pairs (with varying sequence identity) of ORs from human and mouse genomes and ligand binding residues and the ligand profile differed among such related olfactory receptor sequences. This study revealed that homologous sequences with high sequence identity need not bind to the same/ similar ligand with a given affinity. A ligand profile has been obtained for each of the 20 receptors in this analysis which will be useful for expression and mutation studies on these receptors. PMID:26221959

Prevalence and genetic characterization of eimeriid coccidia from feces of black-necked cranes, Grus nigricollis.

PubMed

Liang, Yu; Zhao, ZiJiao; Hu, JunJie; Esch, Gerald W; Peng, MingChun; Liu, Qiong; Chen, JinQing

2018-03-01

Disseminated visceral coccidiosis (DVC) is a widely distributed intestinal and extraintestinal disease of cranes caused by eimeriid coccidia and has lethal pathogenicity to several crane species. Here, feces of 164 black-necked cranes collected in Dashanbao Black-necked Crane National Nature Reserve, China, were examined to determine the prevalence of coccidial oocysts. Of the 164 fecal samples, 76 (46.3%) were positive for oocysts of Eimeria, including E. gruis in 59 (35.9%), E. reichenowi in 52 (31.7%), and E. bosquei in 47 (28.7%) by microscopic observation. Sixty-eight (89.5%) of these positive samples included two or more morphologically identifiable species of Eimeria. The nearly full length 18S rRNA gene (18S rRNA; about 1.8 kb) and partial mitochondrial cytochrome c oxidase I gene (COX1; about 1.3 kb) from oocysts of each morphologically distinct species of Eimeria were amplified, sequenced, and analyzed. BLAST searches using these new 18S rRNA sequences for E. gruis, E. reichenowi, or E. bosquei showed the most similar sequences were those of E. gruis (98.7-99.7% identity), E. reichenowi (97.9-100% identity), or E. gruis (98.6-99.6% identity) isolated from different species of Grus. BLAST searches using the new COX1 sequences for the three species of Eimeria showed that no nucleotide sequences of Eimeria and Isospora coccidia in GenBank have more than 83.0% identity with these species. Identities among the new COX1 sequences were 91.8% for E. gruis and E. reichenowi, 94.5% for E. gruis and E. bosquei, and 91.3% for E. reichenowi and E. bosquei. Phylogenetic analysis based on 18S rRNA or COX1 sequences indicated that Eimeria spp. in black-necked cranes were clustered together with other previously identified Eimeria species from different cranes.

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster

PubMed Central

Pool, John E.; Aquadro, Charles F.

2009-01-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kilobases upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony. PMID:17614900

Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

PubMed Central

Axelsen, Jacob Bock; Yan, Koon-Kiu; Maslov, Sergei

2007-01-01

Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw") duplication and deletion rates rdup∗, rdel∗ which include gene copies that will be removed soon after the duplication event and their dramatically reduced long-term counterparts rdup, rdel. High deletion rate among recently duplicated proteins is consistent with a scenario in which they didn't have enough time to significantly change their functional roles and thus are to a large degree disposable. Systematic trends of each of the four duplication/deletion rates with the total number of genes in the genome were analyzed. All but the deletion rate of recent duplicates rdel∗ were shown to systematically increase with Ngenes. Abnormally flat shapes of sequence identity histograms observed for yeast and human are consistent with lineages leading to these organisms undergoing one or more whole-genome duplications. This interpretation is corroborated by our analysis of the genome of Paramecium tetraurelia where the p-4 profile of the histogram is gradually restored by the successive removal of paralogs generated in its four known whole-genome duplication events. PMID:18039386

Metabolism of β-valine via a CoA-dependent ammonia lyase pathway.

PubMed

Otzen, Marleen; Crismaru, Ciprian G; Postema, Christiaan P; Wijma, Hein J; Heberling, Matthew M; Szymanski, Wiktor; de Wildeman, Stefaan; Janssen, Dick B

2015-11-01

Pseudomonas species strain SBV1 can rapidly grow on medium containing β-valine as a sole nitrogen source. The tertiary amine feature of β-valine prevents direct deamination reactions catalyzed by aminotransferases, amino acid dehydrogenases, and amino acid oxidases. However, lyase- or aminomutase-mediated conversions would be possible. To identify enzymes involved in the degradation of β-valine, a PsSBV1 gene library was prepared and used to complement the β-valine growth deficiency of a closely related Pseudomonas strain. This resulted in the identification of a gene encoding β-valinyl-coenzyme A ligase (BvaA) and two genes encoding β-valinyl-CoA ammonia lyases (BvaB1 and BvaB2). The BvaA protein demonstrated high sequence identity to several known phenylacetate CoA ligases. Purified BvaA enzyme did not convert phenyl acetic acid but was able to activate β-valine in an adenosine triphosphate (ATP)- and CoA-dependent manner. The substrate range of the enzyme appears to be narrow, converting only β-valine and to a lesser extent, 3-aminobutyrate and β-alanine. Characterization of BvaB1 and BvaB2 revealed that both enzymes were able to deaminate β-valinyl-CoA to produce 3-methylcrotonyl-CoA, a common intermediate in the leucine degradation pathway. Interestingly, BvaB1 and BvaB2 demonstrated no significant sequence identity to known CoA-dependent ammonia lyases, suggesting they belong to a new family of enzymes. BLAST searches revealed that BvaB1 and BvaB2 show high sequence identity to each other and to several enoyl-CoA hydratases, a class of enzymes that catalyze a similar reaction with water instead of amine as the leaving group.

High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain.

PubMed

Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; Velázquez, Encarna; Elia, Patrick; Tian, Rui; Ardley, Julie; Gollagher, Margaret; Seshadri, Rekha; Reddy, T B K; Ivanova, Natalia; Woyke, Tanja; Pati, Amrita; Markowitz, Victor; Baeshen, Mohamed N; Baeshen, Naseebh Nabeeh; Kyrpides, Nikos; Reeve, Wayne

2017-01-01

10.1601/nm.1335 Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata . This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here the features of 10.1601/nm.1335 Mlalz-1 are described, together with high-quality permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to 10.1601/nm.1335 10.1601/strainfinder?urlappend=%3Fid%3DIAM+12611 T , 10.1601/nm.1334 A 321 T and 10.1601/nm.17831 10.1601/strainfinder?urlappend=%3Fid%3DORS+1407 T , based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as 10.1601/nm.1335. Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata -nodulating 10.1601/nm.1328 strains, but ≤93% with nodC of 10.1601/nm.1328 strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced 10.1601/nm.1335 strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In 10.1601/nm.1334 strain 10.1601/strainfinder?urlappend=%3Fid%3DWSM+419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of 10.1601/nm.1334 strains, which suggests genetic recombination between strain Mlalz-1 and 10.1601/nm.1334 and the horizontal gene transfer of lpiA-acvB .

High-Level Diversity of Tailed Phages, Eukaryote-Associated Viruses, and Virophage-Like Elements in the Metaviromes of Antarctic Soils

PubMed Central

Zablocki, Olivier; van Zyl, Lonnie; Adriaenssens, Evelien M.; Rubagotti, Enrico; Tuffin, Marla; Cary, Stephen Craig

2014-01-01

The metaviromes of two distinct Antarctic hyperarid desert soil communities have been characterized. Hypolithic communities, cyanobacterium-dominated assemblages situated on the ventral surfaces of quartz pebbles embedded in the desert pavement, showed higher virus diversity than surface soils, which correlated with previous bacterial community studies. Prokaryotic viruses (i.e., phages) represented the largest viral component (particularly Mycobacterium phages) in both habitats, with an identical hierarchical sequence abundance of families of tailed phages (Siphoviridae > Myoviridae > Podoviridae). No archaeal viruses were found. Unexpectedly, cyanophages were poorly represented in both metaviromes and were phylogenetically distant from currently characterized cyanophages. Putative phage genomes were assembled and showed a high level of unaffiliated genes, mostly from hypolithic viruses. Moreover, unusual gene arrangements in which eukaryotic and prokaryotic virus-derived genes were found within identical genome segments were observed. Phycodnaviridae and Mimiviridae viruses were the second-most-abundant taxa and more numerous within open soil. Novel virophage-like sequences (within the Sputnik clade) were identified. These findings highlight high-level virus diversity and novel species discovery potential within Antarctic hyperarid soils and may serve as a starting point for future studies targeting specific viral groups. PMID:25172856

Cloning, sequencing, and expression of the Zymomonas mobilis phosphoglycerate mutase gene (pgm) in Escherichia coli.

PubMed Central

Yomano, L P; Scopes, R K; Ingram, L O

1993-01-01

Phosphoglycerate mutase is an essential glycolytic enzyme for Zymomonas mobilis, catalyzing the reversible interconversion of 3-phosphoglycerate and 2-phosphoglycerate. The pgm gene encoding this enzyme was cloned on a 5.2-kbp DNA fragment and expressed in Escherichia coli. Recombinants were identified by using antibodies directed against purified Z. mobilis phosphoglycerate mutase. The pgm gene contains a canonical ribosome-binding site, a biased pattern of codon usage, a long upstream untranslated region, and four promoters which share sequence homology. Interestingly, adhA and a D-specific 2-hydroxyacid dehydrogenase were found on the same DNA fragment and appear to form a cluster of genes which function in central metabolism. The translated sequence for Z. mobilis pgm was in full agreement with the 40 N-terminal amino acid residues determined by protein sequencing. The primary structure of the translated sequence is highly conserved (52 to 60% identity with other phosphoglycerate mutases) and also shares extensive homology with bisphosphoglycerate mutases (51 to 59% identity). Since Southern blots indicated the presence of only a single copy of pgm in the Z. mobilis chromosome, it is likely that the cloned pgm gene functions to provide both activities. Z. mobilis phosphoglycerate mutase is unusual in that it lacks the flexible tail and lysines at the carboxy terminus which are present in the enzyme isolated from all other organisms examined. Images PMID:8320209

Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

EPA Science Inventory

The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Frequent detection and characterization of hepatitis E virus variants in wild rats (Rattus rattus) in Indonesia.

PubMed

Mulyanto; Depamede, Sulaiman Ngongu; Sriasih, Made; Takahashi, Masaharu; Nagashima, Shigeo; Jirintai, Suljid; Nishizawa, Tsutomu; Okamoto, Hiroaki

2013-01-01

One hundred sixteen rats (Rattus rattus) captured in Indonesia from 2011 to 2012 were investigated for the prevalence of hepatitis E virus (HEV)-specific antibodies and HEV RNA. Using an ELISA based on HEV genotype 4 with an ad hoc cutoff value of 0.500, 18.1 % of the rats tested positive for anti-HEV IgG. By nested RT-PCR, 14.7 % of the rats had rat HEV RNA, and none were positive for HEV genotype 1-4. A high HEV prevalence among rats was associated with lower sanitary conditions in areas with a high population density. Sixteen of the 17 HEV isolates obtained from infected rats showed >93.0 % nucleotide sequence identity within the 840-nucleotide ORF1-ORF2 sequence and were most closely related to a Vietnamese strain (85.9-87.9 % identity), while the remaining isolate differed from known rat HEV strains by 18.8-23.3 % and may belong to a novel lineage of rat HEV. These results suggest a wide distribution of rat HEV with divergent genomes.

Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

PubMed

Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

2009-01-01

Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

PubMed

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.

PSS-3D1D: an improved 3D1D profile method of protein fold recognition for the annotation of twilight zone sequences.

PubMed

Ganesan, K; Parthasarathy, S

2011-12-01

Annotation of any newly determined protein sequence depends on the pairwise sequence identity with known sequences. However, for the twilight zone sequences which have only 15-25% identity, the pair-wise comparison methods are inadequate and the annotation becomes a challenging task. Such sequences can be annotated by using methods that recognize their fold. Bowie et al. described a 3D1D profile method in which the amino acid sequences that fold into a known 3D structure are identified by their compatibility to that known 3D structure. We have improved the above method by using the predicted secondary structure information and employ it for fold recognition from the twilight zone sequences. In our Protein Secondary Structure 3D1D (PSS-3D1D) method, a score (w) for the predicted secondary structure of the query sequence is included in finding the compatibility of the query sequence to the known fold 3D structures. In the benchmarks, the PSS-3D1D method shows a maximum of 21% improvement in predicting correctly the α + β class of folds from the sequences with twilight zone level of identity, when compared with the 3D1D profile method. Hence, the PSS-3D1D method could offer more clues than the 3D1D method for the annotation of twilight zone sequences. The web based PSS-3D1D method is freely available in the PredictFold server at http://bioinfo.bdu.ac.in/servers/ .

Phylogenetic analysis of porcine reproductive and respiratory syndrome virus isolates from Northern Ireland.

PubMed

Smith, Natalie; Power, Ultan F; McKillen, John

2018-05-29

To investigate the genetic diversity of porcine reproductive and respiratory syndrome virus (PRRSV) in Northern Ireland, the ORF5 gene from nine field isolates was sequenced and phylogenetically analysed. The results revealed relatively high diversity amongst isolates, with 87.6-92.2% identity between farms at the nucleotide level and 84.1-93.5% identity at the protein level. Phylogenetic analysis confirmed that all nine isolates belonged to the European (type 1) genotype and formed a cluster within the subtype 1 subgroup. This study provides the first report on PRRSV isolate diversity in Northern Ireland.

Carbohydrate degrading polypeptide and uses thereof

DOEpatents

Sagt, Cornelis Maria Jacobus; Schooneveld-Bergmans, Margot Elisabeth Francoise; Roubos, Johannes Andries; Los, Alrik Pieter

2015-10-20

The invention relates to a polypeptide having carbohydrate material degrading activity which comprises the amino acid sequence set out in SEQ ID NO: 2 or an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 4, or a variant polypeptide or variant polynucleotide thereof, wherein the variant polypeptide has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2 or the variant polynucleotide encodes a polypeptide that has at least 96% sequence identity with the sequence set out in SEQ ID NO: 2. The invention features the full length coding sequence of the novel gene as well as the amino acid sequence of the full-length functional protein and functional equivalents of the gene or the amino acid sequence. The invention also relates to methods for using the polypeptide in industrial processes. Also included in the invention are cells transformed with a polynucleotide according to the invention suitable for producing these proteins.

High-throughput sequencing of TCR repertoires in multiple sclerosis reveals intrathecal enrichment of EBV-reactive CD8+ T cells.

PubMed

Lossius, Andreas; Johansen, Jorunn N; Vartdal, Frode; Robins, Harlan; Jūratė Šaltytė, Benth; Holmøy, Trygve; Olweus, Johanna

2014-11-01

Epstein-Barr virus (EBV) has long been suggested as a pathogen in multiple sclerosis (MS). Here, we used high-throughput sequencing to determine the diversity, compartmentalization, persistence, and EBV-reactivity of the T-cell receptor (TCR) repertoires in MS. TCR-β genes were sequenced in paired samples of cerebrospinal fluid (CSF) and blood from patients with MS and controls with other inflammatory neurological diseases. The TCR repertoires were highly diverse in both compartments and patient groups. Expanded T-cell clones, represented by TCR-β sequences >0.1%, were of different identity in CSF and blood of MS patients, and persisted for more than a year. Reference TCR-β libraries generated from peripheral blood T cells reactive against autologous EBV-transformed B cells were highly enriched for public EBV-specific sequences and were used to quantify EBV-reactive TCR-β sequences in CSF. TCR-β sequences of EBV-reactive CD8+ T cells, including several public EBV-specific sequences, were intrathecally enriched in MS patients only, whereas those of EBV-reactive CD4+ T cells were also enriched in CSF of controls. These data provide evidence for a clonally diverse, yet compartmentalized and persistent, intrathecal T-cell response in MS. The presented strategy links TCR sequence to intrathecal T-cell specificity, demonstrating enrichment of EBV-reactive CD8+ T cells in MS. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

PubMed

Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

2016-01-01

The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

NASA Astrophysics Data System (ADS)

Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

2018-03-01

It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

Quaranfil, Johnston Atoll, and Lake Chad viruses are novel members of the family Orthomyxoviridae.

PubMed

Presti, Rachel M; Zhao, Guoyan; Beatty, Wandy L; Mihindukulasuriya, Kathie A; da Rosa, Amelia P A Travassos; Popov, Vsevolod L; Tesh, Robert B; Virgin, Herbert W; Wang, David

2009-11-01

Arboviral infections are an important cause of emerging infections due to the movements of humans, animals, and hematophagous arthropods. Quaranfil virus (QRFV) is an unclassified arbovirus originally isolated from children with mild febrile illness in Quaranfil, Egypt, in 1953. It has subsequently been isolated in multiple geographic areas from ticks and birds. We used high-throughput sequencing to classify QRFV as a novel orthomyxovirus. The genome of this virus is comprised of multiple RNA segments; five were completely sequenced. Proteins with limited amino acid similarity to conserved domains in polymerase (PA, PB1, and PB2) and hemagglutinin (HA) genes from known orthomyxoviruses were predicted to be present in four of the segments. The fifth sequenced segment shared no detectable similarity to any protein and is of uncertain function. The end-terminal sequences of QRFV are conserved between segments and are different from those of the known orthomyxovirus genera. QRFV is known to cross-react serologically with two other unclassified viruses, Johnston Atoll virus (JAV) and Lake Chad virus (LKCV). The complete open reading frames of PB1 and HA were sequenced for JAV, while a fragment of PB1 of LKCV was identified by mass sequencing. QRFV and JAV PB1 and HA shared 80% and 70% amino acid identity to each other, respectively; the LKCV PB1 fragment shared 83% amino acid identity with the corresponding region of QRFV PB1. Based on phylogenetic analyses, virion ultrastructural features, and the unique end-terminal sequences identified, we propose that QRFV, JAV, and LKCV comprise a novel genus of the family Orthomyxoviridae.

Quaranfil, Johnston Atoll, and Lake Chad Viruses Are Novel Members of the Family Orthomyxoviridae▿

PubMed Central

Presti, Rachel M.; Zhao, Guoyan; Beatty, Wandy L.; Mihindukulasuriya, Kathie A.; Travassos da Rosa, Amelia P. A.; Popov, Vsevolod L.; Tesh, Robert B.; Virgin, Herbert W.; Wang, David

2009-01-01

Arboviral infections are an important cause of emerging infections due to the movements of humans, animals, and hematophagous arthropods. Quaranfil virus (QRFV) is an unclassified arbovirus originally isolated from children with mild febrile illness in Quaranfil, Egypt, in 1953. It has subsequently been isolated in multiple geographic areas from ticks and birds. We used high-throughput sequencing to classify QRFV as a novel orthomyxovirus. The genome of this virus is comprised of multiple RNA segments; five were completely sequenced. Proteins with limited amino acid similarity to conserved domains in polymerase (PA, PB1, and PB2) and hemagglutinin (HA) genes from known orthomyxoviruses were predicted to be present in four of the segments. The fifth sequenced segment shared no detectable similarity to any protein and is of uncertain function. The end-terminal sequences of QRFV are conserved between segments and are different from those of the known orthomyxovirus genera. QRFV is known to cross-react serologically with two other unclassified viruses, Johnston Atoll virus (JAV) and Lake Chad virus (LKCV). The complete open reading frames of PB1 and HA were sequenced for JAV, while a fragment of PB1 of LKCV was identified by mass sequencing. QRFV and JAV PB1 and HA shared 80% and 70% amino acid identity to each other, respectively; the LKCV PB1 fragment shared 83% amino acid identity with the corresponding region of QRFV PB1. Based on phylogenetic analyses, virion ultrastructural features, and the unique end-terminal sequences identified, we propose that QRFV, JAV, and LKCV comprise a novel genus of the family Orthomyxoviridae. PMID:19726499

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Integrative revision of the giant pill-millipede genus Sphaeromimus from Madagascar, with the description of seven new species (Diplopoda, Sphaerotheriida, Arthrosphaeridae)

PubMed Central

Wesener, Thomas; Le, Daniel Minh-Tu; Loria, Stephanie F.

2014-01-01

Abstract The Malagasy giant pill-millipede genus Sphaeromimus de Saussure & Zehntner, 1902 is revised. Seven new species, S. titanus sp. n., S. vatovavy sp. n., S. lavasoa sp. n., S. andohahela sp. n., S. ivohibe sp. n., S. saintelucei sp. n., and S. andrahomana sp. n. were discovered, in one case with the help of sequence data, in the rainforests of southeastern Madagascar. The species are described using light- and scanning electron microscopy. A key to all 10 species of the genus is presented. All but one (S. andohahela) of the newly discovered species are microendemics each occurring in isolated forest fragments. The mitochondrial COI barcoding gene was amplified and sequenced for 18 Sphaeromimus specimens, and a dataset containing COI sequences of 28 specimens representing all Sphaeromimus species (except S. vatovavy) was analyzed. All species are genetically monophyletic. Interspecific uncorrected genetic distances were moderate (4–10%) to high (18–25%), whereas intraspecific variation is low (0–3.5%). Sequence data allowed the correct identification of three colour morphs of S. musicus, as well as the identity of a cave specimen, which although aberrant in its morphology and colouration, was genetically identical to the holotype of S. andrahoma. PMID:25009417

[Molecular epidemiological analysis of rubella virus isolates from 2001 to 2011 in Shanghai, China].

PubMed

Li, Chong-Shan; Yang, Yu-Ying; Wang, Jian-Guo; Zhu, Zhen; Tang, Wei; Li, Zhi; Sun, Xiao-Dong; Xu, Wen-Bo

2012-03-01

Throat swabs collected from patients whose serum was measles IgM negative and rubella IgM positive during 2001-2011 were used to conduct cell culture for rubella virus. After identification of cell culture with RT-PCR, nucleotide of gene E1 of rubella virus was amplified and sequenced, followed by molecular epidemiological analysis. A total of 31 rubella viruses were isolated from 60 throat swabs. Compared 27 isolates with the WHO reference strains of all genotypes, phylogenetic tree was constructed based on the amplified 739 nucleotide fragment. These isolates belonged to two different genotypes respectively. Isolates 11009, 11052 and 11106 in 2011 belonged to genotype 2B, and others belonged to genotype 1E. Most of mutations were nonsense mutation, and sequence of amino acid was highly conserved. Amino acid sequence of most isolates of genotype 1E was identical, which suggested rubella viruses from same transmission chain might be transmitted continually since 2001. Rubella virus genotype 2B was found to be popular for the first time in Shanghai in 2011. The nucleotide sequences of these genotype 2B isolates showed 99% identity compared with that of isolates recently from Vietnam, Japan and Argentina. The resources of these strains were not confirmed due to the absence of rubella virus surveillance before.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout

USGS Publications Warehouse

Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.

2010-01-01

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

The perils of pathogen discovery: origin of a novel parvovirus-like hybrid genome traced to nucleic acid extraction spin columns.

PubMed

Naccache, Samia N; Greninger, Alexander L; Lee, Deanna; Coffey, Lark L; Phan, Tung; Rein-Weston, Annie; Aronsohn, Andrew; Hackett, John; Delwart, Eric L; Chiu, Charles Y

2013-11-01

Next-generation sequencing was used for discovery and de novo assembly of a novel, highly divergent DNA virus at the interface between the Parvoviridae and Circoviridae. The virus, provisionally named parvovirus-like hybrid virus (PHV), is nearly identical by sequence to another DNA virus, NIH-CQV, previously detected in Chinese patients with seronegative (non-A-E) hepatitis. Although we initially detected PHV in a wide range of clinical samples, with all strains sharing ∼99% nucleotide and amino acid identity with each other and with NIH-CQV, the exact origin of the virus was eventually traced to contaminated silica-binding spin columns used for nucleic acid extraction. Definitive confirmation of the origin of PHV, and presumably NIH-CQV, was obtained by in-depth analyses of water eluted through contaminated spin columns. Analysis of environmental metagenome libraries detected PHV sequences in coastal marine waters of North America, suggesting that a potential association between PHV and diatoms (algae) that generate the silica matrix used in the spin columns may have resulted in inadvertent viral contamination during manufacture. The confirmation of PHV/NIH-CQV as laboratory reagent contaminants and not bona fide infectious agents of humans underscores the rigorous approach needed to establish the validity of new viral genomes discovered by next-generation sequencing.

Applying the Concept of Peptide Uniqueness to Anti-Polio Vaccination

PubMed Central

Kanduc, Darja; Fasano, Candida; Capone, Giovanni; Pesce Delfino, Antonella; Calabrò, Michele; Polimeno, Lorenzo

2015-01-01

Background. Although rare, adverse events may associate with anti-poliovirus vaccination thus possibly hampering global polio eradication worldwide. Objective. To design peptide-based anti-polio vaccines exempt from potential cross-reactivity risks and possibly able to reduce rare potential adverse events such as the postvaccine paralytic poliomyelitis due to the tendency of the poliovirus genome to mutate. Methods. Proteins from poliovirus type 1, strain Mahoney, were analyzed for amino acid sequence identity to the human proteome at the pentapeptide level, searching for sequences that (1) have zero percent of identity to human proteins, (2) are potentially endowed with an immunologic potential, and (3) are highly conserved among poliovirus strains. Results. Sequence analyses produced a set of consensus epitopic peptides potentially able to generate specific anti-polio immune responses exempt from cross-reactivity with the human host. Conclusion. Peptide sequences unique to poliovirus proteins and conserved among polio strains might help formulate a specific and universal anti-polio vaccine able to react with multiple viral strains and exempt from the burden of possible cross-reactions with human proteins. As an additional advantage, using a peptide-based vaccine instead of current anti-polio DNA vaccines would eliminate the rare post-polio poliomyelitis cases and other disabling symptoms that may appear following vaccination. PMID:26568962

Group 10 allergens (tropomyosins) from house-dust mites may cause covariation of sensitization to allergens from other invertebrates

PubMed Central

Inam, Muhammad; Ismail, Muhammad; Chaudhary, Farhana Riaz

2012-01-01

Group 10 allergens (tropomyosins) have been assumed to be a major cause of cross-reactivity between house-dust mites (HDMs) and other invertebrates. Despite all of the published data regarding the epidemiology, percent IgE binding and level of sensitization in the population, the role of tropomyosin as a cross-reactive allergen in patients with multiple allergy syndrome still remains to be elucidated. Homology between amino acid sequences reported in allergen databases of selected invertebrate tropomyosins was determined with Der f 10 as the reference allergen. The 66.9 and 54.4% identities were found with selected crustacean and insect species, respectively, whereas only 20.4% identity was seen with mollusks. A similar analysis was performed using reported B-cell IgE-binding epitopes from Met e1 (shrimp allergen) and Bla g7 (cockroach allergen) with other invertebrate tropomyosins. The percent identity in linear sequences was higher than 35% in mites, crustaceans, and cockroaches. The polar and hydrophobic regions in these groups were highly conserved. These findings suggest that tropomyosin may be a major cause of covariation of sensitization between HDMs, crustaceans, and some species of insects and mollusks. PMID:23342293

Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

PubMed

Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

1997-06-15

We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

Massively parallel sequencing of 68 insertion/deletion markers identifies novel microhaplotypes for utility in human identity testing.

PubMed

Wendt, Frank R; Warshauer, David H; Zeng, Xiangpei; Churchill, Jennifer D; Novroski, Nicole M M; Song, Bing; King, Jonathan L; LaRue, Bobby L; Budowle, Bruce

2016-11-01

Short tandem repeat (STR) loci are the traditional markers used for kinship, missing persons, and direct comparison human identity testing. These markers hold considerable value due to their highly polymorphic nature, amplicon size, and ability to be multiplexed. However, many STRs are still too large for use in analysis of highly degraded DNA. Small bi-allelic polymorphisms, such as insertions/deletions (INDELs), may be better suited for analyzing compromised samples, and their allele size differences are amenable to analysis by capillary electrophoresis. The INDEL marker allelic states range in size from 2 to 6 base pairs, enabling small amplicon size. In addition, heterozygote balance may be increased by minimizing preferential amplification of the smaller allele, as is more common with STR markers. Multiplexing a large number of INDELs allows for generating panels with high discrimination power. The Nextera™ Rapid Capture Custom Enrichment Kit (Illumina, Inc., San Diego, CA) and massively parallel sequencing (MPS) on the Illumina MiSeq were used to sequence 68 well-characterized INDELs in four major US population groups. In addition, the STR Allele Identification Tool: Razor (STRait Razor) was used in a novel way to analyze INDEL sequences and detect adjacent single nucleotide polymorphisms (SNPs) and other polymorphisms. This application enabled the discovery of unique allelic variants, which increased the discrimination power and decreased the single-locus random match probabilities (RMPs) of 22 of these well-characterized INDELs which can be considered as microhaplotypes. These findings suggest that additional microhaplotypes containing human identification (HID) INDELs may exist elsewhere in the genome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Classification of Fowl Adenovirus Serotypes by Use of High-Resolution Melting-Curve Analysis of the Hexon Gene Region▿

PubMed Central

Steer, Penelope A.; Kirkpatrick, Naomi C.; O'Rourke, Denise; Noormohammadi, Amir H.

2009-01-01

Identification of fowl adenovirus (FAdV) serotypes is of importance in epidemiological studies of disease outbreaks and the adoption of vaccination strategies. In this study, real-time PCR and subsequent high-resolution melting (HRM)-curve analysis of three regions of the hexon gene were developed and assessed for their potential in differentiating 12 FAdV reference serotypes. The results were compared to previously described PCR and restriction enzyme analyses of the hexon gene. Both HRM-curve analysis of a 191-bp region of the hexon gene and restriction enzyme analysis failed to distinguish a number of serotypes used in this study. In addition, PCR of the region spanning nucleotides (nt) 144 to 1040 failed to amplify FAdV-5 in sufficient quantities for further analysis. However, HRM-curve analysis of the region spanning nt 301 to 890 proved a sensitive and specific method of differentiating all 12 serotypes. All melt curves were highly reproducible, and replicates of each serotype were correctly genotyped with a mean confidence value of more than 99% using normalized HRM curves. Sequencing analysis revealed that each profile was related to a unique sequence, with some sequences sharing greater than 94% identity. Melting-curve profiles were found to be related mainly to GC composition and distribution throughout the amplicons, regardless of sequence identity. The results presented in this study show that the closed-tube method of PCR and HRM-curve analysis provides an accurate, rapid, and robust genotyping technique for the identification of FAdV serotypes and can be used as a model for developing genotyping techniques for other pathogens. PMID:19036935

Low-pathogenic influenza A viruses in North American diving ducks contribute to the emergence of a novel highly pathogenic influenza A(H7N8) virus

USGS Publications Warehouse

Xu, Yifei; Ramey, Andrew M.; Bowman, Andrew S; DeLiberto, Thomas J.; Killian, Mary Lea; Krauss, Scott; Nolting, Jacqueline M.; Torchetti, Mia Kim; Reeves, Andrew B.; Webby, Richard J.; Stallknecht, David E.; Wan, Xiu-Feng

2017-01-01

Introductions of low-pathogenic avian influenza (LPAI) viruses of subtypes H5 and H7 into poultry from wild birds have the potential to mutate to highly pathogenic avian influenza (HPAI) viruses, but such viruses' origins are often unclear. In January 2016, a novel H7N8 HPAI virus caused an outbreak in turkeys in Indiana, USA. To determine the virus's origin, we sequenced the genomes of 441 wild-bird origin influenza A viruses (IAVs) from North America and subjected them to evolutionary analyses. The results showed that the H7N8 LPAI virus most likely circulated among diving ducks in the Mississippi flyway during autumn 2015 and was subsequently introduced to Indiana turkeys, in which it evolved high pathogenicity. Preceding the outbreak, an isolate with six gene segments (PB2, PB1, PA, HA, NA, and NS) sharing >99% sequence identity with those of H7N8 turkey isolates was recovered from a diving duck sampled in Kentucky, USA. H4N8 IAVs from other diving ducks possessed five H7N8-like gene segments (PB2, PB1, NA, MP, and NS; >98% sequence identity). Our findings suggest that viral gene constellations circulating among diving ducks can contribute to the emergence of IAVs that affect poultry. Therefore, diving ducks may serve an important and understudied role in the maintenance, diversification, and transmission of IAVs in the wild-bird reservoir.

Evidence for Widespread Reticulate Evolution within Human Duplicons

PubMed Central

Jackson, Michael S. ; Oliver, Karen ; Loveland, Jane ; Humphray, Sean ; Dunham, Ian ; Rocchi, Mariano ; Viggiano, Luigi ; Park, Jonathan P. ; Hurles, Matthew E. ; Santibanez-Koref, Mauro 

2005-01-01

Approximately 5% of the human genome consists of segmental duplications that can cause genomic mutations and may play a role in gene innovation. Reticulate evolutionary processes, such as unequal crossing-over and gene conversion, are known to occur within specific duplicon families, but the broader contribution of these processes to the evolution of human duplications remains poorly characterized. Here, we use phylogenetic profiling to analyze multiple alignments of 24 human duplicon families that span >8 Mb of DNA. Our results indicate that none of them are evolving independently, with all alignments showing sharp discontinuities in phylogenetic signal consistent with reticulation. To analyze these results in more detail, we have developed a quartet method that estimates the relative contribution of nucleotide substitution and reticulate processes to sequence evolution. Our data indicate that most of the duplications show a highly significant excess of sites consistent with reticulate evolution, compared with the number expected by nucleotide substitution alone, with 15 of 30 alignments showing a >20-fold excess over that expected. Using permutation tests, we also show that at least 5% of the total sequence shares 100% sequence identity because of reticulation, a figure that includes 74 independent tracts of perfect identity >2 kb in length. Furthermore, analysis of a subset of alignments indicates that the density of reticulation events is as high as 1 every 4 kb. These results indicate that phylogenetic relationships within recently duplicated human DNA can be rapidly disrupted by reticulate evolution. This finding has important implications for efforts to finish the human genome sequence, complicates comparative sequence analysis of duplicon families, and could profoundly influence the tempo of gene-family evolution. PMID:16252241

Single sea urchin phagocytes express messages of a single sequence from the diverse Sp185/333 gene family in response to bacterial challenge.

PubMed

Majeske, Audrey J; Oren, Matan; Sacchi, Sandro; Smith, L Courtney

2014-12-01

Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (±10) members per genome that share a basic gene structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements. The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333 gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of immune response genes in single cells has not been identified previously in other invertebrates. Copyright © 2014 by The American Association of Immunologists, Inc.

Infection of Taenia asiatica in a Bai Person in Dali, China.

PubMed

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-02-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica.

Infection of Taenia asiatica in a Bai Person in Dali, China

PubMed Central

Wang, Li; Luo, Xuenong; Hou, Junling; Guo, Aijiang; Zhang, Shaohua; Li, Hailong; Cai, Xuepeng

2016-01-01

We report here a human case of Taenia asiatica infection which was confirmed by genetic analyses in Dali, China. A patient was found to have symptoms of taeniasis with discharge of tapeworm proglottids. By sequencing of the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene, we observed nucleotide sequence identity of 99% with T. asiatica and 96% with T. saginata. Using the cytochrome b (cytb) gene, 99% identity with T. asiatica and 96% identity with T. saginata were found. Our findings suggest that taeniasis of people in Dali, China may be mainly caused by T. asiatica. PMID:26951981

Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

USGS Publications Warehouse

Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

2011-01-01

Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

Precursors of vertebrate peptide antibiotics dermaseptin b and adenoregulin have extensive sequence identities with precursors of opioid peptides dermorphin, dermenkephalin, and deltorphins.

PubMed

Amiche, M; Ducancel, F; Mor, A; Boulain, J C; Menez, A; Nicolas, P

1994-07-08

The dermaseptins are a family of broad spectrum antimicrobial peptides, 27-34 amino acids long, involved in the defense of the naked skin of frogs against microbial invasion. They are the first vertebrate peptides to show lethal effects against the filamentous fungi responsible for severe opportunistic infections accompanying immunodeficiency syndrome and the use of immunosuppressive agents. A cDNA library was constructed from skin poly(A+) RNA of the arboreal frog Phyllomedusa bicolor and screened with an oligonucleotide probe complementary to the COOH terminus of dermaseptin b. Several clones contained a full-length DNA copy of a 443-nucleotide mRNA that encoded a 78-residue dermaseptin b precursor protein. The deduced precursor contained a putative signal sequence at the NH2 terminus, a 20-residue spacer sequence extremely rich (60%) in glutamic and aspartic acids, and a single copy of a dermaseptin b progenitor sequence at the COOH terminus. One clone contained a complete copy of adenoregulin, a 33-residue peptide reported to enhance the binding of agonists to the A1 adenosine receptor. The mRNAs encoding adenoregulin and dermaseptin b were very similar: 70 and 75% nucleotide identities between the 5'- and 3'-untranslated regions, respectively; 91% amino acid identity between the signal peptides; 82% identity between the acidic spacer sequences; and 38% identity between adenoregulin and dermaseptin b. Because adenoregulin and dermaseptin b have similar precursor designs and antimicrobial spectra, adenoregulin should be considered as a new member of the dermaseptin family and alternatively named dermaseptin b II. Preprodermaseptin b and preproadenoregulin have considerable sequence identities to the precursors encoding the opioid heptapeptides dermorphin, dermenkephalin, and deltorphins. This similarity extended into the 5'-untranslated regions of the mRNAs. These findings suggest that the genes encoding the four preproproteins are all members of the same family despite the fact that they encode end products having very different biological activities. These genes might contain a homologous export exon comprising the 5'-untranslated region, the 22-residue signal peptide, the 20-24-residue acidic spacer, and the basic pair Lys-Arg.

galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

PubMed

Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

2004-06-12

The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

Application of Genotyping during an Extensive Outbreak of Waterborne Giardiasis in Bergen, Norway, during Autumn and Winter 2004†

PubMed Central

Robertson, L. J.; Hermansen, L.; Gjerde, B. K.; Strand, E.; Alvsvåg, J. O.; Langeland, N.

2006-01-01

During the autumn and winter of 2004 and 2005, an extensive outbreak of waterborne giardiasis occurred in Bergen, Norway. Over 1,500 patients were diagnosed with giardiasis. Analysis of water from the implicated source revealed low numbers of Giardia cysts, but the initial contamination event probably occurred up to 10 weeks previously. While sewage leakage from a residential area is now considered to be the probable source of contamination, during the episode waste from one particular septic tank was thought to be a possible source. Genotyping of cysts from the septic tank demonstrated that they were assemblage A cysts, although the sequences were not identical to any previously published sequences. For the β-giardin gene, the closest published subgenotype was subgenotype A3; for the gdh gene, the closest published subgenotype was subgenotype A2. Genotyping of cysts from 21 patient samples revealed that they were assemblage B cysts; thus, the septic tank was unlikely to be the contamination source. Sequencing of the β-giardin and gdh genes from patient samples and a comparison of the sequences gave complex results. For the β-giardin gene, three isolates had sequences identical to subgenotype B3 sequences. However, other isolates had between one and four single-nucleotide polymorphisms (SNPs). For the gdh gene, none of the sequences were identical to the sequence published for subgenotype B3, and the sequences had between one and three SNPs. One isolate, which was identical to subgenotype B3 at the β-giardin gene, was more similar to subgenotype B2 at the gdh gene. Grouping the isolates on the basis of SNPs resulted in different groups for the two genes. The results are discussed in relation to giardiasis in Norway and to other Giardia genotyping studies. PMID:16517674

Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina.

PubMed

Valles, Steven M; Porter, Sanford D; Calcaterra, Luis A

2018-01-01

Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations.

Sequence analysis of porcine kobuvirus VP1 region detected in pigs in Japan and Thailand.

PubMed

Okitsu, Shoko; Khamrin, Pattara; Thongprachum, Aksara; Hidaka, Satoshi; Kongkaew, Sompreeya; Kongkaew, Apisek; Maneekarn, Niwat; Mizuguchi, Masashi; Hayakawa, Satoshi; Ushijima, Hiroshi

2012-04-01

Porcine kobuvirus is a new candidate species of the genus Kobuvirus in the family Picornaviridae, and information is still limited. The identification of porcine kobuvirus has been performed by the sequence analyses of the 3D region of the viruses. Therefore, the purpose of this study was to characterize the molecular properties of VP1 nucleotide sequences of the porcine kobuviruses isolated from porcine stool samples in Japan during 2009 and Thailand between 2006 and 2008. In addition, previous identification of a unique porcine kobuvirus; Japanese H023/2009/JP, which is a bovine kobuvirus-like strain based on sequence analysis of the 3D region, was also included in this study. All of the strains were amplified by the VP1-specific primer pair: the amplicons were subjected to direct sequencing and compared with the VP1 nucleotide sequences of reference strains. The VP1 sequences of strains from the GenBank database revealed high nucleotide sequence identity at 84.3-100%. On the other hand, the nucleotide identities among the 15 porcine kobuvirus strains analyzed in this study ranged from 78.8 to 99.8%. The results revealed that diversity of the strains in this study were higher than those of the strains in previous studies. Furthermore, it was found that the VP1 region of the bovine kobuvirus-like strain, H023/2009/JP, clustered with nine porcine kobuvirus strains that were isolated in Thailand and Japan. Since this strain was previously found to be closely related to bovine kobuviruses in the 3D gene region, it may be a natural recombinant.

Prospecting for viral natural enemies of the fire ant Solenopsis invicta in Argentina

PubMed Central

Porter, Sanford D.; Calcaterra, Luis A.

2018-01-01

Metagenomics and next generation sequencing were employed to discover new virus natural enemies of the fire ant, Solenopsis invicta Buren in its native range (i.e., Formosa, Argentina) with the ultimate goal of testing and releasing new viral pathogens into U.S. S. invicta populations to provide natural, sustainable control of this ant. RNA was purified from worker ants from 182 S. invicta colonies, which was pooled into 4 groups according to location. A library was created from each group and sequenced using Illumina Miseq technology. After a series of winnowing methods to remove S. invicta genes, known S. invicta virus genes, and all other non-virus gene sequences, 61,944 unique singletons were identified with virus identity. These were assembled de novo yielding 171 contiguous sequences with significant identity to non-plant virus genes. Fifteen contiguous sequences exhibited very high expression rates and were detected in all four gene libraries. One contig (Contig_29) exhibited the highest expression level overall and across all four gene libraries. Random amplification of cDNA ends analyses expanded this contiguous sequence yielding a complete virus genome, which we have provisionally named Solenopsis invicta virus 5 (SINV-5). SINV-5 is a positive-sense, single-stranded RNA virus with genome characteristics consistent with insect-infecting viruses from the family Dicistroviridae. Moreover, the replicative genome strand of SINV-5 was detected in worker ants indicating that S. invicta serves as host for the virus. Many additional sequences were identified that are likely of viral origin. These sequences await further investigation to determine their origins and relationship with S. invicta. This study expands knowledge of the RNA virome diversity found within S. invicta populations. PMID:29466388

Microbial genomic taxonomy

PubMed Central

2013-01-01

A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132

Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman

PubMed Central

Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid

2012-01-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

PubMed Central

Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

1991-01-01

The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

Molecular characterization of the full-length L and M RNAs of Tomato yellow ring virus, a member of the genus Tospovirus.

PubMed

Chen, Tsung-Chi; Li, Ju-Ting; Fan, Ya-Shu; Yeh, Yi-Chun; Yeh, Shyi-Dong; Kormelink, Richard

2013-06-01

Tomato yellow ring virus (TYRV), first isolated from tomato in Iran, was classified as a non-approved species of the genus Tospovirus based on the characterization of its genomic S RNA. In the current study, the complete sequences of the genomic L and M RNAs of TYRV were determined and analyzed. The L RNA has 8,877 nucleotides (nt) and codes in the viral complementary (vc) strand for the putative RNA-dependent RNA polymerase (RdRp) of 2,873 amino acids (aa) (331 kDa). The RdRp of TYRV shares the highest aa sequence identity (88.7 %) with that of Iris yellow spot virus (IYSV), and contains conserved motifs shared with those of the animal-infecting bunyaviruses. The M RNA contains 4,786 nt and codes in ambisense arrangement for the NSm protein of 308 aa (34.5 kDa) in viral sense, and the Gn/Gc glycoprotein precursor (GP) of 1,310 aa (128 kDa) in vc-sense. Phylogenetic analyses indicated that TYRV is closely clustered with IYSV and Polygonum ringspot virus (PolRSV). The NSm and GP of TYRV share the highest aa sequence identity with those of IYSV and PolRSV (89.9 and 80.2-86.5 %, respectively). Moreover, the GPs of TYRV, IYSV, and PolRSV share highly similar characteristics, among which an identical deduced N-terminal protease cleavage site that is distinct from all tospoviral GPs analyzed thus far. Taken together, the elucidation of the complete genome sequence and biological features of TYRV support a close ancestral relationship with IYSV and PolRSV.

Eating Disorder Symptomatology and Identity Formation in Adolescence: A Cross-Lagged Longitudinal Approach.

PubMed

Verschueren, Margaux; Claes, Laurence; Bogaerts, Annabel; Palmeroni, Nina; Gandhi, Amarendra; Moons, Philip; Luyckx, Koen

2018-01-01

Introduction: Eating disorder symptomatology, comprising both psychological and behavioral aspects of subclinical eating concerns, constitutes a clear precursor of developing eating disorders. It is crucial to investigate its antecedents and correlates to subsequently inform eating disorder prevention programs. The present study focused on identity formation, a core developmental task in adolescence, that has increasingly been linked to eating disorder development. Our main aim was to examine the temporal sequence between eating disorder symptomatology and identity formation. Methods: Data on eating disorder symptomatology and identity formation were collected in 530 high school students (at Time 1: mean age = 15 years; SD = 1.84; range: 12-18 years; 50.6% females) using self-report questionnaires at three annual measurement points. Cross-lagged structural equation modeling was performed to examine the directionality of effects. Results: Results indicated bidirectional effects between eating disorder symptomatology and identity formation. Identity confusion seemed to increase vulnerability to body dissatisfaction and bulimia symptoms, whereas identity synthesis seemed to protect against their development. Additionally, identity synthesis seemed to protect against the development of drive for thinness as well. At the same time, body dissatisfaction and bulimia symptoms positively predicted identity confusion and negatively predicted identity synthesis over time. Conclusion: The present study adds to the growing body of literature on identity and eating disorders by focusing on their temporal interplay in a community sample of adolescents. As bidirectional effects emerged, a greater emphasis on identity formation in eating disorder prevention programs is advocated.

Eating Disorder Symptomatology and Identity Formation in Adolescence: A Cross-Lagged Longitudinal Approach

PubMed Central

Verschueren, Margaux; Claes, Laurence; Bogaerts, Annabel; Palmeroni, Nina; Gandhi, Amarendra; Moons, Philip; Luyckx, Koen

2018-01-01

Introduction: Eating disorder symptomatology, comprising both psychological and behavioral aspects of subclinical eating concerns, constitutes a clear precursor of developing eating disorders. It is crucial to investigate its antecedents and correlates to subsequently inform eating disorder prevention programs. The present study focused on identity formation, a core developmental task in adolescence, that has increasingly been linked to eating disorder development. Our main aim was to examine the temporal sequence between eating disorder symptomatology and identity formation. Methods: Data on eating disorder symptomatology and identity formation were collected in 530 high school students (at Time 1: mean age = 15 years; SD = 1.84; range: 12–18 years; 50.6% females) using self-report questionnaires at three annual measurement points. Cross-lagged structural equation modeling was performed to examine the directionality of effects. Results: Results indicated bidirectional effects between eating disorder symptomatology and identity formation. Identity confusion seemed to increase vulnerability to body dissatisfaction and bulimia symptoms, whereas identity synthesis seemed to protect against their development. Additionally, identity synthesis seemed to protect against the development of drive for thinness as well. At the same time, body dissatisfaction and bulimia symptoms positively predicted identity confusion and negatively predicted identity synthesis over time. Conclusion: The present study adds to the growing body of literature on identity and eating disorders by focusing on their temporal interplay in a community sample of adolescents. As bidirectional effects emerged, a greater emphasis on identity formation in eating disorder prevention programs is advocated. PMID:29915548

High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs.

PubMed

Panda, Amaresh C; De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B; Abdelmohsen, Kotb; Gorospe, Myriam

2017-07-07

High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

High-purity circular RNA isolation method (RPAD) reveals vast collection of intronic circRNAs

PubMed Central

De, Supriyo; Grammatikakis, Ioannis; Munk, Rachel; Yang, Xiaoling; Piao, Yulan; Dudekula, Dawood B.; Gorospe, Myriam

2017-01-01

Abstract High-throughput RNA sequencing methods coupled with specialized bioinformatic analyses have recently uncovered tens of thousands of unique circular (circ)RNAs, but their complete sequences, genes of origin and functions are largely unknown. Given that circRNAs lack free ends and are thus relatively stable, their association with microRNAs (miRNAs) and RNA-binding proteins (RBPs) can influence gene expression programs. While exoribonuclease treatment is widely used to degrade linear RNAs and enrich circRNAs in RNA samples, it does not efficiently eliminate all linear RNAs. Here, we describe a novel method for the isolation of highly pure circRNA populations involving RNase R treatment followed by Polyadenylation and poly(A)+ RNA Depletion (RPAD), which removes linear RNA to near completion. High-throughput sequencing of RNA prepared using RPAD from human cervical carcinoma HeLa cells and mouse C2C12 myoblasts led to two surprising discoveries: (i) many exonic circRNA (EcircRNA) isoforms share an identical backsplice sequence but have different body sizes and sequences, and (ii) thousands of novel intronic circular RNAs (IcircRNAs) are expressed in cells. In sum, isolating high-purity circRNAs using the RPAD method can enable quantitative and qualitative analyses of circRNA types and sequence composition, paving the way for the elucidation of circRNA functions. PMID:28444238

Development of phylogenetic markers for Sebacina (Sebacinaceae) mycorrhizal fungi associated with Australian orchids.

PubMed

Ruibal, Monica P; Peakall, Rod; Foret, Sylvain; Linde, Celeste C

2014-06-01

To investigate fungal species identity and diversity in mycorrhizal fungi of order Sebacinales, we developed phylogenetic markers. These new markers will enable future studies investigating species delineation and phylogenetic relationships of the fungal symbionts and facilitate investigations into evolutionary interactions among Sebacina species and their orchid hosts. • We generated partial genome sequences for a Sebacina symbiont originating from Caladenia huegelii with 454 genome sequencing and from three symbionts from Eriochilus dilatatus and one from E. pulchellus using Illumina sequencing. Six nuclear and two mitochondrial loci showed high variability (10-31% parsimony informative sites) for Sebacinales mycorrhizal fungi across four genera of Australian orchids (Caladenia, Eriochilus, Elythranthera, and Glossodia). • We obtained highly informative DNA markers that will allow investigation of mycorrhizal diversity of Sebacinaceae fungi associated with terrestrial orchids in Australia and worldwide.

The complete genome of klassevirus – a novel picornavirus in pediatric stool

PubMed Central

Greninger, Alexander L; Runckel, Charles; Chiu, Charles Y; Haggerty, Thomas; Parsonnet, Julie; Ganem, Donald; DeRisi, Joseph L

2009-01-01

Background Diarrhea kills 2 million children worldwide each year, yet an etiological agent is not found in approximately 30–50% of cases. Picornaviral genera such as enterovirus, kobuvirus, cosavirus, parechovirus, hepatovirus, teschovirus, and cardiovirus have all been found in human and animal diarrhea. Modern technologies, especially deep sequencing, allow rapid, high-throughput screening of clinical samples such as stool for new infectious agents associated with human disease. Results A pool of 141 pediatric gastroenteritis samples that were previously found to be negative for known diarrheal viruses was subjected to pyrosequencing. From a total of 937,935 sequence reads, a collection of 849 reads distantly related to Aichi virus were assembled and found to comprise 75% of a novel picornavirus genome. The complete genome was subsequently cloned and found to share 52.3% nucleotide pairwise identity and 38.9% amino acid identity to Aichi virus. The low level of sequence identity suggests a novel picornavirus genus which we have designated klassevirus. Blinded screening of 751 stool specimens from both symptomatic and asymptomatic individuals revealed a second positive case of klassevirus infection, which was subsequently found to be from the index case's 11-month old twin. Conclusion We report the discovery of human klassevirus 1, a member of a novel picornavirus genus, in stool from two infants from Northern California. Further characterization and epidemiological studies will be required to establish whether klasseviruses are significant causes of human infection. PMID:19538752

Fox parasites in Pre-columbian times: Evidence from the past to understand the current helminth assemblages.

PubMed

Fugassa, M H; Petrigh, R S; Fernández, P M; Carballido Catalayud, M; Belleli, C

2018-06-11

This work aims to increase the information on the entero-parasitism in Holocene carnivores, by examining coprolites found in Patagonia. Molecular analysis was conducted following the Authenticity Criteria to Determine Ancient DNA sequences. The nucleotide sequences showed 99% of identity with the Control Region sequences of Lycalopex culpaeus (culpeo fox). Coprolites were positive for gastrointestinal parasites. The presence of Alaria sp. and Clonorchis sp. represents the first record for pre-Columbian America. The parasitological findings suggest the importance of these carnivores for the dissemination of their own parasites and those to their prey in rockshelters, areas with high re-use of space. Copyright © 2018. Published by Elsevier B.V.

Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

PubMed

Gonzalez, P; Barroso, G; Labarère, J

1998-10-05

The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).

PubMed

Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya

2011-05-01

The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.

Vascular endothelial growth factor from Trimeresurus jerdonii venom specifically binds to VEGFR-2.

PubMed

Zhong, Shurong; Wu, Jianbo; Cui, Yunpeng; Li, Rui; Zhu, Shaowen; Rong, Mingqiang; Lu, Qiumin; Lai, Ren

2015-09-01

Vascular endothelial growth factors (VEGFs) play important roles in angiogenesis. In this study, a vascular endothelial growth factor named TjsvVEGF was purified from the venom of Trimeresurus jerdonii by gel filtration, affinity, ion-exchange and high-performance liquid chromatography. TjsvVEGF was a homodimer with an apparent molecular mass of 29 kDa. The cDNA encoding TjsvVEGF was obtained by PCR. The open reading frame of the cloned TjsvVEGF was composed of 432 bp coding for a signal peptide of 24 amino acid residues and a mature protein of 119 amino acid residues. Compared with other snake venom VEGFs, the nucleotide and deduced protein sequences of the cloned TjsvVEGF were conserved. TjsvVEGF showed low heparin binding activity and strong capillary permeability increasing activity. The KD of TjsvVEGF to VEFGR-2 is 413 pM. However, the binding of TjsvVEGF to VEGFR-1 is too weak to detect. Though TjsvVEGF had high sequence identities (about 90%) with Crotalinae VEGFs, the receptor preference of TjsvVEGF was similar to Viperinae VEGFs which had lower sequence identities (about 60%) with it. TjsvVEGF might serve as a useful tool for the study of structure-function relationships of VEGFs and their receptors. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Analysis of the entire genomes of fifteen torque teno midi virus variants classifiable into a third group of genus Anellovirus.

PubMed

Ninomiya, M; Takahashi, M; Shimosegawa, T; Okamoto, H

2007-01-01

Recently, we identified a novel human virus with a circular DNA genome of 3.2 kb, tentatively designated as torque teno midi virus (TTMDV), with a genomic organization resembling those of torque teno virus (TTV) of 3.8-3.9 kb and torque teno mini virus (TTMV) of 2.8-2.9 kb. To investigate the extent of genomic variability of TTMDV genomes, the full-length sequence was determined for 15 TTMDV isolates obtained from viremic individuals in Japan. The 15 TTMDV isolates comprised 3175-3230 bases and shared 67.0-90.3% identities with each other, and were only 68.4-73.0% identical to the 3 reported TTMDV isolates over the entire genome. TTMDV possessed a genomic organization with four open reading frames (ORF1-ORF4) with characteristic sequence motifs and stem and loop structures with high GC content, similar to TTV and TTMV. The total of 18 TTMDV genomes differed by up to 60.7% from each other in the amino acid sequence of ORF1 (658-677 amino acids), but segregated phylogenetically into the same cluster, which was distantly related to the TTVs and TTMVs. These results indicate that TTMDV with a circular DNA genome of 3.2 kb, has an extremely high degree of genomic variability, and is classifiable into a third group in the genus Anellovirus.

Frequent hepatitis E virus contamination in food containing raw pork liver, France.

PubMed

Pavio, Nicole; Merbah, Thiziri; Thébault, Anne

2014-11-01

Food products containing raw pork liver are suspected to be vehicles for transmission of hepatitis E virus. Four categories of food products, comprising 394 samples, were analyzed to determine hepatitis E virus prevalence. Virus was detected in 3%-30% of the different categories. Phylogenetic analysis showed high identity with human and swine sequences.

Genetic diversity and distribution of a distinct strain of Chili leaf curl virus and associated betasatellite infecting tomato and pepper in Oman.

PubMed

Khan, Akhtar J; Akhtar, Sohail; Al-Zaidi, Amal M; Singh, Achuit K; Briddon, Rob W

2013-10-01

Tomato and pepper are widely grown in Oman for local consumption. A countrywide survey was conducted during 2010-2011 to collect samples and assess the diversity of begomoviruses associated with leaf curl disease of tomato and pepper. A virus previously only identified on the Indian subcontinent, chili leaf curl virus (ChLCV), was found associated with tomato and pepper diseases in all vegetable grown areas of Oman. Some of the infected plant samples were also found to contain a betasatellite. A total of 19 potentially full-length begomovirus and eight betasatellite clones were sequenced. The begomovirus clones showed >96% nucleotide sequence identity, showing them to represent a single species. Comparisons to sequences available in the databases showed the highest levels of nucleotide sequence identity (88.0-91.1%) to isolates of the "Pakistan" strain of ChLCV (ChLCV-PK), indicating the virus from Oman to be a distinct strain, for which the name Oman strain (ChLCV-OM) is proposed. An analysis for recombination showed ChLCV-OM likely to have originated by recombination between ChLCV-PK (the major parent), pepper leaf curl Lahore virus and a third strain of ChLCV. The betasatellite sequences obtained were shown to have high levels of identity to isolates of tomato leaf curl betasatellite (ToLCB) previous shown to be present in Oman. For the disease in tomato Koch's postulates were satisfied by Agrobacterium-mediated inoculation of virus and betasatellites clones. This showed the symptoms induced by the virus in the presence of the betasatellite to be enhanced, although viral DNA levels were not affected. ChLCV-OM is the fourth begomovirus identified in tomato in Oman and the first in Capsicum. The significance of these findings is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Expression of the Caulobacter heat shock gene dnaK is developmentally controlled during growth at normal temperatures.

PubMed Central

Gomes, S L; Gober, J W; Shapiro, L

1990-01-01

Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134

Complete genome analysis of jasmine virus T from Jasminum sambac in China.

PubMed

Tang, Yajun; Gao, Fangluan; Yang, Zhen; Wu, Zujian; Yang, Liang

2016-07-01

The genome of a potyvirus (isolate JaVT_FZ) recovered from jasmine (Jasminum sambac L.) showing yellow ringspot symptoms in Fuzhou, China, was sequenced. JaVT_FZ is closely related to seven other potyviruses with completely sequenced genomes, with which it shares 66-70 % nucleotide and 52-56 % amino acid sequence identity. However, the coat protein (CP) gene shares 82-92 % nucleotide and 90-97 % amino acid sequence identity with those of two partially sequenced potyviruses, named jasmine potyvirus T (JaVT-jasmine) and jasmine yellow mosaic potyvirus (JaYMV-India), respectively. This suggests that JaVT_FZ, JaVT-jasmine and JaYMV-India should be regarded as members of a single potyvirus species, for which the name "Jasmine virus T" has priority.

Genome characterization of Turkey Rotavirus G strains from the United States identifies potential recombination events with human Rotavirus B strains.

PubMed

Chen, Fangzhou; Knutson, Todd P; Porter, Robert E; Ciarlet, Max; Mor, Sunil Kumar; Marthaler, Douglas G

2017-12-01

Rotavirus G (RVG) strains have been detected in a variety of avian species, but RVG genomes have been published from only a single pigeon and two chicken strains. Two turkey RVG strains were identified and characterized, one in a hatchery with no reported health issues and the other in a hatchery with high embryo/poult mortality. The two turkey RVG strains shared only an 85.3 % nucleotide sequence identity in the VP7 gene while the other genes possessed high nucleotide identity among them (96.3-99.9 %). Low nucleotide percentage identities (31.6-87.3 %) occurred among the pigeon and chicken RVG strains. Interestingly, potential recombination events were detected between our RVG strains and a human RVB strain, in the VP6 and NSP3 segments. The epidemiology of RVG in avian flocks and the pathogenicity of the two different RVG strains should be further investigated to understand the ecology and impact of RVG in commercial poultry flocks.

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

New Ehrlichia Species Closely Related to Ehrlichia chaffeensis Isolated from Ixodes ovatus Ticks in Japan

PubMed Central

Shibata, Shin-ichiro; Kawahara, Makoto; Rikihisa, Yasuko; Fujita, Hiromi; Watanabe, Yuriko; Suto, Chiharu; Ito, Tadahiko

2000-01-01

Seven Ehrlichia strains (six HF strains and one Anan strain) that were obtained from laboratory mice by intraperitoneally inoculating homogenates of adult Ixodes ovatus collected in Japan were characterized. 16S rRNA sequences of all six HF strains were identical, and the sequences were 99.7, 98.2, and 97.7% identical to those of Anan strain, Ehrlichia chaffeensis (human monocytic ehrlichiosis agent), and E. muris, respectively. Partial GroEL amino acid sequencing also revealed that the six HF strains had identical sequences, which were 99.0, 98.5, and 97.3% identical to those of E. chaffeensis, the Anan strain, and E. canis, respectively. All HF strains were lethal to mice at higher dosages and intraperitoneal inoculation, whereas the Anan or E. muris strain induced only mild clinical signs. Light and electron microscopy of moribund mice inoculated with one of the HF strains revealed severe liver necrosis and the presence of numerous ehrlichial inclusions (morulae) in various organs. The study revealed that members of E. canis genogroup are naturally present in Ixodes ticks. HF strains that can cause severe illness in immunocompetent laboratory mice would be valuable in studying the pathogenesis and the roles of both cellular and humoral immune responses in ehrlichiosis caused by E. canis genogroup. PMID:10747103

Taxonomic uncertainty and the loss of biodiversity on Christmas Island, Indian Ocean.

PubMed

Eldridge, Mark D B; Meek, Paul D; Johnson, Rebecca N

2014-04-01

The taxonomic uniqueness of island populations is often uncertain which hinders effective prioritization for conservation. The Christmas Island shrew (Crocidura attenuata trichura) is the only member of the highly speciose eutherian family Soricidae recorded from Australia. It is currently classified as a subspecies of the Asian gray or long-tailed shrew (C. attenuata), although it was originally described as a subspecies of the southeast Asian white-toothed shrew (C. fuliginosa). The Christmas Island shrew is currently listed as endangered and has not been recorded in the wild since 1984-1985, when 2 specimens were collected after an 80-year absence. We aimed to obtain DNA sequence data for cytochrome b (cytb) from Christmas Island shrew museum specimens to determine their taxonomic affinities and to confirm the identity of the 1980s specimens. The Cytb sequences from 5, 1898 specimens and a 1985 specimen were identical. In addition, the Christmas Island shrew cytb sequence was divergent at the species level from all available Crocidura cytb sequences. Rather than a population of a widespread species, current evidence suggests the Christmas Island shrew is a critically endangered endemic species, C. trichura, and a high priority for conservation. As the decisions typically required to save declining species can be delayed or deferred if the taxonomic status of the population in question is uncertain, it is hoped that the history of the Christmas Island shrew will encourage the clarification of taxonomy to be seen as an important first step in initiating informed and effective conservation action. © 2013 Society for Conservation Biology.

Comparative analysis of the 5{prime} genomic and promoter regions between the mouse (Hdh) and human Huntington disease (HD) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalchman, M.; Lin, B.; Nasir, J.

1994-09-01

The mouse homologue of the Huntington disease gene (Hdh) has recently been cloned and mapped to a region of synteny with the human, on mouse chromosome 5. The two genes share a high degree of both coding (90% amino acid) and nucleotide (86.2%) identity. We have subsequently performed a detailed comparison of the genomic organization of the 5{prime} region of the two genes encompassing the promoter region and first five exons of both the human and mouse genes. The comparative sequence analysis of the promoter region between HD and Hdh reveals two highly conserved regions. One region (-56 to -118)more » (+1 is the ATG start codon), shared 84% nucleotide identity and another region (-130 to -206) had 81% nucleotide identity. Nine putative Sp1 sites appear in the human promoter region contrasted with only 3 in a similar region in the mouse. Furthermore, 17 and 20 base pair direct repeats present in the HD 5{prime} region are absent in the similar Hdh region. Although both the mouse and human intron/exon boundaries conform to the GT/AG rule, the intron sizes between HD and Hdh are markedly different. The first four introns in Hdh are 15, 7, 5 and 0.5 kb compared to sizes of 10, 15, 7 and 0.5 kb, respectively. Comparison between the mouse and human intronic sequences immediately adjacent to the first five exons (excluding exon 1) reveals only about 46 to 50% identity within the first 60 bp of intronic sequence. Furthermore, we have identified novel polymorphic di-, tri- and tetra-nucleotide repeats in Hdh introns of various mouse strains that are not present in the human. For example, polymorphic CT repeats are present in introns 2 and 4 of Hdh and a novel mouse 56 AAG trinucleotide repeat (interrupted by an AAGG) is also located within intron 2. This information concerning the promoter and genomic organization of both HD and Hdh is critical for designing appropriate gene targetting vectors for studying the normal function of the HD and Hdh genes in model systems.« less

Probing the Rare Biosphere of the North-West Mediterranean Sea: An Experiment with High Sequencing Effort.

PubMed

Crespo, Bibiana G; Wallhead, Philip J; Logares, Ramiro; Pedrós-Alió, Carlos

2016-01-01

High-throughput sequencing (HTS) techniques have suggested the existence of a wealth of species with very low relative abundance: the rare biosphere. We attempted to exhaustively map this rare biosphere in two water samples by performing an exceptionally deep pyrosequencing analysis (~500,000 final reads per sample). Species data were derived by a 97% identity criterion and various parametric distributions were fitted to the observed counts. Using the best-fitting Sichel distribution we estimate a total species richness of 1,568-1,669 (95% Credible Interval) and 5,027-5,196 for surface and deep water samples respectively, implying that 84-89% of the total richness in those two samples was sequenced, and we predict that a quadrupling of the present sequencing effort would suffice to observe 90% of the total richness in both samples. Comparing the HTS results with a culturing approach we found that most of the cultured taxa were not obtained by HTS, despite the high sequencing effort. Culturing therefore remains a useful tool for uncovering marine bacterial diversity, in addition to its other uses for studying the ecology of marine bacteria.

Indigenous and introduced potyviruses of legumes and Passiflora spp. from Australia: biological properties and comparison of coat protein sequences

USDA-ARS?s Scientific Manuscript database

Coat protein sequences of 33 Potyvirus isolates from legume and Passiflora spp. were sequenced to determine the identity of infecting viruses. Phylogenetic analysis of the sequences revealed the presence of seven distinct virus species....

Complete genome analysis of highly pathogenic bovine ephemeral fever virus isolated in Turkey in 2012.

PubMed

Abayli, Hasan; Tonbak, Sukru; Azkur, Ahmet Kursat; Bulut, Hakan

2017-10-01

Relatively high prevalence and mortality rates of bovine ephemeral fever (BEF) have been reported in recent epidemics in some countries, including Turkey, when compared with previous outbreaks. A limited number of complete genome sequences of BEF virus (BEFV) are available in the GenBank Database. In this study, the complete genome of highly pathogenic BEFV isolated during an outbreak in Turkey in 2012 was analyzed for genetic characterization. The complete genome of the Turkish BEFV isolate was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and sequenced. It was found that the complete genome of the Turkish BEFV isolate was 14,901 nt in length. The complete genome sequence obtained from the study showed 91-92% identity at nucleotide level to Australian (BB7721) and Chinese (Bovine/China/Henan1/2012) BEFV isolates. Phylogenetic analysis of the glycoprotein gene of the Turkish BEFV isolate also showed that Turkish isolates were closely related to Israeli isolates. Because of the limited number of complete BEFV genome sequences, the results from this study will be useful for understanding the global molecular epidemiology and geodynamics of BEF.

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Nanopore Kinetic Proofreading of DNA Sequences

NASA Astrophysics Data System (ADS)

Ling, Xinsheng Sean

The concept of DNA sequencing using the time dependence of the nanopore ionic current was proposed in 1996 by Kasianowicz, Brandin, Branton, and Deamer (KBBD). The KBBD concept has generated tremendous amount interests in recent decade. In this talk, I will review the current understanding of the DNA ``translocation'' dynamics and how it can be described by Schrodinger's 1915 paper on first-passage-time distribution function. Schrodinger's distribution function can be used to give a rigorous criterion for achieving nanopore DNA sequencing which turns out to be identical to that of gel electrophoresis used by Sanger in the first-generation Sanger method. A nanopore DNA sequencing technology also requires discrimination of bases with high accuracies. I will describe a solid-state nanopore sandwich structure that can function as a proofreading device capable of discriminating between correct and incorrect hybridization probes with an accuracy rivaling that of high-fidelity DNA polymerases. The latest results from Nanjing will be presented. This work is supported by China 1000-Talent Program at Southeast University, Nanjing, China.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

PubMed

Li, Chao; Chang, Wei Shan

2014-01-01

Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia

PubMed Central

Chang, Wei Shan

2014-01-01

Objective Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. Material and methods In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. Results The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. Conclusions We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application. PMID:26155117

Molecular characterization of genes encoding trypsin-like enzymes from Aedes aegypti larvae and identification of digestive enzymes.

PubMed

Soares, Tatiane S; Watanabe, Renata M O; Lemos, Francisco J A; Tanaka, Aparecida S

2011-12-10

Trypsin-like enzymes play an important role in the Aedes aegypti digestive process. The trypsin-like enzymes present in adults were characterized previously, but little is known about trypsins in larvae. In the present work, we identified one of the trypsin enzymes from Ae. aegypti larval midgut using a library of trypsin gene fragments, which was the sequence known as AAEL005607 from the Ae. aegypti genome. Quantitative PCR analysis showed that AAEL005607 was transcribed in all larval instars, but it was not present in adult midgut. In order to confirm transcription data, the trypsin-like enzymes from 4th instar larvae of Ae. aegypti midgut were purified and sequenced. Purified trypsin showed identity with the amino-terminal sequence of AAEL005607, AAEL005609 and AAEL005614. These three trypsins have high amino acids identity, and could all be used as a template for the design of inhibitors. In conclusion, for the first time, digestive enzymes of 4th larval instar of Ae. aegypti were purified and characterized. The knowledge of digestive enzymes present in Ae. aegypti larvae may be helpful in the development of a larvicide. Copyright © 2011 Elsevier B.V. All rights reserved.

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

Characterization of a molt-inhibiting hormone (MIH) of the crayfish, Orconectes limosus, by cDNA cloning and mass spectrometric analysis.

PubMed

Bulau, Patrick; Okuno, Atsuro; Thome, Elke; Schmitz, Tina; Peter-Katalinic, Jasna; Keller, Rainer

2005-11-01

The structure of the precursor of a molt-inhibiting hormone (MIH) of the American crayfish, Orconectes limosus was determined by cloning of a cDNA based on RNA from the neurosecretory perikarya of the X-organ in the eyestalk ganglia. The open reading frame includes the complete precursor sequence, consisting of a signal peptide of 29, and the MIH sequence of 77 amino acids. In addition, the mature peptide was isolated by HPLC from the neurohemal sinus gland and analyzed by ESI-MS and MALDI-TOF-MS peptide mapping. This showed that the mature peptide (Mass 8664.29 Da) consists of only 75 amino acids, having Ala75-NH2 as C-terminus. Thus, C-terminal Arg77 of the precursor is removed during processing, and Gly76 serves as an amide donor. Sequence comparison confirms this peptide as a novel member of the large family, which includes crustacean hyperglycaemic hormone (CHH), MIH and gonad (vitellogenesis)-inhibiting hormone (GIH/VIH). The lack of a CPRP (CHH-precursor related peptide) in the hormone precursor, the size and specific sequence characteristics show that Orl MIH belongs to the MIH/GIH(VIH) subgroup of this larger family. Comparison with the MIH of Procambarus clarkii, the only other MIH that has thus far been identified in freshwater crayfish, shows extremely high sequence conservation. Both MIHs differ in only one amino acid residue ( approximately 99% identity), whereas the sequence identity to several other known MIHs is between 40 and 46%.

Phylogenetic inference and SSR characterization of tropical woody bamboos tribe Bambuseae (Poaceae: Bambusoideae) based on complete plastid genome sequences.

PubMed

Vieira, Leila do Nascimento; Dos Anjos, Karina Goulart; Faoro, Helisson; Fraga, Hugo Pacheco de Freitas; Greco, Thiago Machado; Pedrosa, Fábio de Oliveira; de Souza, Emanuel Maltempi; Rogalski, Marcelo; de Souza, Robson Francisco; Guerra, Miguel Pedro

2016-05-01

The complete plastome sequencing is an efficient option for increasing phylogenetic resolution and evolutionary studies, as well as may greatly facilitate the use of plastid DNA markers in plant population genetic studies. Merostachys and Guadua stand out as the most common and the highest potential utilization bamboos indigenous of Brazil. Here, we sequenced the complete plastome sequences of the Brazilian Guadua chacoensis and Merostachys sp. to perform full plastome phylogeny and characterize the occurrence, type, and distribution of SRRs using 20 Bambuseae species. The determined plastome sequence of Merostachys sp. and G. chacoensis is 136,334 and 135,403 bp in size, respectively, with an identical gene content and typical quadripartite structure consisting of a pair of IRs separated by the LSC and SSC regions. The Maximum Likelihood and Bayesian Inference analyses produced phylogenomic trees identical in topology. These trees supported monophyly of Paleotropical and Neotropical Bamboos clades. The Neotropical bamboos segregated into three well-supported lineages, Chusqueinae, Guaduinae, and Arthrostylidiinae, with the last two forming a well-supported sister relationship. Paleotropical bamboos segregated into two well-supported lineages, Hickeliinae and Bambusinae + Melocanninae. We identified 141.8 cpSSR in Bambuseae plastomes and an inferior value (38.15) for plastome coding sequences. Among them, we identified 16 polymorphic SSR loci, with number of alleles varying from 3 to 10. These 16 polymorphic cpSSR loci in Bambuseae plastome can be assessed for the intraspecific level of polymorphism, leading to innovative highly sensitive phylogeographic and population genetics studies for this tribe.

DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

PubMed

Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M

2007-01-01

DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

PubMed

Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

2002-11-01

The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Common Amino Acid Subsequences in a Universal Proteome—Relevance for Food Science

PubMed Central

Minkiewicz, Piotr; Darewicz, Małgorzata; Iwaniak, Anna; Sokołowska, Jolanta; Starowicz, Piotr; Bucholska, Justyna; Hrynkiewicz, Monika

2015-01-01

A common subsequence is a fragment of the amino acid chain that occurs in more than one protein. Common subsequences may be an object of interest for food scientists as biologically active peptides, epitopes, and/or protein markers that are used in comparative proteomics. An individual bioactive fragment, in particular the shortest fragment containing two or three amino acid residues, may occur in many protein sequences. An individual linear epitope may also be present in multiple sequences of precursor proteins. Although recent recommendations for prediction of allergenicity and cross-reactivity include not only sequence identity, but also similarities in secondary and tertiary structures surrounding the common fragment, local sequence identity may be used to screen protein sequence databases for potential allergens in silico. The main weakness of the screening process is that it overlooks allergens and cross-reactivity cases without identical fragments corresponding to linear epitopes. A single peptide may also serve as a marker of a group of allergens that belong to the same family and, possibly, reveal cross-reactivity. This review article discusses the benefits for food scientists that follow from the common subsequences concept. PMID:26340620

Novel Detection of Coxiella spp., Theileria luwenshuni, and T. ovis Endosymbionts in Deer Keds (Lipoptena fortisetosa).

PubMed

Lee, Seung-Hun; Kim, Kyoo-Tae; Kwon, Oh-Deog; Ock, Younsung; Kim, Taeil; Choi, Donghag; Kwak, Dongmi

2016-01-01

We describe for the first time the detection of Coxiella-like bacteria (CLB), Theileria luwenshuni, and T. ovis endosymbionts in blood-sucking deer keds. Eight deer keds attached to a Korean water deer were identified as Lipoptena fortisetosa (Diptera: Hippoboscidae) by morphological and genetic analyses. Among the endosymbionts assessed, CLB, Theileria luwenshuni, and T. ovis were identified in L. fortisetosa by PCR and nucleotide sequencing. Based on phylogeny, CLB 16S rRNA sequences were classified into clade B, sharing 99.4% identity with CLB from Haemaphysalis longicornis in South Korea. Although the virulence of CLB to vertebrates is still controversial, several studies have reported clinical symptoms in birds due to CLB infections. The 18S rRNA sequences of T. luwenshuni and T. ovis in this study were 98.8-100% identical to those in GenBank, and all of the obtained sequences of T. ovis and T. luwenshuni in this study were 100% identical to each other, respectively. Although further studies are required to positively confirm L. fortisetosa as a biological vector of these pathogens, strong genetic relationships among sequences from this and previous studies suggest potential transmission among mammalian hosts by ticks and keds.

Complete genome sequence of a new begomovirus associated with yellow mosaic disease of Hemidesmus indicus in India.

PubMed

Reddy, M Sreekanth; Kanakala, S; Srinivas, K P; Hema, M; Malathi, V G; Sreenivasulu, P

2014-05-01

The complete DNA A genome of a virus isolate associated with yellow mosaic disease of a medicinal plant, Hemidesmus indicus, from India was cloned and sequenced. The length of DNA A was 2825 nucleotides, 35 nucleotides longer than the unit genome of monopartite begomoviruses. Comparison of the nucleotide sequence of DNA A of the virus isolate with those of other begomoviruses showed maximum sequence identity of 69 % to DNA A of ageratum yellow vein China virus (AYVCNV; AJ558120) and 68 % with tomato yellow leaf curl virus- LBa4 (TYLCV; EF185318), and it formed a distinct clade in phylogenetic analysis. The genome organization of the present virus isolate was found to be similar to that of Old World monopartite begomoviruses. The genome was considered to be monopartite, because association of DNA B and β satellite DNA components was not detected. Based on its sequence identity (<70 %) to all other begomoviruses known to date and ICTV (International Committee on Taxonomy of Viruses) species demarcating criteria (<89 % identity), it is considered a member of a novel begomovirus species, and the tentative name "Hemidesmus yellow mosaic virus" (HeYMV) is proposed.

Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

PubMed

Habibi, Gh

2012-01-01

Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tü57.

PubMed Central

Gaisser, S; Trefzer, A; Stockert, S; Kirschning, A; Bechthold, A

1997-01-01

A 65-kb region of DNA from Streptomyces viridochromogenes Tü57, containing genes encoding proteins involved in the biosynthesis of avilamycins, was isolated. The DNA sequence of a 6.4-kb fragment from this region revealed four open reading frames (ORF1 to ORF4), three of which are fully contained within the sequenced fragment. The deduced amino acid sequence of AviM, encoded by ORF2, shows 37% identity to a 6-methylsalicylic acid synthase from Penicillium patulum. Cultures of S. lividans TK24 and S. coelicolor CH999 containing plasmids with ORF2 on a 5.5-kb PstI fragment were able to produce orsellinic acid, an unreduced version of 6-methylsalicylic acid. The amino acid sequence encoded by ORF3 (AviD) is 62% identical to that of StrD, a dTDP-glucose synthase from S. griseus. The deduced amino acid sequence of AviE, encoded by ORF4, shows 55% identity to a dTDP-glucose dehydratase (StrE) from S. griseus. Gene insertional inactivation experiments of aviE abolished avilamycin production, indicating the involvement of aviE in the biosynthesis of avilamycins. PMID:9335272

Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.

PubMed

Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide

2017-06-01

To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.

Determination and analysis of the complete genome sequence of Paralichthys olivaceus rhabdovirus (PORV).

PubMed

Zhu, Ruo-Lin; Zhang, Qi-Ya

2014-04-01

Paralichthys olivaceus rhabdovirus (PORV), which is associated with high mortality rates in flounder, was isolated in China in 2005. Here, we provide an annotated sequence record of PORV, the genome of which comprises 11,182 nucleotides and contains six genes in the order 3'-N-P-M-G-NV-L-5'. Phylogenetic analysis based on glycoprotein sequences of PORV and other rhabdoviruses showed that PORV clusters with viral haemorrhagic septicemia virus (VHSV), genus Novirhabdovirus, family Rhabdoviridae. Further phylogenetic analysis of the combined amino acid sequences of six proteins of PORV and VHSV strains showed that PORV clusters with Korean strains and is closely related to Asian strains, all of which were isolated from flounder. In a comparison in which the sequences of the six proteins were combined, PORV shared the highest identity (98.3 %) with VHSV strain KJ2008 from Korea.

Comparative analysis of the prion protein gene sequences in African lion.

PubMed

Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

2006-10-01

The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

Taxonomic evaluation of Streptomyces albus and related species using multilocus sequence analysis and proposals to emend the description of Streptomyces albus and describe Streptomyces pathocidini sp. nov.

PubMed Central

Doroghazi, J. R.; Ju, K.-S.; Metcalf, W. W.

2014-01-01

In phylogenetic analyses of the genus Streptomyces using 16S rRNA gene sequences, Streptomyces albus subsp. albus NRRL B-1811T forms a cluster with five other species having identical or nearly identical 16S rRNA gene sequences. Moreover, the morphological and physiological characteristics of these other species, including Streptomyces almquistii NRRL B-1685T, Streptomyces flocculus NRRL B-2465T, Streptomyces gibsonii NRRL B-1335T and Streptomyces rangoonensis NRRL B-12378T are quite similar. This cluster is of particular taxonomic interest because Streptomyces albus is the type species of the genus Streptomyces. The related strains were subjected to multilocus sequence analysis (MLSA) utilizing partial sequences of the housekeeping genes atpD, gyrB, recA, rpoB and trpB and confirmation of previously reported phenotypic characteristics. The five strains formed a coherent cluster supported by a 100 % bootstrap value in phylogenetic trees generated from sequence alignments prepared by concatenating the sequences of the housekeeping genes, and identical tree topology was observed using various different tree-making algorithms. Moreover, all but one strain, S. flocculus NRRL B-2465T, exhibited identical sequences for all of the five housekeeping gene loci sequenced, but NRRL B-2465T still exhibited an MLSA evolutionary distance of 0.005 from the other strains, a value that is lower than the 0.007 MLSA evolutionary distance threshold proposed for species-level relatedness. These data support a proposal to reclassify S. almquistii, S. flocculus, S. gibsonii and S. rangoonensis as later heterotypic synonyms of S. albus with NRRL B-1811T as the type strain. The MLSA sequence database also demonstrated utility for quickly and conclusively confirming that numerous strains within the ARS Culture Collection had been previously misidentified as subspecies of S. albus and that Streptomyces albus subsp. pathocidicus should be redescribed as a novel species, Streptomyces pathocidini sp. nov., with the type strain NRRL B-24287T. PMID:24277863

Sequence analyses of fimbriae subunit FimA proteins on Actinomyces naeslundii genospecies 1 and 2 and Actinomyces odontolyticus with variant carbohydrate binding specificities

PubMed Central

Drobni, Mirva; Hallberg, Kristina; Öhman, Ulla; Birve, Anna; Persson, Karina; Johansson, Ingegerd; Strömberg, Nicklas

2006-01-01

Background Actinomyces naeslundii genospecies 1 and 2 express type-2 fimbriae (FimA subunit polymers) with variant Galβ binding specificities and Actinomyces odontolyticus a sialic acid specificity to colonize different oral surfaces. However, the fimbrial nature of the sialic acid binding property and sequence information about FimA proteins from multiple strains are lacking. Results Here we have sequenced fimA genes from strains of A.naeslundii genospecies 1 (n = 4) and genospecies 2 (n = 4), both of which harboured variant Galβ-dependent hemagglutination (HA) types, and from A.odontolyticus PK984 with a sialic acid-dependent HA pattern. Three unique subtypes of FimA proteins with 63.8–66.4% sequence identity were present in strains of A. naeslundii genospecies 1 and 2 and A. odontolyticus. The generally high FimA sequence identity (>97.2%) within a genospecies revealed species specific sequences or segments that coincided with binding specificity. All three FimA protein variants contained a signal peptide, pilin motif, E box, proline-rich segment and an LPXTG sorting motif among other conserved segments for secretion, assembly and sorting of fimbrial proteins. The highly conserved pilin, E box and LPXTG motifs are present in fimbriae proteins from other Gram-positive bacteria. Moreover, only strains of genospecies 1 were agglutinated with type-2 fimbriae antisera derived from A. naeslundii genospecies 1 strain 12104, emphasizing that the overall folding of FimA may generate different functionalities. Western blot analyses with FimA antisera revealed monomers and oligomers of FimA in whole cell protein extracts and a purified recombinant FimA preparation, indicating a sortase-independent oligomerization of FimA. Conclusion The genus Actinomyces involves a diversity of unique FimA proteins with conserved pilin, E box and LPXTG motifs, depending on subspecies and associated binding specificity. In addition, a sortase independent oligomerization of FimA subunit proteins in solution was indicated. PMID:16686953

Strain variation in Mycobacterium marinum fish isolates.

PubMed

Ucko, M; Colorni, A; Kvitt, H; Diamant, A; Zlotkin, A; Knibb, W R

2002-11-01

A molecular characterization of two Mycobacterium marinum genes, 16S rRNA and hsp65, was carried out with a total of 21 isolates from various species of fish from both marine and freshwater environments of Israel, Europe, and the Far East. The nucleotide sequences of both genes revealed that all M. marinum isolates from fish in Israel belonged to two different strains, one infecting marine (cultured and wild) fish and the other infecting freshwater (cultured) fish. A restriction enzyme map based on the nucleotide sequences of both genes confirmed the divergence of the Israeli marine isolates from the freshwater isolates and differentiated the Israeli isolates from the foreign isolates, with the exception of one of three Greek isolates from marine fish which was identical to the Israeli marine isolates. The second isolate from Greece exhibited a single base alteration in the 16S rRNA sequence, whereas the third isolate was most likely a new Mycobacterium species. Isolates from Denmark and Thailand shared high sequence homology to complete identity with reference strain ATCC 927. Combined analysis of the two gene sequences increased the detection of intraspecific variations and was thus of importance in studying the taxonomy and epidemiology of this aquatic pathogen. Whether the Israeli M. marinum strain infecting marine fish is endemic to the Red Sea and found extremely susceptible hosts in the exotic species imported for aquaculture or rather was accidentally introduced with occasional imports of fingerlings from the Mediterranean Sea could not be determined.

Molecular Analysis of Shower Curtain Biofilm Microbes

PubMed Central

Kelley, Scott T.; Theisen, Ulrike; Angenent, Largus T.; Amand, Allison St.; Pace, Norman R.

2004-01-01

Households provide environments that encourage the formation of microbial communities, often as biofilms. Such biofilms constitute potential reservoirs for pathogens, particularly for immune-compromised individuals. One household environment that potentially accumulates microbial biofilms is that provided by vinyl shower curtains. Over time, vinyl shower curtains accumulate films, commonly referred to as “soap scum,” which microscopy reveals are constituted of lush microbial biofilms. To determine the kinds of microbes that constitute shower curtain biofilms and thereby to identify potential opportunistic pathogens, we conducted an analysis of rRNA genes obtained by PCR from four vinyl shower curtains from different households. Each of the shower curtain communities was highly complex. No sequence was identical to one in the databases, and no identical sequences were encountered in the different communities. However, the sequences generally represented similar phylogenetic kinds of organisms. Particularly abundant sequences represented members of the α-group of proteobacteria, mainly Sphingomonas spp. and Methylobacterium spp. Both of these genera are known to include opportunistic pathogens, and several of the sequences obtained from the environmental DNA samples were closely related to known pathogens. Such organisms have also been linked to biofilm formation associated with water reservoirs and conduits. In addition, the study detected many other kinds of organisms at lower abundances. These results show that shower curtains are a potential source of opportunistic pathogens associated with biofilms. Frequent cleaning or disposal of shower curtains is indicated, particularly in households with immune-compromised individuals. PMID:15240300

Orpinomyces cellulase CelE protein and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2000-08-29

A CDNA designated celE cloned from Orpinomyces PC-2 encodes a polypeptide (CelE) of 477 amino acids. CelE is highly homologous to CelB of Orpinomyces (72.3% identity) and Neocallimastix (67.9% identity), and like them, it has a non-catalytic repeated peptide domain (NCRPD) at the C-terminal end. The catalytic domain of CelE is homologous to glycosyl hydrolases of Family 5, found in several anaerobic bacteria. The gene of celE is devoid of introns. The recombinant proteins CelE and CelB of Orpinomyces PC-2 randomly hydrolyze carboxymethylcellulose and cello-oligosaccharides in the pattern of endoglucanases.

Novel phytochrome sequences in Arabidopsis thaliana: Structure, evolution, and differential expression of a plant regulatory photoreceptor family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharrock, R.A.; Quail, P.H.

1989-01-01

Phytochrome is a plant regulatory photoreceptor that mediates red light effects on a wide variety of physiological and molecular responses. DNA blot analysis indicates that the Arabidopsis thaliana genome contains four to five phytochrome-related gene sequences. The authors have isolated and sequenced cDNA clones corresponding to three of these genes and have deduced the amino acid sequence of the full-length polypeptide encoded in each case. One of these proteins (phyA) shows 65-80% amino acid sequence identity with the major, etiolated-tissue phytochrome apoproteins described previously in other plant species. The other two polypeptides (phyB and phyC) are unique in that theymore » have low sequence identity with each other, with phyA, and with all previously described phytochromes. The phyA, phyB, and phyC proteins are of similar molecular mass, have related hydropathic profiles, and contain a conserved chromophore attachment region. However, the sequence comparison data indicate that the three phy genes diverged early in plant evolution, well before the divergence of the two major groups of angiosperms, the monocots and dicots. The steady-state level of the phyA transcript is high in dark-grown A. thaliana seedlings and is down-regulated by light. In contrast, the phyB and phyC transcripts are present at lower levels and are not strongly light-regulated. These findings indicate that the red/far red light-responsive phytochrome photoreceptor system in A. thaliana, and perhaps in all higher plants, consists of a family of chromoproteins that are heterogeneous in structure and regulation.« less

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Bean common mosaic virus isolates causing different symptoms in asparagus bean in China differ greatly in the 5'-parts of their genomes.

PubMed

Zheng, Hongying; Chen, Jiong; Chen, Jianping; Adams, Michael J; Hou, Mingsheng

2002-06-01

Potyvirus isolates from asparagus bean ( Vigna sesquipedalis) plants in Zhejiang province, China, caused either rugose and vein banding mosaic symptoms (isolate R) or severe yellowing (isolate Y) in this host, but were otherwise similar in host range. Both isolates were completely sequenced and shown to be isolates of Bean common mosaic virus (BCMV). The complete sequences were 9992 (R) or 10062 (Y) nucleotides long and shared 91.7% identical nucleotides (93.2% identical amino acids) in their genomes and were more distantly related to the BCMV-Peanut stripe virus sequence (PStV). The isolates were much less similar to one another in the 5'-UTR and the N-terminal region of the P1 protein. In the P1, isolate Y was closer to PStV (76.1% identical amino acids) than to isolate R (64.8%). Phylogenetic analyses of the coat protein region showed that the new isolates grouped with other isolates from Vigna spp., forming the blackeye cowpea mosaic strain subgroup of BCMV with 94-98% nucleotides (96-99% amino acids) identical to one another and about 90% identity to other BCMV isolates. Other significant subgroupings amongst published BCMV isolates were detected.

T cell receptor repertoires of mice and humans are clustered in similarity networks around conserved public CDR3 sequences

PubMed Central

Madi, Asaf; Poran, Asaf; Shifrut, Eric; Reich-Zeliger, Shlomit; Greenstein, Erez; Zaretsky, Irena; Arnon, Tomer; Laethem, Francois Van; Singer, Alfred; Lu, Jinghua; Sun, Peter D; Cohen, Irun R; Friedman, Nir

2017-01-01

Diversity of T cell receptor (TCR) repertoires, generated by somatic DNA rearrangements, is central to immune system function. However, the level of sequence similarity of TCR repertoires within and between species has not been characterized. Using network analysis of high-throughput TCR sequencing data, we found that abundant CDR3-TCRβ sequences were clustered within networks generated by sequence similarity. We discovered a substantial number of public CDR3-TCRβ segments that were identical in mice and humans. These conserved public sequences were central within TCR sequence-similarity networks. Annotated TCR sequences, previously associated with self-specificities such as autoimmunity and cancer, were linked to network clusters. Mechanistically, CDR3 networks were promoted by MHC-mediated selection, and were reduced following immunization, immune checkpoint blockade or aging. Our findings provide a new view of T cell repertoire organization and physiology, and suggest that the immune system distributes its TCR sequences unevenly, attending to specific foci of reactivity. DOI: http://dx.doi.org/10.7554/eLife.22057.001 PMID:28731407

Deep Sequencing Analysis of Apple Infecting Viruses in Korea

PubMed Central

Cho, In-Sook; Igori, Davaajargal; Lim, Seungmo; Choi, Gug-Seoun; Hammond, John; Lim, Hyoun-Sub; Moon, Jae Sun

2016-01-01

Deep sequencing has generated 52 contigs derived from five viruses; Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), Apple stem pitting virus (ASPV), Apple green crinkle associated virus (AGCaV), and Apricot latent virus (ApLV) were identified from eight apple samples showing small leaves and/or growth retardation. Nucleotide (nt) sequence identity of the assembled contigs was from 68% to 99% compared to the reference sequences of the five respective viral genomes. Sequences of ASPV and ASGV were the most abundantly represented by the 52 contigs assembled. The presence of the five viruses in the samples was confirmed by RT-PCR using specific primers based on the sequences of each assembled contig. All five viruses were detected in three of the samples, whereas all samples had mixed infections with at least two viruses. The most frequently detected virus was ASPV, followed by ASGV, ApLV, ACLSV, and AGCaV which were withal found in mixed infections in the tested samples. AGCaV was identified in assembled contigs ID 1012480 and 93549, which showed 82% and 78% nt sequence identity with ORF1 of AGCaV isolate Aurora-1. ApLV was identified in three assembled contigs, ID 65587, 1802365, and 116777, which showed 77%, 78%, and 76% nt sequence identity respectively with ORF1 of ApLV isolate LA2. Deep sequencing assay was shown to be a valuable and powerful tool for detection and identification of known and unknown virome in infected apple trees, here identifying ApLV and AGCaV in commercial orchards in Korea for the first time. PMID:27721694

Complete genome sequence of lymphocystis disease virus isolated from China.

PubMed

Zhang, Qi-Ya; Xiao, Feng; Xie, Jian; Li, Zheng-Qiu; Gui, Jian-Fang

2004-07-01

Lymphocystis diseases in fish throughout the world have been extensively described. Here we report the complete genome sequence of lymphocystis disease virus isolated in China (LCDV-C), an LCDV isolated from cultured flounder (Paralichthys olivaceus) with lymphocystis disease in China. The LCDV-C genome is 186,250 bp, with a base composition of 27.25% G+C. Computer-assisted analysis revealed 240 potential open reading frames (ORFs) and 176 nonoverlapping putative viral genes, which encode polypeptides ranging from 40 to 1,193 amino acids. The percent coding density is 67%, and the average length of each ORF is 702 bp. A search of the GenBank database using the 176 individual putative genes revealed 103 homologues to the corresponding ORFs of LCDV-1 and 73 potential genes that were not found in LCDV-1 and other iridoviruses. Among the 73 genes, there are 8 genes that contain conserved domains of cellular genes and 65 novel genes that do not show any significant homology with the sequences in public databases. Although a certain extent of similarity between putative gene products of LCDV-C and corresponding proteins of LCDV-1 was revealed, no colinearity was detected when their ORF arrangements and coding strategies were compared to each other, suggesting that a high degree of genetic rearrangements between them has occurred. And a large number of tandem and overlapping repeated sequences were observed in the LCDV-C genome. The deduced amino acid sequence of the major capsid protein (MCP) presents the highest identity to those of LCDV-1 and other iridoviruses among the LCDV-C gene products. Furthermore, a phylogenetic tree was constructed based on the multiple alignments of nine MCP amino acid sequences. Interestingly, LCDV-C and LCDV-1 were clustered together, but their amino acid identity is much less than that in other clusters. The unexpected levels of divergence between their genomes in size, gene organization, and gene product identity suggest that LCDV-C and LCDV-1 shouldn't belong to a same species and that LCDV-C should be considered a species different from LCDV-1.

Complete Genome Sequence of Lymphocystis Disease Virus Isolated from China

PubMed Central

Zhang, Qi-Ya; Xiao, Feng; Xie, Jian; Li, Zheng-Qiu; Gui, Jian-Fang

2004-01-01

Lymphocystis diseases in fish throughout the world have been extensively described. Here we report the complete genome sequence of lymphocystis disease virus isolated in China (LCDV-C), an LCDV isolated from cultured flounder (Paralichthys olivaceus) with lymphocystis disease in China. The LCDV-C genome is 186,250 bp, with a base composition of 27.25% G+C. Computer-assisted analysis revealed 240 potential open reading frames (ORFs) and 176 nonoverlapping putative viral genes, which encode polypeptides ranging from 40 to 1,193 amino acids. The percent coding density is 67%, and the average length of each ORF is 702 bp. A search of the GenBank database using the 176 individual putative genes revealed 103 homologues to the corresponding ORFs of LCDV-1 and 73 potential genes that were not found in LCDV-1 and other iridoviruses. Among the 73 genes, there are 8 genes that contain conserved domains of cellular genes and 65 novel genes that do not show any significant homology with the sequences in public databases. Although a certain extent of similarity between putative gene products of LCDV-C and corresponding proteins of LCDV-1 was revealed, no colinearity was detected when their ORF arrangements and coding strategies were compared to each other, suggesting that a high degree of genetic rearrangements between them has occurred. And a large number of tandem and overlapping repeated sequences were observed in the LCDV-C genome. The deduced amino acid sequence of the major capsid protein (MCP) presents the highest identity to those of LCDV-1 and other iridoviruses among the LCDV-C gene products. Furthermore, a phylogenetic tree was constructed based on the multiple alignments of nine MCP amino acid sequences. Interestingly, LCDV-C and LCDV-1 were clustered together, but their amino acid identity is much less than that in other clusters. The unexpected levels of divergence between their genomes in size, gene organization, and gene product identity suggest that LCDV-C and LCDV-1 shouldn't belong to a same species and that LCDV-C should be considered a species different from LCDV-1. PMID:15194775

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

High-level diversity of tailed phages, eukaryote-associated viruses, and virophage-like elements in the metaviromes of antarctic soils.

PubMed

Zablocki, Olivier; van Zyl, Lonnie; Adriaenssens, Evelien M; Rubagotti, Enrico; Tuffin, Marla; Cary, Stephen Craig; Cowan, Don

2014-11-01

The metaviromes of two distinct Antarctic hyperarid desert soil communities have been characterized. Hypolithic communities, cyanobacterium-dominated assemblages situated on the ventral surfaces of quartz pebbles embedded in the desert pavement, showed higher virus diversity than surface soils, which correlated with previous bacterial community studies. Prokaryotic viruses (i.e., phages) represented the largest viral component (particularly Mycobacterium phages) in both habitats, with an identical hierarchical sequence abundance of families of tailed phages (Siphoviridae > Myoviridae > Podoviridae). No archaeal viruses were found. Unexpectedly, cyanophages were poorly represented in both metaviromes and were phylogenetically distant from currently characterized cyanophages. Putative phage genomes were assembled and showed a high level of unaffiliated genes, mostly from hypolithic viruses. Moreover, unusual gene arrangements in which eukaryotic and prokaryotic virus-derived genes were found within identical genome segments were observed. Phycodnaviridae and Mimiviridae viruses were the second-most-abundant taxa and more numerous within open soil. Novel virophage-like sequences (within the Sputnik clade) were identified. These findings highlight high-level virus diversity and novel species discovery potential within Antarctic hyperarid soils and may serve as a starting point for future studies targeting specific viral groups. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Methods for determining the genetic affinity of microorganisms and viruses

NASA Technical Reports Server (NTRS)

Fox, George E. (Inventor); Willson, III, Richard C. (Inventor); Zhang, Zhengdong (Inventor)

2012-01-01

Selecting which sub-sequences in a database of nucleic acid such as 16S rRNA are highly characteristic of particular groupings of bacteria, microorganisms, fungi, etc. on a substantially phylogenetic tree. Also applicable to viruses comprising viral genomic RNA or DNA. A catalogue of highly characteristic sequences identified by this method is assembled to establish the genetic identity of an unknown organism. The characteristic sequences are used to design nucleic acid hybridization probes that include the characteristic sequence or its complement, or are derived from one or more characteristic sequences. A plurality of these characteristic sequences is used in hybridization to determine the phylogenetic tree position of the organism(s) in a sample. Those target organisms represented in the original sequence database and sufficient characteristic sequences can identify to the species or subspecies level. Oligonucleotide arrays of many probes are especially preferred. A hybridization signal can comprise fluorescence, chemiluminescence, or isotopic labeling, etc.; or sequences in a sample can be detected by direct means, e.g. mass spectrometry. The method's characteristic sequences can also be used to design specific PCR primers. The method uniquely identifies the phylogenetic affinity of an unknown organism without requiring prior knowledge of what is present in the sample. Even if the organism has not been previously encountered, the method still provides useful information about which phylogenetic tree bifurcation nodes encompass the organism.

High quality draft genome sequence of Janthinobacterium psychrotolerans sp. nov., isolated from a frozen freshwater pond.

PubMed

Gong, Xianzhe; Skrivergaard, Stig; Korsgaard, Benjamin Smed; Schreiber, Lars; Marshall, Ian P G; Finster, Kai; Schramm, Andreas

2017-01-01

Strain S3-2 T , isolated from sediment of a frozen freshwater pond, shares 99% 16S rRNA gene sequence identity with strains of the genus Janthinobacterium . Strain S3-2 T is a facultative anaerobe that lacks the ability to produce violacein but shows antibiotic resistance, psychrotolerance, incomplete denitrification, and fermentation. The draft genome of strain S3-2 T has a size of ~5.8 Mbp and contains 5,297 genes, including 115 RNA genes. Based on the phenotypic properties of the strain, the low in silico DNA-DNA hybridization (DDH) values with related genomes (<35%), and the low whole genome-based average nucleotide identity (ANI) (<86%) with other strains within the genus Janthinobacterium, we propose that strain S3-2 T is the type strain (= DSM 102223 = LMG 29653) of a new species within this genus. We propose the name Janthinobacterium psychrotolerans sp. nov. to emphasize the capability of the strain to grow at low temperatures.

Isolation, antimicrobial activities, and primary structures of hamster neutrophil defensins.

PubMed Central

Mak, P; Wójcik, K; Thogersen, I B; Dubin, A

1996-01-01

Hamster (Mesocricetus auratus) neutrophil granules contain at least four microbicidal peptides belonging to the defensin family. These compounds were purified from granule acid extracts by reverse-phase chromatography and termed HaNP-1 to -4 (hamster neutrophil peptide). HaNP-1 and HaNP-3 revealed the most bactericidal activity, with a 50% inhibitory concentration of 0.3 to 0.8 microg/ml for Staphylococcus aureus and Streptococcus pyogenes strains. The HaNP-4 was always isolated in concentrations exceeding about 10 times the concentrations of other hamster peptides, but its antibacterial activity as well as that of HaNP-2 was relatively lower, probably as a result of conserved Arg residue substitutions. Other microorganisms were also tested, and generally, hamster defensins exhibited less potency against gram-negative bacteria. The amino acid sequence of hamster defensins showed a high percentage of identity to the sequence of mouse enteric defensins, reaching about 60% identical residues in the case of HaNP-3 and cryptdin 3. PMID:8890190

Molecular characterization of the amplified carboxylesterase gene associated with organophosphorus insecticide resistance in the brown planthopper, Nilaparvata lugens.

PubMed

Small, G J; Hemingway, J

2000-12-01

Widespread resistance to organophosphorus insecticides (OPs) in Nilaparvata lugens is associated with elevation of carboxylesterase activity. A cDNA encoding a carboxylesterase, Nl-EST1, has been isolated from an OP-resistant Sri Lankan strain of N. lugens. The full-length cDNA codes for a 547-amino acid protein with high homology to other esterases/lipases. Nl-EST1 has an N-terminal hydrophobic signal peptide sequence of 24 amino acids which suggests that the mature protein is secreted from cells expressing it. The nucleotide sequence of the homologue of Nl-EST1 in an OP-susceptible, low esterase Sri Lankan strain of N. lugens is identical to Nl-EST1. Southern analysis of genomic DNA from the Sri Lankan OP-resistant and susceptible strains suggests that Nl-EST1 is amplified in the resistant strain. Therefore, resistance to OPs in the Sri Lankan strain is through amplification of a gene identical to that found in the susceptible strain.

Candida utilis and Cyberlindnera (Pichia) jadinii: yeast relatives with expanding applications.

PubMed

Buerth, Christoph; Tielker, Denis; Ernst, Joachim F

2016-08-01

The yeast Candida utilis is used as a food additive and as a host for heterologous gene expression to produce various metabolites and proteins. Reliable protocols for intracellular production of recombinant proteins are available for C. utilis and have now been expanded to secrete proteins into the growth medium or to achieve surface display by linkage to a cell wall protein. A recombinant C. utilis strain was recently shown to induce oral tolerance in a mouse model of multiple sclerosis suggesting future applications in autoimmune therapy. Whole genome sequencing of C. utilis and its presumed parent Cyberlindnera (Pichia) jadinii demonstrated different ploidy but high sequence identity, consistent with identical recombinant technologies for both yeasts. C. jadinii was recently described as an antagonist to the important human fungal pathogen Candida albicans suggesting its use as a probiotic agent. The review summarizes the status of recombinant protein production in C. utilis, as well as current and future biotechnological and medical applications of C. utilis and C. jadinii.

Bioinformatic Analysis Reveals Archaeal tRNATyr and tRNATrp Identities in Bacteria

PubMed Central

Mukai, Takahito; Reynolds, Noah M.; Crnković, Ana; Söll, Dieter

2017-01-01

The tRNA identity elements for some amino acids are distinct between the bacterial and archaeal domains. Searching in recent genomic and metagenomic sequence data, we found some candidate phyla radiation (CPR) bacteria with archaeal tRNA identity for Tyr-tRNA and Trp-tRNA synthesis. These bacteria possess genes for tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase (TrpRS) predicted to be derived from DPANN superphylum archaea, while the cognate tRNATyr and tRNATrp genes reveal bacterial or archaeal origins. We identified a trace of domain fusion and swapping in the archaeal-type TyrRS gene of a bacterial lineage, suggesting that CPR bacteria may have used this mechanism to create diverse proteins. Archaeal-type TrpRS of bacteria and a few TrpRS species of DPANN archaea represent a new phylogenetic clade (named TrpRS-A). The TrpRS-A open reading frames (ORFs) are always associated with another ORF (named ORF1) encoding an unknown protein without global sequence identity to any known protein. However, our protein structure prediction identified a putative HIGH-motif and KMSKS-motif as well as many α-helices that are characteristic of class I aminoacyl-tRNA synthetase (aaRS) homologs. These results provide another example of the diversity of molecular components that implement the genetic code and provide a clue to the early evolution of life and the genetic code. PMID:28230768

Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan.

PubMed

Chang, Jenn-Tzong; Yang, Chih-Shiang; Chen, Bao-Chen; Chen, Yao-Shen; Chang, Tsung-Hsien

2017-11-01

The first human parechovirus 3 (HPeV3 VGHKS-2007) in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection. Copyright © 2017. Published by Elsevier Taiwan LLC.

Genetic variation in potential Giardia vaccine candidates cyst wall protein 2 and α1-giardin.

PubMed

Radunovic, Matej; Klotz, Christian; Saghaug, Christina Skår; Brattbakk, Hans-Richard; Aebischer, Toni; Langeland, Nina; Hanevik, Kurt

2017-08-01

Giardia is a prevalent intestinal parasitic infection. The trophozoite structural protein a1-giardin (a1-g) and the cyst protein cyst wall protein 2 (CWP2) have shown promise as Giardia vaccine antigen candidates in murine models. The present study assesses the genetic diversity of a1-g and CWP2 between and within assemblages A and B in human clinical isolates. a1-g and CWP2 sequences were acquired from 15 Norwegian isolates by PCR amplification and 20 sequences from German cultured isolates by whole genome sequencing. Sequences were aligned to reference genomes from assemblage A2 and B to identify genetic variance. Genetic diversity was found between assemblage A and B reference sequences for both a1-g (90.8% nucleotide identity) and CWP2 (82.5% nucleotide identity). However, for a1-g, this translated into only 3 amino acid (aa) substitutions, while for CWP2 there were 41 aa substitutions, and also one aa deletion. Genetic diversity within assemblage B was larger; nucleotide identity 92.0% for a1-g and 94.3% for CWP2, than within assemblage A (nucleotide identity 99.0% for a1-g and 99.7% for CWP2). For CWP2, the diversity on both nucleotide and protein level was higher in the C-terminal end. Predicted antigenic epitopes were not affected for a1-g, but partially for CWP2. Despite genetic diversity in a1-g, we found aa sequence, characteristics, and antigenicity to be well preserved. CWP2 showed more aa variance and potential antigenic differences. Several CWP2 antigens might be necessary in a future Giardia vaccine to provide cross protection against both Giardia assemblages infecting humans.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

PubMed

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Molecular characterization of two prunus necrotic ringspot virus isolates from Canada.

PubMed

Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

2012-05-01

We determined the entire RNA1, 2 and 3 sequences of two prunus necrotic ringspot virus (PNRSV) isolates, Chr3 from cherry and Pch12 from peach, obtained from an orchard in the Niagara Fruit Belt, Canada. The RNA1, 2 and 3 of the two isolates share nucleotide sequence identities of 98.6%, 98.4% and 94.5%, respectively. Their RNA1- and 2-encoded amino acid sequences are about 98% identical to the corresponding sequences of a cherry isolate, CH57, the only other PNRSV isolate with complete RNA1 and 2 sequences available. Phylogenetic analysis of the coat protein and movement protein encoded by RNA3 of Pch12 and Chr3 and published PNRSV isolates indicated that Chr3 belongs to the PV96 group and Pch12 belongs to the PV32 group.

Prevalence and genetic heterogeneity of porcine group C rotaviruses in nursing and weaned piglets in Ohio, USA and identification of a potential new VP4 genotype.

PubMed

Amimo, J O; Vlasova, A N; Saif, L J

2013-05-31

Swine fecal samples collected from seven farms were screened for group C rotaviruses (RVCs) using a reverse transcription-polymerase chain reaction assay. A total of 380 samples were tested and 19.5% were positive. Of the 128 samples collected in 2012, 23.5% from nursing piglets and 8.5% from weaned piglets were RVC positive, with a higher RVC frequency in diarrheic (28.4%) than in non-diarrheic (6.6%) piglets. Two strains (RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px) from two different farms were characterized genetically to gain information on virus diversity based on full length sequences of the inner capsid VP6, enterotoxin NSP4 and the outer capsid VP7 and VP4 (partial for RV0104) genes. The VP6 gene of the two strains showed high (99%) nucleotide identity to one another, 84-91% identity to other porcine RVCstrains and 81-82% identity to human and bovine RVC strains. The NSP4 gene analysis revealed that RVC/Pig-wt/USA/RV0104/2011/G3PX and RVC/Pig-wt/USA/RV0143/2012/G6Px strains were not closely related to each other (87% identity), but shared higher identity with prototype RVC/Pig-wt/USA/Cowden/1980/G1Px strain (93% and 89%, respectively) and were more distantly related to human strains (72-76% identity). The VP7 gene analysis indicated that the two strains were distantly related to one another (72% identity). RVC/Pig-wt/USA/RV0143/2012/G6Px was most closely related to porcine RVC G6 strains (82-86% identity), whereas RVC/Pig-wt/USA/RV0104/2011/G3PX was most closely related to porcine HF (G3) strain (94% identity). Analysis of the full length nucleotide sequence of the VP4 gene revealed that RVC/Pig-wt/USA/RV0143/2012/G6Px was distantly related to porcine (75%), bovine (74%) and human (70%) strains. The deduced amino acid identities (69.5-75.6%) of VP4 between RVC/Pig-wt/USA/RV0143/2012/G6Px and other RVCs were low; hence, we propose that this strain comprises a new VP4 genotype. Our results indicate high genetic heterogeneity in RVCs genes and the concurrent co-circulation of different genotypes at the same time. Our findings are useful for the development of more accurate diagnostic tools, for basic research to understand gene function and to provide information for RVC diversity germane to vaccine development. Copyright © 2013 Elsevier B.V. All rights reserved.

FragIdent--automatic identification and characterisation of cDNA-fragments.

PubMed

Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

2009-03-02

Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

PubMed

Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G

2018-06-01

Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

Molecular differentiation and pathogenicity of Aviadenoviruses isolated during an outbreak of inclusion body hepatitis in South Africa.

PubMed

Joubert, Hilda W; Aitchison, Henry; Maartens, Louis H; Venter, Estelle H

2014-11-05

Fowl adenovirus (FAdV) is a member of the genus Aviadenovirus and causes a number of economically important poultry diseases. One of these diseases, inclusion body hepatitis (IBH), has a worldwide distribution and is characterised by acute mortality (5% - 20%) in production chickens. The disease was first described in the United States of America in 1963 and has also been reported in Canada, the United Kingdom, Australia, France and Ireland, but until now, not in South Africa. Adenoviruses isolated from the first outbreak of IBH in South Africa were able to reproduce the disease in chicken embryo livers. The aim of the present study was to characterise the viruses and determine the pathogenicity of the FAdV strains responsible for the first reported case of IBH in South Africa. Polymerase chain reaction (PCR) amplification of the L1 loop region of the fowl adenovirus hexon gene using degenerate primer pair hexon A/B was used to identify the viruses that were isolated. Restriction fragment length polymorphism (RFLP) of the amplification products was used for the differentiation of 14 isolates of fowl adenovirus. Sequencing of the PCR products followed by amino acid comparison and phylogenetic analysis using the L1 loop region of the hexon protein was done to determine the identity of the isolates. Amino acid sequences of the hexon genes of all the South African isolates were compared with those of reference strains representing FAdV species. Amino acid comparison of 12 South Africa field isolates to FAdV reference strains revealed a high sequence identity (> 93.33%) with reference strains T8-A and 764. Two of the isolates had high sequence identity (93.40%) with reference strains P7-A, C2B and SR48. Phylogenetic analysis of the L1 loop region of the hexon protein of all 14 South African isolates was consistent with their RFLP clusters. The mortality rates of embryos challenged with 106 egg infective doses (EID50) FAdV 2 were 80% - 87% and mortality rates for embryos challenged with 105.95 (EID50) FAdV 8b were 65% - 80%.

Sequences Associated with Centromere Competency in the Human Genome

PubMed Central

Hayden, Karen E.; Strome, Erin D.; Merrett, Stephanie L.; Lee, Hye-Ran; Rudd, M. Katharine

2013-01-01

Centromeres, the sites of spindle attachment during mitosis and meiosis, are located in specific positions in the human genome, normally coincident with diverse subsets of alpha satellite DNA. While there is strong evidence supporting the association of some subfamilies of alpha satellite with centromere function, the basis for establishing whether a given alpha satellite sequence is or is not designated a functional centromere is unknown, and attempts to understand the role of particular sequence features in establishing centromere identity have been limited by the near identity and repetitive nature of satellite sequences. Utilizing a broadly applicable experimental approach to test sequence competency for centromere specification, we have carried out a genomic and epigenetic functional analysis of endogenous human centromere sequences available in the current human genome assembly. The data support a model in which functionally competent sequences confer an opportunity for centromere specification, integrating genomic and epigenetic signals and promoting the concept of context-dependent centromere inheritance. PMID:23230266

Frequent Hepatitis E Virus Contamination in Food Containing Raw Pork Liver, France

PubMed Central

Merbah, Thiziri; Thébault, Anne

2014-01-01

Food products containing raw pork liver are suspected to be vehicles for transmission of hepatitis E virus. Four categories of food products, comprising 394 samples, were analyzed to determine hepatitis E virus prevalence. Virus was detected in 3%–30% of the different categories. Phylogenetic analysis showed high identity with human and swine sequences. PMID:25340373

Complete genome sequence of southern tomato virus identified from China using next generation sequencing

USDA-ARS?s Scientific Manuscript database

Complete genome sequence of a double-stranded RNA (dsRNA) virus, southern tomato virus (STV), on tomatoes in China, was elucidated using small RNAs deep sequencing. The identified STV_CN12 shares 99% sequence identity to other isolates from Mexico, France, Spain, and U.S. This is the first report ...

Triple infection with agamid adenovirus 1, Encephaliton cuniculi-like microsporidium and enteric coccidia in a bearded dragon (Pogona vitticeps).

PubMed

Schilliger, Lionel; Mentré, Véronique; Marschang, Rachel E; Nicolier, Alexandra; Richter, Barbara

2016-10-12

A 2-month-old juvenile central bearded dragon was presented for anorexia and cachexia. Another specimen from the same cage had died suddenly 2 weeks prior. Fecal analysis revealed a high quantity of Isospora amphiboluri and a few pinworm eggs. Other examinations were not performed and the animal died a few days later despite supportive care. A third individual from the same cage presented with anorexia and a distended cœlom and was euthanized. In this third dragon, histological examination revealed intestinal coccidiosis, basophilic intranuclear inclusions compatible with adenovirus infection, acute hepatic necrosis with intrahepatocytic and intraenteritic organisms typical of microsporidia and renal gout. A PCR confirmed the diagnosis of adenovirosis. Sequencing showed that the PCR product was 100% identical to the corresponding portion of the agamid adenovirus 1 genome. A PCR for the detection of Encephalitozoon (E.) cuniculi was positive. Partial sequencing revealed 100% identity to an E. cuniculi-like organism previously found in bearded dragons. In cases where environmental factors such as poor hygiene or stress can be excluded, the presence of opportunistic pathogens in high numbers can be due to a systemic (viral) infection with temporary immunosuppression.

The Perils of Pathogen Discovery: Origin of a Novel Parvovirus-Like Hybrid Genome Traced to Nucleic Acid Extraction Spin Columns

PubMed Central

Naccache, Samia N.; Greninger, Alexander L.; Lee, Deanna; Coffey, Lark L.; Phan, Tung; Rein-Weston, Annie; Aronsohn, Andrew; Hackett, John; Delwart, Eric L.

2013-01-01

Next-generation sequencing was used for discovery and de novo assembly of a novel, highly divergent DNA virus at the interface between the Parvoviridae and Circoviridae. The virus, provisionally named parvovirus-like hybrid virus (PHV), is nearly identical by sequence to another DNA virus, NIH-CQV, previously detected in Chinese patients with seronegative (non-A-E) hepatitis. Although we initially detected PHV in a wide range of clinical samples, with all strains sharing ∼99% nucleotide and amino acid identity with each other and with NIH-CQV, the exact origin of the virus was eventually traced to contaminated silica-binding spin columns used for nucleic acid extraction. Definitive confirmation of the origin of PHV, and presumably NIH-CQV, was obtained by in-depth analyses of water eluted through contaminated spin columns. Analysis of environmental metagenome libraries detected PHV sequences in coastal marine waters of North America, suggesting that a potential association between PHV and diatoms (algae) that generate the silica matrix used in the spin columns may have resulted in inadvertent viral contamination during manufacture. The confirmation of PHV/NIH-CQV as laboratory reagent contaminants and not bona fide infectious agents of humans underscores the rigorous approach needed to establish the validity of new viral genomes discovered by next-generation sequencing. PMID:24027301

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Isolation and characterization of two cryptic plasmids in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

PubMed

Yamagata, A; Kato, J; Hirota, R; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

1999-06-01

Two plasmids were discovered in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11, which was isolated from activated sludge. The plasmids, designated pAYS and pAYL, were relatively small, being approximately 1.9 kb long. They were cryptic plasmids, having no detectable plasmid-linked antibiotic resistance or heavy metal resistance markers. The complete nucleotide sequences of pAYS and pAYL were determined, and their physical maps were constructed. There existed two major open reading frames, ORF1 in pAYS and ORF2 in pAYL, each of which was more than 500 bp long. The predicted product of ORF2 was 28% identical to part of the replication protein of a Bacillus plasmid, pBAA1. However, no significant similarity to any known protein sequences was detected with the predicted product of ORF1. pAYS and pAYL had a highly homologous region, designated HHR, of 262 bp. The overall identity was 98% between the two nucleotide sequences. Interestingly, HHR-homologous sequences were also detected in the genomes of ENI-11 and the plasmidless strain Nitrosomonas europaea IFO14298. Deletion analysis of pAYS and pAYL indicated that HHR, together with either ORF1 or ORF2, was essential for plasmid maintenance in ENI-11. To our knowledge, pAYS and pAYL are the first plasmids found in the ammonia-oxidizing autotrophic bacteria.

Candida mesorugosa sp. nov., a novel yeast species similar to Candida rugosa, isolated from a tertiary hospital in Brazil.

PubMed

Chaves, Guilherme M; Terçarioli, Gisela R; Padovan, Ana Carolina B; Rosas, Robert C; Ferreira, Renata C; Melo, Analy S A; Colombo, Arnaldo L

2013-04-01

Candida rugosa is a yeast species that is emerging as a causative agent of invasive infection, particularly in Latin America. Recently, C. pseudorugosa was proposed as a new species closely related to C. rugosa. We evaluated in this investigation the genetic heterogeneity within the C. rugosa species complex. All clinical isolates used in this study were identified phenotypically as C. rugosa but were genotypically different from the C. rugosa type, ATCC 10571. RAPD marker analysis revealed less than 83% similarity between our clinical isolates and the C. rugosa type strain. The D1/D2 region sequences of our clinical isolates showed 98% identity with C. rugosa but only 94-95% identity with C. pseudorugosa. The ITS rDNA sequences of the Brazilian isolates showed 91% identity with the C. rugosa ATCC 10571 ITS sequence. Network and Bayesian analyses of ITS and housekeeping gene sequences separated our clinical isolates into different branches from C. rugosa type strain. These differences are sufficient to reassign our isolates to a distinct species, named C. mesorugosa.

Examining social identity and intrateam moral behaviours in competitive youth ice hockey using stimulated recall.

PubMed

Bruner, Mark W; Boardley, Ian D; Allan, Veronica; Root, Zach; Buckham, Sara; Forrest, Chris; Côté, Jean

2017-10-01

Social identity - identity formed through membership in groups - may play an important role in regulating intrateam moral behaviour in youth sport (Bruner, M. W., Boardley, I., & Côté, J. (2014). Social identity and prosocial and antisocial behavior in youth sport. Psychology of Sport and Exercise, 15(1), 56-64. doi:10.1016/j.psychsport.2013.09.003). The aim of this study was to qualitatively examine this potential role through stimulated recall interviews with competitive youth-ice-hockey players. Twenty-three players (M age  = 13.27 years, SD = 1.79) who reported engaging in high, median or low frequency of antisocial teammate behaviour (determined through pre-screening with the Prosocial and Antisocial Behaviour in Sport Scale [Kavussanu, M., & Boardley, I. D. (2009). The prosocial and antisocial behavior in sport scale. Journal of Sport and Exercise Psychology, 31(1), 97-117. doi:10.1123/jsep.31.1.97]) were recruited from eight youth-ice-hockey teams in Canada. Interviews involved participants recalling their thoughts during prosocial/antisocial interactions with teammates, prompted by previously recorded video sequences of such incidents. Thematic analysis of interview data revealed all athletes - regardless of reported frequency of intrateam antisocial behaviour - felt prosocial interactions with teammates enhanced social identity. In contrast, the perceived influence of antisocial teammate behaviour on social identity differed depending on athletes' reported frequency of intrateam antisocial behaviour; those reporting low and median frequencies described how such behaviour undermines social identity, whereas athletes reporting high frequency did not perceive this effect. The study findings highlight the potential importance of intrateam moral behaviour and social identity for youth-sport team functioning.

The Species Identity of the Widely Cultivated Ganoderma, ‘G. lucidum’ (Ling-zhi), in China

PubMed Central

Wang, Xin-Cun; Xi, Rui-Jiao; Li, Yi; Wang, Dong-Mei; Yao, Yi-Jian

2012-01-01

Ling-zhi, a widely cultivated fungus in China, has a long history in traditional Chinese medicine. Although the name ‘Ganoderma lucidum’, a species originally described from England, has been applied to the fungus, their identities are not the same. This study aims to clarify the identity of this medicinally and economically important fungus. Specimens of Ling-zhi from China (field collections and cultivated basidiomata of the Chinese ‘G. lucidum’), G. lucidum from UK and other related Ganoderma species, were examined both morphologically and molecularly. High variability of basidioma morphology was found in the cultivated specimens of the Chinese ‘G. lucidum’, while some microscopic characters were more or less consistent, i.e. short clavate cutis elements, Bovista-type ligative hyphae and strongly echinulate basidiospores. These characters were also found in the holotype of G. sichuanense, a species originally described from Sichuan, China, and in recent collections made in the type locality of the species, which matched the diagnostic characters in the prologue. For comparison, specimens of closely related species, G. lucidum, G. multipileum, G. resinaceum, G. tropicum and G. weberianum, were also examined. DNA sequences were obtained from field collections, cultivated basidiomata and living strains of the Chinese ‘G. lucidum’, specimens from the type locality of G. sichuanense, and specimens of the closely related species studied. Three-gene combined analyses (ITS+IGS+rpb2) were performed and the results indicated that the Chinese ‘G. lucidum’ shared almost identical sequences with G. sichuanense. Based on both morphological and molecular data, the identity of the Chinese ‘G. lucidum’ (Ling-zhi) is considered conspecific with G. sichuanense. Detailed morphological descriptions and illustrations are provided in addition to discussion of nomenclature implications. PMID:22911713

Petroleum hydrocarbon contamination, plant identity and arbuscular mycorrhizal fungal (AMF) community determine assemblages of the AMF spore-associated microbes.

PubMed

Iffis, Bachir; St-Arnaud, Marc; Hijri, Mohamed

2016-09-01

The root-associated microbiome is a key determinant of pollutant degradation, soil nutrient availability and plant biomass productivity, but could not be examined in depth prior to recent advances in high-throughput sequencing. Arbuscular mycorrhizal fungi (AMF) form symbioses with the majority of vascular plants. They are known to enhance mineral uptake and promote plant growth and are postulated to influence the processes involved in phytoremediation. Amplicon sequencing approaches have previously shown that petroleum hydrocarbon pollutant (PHP) concentration strongly influences AMF community structure in in situ phytoremediation experiments. We examined how AMF communities and their spore-associated microbiomes were structured within the rhizosphere of three plant species growing spontaneously in three distinct waste decantation basins of a former petrochemical plant. Our results show that the AMF community was only affected by PHP concentrations, while the AMF-associated fungal and bacterial communities were significantly affected by both PHP concentrations and plant species identity. We also found that some AMF taxa were either positively or negatively correlated with some fungal and bacterial groups. Our results suggest that in addition to PHP concentrations and plant species identity, AMF community composition may also shape the community structure of bacteria and fungi associated with AMF spores. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Thermophilic cellobiohydrolase

DOEpatents

Sapra, Rajat; Park, Joshua I.; Datta, Supratim; Simmons, Blake A.

2017-04-18

The present invention provides for a composition comprising a polypeptide comprising a first amino acid sequence having at least 70% identity with the amino acid sequence of Csac GH5 wherein said first amino acid sequence has a thermostable or thermophilic cellobiohydrolase (CBH) or exoglucanase activity.

The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

PubMed

Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

2018-01-01

We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

The Complete Sequence of a Human Parainfluenzavirus 4 Genome

PubMed Central

Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

2009-01-01

Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

Sinorhizobium meliloti strains TII7 and A5 by Multilocus Sequence Typing (MLST) have chromsomes identical with Rm1021 and form an effective and ineffective symbiosis with Medicago truncatula line Jemalong A17, respectively

USDA-ARS?s Scientific Manuscript database

The strains TII7 and A5 formed an effective and ineffective symbiosis with Medicago truncatula Jemalong A17, respectively. Both were shown to have identical chromsomes with strains Rm1021 and RCR2011 using a Multilocus Sequence Typing method. The 2260 bp segments of DNA stretching from the 3’ end ...

Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

PubMed Central

Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

2005-01-01

The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

HPV-QUEST: A highly customized system for automated HPV sequence analysis capable of processing Next Generation sequencing data set.

PubMed

Yin, Li; Yao, Jiqiang; Gardner, Brent P; Chang, Kaifen; Yu, Fahong; Goodenow, Maureen M

2012-01-01

Next Generation sequencing (NGS) applied to human papilloma viruses (HPV) can provide sensitive methods to investigate the molecular epidemiology of multiple type HPV infection. Currently a genotyping system with a comprehensive collection of updated HPV reference sequences and a capacity to handle NGS data sets is lacking. HPV-QUEST was developed as an automated and rapid HPV genotyping system. The web-based HPV-QUEST subtyping algorithm was developed using HTML, PHP, Perl scripting language, and MYSQL as the database backend. HPV-QUEST includes a database of annotated HPV reference sequences with updated nomenclature covering 5 genuses, 14 species and 150 mucosal and cutaneous types to genotype blasted query sequences. HPV-QUEST processes up to 10 megabases of sequences within 1 to 2 minutes. Results are reported in html, text and excel formats and display e-value, blast score, and local and coverage identities; provide genus, species, type, infection site and risk for the best matched reference HPV sequence; and produce results ready for additional analyses.

Genome sequence of a distinct watermelon mosaic virus identified from ginseng (Panax ginseng) transcriptome.

PubMed

Park, D; Kim, H; Hahn, Y

Watermelon mosaic virus (WMV) is a member of the genus Potyvirus, which is the largest genus of plant viruses. WMV is a significant pathogen of crop plants, including Cucurbitaceae species. A WMV strain, designated as WMV-Pg, was identified in transcriptome data collected from ginseng (Panax ginseng) root. WMV-Pg showed 84% nucleotide sequence identity and 91% amino acid sequence identity with its closest related virus, WMV-Fr. A phylogenetic analysis of WMV-Pg with other WMVs and soybean mosaic viruses (SMVs) indicated that WMV-Pg is a distinct subtype of the WMV/SMV group of the genus Potyvirus in the family Potyviridae.

DNA-A of a highly pathogenic Indian cassava mosaic virus isolated from Jatropha curcas causes symptoms in Nicotiana benthamiana.

PubMed

Wang, Gang; Sun, Yanwei; Xu, Ruirui; Qu, Jing; Tee, Chuansia; Jiang, Xiyuan; Ye, Jian

2014-04-01

Jatropha curcas mosaic disease (JcMD) is a newly emerging disease that has been reported in Africa and India. Here, we report the complete nucleotide sequence of a new Indian cassava mosaic virus isolate (ICMV-SG) from Singapore. Infection of ICMV-SG showed more severe JcMD in Jatropha curcas and Nicotiana benthamiana than the other ICMV isolates reported previously, though ICMV-SG shares high sequence identity with the other ICMV isolates. Agroinfectious DNA-A alone sufficiently induced systemic symptoms in N. benthamiana, but not in J. curcas. Results from agroinfection assays showed that systemic infection of ICMV-SG in J. curcas required both DNA-A and DNA-B components.

Discovery of a novel retrovirus sequence in an Australian native rodent (Melomys burtoni): a putative link between gibbon ape leukemia virus and koala retrovirus.

PubMed

Simmons, Greg; Clarke, Daniel; McKee, Jeff; Young, Paul; Meers, Joanne

2014-01-01

Gibbon ape leukaemia virus (GALV) and koala retrovirus (KoRV) share a remarkably close sequence identity despite the fact that they occur in distantly related mammals on different continents. It has previously been suggested that infection of their respective hosts may have occurred as a result of a species jump from another, as yet unidentified vertebrate host. To investigate possible sources of these retroviruses in the Australian context, DNA samples were obtained from 42 vertebrate species and screened using PCR in order to detect proviral sequences closely related to KoRV and GALV. Four proviral partial sequences totalling 2880 bases which share a strong similarity with KoRV and GALV were detected in DNA from a native Australian rodent, the grassland melomys, Melomys burtoni. We have designated this novel gammaretrovirus Melomys burtoni retrovirus (MbRV). The concatenated nucleotide sequence of MbRV shares 93% identity with the corresponding sequence from GALV-SEATO and 83% identity with KoRV. The geographic ranges of the grassland melomys and of the koala partially overlap. Thus a species jump by MbRV from melomys to koalas is conceivable. However the genus Melomys does not occur in mainland South East Asia and so it appears most likely that another as yet unidentified host was the source of GALV.

An approach for identification of unknown viruses using sequencing-by-hybridization.

PubMed

Katoski, Sarah E; Meyer, Hermann; Ibrahim, Sofi

2015-09-01

Accurate identification of biological threat agents, especially RNA viruses, in clinical or environmental samples can be challenging because the concentration of viral genomic material in a given sample is usually low, viral genomic RNA is liable to degradation, and RNA viruses are extremely diverse. A two-tiered approach was used for initial identification, then full genomic characterization of 199 RNA viruses belonging to virus families Arenaviridae, Bunyaviridae, Filoviridae, Flaviviridae, and Togaviridae. A Sequencing-by-hybridization (SBH) microarray was used to tentatively identify a viral pathogen then, the identity is confirmed by guided next-generation sequencing (NGS). After optimization and evaluation of the SBH and NGS methodologies with various virus species and strains, the approach was used to test the ability to identify viruses in blinded samples. The SBH correctly identified two Ebola viruses in the blinded samples within 24 hr, and by using guided amplicon sequencing with 454 GS FLX, the identities of the viruses in both samples were confirmed. SBH provides at relatively low-cost screening of biological samples against a panel of viral pathogens that can be custom-designed on a microarray. Once the identity of virus is deduced from the highest hybridization signal on the SBH microarray, guided (amplicon) NGS sequencing can be used not only to confirm the identity of the virus but also to provide further information about the strain or isolate, including a potential genetic manipulation. This approach can be useful in situations where natural or deliberate biological threat incidents might occur and a rapid response is required. © 2015 Wiley Periodicals, Inc.

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

PubMed

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes

PubMed Central

Saski, Christopher; Lee, Seung-Bum; Fjellheim, Siri; Guda, Chittibabu; Jansen, Robert K.; Luo, Hong; Tomkins, Jeffrey; Rognli, Odd Arne; Clarke, Jihong Liu

2009-01-01

Comparisons of complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera to six published grass chloroplast genomes reveal that gene content and order are similar but two microstructural changes have occurred. First, the expansion of the IR at the SSC/IRa boundary that duplicates a portion of the 5′ end of ndhH is restricted to the three genera of the subfamily Pooideae (Agrostis, Hordeum and Triticum). Second, a 6 bp deletion in ndhK is shared by Agrostis, Hordeum, Oryza and Triticum, and this event supports the sister relationship between the subfamilies Erhartoideae and Pooideae. Repeat analysis identified 19–37 direct and inverted repeats 30 bp or longer with a sequence identity of at least 90%. Seventeen of the 26 shared repeats are found in all the grass chloroplast genomes examined and are located in the same genes or intergenic spacer (IGS) regions. Examination of simple sequence repeats (SSRs) identified 16–21 potential polymorphic SSRs. Five IGS regions have 100% sequence identity among Zea mays, Saccharum officinarum and Sorghum bicolor, whereas no spacer regions were identical among Oryza sativa, Triticum aestivum, H. vulgare and A. stolonifera despite their close phylogenetic relationship. Alignment of EST sequences and DNA coding sequences identified six C–U conversions in both Sorghum bicolor and H. vulgare but only one in A. stolonifera. Phylogenetic trees based on DNA sequences of 61 protein-coding genes of 38 taxa using both maximum parsimony and likelihood methods provide moderate support for a sister relationship between the subfamilies Erhartoideae and Pooideae. PMID:17534593

Complete genome sequence of a tomato infecting tomato mottle mosaic virus in New York

USDA-ARS?s Scientific Manuscript database

Complete genome sequence of an emerging isolate of tomato mottle mosaic virus (ToMMV) infecting experimental nicotianan benthamiana plants in up-state New York was obtained using small RNA deep sequencing. ToMMV_NY-13 shared 99% sequence identity to ToMMV isolates from Mexico and Florida. Broader d...

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Mitrocomin from the jellyfish Mitrocoma cellularia with deleted C-terminal tyrosine reveals a higher bioluminescence activity compared to wild type photoprotein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burakova, Ludmila P.; Natashin, Pavel V.; Markova, Svetlana V.

The full-length cDNA genes encoding five new isoforms of Ca2 +-regulated photoprotein mitrocomin from a small tissue sample of the outer bell margin containing photocytes of only one specimen of the luminous jellyfish Mitrocoma cellularia were cloned, sequenced, and characterized after their expression in Escherichia coli and subsequent purification. The analysis of cDNA nucleotide sequences encoding mitrocomin isoforms allowed suggestion that two isoforms might be the products of two allelic genes differing in one amino acid residue (64R/Q) whereas other isotypes appear as a result of transcriptional mutations. In addition, the crystal structure of mitrocomin was determined at 1.30 Åmore » resolution which expectedly revealed a high similarity with the structures of other hydromedusan photoproteins. Although mitrocomin isoforms reveal a high degree of identity of amino acid sequences, they vary in specific bioluminescence activities. At that, all isotypes displayed the identical bioluminescence spectra (473–474 nm with no shoulder at 400 nm). Fluorescence spectra of Ca2 +-discharged mitrocomins were almost identical to their light emission spectra similar to the case of Ca2 +-discharged aequorin, but different from Ca2 +-discharged obelins and clytin which fluorescence is red-shifted by 25–30 nm from bioluminescence spectra. The main distinction of mitrocomin from other hydromedusan photoproteins is an additional Tyr at the C-terminus. Using site-directed mutagenesis, we showed that this Tyr is not important for bioluminescence because its deletion even increases specific activity and efficiency of apo-mitrocomin conversion into active photoprotein, in contrast to C-terminal Pro of other photoproteins. Since genes in a population generally exist as different isoforms, it makes us anticipate the cloning of even more isoforms of mitrocomin and other hydromedusan photoproteins with different bioluminescence properties.« less

New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain.

PubMed

Criado-Fornelio, A; Rey-Valeiron, C; Buling, A; Barba-Carretero, J C; Jefferies, R; Irwin, P

2007-03-31

The prevalence of hematozoan infections (Hepatozoon canis and Babesia sp., particularly Babesia canis vogeli) in canids from Venezuela, Thailand and Spain was studied by amplification and sequencing of the 18S rRNA gene. H. canis infections caused simultaneously by two different isolates were confirmed by RFLP analysis in samples from all the geographic regions studied. In Venezuela, blood samples from 134 dogs were surveyed. Babesia infections were found in 2.24% of the dogs. Comparison of sequences of the 18S rRNA gene indicated that protozoan isolates were genetically identical to B. canis vogeli from Japan and Brazil. H. canis infected 44.77 per cent of the dogs. A representative sample of Venezuelan H. canis isolates (21.6% of PCR-positives) was sequenced. Many of them showed 18S rRNA gene sequences identical to H. canis Spain 2, albeit two less frequent genotypes were found in the sample studied. In Thailand, 20 dogs were analyzed. No infections caused by Babesia were diagnosed, whereas 30 per cent of the dogs were positive to hematozoan infection. Two protozoa isolates showing 99.7-100% identity to H. canis Spain 2 were found. In Spain, 250 dogs were studied. B. canis vogeli infected 0.01% of the animals. The sequence of the 18S rRNA gene in Spanish isolates of this protozoa was closely related to those previously deposited in GenBank (> 99% identity). Finally, 20 red foxes were screened for hematozoans employing semi-nested PCR and primers designed to detect Babesia/Theileria. Fifty percent of the foxes were positive to Theileria annae. In addition, it was found that the PCR assay was able as well to detect Hepatozoon infections. Thirty five percent of the foxes were infected with two different H. canis isolates showing 99.8-100% identity to Curupira 1 from Brazil.

Identity of Fasciola spp. in sheep in Egypt.

PubMed

Amer, Said; ElKhatam, Ahmed; Zidan, Shereif; Feng, Yaoyu; Xiao, Lihua

2016-12-01

In Egypt, liver flukes, Fasciola spp. (Digenea: Fasciolidae), have a serious impact on the farming industry and public health. Both Fasciola hepatica and Fasciola gigantica are known to occur in cattle, providing the opportunity for genetic recombination. Little is known on the identity and genetic variability of Fasciola populations in sheep. This study was performed to determine the prevalence of liver flukes in sheep in Menofia Province as a representative area of the delta region in Egypt, as measured by postmortem examination of slaughtered animals at three abattoirs. The identity and genetic variability of Fasciola spp. in slaughtered animals were determined by PCR-sequence analysis of the nuclear ribosomal internal transcribed spacer 1 (ITS1) and the mitochondrial NADH dehydrogenase subunit 1 (nad1) genes. Physical inspection of the liver indicated that 302 of 2058 (14.7%) slaughtered sheep were infected with Fasciola spp. Sequence analysis of the ITS1 and nad1 genes of liver flukes from 17 animals revealed that 11 animals were infected with F. hepatica, four with F. gigantica, and two with both species. Seventy eight of 103 flukes genetically characterized from these animals were F. hepatica, 23 were F. gigantica, and two had ITS1 sequences identical to F. hepatica but nad1 sequences identical to F. gigantica. nad1 sequences of Egyptian isolates of F. gigantica showed pronounced differences from those in the GenBank database. Egyptian F. gigantica haplotypes formed haplogroup D, which clustered in a sister clade with haplogroups A, B and C circulating in Asia, indicating the existence of geographic isolation in the species. Both F. hepatica and F. gigantica are prevalent in sheep in Egypt and an introgressed form of the two occurs as the result of genetic recombination. In addition, a geographically isolated F. gigantica population is present in the country. The importance of these observations in epidemiology of fascioliasis needs to be examined in future studies.

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

PubMed

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization, genetic diversity, and evolutionary link of Cucumber mosaic virus strain New Delhi from India.

PubMed

Koundal, Vikas; Haq, Qazi Mohd Rizwanul; Praveen, Shelly

2011-02-01

The genome of Cucumber mosaic virus New Delhi strain (CMV-ND) from India, obtained from tomato, was completely sequenced and compared with full genome sequences of 14 known CMV strains from subgroups I and II, for their genetic diversity. Sequence analysis suggests CMV-ND shares maximum sequence identity at the nucleotide level with a CMV strain from Taiwan. Among all 15 strains of CMV, the encoded protein 2b is least conserved, whereas the coat protein (CP) is most conserved. Sequence identity values and phylogram results indicate that CMV-ND belongs to subgroup I. Based on the recombination detection program result, it appears that CMV is prone to recombination, and different RNA components of CMV-ND have evolved differently. Recombinational analysis of all 15 CMV strains detected maximum recombination breakpoints in RNA2; CP showed the least recombination sites.

Molecular characterization of Atractolytocestus sagittatus (Cestoda: Caryophyllidea), monozoic parasite of common carp, and its differentiation from the invasive species Atractolytocestus huronensis.

PubMed

Bazsalovicsová, Eva; Králová-Hromadová, Ivica; Stefka, Jan; Scholz, Tomáš

2012-05-01

Sequence structure of complete internal transcribed spacer 1 and 2 (ITS1 and ITS2) of the ribosomal DNA region and partial mitochondrial cytochrome c oxidase subunit I (cox1) gene sequences were studied in the monozoic tapeworm Atractolytocestus sagittatus (Kulakovskaya et Akhmerov, 1965) (Cestoda: Caryophyllidea), a parasite of common carp (Cyprinus carpio carpio L.). Intraindividual sequence diversity was observed in both ribosomal spacers. In ITS1, a total number of 19 recombinant clones yielded eight different sequence types (pairwise sequence identity, 99.7-100%) which, however, did not resemble the structure typical for divergent intragenomic ITS copies (paralogues). Polymorphism was displayed by several single nucleotide mutations present exclusively in single clones, but variation in the number of short repetitive motifs was not observed. In ITS2, a total of 21 recombinant clones yielded ten different sequence types (pairwise sequence identity, 97.5-100%). They were mostly characterized by a varying number of (TCGT)(n) repeats resulting in assortment of ITS2 sequences into two sequence variants, which reflected the structure specific for ITS paralogues. The third DNA region analysed, mitochondrial cox1 gene (669 bp) was detected to be 100% identical in all studied A. sagittatus individuals. Comparison of molecular data on A. sagittatus with those on Atractolytocestus huronensis Anthony, 1958, an invasive parasite of common carp, has shown that interspecific differences significantly exceeded intraspecific variation in both ribosomal spacers (81.4-82.5% in ITS1, 74.4-75.2% in ITS2) as well as in mitochondrial cox1, which confirms validity of both congeneric tapeworms parasitic in the same fish host.

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

Hepatitis delta genotypes in chronic delta infection in the northeast of Spain (Catalonia).

PubMed

Cotrina, M; Buti, M; Jardi, R; Quer, J; Rodriguez, F; Pascual, C; Esteban, R; Guardia, J

1998-06-01

Based on genetic analysis of variants obtained around the world, three genotypes of the hepatitis delta virus have been defined. Hepatitis delta virus variants have been associated with different disease patterns and geographic distributions. To determine the prevalence of hepatitis delta virus genotypes in the northeast of Spain (Catalonia) and the correlation with transmission routes and clinical disease, we studied the nucleotide divergence of the consensus sequence of HDV RNA obtained from 33 patients with chronic delta hepatitis (24 were intravenous drug users and nine had no risk factors), and four patients with acute self-limited delta infection. Serum HDV RNA was amplified by the polymerase chain reaction technique and a fragment of 350 nucleotides (nt 910 to 1259) was directly sequenced. Genetic analysis of the nucleotide consensus sequence obtained showed a high degree of conservation among sequences (93% of mean). Comparison of these sequences with those derived from different geographic areas and pertaining to genotypes I, II and III, showed a mean sequence identity of 92% with genotype I, 73% with genotype II and 61% with genotype III. At the amino acid level (aa 115 to 214), the mean identity was 87% with genotype I, 63% with genotype II and 56% with genotype III. Conserved regions included the RNA editing domain, the carboxyl terminal 19 amino acids of the hepatitis delta antigen and the polyadenylation signal of the viral mRNA. Hepatitis delta virus isolates in the northeast of Spain are exclusively genotype I, independently of the transmission route and the type of infection. No hepatitis delta virus subgenotypes were found, suggesting that the origin of hepatitis delta virus infection in our geographical area is homogeneous.

The Origins of 168, W23, and Other Bacillus subtilis Legacy Strains▿ †

PubMed Central

Zeigler, Daniel R.; Prágai, Zoltán; Rodriguez, Sabrina; Chevreux, Bastien; Muffler, Andrea; Albert, Thomas; Bai, Renyuan; Wyss, Markus; Perkins, John B.

2008-01-01

Bacillus subtilis is both a model organism for basic research and an industrial workhorse, yet there are major gaps in our understanding of the genomic heritage and provenance of many widely used strains. We analyzed 17 legacy strains dating to the early years of B. subtilis genetics. For three—NCIB 3610T, PY79, and SMY—we performed comparative genome sequencing. For the remainder, we used conventional sequencing to sample genomic regions expected to show sequence heterogeneity. Sequence comparisons showed that 168, its siblings (122, 160, and 166), and the type strains NCIB 3610 and ATCC 6051 are highly similar and are likely descendants of the original Marburg strain, although the 168 lineage shows genetic evidence of early domestication. Strains 23, W23, and W23SR are identical in sequence to each other but only 94.6% identical to the Marburg group in the sequenced regions. Strain 23, the probable W23 parent, likely arose from a contaminant in the mutagenesis experiments that produced 168. The remaining strains are all genomic hybrids, showing one or more “W23 islands” in a 168 genomic backbone. Each traces its origin to transformations of 168 derivatives with DNA from 23 or W23. The common prototrophic lab strain PY79 possesses substantial W23 islands at its trp and sac loci, along with large deletions that have reduced its genome 4.3%. SMY, reputed to be the parent of 168, is actually a 168-W23 hybrid that likely shares a recent ancestor with PY79. These data provide greater insight into the genomic history of these B. subtilis legacy strains. PMID:18723616

First molecular detection and phylogenetic analysis of Anaplasma phagocytophilum in shelter dogs in Seoul, Korea.

PubMed

Lee, Sukyee; Lee, Seung-Hun; VanBik, Dorene; Kim, Neung-Hee; Kim, Kyoo-Tae; Goo, Youn-Kyoung; Rhee, Man Hee; Kwon, Oh-Deog; Kwak, Dongmi

2016-07-01

In this study, the status of Anaplasma phagocytophilum infection was assessed in shelter dogs in Seoul, Korea, with PCR and phylogenetic analyses. Nested PCR on 1058 collected blood samples revealed only one A. phagocytophilum positive sample (female, age <1year, mixed breed, collected from the north of the Han River). The genetic variability of A. phagocytophilum was evaluated by genotyping, using the 16S rRNA, groEL, and msp2 gene sequences of the positive sample. BLASTn analysis revealed that the 16S rRNA, groEL, and msp2 genes had 99.6%, 99.9%, and 100% identity with the following sequences deposited in GenBank: a cat 16S rRNA sequence from Korea (KR021166), a rat groEL sequence from Korea (KT220194), and a water deer msp2 sequence from Korea (HM752099), respectively. Phylogenetic analyses classified the groEL gene into two distinct groups (serine and alanine), whereas the msp2 gene showed a general classification into two groups (USA and Europe) that were further subgrouped according to region. To the best of our knowledge, this study is the first to describe the molecular diagnosis of A. phagocytophilum in dogs reared in Korea. In addition, the high genetic identity of the 16S rRNA and groEL sequences between humans and dogs from the same region suggests a possible epidemiological relation. Given the conditions of climate change, tick ecology, and recent incidence of human granulocytic anaplasmosis in Korea, the findings of this study underscore the need to establish appropriate control programs for tick-borne diseases in Korea. Copyright © 2016 Elsevier GmbH. All rights reserved.

Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilkins, T.A.

1993-06-01

This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

Molecular detection of kobuviruses in European roe deer (Capreolus capreolus) in Italy.

PubMed

Di Martino, Barbara; Di Profio, Federica; Melegari, Irene; Di Felice, Elisabetta; Robetto, Serena; Guidetti, Cristina; Orusa, Riccardo; Martella, Vito; Marsilio, Fulvio

2015-08-01

Kobuvirus RNA was found in 6.6 % (13/198) of stool specimens from roe deer (Capreolus capreolus) captured during the regular hunting season. Upon sequence analysis of a fragment of the 3D gene, nine strains displayed the highest nucleotide sequence identity (91.2-97.4 %) to bovine kobuviruses previously detected in either diarrhoeic or asymptomatic calves. Interestingly, four strains were genetically related to the newly discovered caprine kobuviruses (84.2-87.6 % nucleotide identity) identified in black goats in Korea.

Some identities of generalized Fibonacci sequence

NASA Astrophysics Data System (ADS)

Chong, Chin-Yoon; Cheah, C. L.; Ho, C. K.

2014-07-01

We introduced the generalized Fibonacci sequence {Un} defined by U0 = 0, U1 = 1, and Un+2 = pUn+1+qUn for all p, q∈Z+ and for all non-negative integers n. In this paper, we obtained some recursive formulas of the sequence.

Complete genome sequence of a new maize-associated cytorhabdovirus

USDA-ARS?s Scientific Manuscript database

A new 11,877 nt cytorhabdovirus sequence with 6 open reading frames has been identified in a maize sample. It shares 50 and 51% genome-wide nucleotide sequence identity with northern cereal mosaic cytorhabdovirus (NCMV) and barley yellow striate mosaic cytorhabdovirus (BYSMV), respectively....

Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Grant S.; Mills, Jeffrey L.; Miley, Michael J.

2015-10-15

Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helixmore » bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).« less

Comparison of the nucleotide and amino acid sequences of the RsrI and EcoRI restriction endonucleases.

PubMed

Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J

1989-12-21

The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.

Metatranscriptomic Evidence of Chemolithoautotrophy in the Rifle (CO) Subsurface Relevant to C, S, N, and Fe Cycling

NASA Astrophysics Data System (ADS)

Beller, H. R.; Jewell, T. N. M.; Karaoz, U.; Thomas, B. C.; Banfield, J. F.; Brodie, E.; Williams, K. H.

2014-12-01

Although there is a limited understanding of the chemolithoautotrophic activity of aquifer microorganisms, such subsurface microbial activity could greatly influence the cycling of elements such as C, S, N, and Fe. Here, we present transcriptional (RNA-Seq) evidence of the emergence of such chemolithoautotrophic activities in groundwater filter samples from a 2-month experiment in which up to 1.5 mM nitrate (a native electron acceptor) was injected into a perennially suboxic/anoxic aquifer (Rifle, CO) containing a large reservoir of reduced Fe- and S-containing compounds. Illumina sequence data from rRNA-subtracted cDNA libraries was assembled and mapped to phylogenetically binned Rifle metagenome data. Indicative of the activity of Fe(II)-oxidizing bacteria, many high-abundance transcripts mapped to the Gallionellaceae family, whose known members are chemolithoautotrophic bacteria that catalyze Fe(II) oxidation. For example, included among the most abundant transcripts were a cold-shock protein and an acyl carrier protein with 96-98% protein sequence identity to Gallionella capsiferriformans and a nitrite reductase (nirS) gene likely belonging to a Sideroxydans relative. The apparent activity of Gallionellaceae members is consistent with 16S rRNA iTag analyses of these samples, which indicated that Gallionella-related taxa accounted for up to ~50% of these communities. Evidence of sulfide oxidation also was apparent in these samples. For example, highly expressed subunits of APS reductase were very similar to those of the obligately chemolithoautotrophic S- and Fe(II)-oxidizing Thiobacillus denitrificans in terms of sequence identity (98-99%) and synteny of the mapped scaffold. Also highly expressed were a ß-Proteobacterial Form II RubisCO gene and a hydrazine oxidoreductase gene (93% identity to the planctomycete KSU-1), the latter strongly indicative of anaerobic ammonia oxidation (anammox) activity, which has seldom been reported in aquifer environments. Such gene-level data on CO2 fixation and Fe(II), sulfide, and ammonium oxidation in the Rifle subsurface will contribute to genome-enabled modeling efforts aimed at developing a predictive understanding of biogeochemical processes at the site as part of LBNL's Sustainable Systems Scientific Focus Area (SFA) 2.0.

An approach to large scale identification of non-obvious structural similarities between proteins

PubMed Central

Cherkasov, Artem; Jones, Steven JM

2004-01-01

Background A new sequence independent bioinformatics approach allowing genome-wide search for proteins with similar three dimensional structures has been developed. By utilizing the numerical output of the sequence threading it establishes putative non-obvious structural similarities between proteins. When applied to the testing set of proteins with known three dimensional structures the developed approach was able to recognize structurally similar proteins with high accuracy. Results The method has been developed to identify pathogenic proteins with low sequence identity and high structural similarity to host analogues. Such protein structure relationships would be hypothesized to arise through convergent evolution or through ancient horizontal gene transfer events, now undetectable using current sequence alignment techniques. The pathogen proteins, which could mimic or interfere with host activities, would represent candidate virulence factors. The developed approach utilizes the numerical outputs from the sequence-structure threading. It identifies the potential structural similarity between a pair of proteins by correlating the threading scores of the corresponding two primary sequences against the library of the standard folds. This approach allowed up to 64% sensitivity and 99.9% specificity in distinguishing protein pairs with high structural similarity. Conclusion Preliminary results obtained by comparison of the genomes of Homo sapiens and several strains of Chlamydia trachomatis have demonstrated the potential usefulness of the method in the identification of bacterial proteins with known or potential roles in virulence. PMID:15147578

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

PubMed Central

Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

2008-01-01

The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

PubMed

Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

2011-04-01

κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

Cloning and Characterization of the Pyrrolomycin Biosynthetic Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and Streptomyces sp. Strain UC 11065▿

PubMed Central

Zhang, Xiujun; Parry, Ronald J.

2007-01-01

The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935

Novel division level bacterial diversity in a Yellowstone hot spring.

PubMed

Hugenholtz, P; Pitulle, C; Hershberger, K L; Pace, N R

1998-01-01

A culture-independent molecular phylogenetic survey was carried out for the bacterial community in Obsidian Pool (OP), a Yellowstone National Park hot spring previously shown to contain remarkable archaeal diversity (S. M. Barns, R. E. Fundyga, M. W. Jeffries, and N. R. Page, Proc. Natl. Acad. Sci. USA 91:1609-1613, 1994). Small-subunit rRNA genes (rDNA) were amplified directly from OP sediment DNA by PCR with universally conserved or Bacteria-specific rDNA primers and cloned. Unique rDNA types among > 300 clones were identified by restriction fragment length polymorphism, and 122 representative rDNA sequences were determined. These were found to represent 54 distinct bacterial sequence types or clusters (> or = 98% identity) of sequences. A majority (70%) of the sequence types were affiliated with 14 previously recognized bacterial divisions (main phyla; kingdoms); 30% were unaffiliated with recognized bacterial divisions. The unaffiliated sequence types (represented by 38 sequences) nominally comprise 12 novel, division level lineages termed candidate divisions. Several OP sequences were nearly identical to those of cultivated chemolithotrophic thermophiles, including the hydrogen-oxidizing Calderobacterium and the sulfate reducers Thermodesulfovibrio and Thermodesulfobacterium, or belonged to monophyletic assemblages recognized for a particular type of metabolism, such as the hydrogen-oxidizing Aquificales and the sulfate-reducing delta-Proteobacteria. The occurrence of such organisms is consistent with the chemical composition of OP (high in reduced iron and sulfur) and suggests a lithotrophic base for primary productivity in this hot spring, through hydrogen oxidation and sulfate reduction. Unexpectedly, no archaeal sequences were encountered in OP clone libraries made with universal primers. Hybridization analysis of amplified OP DNA with domain-specific probes confirmed that the analyzed community rDNA from OP sediment was predominantly bacterial. These results expand substantially our knowledge of the extent of bacterial diversity and call into question the commonly held notion that Archaea dominate hydrothermal environments. Finally, the currently known extent of division level bacterial phylogenetic diversity is collated and summarized.

StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase.

PubMed

Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L

2011-06-02

Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.

Deletion within the metallothionein locus of cadmium-tolerant Synechococcus PCC 6301 involving a highly iterated palindrome (HIP1).

PubMed

Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J

1993-01-01

Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.

HPLC purification and re-evaluation of chemical identity of two circular bacteriocins, gassericin A and reutericin 6.

PubMed

Arakawa, K; Kawai, Y; Ito, Y; Nakamura, K; Chujo, T; Nishimura, J; Kitazawa, H; Saito, T

2010-04-01

The study aimed for the complete purification and recharacterization of the highly hydrophobic circular bacteriocins, gassericin A and reutericin 6. Gassericin A and reutericin 6 were purified to homogeneity using previously described method and reverse-phase HPLC with an octyl column and eluents of aqueous acetonitrile and 2-propanol. Mass analysis, N-terminal sequencing and bacteriocin assay of the HPLC-purified bacteriocins showed the two bacteriocins had identical seamless circular structures with the same m/z value (5651) of [M + H](+) and both had the same specific activity. D/L-amino acid composition analysis using two distinct methods with the chiral fluorescent derivatization reagents (+)-1-(9-fluorenyl)ethyl chloroformate and O-phthalaldehyde/N-acetyl-L-cystein revealed neither gassericin A nor reutericin 6 contained D-alanine residues contrary to our previous results. Purified gassericin A and reutericin 6 are chemically identical circular molecules containing no D-alanine residues. The HPLC conditions developed in this study will facilitate advanced purification and correct characterization of other highly hydrophobic bacteriocins.

Initial Detection and Molecular Characterization of Namaycush Herpesvirus (Salmonid Herpesvirus 5) in Lake Trout.

PubMed

Glenney, Gavin W; Barbash, Patricia A; Coll, John A

2016-03-01

A novel herpesvirus was found by molecular methods in samples of Lake Trout Salvelinus namaycush from Lake Erie, Pennsylvania, and Lake Ontario, Keuka Lake, and Lake Otsego, New York. Based on PCR amplification and partial sequencing of polymerase, terminase, and glycoprotein genes, a number of isolates were identified as a novel virus, which we have named Namaycush herpesvirus (NamHV) salmonid herpesvirus 5 (SalHV5). Phylogenetic analyses of three NamHV genes indicated strong clustering with other members of the genus Salmonivirus, placing these isolates into family Alloherpesviridae. The NamHV isolates were identical in the three partially sequenced genes; however, they varied from other salmonid herpesviruses in nucleotide sequence identity. In all three of the genes sequenced, NamHV shared the highest sequence identity with Atlantic Salmon papillomatosis virus (ASPV; SalHV4) isolated from Atlantic Salmon Salmo salar in northern Europe, including northwestern Russia. These results lead one to believe that NamHV and ASPV have a common ancestor that may have made a relatively recent host jump from Atlantic Salmon to Lake Trout or vice versa. Partial nucleotide sequence comparisons between NamHV and ASPV for the polymerase and glycoprotein genes differ by >5% and >10%, respectively. Additional nucleotide sequence comparisons between NamHV and epizootic epitheliotropic disease virus (EEDV/SalHV3) in the terminase, glycoprotein, and polymerase genes differ by >5%, >20%, and >10%, respectively. Thus, NamHV and EEDV may be occupying discrete ecological niches in Lake Trout. Even though NamHV shared the highest genetic identity with ASPV, each of these viruses has a separate host species, which also implies speciation. Additionally, NamHV has been detected over the last 4 years in four separate water bodies across two states, which suggests that NamHV is a distinct, naturally replicating lineage. This, in combination with a divergence in nucleotide sequence from EEDV, indicates that NamHV is a new species in the genus Salmonivirus. Received April 20, 2015; accepted October 11, 2015.

Complete genome sequence of a novel genotype of squash mosaic virus

USDA-ARS?s Scientific Manuscript database

Complete genome sequence of a novel genotype of Squash mosaic virus (SqMV) infecting squash plants in Spain was obtained using deep sequencing of small ribonucleic acids and assembly. The low nucleotide sequence identities, with 87-88% on RNA1 and 84-86% on RNA2 to known SqMV isolates, suggest a new...

First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

USDA-ARS?s Scientific Manuscript database

The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

The phytochemical and genetic survey of common and dwarf juniper (Juniperus communis and Juniperus nana) identifies chemical races and close taxonomic identity of the species.

PubMed

Filipowicz, Natalia; Piotrowski, Arkadiusz; Ochocka, J Renata; Asztemborska, Monika

2006-07-01

Juniperus communis L. (= J. communis var. communis) and Juniperus nana Willd. (= J. communis var. SAXATILIS) are subspecies of juniper. J. communis grows widely in both hemispheres, primarily in lower elevations while J. nana is mainly observed in high mountains. Although they can be distinguished by morphological features, it is not known whether they are genetically and phytochemically distinct entities. We aimed to check whether it is possible to distinguish these two plants (i) by pharmaceutically important chemical traits and (ii) on the basis of intraspecifically highly polymorphic fragment of chloroplast DNA. We used GC with achiral as well as with enantioselective stationary phase columns to identify the main monoterpenes of the essential oil. Sequence analysis of the TRNL (UAA)- TRNF (GAA) intergenic spacer of the chloroplast genome was used as a genetic marker of taxonomic identity between these two subspecies. The chromatographic analysis showed the existence of three chemical races - the alpha-pinene type, the sabinene type and one with intermediate contents of these terpenes among both J. communis and J. nana. Surprisingly, sequence analysis of TRNL (UAA)- TRNF (GAA) revealed 100 % similarity between the common and the dwarf juniper. Thus, the monoterpene pattern is related to geographical origin, and not to the species identity. We suggest that the three chemical races identified in the present study should be considered as separate sources of pharmaceutical raw material. Our results demonstrate that the contents of alpha-pinene and sabinene may be applied as a quick diagnostic test for preliminary evaluation of plant material.

Enzymatic properties and primary structures of hyaluronidases from two species of lionfish (Pterois antennata and Pterois volitans).

PubMed

Kiriake, Aya; Madokoro, Mihoko; Shiomi, Kazuo

2014-08-01

Lionfish are representative venomous fish, having venomous glandular tissues in dorsal, pelvic and anal spines. Some properties and primary structures of proteinaceous toxins from the venoms of three species of lionfish, Pterois antennata, Pterois lunulata and Pterois volitans, have so far been clarified. Our recent survey established the presence of hyaluronidase, presumably a toxin-spreading factor, in the venoms of P. antennata and P. volitans. This prompted us to examine enzymatic properties and primary structures of lionfish hyaluronidases. The hyaluronidases of P. antennata and P. volitans were shown to be optimally active at pH 6.6, 37°C and 0.1 M NaCl and specifically active against hyaluronan. These enzymatic properties are almost the same as those of stonefish hyaluronidases. The primary structures (483 amino acid residues) of the lionfish hyaluronidases were elucidated by a cDNA cloning strategy using degenerate primers designed from the reported amino acid sequences of the stonefish hyaluronidases. Both lionfish hyaluronidases share as high as 99.6% of sequence identity with each other and also considerably high identities (72-77%) with the stonefish hyaluronidases but rather low identities (25-40%) with other hyaluronidases from mammals and venomous animals. In consistent with this, phylogenetic tree analysis revealed that the lionfish hyaluronidases, together with the stonefish hyaluronidases, form a cluster independently of other hyaluronidases. Nevertheless, the lionfish hyaluronidases as well as the stonefish hyaluronidases almost maintain structural features (active site, glyco_hydro_56 domain and cysteine location) observed in other hyaluronidases.

Koi herpesvirus encodes and expresses a functional interleukin-10.

PubMed

Sunarto, Agus; Liongue, Clifford; McColl, Kenneth A; Adams, Mathew M; Bulach, Dieter; Crane, Mark St J; Schat, Karel A; Slobedman, Barry; Barnes, Andrew C; Ward, Alister C; Walker, Peter J

2012-11-01

Koi herpesvirus (KHV) (species Cyprinid herpesvirus 3) ORF134 was shown to transcribe a spliced transcript encoding a 179-amino-acid (aa) interleukin-10 (IL-10) homolog (khvIL-10) in koi fin (KF-1) cells. Pairwise sequence alignment indicated that the expressed product shares 25% identity with carp IL-10, 22 to 24% identity with mammalian (including primate) IL-10s, and 19.1% identity with European eel herpesvirus IL-10 (ahvIL-10). In phylogenetic analyses, khvIL-10 fell in a divergent position from all host IL-10 sequences, indicating extensive structural divergence following capture from the host. In KHV-infected fish, khvIL-10 transcripts were observed to be highly expressed during the acute and reactivation phases but to be expressed at very low levels during low-temperature-induced persistence. Similarly, KHV early (helicase [Hel] and DNA polymerase [DNAP]) and late (intercapsomeric triplex protein [ITP] and major capsid protein [MCP]) genes were also expressed at high levels during the acute and reactivation phases, but only low-level expression of the ITP gene was detected during the persistent phase. Injection of khvIL-10 mRNA into zebrafish (Danio rerio) embryos increased the number of lysozyme-positive cells to a similar degree as zebrafish IL-10. Downregulation of the IL-10 receptor long chain (IL-10R1) using a specific morpholino abrogated the response to both khvIL-10 and zebrafish IL-10 transcripts, indicating that, despite the structural divergence, khvIL-10 functions via this receptor. This is the first report describing the characteristics of a functional viral IL-10 gene in the Alloherpesviridae.

Biosynthetic Investigations of Lactonamycin and Lactonamycin Z: Cloning of the Biosynthetic Gene Clusters and Discovery of an Unusual Starter Unit▿ †

PubMed Central

Zhang, Xiujun; Alemany, Lawrence B.; Fiedler, Hans-Peter; Goodfellow, Michael; Parry, Ronald J.

2008-01-01

The antibiotics lactonamycin and lactonamycin Z provide attractive leads for antibacterial drug development. Both antibiotics contain a novel aglycone core called lactonamycinone. To gain insight into lactonamycinone biosynthesis, cloning and precursor incorporation experiments were undertaken. The lactonamycin gene cluster was initially cloned from Streptomyces rishiriensis. Sequencing of ca. 61 kb of S. rishiriensis DNA revealed the presence of 57 open reading frames. These included genes coding for the biosynthesis of l-rhodinose, the sugar found in lactonamycin, and genes similar to those in the tetracenomycin biosynthetic gene cluster. Since lactonamycin production by S. rishiriensis could not be sustained, additional proof for the identity of the S. rishiriensis cluster was obtained by cloning the lactonamycin Z gene cluster from Streptomyces sanglieri. Partial sequencing of the S. sanglieri cluster revealed 15 genes that exhibited a very high degree of similarity to genes within the lactonamycin cluster, as well as an identical organization. Double-crossover disruption of one gene in the S. sanglieri cluster abolished lactonamycin Z production, and production was restored by complementation. These results confirm the identity of the genetic locus cloned from S. sanglieri and indicate that the highly similar locus in S. rishiriensis encodes lactonamycin biosynthetic genes. Precursor incorporation experiments with S. sanglieri revealed that lactonamycinone is biosynthesized in an unusual manner whereby glycine or a glycine derivative serves as a starter unit that is extended by nine acetate units. Analysis of the gene clusters and of the precursor incorporation data suggested a hypothetical scheme for lactonamycinone biosynthesis. PMID:18070976

Mercury BLASTP: Accelerating Protein Sequence Alignment

PubMed Central

Jacob, Arpith; Lancaster, Joseph; Buhler, Jeremy; Harris, Brandon; Chamberlain, Roger D.

2008-01-01

Large-scale protein sequence comparison is an important but compute-intensive task in molecular biology. BLASTP is the most popular tool for comparative analysis of protein sequences. In recent years, an exponential increase in the size of protein sequence databases has required either exponentially more running time or a cluster of machines to keep pace. To address this problem, we have designed and built a high-performance FPGA-accelerated version of BLASTP, Mercury BLASTP. In this paper, we describe the architecture of the portions of the application that are accelerated in the FPGA, and we also describe the integration of these FPGA-accelerated portions with the existing BLASTP software. We have implemented Mercury BLASTP on a commodity workstation with two Xilinx Virtex-II 6000 FPGAs. We show that the new design runs 11-15 times faster than software BLASTP on a modern CPU while delivering close to 99% identical results. PMID:19492068

The structure of cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+-dependent cell adhesion.

PubMed Central

Ringwald, M; Schuh, R; Vestweber, D; Eistetter, H; Lottspeich, F; Engel, J; Dölz, R; Jähnig, F; Epplen, J; Mayer, S

1987-01-01

We have determined the amino acid sequence of the Ca2+-dependent cell adhesion molecule uvomorulin as it appears on the cell surface. The extracellular part of the molecule exhibits three internally repeated domains of 112 residues which are most likely generated by gene duplication. Each of the repeated domains contains two highly conserved units which could represent putative Ca2+-binding sites. Secondary structure predictions suggest that the putative Ca2+-binding units are located in external loops at the surface of the protein. The protein sequence exhibits a single membrane-spanning region and a cytoplasmic domain. Sequence comparison reveals extensive homology to the chicken L-CAM. Both uvomorulin and L-CAM are identical in 65% of their entire amino acid sequence suggesting a common origin for both CAMs. Images Fig. 1. Fig. 4. Fig. 7. PMID:3501370

Molecular characterization of a novel orthomyxovirus from rainbow and steelhead trout (Oncorhynchus mykiss)

USGS Publications Warehouse

Batts, William N.; LaPatra, Scott E.; Katona, Ryan; Leis, Eric; Fei Fan Ng, Terry; Bruieuc, Marine S.O.; Breyta, Rachel; Purcell, Maureen; Waltzek, Thomas B.; Delwart, Eric; Winton, James

2017-01-01

A novel virus, rainbow trout orthomyxovirus (RbtOV), was isolated in 1997 and again in 2000 from commercially-reared rainbow trout (Oncorhynchus mykiss) in Idaho, USA. The virus grew optimally in the CHSE-214 cell line at 15°C producing a diffuse cytopathic effect; however, juvenile rainbow trout exposed to cell culture-grown virus showed no mortality or gross pathology. Electron microscopy of preparations from infected cell cultures revealed the presence of typical orthomyxovirus particles. The complete genome of RbtOV is comprised of eight linear segments of single-stranded, negative-sense RNA having highly conserved 5′ and 3′-terminal nucleotide sequences. Another virus isolated in 2014 from steelhead trout (also O. mykiss) in Wisconsin, USA, and designated SttOV was found to have eight genome segments with high amino acid sequence identities (89–99%) to the corresponding genes of RbtOV, suggesting these new viruses are isolates of the same virus species and may be more widespread than currently realized. The new isolates had the same genome segment order and the closest pairwise amino acid sequence identities of 16–42% with Infectious salmon anemia virus (ISAV), the type species and currently only member of the genus Isavirus in the family Orthomyxoviridae. However, pairwise comparisons of the predicted amino acid sequences of the 10 RbtOV and SttOV proteins with orthologs from representatives of the established orthomyxoviral genera and a phylogenetic analysis using the PB1 protein showed that while RbtOV and SttOV clustered most closely with ISAV, they diverged sufficiently to merit consideration as representatives of a novel genus. A set of PCR primers was designed using conserved regions of the PB1 gene to produce amplicons that may be sequenced for identification of similar fish orthomyxoviruses in the future.

[Mass spectrometry identification and immune cross-reactivity of a minor shrimp allergen-sarcoplasmic calcium binding protein from Litopenaeus vannamei].

PubMed

Wang, Cai-xia; Huang, Jian-fang; Xiang, Jun-jian; Sun, Yi-fan; Lv, Si; Guo, Jie

2012-08-01

To identify sarcoplasmic calcium-binding protein (SCP) as a minor shrimp allergen by mass spectrometry, and to analyze the immune cross-reactivity among crustacean SCPs. The M(r); 21 000 allergen from Litopenaeus vannamei was identified by MALDI-TOF/TOF-MS. BLAST and ClustalW were used to compare amino acid sequence identity of the allergen among crustaceans. The puritifed M(r); 21 000 allergen was injected subcutaneously in mice to produce the specific polyclonal antibodies to analyze immune cross-reactivity of the allergen with proteins from 8 other species of crustaceans by Western blotting. The M(r); 21 000 shrimp allergen was identified as SCP. Sequence comparison revealed that SCP had 81%-100% amino acid identity among crustaceans. Western blotting showed that the proteins with M(r); about 21 000, corresponding to SCP from Metapenaeus ensis, Penaeus monodon, Oratosquilla oratoria, Macrobrachium rosenbergii, Procambarus clarkii, Portunus pelagicus, Charybdis feriatus, Eriocheir sinensis were recognized by polyclonal antibodies against SCP of Litopenaeus vannamei. SCP is a minor shrimp allergen, and SCPs have a high sequence homology and strong immune cross-reactivity among crustaceans, which can be used as detective, diagnostic and safe immunotherapeutic agents for subjects with shrimp allergy.

Genetic characterization of strains of Saccharomyces uvarum from New Zealand wineries.

PubMed

Zhang, Hanyao; Richards, Keith D; Wilson, Sandra; Lee, Soon A; Sheehan, Hester; Roncoroni, Miguel; Gardner, Richard C

2015-04-01

We present a genetic characterization of 65 isolates of Saccharomyces uvarum isolated from wineries in New Zealand, along with the complete nucleotide sequence of a single sulfite-tolerant isolate. The genome of the New Zealand isolate averaged 99.85% nucleotide identity to CBS7001, the previously sequenced strain of S. uvarum. However, three genomic segments (37-87 kb) showed 10% nucleotide divergence from CBS7001 but 99% identity to Saccharomyces eubayanus. We conclude that these three segments appear to have been introgressed from that species. The nucleotide sequence of the internal transcribed spacer (ITS) region from other New Zealand isolates were also very similar to that of CBS7001, and hybrids showed complete genetic compatibility for some strains, with tetrads giving four viable progeny that showed 2:2 segregations of marker genes. Some strains showed high tolerance to sulfite, with genetic analysis indicating linkage of this trait to the transcription factor FZF1, but not to SSU1, the sulfite efflux pump that it regulates in order to confer sulfite tolerance in Saccharomyces cerevisiae. The fermentation characteristics of selected strains of S. uvarum showed exceptionally good cold fermentation characteristics, superior to the best commercially available strains of S. cerevisiae. Copyright © 2014 Elsevier Ltd. All rights reserved.

PCR amplification and sequence analysis of the major capsid protein gene of megalocytiviruses isolated in Taiwan.

PubMed

Wang, C S; Chao, S Y; Ku, C C; Wen, C M; Shih, H H

2009-06-01

Viruses belonging to the genus Megalocytivirus in the family Iridoviridae are one of the major agents causing mass mortalities in marine and freshwater fish in Asian countries. Outbreaks of iridovirus disease have been reported among various fish species in Taiwan. However, the genotypes of these iridoviruses have not yet been determined. In this study, seven megalocytivirus isolates from four fish species: king grouper, Epinephelus lanceolatus (Bloch), barramundi perch, Lates calcarifer (Bloch), silver sea bream, Rhabdosargus sarba (Forsskal), and common ponyfish, Leiognathus equulus (Forsskal), cultured in three different regions of Taiwan were collected. The full open reading frame encoding the viral major capsid protein gene was amplified using PCR. The PCR products of approximately 1581 bp were cloned and the nucleotide sequences were phylogenetically analysed. Results showed that all seven PCR products contained a unique open reading frame with 1362 nucleotides and encoded a structural protein with 453 amino acids. Even though the nucleotide sequences were not identical, these seven megalocytiviruses were classified into one cluster and showed very high homology with red sea bream iridovirus (RSIV) with more than 97% identity. Thus, the seven iridovirus strains isolated from cultured marine fish in Taiwan were closer to the RSIV genotype than the infectious spleen and kidney necrosis virus genotype.

International linkage of two food-borne hepatitis A clusters through traceback of mussels, the Netherlands, 2012.

PubMed

Boxman, Ingeborg L A; Verhoef, Linda; Vennema, Harry; Ngui, Siew-Lin; Friesema, Ingrid H M; Whiteside, Chris; Lees, David; Koopmans, Marion

2016-01-01

This report describes an outbreak investigation starting with two closely related suspected food-borne clusters of Dutch hepatitis A cases, nine primary cases in total, with an unknown source in the Netherlands. The hepatitis A virus (HAV) genotype IA sequences of both clusters were highly similar (459/460 nt) and were not reported earlier. Food questionnaires and a case-control study revealed an association with consumption of mussels. Analysis of mussel supply chains identified the most likely production area. International enquiries led to identification of a cluster of patients near this production area with identical HAV sequences with onsets predating the first Dutch cluster of cases. The most likely source for this cluster was a case who returned from an endemic area in Central America, and a subsequent household cluster from which treated domestic sewage was discharged into the suspected mussel production area. Notably, mussels from this area were also consumed by a separate case in the United Kingdom sharing an identical strain with the second Dutch cluster. In conclusion, a small number of patients in a non-endemic area led to geographically dispersed hepatitis A outbreaks with food as vehicle. This link would have gone unnoticed without sequence analyses and international collaboration.

Purification and sequence analysis of two rat tissue inhibitors of metalloproteinases

NASA Technical Reports Server (NTRS)

Roswit, W. T.; McCourt, D. W.; Partridge, N. C.; Jeffrey, J. J.

1992-01-01

Two protein inhibitors of metalloproteinases (TIMP) were isolated from medium conditioned by the clonal rat osteosarcoma line UMR 106-01. Initial purification of both a 30-kDa inhibitor and a 20-kDa inhibitor was accomplished using heparin-Sepharose chromatography with dextran sulfate elution followed by DEAE-Sepharose and CM-Sepharose chromatography. Purification of the 20-kDa inhibitor to homogeneity was completed with reverse-phase high-performance liquid chromatography. The 20-kDa inhibitor was identified as rat TIMP-2. The 30-kDa inhibitor, although not purified to homogeneity, was identified as rat TIMP-1. Amino terminal amino acid sequence analysis of the 30-kDa inhibitor demonstrated 86% identity to human TIMP-1 for the first 22 amino acids while the sequence of the 20-kDa inhibitor was identical to that of human TIMP-2 for the first 22 residues. Treatment with peptide:N-glycosidase F indicated that the 30-kDa rat inhibitor is glycosylated while the 20-kDa inhibitor is apparently unglycosylated. Inhibition of both rat and human interstitial collagenase by rat TIMP-2 was stoichiometric, with a 1:1 molar ratio required for complete inhibition. Exposure of UMR 106-01 cells to 10(-7) M parathyroid hormone resulted in approximately a 40% increase in total inhibitor production over basal levels.

The role of prophage for genome diversification within a clonal lineage of Lactobacillus johnsonii: characterization of the defective prophage LJ771.

PubMed

Denou, Emmanuel; Pridmore, Raymond David; Ventura, Marco; Pittet, Anne-Cécile; Zwahlen, Marie-Camille; Berger, Bernard; Barretto, Caroline; Panoff, Jean-Michel; Brüssow, Harald

2008-09-01

Two independent isolates of the gut commensal Lactobacillus johnsonii were sequenced. These isolates belonged to the same clonal lineage and differed mainly by a 40.8-kb prophage, LJ771, belonging to the Sfi11 phage lineage. LJ771 shares close DNA sequence identity with Lactobacillus gasseri prophages. LJ771 coexists as an integrated prophage and excised circular phage DNA, but phage DNA packaged into extracellular phage particles was not detected. Between the phage lysin gene and attR a likely mazE ("antitoxin")/pemK ("toxin") gene cassette was detected in LJ771 but not in the L. gasseri prophages. Expressed pemK could be cloned in Escherichia coli only together with the mazE gene. LJ771 was shown to be highly stable and could be cured only by coexpression of mazE from a plasmid. The prophage was integrated into the methionine sulfoxide reductase gene (msrA) and complemented the 5' end of this gene, creating a protein with a slightly altered N-terminal sequence. The two L. johnsonii strains had identical in vitro growth and in vivo gut persistence phenotypes. Also, in an isogenic background, the presence of the prophage resulted in no growth disadvantage.

A new betasatellite associated with cotton leaf curl Burewala virus infecting tomato in India: influence on symptoms and viral accumulation.

PubMed

Kumar, Jitendra; Gunapati, Samatha; Singh, Sudhir P; Kumar, Abhinav; Lalit, Adarsh; Sharma, Naresh C; Puranik, Rekha; Tuli, Rakesh

2013-06-01

A begomovirus and its associated alpha- and betasatellite were detected in tomato plants affected with leaf curl disease. Based on a nucleotide sequence identity of 99 %, this begomovirus was designated an isolate of cotton leaf curl Burewala virus (CLCuBuV). The alphasatellite exhibited 93 % sequence identity to cotton leaf curl Burewala alphasatellite (CLCuBuA) and is hence referred to here as a variant of CLCuBuA. The detected betasatellite was recombinant in nature and showed 70 % sequence identity to the known betasatellites. Inoculation of healthy tomato with CLCuBuV plus betasatellite, either in the presence or the absence of alphasatellite, led to typical leaf curling, while inoculation with CLCuBuV in the absence of betasatellite resulted in mild symptoms. This confirmed the role of the betasatellite in expression of disease symptoms. We propose to name the newly detected betasatellite tomato leaf curl Hajipur betasatellite (ToLCHJB).

Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

PubMed

Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

2017-09-01

Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

Assembly of the Lactuca sativa, L. cv. Tizian draft genome sequence reveals differences within major resistance complex 1 as compared to the cv. Salinas reference genome.

PubMed

Verwaaijen, Bart; Wibberg, Daniel; Nelkner, Johanna; Gordin, Miriam; Rupp, Oliver; Winkler, Anika; Bremges, Andreas; Blom, Jochen; Grosch, Rita; Pühler, Alfred; Schlüter, Andreas

2018-02-10

Lettuce (Lactuca sativa, L.) is an important annual plant of the family Asteraceae (Compositae). The commercial lettuce cultivar Tizian has been used in various scientific studies investigating the interaction of the plant with phytopathogens or biological control agents. Here, we present the de novo draft genome sequencing and gene prediction for this specific cultivar derived from transcriptome sequence data. The assembled scaffolds amount to a size of 2.22 Gb. Based on RNAseq data, 31,112 transcript isoforms were identified. Functional predictions for these transcripts were determined within the GenDBE annotation platform. Comparison with the cv. Salinas reference genome revealed a high degree of sequence similarity on genome and transcriptome levels, with an average amino acid identity of 99%. Furthermore, it was observed that two large regions are either missing or are highly divergent within the cv. Tizian genome compared to cv. Salinas. One of these regions covers the major resistance complex 1 region of cv. Salinas. The cv. Tizian draft genome sequence provides a valuable resource for future functional and transcriptome analyses focused on this lettuce cultivar. Copyright © 2017 Elsevier B.V. All rights reserved.

An Accurate Scalable Template-based Alignment Algorithm

PubMed Central

Gardner, David P.; Xu, Weijia; Miranker, Daniel P.; Ozer, Stuart; Cannone, Jamie J.; Gutell, Robin R.

2013-01-01

The rapid determination of nucleic acid sequences is increasing the number of sequences that are available. Inherent in a template or seed alignment is the culmination of structural and functional constraints that are selecting those mutations that are viable during the evolution of the RNA. While we might not understand these structural and functional, template-based alignment programs utilize the patterns of sequence conservation to encapsulate the characteristics of viable RNA sequences that are aligned properly. We have developed a program that utilizes the different dimensions of information in rCAD, a large RNA informatics resource, to establish a profile for each position in an alignment. The most significant include sequence identity and column composition in different phylogenetic taxa. We have compared our methods with a maximum of eight alternative alignment methods on different sets of 16S and 23S rRNA sequences with sequence percent identities ranging from 50% to 100%. The results showed that CRWAlign outperformed the other alignment methods in both speed and accuracy. A web-based alignment server is available at http://www.rna.ccbb.utexas.edu/SAE/2F/CRWAlign. PMID:24772376

rRNA Gene Internal Transcribed Spacer 1 and 2 Sequences of Asexual, Anthropophilic Dermatophytes Related to Trichophyton rubrum

PubMed Central

Summerbell, R. C.; Haugland, R. A.; Li, A.; Gupta, A. K.

1999-01-01

The ribosomal region spanning the two internal transcribed spacer (ITS) regions and the 5.8S ribosomal DNA region was sequenced for asexual, anthropophilic dermatophyte species with morphological similarity to Trichophyton rubrum, as well as for members of the three previously delineated, related major clades in the T. mentagrophytes complex. Representative isolates of T. raubitschekii, T. fischeri, and T. kanei were found to have ITS sequences identical to that of T. rubrum. The ITS sequences of T. soudanense and T. megninii differed from that of T. rubrum by only a small number of base pairs. Their continued status as species, however, appears to meet criteria outlined in the population genetics-based cohesion species concept of A. R. Templeton. The ITS sequence of T. tonsurans differed from that of the biologically distinct T. equinum by only 1 bp, while the ITS sequence of the recently described species T. krajdenii had a sequence identical to that of T. mentagrophytes isolates related to the teleomorph Arthroderma vanbreuseghemii. PMID:10565922

Performance of an in-house human immunodeficiency virus type 1 genotyping system for assessment of drug resistance in Cuba.

PubMed

Alemán, Yoan; Vinken, Lore; Kourí, Vivian; Pérez, Lissette; Álvarez, Alina; Abrahantes, Yeissel; Fonseca, Carlos; Pérez, Jorge; Correa, Consuelo; Soto, Yudira; Schrooten, Yoeri; Vandamme, Anne-Mieke; Van Laethem, Kristel

2015-01-01

As commercial human immunodeficiency virus type 1 drug resistance assays are expensive, they are not commonly used in resource-limited settings. Hence, a more affordable in-house procedure was set up taking into account the specific epidemiological and economic circumstances of Cuba. The performance characteristics of the in-house assay were evaluated using clinical samples with various subtypes and resistance patterns. The lower limit of amplification was determined on dilutions series of 20 clinical isolates and ranged from 84 to 529 RNA copies/mL. For the assessment of trueness, 14 clinical samples were analyzed and the ViroSeq HIV-1 Genotyping System v2.0 was used as the reference standard. The mean nucleotide sequence identity between the two assays was 98.7% ± 1.0. Additionally, 99.0% of the amino acids at drug resistance positions were identical. The sensitivity and specificity in detecting drug resistance mutations was respectively 94.1% and 99.5%. Only few discordances in drug resistance interpretation patterns were observed. The repeatability and reproducibility were evaluated using 10 clinical samples with 3 replicates per sample. The in-house test was very precise as nucleotide sequence identity among paired nucleotide sequences ranged from 98.7% to 99.9%. The acceptance criteria were met by the in-house test for all performance characteristics, demonstrating a high degree of accuracy. Subsequently, the applicability in routine clinical practice was evaluated on 380 plasma samples. The amplification success rate was 91% and good quality consensus sequences encoding the entire protease and the first 335 codons in reverse transcriptase could be obtained for 99% of the successful amplicons. The reagent cost per sample using the in-house procedure was around € 80 per genotyping attempt. Overall, the in-house assay provided good results, was feasible with equipment and reagents available in Cuba and was half as expensive as commercial assays.

Leveraging genome-wide datasets to quantify the functional role of the anti-Shine-Dalgarno sequence in regulating translation efficiency.

PubMed

Hockenberry, Adam J; Pah, Adam R; Jewett, Michael C; Amaral, Luís A N

2017-01-01

Studies dating back to the 1970s established that sequence complementarity between the anti-Shine-Dalgarno (aSD) sequence on prokaryotic ribosomes and the 5' untranslated region of mRNAs helps to facilitate translation initiation. The optimal location of aSD sequence binding relative to the start codon, the full extents of the aSD sequence and the functional form of the relationship between aSD sequence complementarity and translation efficiency have not been fully resolved. Here, we investigate these relationships by leveraging the sequence diversity of endogenous genes and recently available genome-wide estimates of translation efficiency. We show that-after accounting for predicted mRNA structure-aSD sequence complementarity increases the translation of endogenous mRNAs by roughly 50%. Further, we observe that this relationship is nonlinear, with translation efficiency maximized for mRNAs with intermediate levels of aSD sequence complementarity. The mechanistic insights that we observe are highly robust: we find nearly identical results in multiple datasets spanning three distantly related bacteria. Further, we verify our main conclusions by re-analysing a controlled experimental dataset. © 2017 The Authors.

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE PAGES

Brumm, Phillip; Land, Miriam L.; Mead, David

2016-04-27

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

Complete genome sequences of two highly divergent Japanese isolates of Plantago asiatica mosaic virus.

PubMed

Komatsu, Ken; Yamashita, Kazuo; Sugawara, Kota; Verbeek, Martin; Fujita, Naoko; Hanada, Kaoru; Uehara-Ichiki, Tamaki; Fuji, Shin-Ichi

2017-02-01

Plantago asiatica mosaic virus (PlAMV) is a member of the genus Potexvirus and has an exceptionally wide host range. It causes severe damage to lilies. Here we report on the complete nucleotide sequences of two new Japanese PlAMV isolates, one from the eudicot weed Viola grypoceras (PlAMV-Vi), and the other from the eudicot shrub Nandina domestica Thunb. (PlAMV-NJ). Their genomes contain five open reading frames (ORFs), which is characteristic of potexviruses. Surprisingly, the isolates showed only 76.0-78.0 % sequence identity with each other and with other PlAMV isolates, including isolates from Japanese lily and American nandina. Amino acid alignments of the replicase coding region encoded by ORF1 showed that the regions between the methyltransferase and helicase domains were less conserved than other regions, with several insertions and/or deletions. Phylogenetic analyses of the full-length nucleotide sequences revealed a moderate correlation between phylogenetic clustering and the original host plants of the PlAMV isolates. This study revealed the presence of two highly divergent PlAMV isolates in Japan.

Human Y chromosome copy number variation in the next generation sequencing era and beyond.

PubMed

Massaia, Andrea; Xue, Yali

2017-05-01

The human Y chromosome provides a fertile ground for structural rearrangements owing to its haploidy and high content of repeated sequences. The methodologies used for copy number variation (CNV) studies have developed over the years. Low-throughput techniques based on direct observation of rearrangements were developed early on, and are still used, often to complement array-based or sequencing approaches which have limited power in regions with high repeat content and specifically in the presence of long, identical repeats, such as those found in human sex chromosomes. Some specific rearrangements have been investigated for decades; because of their effects on fertility, or their outstanding evolutionary features, the interest in these has not diminished. However, following the flourishing of large-scale genomics, several studies have investigated CNVs across the whole chromosome. These studies sometimes employ data generated within large genomic projects such as the DDD study or the 1000 Genomes Project, and often survey large samples of healthy individuals without any prior selection. Novel technologies based on sequencing long molecules and combinations of technologies, promise to stimulate the study of Y-CNVs in the immediate future.

Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brumm, Phillip; Land, Miriam L.; Mead, David

Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection

PubMed Central

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike

2018-01-01

ABSTRACT Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection. PMID:29564396

A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

PubMed

Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

2018-01-01

Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have developed a new reference viral database (RVDB) that provides a broad representation of different virus species from eukaryotes by including all viral, virus-like, and virus-related sequences (excluding bacteriophages), regardless of their size. In particular, RVDB contains endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Sequences were clustered to reduce redundancy while retaining high viral sequence diversity. A particularly useful feature of RVDB is the reduction of cellular sequences, which can enhance the run efficiency of large transcriptomic and genomic data analysis and increase the specificity of virus detection.

Enterocin T, a novel class IIa bacteriocin produced by Enterococcus sp. 812.

PubMed

Chen, Yi-Sheng; Yu, Chi-Rong; Ji, Si-Hua; Liou, Min-Shiuan; Leong, Kun-Hon; Pan, Shwu-Fen; Wu, Hui-Chung; Lin, Yu-Hsuan; Yu, Bi; Yanagida, Fujitoshi

2013-09-01

Enterococcus sp. 812, isolated from fresh broccoli, was previously found to produce a bacteriocin active against a number of Gram-positive bacteria, including Listeria monocytogenes. Bacteriocin activity decreased slightly after autoclaving (121 °C for 15 min), but was inactivated by protease K. Mass spectrometry analysis revealed the bacteriocin mass to be approximately 4,521.34 Da. N-terminal amino acid sequencing yielded a partial sequence, NH2-ATYYGNGVYXDKKKXWVEWGQA, by Edman degradation, which contained the consensus class IIa bacteriocin motif YGNGV in the N-terminal region. The obtained partial sequence showed high homology with some enterococcal bacteriocins; however, no identical peptide or protein was found. This peptide was therefore considered to be a novel bacteriocin produced by Enterococcus sp. 812 and was termed enterocin T.

Evidence of three new members of malignant catarrhal fever virus group in Muskox (Ovibos moschatus), Nubian ibex (Capra nubiana), and gemsbok (Oryx gazella)

USGS Publications Warehouse

Li, H.; Gailbreath, K.; Bender, L.C.; West, K.; Keller, J.; Crawford, T.B.

2003-01-01

Six members of the malignant catarrhal fever (MCF) virus group of ruminant rhadinoviruses have been identified to date. Four of these viruses are clearly associated with clinical disease: alcelaphine herpesvirus 1 (AlHV-1) carried by wildebeest (Connochaetes spp.); ovine herpesvirus 2 (OvHV-2), ubiquitous in domestic sheep; caprine herpesvirus 2 (CpHV-2), endemic in domestic goats; and the virus of unknown origin found causing classic MCF in white-tailed deer (Odocoileus virginianus; MCFV-WTD). Using serology and polymerase chain reaction with degenerate primers targeting a portion of the herpesviral DNA polymerase gene, evidence of three previously unrecognized rhadinoviruses in the MCF virus group was found in muskox (Ovibos moschatus), Nubian ibex (Capra nubiana), and gemsbok (South African oryx, Oryx gazella), respectively. Based on sequence alignment, the viral sequence in the muskox is most closely related to MCFV-WTD (81.5% sequence identity) and that in the Nubian ibex is closest to CpHV-2 (89.3% identity). The viral sequence in the gemsbok is most closely related to AlHV-1 (85.1% identity). No evidence of disease association with these viruses has been found. ?? Wildlife Disease Association 2003.

Structure and Function of Lipopolysaccharide Binding Protein

NASA Astrophysics Data System (ADS)

Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

1990-09-01

The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

Genetic Characteristics of Coronaviruses from Korean Bats in 2016.

PubMed

Lee, Saemi; Jo, Seong-Deok; Son, Kidong; An, Injung; Jeong, Jipseol; Wang, Seung-Jun; Kim, Yongkwan; Jheong, Weonhwa; Oem, Jae-Ku

2018-01-01

Bats have increasingly been recognized as the natural reservoir of severe acute respiratory syndrome (SARS), coronavirus, and other coronaviruses found in mammals. However, little research has been conducted on bat coronaviruses in South Korea. In this study, bat samples (332 oral swabs, 245 fecal samples, 38 urine samples, and 57 bat carcasses) were collected at 33 natural bat habitat sites in South Korea. RT-PCR and sequencing were performed for specific coronavirus genes to identify the bat coronaviruses in different bat samples. Coronaviruses were detected in 2.7% (18/672) of the samples: 13 oral swabs from one species of the family Rhinolophidae, and four fecal samples and one carcass (intestine) from three species of the family Vespertiliodae. To determine the genetic relationships of the 18 sequences obtained in this study and previously known coronaviruses, the nucleotide sequences of a 392-nt region of the RNA-dependent RNA polymerase (RdRp) gene were analyzed phylogenetically. Thirteen sequences belonging to SARS-like betacoronaviruses showed the highest nucleotide identity (97.1-99.7%) with Bat-CoV-JTMC15 reported in China. The other five sequences were most similar to MERS-like betacoronaviruses. Four nucleotide sequences displayed the highest identity (94.1-95.1%) with Bat-CoV-HKU5 from Hong Kong. The one sequence from a carcass showed the highest nucleotide identity (99%) with Bat-CoV-SC2013 from China. These results suggest that careful surveillance of coronaviruses from bats should be continued, because animal and human infections may result from the genetic variants present in bat coronavirus reservoirs.

Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

PubMed

Sugimura; Sawabe; Ezura

2000-01-01

The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

The Completely Sequenced Plasmid pEST4011 Contains a Novel IncP1 Backbone and a Catabolic Transposon Harboring tfd Genes for 2,4-Dichlorophenoxyacetic Acid Degradation

PubMed Central

Vedler, Eve; Vahter, Merle; Heinaru, Ain

2004-01-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacterium Achromobacter xylosoxidans subsp. denitrificans strain EST4002 contains plasmid pEST4011. This plasmid ensures its host a stable 2,4-D+ phenotype. We determined the complete 76,958-bp nucleotide sequence of pEST4011. This plasmid is a deletion and duplication derivative of pD2M4, the 95-kb highly unstable laboratory ancestor of pEST4011, and was self-generated during different laboratory manipulations performed to increase the stability of the 2,4-D+ phenotype of the original strain, strain D2M4(pD2M4). The 47,935-bp catabolic region of pEST4011 forms a transposon-like structure with identical copies of the hybrid insertion element IS1071::IS1471 at the two ends. The catabolic regions of pEST4011 and pJP4, the best-studied 2,4-D-degradative plasmid, both contain homologous, tfd-like genes for complete 2,4-D degradation, but they have little sequence similarity other than that. The backbone genes of pEST4011 are most similar to the corresponding genes of broad-host-range self-transmissible IncP1 plasmids. The backbones of the other three IncP1 catabolic plasmids that have been sequenced (the 2,4-D-degradative plasmid pJP4, the haloacetate-catabolic plasmid pUO1, and the atrazine-catabolic plasmid pADP-1) are nearly identical to the backbone of R751, the archetype plasmid of the IncP1 β subgroup. We show that despite the overall similarity in plasmid organization, the pEST4011 backbone is sufficiently different (51 to 86% amino acid sequence identity between individual backbone genes) from the backbones of members of the three IncP1 subgroups (the α, β, and γ subgroups) that it belongs to a new IncP1subgroup, the δ subgroup. This conclusion was also supported by a phylogenetic analysis of the trfA2, korA, and traG gene products of different IncP1 plasmids. PMID:15489427

Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

PubMed

Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

2015-08-01

Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

[Analysis of 4 clustered high risk acute flaccid paralysis cases in Shanxi Province in 2006].

PubMed

Yan, Dong-mei; Zhang, Yong; Wang, Dong-yan

2010-04-01

Analysis of epidemiology of 4 clustered high risk acute flaccid paralysis(AFP) cases reported by Shanxi province in 2006 and VP1 gene characteristic for type III poliovirus isolated from the four AFP cases. Virus isolation and identification were conducted according to the 4th edition of WHO polio laboratory manual. The sequence of VP1 region were amplified and sequenced. The phylogenetic trees based on VP1 region were constructed. Three of four high risk AFP cases were suspected as vaccine associated paralysis poliomyelitis (VAPP), the onset date of them were close. VP1 sequencing of the four type III isolates revealed that the identity were 99.7%, 99.9%, 99.4% and 99.9% respectively compared with vaccine reference strain-BJOPV3. According to WHO criteria, the four isolates were identified as type III vaccine-related poliovirus. Phylogenetic analysis based on VP1 coding sequence showed that the four type III poliovirus were not related significantly. The type III poliovirus isolated from 3 suspected VAPP cases shared one nucleotide mutation at 2637 (C-->U), which result in the amino acid mutation from Val into Ala. The improvement of laboratory surveillance for clustered high risk AFP cases should be strengthened so as to detect and prevent poliovirus circulation timely.

Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

USGS Publications Warehouse

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

Piscine Reovirus: Genomic and Molecular Phylogenetic Analysis from Farmed and Wild Salmonids Collected on the Canada/US Pacific Coast

PubMed Central

Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul; Richmond, Zina; Johns, Robert; Purcell, Maureen K.; Johnson, Stewart C.; Saksida, Sonja M.

2015-01-01

Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period. PMID:26536673

Deep sequencing of the viral phoH gene reveals temporal variation, depth-specific composition, and persistent dominance of the same viral phoH genes in the Sargasso Sea

PubMed Central

Goldsmith, Dawn B.; Parsons, Rachel J.; Beyene, Damitu; Salamon, Peter

2015-01-01

Deep sequencing of the viral phoH gene, a host-derived auxiliary metabolic gene, was used to track viral diversity throughout the water column at the Bermuda Atlantic Time-series Study (BATS) site in the summer (September) and winter (March) of three years. Viral phoH sequences reveal differences in the viral communities throughout a depth profile and between seasons in the same year. Variation was also detected between the same seasons in subsequent years, though these differences were not as great as the summer/winter distinctions. Over 3,600 phoH operational taxonomic units (OTUs; 97% sequence identity) were identified. Despite high richness, most phoH sequences belong to a few large, common OTUs whereas the majority of the OTUs are small and rare. While many OTUs make sporadic appearances at just a few times or depths, a small number of OTUs dominate the community throughout the seasons, depths, and years. PMID:26157645

UMI-tools: modeling sequencing errors in Unique Molecular Identifiers to improve quantification accuracy

PubMed Central

2017-01-01

Unique Molecular Identifiers (UMIs) are random oligonucleotide barcodes that are increasingly used in high-throughput sequencing experiments. Through a UMI, identical copies arising from distinct molecules can be distinguished from those arising through PCR amplification of the same molecule. However, bioinformatic methods to leverage the information from UMIs have yet to be formalized. In particular, sequencing errors in the UMI sequence are often ignored or else resolved in an ad hoc manner. We show that errors in the UMI sequence are common and introduce network-based methods to account for these errors when identifying PCR duplicates. Using these methods, we demonstrate improved quantification accuracy both under simulated conditions and real iCLIP and single-cell RNA-seq data sets. Reproducibility between iCLIP replicates and single-cell RNA-seq clustering are both improved using our proposed network-based method, demonstrating the value of properly accounting for errors in UMIs. These methods are implemented in the open source UMI-tools software package. PMID:28100584

Sequence analysis of infectious pancreatic necrosis virus isolated from Iranian reared rainbow trout (Oncorhynchus mykiss) in 2012.

PubMed

Dadar, Maryam; Peyghan, Rahim; Memari, Hamid Rajabi; Shapouri, Masod Reza Seifi Abad; Hasanzadeh, Reza; Goudarzi, Laleh Moazzami; Vakharia, Vikram N

2013-12-01

Infectious pancreatic necrosis virus (IPNV) is the causal agent of a highly contagious disease that affects many species of fish and shellfish. This virus causes economically significant diseases of farmed rainbow trout, Oncorhynchus mykiss (Walbaum), in Iran, which is often associated with the transmission of pathogens from European resources. In this study, moribund rainbow trout fry samples were collected during an outbreak of IPNV in three different fish farms in north and west provinces of Iran in 2012; and we investigated the full genome sequence of Iranian IPNV and compared it with previously identified IPNV sequences. The sequences of different structural and nonstructural-protein genes were compared to those of other aquatic birnaviruses sequenced to date. Our results show that the Iranian isolate falls within genogroup 5, serotype A2 strain SP, having 99% identity with the strain 1146 from Spain. These results suggest that the Iranian isolate may have originated from Europe.

Merida virus, a putative novel rhabdovirus discovered in Culex and Ochlerotatus spp. mosquitoes in the Yucatan Peninsula of Mexico.

PubMed

Charles, Jermilia; Firth, Andrew E; Loroño-Pino, Maria A; Garcia-Rejon, Julian E; Farfan-Ale, Jose A; Lipkin, W Ian; Blitvich, Bradley J; Briese, Thomas

2016-04-01

Sequences corresponding to a putative, novel rhabdovirus [designated Merida virus (MERDV)] were initially detected in a pool of Culex quinquefasciatus collected in the Yucatan Peninsula of Mexico. The entire genome was sequenced, revealing 11 798 nt and five major ORFs, which encode the nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). The deduced amino acid sequences of the N, G and L proteins have no more than 24, 38 and 43 % identity, respectively, to the corresponding sequences of all other known rhabdoviruses, whereas those of the P and M proteins have no significant identity with any sequences in GenBank and their identity is only suggested based on their genome position. Using specific reverse transcription-PCR assays established from the genome sequence, 27 571 C. quinquefasciatus which had been sorted in 728 pools were screened to assess the prevalence of MERDV in nature and 25 pools were found positive. The minimal infection rate (calculated as the number of positive mosquito pools per 1000 mosquitoes tested) was 0.9, and similar for both females and males. Screening another 140 pools of 5484 mosquitoes belonging to four other genera identified positive pools of Ochlerotatus spp. mosquitoes, indicating that the host range is not restricted to C. quinquefasciatus. Attempts to isolate MERDV in C6/36 and Vero cells were unsuccessful. In summary, we provide evidence that a previously undescribed rhabdovirus occurs in mosquitoes in Mexico.

Accuracy of the high-throughput amplicon sequencing to identify species within the genus Aspergillus.

PubMed

Lee, Seungeun; Yamamoto, Naomichi

2015-12-01

This study characterized the accuracy of high-throughput amplicon sequencing to identify species within the genus Aspergillus. To this end, we sequenced the internal transcribed spacer 1 (ITS1), β-tubulin (BenA), and calmodulin (CaM) gene encoding sequences as DNA markers from eight reference Aspergillus strains with known identities using 300-bp sequencing on the Illumina MiSeq platform, and compared them with the BLASTn outputs. The identifications with the sequences longer than 250 bp were accurate at the section rank, with some ambiguities observed at the species rank due to mostly cross detection of sibling species. Additionally, in silico analysis was performed to predict the identification accuracy for all species in the genus Aspergillus, where 107, 210, and 187 species were predicted to be identifiable down to the species rank based on ITS1, BenA, and CaM, respectively. Finally, air filter samples were analysed to quantify the relative abundances of Aspergillus species in outdoor air. The results were reproducible across biological duplicates both at the species and section ranks, but not strongly correlated between ITS1 and BenA, suggesting the Aspergillus detection can be taxonomically biased depending on the selection of the DNA markers and/or primers. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Defining species-specific immunodominant B cell epitopes for molecular serology of Chlamydia species.

PubMed

Rahman, K Shamsur; Chowdhury, Erfan U; Poudel, Anil; Ruettger, Anke; Sachse, Konrad; Kaltenboeck, Bernhard

2015-05-01

Urgently needed species-specific enzyme-linked immunosorbent assays (ELISAs) for the detection of antibodies against Chlamydia spp. have been elusive due to high cross-reactivity of chlamydial antigens. To identify Chlamydia species-specific B cell epitopes for such assays, we ranked the potential epitopes of immunodominant chlamydial proteins that are polymorphic among all Chlamydia species. High-scoring peptides were synthesized with N-terminal biotin, followed by a serine-glycine-serine-glycine spacer, immobilized onto streptavidin-coated microtiter plates, and tested with mono-specific mouse hyperimmune sera against each Chlamydia species in chemiluminescent ELISAs. For each of nine Chlamydia species, three to nine dominant polymorphic B cell epitope regions were identified on OmpA, CT618, PmpD, IncA, CT529, CT442, IncG, Omp2, TarP, and IncE proteins. Peptides corresponding to 16- to 40-amino-acid species-specific sequences of these epitopes reacted highly and with absolute specificity with homologous, but not heterologous, Chlamydia monospecies-specific sera. Host-independent reactivity of such epitopes was confirmed by testing of six C. pecorum-specific peptides from five proteins with C. pecorum-reactive sera from cattle, the natural host of C. pecorum. The probability of cross-reactivity of peptide antigens from closely related chlamydial species or strains correlated with percent sequence identity and declined to zero at <50% sequence identity. Thus, phylograms of B cell epitope regions predict the specificity of peptide antigens for rational use in the genus-, species-, or serovar-specific molecular serology of Chlamydia spp. We anticipate that these peptide antigens will improve chlamydial serology by providing easily accessible assays to nonspecialist laboratories. Our approach also lends itself to the identification of relevant epitopes of other microbial pathogens. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Defining Species-Specific Immunodominant B Cell Epitopes for Molecular Serology of Chlamydia Species

PubMed Central

Rahman, K. Shamsur; Chowdhury, Erfan U.; Poudel, Anil; Ruettger, Anke; Sachse, Konrad

2015-01-01

Urgently needed species-specific enzyme-linked immunosorbent assays (ELISAs) for the detection of antibodies against Chlamydia spp. have been elusive due to high cross-reactivity of chlamydial antigens. To identify Chlamydia species-specific B cell epitopes for such assays, we ranked the potential epitopes of immunodominant chlamydial proteins that are polymorphic among all Chlamydia species. High-scoring peptides were synthesized with N-terminal biotin, followed by a serine-glycine-serine-glycine spacer, immobilized onto streptavidin-coated microtiter plates, and tested with mono-specific mouse hyperimmune sera against each Chlamydia species in chemiluminescent ELISAs. For each of nine Chlamydia species, three to nine dominant polymorphic B cell epitope regions were identified on OmpA, CT618, PmpD, IncA, CT529, CT442, IncG, Omp2, TarP, and IncE proteins. Peptides corresponding to 16- to 40-amino-acid species-specific sequences of these epitopes reacted highly and with absolute specificity with homologous, but not heterologous, Chlamydia monospecies-specific sera. Host-independent reactivity of such epitopes was confirmed by testing of six C. pecorum-specific peptides from five proteins with C. pecorum-reactive sera from cattle, the natural host of C. pecorum. The probability of cross-reactivity of peptide antigens from closely related chlamydial species or strains correlated with percent sequence identity and declined to zero at <50% sequence identity. Thus, phylograms of B cell epitope regions predict the specificity of peptide antigens for rational use in the genus-, species-, or serovar-specific molecular serology of Chlamydia spp. We anticipate that these peptide antigens will improve chlamydial serology by providing easily accessible assays to nonspecialist laboratories. Our approach also lends itself to the identification of relevant epitopes of other microbial pathogens. PMID:25761461

A first report and complete genome sequence of alfalfa enamovirus from Sudan

USDA-ARS?s Scientific Manuscript database

A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...

Characterization of Cryptocaryon irritans, a parasite isolated from marine fishes in Taiwan.

PubMed

Yambot, Apolinario V; Song, Yen-Ling; Sung, Hung-Hung

2003-03-31

The ciliated protozoan parasite Cryptocaryon irritans infecting marine fishes in Taiwan is described. Developmental characteristics and sequences of the ribosomal DNA regions such as part of 18 S, the entire first internal transcribed spacer, and part of 5.8 S of various Taiwan isolates of C. irritans were investigated. A total of 5 isolates was obtained from different fish-host species and localities, the majority from cultured fish species. C. irritans from Taiwan is able to shift its developmental characteristics, i.e. from non-adherent to adherent tomonts, from individualistic to aggregate-forming tomonts, from infection of the gills only to infection of the gills and body. Thus, it is not possible to classify strains of C. irritans on the basis of these parameters. Premature tomonts that developed from dead fishes were able to produce theronts that could infect fish host. Isolates from Pingtung and the USA had identical nucleotide sequences while an isolate from Malaysia was identical to an Israel isolate. Percentage variation among pairs of Taiwan isolates showed a higher degree of variation than isolate sequences listed in GenBank. Sequence analysis revealed highly aberrant isolates in Taiwan, and a phylogenetic tree distinguished a marine and a low-salinity variant. C. irritans from marine fishes in Taiwan, therefore, display some characteristics not previously reported. Since manipulation of salinity in brackishwater ponds and marine cage sites is not feasible, there is a need to develop new strategies for the control and prevention of cryptocaryoniasis.

Genotypic characterization and species identification of Fasciola spp. with implications regarding the isolates infecting goats in Vietnam.

PubMed

Nguyen, Thanh Giang Thi; Van De, Nguyen; Vercruysse, Jozef; Dorny, Pierre; Le, Thanh Hoa

2009-12-01

Ribosomal RNA sequences (361 or 362bp) of the second internal transcribed spacer 2 (ITS-2) and a portion of mitochondrial cox1 (423bp) for Fasciola spp. obtained from specimens collected in indigenous and hybrid goats and sheep in Vietnam were characterized for genotypic status and hybridization/introgression. Alignment of 48 ITS-2 sequences (also those from goats and sheep in this study) indicates that F. gigantica and F. hepatica differ typically from each other at seven sites whereas one of these is a distinguishing deletion (T) at the 327th position in F. gigantica relative to F. hepatica. The isolates from the mountainous goats in the North of Vietnam (Yen Bai province) showed the ITS-2 composition relatively identical to that of F. hepatica. The ITS-2 sequences from populations of Fasciola isolates in goats had probably experienced introgression/hybridization as reported previously in other ruminants and humans. All Vietnamese goat-of-origin specimens had high pairwise percentage of mitochondrial cox1 sequences to F. gigantica (97-100%), and very low identity to F. hepatica (91-93%), suggesting their maternal linkage to be traced to F. gigantica. The presence of hybrid and/or introgressed populations of liver flukes bearing genetic material from both F. hepatica and F. gigantica in the goats/sheep in Vietnam, regardless of indigenous or imported hosts, appears to be the first demonstration from a tropical country.

Evidence for Sequence Scrambling and Divergent H/D Exchange Reactions of Doubly-Charged Isobaric b-Type Fragment Ions

NASA Astrophysics Data System (ADS)

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H.; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10 2+ that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10 2+ and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10 2+, suggesting that b10 2+ may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10 2+; over 30 % of the observed SORI-CID fragment ions from substance P b10 2+ had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10 2+, whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10 2+.

Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

PubMed

Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

2014-02-01

To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

Isolation and Characterization of Two Cryptic Plasmids in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

PubMed Central

Yamagata, Akira; Kato, Junichi; Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

1999-01-01

Two plasmids were discovered in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11, which was isolated from activated sludge. The plasmids, designated pAYS and pAYL, were relatively small, being approximately 1.9 kb long. They were cryptic plasmids, having no detectable plasmid-linked antibiotic resistance or heavy metal resistance markers. The complete nucleotide sequences of pAYS and pAYL were determined, and their physical maps were constructed. There existed two major open reading frames, ORF1 in pAYS and ORF2 in pAYL, each of which was more than 500 bp long. The predicted product of ORF2 was 28% identical to part of the replication protein of a Bacillus plasmid, pBAA1. However, no significant similarity to any known protein sequences was detected with the predicted product of ORF1. pAYS and pAYL had a highly homologous region, designated HHR, of 262 bp. The overall identity was 98% between the two nucleotide sequences. Interestingly, HHR-homologous sequences were also detected in the genomes of ENI-11 and the plasmidless strain Nitrosomonas europaea IFO14298. Deletion analysis of pAYS and pAYL indicated that HHR, together with either ORF1 or ORF2, was essential for plasmid maintenance in ENI-11. To our knowledge, pAYS and pAYL are the first plasmids found in the ammonia-oxidizing autotrophic bacteria. PMID:10348848

An outbreak of food-borne gastroenteritis due to sapovirus among junior high school students.

PubMed

Usuku, Shuzo; Kumazaki, Makoto; Kitamura, Katsuhiko; Tochikubo, Osamu; Noguchi, Yuzo

2008-11-01

The human sapovirus (SaV) causes acute gastroenteritis mainly in infants and young children. A food-borne outbreak of gastroenteritis associated with SaV occurred among junior high school students in Yokohama, Japan, during and after a study trip. The nucleotide sequences of the partial capsid gene derived from the students exhibited 98% homology to a SaV genogroup IV strain, Hu/Angelholm/SW278/2004/SE, which was isolated from an adult with gastroenteritis in Solna, Sweden. An identical nucleotide sequence was detected from a food handler at the hotel restaurant, suggesting that the causative agent of the outbreak was transmitted from the food handler. This is the first description of a food-borne outbreak associated with the SaV genogroup IV strain in Japan.

International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

PubMed Central

Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

2015-01-01

This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

Novel Phenotype-Genotype Correlations of Restrictive Cardiomyopathy With Myosin-Binding Protein C (MYBPC3) Gene Mutations Tested by Next-Generation Sequencing.

PubMed

Wu, Wei; Lu, Chao-Xia; Wang, Yi-Ning; Liu, Fang; Chen, Wei; Liu, Yong-Tai; Han, Ye-Chen; Cao, Jian; Zhang, Shu-Yang; Zhang, Xue

2015-07-10

MYBPC3 dysfunctions have been proven to induce dilated cardiomyopathy, hypertrophic cardiomyopathy, and/or left ventricular noncompaction; however, the genotype-phenotype correlation between MYBPC3 and restrictive cardiomyopathy (RCM) has not been established. The newly developed next-generation sequencing method is capable of broad genomic DNA sequencing with high throughput and can help explore novel correlations between genetic variants and cardiomyopathies. A proband from a multigenerational family with 3 live patients and 1 unrelated patient with clinical diagnoses of RCM underwent a next-generation sequencing workflow based on a custom AmpliSeq panel, including 64 candidate pathogenic genes for cardiomyopathies, on the Ion Personal Genome Machine high-throughput sequencing benchtop instrument. The selected panel contained a total of 64 genes that were reportedly associated with inherited cardiomyopathies. All patients fulfilled strict criteria for RCM with clinical characteristics, echocardiography, and/or cardiac magnetic resonance findings. The multigenerational family with 3 adult RCM patients carried an identical nonsense MYBPC3 mutation, and the unrelated patient carried a missense mutation in the MYBPC3 gene. All of these results were confirmed by the Sanger sequencing method. This study demonstrated that MYBPC3 gene mutations, revealed by next-generation sequencing, were associated with familial and sporadic RCM patients. It is suggested that the next-generation sequencing platform with a selected panel provides a highly efficient approach for molecular diagnosis of hereditary and idiopathic RCM and helps build new genotype-phenotype correlations. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

Using phylogenetically-informed annotation (PIA) to search for light-interacting genes in transcriptomes from non-model organisms.

PubMed

Speiser, Daniel I; Pankey, M Sabrina; Zaharoff, Alexander K; Battelle, Barbara A; Bracken-Grissom, Heather D; Breinholt, Jesse W; Bybee, Seth M; Cronin, Thomas W; Garm, Anders; Lindgren, Annie R; Patel, Nipam H; Porter, Megan L; Protas, Meredith E; Rivera, Ajna S; Serb, Jeanne M; Zigler, Kirk S; Crandall, Keith A; Oakley, Todd H

2014-11-19

Tools for high throughput sequencing and de novo assembly make the analysis of transcriptomes (i.e. the suite of genes expressed in a tissue) feasible for almost any organism. Yet a challenge for biologists is that it can be difficult to assign identities to gene sequences, especially from non-model organisms. Phylogenetic analyses are one useful method for assigning identities to these sequences, but such methods tend to be time-consuming because of the need to re-calculate trees for every gene of interest and each time a new data set is analyzed. In response, we employed existing tools for phylogenetic analysis to produce a computationally efficient, tree-based approach for annotating transcriptomes or new genomes that we term Phylogenetically-Informed Annotation (PIA), which places uncharacterized genes into pre-calculated phylogenies of gene families. We generated maximum likelihood trees for 109 genes from a Light Interaction Toolkit (LIT), a collection of genes that underlie the function or development of light-interacting structures in metazoans. To do so, we searched protein sequences predicted from 29 fully-sequenced genomes and built trees using tools for phylogenetic analysis in the Osiris package of Galaxy (an open-source workflow management system). Next, to rapidly annotate transcriptomes from organisms that lack sequenced genomes, we repurposed a maximum likelihood-based Evolutionary Placement Algorithm (implemented in RAxML) to place sequences of potential LIT genes on to our pre-calculated gene trees. Finally, we implemented PIA in Galaxy and used it to search for LIT genes in 28 newly-sequenced transcriptomes from the light-interacting tissues of a range of cephalopod mollusks, arthropods, and cubozoan cnidarians. Our new trees for LIT genes are available on the Bitbucket public repository ( http://bitbucket.org/osiris_phylogenetics/pia/ ) and we demonstrate PIA on a publicly-accessible web server ( http://galaxy-dev.cnsi.ucsb.edu/pia/ ). Our new trees for LIT genes will be a valuable resource for researchers studying the evolution of eyes or other light-interacting structures. We also introduce PIA, a high throughput method for using phylogenetic relationships to identify LIT genes in transcriptomes from non-model organisms. With simple modifications, our methods may be used to search for different sets of genes or to annotate data sets from taxa outside of Metazoa.

Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

PubMed Central

Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

2012-01-01

Background Cotton (Gossypium spp.) is a model system for the analysis of polyploidization. Although ascertaining the donor species of allotetraploid cotton has been intensively studied, sequence comparison of Gossypium chloroplast genomes is still of interest to understand the mechanisms underlining the evolution of Gossypium allotetraploids, while it is generally accepted that the parents were A- and D-genome containing species. Here we performed a comparative analysis of 13 Gossypium chloroplast genomes, twelve of which are presented here for the first time. Methodology/Principal Findings The size of 12 chloroplast genomes under study varied from 159,959 bp to 160,433 bp. The chromosomes were highly similar having >98% sequence identity. They encoded the same set of 112 unique genes which occurred in a uniform order with only slightly different boundary junctions. Divergence due to indels as well as substitutions was examined separately for genome, coding and noncoding sequences. The genome divergence was estimated as 0.374% to 0.583% between allotetraploid species and A-genome, and 0.159% to 0.454% within allotetraploids. Forty protein-coding genes were completely identical at the protein level, and 20 intergenic sequences were completely conserved. The 9 allotetraploids shared 5 insertions and 9 deletions in whole genome, and 7-bp substitutions in protein-coding genes. The phylogenetic tree confirmed a close relationship between allotetraploids and the ancestor of A-genome, and the allotetraploids were divided into four separate groups. Progenitor allotetraploid cotton originated 0.43–0.68 million years ago (MYA). Conclusion Despite high degree of conservation between the Gossypium chloroplast genomes, sequence variations among species could still be detected. Gossypium chloroplast genomes preferred for 5-bp indels and 1–3-bp indels are mainly attributed to the SSR polymorphisms. This study supports that the common ancestor of diploid A-genome species in Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

PubMed

Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

2008-11-04

We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

Corruption of genomic databases with anomalous sequence.

PubMed

Lamperti, E D; Kittelberger, J M; Smith, T F; Villa-Komaroff, L

1992-06-11

We describe evidence that DNA sequences from vectors used for cloning and sequencing have been incorporated accidentally into eukaryotic entries in the GenBank database. These incorporations were not restricted to one type of vector or to a single mechanism. Many minor instances may have been the result of simple editing errors, but some entries contained large blocks of vector sequence that had been incorporated by contamination or other accidents during cloning. Some cases involved unusual rearrangements and areas of vector distant from the normal insertion sites. Matches to vector were found in 0.23% of 20,000 sequences analyzed in GenBank Release 63. Although the possibility of anomalous sequence incorporation has been recognized since the inception of GenBank and should be easy to avoid, recent evidence suggests that this problem is increasing more quickly than the database itself. The presence of anomalous sequence may have serious consequences for the interpretation and use of database entries, and will have an impact on issues of database management. The incorporated vector fragments described here may also be useful for a crude estimate of the fidelity of sequence information in the database. In alignments with well-defined ends, the matching sequences showed 96.8% identity to vector; when poorer matches with arbitrary limits were included, the aggregate identity to vector sequence was 94.8%.

Gene encoding the group B streptococcal protein R4, its presence in clinical reference laboratory isolates & R4 protein pepsin sensitivity.

PubMed

Smith, B L; Flores, A; Dechaine, J; Krepela, J; Bergdall, A; Ferrieri, P

2004-05-01

R proteins were first identified by Lancefield in group B Streptococcus (GBS) as resistant to trypsin at pH8 and sensitive to pepsin at pH2. The R4 protein found predominantly in type III and some type II and V invasive isolates conforms to these criteria. The Rib protein, although structurally and epidemiologically similar to R4, was reported as resistant to both proteases. We report here the gene encoding the R4 protein from a type III group B streptococcal isolate (76-043) well characterized in our laboratory. Trypsin extracted GBS proteins were assayed for protease sensitivities by double-diffusion Ouchterlony using varying conditions for the enzyme pepsin. Standard haemoglobin assay was used to examine pepsin enzymatic activity. Thirty clinical isolates of varying protein profiles identified by double-diffusion from our reference strain laboratory were screened by PCR and Southern technique. SDS-PAGE gel purified R4 amino acid sequences were determined and used to design oligonucleotide primers for screening a 76-043 genomic library. R4 was sensitive to pepsin at pH2 but appeared resistant at pH4, the reported pH used for Rib. By standard haemoglobin assay and trypsin extract studies of R4 protein, pepsin was shown to be active at pH2, yet easily inactivated; assays of GBS surface proteins are critical at pH2. Of the amino acids initially sequenced from R4, 88 per cent (61/69) showed identity to Rib; the r4 nucleotide sequence was identical to that of rib. All isolates with strong positive protein reactions for R4 were positive in both PCR and Southern technique, whereas isolates expressing alpha, beta, R1/R4, and R5 (BPS) protein profiles were not. Sequenced PCR products aligned with identity to the R4 and Rib nucleotide sequences and confirmed the identity of these proteins and their molecular sequences.

Lateral Transfer of a Lectin-Like Antifreeze Protein Gene in Fishes

PubMed Central

Graham, Laurie A.; Lougheed, Stephen C.; Ewart, K. Vanya; Davies, Peter L.

2008-01-01

Fishes living in icy seawater are usually protected from freezing by endogenous antifreeze proteins (AFPs) that bind to ice crystals and stop them from growing. The scattered distribution of five highly diverse AFP types across phylogenetically disparate fish species is puzzling. The appearance of radically different AFPs in closely related species has been attributed to the rapid, independent evolution of these proteins in response to natural selection caused by sea level glaciations within the last 20 million years. In at least one instance the same type of simple repetitive AFP has independently originated in two distant species by convergent evolution. But, the isolated occurrence of three very similar type II AFPs in three distantly related species (herring, smelt and sea raven) cannot be explained by this mechanism. These globular, lectin-like AFPs have a unique disulfide-bonding pattern, and share up to 85% identity in their amino acid sequences, with regions of even higher identity in their genes. A thorough search of current databases failed to find a homolog in any other species with greater than 40% amino acid sequence identity. Consistent with this result, genomic Southern blots showed the lectin-like AFP gene was absent from all other fish species tested. The remarkable conservation of both intron and exon sequences, the lack of correlation between evolutionary distance and mutation rate, and the pattern of silent vs non-silent codon changes make it unlikely that the gene for this AFP pre-existed but was lost from most branches of the teleost radiation. We propose instead that lateral gene transfer has resulted in the occurrence of the type II AFPs in herring, smelt and sea raven and allowed these species to survive in an otherwise lethal niche. PMID:18612417

Detection and follow-up of torque teno midi virus ("small anelloviruses") in nasopharyngeal aspirates and three other human body fluids in children.

PubMed

Burián, Zsófia; Szabó, Hajnalka; Székely, Gyöngyi; Gyurkovits, Kálmán; Pankovics, Péter; Farkas, Tibor; Reuter, Gábor

2011-09-01

Torque teno midi virus/small anellovirus (TTMDV/SAV) is a member of the family Anelloviridae. It has a single-stranded, circular, negative-sense DNA genome. Its pathogenic role in human disease remains to be confirmed. In this study, viral shedding, molecular epidemiology and genetic diversity of TTMDV/SAV were studied in human body fluids. Nasopharyngeal aspirates collected from children with acute respiratory disease were tested by PCR/nested PCR for TTMDV/SAV in two seasons (2005/2006, 2006/2007). Two years later, additional urine, stool, and serum samples and nasopharyngeal aspirates were collected from eight symptomless children for follow-up investigation. Forty-three (46.7%) of the 92 nasopharyngeal aspirates collected contained TTMDV/SAV. High genetic diversity was observed; however, identical sequences were also detected in two patients. The mean age of the infected children was 3 years (1 months-8 years), and 58% of them were female. Co-infection with RSV was detected in 23% of the samples. In a follow-up study, nasopharyngeal aspirates and serum of six (75%), stool samples of four (50%) and urine samples of two (25%) of the eight children were anellovirus-positive. None of the anellovirus sequences were identical in the two collection periods, but identical sequences were detected in different body fluids collected at the same time from the same child. TTMDV/SAVs shedding was detected in four human body fluids. As a consequence, it is possible that generalized infection and fecal/uro-oral transmission of TTMDV/SAV occur. TTMDV/SAVs are frequently present in nasopharyngeal aspirates, although the variants may only be transient agents. Further research is needed to investigate the pathogenesis and pathogenic role of TTMDV/SAV.

Molecular variation and distribution of Anopheles fluviatilis (Diptera: Culicidae) complex in Iran.

PubMed

Naddaf, Saied Reza; Razavi, Mohammad Reza; Bahramali, Golnaz

2010-09-01

Anopheles fluviatilis James (Diptera: Culicidae) is one of the known malaria vectors in south and southeastern Iran. Earlier ITS2 sequences analysis of specimens from Iran demonstrated only a single genotype that was identical to species Y in India, which is also the same as species T. We identified 2 haplotypes in the An. fluviatilis populations of Iran based on differences in nucleotide sequences of D3 domain of the 28S locus of ribosomal DNA (rDNA). Comparison of sequence data from 44 Iranian specimens with those publicly available in the Genbank database showed that all of the 28S-D3 sequences from Kazeroun and Khesht regions in Fars Province were identical to the database entry representing species U in India. In other regions, all the individuals showed heterozygosity at the single nucleotide position, which identifies species U and T. It is argued that the 2 species may co-occur in some regions and hybridize; however, the heterozygosity in the 28S-D3 locus was not reflected in ITS2 sequences and this locus for all individuals was identical to species T. This study shows that in a newly diverged species, like members of An. fluviatilis complex, a single molecular marker may not be sufficiently discriminatory to identify all the taxa over a vast geographical area. In addition, other molecular markers may provide more reliable information for species discrimination.

Molecular homogeneity of heat-stable enterotoxins produced by bovine enterotoxigenic Escherichia coli.

PubMed Central

Saeed, A M; Magnuson, N S; Sriranganathan, N; Burger, D; Cosand, W

1984-01-01

Heat-stable enterotoxins (STs) from four strains of bovine enterotoxigenic Escherichia coli representing four serogroups were purified to homogeneity by utilizing previously published purification schemata. Biochemical characterization of the purified STs showed that they met the basic criteria for the heat-stable enterotoxins of E. coli. Amino acid analysis of the purified STs revealed that they were peptides of identical amino acid composition. This composition consisted of 18 residues of 10 different amino acids, 6 of which were cysteine. The amino acid composition of the four ST peptides was identical to that reported for the STs of human and porcine E. coli. In addition, complete sequence analysis of two of the ST peptides and partial sequencing of several others revealed strong homology to the sequences of STs from human and porcine E. coli and to the sequence predicted from the last 18 codons of the transposon Tn1681. There was also substantial homology to the sequence predicted from the ST-coding genetic element of human E. coli, which may indicate the existence of identical bioactive configuration among ST peptides of E. coli strains of various host origins. These data support the hypothesis that STs produced by human, bovine, and porcine E. coli are coded by a closely related genetic element which may have originated from a single, widely disseminated transposon. Images PMID:6376355

Abr1, a Transposon-Like Element in the Genome of the Cultivated Mushroom Agaricus bisporus (Lange) Imbach

PubMed Central

Sonnenberg, Anton S. M.; Baars, Johan J. P.; Mikosch, Thomas S. P.; Schaap, Peter J.; Van Griensven, Leo J. L. D.

1999-01-01

A 300-bp repetitive element was found in the genome of the white button mushroom, Agaricus bisporus, and designated Abr1. It is present in ∼15 copies per haploid genome in the commercial strain Horst U1. Analysis of seven copies showed 89 to 97% sequence identity. The repeat has features typical of class II transposons (i.e., terminal inverted repeats, subterminal repeats, and a target site duplication of 7 bp). The latter shows a consensus sequence. When used as probe on Southern blots, Abr1 identifies relatively little variation within traditional and present-day commercial strains, indicating that most strains are identical or have a common origin. In contrast to these cultivars, high variation is found among field-collected strains. Furthermore, a remarkable difference in copy numbers of Abr1 was found between A. bisporus isolates with a secondarily homothallic life cycle and those with a heterothallic life cycle. Abr1 is a type II transposon not previously reported in basidiomycetes and appears to be useful for the identification of strains within the species A. bisporus. PMID:10427018

Fowl Adenoviruses D and E Cause Inclusion Body Hepatitis Outbreaks in Broiler and Broiler Breeder Pullet Flocks.

PubMed

Morshed, Rima; Hosseini, Hossein; Langeroudi, Arash Ghalyanchi; Fard, Mohammad Hassan Bozorgmehri; Charkhkar, Saeid

2017-06-01

Twenty-four fowl adenoviruses (FAdVs) were isolated from broiler and broiler breeder pullet flocks in Iran during 2013-2016 and were identified and characterized. All FAdVs were from inclusion body hepatitis (IBH) cases, showing an enlarged and pale yellow liver with multiple petechial hemorrhages. Phylogenetic analyses of partial hexon gene sequences are an adequate and quick method for differentiation and genotyping. The isolates were subjected to PCR to amplify a 590-bp fragment from the hexon gene. Sequence analysis revealed the presence of two species D and E. Eighty FAdV isolates were genetically related to the strain EU979378 of FAdV-11 (96.5% to 97.6% identity), and six isolates were related to the strain EU979375 of FAdV-8b (97% identity). The results indicated that two FAdV serotypes (11 and 8b) are high prevalence serotypes of FAdVs in Iran and are pathogenic enough to cause IBH in young chicks. Therefore, preventive measures against FAdV infection on poultry farms should be implemented.

Characterization and in situ localization of a salt-induced tomato peroxidase mRNA.

PubMed

Botella, M A; Quesada, M A; Kononowicz, A K; Bressan, R A; Pliego, F; Hasegawa, P M; Valpuesta, V

1994-04-01

NaCl treatment of tomato plants in hydroponic culture at concentrations as low as 50 mM resulted in enhanced accumulation of transcripts of TPX1, a full-length cDNA clone that we had isolated from a library of NaCl-treated tomato plants using a peroxidase-specific oligonucleotide probe. Although the overall amino acid sequence identity of TPX1 to other peroxidase genes was less than 45%, there was a very high degree of identity in all of the conserved domains. The deduced amino acid sequence included the presence of a N-terminal signal peptide but not the C-terminal extension present in peroxidases targeted to the vacuole. The mature protein has a theoretical pI value of 7.5. Transcripts that hybridized to TPX1 were detected only in the roots with higher levels of mRNA in epidermal and subepidermal cell layers. Isoelectric focusing of root extracts showed two major bands of peroxidase activity at pI 5.9 and 6.2. Both activities increased with salt treatment. Southern analysis indicated the presence of only a single TPX1 gene in tomato.

The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

PubMed

Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

2005-12-20

Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

Molecular identification of hard ticks (Ixodes sp.) infesting rodents in Selangor, Malaysia

NASA Astrophysics Data System (ADS)

Ishak, Siti Nabilah; Shiang, Lim Fang; Taib, Farah Shafawati Mohd; Jing, Khoo Jing; Nor, Shukor Md; Yusof, Muhammad Afif; Sah, Shahrul Anuar Mohd; Sitam, Frankie Thomas; Japning, Jeffrine Rovie Ryan

2018-04-01

This study aims to identify hard ticks (Ixodes sp.) infesting rodents in three different sites in Selangor, Malaysia using a molecular approach. A total of 11 individual ticks infesting four different host species (Rattus tiomanicus, Rattus ratus, Maxomys surifer and Sundamys muelleri) were examined based on its morphological features, followed by molecular identification using mitochondrial 16S rDNA gene. Confirmation of the species identity was accomplished by using BLAST program. Clustering analysis based on 16S rDNA sequences was carried out by constructing Neighbour-joining (NJ) and Maximum parsimony (MP) tree using MEGA 7 to clarify the genetic identity of Ixodes sp. Based on morphological features, all individual ticks were only able to be identified up to genus level as most of the samples were fully engorged, damaged and lacked morphological characters. However, molecular analysis of samples revealed 99% similarity with Ixodes granulatus from the GenBank database. Thus, the result of this study showed that all these ticks (Ixodes granulatus) were genetically affiliated to a monophyletic group with highly homogenous sequences.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

NASA Astrophysics Data System (ADS)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Polymorphisms and variants in the prion protein sequence of European moose (Alces alces), reindeer (Rangifer tarandus), roe deer (Capreolus capreolus) and fallow deer (Dama dama) in Scandinavia

PubMed Central

Wik, Lotta; Mikko, Sofia; Klingeborn, Mikael; Stéen, Margareta; Simonsson, Magnus; Linné, Tommy

2012-01-01

The prion protein (PrP) sequence of European moose, reindeer, roe deer and fallow deer in Scandinavia has high homology to the PrP sequence of North American cervids. Variants in the European moose PrP sequence were found at amino acid position 109 as K or Q. The 109Q variant is unique in the PrP sequence of vertebrates. During the 1980s a wasting syndrome in Swedish moose, Moose Wasting Syndrome (MWS), was described. SNP analysis demonstrated a difference in the observed genotype proportions of the heterozygous Q/K and homozygous Q/Q variants in the MWS animals compared with the healthy animals. In MWS moose the allele frequencies for 109K and 109Q were 0.73 and 0.27, respectively, and for healthy animals 0.69 and 0.31. Both alleles were seen as heterozygotes and homozygotes. In reindeer, PrP sequence variation was demonstrated at codon 176 as D or N and codon 225 as S or Y. The PrP sequences in roe deer and fallow deer were identical with published GenBank sequences. PMID:22441661

Rapid construction of a whole-genome transposon insertion collection for Shewanella oneidensis by Knockout Sudoku.

PubMed

Baym, Michael; Shaket, Lev; Anzai, Isao A; Adesina, Oluwakemi; Barstow, Buz

2016-11-10

Whole-genome knockout collections are invaluable for connecting gene sequence to function, yet traditionally, their construction has required an extraordinary technical effort. Here we report a method for the construction and purification of a curated whole-genome collection of single-gene transposon disruption mutants termed Knockout Sudoku. Using simple combinatorial pooling, a highly oversampled collection of mutants is condensed into a next-generation sequencing library in a single day, a 30- to 100-fold improvement over prior methods. The identities of the mutants in the collection are then solved by a probabilistic algorithm that uses internal self-consistency within the sequencing data set, followed by rapid algorithmically guided condensation to a minimal representative set of mutants, validation, and curation. Starting from a progenitor collection of 39,918 mutants, we compile a quality-controlled knockout collection of the electroactive microbe Shewanella oneidensis MR-1 containing representatives for 3,667 genes that is functionally validated by high-throughput kinetic measurements of quinone reduction.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zemla, A; Lang, D; Kostova, T

2010-11-29

Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

PubMed Central

Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

2012-01-01

Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

Recombinant SINEs are formed at high frequency during induced retrotransposition in vivo.

PubMed

Yadav, Vijay Pal; Mandal, Prabhat Kumar; Bhattacharya, Alok; Bhattacharya, Sudha

2012-05-22

Non-long terminal repeat Retrotransposons are referred to as long interspersed nuclear elements (LINEs) and their non-autonomous partners are short interspersed nuclear elements (SINEs). It is believed that an active SINE copy, upon retrotransposition, generates near identical copies of itself, which subsequently accumulate mutations resulting in sequence polymorphism. Here we show that when a retrotransposition-competent cell line of the parasitic protist Entamoeba histolytica, transfected with a marked SINE copy, is induced to retrotranspose, >20% of the newly retrotransposed copies are neither identical to the marked SINE nor to the mobilized resident SINEs. Rather they are recombinants of resident SINEs and the marked SINE. They are a consequence of retrotransposition and not DNA recombination, as they are absent in cells not expressing the retrotransposition functions. This high-frequency recombination provides a new explanation for the existence of mosaic SINEs, which may impact on genetic analysis of SINE lineages, and measurement of phylogenetic distances.

A Systematic Approach for Discovering Novel, Clinically Relevant Bacteria

PubMed Central

Simmon, Keith E.; Fisher, Mark A.

2012-01-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006–June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities. PMID:22377371

IVisTMSA: Interactive Visual Tools for Multiple Sequence Alignments.

PubMed

Pervez, Muhammad Tariq; Babar, Masroor Ellahi; Nadeem, Asif; Aslam, Naeem; Naveed, Nasir; Ahmad, Sarfraz; Muhammad, Shah; Qadri, Salman; Shahid, Muhammad; Hussain, Tanveer; Javed, Maryam

2015-01-01

IVisTMSA is a software package of seven graphical tools for multiple sequence alignments. MSApad is an editing and analysis tool. It can load 409% more data than Jalview, STRAP, CINEMA, and Base-by-Base. MSA comparator allows the user to visualize consistent and inconsistent regions of reference and test alignments of more than 21-MB size in less than 12 seconds. MSA comparator is 5,200% efficient and more than 40% efficient as compared to BALiBASE c program and FastSP, respectively. MSA reconstruction tool provides graphical user interfaces for four popular aligners and allows the user to load several sequence files at a time. FASTA generator converts seven formats of alignments of unlimited size into FASTA format in a few seconds. MSA ID calculator calculates identity matrix of more than 11,000 sequences with a sequence length of 2,696 base pairs in less than 100 seconds. Tree and Distance Matrix calculation tools generate phylogenetic tree and distance matrix, respectively, using neighbor joining% identity and BLOSUM 62 matrix.

A systematic approach for discovering novel, clinically relevant bacteria.

PubMed

Schlaberg, Robert; Simmon, Keith E; Fisher, Mark A

2012-03-01

Sequencing of the 16S rRNA gene (16S) is a reference method for bacterial identification. Its expanded use has led to increased recognition of novel bacterial species. In most clinical laboratories, novel species are infrequently encountered, and their pathogenic potential is often difficult to assess. We reviewed partial 16S sequences from >26,000 clinical isolates, analyzed during February 2006-June 2010, and identified 673 that have <99% sequence identity with valid reference sequences and are thus possibly novel species. Of these 673 isolates, 111 may represent novel genera (<95% identity). Isolates from 95 novel taxa were recovered from multiple patients, indicating possible clinical relevance. Most repeatedly encountered novel taxa belonged to the genera Nocardia (14 novel taxa, 42 isolates) and Actinomyces (12 novel taxa, 52 isolates). This systematic approach for recognition of novel species with potential diagnostic or therapeutic relevance provides a basis for epidemiologic surveys and improvement of sequence databases and may lead to identification of new clinical entities.

Characterization of Austrian koi herpesvirus samples based on the ORF40 region.

PubMed

Marek, A; Schachner, O; Bilic, I; Hess, M

2010-02-17

Using a PCR that amplifies a region of the thymidine kinase (TK) gene, an epidemic spread of koi herpesvirus (KHV) was determined in koi carps in Austria in 2007. A total of 15 virus samples from different locations in Austria were analyzed to determine their genetic relatedness following PCR and nucleic acid sequencing of the open reading frame 40 (ORF40) region of the KHV genome. ORF40-specific PCR amplification products that were obtained from tissue samples shared 100% nucleotide sequence identity with the published sequence of the Japanese strain of KHV. The ORF40 sequence of one isolate from the UK that was included in the present study was 100% identical with the published sequence of an Israeli strain of KHV. This is the first study that used a larger number of samples and a PCR method, which allowed distinguishing all 3 strains of KHV. The present investigation provides information on the epidemiology of KHV infections in Europe and describes a useful molecular tool for epidemiological studies.

Recent advances in plant centromere biology.

PubMed

Feng, Chao; Liu, YaLin; Su, HanDong; Wang, HeFei; Birchler, James; Han, FangPu

2015-03-01

The centromere, which is one of the essential parts of a chromosome, controls kinetochore formation and chromosome segregation during mitosis and meiosis. While centromere function is conserved in eukaryotes, the centromeric DNA sequences evolve rapidly and have few similarities among species. The histone H3 variant CENH3 (CENP-A in human), which mostly exists in centromeric nucleosomes, is a universal active centromere mark in eukaryotes and plays an essential role in centromere identity determination. The relationship between centromeric DNA sequences and centromere identity determination is one of the intriguing questions in studying centromere formation. Due to the discoveries in the past decades, including "neocentromeres" and "centromere inactivation", it is now believed that the centromere identity is determined by epigenetic mechanisms. This review will present recent progress in plant centromere biology.

Human centromere genomics: now it's personal.

PubMed

Hayden, Karen E

2012-07-01

Advances in human genomics have accelerated studies in evolution, disease, and cellular regulation. However, centromere sequences, defining the chromosomal interface with spindle microtubules, remain largely absent from ongoing genomic studies and disconnected from functional, genome-wide analyses. This disparity results from the challenge of predicting the linear order of multi-megabase-sized regions that are composed almost entirely of near-identical satellite DNA. Acknowledging these challenges, the field of human centromere genomics possesses the potential to rapidly advance given the availability of individual, or personalized, genome projects matched with the promise of long-read sequencing technologies. Here I review the current genomic model of human centromeres in consideration of those studies involving functional datasets that examine the role of sequence in centromere identity.

Full genome sequences of zebra-borne equine herpesvirus type 1 isolated from zebra, onager and Thomson's gazelle.

PubMed

Guo, Xiaoqin; Izume, Satoko; Okada, Ayaka; Ohya, Kenji; Kimura, Takashi; Fukushi, Hideto

2014-09-01

A strain of equine herpesvirus type 1 (EHV-1) was isolated from zebra. This strain, called "zebra-borne EHV-1", was also isolated from an onager and a gazelle in zoological gardens in U.S.A. The full genome sequences of the 3 strains were determined. They shared 99% identities with each other, while they shared 98% and 95% identities with the horse derived EHV-1 and equine herpesvirus type 9, respectively. Sequence data indicated that the EHV-1 isolated from a polar bear in Germany is one of the zebra-borne EHV-1 and not a recombinant virus. These results indicated that zebra-borne EHV-1 is a subtype of EHV-1.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

PubMed

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12.

PubMed

Farrokh, Parisa; Yakhchali, Bagher; Karkhane, Ali Asghar

2014-01-01

A mesophilic Enterobacter sp. Bn12 producing an alkaline thermostable lipase was isolated from soil in Tehran, Iran. The lipase gene (ELBn12) was identified from a genomic library. Sequence analysis of the DNA fragment revealed an open reading frame of 879 bp encoding a lipase with a molecular mass of 31.3 kDa. The deduced amino acid sequence showed 96% identity with a lipase of Enterobacter sp. Ag1 and the identity of their DNA sequences was 88.9%. ELBn12 belongs to the lipase subfamily I.1 and its catalytic triad consists of Ser82, Asp237 and His259. The lipase was expressed in Escherichia coli (BL21) pLysS and partially purified by anion exchange chromatography. The maximum activity of ELBn12 was obtained at temperature of 60 °C and pH 8.0 towards tricaprylin (C8) and its specific activity was around 2900 U/mg. ELBn12 was stable within a broad pH range from 6.0 to 11.0. The enzyme showed high stability in both polar and nonpolar organic solvents at 50% (v/v). The lipase activity was enhanced in the presence of 10 mM of Ca(2+), Mg(2+) and K(+), while heavy metals (Fe(3+) and Zn(2+)) had strong inhibitory effect. ELBn12 showed high activity in the presence of 1% (w/v) nonionic surfactants, however ionic surfactants inhibited the lipolytic activity. ELBn12 characteristics show that it has a potential to be used in various industrial processes.

Cloning and characterization of newly isolated lipase from Enterobacter sp. Bn12

PubMed Central

Farrokh, Parisa; Yakhchali, Bagher; Karkhane, Ali Asghar

2014-01-01

A mesophilic Enterobacter sp. Bn12 producing an alkaline thermostable lipase was isolated from soil in Tehran, Iran. The lipase gene (ELBn12) was identified from a genomic library. Sequence analysis of the DNA fragment revealed an open reading frame of 879 bp encoding a lipase with a molecular mass of 31.3 kDa. The deduced amino acid sequence showed 96% identity with a lipase of Enterobacter sp. Ag1 and the identity of their DNA sequences was 88.9%. ELBn12 belongs to the lipase subfamily I.1 and its catalytic triad consists of Ser82, Asp237 and His259. The lipase was expressed in Escherichia coli (BL21) pLysS and partially purified by anion exchange chromatography. The maximum activity of ELBn12 was obtained at temperature of 60 °C and pH 8.0 towards tricaprylin (C8) and its specific activity was around 2900 U/mg. ELBn12 was stable within a broad pH range from 6.0 to 11.0. The enzyme showed high stability in both polar and nonpolar organic solvents at 50% (v/v). The lipase activity was enhanced in the presence of 10 mM of Ca2+, Mg2+ and K+, while heavy metals (Fe3+ and Zn2+) had strong inhibitory effect. ELBn12 showed high activity in the presence of 1% (w/v) nonionic surfactants, however ionic surfactants inhibited the lipolytic activity. ELBn12 characteristics show that it has a potential to be used in various industrial processes. PMID:25242958

Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study

USDA-ARS?s Scientific Manuscript database

Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...

Genome Sequences for Five Strains of the Emerging Pathogen Haemophilus haemolyticus

PubMed Central

Jordan, I. King; Conley, Andrew B.; Antonov, Ivan V.; Arthur, Robert A.; Cook, Erin D.; Cooper, Guy P.; Jones, Bernard L.; Knipe, Kristen M.; Lee, Kevin J.; Liu, Xing; Mitchell, Gabriel J.; Pande, Pushkar R.; Petit, Robert A.; Qin, Shaopu; Rajan, Vani N.; Sarda, Shruti; Sebastian, Aswathy; Tang, Shiyuyun; Thapliyal, Racchit; Varghese, Neha J.; Ye, Tianjun; Katz, Lee S.; Wang, Xin; Rowe, Lori; Frace, Michael; Mayer, Leonard W.

2011-01-01

We report the first whole-genome sequences for five strains, two carried and three pathogenic, of the emerging pathogen Haemophilus haemolyticus. Preliminary analyses indicate that these genome sequences encode markers that distinguish H. haemolyticus from its closest Haemophilus relatives and provide clues to the identity of its virulence factors. PMID:21952546

Perception and the Temporal Properties of Speech.

DTIC Science & Technology

1993-01-11

conditions. In the embedded condition, phoneme sequences equivalent to these words formed the second syllable of a two-syllable word. In the unembedded ... unembedded in the sequence "warm lips". These priming sequences were based on the sequences used in Experiment 2. Each combinable priming sequence in...unrelated, to the embedded or unembedded prime word. The probes used in this experiment were identical to the ones used in Experiment 2. Subjects were tested

Query-seeded iterative sequence similarity searching improves selectivity 5–20-fold

PubMed Central

Li, Weizhong; Lopez, Rodrigo

2017-01-01

Abstract Iterative similarity search programs, like psiblast, jackhmmer, and psisearch, are much more sensitive than pairwise similarity search methods like blast and ssearch because they build a position specific scoring model (a PSSM or HMM) that captures the pattern of sequence conservation characteristic to a protein family. But models are subject to contamination; once an unrelated sequence has been added to the model, homologs of the unrelated sequence will also produce high scores, and the model can diverge from the original protein family. Examination of alignment errors during psiblast PSSM contamination suggested a simple strategy for dramatically reducing PSSM contamination. psiblast PSSMs are built from the query-based multiple sequence alignment (MSA) implied by the pairwise alignments between the query model (PSSM, HMM) and the subject sequences in the library. When the original query sequence residues are inserted into gapped positions in the aligned subject sequence, the resulting PSSM rarely produces alignment over-extensions or alignments to unrelated sequences. This simple step, which tends to anchor the PSSM to the original query sequence and slightly increase target percent identity, can reduce the frequency of false-positive alignments more than 20-fold compared with psiblast and jackhmmer, with little loss in search sensitivity. PMID:27923999

Echinococcus P29 antigen: molecular characterization and implication on post-surgery follow-up of CE patients infected with different species of the Echinococcus granulosus complex.

PubMed

Boubaker, Ghalia; Gottstein, Bruno; Hemphill, Andrew; Babba, Hamouda; Spiliotis, Markus

2014-01-01

The protein P29 is a potential serological marker for post-treatment monitoring of cystic echinococcosis (CE) especially in young patients. We now have demonstrated that P29 is encoded in the Echinococcus genus by a single gene consisting of 7 exons spanning 1.2 kb of DNA. Variability of the p29 gene at inter- and intra-species level was assessed with 50 cDNA and 280 genomic DNA clones isolated from different E. granulosus s.l. isolates (E. granulosus sensu stricto (G1), E. equinus (G4), E. ortleppi (G5), E. canadensis (G6), E. canadensis (G7) and E. canadensis (G10)) as well as four E. multilocularis isolates. Scarce interspecies polymorphism at the p29 locus was observed and affected predominantly E. granulosus s.s. (G1), where we identified two alleles (A1 and A2) coding for identical P29 proteins and yielding in three genotypes (A1/A1, A2/A2 and A1/A2). Genotypic frequencies expected under Hardy-Weinberg equilibrium revealed a high rate of heterozygosity (47%) that strongly supports the hypothesis that E. granulosus s.s. (G1) is predominantly outbreeding. Comparative sequence analyses of the complete p29 gene showed that phylogenetic relationships within the genus Echinococcus were in agreement with those of previous nuclear gene studies. At the protein level, the deduced P29 amino acid (AA) sequences exhibited a high level of conservation, ranging from 97.9% AA sequence identity among the whole E. granulosus s.l. group to 99.58% identity among E. multilocularis isolates. We showed that P29 proteins of these two species differ by three AA substitutions without implication for antigenicity. In Western-blot analyses, serum antibodies from a human CE patient infected with E. canadensis (G6) strongly reacted with recombinant P29 from E. granulosus s.s. (G1) (recEg(G1)P29). In the same line, human anti-Eg(G1)P29 antibodies bound to recEcnd(G6)P29. Thus, minor AA sequence variations appear not to impair the prognostic serological use of P29.

Echinococcus P29 Antigen: Molecular Characterization and Implication on Post-Surgery Follow-Up of CE Patients Infected with Different Species of the Echinococcus granulosus Complex

PubMed Central

Boubaker, Ghalia; Gottstein, Bruno; Hemphill, Andrew; Babba, Hamouda; Spiliotis, Markus

2014-01-01

The protein P29 is a potential serological marker for post-treatment monitoring of cystic echinococcosis (CE) especially in young patients. We now have demonstrated that P29 is encoded in the Echinococcus genus by a single gene consisting of 7 exons spanning 1.2 kb of DNA. Variability of the p29 gene at inter- and intra-species level was assessed with 50 cDNA and 280 genomic DNA clones isolated from different E. granulosus s.l. isolates (E. granulosus sensu stricto (G1), E. equinus (G4), E. ortleppi (G5), E. canadensis (G6), E. canadensis (G7) and E. canadensis (G10)) as well as four E. multilocularis isolates. Scarce interspecies polymorphism at the p29 locus was observed and affected predominantly E. granulosus s.s. (G1), where we identified two alleles (A1 and A2) coding for identical P29 proteins and yielding in three genotypes (A1/A1, A2/A2 and A1/A2). Genotypic frequencies expected under Hardy-Weinberg equilibrium revealed a high rate of heterozygosity (47%) that strongly supports the hypothesis that E. granulosus s.s. (G1) is predominantly outbreeding. Comparative sequence analyses of the complete p29 gene showed that phylogenetic relationships within the genus Echinococcus were in agreement with those of previous nuclear gene studies. At the protein level, the deduced P29 amino acid (AA) sequences exhibited a high level of conservation, ranging from 97.9% AA sequence identity among the whole E. granulosus s.l. group to 99.58% identity among E. multilocularis isolates. We showed that P29 proteins of these two species differ by three AA substitutions without implication for antigenicity. In Western-blot analyses, serum antibodies from a human CE patient infected with E. canadensis (G6) strongly reacted with recombinant P29 from E. granulosus s.s. (G1) (recEg(G1)P29). In the same line, human anti-Eg(G1)P29 antibodies bound to recEcnd(G6)P29. Thus, minor AA sequence variations appear not to impair the prognostic serological use of P29. PMID:24851904

Reduced TCOF1 mRNA level in a rhesus macaque with Treacher Collins-like syndrome: further evidence for haploinsufficiency of treacle as the cause of disease.

PubMed

Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita

2006-02-01

Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.

DNA sequence analysis of a 10 624 bp fragment of the left arm of chromosome XV from Saccharomyces cerevisiae reveals a RNA binding protein, a mitochondrial protein, two ribosomal proteins and two new open reading frames.

PubMed

Lafuente, M J; Gamo, F J; Gancedo, C

1996-09-01

We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.

Host Cell Virus Entry Mediated by Australian Bat Lyssavirus Envelope G glycoprotein

DTIC Science & Technology

2013-10-24

39 Figure 7. Comparison of the amino acid sequences of Saccolaimus and Pteropus ABLV G mature protein... sequence analysis revealed that the PCR products were identical. Sequence comparisons of the ABLV N and other lyssavirus N proteins showed that ABLV...Saccolaimus flaviventris) (129). Nucleoprotein sequence comparisons revealed that the Saccolaimus N protein shared 96% amino acid homology with the Pteropus

Full-Genome Sequence of Infectious Laryngotracheitis Virus (Gallid Alphaherpesvirus 1) Strain VFAR-043, Isolated in Peru

PubMed Central

Bendezu Eguis, Jorge; Montesinos, Ricardo; Fernández-Díaz, Manolo

2018-01-01

ABSTRACT We report here the first genome sequence of infectious laryngotracheitis virus isolated in Peru from tracheal tissues of layer chickens. The genome showed 99.98% identity to the J2 strain genome sequence. Single nucleotide polymorphisms were detected in five gene-coding sequences related to vaccine development, virus attachment, and viral immune evasion. PMID:29519822

PASS2: an automated database of protein alignments organised as structural superfamilies.

PubMed

Bhaduri, Anirban; Pugalenthi, Ganesan; Sowdhamini, Ramanathan

2004-04-02

The functional selection and three-dimensional structural constraints of proteins in nature often relates to the retention of significant sequence similarity between proteins of similar fold and function despite poor sequence identity. Organization of structure-based sequence alignments for distantly related proteins, provides a map of the conserved and critical regions of the protein universe that is useful for the analysis of folding principles, for the evolutionary unification of protein families and for maximizing the information return from experimental structure determination. The Protein Alignment organised as Structural Superfamily (PASS2) database represents continuously updated, structural alignments for evolutionary related, sequentially distant proteins. An automated and updated version of PASS2 is, in direct correspondence with SCOP 1.63, consisting of sequences having identity below 40% among themselves. Protein domains have been grouped into 628 multi-member superfamilies and 566 single member superfamilies. Structure-based sequence alignments for the superfamilies have been obtained using COMPARER, while initial equivalencies have been derived from a preliminary superposition using LSQMAN or STAMP 4.0. The final sequence alignments have been annotated for structural features using JOY4.0. The database is supplemented with sequence relatives belonging to different genomes, conserved spatially interacting and structural motifs, probabilistic hidden markov models of superfamilies based on the alignments and useful links to other databases. Probabilistic models and sensitive position specific profiles obtained from reliable superfamily alignments aid annotation of remote homologues and are useful tools in structural and functional genomics. PASS2 presents the phylogeny of its members both based on sequence and structural dissimilarities. Clustering of members allows us to understand diversification of the family members. The search engine has been improved for simpler browsing of the database. The database resolves alignments among the structural domains consisting of evolutionarily diverged set of sequences. Availability of reliable sequence alignments of distantly related proteins despite poor sequence identity and single-member superfamilies permit better sampling of structures in libraries for fold recognition of new sequences and for the understanding of protein structure-function relationships of individual superfamilies. PASS2 is accessible at http://www.ncbs.res.in/~faculty/mini/campass/pass2.html

Characterization of class II β chain major histocompatibility complex genes in a family of Hawaiian honeycreepers: 'amakihi (Hemignathus virens).

PubMed

Jarvi, Susan I; Bianchi, Kiara R; Farias, Margaret Em; Txakeeyang, Ann; McFarland, Thomas; Belcaid, Mahdi; Asano, Ashley

2016-07-01

Hawaiian honeycreepers (Drepanidinae) have evolved in the absence of mosquitoes for over five million years. Through human activity, mosquitoes were introduced to the Hawaiian archipelago less than 200 years ago. Mosquito-vectored diseases such as avian malaria caused by Plasmodium relictum and Avipoxviruses have greatly impacted these vulnerable species. Susceptibility to these diseases is variable among and within species. Due to their function in adaptive immunity, the role of major histocompatibility complex genes (Mhc) in disease susceptibility is under investigation. In this study, we evaluate gene organization and levels of diversity of Mhc class II β chain genes (exon 2) in a captive-reared family of Hawaii 'amakihi (Hemignathus virens). A total of 233 sequences (173 bp) were obtained by PCR+1 amplification and cloning, and 5720 sequences were generated by Roche 454 pyrosequencing. We report a total of 17 alleles originating from a minimum of 14 distinct loci. We detected three linkage groups that appear to represent three distinct haplotypes. Phylogenetic analysis revealed one variable cluster resembling classical Mhc sequences (DAB) and one highly conserved, low variability cluster resembling non-classical Mhc sequences (DBB). High net evolutionary divergence values between DAB and DBB resemble that seen between chicken BLB system and YLB system genes. High amino acid identity among non-classical alleles from 12 species of passerines (DBB) and four species of Galliformes (YLB) was found, suggesting that these non-classical passerine sequences may be related to the Galliforme YLB sequences.

A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

PubMed

Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

2015-09-01

Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Design and implementation of low complexity wake-up receiver for underwater acoustic sensor networks

NASA Astrophysics Data System (ADS)

Yue, Ming

This thesis designs a low-complexity dual Pseudorandom Noise (PN) scheme for identity (ID) detection and coarse frame synchronization. The two PN sequences for a node are identical and are separated by a specified length of gap which serves as the ID of different sensor nodes. The dual PN sequences are short in length but are capable of combating severe underwater acoustic (UWA) multipath fading channels that exhibit time varying impulse responses up to 100 taps. The receiver ID detection is implemented on a microcontroller MSP430F5529 by calculating the correlation between the two segments of the PN sequence with the specified separation gap. When the gap length is matched, the correlator outputs a peak which triggers the wake-up enable. The time index of the correlator peak is used as the coarse synchronization of the data frame. The correlator is implemented by an iterative algorithm that uses only one multiplication and two additions for each sample input regardless of the length of the PN sequence, thus achieving low computational complexity. The real-time processing requirement is also met via direct memory access (DMA) and two circular buffers to accelerate data transfer between the peripherals and the memory. The proposed dual PN detection scheme has been successfully tested by simulated fading channels and real-world measured channels. The results show that, in long multipath channels with more than 60 taps, the proposed scheme achieves high detection rate and low false alarm rate using maximal-length sequences as short as 31 bits to 127 bits, therefore it is suitable as a low-power wake-up receiver. The future research will integrate the wake-up receiver with Digital Signal Processors (DSP) for payload detection.

A novel spotted fever group Rickettsia infecting Amblyomma parvitarsum (Acari: Ixodidae) in highlands of Argentina and Chile.

PubMed

Ogrzewalska, Maria; Nieri-Bastos, Fernanda A; Marcili, Arlei; Nava, Santiago; González-Acuña, Daniel; Muñoz-Leal, Sebastián; Ruiz-Arrondo, Ignacio; Venzal, José M; Mangold, Atilio; Labruna, Marcelo B

2016-04-01

The tick Amblyomma parvitarsum (Acari: Ixodidae) has established populations in Andean and Patagonic environments of South America. For the present study, adults of A. parvitarsum were collected in highland areas (elevation >3500 m) of Argentina and Chile during 2009-2013, and tested by PCR for rickettsial infection in the laboratory, and isolation of rickettsiae in Vero cell culture by the shell vial technique. Overall, 51 (62.2%) out of 82 A. parvitarsum adult ticks were infected by spotted fever group (SFG) rickettsiae, which generated DNA sequences 100% identical to each other, and when submitted to BLAST analysis, they were 99.3% identical to corresponding sequence of the ompA gene of Rickettsia sp. strain Atlantic rainforest. Rickettsiae were successfully isolated in Vero cell culture from two ticks, one from Argentina and one from Chile. DNA extracted from the third passage of the isolates of Argentina and Chile were processed by PCR, resulting in partial sequences for three rickettsial genes (gltA, ompB, ompA). These sequences were concatenated and aligned with rickettsial corresponding sequences available in GenBank. Phylogenetic analysis revealed that the A. pavitarsum rickettsial agent grouped under high bootstrap support in a clade composed by the SFG pathogens R. sibirica, R. africae, R. parkeri, Rickettsia sp. strain Atlantic rainforest, and two unnamed SFG agents of unknown pathogenicty, Rickettsia sp. strain NOD, and Rickettsia sp. strain ApPR. The pathogenic role of this A. parvitarsum rickettsia cannot be discarded, since several species of tick-borne rickettsiae that were considered nonpathogenic for decades are now associated with human infections. Copyright © 2016. Published by Elsevier GmbH.

Genome-Wide Microsatellite Characterization and Marker Development in the Sequenced Brassica Crop Species

PubMed Central

Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

2014-01-01

Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species. PMID:24130371

High efficiency family shuffling based on multi-step PCR and in vivo DNA recombination in yeast: statistical and functional analysis of a combinatorial library between human cytochrome P450 1A1 and 1A2.

PubMed

Abécassis, V; Pompon, D; Truan, G

2000-10-15

The design of a family shuffling strategy (CLERY: Combinatorial Libraries Enhanced by Recombination in Yeast) associating PCR-based and in vivo recombination and expression in yeast is described. This strategy was tested using human cytochrome P450 CYP1A1 and CYP1A2 as templates, which share 74% nucleotide sequence identity. Construction of highly shuffled libraries of mosaic structures and reduction of parental gene contamination were two major goals. Library characterization involved multiprobe hybridization on DNA macro-arrays. The statistical analysis of randomly selected clones revealed a high proportion of chimeric genes (86%) and a homogeneous representation of the parental contribution among the sequences (55.8 +/- 2.5% for parental sequence 1A2). A microtiter plate screening system was designed to achieve colorimetric detection of polycyclic hydrocarbon hydroxylation by transformed yeast cells. Full sequences of five randomly picked and five functionally selected clones were analyzed. Results confirmed the shuffling efficiency and allowed calculation of the average length of sequence exchange and mutation rates. The efficient and statistically representative generation of mosaic structures by this type of family shuffling in a yeast expression system constitutes a novel and promising tool for structure-function studies and tuning enzymatic activities of multicomponent eucaryote complexes involving non-soluble enzymes.

Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species.

PubMed

Shi, Jiaqin; Huang, Shunmou; Zhan, Jiepeng; Yu, Jingyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

2014-02-01

Although much research has been conducted, the pattern of microsatellite distribution has remained ambiguous, and the development/utilization of microsatellite markers has still been limited/inefficient in Brassica, due to the lack of genome sequences. In view of this, we conducted genome-wide microsatellite characterization and marker development in three recently sequenced Brassica crops: Brassica rapa, Brassica oleracea and Brassica napus. The analysed microsatellite characteristics of these Brassica species were highly similar or almost identical, which suggests that the pattern of microsatellite distribution is likely conservative in Brassica. The genomic distribution of microsatellites was highly non-uniform and positively or negatively correlated with genes or transposable elements, respectively. Of the total of 115 869, 185 662 and 356 522 simple sequence repeat (SSR) markers developed with high frequencies (408.2, 343.8 and 356.2 per Mb or one every 2.45, 2.91 and 2.81 kb, respectively), most represented new SSR markers, the majority had determined physical positions, and a large number were genic or putative single-locus SSR markers. We also constructed a comprehensive database for the newly developed SSR markers, which was integrated with public Brassica SSR markers and annotated genome components. The genome-wide SSR markers developed in this study provide a useful tool to extend the annotated genome resources of sequenced Brassica species to genetic study/breeding in different Brassica species.

Rapid detection and non-subjective characterisation of infectious bronchitis virus isolates using high-resolution melt curve analysis and a mathematical model.

PubMed

Hewson, Kylie; Noormohammadi, Amir H; Devlin, Joanne M; Mardani, Karim; Ignjatovic, Jagoda

2009-01-01

Infectious bronchitis virus (IBV) is a coronavirus that causes upper respiratory, renal and/or reproductive diseases with high morbidity in poultry. Classification of IBV is important for implementation of vaccination strategies to control the disease in commercial poultry. Currently, the lengthy process of sequence analysis of the IBV S1 gene is considered the gold standard for IBV strain identification, with a high nucleotide identity (e.g. > or =95%) indicating related strains. However, this gene has a high propensity to mutate and/or undergo recombination, and alone it may not be reliable for strain identification. A real-time polymerase chain reaction (RT-PCR) combined with high-resolution melt (HRM) curve analysis was developed based on the 3'UTR of IBV for rapid detection and classification of IBV from commercial poultry. HRM curves generated from 230 to 435-bp PCR products of several IBV strains were subjected to further analysis using a mathematical model also developed during this study. It was shown that a combination of HRM curve analysis and the mathematical model could reliably group 189 out of 190 comparisons of pairs of IBV strains in accordance with their 3'UTR and S1 gene identities. The newly developed RT-PCR/HRM curve analysis model could detect and rapidly identify novel and vaccine-related IBV strains, as confirmed by S1 gene and 3'UTR nucleotide sequences. This model is a rapid, reliable, accurate and non-subjective system for detection of IBVs in poultry flocks.

Detection of Co-Infection of Notocactus leninghausii f. cristatus with Six Virus Species in South Korea

PubMed Central

Park, Chung Hwa; Song, Eun Gyeong; Ryu, Ki Hyun

2018-01-01

Co-infection with two virus species was previously reported in some cactus plants. Here, we showed that Notocactus leninghausii f. cristatus can be co-infected with six different viruses: cactus mild mottle virus (CMMoV)-Nl, cactus virus X (CVX)-Nl, pitaya virus X (PiVX)-Nl, rattail cactus necrosis-associated virus (RCNaV)-Nl, schlumbergera virus X (SchVX)-Nl, and zygocactus virus X (ZyVX)-Nl. The coat protein sequences of these viruses were compared with those of previously reported viruses. CMMoV-Nl, CVX-Nl, PiVX-Nl, RCNaV-Nl, SchVX-Nl, and ZyVX-Nl showed the greatest nucleotide sequence homology to CMMoV-Kr (99.8% identity, GenBank accession NC_011803), CVX-Jeju (77.5% identity, GenBank accession LC12841), PiVX-P37 (98.4% identity, GenBank accession NC_024458), RCNaV (99.4% identity, GenBank accession NC_016442), SchVX-K11 (95.7% identity, GenBank accession NC_011659), and ZyVX-B1 (97.9% identity, GenBank accession NC_006059), respectively. This study is the first report of co-infection with six virus species in N. leninghausii f. cristatus in South Korea. PMID:29422789