Sample records for high stringency conditions

  1. High-stringency screening of target-binding partners using a microfluidic device

    DOEpatents

    Soh, Hyongsok; Lou, Xinhui; Lagally, Eric

    2015-12-01

    The invention provides a method of screening a library of candidate agents by contacting the library with a target in a reaction mixture under a condition of high stringency, wherein the target includes a tag that responds to a controllable force applied to the tag, and passing the members of the library through a microfluidic device in a manner that exposes the library members to the controllable force, thereby displacing members of the library that are bound to the target relative to their unbound counterparts. Kits and systems for use with the methods of the invention are also provided.

  2. Risk of breast cancer with CXCR4-using HIV defined by V3 loop sequencing.

    PubMed

    Goedert, James J; Swenson, Luke C; Napolitano, Laura A; Haddad, Mojgan; Anastos, Kathryn; Minkoff, Howard; Young, Mary; Levine, Alexandra; Adeyemi, Oluwatoyin; Seaberg, Eric C; Aouizerat, Bradley; Rabkin, Charles S; Harrigan, P Richard; Hessol, Nancy A

    2015-01-01

    Evaluate the risk of female breast cancer associated with HIV-CXCR4 (X4) tropism as determined by various genotypic measures. A breast cancer case-control study, with pairwise comparisons of tropism determination methods, was conducted. From the Women's Interagency HIV Study repository, one stored plasma specimen was selected from 25 HIV-infected cases near the breast cancer diagnosis date and 75 HIV-infected control women matched for age and calendar date. HIV-gp120 V3 sequences were derived by Sanger population sequencing (PS) and 454-pyro deep sequencing (DS). Sequencing-based HIV-X4 tropism was defined using the geno2pheno algorithm, with both high-stringency DS [false-positive rate (3.5) and 2% X4 cutoff], and lower stringency DS (false-positive rate, 5.75 and 15% X4 cutoff). Concordance of tropism results by PS, DS, and previously performed phenotyping was assessed with kappa (κ) statistics. Case-control comparisons used exact P values and conditional logistic regression. In 74 women (19 cases, 55 controls) with complete results, prevalence of HIV-X4 by PS was 5% in cases vs 29% in controls (P = 0.06; odds ratio, 0.14; confidence interval: 0.003 to 1.03). Smaller case-control prevalence differences were found with high-stringency DS (21% vs 36%, P = 0.32), lower stringency DS (16% vs 35%, P = 0.18), and phenotyping (11% vs 31%, P = 0.10). HIV-X4 tropism concordance was best between PS and lower stringency DS (93%, κ = 0.83). Other pairwise concordances were 82%-92% (κ = 0.56-0.81). Concordance was similar among cases and controls. HIV-X4 defined by population sequencing (PS) had good agreement with lower stringency DS and was significantly associated with lower odds of breast cancer.

  3. Electrokinetic stringency control in self-assembled monolayer-based biosensors for multiplex urinary tract infection diagnosis.

    PubMed

    Liu, Tingting; Sin, Mandy L Y; Pyne, Jeff D; Gau, Vincent; Liao, Joseph C; Wong, Pak Kin

    2014-01-01

    Rapid detection of bacterial pathogens is critical toward judicious management of infectious diseases. Herein, we demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis. The in situ electrokinetic stringency control technique generates Joule heating induced temperature rise and electrothermal fluid motion directly on the sensor to improve its performance for detecting bacterial 16S rRNA, a phylogenetic biomarker. The dependence of the hybridization efficiency reveals that in situ electrokinetic stringency control is capable of discriminating single-base mismatches. With electrokinetic stringency control, the background noise due to the matrix effects of clinical urine samples can be reduced by 60%. The applicability of the system is demonstrated by multiplex detection of three uropathogenic clinical isolates with similar 16S rRNA sequences. The results demonstrate that electrokinetic stringency control can significantly improve the signal-to-noise ratio of the biosensor for multiplex urinary tract infection diagnosis. Urinary tract infections remain a significant cause of mortality and morbidity as secondary conditions often related to chronic diseases or to immunosuppression. Rapid and sensitive identification of the causative organisms is critical in the appropriate management of this condition. These investigators demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis, establishing that such an approach significantly improves the biosensor's signal-to-noise ratio. © 2013.

  4. Risk of Breast Cancer with CXCR4-using HIV Defined by V3-Loop Sequencing

    PubMed Central

    Goedert, James J.; Swenson, Luke C.; Napolitano, Laura A.; Haddad, Mojgan; Anastos, Kathryn; Minkoff, Howard; Young, Mary; Levine, Alexandra; Adeyemi, Oluwatoyin; Seaberg, Eric C.; Aouizerat, Bradley; Rabkin, Charles S.; Harrigan, P. Richard; Hessol, Nancy A.

    2014-01-01

    Objective Evaluate the risk of female breast cancer associated with HIV-CXCR4 (X4) tropism as determined by various genotypic measures. Methods A breast cancer case-control study, with pairwise comparisons of tropism determination methods, was conducted. From the Women's Interagency HIV Study repository, one stored plasma specimen was selected from 25 HIV-infected cases near the breast cancer diagnosis date and 75 HIV-infected control women matched for age and calendar date. HIVgp120-V3 sequences were derived by Sanger population sequencing (PS) and 454-pyro deep sequencing (DS). Sequencing-based HIV-X4 tropism was defined using the geno2pheno algorithm, with both high-stringency DS [False-Positive-Rate (FPR 3.5) and 2% X4 cutoff], and lower stringency DS (FPR 5.75, 15% X4 cut-off). Concordance of tropism results by PS, DS, and previously performed phenotyping was assessed with kappa (κ) statistics. Case-control comparisons used exact P-values and conditional logistic regression. Results In 74 women (19 cases, 55 controls) with complete results, prevalence of HIV-X4 by PS was 5% in cases vs 29% in controls (P=0.06, odds ratio 0.14, confidence interval 0.003-1.03). Smaller case-control prevalence differences were found with high-stringency DS (21% vs 36%, P=0.32), lower-stringency DS (16% vs 35%, P=0.18), and phenotyping (11% vs 31%, P=0.10). HIV-X4-tropism concordance was best between PS and lower-stringency DS (93%, κ=0.83). Other pairwise concordances were 82%-92% (κ=0.56-0.81). Concordance was similar among cases and controls. Conclusions HIV-X4 defined by population sequencing (PS) had good agreement with lower stringency deep sequencing and was significantly associated with lower odds of breast cancer. PMID:25321183

  5. Development of species-specific hybridization probes for marine luminous bacteria by using in vitro DNA amplification.

    PubMed Central

    Wimpee, C F; Nadeau, T L; Nealson, K H

    1991-01-01

    By using two highly conserved region of the luxA gene as primers, polymerase chain reaction amplification methods were used to prepare species-specific probes against the luciferase gene from four major groups of marine luminous bacteria. Laboratory studies with test strains indicated that three of the four probes cross-reacted with themselves and with one or more of the other species at low stringencies but were specific for members of their own species at high stringencies. The fourth probe, generated from Vibrio harveyi DNA, cross-reacted with DNAs from two closely related species, V. orientalis and V. vulnificus. When nonluminous cultures were tested with the species-specific probes, no false-positive results were observed, even at low stringencies. Two field isolates were correctly identified as Photobacterium phosphoreum by using the species-specific hybridization probes at high stringency. A mixed probe (four different hybridization probes) used at low stringency gave positive results with all of the luminous bacteria tested, including the terrestrial species, Xenorhabdus luminescens, and the taxonomically distinct marine bacterial species Shewanella hanedai; minimal cross-hybridization with these species was seen at higher stringencies. Images PMID:1854194

  6. Measuring the stringency of states' indoor tanning regulations: instrument development and outcomes.

    PubMed

    Woodruff, Susan I; Pichon, Latrice C; Hoerster, Katherine D; Forster, Jean L; Gilmer, Todd; Mayer, Joni A

    2007-05-01

    We sought to describe the development of an instrument to quantify the stringency of state indoor tanning legislation in the United States, and the instrument's psychometric properties. The instrument was then used to rate the stringency of state laws. A 35-item instrument was developed. An overall stringency measure and 9 stringency subscales were developed, including one measuring minors' access to indoor tanning. Stringency measures showed good internal consistency and interrater reliability. In all, 55% of the 50 states and the District of Columbia had any indoor tanning law, and 41% had any law addressing minors' access. Oregon, Illinois, South Carolina, Florida, Indiana, Iowa, and Rhode Island had high overall stringency scores, and Texas and New Hampshire were the most restrictive with regard to minors' access. Measurement of actual enforcement of the laws was not included in this study. The instrument appears to be an easy-to-use, reliable, and valid methodology. Application of the instrument to actual laws showed that, in general, state laws are relatively weak, although there was considerable variability by state.

  7. Certificate of need legislation and the dissemination of robotic surgery for prostate cancer.

    PubMed

    Jacobs, Bruce L; Zhang, Yun; Skolarus, Ted A; Wei, John T; Montie, James E; Schroeck, Florian R; Hollenbeck, Brent K

    2013-01-01

    The uncertainty about the incremental benefit of robotic prostatectomy and its higher associated costs makes it an ideal target for state based certificate of need laws, which have been enacted in several states. We studied the relationship between certificate of need laws and market level adoption of robotic prostatectomy. We used SEER (Surveillance, Epidemiology, and End Results)-Medicare data from 2003 through 2007 to identify men 66 years old or older treated with prostatectomy for prostate cancer. Using data from the American Health Planning Association, we categorized Health Service Areas according to the stringency of certificate of need regulations (ie low vs high stringency) presiding over that market. We assessed our outcomes (probability of adopting robotic prostatectomy and propensity for robotic prostatectomy use in adopting Health Service Areas) using Cox proportional hazards and Poisson regression models, respectively. Compared to low stringency markets, high stringency markets were more racially diverse (54% vs 15% nonwhite, p <0.01), and had similar population densities (886 vs 861 people per square mile, p = 0.97) and median incomes ($42,344 vs $39,770, p = 0.56). In general, both market types had an increase in the adoption and utilization of robotic prostatectomy. However, the probability of robotic prostatectomy adoption (p = 0.22) did not differ based on a market's certificate of need stringency and use was lower in high stringency markets (p <0.01). State based certificate of need regulations were ineffective in constraining robotic surgery adoption. Despite decreased use in high stringency markets, similar adoption rates suggest that other factors impact the diffusion of robotic prostatectomy. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  8. Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

    PubMed

    Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

    1995-03-01

    Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

  9. Assessment of examiner leniency and stringency ('hawk-dove effect') in the MRCP(UK) clinical examination (PACES) using multi-facet Rasch modelling

    PubMed Central

    McManus, IC; Thompson, M; Mollon, J

    2006-01-01

    Background A potential problem of clinical examinations is known as the hawk-dove problem, some examiners being more stringent and requiring a higher performance than other examiners who are more lenient. Although the problem has been known qualitatively for at least a century, we know of no previous statistical estimation of the size of the effect in a large-scale, high-stakes examination. Here we use FACETS to carry out a multi-facet Rasch modelling of the paired judgements made by examiners in the clinical examination (PACES) of MRCP(UK), where identical candidates were assessed in identical situations, allowing calculation of examiner stringency. Methods Data were analysed from the first nine diets of PACES, which were taken between June 2001 and March 2004 by 10,145 candidates. Each candidate was assessed by two examiners on each of seven separate tasks. with the candidates assessed by a total of 1,259 examiners, resulting in a total of 142,030 marks. Examiner demographics were described in terms of age, sex, ethnicity, and total number of candidates examined. Results FACETS suggested that about 87% of main effect variance was due to candidate differences, 1% due to station differences, and 12% due to differences between examiners in leniency-stringency. Multiple regression suggested that greater examiner stringency was associated with greater examiner experience and being from an ethnic minority. Male and female examiners showed no overall difference in stringency. Examination scores were adjusted for examiner stringency and it was shown that for the present pass mark, the outcome for 95.9% of candidates would be unchanged using adjusted marks, whereas 2.6% of candidates would have passed, even though they had failed on the basis of raw marks, and 1.5% of candidates would have failed, despite passing on the basis of raw marks. Conclusion Examiners do differ in their leniency or stringency, and the effect can be estimated using Rasch modelling. The reasons for differences are not clear, but there are some demographic correlates, and the effects appear to be reliable across time. Account can be taken of differences, either by adjusting marks or, perhaps more effectively and more justifiably, by pairing high and low stringency examiners, so that raw marks can be used in the determination of pass and fail. PMID:16919156

  10. Identification of Vibrio splendidus as a Member of the Planktonic Luminous Bacteria from the Persian Gulf and Kuwait Region with luxA Probes

    PubMed Central

    Nealson, K. H.; Wimpee, B.; Wimpee, C.

    1993-01-01

    Hybridization probes specific for the luxA genes of four groups of luminous bacteria were used to screen luminous isolates obtained from the Persian Gulf, near Al Khiran, Kuwait Nine of these isolates were identified as Vibrio harveyi, a commonly encountered planktonic isolate, while three others showed no hybridization to any of the four probes (V. harveyi, Vibrio fischeri, Photobacterium phosphoreum, or Photobacterium leiognathi) under high-stringency conditions. Polymerase chain reaction amplification was used to prepare a luxA probe against one of these isolates, K-1, and this probe was screened under high-stringency conditions against a collection of DNAs from luminous bacteria; it was found to hybridize specifically to the DNA of the species Vibrio splendidus. A probe prepared against the type strain of V. splendidus (ATCC 33369) was tested against the collection of luminous bacterial DNA preparations and against the Kuwait isolates and was found to hybridize only against the type strain and the three unidentified Kuwait isolates. Extensive taxonomic analysis by standard methods confirmed the identification of the 13 isolates. Images PMID:16349023

  11. Underage alcohol policies across 50 California cities: an assessment of best practices

    PubMed Central

    2012-01-01

    Background We pursue two primary goals in this article: (1) to test a methodology and develop a dataset on U.S. local-level alcohol policy ordinances, and (2) to evaluate the presence, comprehensiveness, and stringency of eight local alcohol policies in 50 diverse California cities in relationship to recommended best practices in both public health literature and governmental recommendations to reduce underage drinking. Methods Following best practice recommendations from a wide array of authoritative sources, we selected eight local alcohol policy topics (e.g., conditional use permits, responsible beverage service training, social host ordinances, window/billboard advertising ordinances), and determined the presence or absence as well as the stringency (restrictiveness) and comprehensiveness (number of provisions) of each ordinance in each of the 50 cities in 2009. Following the alcohol policy literature, we created scores for each city on each type of ordinance and its associated components. We used these data to evaluate the extent to which recommendations for best practices to reduce underage alcohol use are being followed. Results (1) Compiling datasets of local-level alcohol policy laws and their comprehensiveness and stringency is achievable, even absent comprehensive, on-line, or other legal research tools. (2) We find that, with some exceptions, most of the 50 cities do not have high scores for presence, comprehensiveness, or stringency across the eight key policies. Critical policies such as responsible beverage service and deemed approved ordinances are uncommon, and, when present, they are generally neither comprehensive nor stringent. Even within policies that have higher adoption rates, central elements are missing across many or most cities’ ordinances. Conclusion This study demonstrates the viability of original legal data collection in the U.S. pertaining to local ordinances and of creating quantitative scores for each policy type to reflect comprehensiveness and stringency. Analysis of the resulting dataset reveals that, although the 50 cities have taken important steps to improve public health with regard to underage alcohol use and abuse, there is a great deal more that needs to be done to bring these cities into compliance with best practice recommendations. PMID:22734468

  12. Electrokinetic Stringency Control in Self-Assembled Monolayer-based Biosensors for Multiplex Urinary Tract Infection Diagnosis

    PubMed Central

    Liu, Tingting; Sin, Mandy L. Y.; Pyne, Jeff D.; Gau, Vincent; Liao, Joseph C.; Wong, Pak Kin

    2013-01-01

    Rapid detection of bacterial pathogens is critical toward judicious management of infectious diseases. Herein, we demonstrate an in situ electrokinetic stringency control approach for a self-assembled monolayer-based electrochemical biosensor toward urinary tract infection diagnosis. The in situ electrokinetic stringency control technique generates Joule heating induced temperature rise and electrothermal fluid motion directly on the sensor to improve its performance for detecting bacterial 16S rRNA, a phylogenetic biomarker. The dependence of the hybridization efficiency reveals that in situ electrokinetic stringency control is capable of discriminating single-base mismatches. With electrokinetic stringency control, the background noise due to the matrix effects of clinical urine samples can be reduced by 60%. The applicability of the system is demonstrated by multiplex detection of three uropathogenic clinical isolates with similar 16S rRNA sequences. The results demonstrate that electrokinetic stringency control can significantly improve the signal-to-noise ratio of the biosensor for multiplex urinary tract infection diagnosis. PMID:23891989

  13. Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

    PubMed Central

    Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

    1994-01-01

    Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

  14. The Effect of State Regulatory Stringency on Nursing Home Quality

    PubMed Central

    Mukamel, Dana B; Weimer, David L; Harrington, Charlene; Spector, William D; Ladd, Heather; Li, Yue

    2012-01-01

    Objective To test the hypothesis that more stringent quality regulations contribute to better quality nursing home care and to assess their cost-effectiveness. Data Sources/Setting Primary and secondary data from all states and U.S. nursing homes between 2005 and 2006. Study Design We estimated seven models, regressing quality measures on the Harrington Regulation Stringency Index and control variables. To account for endogeneity between regulation and quality, we used instrumental variables techniques. Quality was measured by staffing hours by type per case-mix adjusted day, hotel expenditures, and risk-adjusted decline in activities of daily living, high-risk pressure sores, and urinary incontinence. Data Collection All states' licensing and certification offices were surveyed to obtain data about deficiencies. Secondary data included the Minimum Data Set, Medicare Cost Reports, and the Economic Freedom Index. Principal Findings Regulatory stringency was significantly associated with better quality for four of the seven measures studied. The cost-effectiveness for the activities-of-daily-living measure was estimated at about 72,000 in 2011/ Quality Adjusted Life Year. Conclusions Quality regulations lead to better quality in nursing homes along some dimensions, but not all. Our estimates of cost-effectiveness suggest that increased regulatory stringency is in the ballpark of other acceptable cost-effective practices. PMID:22946859

  15. The first successful use of a low stringency familial match in a French criminal investigation.

    PubMed

    Pham-Hoai, Emmanuel; Crispino, Frank; Hampikian, Greg

    2014-05-01

    We describe how a very simple application of familial searching resolved a decade-old, high-profile rape/murder in France. This was the first use of familial searching in a criminal case using the French STR DNA database, which contains approximately 1,800,000 profiles. When an unknown forensic profile (18 loci) was searched against the French arrestee/offender database using CODIS configured for a low stringency search, a single low stringency match was identified. This profile was attributed to the father of the man suspected to be the source of the semen recovered from the murder victim Elodie Kulik. The identification was confirmed using Y-chromosome DNA from the putative father, an STR profile from the mother, and finally a tissue sample from the exhumed body of the man who left the semen. Because of this identification, the investigators are now pursuing possible co-conspirators. © 2014 American Academy of Forensic Sciences.

  16. Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

    Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

  17. Evaluation of Phage Display Discovered Peptides as Ligands for Prostate-Specific Membrane Antigen (PSMA)

    PubMed Central

    Edwards, W. Barry

    2013-01-01

    The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860

  18. Conservation of the fourth gene among rotaviruses recovered from asymptomatic newborn infants and its possible role in attenuation.

    PubMed Central

    Flores, J; Midthun, K; Hoshino, Y; Green, K; Gorziglia, M; Kapikian, A Z; Chanock, R M

    1986-01-01

    RNA-RNA hybridization was performed to assess the extent of genetic relatedness among human rotaviruses isolated from children with gastroenteritis and from asymptomatic newborn infants. 32P-labeled single-stranded RNAs produced by in vitro transcription from viral cores of the different strains tested were used as probes in two different hybridization assays: undenatured genomic RNAs were resolved by polyacrylamide gel electrophoresis, denatured in situ, electrophoretically transferred to diazobenzyloxymethyl-paper (Northern blots), and then hybridized to the probes under two different conditions of stringency; and denatured genomic double-stranded RNAs were hybridized to the probes in solution and the hybrids which formed were identified by polyacrylamide gel electrophoresis. When analyzed by Northern blot hybridization at a low level of stringency, all genes from the strains tested cross-hybridized, providing evidence for some sequence homology in each of the corresponding genes. However, when hybridization stringency was increased, a difference in gene 4 sequence was detected between strains recovered from asymptomatic newborn infants ("nursery strains") and strains recovered from infants and young children with diarrhea. Although the nursery strains exhibited serotypic diversity (i.e., each of the four strains tested belonged to a different serotype), the fourth gene appeared to be highly conserved. Similarly, each of the virulent strains tested belonged to a different serotype; nonetheless, there was significant conservation of sequence among the fourth genes of three of these viruses. Significantly, the conserved fourth genes of the nursery strains were distinct from the fourth gene of each of the virulent viruses. These results were confirmed and extended during experiments in which the RNA-RNA hybridization was carried out in solution and the resulting hybrids were analyzed by polyacrylamide gel electrophoresis. Under these conditions, the fourth genes of the nursery strains were closely related to each other but not to the fourth genes of the virulent viruses. Full-length hybrids did not form between the fourth genes from the nursery strains and the corresponding genes from the strains recovered from symptomatic infants and young children. Images PMID:3023685

  19. Development of a DNA-Based Method for Distinguishing the Malaria Vectors, Anopheles gambiae From Anopheles arabiensis.

    DTIC Science & Technology

    1986-06-01

    our preliminary studies hybridization with the Droso- phila actin probe required such low stringency conditions that the signal to noise ratio made...Balabacensis complex of Southeast Asia (Diptera: Culicidae). Genetica 57:81-86. (14) Mahon RJ and PM Miethke. 1982. Anopheles farauti No. 3, a hitherto un

  20. ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

    USDA-ARS?s Scientific Manuscript database

    We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

  1. Microfludic Device for Creating Ionic Strength Gradients over DNA Microarrays for Efficient DNA Melting Studies and Assay Development

    PubMed Central

    Petersen, Jesper; Poulsen, Lena; Birgens, Henrik; Dufva, Martin

    2009-01-01

    The development of DNA microarray assays is hampered by two important aspects: processing of the microarrays is done under a single stringency condition, and characteristics such as melting temperature are difficult to predict for immobilized probes. A technical solution to these limitations is to use a thermal gradient and information from melting curves, for instance to score genotypes. However, application of temperature gradients normally requires complicated equipment, and the size of the arrays that can be investigated is restricted due to heat dissipation. Here we present a simple microfluidic device that creates a gradient comprising zones of defined ionic strength over a glass slide, in which each zone corresponds to a subarray. Using this device, we demonstrated that ionic strength gradients function in a similar fashion as corresponding thermal gradients in assay development. More specifically, we noted that (i) the two stringency modulators generated melting curves that could be compared, (ii) both led to increased assay robustness, and (iii) both were associated with difficulties in genotyping the same mutation. These findings demonstrate that ionic strength stringency buffers can be used instead of thermal gradients. Given the flexibility of design of ionic gradients, these can be created over all types of arrays, and encompass an attractive alternative to temperature gradients, avoiding curtailment of the size or spacing of subarrays on slides associated with temperature gradients. PMID:19277213

  2. Microfludic device for creating ionic strength gradients over DNA microarrays for efficient DNA melting studies and assay development.

    PubMed

    Petersen, Jesper; Poulsen, Lena; Birgens, Henrik; Dufva, Martin

    2009-01-01

    The development of DNA microarray assays is hampered by two important aspects: processing of the microarrays is done under a single stringency condition, and characteristics such as melting temperature are difficult to predict for immobilized probes. A technical solution to these limitations is to use a thermal gradient and information from melting curves, for instance to score genotypes. However, application of temperature gradients normally requires complicated equipment, and the size of the arrays that can be investigated is restricted due to heat dissipation. Here we present a simple microfluidic device that creates a gradient comprising zones of defined ionic strength over a glass slide, in which each zone corresponds to a subarray. Using this device, we demonstrated that ionic strength gradients function in a similar fashion as corresponding thermal gradients in assay development. More specifically, we noted that (i) the two stringency modulators generated melting curves that could be compared, (ii) both led to increased assay robustness, and (iii) both were associated with difficulties in genotyping the same mutation. These findings demonstrate that ionic strength stringency buffers can be used instead of thermal gradients. Given the flexibility of design of ionic gradients, these can be created over all types of arrays, and encompass an attractive alternative to temperature gradients, avoiding curtailment of the size or spacing of subarrays on slides associated with temperature gradients.

  3. Development of a DNA-Based Method for Distinguishing the Malaria Vectors, Anopheles Gambiae from Anopheles Arabiensis.

    DTIC Science & Technology

    1987-11-15

    analysis. However, in our preliminary studies, hybridization with the DPro.5ohil actin probe required such low stringency conditions that the signal to...rDNA genes and could therefore contain seOuencec tjhich, under normal DNA hybridization conditions , behave in a species-specific mrnner. We theref’-e...pAGr23B) behave as species-specific probes under the conditions normally used for DNA hybridization. These sequences could be used to design specific

  4. 78 FR 66648 - Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-06

    ... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 52 [EPA-R06-OAR-2010-0335; FRL-9902-50-Region 6] Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency Determinations and Minor Permit Revisions for Federal Operating Permits AGENCY: Environmental Protection Agency (EPA...

  5. 78 FR 55234 - Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-10

    ... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 52 [EPA-R06-OAR-2010-0335; FRL-9900-81-Region6] Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency Determinations and Minor Permit Revisions for Federal Operating Permits AGENCY: Environmental Protection Agency (EPA...

  6. Low-stringency selection of TEM1 for BLIP shows interface plasticity and selection for faster binders

    PubMed Central

    Cohen-Khait, Ruth; Schreiber, Gideon

    2016-01-01

    Protein–protein interactions occur via well-defined interfaces on the protein surface. Whereas the location of homologous interfaces is conserved, their composition varies, suggesting that multiple solutions may support high-affinity binding. In this study, we examined the plasticity of the interface of TEM1 β-lactamase with its protein inhibitor BLIP by low-stringency selection of a random TEM1 library using yeast surface display. Our results show that most interfacial residues could be mutated without a loss in binding affinity, protein stability, or enzymatic activity, suggesting plasticity in the interface composition supporting high-affinity binding. Interestingly, many of the selected mutations promoted faster association. Further selection for faster binders was achieved by drastically decreasing the library–ligand incubation time to 30 s. Preequilibrium selection as suggested here is a novel methodology for specifically selecting faster-associating protein complexes. PMID:27956635

  7. Practical and Theoretical Requirements for Controlling Rater Stringency in Peer Review.

    ERIC Educational Resources Information Center

    Cason, Gerald J.; Cason, Carolyn L.

    This study describes a computer based, performance rating information processing system, performance rating theory, and programs for the application of the theory to obtain ratings free from the effects of reviewer stringency in reviewing abstracts of conference papers. Originally, the Performance Rating (PR) System was used to evaluate the…

  8. Are More Stringent NCLB State Accountability Systems Associated with Better Student Outcomes? An Analysis of NAEP Results across States

    ERIC Educational Resources Information Center

    Wei, Xin

    2012-01-01

    This study developed a comprehensive measure of the stringency level of NCLB states' accountability systems, including the strength of their annual measurable objectives, confidence intervals, performance indexing, retesting, minimum subgroup size, and the difficulty levels of proficiency standards. This study related accountability stringency in…

  9. Support for PhD Students: The Impact of Institutional Dynamics on the Pedagogy of Learning Development

    ERIC Educational Resources Information Center

    Peelo, Moira

    2013-01-01

    This paper explores one practitioner's learning development work with PhD students in a changing university context in which managerialism and financial stringency have combined. It questions how learning development practitioners can maintain their professional goals while negotiating issues arising from managerialism, financial stringency,…

  10. 40 CFR 51.351 - Enhanced I/M performance standard.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

  11. 40 CFR 51.351 - Enhanced I/M performance standard.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

  12. 40 CFR 51.351 - Enhanced I/M performance standard.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

  13. 40 CFR 51.351 - Enhanced I/M performance standard.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

  14. 40 CFR 51.351 - Enhanced I/M performance standard.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year vehicles. (11) Waiver... 2001 and newer vehicles. (10) Stringency. A 20% emission test failure rate among pre-1981 model year... which will be achieved by the I/M program design in the SIP to those of the model program described in...

  15. Distribution of endogenous type B and type D sheep retrovirus sequences in ungulates and other mammals.

    PubMed Central

    Hecht, S J; Stedman, K E; Carlson, J O; DeMartini, J C

    1996-01-01

    The jaagsiekte sheep retrovirus (JSRV), which appears to be a type B/D retrovirus chimera, has been incriminated as the cause of ovine pulmonary carcinoma. Recent studies suggest that the sequences related to this virus are found in the genomes of normal sheep and goats. To learn whether there are breeds of sheep that lack the endogenous viral sequences and to study their distribution among other groups of mammals, we surveyed several domestic sheep and goat breeds, other ungulates, and various mammal groups for sequences related to JSRV. Probes prepared from the envelope (SU) region of JSRV and the capsid (CA) region of a Peruvian type D virus related to JSRV were used in Southern blot hybridization with genomic DNA followed by low- and high-stringency washes. Fifteen to 20 CA and SU bands were found in all members of the 13 breeds of domestic sheep and 6 breeds of goats tested. There were similar findings in 6 wild Ovis and Capra genera. Within 22 other genera of Bovidae including domestic cattle, and 7 other families of Artiodactyla including Cervidae, there were usually a few CA or SU bands at low stringency and rare bands at high stringency. Among 16 phylogenetically distant genera, there were generally fewer bands hybridizing with either probe. These results reveal wide-spread phylogenetic distribution of endogenous type B and type D retroviral sequences related to JSRV among mammals and argue for further investigation of their potential role in disease. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8622932

  16. Identification of Potent Chemotypes Targeting Leishmania major Using a High-Throughput, Low-Stringency, Computationally Enhanced, Small Molecule Screen

    PubMed Central

    Sharlow, Elizabeth R.; Close, David; Shun, Tongying; Leimgruber, Stephanie; Reed, Robyn; Mustata, Gabriela; Wipf, Peter; Johnson, Jacob; O'Neil, Michael; Grögl, Max; Magill, Alan J.; Lazo, John S.

    2009-01-01

    Patients with clinical manifestations of leishmaniasis, including cutaneous leishmaniasis, have limited treatment options, and existing therapies frequently have significant untoward liabilities. Rapid expansion in the diversity of available cutaneous leishmanicidal chemotypes is the initial step in finding alternative efficacious treatments. To this end, we combined a low-stringency Leishmania major promastigote growth inhibition assay with a structural computational filtering algorithm. After a rigorous assay validation process, we interrogated ∼200,000 unique compounds for L. major promastigote growth inhibition. Using iterative computational filtering of the compounds exhibiting >50% inhibition, we identified 553 structural clusters and 640 compound singletons. Secondary confirmation assays yielded 93 compounds with EC50s ≤ 1 µM, with none of the identified chemotypes being structurally similar to known leishmanicidals and most having favorable in silico predicted bioavailability characteristics. The leishmanicidal activity of a representative subset of 15 chemotypes was confirmed in two independent assay formats, and L. major parasite specificity was demonstrated by assaying against a panel of human cell lines. Thirteen chemotypes inhibited the growth of a L. major axenic amastigote-like population. Murine in vivo efficacy studies using one of the new chemotypes document inhibition of footpad lesion development. These results authenticate that low stringency, large-scale compound screening combined with computational structure filtering can rapidly expand the chemotypes targeting in vitro and in vivo Leishmania growth and viability. PMID:19888337

  17. Investigation of Human Cancers for Retrovirus by Low-Stringency Target Enrichment and High-Throughput Sequencing.

    PubMed

    Vinner, Lasse; Mourier, Tobias; Friis-Nielsen, Jens; Gniadecki, Robert; Dybkaer, Karen; Rosenberg, Jacob; Langhoff, Jill Levin; Cruz, David Flores Santa; Fonager, Jannik; Izarzugaza, Jose M G; Gupta, Ramneek; Sicheritz-Ponten, Thomas; Brunak, Søren; Willerslev, Eske; Nielsen, Lars Peter; Hansen, Anders Johannes

    2015-08-19

    Although nearly one fifth of all human cancers have an infectious aetiology, the causes for the majority of cancers remain unexplained. Despite the enormous data output from high-throughput shotgun sequencing, viral DNA in a clinical sample typically constitutes a proportion of host DNA that is too small to be detected. Sequence variation among virus genomes complicates application of sequence-specific, and highly sensitive, PCR methods. Therefore, we aimed to develop and characterize a method that permits sensitive detection of sequences despite considerable variation. We demonstrate that our low-stringency in-solution hybridization method enables detection of <100 viral copies. Furthermore, distantly related proviral sequences may be enriched by orders of magnitude, enabling discovery of hitherto unknown viral sequences by high-throughput sequencing. The sensitivity was sufficient to detect retroviral sequences in clinical samples. We used this method to conduct an investigation for novel retrovirus in samples from three cancer types. In accordance with recent studies our investigation revealed no retroviral infections in human B-cell lymphoma cells, cutaneous T-cell lymphoma or colorectal cancer biopsies. Nonetheless, our generally applicable method makes sensitive detection possible and permits sequencing of distantly related sequences from complex material.

  18. Effect of the stringency of conditions on caloric test results in healthy subjects.

    PubMed

    Krstulovic, Claudio; Tulsidas Mahtani, Bharti; Atrache Al Attrache, Nabil; Pérez-Garrigues, Herminio

    The caloric test is widely used to assess vestibular function, but the conditions in which it is performed can vary. Caloric nystagmus obtained in 57 healthy subjects were compared: 24 subjects studied in ideal conditions and 33 subjects in non-ideal conditions. A statistically significant decrease in the slow phase velocity of the 4 irrigations performed on the subjects in non-ideal conditions was observed. This must be considered, especially in subjects with suspected bilateral involvement. Stringent conditions reduce the risk of misdiagnosis with bilateral deficit. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  19. Human papillomavirus type 16 DNA in periungual squamous cell carcinomas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moy, R.L.; Eliezri, Y.D.; Bennett, R.G.

    1989-05-12

    Ten squamous cell carcinomas (in situ or invasive) of the fingernail region were analyzed for the presence of DNA sequences homologous to human papilloma-virus (HPV) by dot blot hybridization. In most patients, the lesions were verrucae of long-term duration that were refractory to conventional treatment methods. Eight of the lesions contained HPV DNA sequences, and in six of these the sequences were related to HPV 16 as deduced from low-stringency nucleic acid hybridization followed by low- and high-stringency washes. Furthermore, the restriction endonuclease digestion pattern of DNA isolated from four of these lesions was diagnostic of episomal HPV 16. Themore » high-frequency association of HPV 16 with periungual squamous cell carcinoma is similar to that reported for HPV 16 with squamous cell carcinomas on mucous membranes at other sites, notably the genital tract. The findings suggest that HPV 16 may play an important role in the development of squamous cell carcinomas of the finger, most notably those lesions that are chronic and located in the periungual area.« less

  20. A process for the quantification of aircraft noise and emissions interdependencies

    NASA Astrophysics Data System (ADS)

    de Luis, Jorge

    The main purpose of this dissertation is to develop a process to improve actual policy-making procedures in terms of aviation environmental effects. This research work expands current practices with physics based publicly available models. The current method uses solely information provided by industry members, and this information is usually proprietary, and not physically intuitive. The process herein proposed provides information regarding the interdependencies between the environmental effects of aircraft. These interdependencies are also tied to the actual physical parameters of the aircraft and the engine, making it more intuitive for decision-makers to understand the impacts to the vehicle due to different policy scenarios. These scenarios involve the use of fleet analysis tools in which the existing aircraft are used to predict the environmental effects of imposing new stringency levels. The aircraft used are reduced to a series of coefficients that represent their performance, in terms of flight characteristics, fuel burn, noise, and emissions. These coefficients are then utilized to model flight operations and calculate what the environmental impacts of those aircraft are. If a particular aircraft does not meet the stringency to be analyzed, a technology response is applied to it, in order to meet that stringency. Depending on the level of reduction needed, this technology response can have an effect on the fuel burn characteristic of the aircraft. Another important point of the current stringency analysis process is that it does not take into account both noise and emissions concurrently, but instead, it considers them separately, one at a time. This assumes that the interdependencies between the two do not exists, which is not realistic. The latest stringency process delineated in 2004 imposed a 2% fuel burn penalty for any required improvements on NOx, no matter the type of aircraft or engine, assuming that no company had the ability to produce a vehicle with similar characteristics. This left all the performance characteristics of the aircraft untouched, except for the fuel burn, including the noise performance. The proposed alternative is to create a fleet of replacement aircraft to the current fleet that does not meet stringency. These replacement aircraft represent the achievable physical limits for state of the art systems. In this research work, the interdependencies between NOx, noise, and fuel burn are not neglected, and it is in fact necessary to take all three into account, simultaneously, to capture the physical limits that can be attained during a stringency analysis. In addition, the replacement aircraft show the linkage between environmental effects and fundamental aircraft and engine characteristics, something that has been neglected in previous policy making procedures. Another aspect that has been ignored is the creation of the coefficients used for the fleet analyses. In current literature, a defined process for the creation of those coefficients does not exist, but this research work develops a process to do so and demonstrates that the characteristics of the aircraft can be propagated to the coefficients and to the fleet analysis tools. The implementation of the process proposed shows that, first, the environmental metrics can be linked to the physical attributes of the aircraft using non-proprietary, physics based tools, second, those interdependencies can be propagated to fleet level tools, and third, this propagation provides an improvement in the policy making process, by showing what needs to change in an aircraft to meet different stringency levels.

  1. Detection of Human Papillomavirus Type 2 Related Sequence in Oral Papilloma

    PubMed Central

    Yamaguchi, Taihei; Shindoh, Masanobu; Amemiya, Akira; Inoue, Nobuo; Kawamura, Masaaki; Sakaoka, Hiroshi; Inoue, Masakazu; Fujinaga, Kei

    1998-01-01

    Oral papilloma is a benign tumourous lesion. Part of this lesion is associated with human papillomavirus (HPV) infection. We analysed the genetical and histopathological evidence for HPV type 2 infection in three oral papillomas. Southern blot hybridization showed HPV 2a sequence in one lesion. Cells of the positive specimen appeared to contain high copy numbers of the viral DNA in an episomal state. In situ staining demonstrated virus capsid antigen in koilocytotic cells and surrounding cells in the hyperplastic epithelial layer. Two other specimens contained no HPV sequences by labeled probe of full length linear HPVs 2a, 6b, 11, 16, 18, 31 and 33 DNA under low stringency hybridization conditions. These results showed the possibility that HPV 2 plays a role in oral papilloma. PMID:9699941

  2. Expression of the highly conserved vaccinia virus E6 protein is required for virion morphogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Resch, Wolfgang; Weisberg, Andrea S.; Moss, Bernard, E-mail: bmoss@nih.go

    2009-04-10

    The vaccinia virus E6R gene (VACVWR062) is conserved in all members of the poxvirus family and encodes a protein associated with the mature virion. We confirmed this association and provided evidence for an internal location. An inducible mutant that conditionally expresses E6 was constructed. In the absence of inducer, plaque formation and virus production were severely inhibited in several cell lines, whereas some replication occurred in others. This difference could be due to variation in the stringency of repression, since we could not isolate a stable deletion mutant even in the more 'permissive' cells. Under non-permissive conditions, viral late proteinsmore » were synthesized but processing of core proteins was inefficient, indicative of an assembly block. Transmission electron microscopy of sections of cells infected with the mutant in the absence of inducer revealed morphogenetic defects with crescents and empty immature virions adjacent to dense inclusions of viroplasm. Mature virions were infrequent and cores appeared to have lucent centers.« less

  3. SIP Shear Walls: Cyclic Performance of High-Aspect-Ratio Segments and Perforated Walls

    Treesearch

    Vladimir Kochkin; Douglas R. Rammer; Kevin Kauffman; Thomas Wiliamson; Robert J. Ross

    2015-01-01

    Increasing stringency of energy codes and the growing market demand for more energy efficient buildings gives structural insulated panel (SIP) construction an opportunity to increase its use in commercial and residential buildings. However, shear wall aspect ratio limitations and lack of knowledge on how to design SIPs with window and door openings are barriers to the...

  4. EAPhy: A Flexible Tool for High-throughput Quality Filtering of Exon-alignments and Data Processing for Phylogenetic Methods.

    PubMed

    Blom, Mozes P K

    2015-08-05

    Recently developed molecular methods enable geneticists to target and sequence thousands of orthologous loci and infer evolutionary relationships across the tree of life. Large numbers of genetic markers benefit species tree inference but visual inspection of alignment quality, as traditionally conducted, is challenging with thousands of loci. Furthermore, due to the impracticality of repeated visual inspection with alternative filtering criteria, the potential consequences of using datasets with different degrees of missing data remain nominally explored in most empirical phylogenomic studies. In this short communication, I describe a flexible high-throughput pipeline designed to assess alignment quality and filter exonic sequence data for subsequent inference. The stringency criteria for alignment quality and missing data can be adapted based on the expected level of sequence divergence. Each alignment is automatically evaluated based on the stringency criteria specified, significantly reducing the number of alignments that require visual inspection. By developing a rapid method for alignment filtering and quality assessment, the consistency of phylogenetic estimation based on exonic sequence alignments can be further explored across distinct inference methods, while accounting for different degrees of missing data.

  5. Specificity Re-evaluation of Oligonucleotide Probes for the Detection of Marine Picoplankton by Tyramide Signal Amplification-Fluorescent In Situ Hybridization.

    PubMed

    Riou, Virginie; Périot, Marine; Biegala, Isabelle C

    2017-01-01

    Oligonucleotide probes are increasingly being used to characterize natural microbial assemblages by Tyramide Signal Amplification-Fluorescent in situ Hybridization (TSA-FISH, or CAtalysed Reporter Deposition CARD-FISH). In view of the fast-growing rRNA databases, we re-evaluated the in silico specificity of eleven bacterial and eukaryotic probes and competitor frequently used for the quantification of marine picoplankton. We performed tests on cell cultures to decrease the risk for non-specific hybridization, before they are used on environmental samples. The probes were confronted to recent databases and hybridization conditions were tested against target strains matching perfectly with the probes, and against the closest non-target strains presenting one to four mismatches. We increased the hybridization stringency from 55 to 65% formamide for the Eub338+EubII+EubIII probe mix to be specific to the Eubacteria domain. In addition, we found that recent changes in the Gammaproteobacteria classification decreased the specificity of Gam42a probe, and that the Roseo536R and Ros537 probes were not specific to, and missed part of the Roseobacter clade. Changes in stringency conditions were important for bacterial probes; these induced, respectively, a significant increase, in Eubacteria and Roseobacter and no significant changes in Gammaproteobacteria concentrations from the investigated natural environment. We confirmed the eukaryotic probes original conditions, and propose the Euk1209+NChlo01+Chlo02 probe mix to target the largest picoeukaryotic diversity. Experiences acquired through these investigations leads us to propose the use of seven steps protocol for complete FISH probe specificity check-up to improve data quality in environmental studies.

  6. Assessing the potential additionality of certification by the Round table on Responsible Soybeans and the Roundtable on Sustainable Palm Oil

    NASA Astrophysics Data System (ADS)

    Garrett, Rachael D.; Carlson, Kimberly M.; Rueda, Ximena; Noojipady, Praveen

    2016-04-01

    Multi-stakeholder roundtables offering certification programs are promising voluntary governance mechanisms to address sustainability issues associated with international agricultural supply chains. Yet, little is known about whether roundtable certifications confer additionality, the benefits of certification beyond what would be expected from policies and practices currently in place. Here, we examine the potential additionality of the Round table on Responsible Soybeans (RTRS) and the Roundtable on Sustainable Palm Oil (RSPO) in mitigating conversion of native vegetation to cropland. We develop a metric of additionality based on business as usual land cover change dynamics and roundtable standard stringency relative to existing policies. We apply this metric to all countries with RTRS (n = 8) and RSPO (n = 12) certified production in 2013-2014, as well as countries that have no certified production but are among the top ten global producers in terms of soy (n = 2) and oil palm (n = 2). We find RSPO and RTRS both have substantially higher levels of stringency than existing national policies except in Brazil and Uruguay. In regions where these certification standards are adopted, the mean estimated rate of tree cover conversion to the target crop is similar for both standards. RTRS has higher mean relative stringency than the RSPO, yet RSPO countries have slightly higher enforcement levels. Therefore, mean potential additionality of RTRS and RSPO is similar across regions. Notably, countries with the highest levels of additionality have some adoption. However, with extremely low adoption rates (0.41% of 2014 global harvested area), RTRS likely has lower impact than RSPO (14%). Like most certification programs, neither roundtable is effectively targeting smallholder producers. To improve natural ecosystem protection, roundtables could target adoption to regions with low levels of environmental governance and high rates of forest-to-cropland conversion.

  7. The recA gene from the thermophile Thermus aquaticus YT-1: cloning, expression, and characterization.

    PubMed Central

    Angov, E; Camerini-Otero, R D

    1994-01-01

    We have cloned, expressed, and purified the RecA analog from the thermophilic eubacterium Thermus aquaticus YT-1. Analysis of the deduced amino acid sequence indicates that the T. aquaticus RecA is structurally similar to the Escherichia coli RecA and suggests that RecA-like function has been conserved in thermophilic organisms. Preliminary biochemical analysis indicates that the protein has an ATP-dependent single-stranded DNA binding activity and can pair and carry out strand exchange to form a heteroduplex DNA under reaction conditions previously described for E. coli RecA, but at 55 to 65 degrees C. Further characterization of a thermophilically derived RecA protein should yield important information concerning DNA-protein interactions at high temperatures. In addition, a thermostable RecA protein may have some general applicability in stabilizing DNA-protein interactions in reactions which occur at high temperatures by increasing the specificity (stringency) of annealing reactions. Images PMID:8113181

  8. Stringency and relaxation among the halobacteria.

    PubMed Central

    Cimmino, C; Scoarughi, G L; Donini, P

    1993-01-01

    Accumulation of stable RNA and production of guanosine polyphosphates (ppGpp and pppGpp) were studied during amino acid starvation in four species of halobacteria. In two of the four species, stable RNA was under stringent control, whereas one of the remaining two species was relaxed and the other gave an intermediate phenotype. The stringent reaction was reversed by anisomycin, an effect analogous to the chloroamphenicol-induced reversal of stringency in the eubacteria. During the stringent response, neither ppGpp nor pppGpp accumulation took place during starvation. In both growing and starved cells a very low basal level of the two polyphosphates appeared to be present. In the stringent species the intracellular concentration of GTP did not diminish but actually increased during the course of the stringent response. These data demonstrate that (i) wild-type halobacteria can have either the stringent or the relaxed phenotype (all wild-type eubacteria tested have been shown to be stringent); (ii) stringency in the halobacteria is dependent on the deaminoacylation of tRNA, as in the eubacteria; and (iii) in the halobacteria, ppGpp is not an effector of stringent control over stable-RNA synthesis. Images PMID:7691798

  9. Genomic clones for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kott, M.; Venta, P.J.; Larsen, J.

    1987-05-01

    A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

  10. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  11. Granulocyte-Macrophage Colony-Stimulating Factor Priming plus Papillomavirus E6 DNA Vaccination: Effects on Papilloma Formation and Regression in the Cottontail Rabbit Papillomavirus-Rabbit Model

    PubMed Central

    Leachman, Sancy A.; Tigelaar, Robert E.; Shlyankevich, Mark; Slade, Martin D.; Irwin, Michele; Chang, Ed; Wu, T. C.; Xiao, Wei; Pazhani, Sundaram; Zelterman, Daniel; Brandsma, Janet L.

    2000-01-01

    A cottontail rabbit papillomavirus (CRPV) E6 DNA vaccine that induces significant protection against CRPV challenge was used in a superior vaccination regimen in which the cutaneous sites of vaccination were primed with an expression vector encoding granulocyte-macrophage colony-stimulating factor (GM-CSF), a cytokine that induces differentiation and local recruitment of professional antigen-presenting cells. This treatment induced a massive influx of major histocompatibility complex class II-positive cells. In a vaccination-challenge experiment, rabbit groups were treated by E6 DNA vaccination, GM-CSF DNA inoculation, or a combination of both treatments. After two immunizations, rabbits were challenged with CRPV at low, moderate, and high stringencies and monitored for papilloma formation. As expected, all clinical outcomes were monotonically related to the stringency of the viral challenge. The results demonstrate that GM-CSF priming greatly augmented the effects of CRPV E6 vaccination. First, challenge sites in control rabbits (at the moderate challenge stringency) had a 0% probability of remaining disease free, versus a 50% probability in E6-vaccinated rabbits, and whereas GM-CSF alone had no effect, the interaction between GM-CSF priming and E6 vaccination increased disease-free survival to 67%. Second, the incubation period before papilloma onset was lengthened by E6 DNA vaccination alone or to some extent by GM-CSF DNA inoculation alone, and the combination of treatments induced additive effects. Third, the rate of papilloma growth was reduced by E6 vaccination and, to a lesser extent, by GM-CSF treatment. In addition, the interaction between the E6 and GM-CSF treatments was synergistic and yielded more than a 99% reduction in papilloma volume. Finally, regression occurred among the papillomas that formed in rabbits treated with the E6 vaccine and/or with GM-CSF, with the highest regression frequency occurring in rabbits that received the combination treatment. PMID:10954571

  12. Neutral evolution of proteins: The superfunnel in sequence space and its relation to mutational robustness

    NASA Astrophysics Data System (ADS)

    Noirel, Josselin; Simonson, Thomas

    2008-11-01

    Following Kimura's neutral theory of molecular evolution [M. Kimura, The Neutral Theory of Molecular Evolution (Cambridge University Press, Cambridge, 1983) (reprinted in 1986)], it has become common to assume that the vast majority of viable mutations of a gene confer little or no functional advantage. Yet, in silico models of protein evolution have shown that mutational robustness of sequences could be selected for, even in the context of neutral evolution. The evolution of a biological population can be seen as a diffusion on the network of viable sequences. This network is called a "neutral network." Depending on the mutation rate μ and the population size N, the biological population can evolve purely randomly (μN ≪1) or it can evolve in such a way as to select for sequences of higher mutational robustness (μN ≫1). The stringency of the selection depends not only on the product μN but also on the exact topology of the neutral network, the special arrangement of which was named "superfunnel." Even though the relation between mutation rate, population size, and selection was thoroughly investigated, a study of the salient topological features of the superfunnel that could affect the strength of the selection was wanting. This question is addressed in this study. We use two different models of proteins: on lattice and off lattice. We compare neutral networks computed using these models to random networks. From this, we identify two important factors of the topology that determine the stringency of the selection for mutationally robust sequences. First, the presence of highly connected nodes ("hubs") in the network increases the selection for mutationally robust sequences. Second, the stringency of the selection increases when the correlation between a sequence's mutational robustness and its neighbors' increases. The latter finding relates a global characteristic of the neutral network to a local one, which is attainable through experiments or molecular modeling.

  13. Neutral evolution of proteins: The superfunnel in sequence space and its relation to mutational robustness.

    PubMed

    Noirel, Josselin; Simonson, Thomas

    2008-11-14

    Following Kimura's neutral theory of molecular evolution [M. Kimura, The Neutral Theory of Molecular Evolution (Cambridge University Press, Cambridge, 1983) (reprinted in 1986)], it has become common to assume that the vast majority of viable mutations of a gene confer little or no functional advantage. Yet, in silico models of protein evolution have shown that mutational robustness of sequences could be selected for, even in the context of neutral evolution. The evolution of a biological population can be seen as a diffusion on the network of viable sequences. This network is called a "neutral network." Depending on the mutation rate mu and the population size N, the biological population can evolve purely randomly (muN<1) or it can evolve in such a way as to select for sequences of higher mutational robustness (muN>1). The stringency of the selection depends not only on the product muN but also on the exact topology of the neutral network, the special arrangement of which was named "superfunnel." Even though the relation between mutation rate, population size, and selection was thoroughly investigated, a study of the salient topological features of the superfunnel that could affect the strength of the selection was wanting. This question is addressed in this study. We use two different models of proteins: on lattice and off lattice. We compare neutral networks computed using these models to random networks. From this, we identify two important factors of the topology that determine the stringency of the selection for mutationally robust sequences. First, the presence of highly connected nodes ("hubs") in the network increases the selection for mutationally robust sequences. Second, the stringency of the selection increases when the correlation between a sequence's mutational robustness and its neighbors' increases. The latter finding relates a global characteristic of the neutral network to a local one, which is attainable through experiments or molecular modeling.

  14. Structure-based protein engineering for thermostable and alkaliphilic enhancement of endo-β-1,4-xylanase for applications in pulp bleaching.

    PubMed

    Boonyapakron, Katewadee; Jaruwat, Aritsara; Liwnaree, Benjamas; Nimchua, Thidarat; Champreda, Verawat; Chitnumsub, Penchit

    2017-10-10

    In the pulp bleaching industry, enzymes with robust activity at high pH and temperatures are desirable for facilitating the pre-bleaching process with simplified processing and minimal use of chlorinated compounds. To engineer an enzyme for this purpose, we determined the crystal structure of the Xyn12.2 xylanase, a xylan-hydrolyzing enzyme derived from the termite gut symbiont metagenome, as the basis for structure-based protein engineering to improve Xyn12.2 stability in high heat and alkaline conditions. Engineered cysteine pairs that generated exterior disulfide bonds increased the k cat of Xyn12.2 variants and melting temperature at all tested conditions. These improvements led to up to 4.2-fold increases in catalytic efficiency at pH 9.0, 50°C for 1h and up to 3-fold increases at 60°C. The most effective variants, XynTT and XynTTTE, exhibited 2-3-fold increases in bagasse hydrolysis at pH 9.0 and 60°C compared to the wild-type enzyme. Overall, engineering arginines and phenylalanines for increased pK a and hydrogen bonding improved enzyme catalytic efficiency at high stringency conditions. These modifications were the keys to enhancing thermostability and alkaliphilicity in our enzyme variants, with XynTT and XynTTTE being especially promising for their application to the pulp and paper industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. [Optimization and assessment of a reverse hybridization system for the detection of HBV drug-resistant mutations].

    PubMed

    Liu, Yan-chen; Huang, Ai-long; Hu, Yuan; Hu, Jie-li; Lai, Guo-qi; Zhang, Wen-lu

    2011-12-01

    To establish a detection method for HBV drug-resistant mutations related to lamivudine, adefovir and entecavir by optimization and assessment of reverse hybridization system. 26 degenerated probes covering 10 drug-resistant hotspots of 3 drugs were synthesized and immobilized on the same positively charged nylon membrane. PCR products labeled with digoxigenin were hybridized with corresponding probes. To improve the sensitivity and specificity, 4 reaction steps of reverse hybridization were optimized including the number of labeled digoxigenin, the energy intensity of UV cross-linking, hybridization and stringency wash conditions. To prove the feasibility, the specificity, sensitivity and accuracy of this system were assessed respectively. Sensitive and specific results are obtained by the optimization of the following 4 reaction steps: the primers labeled with 3 digoxigenin, energy intensity of UV cross-linking for 1500 x 0.1 mJ/cm², hybridization at 42 degrees C and stringency wash with 0.5 x SSC and 0.1% SDS solution at 44 degrees C for 30 min. In the assessment of system, the majority of probes have high specificity. The quantity of PCR product with a concentration of 10 ng/μl or above can be detected by this method. The concordant rate between reverse hybridization and direct sequencing is 93.9% in the clinical sample test. Though the specificity of several probes needs to be improved further, it is a simple, rapid and sensitive method which can detect HBV resistant mutations related to lamivudine, adefovir and entecavir simultaneously. Due to the short distance between 180 and 181, likewise 202 and 204, the sequence of the same probe covers two codon positions, and hybridization will be interfered by each other. To avoid such interference, the possible solution is that probes are designed by arranging and combining various forms of two near codons.

  16. Phylogenetic group- and species-specific oligonucleotide probes for single-cell detection of lactic acid bacteria in oral biofilms

    PubMed Central

    2011-01-01

    Background The purpose of this study was to design and evaluate fluorescent in situ hybridization (FISH) probes for the single-cell detection and enumeration of lactic acid bacteria, in particular organisms belonging to the major phylogenetic groups and species of oral lactobacilli and to Abiotrophia/Granulicatella. Results As lactobacilli are known for notorious resistance to probe penetration, probe-specific assay protocols were experimentally developed to provide maximum cell wall permeability, probe accessibility, hybridization stringency, and fluorescence intensity. The new assays were then applied in a pilot study to three biofilm samples harvested from variably demineralized bovine enamel discs that had been carried in situ for 10 days by different volunteers. Best probe penetration and fluorescent labeling of reference strains were obtained after combined lysozyme and achromopeptidase treatment followed by exposure to lipase. Hybridization stringency had to be established strictly for each probe. Thereafter all probes showed the expected specificity with reference strains and labeled the anticipated morphotypes in dental plaques. Applied to in situ grown biofilms the set of probes detected only Lactobacillus fermentum and bacteria of the Lactobacillus casei group. The most cariogenic biofilm contained two orders of magnitude higher L. fermentum cell numbers than the other biofilms. Abiotrophia/Granulicatella and streptococci from the mitis group were found in all samples at high levels, whereas Streptococcus mutans was detected in only one sample in very low numbers. Conclusions Application of these new group- and species-specific FISH probes to oral biofilm-forming lactic acid bacteria will allow a clearer understanding of the supragingival biome, its spatial architecture and of structure-function relationships implicated during plaque homeostasis and caries development. The probes should prove of value far beyond the field of oral microbiology, as many of them detect non-oral species and phylogenetic groups of importance in a variety of medical conditions and the food industry. PMID:21247450

  17. Multiple components in restriction enzyme digests of mammalian (insectivore), avian and reptilian genomic DNA hybridize with murine immunoglobulin VH probes.

    PubMed

    Litman, G W; Berger, L; Jahn, C L

    1982-06-11

    High molecular weight genomic DNAs isolated from an insectivore, Tupaia, and a representative reptilian, Caiman, and avian, Gallus, were digested with restriction endonucleases transferred to nitrocellulose and hybridized with nick-translated probes of murine VH genes. The derivations of the probes designated S107V (1) and mu 107V (2,3) have been described previously. Under conditions of reduced stringency, multiple hybridizing components were observed with Tupaia and Caiman; only mu mu 107V exhibited significant hybridization with the separated fragments of Gallus DNA. The nick-translated S107V probe was digested with Fnu4H1 and subinserts corresponding to the 5' and 3' regions both detected multiple hybridizing components in Tupaia and Caiman DNA. A 5' probe lacking the leader sequence identified the same components as the intact 5' probe, suggesting that VH coding regions distant as the reptilians may possess multiple genetic components which exhibit significant homology with murine immunoglobulin in VH regions.

  18. Multiple components in restriction enzyme digests of mammalian (insectivore), avian and reptilian genomic DNA hybridize with murine immunoglobulin VH probes.

    PubMed Central

    Litman, G W; Berger, L; Jahn, C L

    1982-01-01

    High molecular weight genomic DNAs isolated from an insectivore, Tupaia, and a representative reptilian, Caiman, and avian, Gallus, were digested with restriction endonucleases transferred to nitrocellulose and hybridized with nick-translated probes of murine VH genes. The derivations of the probes designated S107V (1) and mu 107V (2,3) have been described previously. Under conditions of reduced stringency, multiple hybridizing components were observed with Tupaia and Caiman; only mu mu 107V exhibited significant hybridization with the separated fragments of Gallus DNA. The nick-translated S107V probe was digested with Fnu4H1 and subinserts corresponding to the 5' and 3' regions both detected multiple hybridizing components in Tupaia and Caiman DNA. A 5' probe lacking the leader sequence identified the same components as the intact 5' probe, suggesting that VH coding regions distant as the reptilians may possess multiple genetic components which exhibit significant homology with murine immunoglobulin in VH regions. Images PMID:6285298

  19. Stringency of workplace air contaminant exposure limits: a case study of OSHA risk management.

    PubMed

    Hakes, J K

    1999-12-01

    Political context may play a large role in influencing the efficiency of environmental and health regulations. This case study uses data from a 1989 update of the Occupational Safety and Health Administration (OSHA) Permissible Exposure Limits (PELs) program to determine the relative effects of legislative mandates, costly acquisition of information by the agency, and pressure applied by special interest groups upon exposure standards. The empirical analysis suggests that federal agencies successfully thwart legislative attempts to limit agency discretion, and that agencies exercise bounded rationality by placing greater emphasis on more easily obtained information. The 1989 PELs were less significantly related to more costly information, contained "safety factors" for chemicals presenting relatively more ambiguous risks, and the proposed standard stringencies showed evidence of being influenced by vying industry and labor interests.

  20. DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

    PubMed

    Martín-Blanco, E; Kornberg, T B

    1993-11-16

    Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

  1. A Two-Stream Plasma Electron Microwave Source for High-Power Millimeter Wave Generation. Phase 1

    DTIC Science & Technology

    1989-03-29

    MIT Press, Cambridge, MA, 1963). these findings that strong amplification is possible for repre- ’See, for example, G. E. Guest and D. J. Sigmar , Nucl...stringency of the stability criteria for electrostatic and whistler modes, as fl(z=O, 6, t=O) = -i/2u,(e/m) discussed by Guest and Sigmar [22], and...therein. Function. Academic Press, New York (1961). 1221 GUEST, G.E., SIGMAR , D.J., Nuci. Fusion It1(1971) [271 ABRAMOWITZ, M., STEGUN. I.A. (Eds

  2. Acoustic flight test of the Piper Lance

    DOT National Transportation Integrated Search

    1986-12-01

    Research is being conducted to refine current noise regulation of propeller-driven small airplanes. Studies are examining the prospect of a substituting a takeoff procedure of equal stringency for the level flyover certification test presently requir...

  3. Lack of production of (p)ppGpp in Halobacterium volcanii under conditions that are effective in the eubacteria.

    PubMed Central

    Scoarughi, G L; Cimmino, C; Donini, P

    1995-01-01

    The stringent halobacterial strain Haloferax volcanii was subjected to a set of physiological conditions different from amino acid starvation that are known to cause production of guanosine polyphosphates [(p)pp Gpp] in eubacteria via the relA-independent (spoT) pathway. The conditions used were temperature upshift, treatment with cyanide, and total starvation. Under none of these conditions were detectable levels of (p)ppGpp observed. This result, in conjunction with our previous finding that (p)ppGpp synthesis does not occur under amino acid starvation, leads to the conclusion that in halobacteria both growth rate control and stringency are probably governed by mechanisms that operate in the absence of ppGpp. During exponential growth, a low level of phosphorylated compounds with electrophoretic mobilities similar, but not identical, to that of (p)ppGpp were observed. The intracellular concentration of these compounds increased considerably during the stationary phase of growth and with all of the treatments used. The compounds were identified as short-chain polyphosphates identical to those found under similar conditions in Saccharomyces cerevisiae. PMID:7798153

  4. Isolation of a novel human papillomavirus (type 51) from a cervical condyloma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nuovo, G.J.; Crum, C.P.; Levine, R.U.

    1988-04-01

    The authors cloned the DNA from a novel human papillomavirus (HPV) present in a cervical condyloma. When DNA from this isolate was hybridized at high stringency with HPV types 1 through 50 (HPV-1 through HPV-50), it showed weak homology with HPV-6 and -16 and stronger homology with HPV-26. A detailed restriction endonuclease map was prepared which showed marked differences from the maps for other HPVs that have been isolated from the female genital tract. Reassociation kinetic analysis revealed that HPV-26 and this new isolate were less than 10% homologous; hence, the new isolate is a noel strain of HPV. Themore » approximate positions of the open reading frames of the new strain were surmised by hybridization with probes derived from individual open reading frames of HPV-16. In an analysis of 175 genital biopsies from patients with abnormal Papanicolaou smears, sequences hybridizing under highly stringent conditions to probes from this novel HPV type were found in 4.2, 6.1, and 2.4% of biopsies containing normal squamous epithelium, condylomata, and intraepithelial neoplasia, respectively. In addition, sequences homologous to probes from this novel isolate were detected in one of five cervical carcinomas examined.« less

  5. A predictive analysis of CO2 emissions, environmental policy stringency, and economic growth in China.

    PubMed

    Ahmed, Khalid; Ahmed, Sidrah

    2018-03-28

    This study takes environmental policy stringency and economic activity as the controlling variables and forecasts the CO 2 emissions in China up to 2022. In doing so, an application of corrected grey model with convolution is used over the annual time series data between 1990 and 2012. The simulation results show that (1) between 2012 and 2022, CO 2 emissions in China is expected to increase at an average rate of 17.46% annually, raising the emissions intensity from 7.04 in 2012 to 25.461 metric tons per capita by 2022; (2) stringent environmental policies reduce CO 2 emissions-whereas, GDP tends to increase the emissions intensity in China; (3) stringent environmental policies are found to have a negative impact on GDP in China. Based on the empirical findings, the study also provides some policy suggestions to reduce emissions intensity in China.

  6. Stringency of the 2-His–1-Asp Active-Site Motif in Prolyl 4-Hydroxylase

    PubMed Central

    Gorres, Kelly L.; Pua, Khian Hong; Raines, Ronald T.

    2009-01-01

    The non-heme iron(II) dioxygenase family of enzymes contain a common 2-His–1-carboxylate iron-binding motif. These enzymes catalyze a wide variety of oxidative reactions, such as the hydroxylation of aliphatic C–H bonds. Prolyl 4-hydroxylase (P4H) is an α-ketoglutarate-dependent iron(II) dioxygenase that catalyzes the post-translational hydroxylation of proline residues in protocollagen strands, stabilizing the ensuing triple helix. Human P4H residues His412, Asp414, and His483 have been identified as an iron-coordinating 2-His–1-carboxylate motif. Enzymes that catalyze oxidative halogenation do so by a mechanism similar to that of P4H. These halogenases retain the active-site histidine residues, but the carboxylate ligand is replaced with a halide ion. We replaced Asp414 of P4H with alanine (to mimic the active site of a halogenase) and with glycine. These substitutions do not, however, convert P4H into a halogenase. Moreover, the hydroxylase activity of D414A P4H cannot be rescued with small molecules. In addition, rearranging the two His and one Asp residues in the active site eliminates hydroxylase activity. Our results demonstrate a high stringency for the iron-binding residues in the P4H active site. We conclude that P4H, which catalyzes an especially demanding chemical transformation, is recalcitrant to change. PMID:19890397

  7. Developing an alcohol policy assessment toolkit: application in the western Pacific.

    PubMed

    Carragher, Natacha; Byrnes, Joshua; Doran, Christopher M; Shakeshaft, Anthony

    2014-10-01

    To demonstrate the development and feasibility of a tool to assess the adequacy of national policies aimed at reducing alcohol consumption and related problems. We developed a quantitative tool - the Toolkit for Evaluating Alcohol policy Stringency and Enforcement (TEASE-16) - to assess the level of stringency and enforcement of 16 alcohol control policies. TEASE-16 was applied to policy data from nine study areas in the western Pacific: Australia, China excluding Hong Kong Special Administrative Region (SAR), Hong Kong SAR, Japan, Malaysia, New Zealand, the Philippines, Singapore and Viet Nam. Correlation and regression analyses were then used to examine the relationship between alcohol policy scores and income-adjusted levels of alcohol consumption per capita. Vast differences exist in how alcohol control policies are implemented in the western Pacific. Out of a possible 100 points, the nine study areas achieved TEASE-16 scores that ranged from 24.1 points for the Philippines to 67.5 points for Australia. Study areas with high policy scores - indicating relatively strong alcohol policy frameworks - had lower alcohol consumption per capita. Sensitivity analyses indicated scores and rankings for each study area remained relatively stable across different weighting schemes, indicating that TEASE-16 was robust. TEASE-16 could be used by international and national regulatory bodies and policy-makers to guide the design, implementation, evaluation and refinement of effective policies to reduce alcohol consumption and related problems.

  8. Of Publishers and Pirates: License Agreements Promote Unethical Behavior, But That's Only the Beginning.

    ERIC Educational Resources Information Center

    Pournelle, Jerry

    1984-01-01

    Discussion of software license agreements implies that they actually contribute to software piracy because of their stringency and indicates that competition in the software publishing field will eventually eliminate the piracy problem. (MBR)

  9. The Political Economy of Part-Time Academic Work in Canada.

    ERIC Educational Resources Information Center

    Rajagopal, Indhu; Farr, William D.

    1989-01-01

    Under continuing financial stringency, the university administration negotiates concessions with full-time faculty to satisfy their interests and maintain the stability of the system. Part-timers, excluded from the collegium, remain peripheral to these arrangements. (Author/MLW)

  10. Peptide Array X-Linking (PAX): A New Peptide-Protein Identification Approach

    PubMed Central

    Okada, Hirokazu; Uezu, Akiyoshi; Soderblom, Erik J.; Moseley, M. Arthur; Gertler, Frank B.; Soderling, Scott H.

    2012-01-01

    Many protein interaction domains bind short peptides based on canonical sequence consensus motifs. Here we report the development of a peptide array-based proteomics tool to identify proteins directly interacting with ligand peptides from cell lysates. Array-formatted bait peptides containing an amino acid-derived cross-linker are photo-induced to crosslink with interacting proteins from lysates of interest. Indirect associations are removed by high stringency washes under denaturing conditions. Covalently trapped proteins are subsequently identified by LC-MS/MS and screened by cluster analysis and domain scanning. We apply this methodology to peptides with different proline-containing consensus sequences and show successful identifications from brain lysates of known and novel proteins containing polyproline motif-binding domains such as EH, EVH1, SH3, WW domains. These results suggest the capacity of arrayed peptide ligands to capture and subsequently identify proteins by mass spectrometry is relatively broad and robust. Additionally, the approach is rapid and applicable to cell or tissue fractions from any source, making the approach a flexible tool for initial protein-protein interaction discovery. PMID:22606326

  11. Development of an automated in vitro selection protocol to obtain RNA-based aptamers: identification of a biostable substance P antagonist

    PubMed Central

    Eulberg, Dirk; Buchner, Klaus; Maasch, Christian; Klussmann, Sven

    2005-01-01

    We have developed an automated SELEX (Systematic Evolution of Ligands by EXponential Enrichment) process that allows the execution of in vitro selection cycles without any direct manual intervention steps. The automated selection protocol is designed to provide for high flexibility and versatility in terms of choice of buffers and reagents as well as stringency of selection conditions. Employing the automated SELEX process, we have identified RNA aptamers to the mirror-image configuration (d-peptide) of substance P. The peptide substance P belongs to the tachykinin family and exerts various biologically important functions, such as peripheral vasodilation, smooth muscle contraction and pain transmission. The aptamer that was identified most frequently was truncated to the 44mer SUP-A-004. The mirror-image configuration of SUP-A-004, the so-called Spiegelmer, has been shown to bind to naturally occurring l-substance P displaying a Kd of 40 nM and to inhibit (IC50 of 45 nM) l-substance P-mediated Ca2+ release in a cell culture assay. PMID:15745995

  12. Development of an automated in vitro selection protocol to obtain RNA-based aptamers: identification of a biostable substance P antagonist.

    PubMed

    Eulberg, Dirk; Buchner, Klaus; Maasch, Christian; Klussmann, Sven

    2005-03-03

    We have developed an automated SELEX (Systematic Evolution of Ligands by EXponential Enrichment) process that allows the execution of in vitro selection cycles without any direct manual intervention steps. The automated selection protocol is designed to provide for high flexibility and versatility in terms of choice of buffers and reagents as well as stringency of selection conditions. Employing the automated SELEX process, we have identified RNA aptamers to the mirror-image configuration (d-peptide) of substance P. The peptide substance P belongs to the tachykinin family and exerts various biologically important functions, such as peripheral vasodilation, smooth muscle contraction and pain transmission. The aptamer that was identified most frequently was truncated to the 44mer SUP-A-004. The mirror-image configuration of SUP-A-004, the so-called Spiegelmer, has been shown to bind to naturally occurring l-substance P displaying a K(d) of 40 nM and to inhibit (IC50 of 45 nM) l-substance P-mediated Ca2+ release in a cell culture assay.

  13. Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

    PubMed

    Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

    1993-11-01

    In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

  14. A tailing genome walking method suitable for genomes with high local GC content.

    PubMed

    Liu, Taian; Fang, Yongxiang; Yao, Wenjuan; Guan, Qisai; Bai, Gang; Jing, Zhizhong

    2013-10-15

    The tailing genome walking strategies are simple and efficient. However, they sometimes can be restricted due to the low stringency of homo-oligomeric primers. Here we modified their conventional tailing step by adding polythymidine and polyguanine to the target single-stranded DNA (ssDNA). The tailed ssDNA was then amplified exponentially with a specific primer in the known region and a primer comprising 5' polycytosine and 3' polyadenosine. The successful application of this novel method for identifying integration sites mediated by φC31 integrase in goat genome indicates that the method is more suitable for genomes with high complexity and local GC content. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Towards Flexibility in Academic Labour Markets?

    ERIC Educational Resources Information Center

    Nieuwenhuysen, John

    1985-01-01

    It is argued that Australia's relatively uniform and consistent academic salary structure and personnel policies should be more flexible and competitive in order to alleviate current problems of academic labor market stagnation, uneven faculty distribution, and other results of financial stringency. (MSE)

  16. Undesired variance due to examiner stringency/leniency effect in communication skill scores assessed in OSCEs.

    PubMed

    Harasym, Peter H; Woloschuk, Wayne; Cunning, Leslie

    2008-12-01

    Physician-patient communication is a clinical skill that can be learned and has a positive impact on patient satisfaction and health outcomes. A concerted effort at all medical schools is now directed at teaching and evaluating this core skill. Student communication skills are often assessed by an Objective Structure Clinical Examination (OSCE). However, it is unknown what sources of error variance are introduced into examinee communication scores by various OSCE components. This study primarily examined the effect different examiners had on the evaluation of students' communication skills assessed at the end of a family medicine clerkship rotation. The communication performance of clinical clerks from Classes 2005 and 2006 were assessed using six OSCE stations. Performance was rated at each station using the 28-item Calgary-Cambridge guide. Item Response Theory analysis using a Multifaceted Rasch model was used to partition the various sources of error variance and generate a "true" communication score where the effects of examiner, case, and items are removed. Variance and reliability of scores were as follows: communication scores (.20 and .87), examiner stringency/leniency (.86 and .91), case (.03 and .96), and item (.86 and .99), respectively. All facet scores were reliable (.87-.99). Examiner variance (.86) was more than four times the examinee variance (.20). About 11% of the clerks' outcome status shifted using "true" rather than observed/raw scores. There was large variability in examinee scores due to variation in examiner stringency/leniency behaviors that may impact pass-fail decisions. Exploring the benefits of examiner training and employing "true" scores generated using Item Response Theory analyses prior to making pass/fail decisions are recommended.

  17. FUEL ECONOMY AND CO2 EMISSIONS STANDARDS, MANUFACTURER PRICING STRATEGIES, AND FEEBATES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Changzheng; Greene, David L; Bunch, Dr David S.

    2012-01-01

    Corporate Average Fuel Economy (CAFE) standards and CO2 emissions standards for 2012 to 2016 have significantly increased the stringency of requirements for new light-duty vehicle fuel efficiency. This study investigates the role of technology adoption and pricing strategies in meeting new standards, as well as the impact of feebate policies. The analysis is carried out by means of a dynamic optimization model that simulates manufacturer decisions with the objective of maximizing social surplus while simultaneously considering consumer response and meeting CAFE and emissions standards. The results indicate that technology adoption plays the major role and that the provision of compliancemore » flexibility and the availability of cost-effective advanced technologies help manufacturers reduce the need for pricing to induce changes in the mix of vehicles sold. Feebates, when implemented along with fuel economy and emissions standards, can bring additional fuel economy improvement and emissions reduction, but the benefit diminishes with the increasing stringency of the standards.« less

  18. PCR-based study of conserved and variable DNA sequences of Tritrichomonas foetus isolates from Saskatchewan, Canada.

    PubMed Central

    Riley, D E; Wagner, B; Polley, L; Krieger, J N

    1995-01-01

    The protozoan parasite Tritrichomonas foetus causes infertility and spontaneous abortion in cattle. In Saskatchewan, Canada, the culture prevalence of trichomonads was 65 of 1,048 (6%) among 1,048 bulls tested within a 1-year period ending in April 1994. Saskatchewan was previously thought to be free of the parasite. To confirm the culture results, possible T. foetus DNA presence was determined by the PCR. All of the 16 culture-positive isolates tested were PCR positive by a single-band test, but one PCR product was weak. DNA fingerprinting by both T17 PCR and randomly amplified polymorphic DNA PCR revealed genetic variation or polymorphism among the T. foetus isolates. T17 PCR also revealed conserved loci that distinguished these T. foetus isolates from Trichomonas vaginalis, from a variety of other protozoa, and from prokaryotes. TCO-1 PCR, a PCR test designed to sample DNA sequence homologous to the 5' flank of a highly conserved cell division control gene, detected genetic polymorphism at low stringency and a conserved, single locus at higher stringency. These findings suggested that T. foetus isolates exhibit both conserved genetic loci and polymorphic loci detectable by independent PCR methods. Both conserved and polymorphic genetic loci may prove useful for improved clinical diagnosis of T. foetus. The polymorphic loci detected by PCR suggested either a long history of infection or multiple lines of T. foetus infection in Saskatchewan. Polymorphic loci detected by PCR may provide data for epidemiologic studies of T. foetus. PMID:7615746

  19. Methyl CpG level at distal part of heat-shock protein promoter HSP70 exhibits epigenetic memory for heat stress by modulating recruitment of POU2F1-associated nucleosome-remodeling deacetylase (NuRD) complex.

    PubMed

    Kisliouk, Tatiana; Cramer, Tomer; Meiri, Noam

    2017-05-01

    Depending on its stringency, exposure to heat in early life leads to either resilience or vulnerability to heat stress later in life. We hypothesized that epigenetic alterations in genes belonging to the cell proteostasis pathways are attributed to long-term responses to heat stress. Epigenetic regulation of the mRNA expression of the molecular chaperone heat-shock protein (HSP) 70 (HSPA2) was evaluated in the chick hypothalamus during the critical period of thermal-control establishment on day 3 post-hatch and during heat challenge on day 10. Both the level and duration of HSP70 expression during heat challenge a week after heat conditioning were more pronounced in chicks conditioned under harsh versus mild temperature. Analyzing different segments of the promoter in vitro indicated that methylation of a distal part altered its transcriptional activity. In parallel, DNA-methylation level of this segment in vivo was higher in harsh- compared to mild-heat-conditioned chicks. Hypermethylation of the HSP70 promoter in high-temperature-conditioned chicks was accompanied by a reduction in both POU Class 2 Homeobox 1 (POU2F1) binding and recruitment of the nucleosome remodeling deacetylase (NuRD) chromatin-remodeling complex. As a result, histone H3 acetylation levels at the HSP70 promoter were higher in harsh-temperature-conditioned chicks than in their mild-heat-conditioned counterparts. These results suggest that methylation level of a distal part of the HSP70 promoter and POU2F1 recruitment may reflect heat-stress-related epigenetic memory and may be useful in differentiating between individuals that are resilient or vulnerable to stress. © 2017 International Society for Neurochemistry.

  20. Molecular architecture of classical cytological landmarks: Centromeres and telomeres

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meyne, J.

    1994-11-01

    Both the human telomere repeat and the pericentromeric repeat sequence (GGAAT)n were isolated based on evolutionary conservation. Their isolation was based on the premise that chromosomal features as structurally and functionally important as telomeres and centromeres should be highly conserved. Both sequences were isolated by high stringency screening of a human repetitive DNA library with rodent repetitive DNA. The pHuR library (plasmid Human Repeat) used for this project was enriched for repetitive DNA by using a modification of the standard DNA library preparation method. Usually DNA for a library is cut with restriction enzymes, packaged, infected, and the library ismore » screened. A problem with this approach is that many tandem repeats don`t have any (or many) common restriction sites. Therefore, many of the repeat sequences will not be represented in the library because they are not restricted to a viable length for the vector used. To prepare the pHuR library, human DNA was mechanically sheared to a small size. These relatively short DNA fragments were denatured and then renatured to C{sub o}t 50. Theoretically only repetitive DNA sequences should renature under C{sub o}t 50 conditions. The single-stranded regions were digested using S1 nuclease, leaving the double-stranded, renatured repeat sequences.« less

  1. Degenerative encephalopathy in a coastal mountain kingsnake (Lampropeltis zonata multifasciata) due to adenoviral-like infection.

    PubMed

    Raymond, James T; Lamm, Marnie; Nordhausen, Robert; Latimer, Ken; Garner, Michael M

    2003-04-01

    In March 2000, an approximately 30-yr-old, male coastal mountain kingsnake (Lampropeltis zonata multifasciata) presented with disequilibrium and unresponsiveness to stimuli that ultimately lead to euthanasia. Histologically, there were foci of gliosis primarily within the caudal cerebrum, brainstem, and cervical spinal cord. Several glial cells and endothelial cells contained magenta, intranuclear inclusion bodies. Electron microscopy of the inclusions revealed paracrystalline arrays of 79-82 nm, viral-like particles. DNA in situ hybridization of sections of formalin-fixed brain using a mixture of two digoxigenin-end-labeled, adenovirus specific, oligonucleotide probes at low and high stringency was positive for adenovirus.

  2. Off-Setting Differences in Reviewer Stringency.

    ERIC Educational Resources Information Center

    Cason, Carolyn L.; And Others

    A total of 1,071 rating sheets were completed by individual reviewers evaluating abstracts submitted to Sigma Theta Tau International Honor Society for the International Research Congress in Edinburgh, Scotland. Only 972 sheets contained usable data. Reviewers indicated a total of 12 ratings with possible comments for each abstract on machine…

  3. The effects of climate sensitivity and carbon cycle interactions on mitigation policy stringency

    EPA Science Inventory

    Climate sensitivity and climate-carbon cycle feedbacks interact to determine how global carbon and energy cycles will change in the future. While the science of these connections is well documented, their economic implications are not well understood. Here we examine the effect o...

  4. 12 CFR 1204.8 - How are records secured?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... § 1204.8 How are records secured? (a) What controls must FHFA have in place? Each FHFA office must establish administrative and physical controls to prevent unauthorized access to its systems of records... stringency of these controls should correspond to the sensitivity of the records that the controls protect...

  5. Achieving More, Spending Less in Schools, Districts, and States

    ERIC Educational Resources Information Center

    Walberg, Herbert J.

    2011-01-01

    In an era of financial stringency and demands for better school performance, it is useful to think about several means of raising school productivity: (1) increase learning effectiveness without increasing costs; (2) reduce costs without diminishing effectiveness; or (3) both, that is, increase effectiveness and simultaneously reduce costs. The…

  6. Effects of a rater training on rating accuracy in a physical examination skills assessment

    PubMed Central

    Weitz, Gunther; Vinzentius, Christian; Twesten, Christoph; Lehnert, Hendrik; Bonnemeier, Hendrik; König, Inke R.

    2014-01-01

    Background: The accuracy and reproducibility of medical skills assessment is generally low. Rater training has little or no effect. Our knowledge in this field, however, relies on studies involving video ratings of overall clinical performances. We hypothesised that a rater training focussing on the frame of reference could improve accuracy in grading the curricular assessment of a highly standardised physical head-to-toe examination. Methods: Twenty-one raters assessed the performance of 242 third-year medical students. Eleven raters had been randomly assigned to undergo a brief frame-of-reference training a few days before the assessment. 218 encounters were successfully recorded on video and re-assessed independently by three additional observers. Accuracy was defined as the concordance between the raters' grade and the median of the observers' grade. After the assessment, both students and raters filled in a questionnaire about their views on the assessment. Results: Rater training did not have a measurable influence on accuracy. However, trained raters rated significantly more stringently than untrained raters, and their overall stringency was closer to the stringency of the observers. The questionnaire indicated a higher awareness of the halo effect in the trained raters group. Although the self-assessment of the students mirrored the assessment of the raters in both groups, the students assessed by trained raters felt more discontent with their grade. Conclusions: While training had some marginal effects, it failed to have an impact on the individual accuracy. These results in real-life encounters are consistent with previous studies on rater training using video assessments of clinical performances. The high degree of standardisation in this study was not suitable to harmonize the trained raters’ grading. The data support the notion that the process of appraising medical performance is highly individual. A frame-of-reference training as applied does not effectively adjust the physicians' judgement on medical students in real-live assessments. PMID:25489341

  7. Effects of a rater training on rating accuracy in a physical examination skills assessment.

    PubMed

    Weitz, Gunther; Vinzentius, Christian; Twesten, Christoph; Lehnert, Hendrik; Bonnemeier, Hendrik; König, Inke R

    2014-01-01

    The accuracy and reproducibility of medical skills assessment is generally low. Rater training has little or no effect. Our knowledge in this field, however, relies on studies involving video ratings of overall clinical performances. We hypothesised that a rater training focussing on the frame of reference could improve accuracy in grading the curricular assessment of a highly standardised physical head-to-toe examination. Twenty-one raters assessed the performance of 242 third-year medical students. Eleven raters had been randomly assigned to undergo a brief frame-of-reference training a few days before the assessment. 218 encounters were successfully recorded on video and re-assessed independently by three additional observers. Accuracy was defined as the concordance between the raters' grade and the median of the observers' grade. After the assessment, both students and raters filled in a questionnaire about their views on the assessment. Rater training did not have a measurable influence on accuracy. However, trained raters rated significantly more stringently than untrained raters, and their overall stringency was closer to the stringency of the observers. The questionnaire indicated a higher awareness of the halo effect in the trained raters group. Although the self-assessment of the students mirrored the assessment of the raters in both groups, the students assessed by trained raters felt more discontent with their grade. While training had some marginal effects, it failed to have an impact on the individual accuracy. These results in real-life encounters are consistent with previous studies on rater training using video assessments of clinical performances. The high degree of standardisation in this study was not suitable to harmonize the trained raters' grading. The data support the notion that the process of appraising medical performance is highly individual. A frame-of-reference training as applied does not effectively adjust the physicians' judgement on medical students in real-live assessments.

  8. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    PubMed

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  9. Effects of Mastery Criterion on the Emergence of Derived Equivalence Relations

    ERIC Educational Resources Information Center

    Fienup, Daniel M.; Brodsky, Julia

    2017-01-01

    In this study, we manipulated mastery criterion form (rolling or block) and stringency (across 6 or 12 trials) and measured the emergence of derived relations. College students learned neuroanatomy equivalence classes and experienced one of two rolling mastery criteria (6 or 12 consecutive correct responses) or a block mastery criterion (12 trials…

  10. Harvard and Money; A Memorandum on Issues and Choices.

    ERIC Educational Resources Information Center

    Harvard Univ., Cambridge , MA. Univ. Committee on Governance.

    This report discusses some of the financial issues and choices with which Harvard University will have to cope in an environment of increased stringency: issues of money-allocation, money raising, and money management. Part I presents highlights of Harvard's recent financial history and its prospects in quantitative terms. Part II presents some…

  11. 76 FR 59338 - Approval and Promulgation of Air Quality Implementation Plans; Montana; Revisions to the...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-26

    ....) Since for asphalt concrete plants and mineral crushers this revision (ARM 17.8.743(1)(b)) reduces the... plants and mineral crushers reduces the stringency of the current SIP approved regulations. We commented... of Subjects in 40 CFR Part 52 Environmental protection, Air pollution control, Carbon monoxide...

  12. 78 FR 719 - California State Motor Vehicle Pollution Control Standards; Urban Buses; Request for Waiver of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-04

    .... Collectively, the five rulemakings elevated the stringency of exhaust emission standards and test procedures... Act for the emission standards and related test procedures contained in its urban bus regulations, as... Standards; Urban Buses; Request for Waiver of Preemption; Opportunity for Public Hearing and Comment AGENCY...

  13. Making Decisions in a Time of Fiscal Stringency: The Longer-Term Implications.

    ERIC Educational Resources Information Center

    Bowen, Frank M.

    The concept of traditional planning, programming, and budgeting systems (PPBS) is defined and compared with imperative planning, a term used to refer to whatever procedures higher education officials use to integrate program planning and budgeting. The University of Wisconsin system is described as an example of emerging budgetary practice in…

  14. Pharmacogenetic Selection of Volunteers Increases Stringency of Bioequivalence Studies; The Case of Clopidogrel

    PubMed Central

    Garcés-Eisele, J.; Ruiz-Argüelles, A.; Estrada-Marín, Larisa; Reyes-Núñez, Virginia; Vázquez-Pérez, R.; Guzmán-García, Olga; Coutiño-Medina, R.; Acosta-Sandria, Leticia; Cedillo-Carvallo, Beatriz

    2014-01-01

    Clinical response to clopidogrel varies widely due to under-dosing, drug interactions and intrinsic interindividual differences resulting from genetic polymorphisms. Cytochrome P450-2C19 is the principal enzyme involved in the activation of the prodrug and loss-of-function alleles have been described. Upon expiration of the pharmaceutical patent of clopidogrel, generic manufacturers have started to subject interchangeable formulations to bioequivalence studies. The purpose of the current investigation was to study the effect of selection of volunteers homozygous for the CYP2C19*1 haplotype on the bioavailability of clopidogrel. A regular 2×2 bioequivalence study between two formulations of clopidogrel was performed in volunteers selected and unselected for relevant CYP2C19 haplotypes for the Mexican population. It was found that selection of volunteers homozygous for the CYP2C19*1 haplotype, increased the stringency of bioequivalence statistics and resulted in bioinequivalence of a generic clopidogrel compound that otherwise proved equivalent when tested in an open unselected population. Augmentation of bioequivalence strictness is expected to result from pharmacogenetic selection of volunteers. PMID:25284925

  15. Does variation among provincial drug formulary antimicrobial listings in Canada influence prescribing rates?

    PubMed

    Glass-Kaastra, Shiona K; Finley, Rita; Hutchinson, Jim; Patrick, David M; Weiss, Karl; Conly, John

    2014-01-01

    The financial accessibility of antimicrobial drugs to the outpatient community in Canada is governed at the provincial level through formularies. Each province may choose to list particular drugs or impose restriction criteria on products in order to guide prescribing and/or curtail costs. Although changes to formularies have been shown to change patterns in the use of individual products and alter costs, no comparison has been made among the provincial antimicrobial formularies with regards to flexibility/stringency, or an assessment of how these formularies impact overall antimicrobial use in the provinces. To summarize provincial antimicrobial formularies and assess whether their relative flexibility/stringency had a statistical impact upon provincial prescription volume during a one year period. Provincial drug plan formularies were accessed and summarized for all prescribed antimicrobials in Canada during 2010. The number of general and restricted benefits for each plan was compiled by antimicrobial classification. Population-adjusted prescription rates for all individual antimicrobials and by antimicrobial class were obtained from the Canadian Integrated Program for Antimicrobial Resistance Surveillance. Correlations between the number of general benefits, restricted benefits, and total benefits with the prescription rate in the provinces were assessed by Spearman rank correlation coefficients. Formularies varied considerably among the Canadian provinces. Quebec had the most flexible formulary, offering the greatest number of general benefits and fewest restrictions. In contrast, Saskatchewan's formulary displayed the lowest number of general benefits and most restrictions. Correlation analyses detected a single significant result; macrolide prescription rates decreased as the number of general macrolide benefits increased. All other rates of provincial antimicrobial prescribing and measures of flexibility/stringency revealed no significant correlations. Although antimicrobial formulary listings are used to guide prescribing rates within a province, our analysis of one year's data of the impact of the antimicrobial formulary structure did not correlate with antimicrobial prescribing rates, and other factors are likely to be at play.

  16. 78 FR 55221 - Approval and Promulgation of Implementation Plans; Texas; Procedures for Stringency...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-10

    ..., including those pertaining to the minor permit revisions. TCEQ subsequently adopted amendments to 30 TAC 122... were adopted or submitted to the Texas SIP in this rule package. 1. Minor permit revisions at 30 TAC... approaches only to the extent that such minor permit revision procedures are explicitly provided for in the...

  17. Relationships and Values among Students and Staff in British and German Higher Education

    ERIC Educational Resources Information Center

    Pritchard, Rosalind

    2005-01-01

    Financial stringency and neo-liberal influences in higher education are impacting upon relationships and academic values in higher education. The aim of the present paper was to analyse how these forces operate differentially in the UK and Germany. The British students were significantly more satisfied than were their German counterparts with the…

  18. 78 FR 5303 - Approval and Promulgation of Implementation Plans; State of Missouri; Control of Sulfur Emissions...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-25

    ... Promulgation of Implementation Plans; State of Missouri; Control of Sulfur Emissions From Stationary Boilers.... Louis nonattainment area by limiting sulfur dioxide (SO 2 ) emissions (a precursor pollutant to PM 2.5... stringency of the SIP. Missouri's revision adds 10 CSR 10- 5.570 Control of Sulfur Emissions from Stationary...

  19. Self consistency grouping: a stringent clustering method

    PubMed Central

    2012-01-01

    Background Numerous types of clustering like single linkage and K-means have been widely studied and applied to a variety of scientific problems. However, the existing methods are not readily applicable for the problems that demand high stringency. Methods Our method, self consistency grouping, i.e. SCG, yields clusters whose members are closer in rank to each other than to any member outside the cluster. We do not define a distance metric; we use the best known distance metric and presume that it measures the correct distance. SCG does not impose any restriction on the size or the number of the clusters that it finds. The boundaries of clusters are determined by the inconsistencies in the ranks. In addition to the direct implementation that finds the complete structure of the (sub)clusters we implemented two faster versions. The fastest version is guaranteed to find only the clusters that are not subclusters of any other clusters and the other version yields the same output as the direct implementation but does so more efficiently. Results Our tests have demonstrated that SCG yields very few false positives. This was accomplished by introducing errors in the distance measurement. Clustering of protein domain representatives by structural similarity showed that SCG could recover homologous groups with high precision. Conclusions SCG has potential for finding biological relationships under stringent conditions. PMID:23320864

  20. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

  1. Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors.

    PubMed

    Gotzes, F; Balfanz, S; Baumann, A

    1994-01-01

    Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.

  2. Southern Higher Education and the 1977 State Legislatures. Regional Spotlight Vol. XXI, No. 1.

    ERIC Educational Resources Information Center

    Anderson, Laura

    While 1977 was hardly a banner year for southern higher education in terms of legislative appropriations, it was an improvement over the most recent years. Financial stringency in recent years has given way to modest revenue gains in most southern states, with many reporting small but larger than expected surpluses. Budget increases ranged from 6…

  3. The Impact of the Economy on Libraries and the Impact of Libraries on the Economy of New York State.

    ERIC Educational Resources Information Center

    Johnson, Shirley B.

    New York's library system, which helps to attract desirable information related industries, is endangered by inflation and budget stringency. Library costs have increased more rapidly than the general price level. Technological improvements, cost-saving in the long run, require initial capital outlays. The growth of book collections must keep pace…

  4. Undesired Variance Due to Examiner Stringency/Leniency Effect in Communication Skill Scores Assessed in OSCEs

    ERIC Educational Resources Information Center

    Harasym, Peter H.; Woloschuk, Wayne; Cunning, Leslie

    2008-01-01

    Physician-patient communication is a clinical skill that can be learned and has a positive impact on patient satisfaction and health outcomes. A concerted effort at all medical schools is now directed at teaching and evaluating this core skill. Student communication skills are often assessed by an Objective Structure Clinical Examination (OSCE).…

  5. Social Spending in Latin America: The Story of the 1980s. World Bank Discussion Papers No. 106.

    ERIC Educational Resources Information Center

    Grosh, Margaret E.

    This study traces public sector expenditures for nine Latin American countries in the 1980s in order to determine how social services and social well-being fared during the economic stringencies of the decade. The countries included are Argentina, Bolivia, Brazil, Chile, Costa Rica, the Dominican Republic, El Salvador, Jamaica, and Venezuela. The…

  6. Intelligent neuroprocessors for in-situ launch vehicle propulsion systems health management

    NASA Technical Reports Server (NTRS)

    Gulati, S.; Tawel, R.; Thakoor, A. P.

    1993-01-01

    Efficacy of existing on-board propulsion systems health management systems (HMS) are severely impacted by computational limitations (e.g., low sampling rates); paradigmatic limitations (e.g., low-fidelity logic/parameter redlining only, false alarms due to noisy/corrupted sensor signatures, preprogrammed diagnostics only); and telemetry bandwidth limitations on space/ground interactions. Ultra-compact/light, adaptive neural networks with massively parallel, asynchronous, fast reconfigurable and fault-tolerant information processing properties have already demonstrated significant potential for inflight diagnostic analyses and resource allocation with reduced ground dependence. In particular, they can automatically exploit correlation effects across multiple sensor streams (plume analyzer, flow meters, vibration detectors, etc.) so as to detect anomaly signatures that cannot be determined from the exploitation of single sensor. Furthermore, neural networks have already demonstrated the potential for impacting real-time fault recovery in vehicle subsystems by adaptively regulating combustion mixture/power subsystems and optimizing resource utilization under degraded conditions. A class of high-performance neuroprocessors, developed at JPL, that have demonstrated potential for next-generation HMS for a family of space transportation vehicles envisioned for the next few decades, including HLLV, NLS, and space shuttle is presented. Of fundamental interest are intelligent neuroprocessors for real-time plume analysis, optimizing combustion mixture-ratio, and feedback to hydraulic, pneumatic control systems. This class includes concurrently asynchronous reprogrammable, nonvolatile, analog neural processors with high speed, high bandwidth electronic/optical I/O interfaced, with special emphasis on NASA's unique requirements in terms of performance, reliability, ultra-high density ultra-compactness, ultra-light weight devices, radiation hardened devices, power stringency, and long life terms.

  7. Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

    PubMed Central

    Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

    1996-01-01

    Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

  8. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  9. Expanding probe repertoire and improving reproducibility in human genomic hybridization

    PubMed Central

    Dorman, Stephanie N.; Shirley, Ben C.; Knoll, Joan H. M.; Rogan, Peter K.

    2013-01-01

    Diagnostic DNA hybridization relies on probes composed of single copy (sc) genomic sequences. Sc sequences in probe design ensure high specificity and avoid cross-hybridization to other regions of the genome, which could lead to ambiguous results that are difficult to interpret. We examine how the distribution and composition of repetitive sequences in the genome affects sc probe performance. A divide and conquer algorithm was implemented to design sc probes. With this approach, sc probes can include divergent repetitive elements, which hybridize to unique genomic targets under higher stringency experimental conditions. Genome-wide custom probe sets were created for fluorescent in situ hybridization (FISH) and microarray genomic hybridization. The scFISH probes were developed for detection of copy number changes within small tumour suppressor genes and oncogenes. The microarrays demonstrated increased reproducibility by eliminating cross-hybridization to repetitive sequences adjacent to probe targets. The genome-wide microarrays exhibited lower median coefficients of variation (17.8%) for two HapMap family trios. The coefficients of variations of commercial probes within 300 nt of a repetitive element were 48.3% higher than the nearest custom probe. Furthermore, the custom microarray called a chromosome 15q11.2q13 deletion more consistently. This method for sc probe design increases probe coverage for FISH and lowers variability in genomic microarrays. PMID:23376933

  10. Mapping ‘hydroscapes’ along the iso- to anisohydric continuum of stomatal regulation of plant water status

    Treesearch

    Frederick C. Meinzer; David R. Woodruff; Danielle E. Marias; Duncan D. Smith; Katherine A. McCulloh; Ava R. Howard; Alicia L. Magedman; Josep Penuelas

    2016-01-01

    The concept of iso- vs. anisohydry has been used to describe the stringency of stomatal regulation of plant water potential (ψ). However, metrics that accurately and consistently quantify species’ operating ranges along a continuum of iso- to anisohydry have been elusive. Additionally, most approaches to quantifying iso/anisohydry require labour-intensive measurements...

  11. Inactive Wells: Economic and Policy Issues

    NASA Astrophysics Data System (ADS)

    Krupnick, A.

    2016-12-01

    This paper examines the economic and policy issues associated with various types of inactive oil and gas wells. It covers the costs of decommissioning wells, and compares them to the bonding requirements on these wells, looking at a large number of states. It also reviews the detailed regulations governing treatment of inactive wells by states and the federal government and compares them according to their completeness and stringency.

  12. Proceedings of Conference on: Economics of Higher Education: A Comparative Perspective of Policy and Dilemma (New York, New York, March 30, 1978).

    ERIC Educational Resources Information Center

    Wasser, Henry, Ed.

    Proceedings from a conference on the economics of higher education are presented. Following an introduction by Henry Wasser and opening remarks by Mina Rees, a paper by Gareth Williams is presented. In "The Buffer Under Pressure: An Examination of the British System of Financing Higher Education in Periods of Affluence and Stringency,"…

  13. Stomatal kinetics and photosynthetic gas exchange along a continuum of isohydric to anisohydric regulation of plant water status

    Treesearch

    Frederick C. Meinzer; Duncan D. Smith; David R. Woodruff; Danielle E. Marias; Katherine A. McCulloh; Ava R. Howard; Alicia L. Magedman

    2017-01-01

    Species’ differences in the stringency of stomatal control of plant water potential represent a continuum of isohydric to anisohydric behaviours. However, little is known about how quasi-steady-state stomatal regulation of water potential may relate to dynamic behaviour of stomata and photosynthetic gas exchange in species operating at different positions along this...

  14. Did States Use Implementation Discretion to Reduce the Stringency of NCLB? Evidence from a Database of State Regulations

    ERIC Educational Resources Information Center

    Wong, Vivian C.; Wing, Coady; Martin, David; Krishnamachari, Anandita

    2018-01-01

    When No Child Left Behind (NCLB) became law in 2002, it was viewed as an effort to create uniform standards for students and schools across the country. More than a decade later, we know surprisingly little about how states actually implemented NCLB and the extent to which state implementation decisions managed to undo the centralizing objectives…

  15. An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor

    PubMed Central

    Zhao, Wei; Jardine, Paul J.

    2015-01-01

    ABSTRACT During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. IMPORTANCE During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor that translocates the viral DNA into a preformed viral shell. A key event in DNA packaging is recognition of the viral DNA among other nucleic acids in the host cell. Commonly, a DNA-binding protein mediates the interaction of viral DNA with the motor/head shell. Here we show that for the bacteriophage ϕ29, this essential step of genome recognition is mediated by a viral genome-encoded RNA rather than a protein. A domain of the prohead RNA (pRNA) imparts specificity and stringency to the motor by ensuring the correct orientation of DNA packaging and restricting initiation to a single event. Since this assembly step is unique to the virus, DNA packaging is a novel target for the development of antiviral drugs. PMID:26423956

  16. An RNA Domain Imparts Specificity and Selectivity to a Viral DNA Packaging Motor.

    PubMed

    Zhao, Wei; Jardine, Paul J; Grimes, Shelley

    2015-12-01

    During assembly, double-stranded DNA viruses, including bacteriophages and herpesviruses, utilize a powerful molecular motor to package their genomic DNA into a preformed viral capsid. An integral component of the packaging motor in the Bacillus subtilis bacteriophage ϕ29 is a viral genome-encoded pentameric ring of RNA (prohead RNA [pRNA]). pRNA is a 174-base transcript comprised of two domains, domains I and II. Early studies initially isolated a 120-base form (domain I only) that retains high biological activity in vitro; hence, no function could be assigned to domain II. Here we define a role for this domain in the packaging process. DNA packaging using restriction digests of ϕ29 DNA showed that motors with the 174-base pRNA supported the correct polarity of DNA packaging, selectively packaging the DNA left end. In contrast, motors containing the 120-base pRNA had compromised specificity, packaging both left- and right-end fragments. The presence of domain II also provides selectivity in competition assays with genomes from related phages. Furthermore, motors with the 174-base pRNA were restrictive, in that they packaged only one DNA fragment into the head, whereas motors with the 120-base pRNA packaged several fragments into the head, indicating multiple initiation events. These results show that domain II imparts specificity and stringency to the motor during the packaging initiation events that precede DNA translocation. Heteromeric rings of pRNA demonstrated that one or two copies of domain II were sufficient to impart this selectivity/stringency. Although ϕ29 differs from other double-stranded DNA phages in having an RNA motor component, the function provided by pRNA is carried on the motor protein components in other phages. During virus assembly, genome packaging involves the delivery of newly synthesized viral nucleic acid into a protein shell. In the double-stranded DNA phages and herpesviruses, this is accomplished by a powerful molecular motor that translocates the viral DNA into a preformed viral shell. A key event in DNA packaging is recognition of the viral DNA among other nucleic acids in the host cell. Commonly, a DNA-binding protein mediates the interaction of viral DNA with the motor/head shell. Here we show that for the bacteriophage ϕ29, this essential step of genome recognition is mediated by a viral genome-encoded RNA rather than a protein. A domain of the prohead RNA (pRNA) imparts specificity and stringency to the motor by ensuring the correct orientation of DNA packaging and restricting initiation to a single event. Since this assembly step is unique to the virus, DNA packaging is a novel target for the development of antiviral drugs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Environmental Regulation, Foreign Direct Investment and Green Technological Progress-Evidence from Chinese Manufacturing Industries.

    PubMed

    Hu, Jiangfeng; Wang, Zhao; Lian, Yuehan; Huang, Qinghua

    2018-01-29

    This study examines the spillover effects of foreign direct investment (FDI) on green technology progress rate (as measured by the green total factor productivity). The analysis utilizes two measures of FDI, labor-based FDI and capital-based FDI, and separately investigates four sets of industry classifications-high/low discharge regulation and high/low emission standard regulation. The results indicate that in the low discharge regulation and low emission standard regulation industry, labor-based FDI has a significant negative spillover effect, and capital-based FDI has a significant positive spillover effect. However, in the high-intensity environmental regulation industry, the negative influence of labor-based FDI is completely restrained, and capital-based FDI continues to play a significant positive green technological spillover effects. These findings have clear policy implications: the government should be gradually reducing the labor-based FDI inflow or increasing stringency of environmental regulation in order to reduce or eliminate the negative spillover effect of the labor-based FDI.

  18. Environmental Regulation, Foreign Direct Investment and Green Technological Progress—Evidence from Chinese Manufacturing Industries

    PubMed Central

    Hu, Jiangfeng; Wang, Zhao; Lian, Yuehan; Huang, Qinghua

    2018-01-01

    This study examines the spillover effects of foreign direct investment (FDI) on green technology progress rate (as measured by the green total factor productivity). The analysis utilizes two measures of FDI, labor-based FDI and capital-based FDI, and separately investigates four sets of industry classifications—high/low discharge regulation and high/low emission standard regulation. The results indicate that in the low discharge regulation and low emission standard regulation industry, labor-based FDI has a significant negative spillover effect, and capital-based FDI has a significant positive spillover effect. However, in the high-intensity environmental regulation industry, the negative influence of labor-based FDI is completely restrained, and capital-based FDI continues to play a significant positive green technological spillover effects. These findings have clear policy implications: the government should be gradually reducing the labor-based FDI inflow or increasing stringency of environmental regulation in order to reduce or eliminate the negative spillover effect of the labor-based FDI. PMID:29382112

  19. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flores, J.; Sears, J.; Schael, I.P.

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

  20. Long-Term Impact of Valid Case Criterion on Capturing Population-Level Growth under Item Response Theory Equating. Research Report. ETS RR-17-17

    ERIC Educational Resources Information Center

    Deng, Weiling; Monfils, Lora

    2017-01-01

    Using simulated data, this study examined the impact of different levels of stringency of the valid case inclusion criterion on item response theory (IRT)-based true score equating over 5 years in the context of K-12 assessment when growth in student achievement is expected. Findings indicate that the use of the most stringent inclusion criterion…

  1. A Comparative Study of the Employee Skills/Training Acceptable to Employers Under Varying Degrees of Labor Market Stringencies. Final Report.

    ERIC Educational Resources Information Center

    Fisher, W. Halder; And Others

    The purposes of this stud y were to test the dependability of stated employee selection criteria, to ascertain the degree of congruence between stated and actual selection criteria, and to determine the degree of change in criteria due to "looseness" or "tightness" of the local labor market. Seven test labor market areas representing a variety of…

  2. Northern blots: capillary transfer of RNA from agarose gels and filter hybridization using standard stringency conditions.

    PubMed

    Rio, Donald C

    2015-03-02

    In this protocol, an RNA sample, fractionated by gel electrophoresis, is transferred from the gel onto a membrane by capillary transfer. Short-wave UV light is used to fix the transferred RNA to the membrane. The membrane is then pretreated to block nonspecific probe-binding sites, and hybridization of the immobilized RNA to a (32)P-labeled DNA or RNA probe specific for the mRNA of interest is performed. Finally, the membrane is washed and subjected to autoradiography or phosphorimaging. Because exposure to UV cross-links the RNA to the membrane, the membrane can be stripped and hybridized with other probes. The procedure is suitable for detecting poly(A)(+)-selected mRNA or mRNA in total cellular RNA if the target transcript is relatively abundant. Using DNA or RNA probes labeled to 1 × 10(8)-10 × 10(8) cpm/µg, it should be possible to detect ∼5 pg of a specific RNA. © 2015 Cold Spring Harbor Laboratory Press.

  3. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  4. Counterterm counterexamples

    NASA Astrophysics Data System (ADS)

    Pope, C. N.; Sohnius, M. F.; Stelle, K. S.

    We show that, contrary to previous conjectures, there exist acceptable counterterms for Ricci-flat N = 1 and N = 2 super-symmetric σ-models. In the N = 1 case we present infinite sequences of counterterms, starting from the 7-loop order, that do not vanish for general riemannian Ricci-flat metrics but do vanish when the metric is also Kähler. We then investigate the counterterms for theories with Ricci-flat Kähler metrics (i.e. N = 2 models). Acceptable counterterms must vanish for hyper-Kähler metrics (the N = 4 case), and must respect the principle of universality; i.e. that counterterms to the metric can be expressed without the use of complex structures or other special tensors, which do not exist for general riemannian spaces. We show that a recently proposed 4-loop counterterm for the N = 2 models does indeed satisfy these two conditions, despite the apparent stringency of the universality principle. Hence the finiteness of Ricci-flat N = 1 and N = 2 supersymmetric σ-models seems unlikely to persist beyond the 3-loop order.

  5. A Review of ETS Differential Item Functioning Assessment Procedures: Flagging Rules, Minimum Sample Size Requirements, and Criterion Refinement. Research Report. ETS RR-12-08

    ERIC Educational Resources Information Center

    Zwick, Rebecca

    2012-01-01

    Differential item functioning (DIF) analysis is a key component in the evaluation of the fairness and validity of educational tests. The goal of this project was to review the status of ETS DIF analysis procedures, focusing on three aspects: (a) the nature and stringency of the statistical rules used to flag items, (b) the minimum sample size…

  6. [Structure, organization and capacity problems in emergency medical services, emergency admission and intensive care units].

    PubMed

    Dick, W

    1994-01-01

    Emergency medicine is subjected worldwide to financial stringencies and organizational evaluations of cost-effectiveness. The various links in the chain of survival are affected differently. Bystander assistance or bystander CPR is available in only 30% of the emergencies, response intervals--if at all required by legislation--are observed to only a limited degree or are too extended for survival in cardiac arrest. A single emergency telephone number is lacking. Too many different phone numbers for emergency reporting result in confusion and delays. Organizational realities are not fully overcome and impair efficiency. The position of the emergency physician in the EMS System is inadequately defined, the qualification of too many emergency physicians are unsatisfactory. In spite of this, emergency physicians are frequently forced to answer out-of-hospital emergency calls. Conflicts between emergency physicians and EMTs may be overcome by providing both groups with comparable qualifications as well as by providing an explicit definition of emergency competence. A further source of conflict occurs at the juncture of prehospital and inhospital emergency care in the emergency department. Deficiencies on either side play a decisive role. At least in principle there are solutions to the deficiencies in the EMSS and in intensive care medicine. They are among others: Adequate financial compensation of emergency personnel, availability of sufficient numbers of highly qualified personnel, availability of a central receiving area with an adjacent emergency ward, constant information flow to the dispatch center on the number of available emergency beds, maintaining 5% of all beds as emergency beds, establishing intermediate care facilities. Efficiency of emergency physician activities can be demonstrated in polytraumatized patients or in patients with ventricular fibrillation or acute myocardial infarction, in patients with acute myocardial insufficiency and other emergency clinical pictures. Cost effectiveness is clearly in favor of emergency medicine. Future developments will be characterized by the consequences of new health care legislation and by effects of financial stringencies on the emergency medical services.

  7. [THE FEATURES OF PREVALENCE OF SKIN DISEASE AS AN INDEX OF ECOLOGICALLY RELATED MORBIDITY OF POPULATION IN BIOCLIMATIC ZONES OF PRIMORYE KRAI].

    PubMed

    Yarygina, M V; Kiku, P F; Gorborukova, T V

    2015-01-01

    There are presented results of the socio-hygienic analysis of ecologically related skin pathology ofthe population of Primorsky Krai. The aim of the work is to establish the patterns of distribution of ecologically related skin diseases in various ecological bioclimatic zones of Primorsky Krai. There was performed an analysis of skin diseases ofform 12 according to ICD-10 main demographic groups (children, adolescents and adults) of the population of Primorsky Krai, residing in various bioclimatic zones of Krai with different levels of environmental stringency in rural and urban areas for the period of 2000-2013. There were established causal-effect relationships of the prevalence of skin diseases, as ecologically related pathology. The level of the prevalence of skin diseases among the population in the Primorye region depends on bioclimatic zones, the degree of the stringency of the environmental situation and combinations of environmental factors. The prevalence of skin diseases in adults, adolescents and children, as the organism's response to the impact ofthe parameters ofthe environment is affected by the complex offactors, the main of them are hygienic: the sanitary--hygienic level of ambient air pollution, the specification of chemical pollution and adverse physical factors in urban and rural settlements, the characteristics of the state of the soil. The medical-sociological research of the lifestyle of the population was performed on the basis of a specially designed questionnaire. The questionnaire included three arrays of issues: environmental, hygienic and social. On the basis of medical and sociological research with the use of multivariate analysis, method of correlation pleiades advanced by P. V. Terentiev, lifestyle and psycho-emotional factors, socio-hygienic, bioclimatic factors were found to play an important role in the prevalence of ecologically related pathology of skin in residents of Primorsky Krai. Differences in responses between urban and rural residents living in areas with various environmental stringency, confirm the preposition about the ambiguity of the approach to the solution of social, hygienic and environmental problems in areas with different socio-economic situation. The obtained results of the study allow us to determine the main directions of treatment and prevention and to develop targeted prevention programs.

  8. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  9. Bio-Inspired Engineering of Protein-Based Heat Sensors

    DTIC Science & Technology

    2004-01-01

    of Thermosensitive Proteins. 23 3.1 Introduction 23 3.2 Low Stringency PCR Identification of TRPV1 Homologues from Pit Viper Trigeminal Ganglion...Methods and Results. 24 3.3 Directed Evolution of TRPV1 Protein. 25 3.4 Methods and Results 25 3.5 References 27 Pappas, TC F49620-01-1-0552 3 1. Unique...cation channel TRPV1 . Thermal nociceptive neurons are fairly plentiful, and thus benefited studies linking TRPVI to thermal responses. The snake pit

  10. miR-MaGiC improves quantification accuracy for small RNA-seq.

    PubMed

    Russell, Pamela H; Vestal, Brian; Shi, Wen; Rudra, Pratyaydipta D; Dowell, Robin; Radcliffe, Richard; Saba, Laura; Kechris, Katerina

    2018-05-15

    Many tools have been developed to profile microRNA (miRNA) expression from small RNA-seq data. These tools must contend with several issues: the small size of miRNAs, the small number of unique miRNAs, the fact that similar miRNAs can be transcribed from multiple loci, and the presence of miRNA isoforms known as isomiRs. Methods failing to address these issues can return misleading information. We propose a novel quantification method designed to address these concerns. We present miR-MaGiC, a novel miRNA quantification method, implemented as a cross-platform tool in Java. miR-MaGiC performs stringent mapping to a core region of each miRNA and defines a meaningful set of target miRNA sequences by collapsing the miRNA space to "functional groups". We hypothesize that these two features, mapping stringency and collapsing, provide more optimal quantification to a more meaningful unit (i.e., miRNA family). We test miR-MaGiC and several published methods on 210 small RNA-seq libraries, evaluating each method's ability to accurately reflect global miRNA expression profiles. We define accuracy as total counts close to the total number of input reads originating from miRNAs. We find that miR-MaGiC, which incorporates both stringency and collapsing, provides the most accurate counts.

  11. Similarities in the chromosomal distribution of AG and AC repeats within and between Drosophila, human and barley chromosomes.

    PubMed

    Cuadrado, A; Jouve, N

    2007-01-01

    Two simple sequence repeats (SSRs), AG and AC, were mapped directly in the metaphase chromosomes of man and barley (Hordeum vulgare L.), and in the metaphase and polytene chromosomes of Drosophila melanogaster. To this end, synthetic oligonucleotides corresponding to (AG)(12) and (AC)(8) were labelled by the random primer technique and used as probes in fluorescent in situ hybridisation (FISH) under high stringency and strict washing conditions. The distribution and intensity of the signals for the repeat sequences were found to be characteristic of the chromosomes and genomes of the three species analysed. The AC repeat sites were uniformly dispersed along the euchromatic segments of all three genomes; in fact, they were largely excluded from the heterochromatin. The Drosophila genome showed a high density of AC sequences on the X chromosome in both mitotic and polytene nuclei. In contrast, the AG repeats were associated with the euchromatic regions of the polytene chromosomes (and in high density on the X chromosome), but were only seen in specific heterochromatic regions in the mitotic chromosomes of all three species. In Drosophila, the AG repeats were exclusively distributed on the tips of the Y chromosome and near the centromere on both arms of chromosome 2. In barley and man, AG repeats were associated with the centromeres (of all chromosomes) and nucleolar organizer regions, respectively. The conserved chromosome distribution of AC within and between these three phylogenetically distant species, and the association of AG in specific chromosome regions with structural or functional properties, suggests that long clusters of these repeats may have some, as yet unknown, role. Copyright (c) 2007 S. Karger AG, Basel.

  12. A quick and simple FISH protocol with hybridization-sensitive fluorescent linear oligodeoxynucleotide probes

    PubMed Central

    Wang, Dan Ohtan; Matsuno, Hitomi; Ikeda, Shuji; Nakamura, Akiko; Yanagisawa, Hiroyuki; Hayashi, Yasunori; Okamoto, Akimitsu

    2012-01-01

    Fluorescence in situ hybridization (FISH) is a powerful tool used in karyotyping, cytogenotyping, cancer diagnosis, species specification, and gene-expression analysis. Although widely used, conventional FISH protocols are cumbersome and time consuming. We have now developed a FISH method using exciton-controlled hybridization-sensitive fluorescent oligodeoxynucleotide (ECHO) probes. ECHO–FISH uses a 25-min protocol from fixation to mounting that includes no stringency washing steps. We use ECHO–FISH to detect both specific DNA and RNA sequences with multicolor probes. ECHO–FISH is highly reproducible, stringent, and compatible with other fluorescent cellular labeling techniques. The resolution allows detection of intranuclear speckles of poly(A) RNA in HeLa cells and dissociated hippocampal primary cultures, and mRNAs in the distal dendrites of hippocampal neurons. We also demonstrate detection of telomeric and centromeric DNA on metaphase mouse chromosomes. The simplicity of the ECHO–FISH method will likely accelerate cytogenetic and gene-expression analysis with high resolution. PMID:22101241

  13. Reliability of Fault Tolerant Control Systems. Part 2

    NASA Technical Reports Server (NTRS)

    Wu, N. Eva

    2000-01-01

    This paper reports Part II of a two part effort that is intended to delineate the relationship between reliability and fault tolerant control in a quantitative manner. Reliability properties peculiar to fault-tolerant control systems are emphasized, such as the presence of analytic redundancy in high proportion, the dependence of failures on control performance, and high risks associated with decisions in redundancy management due to multiple sources of uncertainties and sometimes large processing requirements. As a consequence, coverage of failures through redundancy management can be severely limited. The paper proposes to formulate the fault tolerant control problem as an optimization problem that maximizes coverage of failures through redundancy management. Coverage modeling is attempted in a way that captures its dependence on the control performance and on the diagnostic resolution. Under the proposed redundancy management policy, it is shown that an enhanced overall system reliability can be achieved with a control law of a superior robustness, with an estimator of a higher resolution, and with a control performance requirement of a lesser stringency.

  14. Introgression of chromosome segments from multiple alien species in wheat breeding lines with wheat streak mosaic virus resistance.

    PubMed

    Ali, N; Heslop-Harrison, Js Pat; Ahmad, H; Graybosch, R A; Hein, G L; Schwarzacher, T

    2016-08-01

    Pyramiding of alien-derived Wheat streak mosaic virus (WSMV) resistance and resistance enhancing genes in wheat is a cost-effective and environmentally safe strategy for disease control. PCR-based markers and cytogenetic analysis with genomic in situ hybridisation were applied to identify alien chromatin in four genetically diverse populations of wheat (Triticum aestivum) lines incorporating chromosome segments from Thinopyrum intermedium and Secale cereale (rye). Out of 20 experimental lines, 10 carried Th. intermedium chromatin as T4DL*4Ai#2S translocations, while, unexpectedly, 7 lines were positive for alien chromatin (Th. intermedium or rye) on chromosome 1B. The newly described rye 1RS chromatin, transmitted from early in the pedigree, was associated with enhanced WSMV resistance. Under field conditions, the 1RS chromatin alone showed some resistance, while together with the Th. intermedium 4Ai#2S offered superior resistance to that demonstrated by the known resistant cultivar Mace. Most alien wheat lines carry whole chromosome arms, and it is notable that these lines showed intra-arm recombination within the 1BS arm. The translocation breakpoints between 1BS and alien chromatin fell in three categories: (i) at or near to the centromere, (ii) intercalary between markers UL-Thin5 and Xgwm1130 and (iii) towards the telomere between Xgwm0911 and Xbarc194. Labelled genomic Th. intermedium DNA hybridised to the rye 1RS chromatin under high stringency conditions, indicating the presence of shared tandem repeats among the cereals. The novel small alien fragments may explain the difficulty in developing well-adapted lines carrying Wsm1 despite improved tolerance to the virus. The results will facilitate directed chromosome engineering producing agronomically desirable WSMV-resistant germplasm.

  15. Musite, a tool for global prediction of general and kinase-specific phosphorylation sites.

    PubMed

    Gao, Jianjiong; Thelen, Jay J; Dunker, A Keith; Xu, Dong

    2010-12-01

    Reversible protein phosphorylation is one of the most pervasive post-translational modifications, regulating diverse cellular processes in various organisms. High throughput experimental studies using mass spectrometry have identified many phosphorylation sites, primarily from eukaryotes. However, the vast majority of phosphorylation sites remain undiscovered, even in well studied systems. Because mass spectrometry-based experimental approaches for identifying phosphorylation events are costly, time-consuming, and biased toward abundant proteins and proteotypic peptides, in silico prediction of phosphorylation sites is potentially a useful alternative strategy for whole proteome annotation. Because of various limitations, current phosphorylation site prediction tools were not well designed for comprehensive assessment of proteomes. Here, we present a novel software tool, Musite, specifically designed for large scale predictions of both general and kinase-specific phosphorylation sites. We collected phosphoproteomics data in multiple organisms from several reliable sources and used them to train prediction models by a comprehensive machine-learning approach that integrates local sequence similarities to known phosphorylation sites, protein disorder scores, and amino acid frequencies. Application of Musite on several proteomes yielded tens of thousands of phosphorylation site predictions at a high stringency level. Cross-validation tests show that Musite achieves some improvement over existing tools in predicting general phosphorylation sites, and it is at least comparable with those for predicting kinase-specific phosphorylation sites. In Musite V1.0, we have trained general prediction models for six organisms and kinase-specific prediction models for 13 kinases or kinase families. Although the current pretrained models were not correlated with any particular cellular conditions, Musite provides a unique functionality for training customized prediction models (including condition-specific models) from users' own data. In addition, with its easily extensible open source application programming interface, Musite is aimed at being an open platform for community-based development of machine learning-based phosphorylation site prediction applications. Musite is available at http://musite.sourceforge.net/.

  16. Hybridization parameters revisited: solutions containing SDS.

    PubMed

    Rose, Ken; Mason, John O; Lathe, Richard

    2002-07-01

    Salt concentration governs nucleic acid hybridization according to the Schildkraut-Lifson equation. High concentrations of SDS are used in some common protocols, but the effects of SDS on hybridization stringency have not been reported. We investigated hybridization parameters in solutions containing SDS. With targets immobilized on nylon membranes and PCR- or transcription-generated probes, we report that the 50% dissociation temperature (Tm*) in the absence of SDS was 15 degrees C-17degrees C lower than the calculated Tm. SDS had only modest effects on Tm* [1% (w/v) equating to 8 mM NaCl]. RNA/DNA hybrids were approximately 11 degrees C more stable than DNA/DNA hybrids. Incomplete homology (69%) significantly reduced the Tm* for DNA/DNA hybrids (approximately /4degrees C; 0.45 degrees C/% nonhomology) but far less so for RNA/DNA hybrids (approximately 2.3 degrees C; approximately 0.07 degrees C/% non-homology); incomplete homology also markedly reduced the extent of hybridization. On these nylonfilters, SDS had a major effect on nonspecific binding. Buffers lacking SDS, or with low salt concentration, gave high hybridization backgrounds; buffers containing SDS, or high-salt buffers, gave reproducibly low backgrounds.

  17. Mosquito Infectivity and Parasitemia after Controlled Human Malaria Infection.

    PubMed

    Walk, Jona; van Gemert, Geert-Jan; Graumans, Wouter; Sauerwein, Robert; Bijker, Else M

    2018-04-30

    Controlled Human Malaria Infection (CHMI) has become an increasingly important tool for the evaluation of drugs and vaccines. Controlled Human Malaria Infection has been demonstrated to be a reproducible model; however, there is some variability in time to onset of parasitemia between volunteers and studies. At our center, mosquitoes infected with Plasmodium falciparum by membrane feeding have variable and high salivary gland sporozoite load (mean 78,415; range 26,500-160,500). To determine whether this load influences parasitemia after CHMI, we analyzed data from 13 studies. We found no correlation between the sporozoite load of a mosquito batch and time to parasitemia or parasite density of first-wave parasitemia. These findings support the use of infected mosquito bite as a reproducible means of inducing P. falciparum infection and suggest that within this range, salivary gland sporozoite load does not influence the stringency of a CHMI.

  18. Comparing climate policy co-benefits in the United States and China

    NASA Astrophysics Data System (ADS)

    Selin, N. E.; Li, M.; Saari, R.; Zhang, D.; Karplus, V. J.; Li, C. T.; Thompson, T. M.; Mulvaney, K. M.; Rausch, S.

    2016-12-01

    We use modeling approaches that integrate atmospheric chemistry, economic analysis, and health impacts calculations to evaluate and compare the co-benefits of greenhouse gas reduction policies for the U.S. and China. Climate policies can have a variety of co-benefits for air quality, in particular on the concentrations of health-damaging pollutants O3 and PM2.5 as well as toxic pollutants such as mercury. Co-benefits. Controlling CO2 sources such as power plants and vehicles can lead to concomitant reductions in other pollutants such as SO2, NOx, and Hg. Here, we present and discuss our evaluations of co-benefits in the U.S. and China, at both national and regional (state/provincial) scales. In particular, we assess how policy design, stringency, and energy system characteristics affect projected co-benefits and their valuation for human health. We find that at the national scale in both the U.S. and China, monetized co-benefits can offset the costs of carbon policies. U.S. co-benefits exhibit diminishing returns to projected increases in policy stringency, while Chinese co-benefits show different behavior. The magnitude of health-related co-benefits is sensitive to the economic valuation methodology, and to the choice of health impact function, with China-specific functions yielding substantially less co-benefit than those typically used in the U.S. In both cases, we see overall national-scale co-benefits but substantial regional variation at sub-national scales, illustrating the benefits of coupled atmospheric-economic analysis.

  19. Capital investment requirements for greenhouse gas emissions mitigation in power generation on near term to century time scales and global to regional spatial scales

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaturvedi, Vaibhav; Clarke, Leon E.; Edmonds, James A.

    Electrification plays a crucial role in cost-effective greenhouse gas emissions mitigation strategies. Such strategies in turn carry implications for financial capital markets. This paper explores the implication of climate mitigation policy for capital investment demands by the electric power sector on decade to century time scales. We go further to explore the implications of technology performance and the stringency of climate policy for capital investment demands by the power sector. Finally, we discuss the regional distribution of investment demands. We find that stabilizing GHG emissions will require additional investment in the electricity generation sector over and above investments that wouldmore » be need in the absence of climate policy, in the range of 16 to 29 Trillion US$ (60-110%) depending on the stringency of climate policy during the period 2015 to 2095 under default technology assumptions. This increase reflects the higher capital intensity of power systems that control emissions. Limits on the penetration of nuclear and carbon capture and storage technology could increase costs substantially. Energy efficiency improvements can reduce the investment requirement by 8 to21 Trillion US$ (default technology assumptions), depending on climate policy scenario with higher savings being obtained under the most stringent climate policy. The heaviest investments in power generation were observed in the China, India, SE Asia and Africa regions with the latter three regions dominating in the second half of the 21st century.« less

  20. Accumulation of Polyphosphate in Lactobacillus spp. and Its Involvement in Stress Resistance

    PubMed Central

    Alcántara, Cristina; Blasco, Amalia; Zúñiga, Manuel

    2014-01-01

    Polyphosphate (poly-P) is a polymer of phosphate residues synthesized and in some cases accumulated by microorganisms, where it plays crucial physiological roles such as the participation in the response to nutritional stringencies and environmental stresses. Poly-P metabolism has received little attention in Lactobacillus, a genus of lactic acid bacteria of relevance for food production and health of humans and animals. We show that among 34 strains of Lactobacillus, 18 of them accumulated intracellular poly-P granules, as revealed by specific staining and electron microscopy. Poly-P accumulation was generally dependent on the presence of elevated phosphate concentrations in the culture medium, and it correlated with the presence of polyphosphate kinase (ppk) genes in the genomes. The ppk gene from Lactobacillus displayed a genetic arrangement in which it was flanked by two genes encoding exopolyphosphatases of the Ppx-GppA family. The ppk functionality was corroborated by its disruption (LCABL_27820 gene) in Lactobacillus casei BL23 strain. The constructed ppk mutant showed a lack of intracellular poly-P granules and a drastic reduction in poly-P synthesis. Resistance to several stresses was tested in the ppk-disrupted strain, showing that it presented a diminished growth under high-salt or low-pH conditions and an increased sensitivity to oxidative stress. These results show that poly-P accumulation is a characteristic of some strains of lactobacilli and may thus play important roles in the physiology of these microorganisms. PMID:24375133

  1. Transcriptome signatures of p,p´-DDE-induced liver damage in Mus spretus mice.

    PubMed

    Morales-Prieto, Noelia; Ruiz-Laguna, Julia; Sheehan, David; Abril, Nieves

    2018-07-01

    The use of DDT (1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane) in some countries, although regulated, is contributing to an increased worldwide risk of exposure to this organochlorine pesticide or its derivative p,p'-DDE [1,1-dichloro-2,2-bis(p-chlorophenyl) ethylene]. Many studies have associated p,p'-DDE exposure to type 2 diabetes, obesity and alterations of the reproductive system, but their molecular mechanisms of toxicity remain poorly understood. We have addressed this issue by using commercial microarrays based on probes for the entire Mus musculus genome to determine the hepatic transcriptional signatures of p,p'-DDE in the phylogenetically close mouse species Mus spretus. High-stringency hybridization conditions and analysis assured reliable results, which were also verified, in part, by qRT-PCR, immunoblotting and/or enzymatic activity. Our data linked 198 deregulated genes to mitochondrial dysfunction and perturbations of central signaling pathways (kinases, lipids, and retinoic acid) leading to enhanced lipogenesis and aerobic glycolysis, inflammation, cell proliferation and testosterone catabolism and excretion. Alterations of transcript levels of genes encoding enzymes involved in testosterone catabolism and excretion would explain the relationships established between p,p´-DDE exposure and reproductive disorders, obesity and diabetes. Further studies will help to fully understand the molecular basis of p,p´-DDE molecular toxicity in liver and reproductive organs, to identify effective exposure biomarkers and perhaps to design efficient p,p'-DDE exposure counteractive strategies. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Cell cycle-related fluctuations in transcellular ionic currents and plasma membrane Ca2+/Mg2+ ATPase activity during early cleavages of Lymnaea stagnalis embryos.

    PubMed

    Zivkovic, Danica; Créton, Robbert; Dohmen, René

    1991-08-01

    During the first four mitotic division cycles of Lymnaea stagnalis embryos, we have detected cell cycle-dependent changes in the pattern of transcellular ionic currents and membrane-bound Ca 2+ -stimulated ATPase activity. Ionic currents ranging from 0.05 to 2.50 μA/cm 2 have been measured using the vibrating probe technique. Enzyme activity was detected using Ando's cytochemical method (Ando et al. 1981) which reveals Ca 2+ /Mg 2+ ATPase localization at the ultrastructural level, and under high-stringency conditions with respect to calcium availability, it reveals Ca 2+ -stimulated ATPase. The ionic currents and Ca 2+ -stimulated ATPase localization have in common that important changes occur during the M-phase of the cell cycles. Minimal outward current at the vegetal pole coincides with metaphase/anaphase. Maximal inward current at the animal pole coincides with the onset of cytokinesis at that pole. Ca 2+ -stimulated ATPase is absent from one half of the embryo at metaphase/anaphase of the two- and four-cell stage, whereas it is present in all cells during the remaining part of the cell cycle. Since fluctuations of cytosolic free calcium concentrations appear to correlate with both karyokinesis and cytokinesis, we speculate that part of the cyclic pattern of Ca 2+ -stimulated ATPase localization and of the transcellular ionic currents reflects the elevation of cytosolic free calcium concentration during the M-phase.

  3. Suicidal Ideation and Related Factors Among Korean High School Students: A Focus on Cyber Addiction and School Bullying.

    PubMed

    Sohn, Min; Oh, Heymin; Lee, Sang-Kyu; Potenza, Marc N

    2017-01-01

    The purpose of the study was to explore the association among suicidal ideation, cyber addiction, and school bullying of Korean high school students. This descriptive cross-sectional study included 416 students. The data were collected using structured questionnaires on suicidal ideation, Internet and smartphone addiction, experiences of school bullying, impulsiveness, and depression. Students who were bullied (odds ratio [ OR] = 3.0, 95% CI [1.1, 8.4]) and more depressed ( OR = 10.8, 95% CI [2.4, 48.2]) were more likely to have higher scores for suicidal ideation; however, when a lower stringency was used, female gender ( OR = 2.3, 95% CI [1.3, 4.0]) and addiction to smartphones ( OR = 2.4, 95% CI [1.1, 5.4]) were also statistically significant contributors to the presence of suicidal ideation. Students with suicidal ideation that is higher than average, but lower than the classical thresholds for risk group designation, should also be carefully assessed for early detection and intervention. Cyber addiction may be a particularly significant contributor to suicidal ideation, in addition to bullying and depressive mood, among Korean adolescents.

  4. Innovative zoning to support equine influenza eradication from New South Wales, Australia.

    PubMed

    Scott-Orr, H

    2011-07-01

    Following detection of equine influenza (EI) in New South Wales, a complete standstill was imposed the next morning on the movement of all horses and donkeys within the state. Premises' biosecurity guidelines became progressively more stringent with time in an effort to stop local spread. The standstill was highly effective as a primary response to stop EI becoming widespread across Australia, but did not prevent spread to properties contiguous to infected premises in areas of high horse density and small property size, nor transmission by fomites nor possible local airborne transmission. Within 2 weeks of the start of the outbreak, a zoning system of Purple (Special Restricted), Red (Restricted), Amber (Control), and Green (Protected) Zones was implemented, and progressively modified as disease distribution changed. The colour coding system proved to be an easy way to communicate zone changes, the approximate level of disease risk and the stringency of movement restrictions to the general public and should be adopted more generally in AUSVETPLAN. © 2011 The Author. Australian Veterinary Journal © 2011 Australian Veterinary Association.

  5. Towards Fluorescence In Vivo Hybridization (FIVH) Detection of H. pylori in Gastric Mucosa Using Advanced LNA Probes

    PubMed Central

    Fontenete, Sílvia; Leite, Marina; Guimarães, Nuno; Madureira, Pedro; Ferreira, Rui Manuel; Figueiredo, Céu; Wengel, Jesper; Azevedo, Nuno Filipe

    2015-01-01

    In recent years, there have been several attempts to improve the diagnosis of infection caused by Helicobacter pylori. Fluorescence in situ hybridization (FISH) is a commonly used technique to detect H. pylori infection but it requires biopsies from the stomach. Thus, the development of an in vivo FISH-based method (FIVH) that directly detects and allows the visualization of the bacterium within the human body would significantly reduce the time of analysis, allowing the diagnosis to be performed during endoscopy. In a previous study we designed and synthesized a phosphorothioate locked nucleic acid (LNA)/ 2’ O-methyl RNA (2’OMe) probe using standard phosphoramidite chemistry and FISH hybridization was then successfully performed both on adhered and suspended bacteria at 37°C. In this work we simplified, shortened and adapted FISH to work at gastric pH values, meaning that the hybridization step now takes only 30 minutes and, in addition to the buffer, uses only urea and probe at non-toxic concentrations. Importantly, the sensitivity and specificity of the FISH method was maintained in the range of conditions tested, even at low stringency conditions (e.g., low pH). In conclusion, this methodology is a promising approach that might be used in vivo in the future in combination with a confocal laser endomicroscope for H. pylori visualization. PMID:25915865

  6. Seasonal variability of microbial biomass phosphorus in urban soils.

    PubMed

    Halecki, W; Gąsiorek, M

    2015-01-01

    Urban soils have been formed through human activities. Seasonal evaluation with time-control procedure are essential for plant, and activity of microorganisms. Therefore, these processes are crucial in the urban area due to geochemical changes in the past years. The purpose of this study was to investigate the changes of content of microbial biomass phosphorus (P) in the top layer of soils throughout the season. In this research, the concentration of microbial biomass P ranged from 0.01 to 6.29 mg·kg(-1). We used single-factor repeated-measure analysis of variance to test the effect of season on microbial biomass P content of selected urban soils. We found no statistically significant differences between the concentration of microbial biomass P in the investigated urban and sub-urban soils during the growing season. This analysis explicitly recognised that environmental urban conditions are steady. Specifically, we have studied how vegetation seasonality and ability of microbial biomass P are useful for detecting quality deviations, which affect the equilibrium of urban soil. In conclusion, seasonal variability of the stringency of assurance across the different compounds of soil reveals, as expected, the stable condition of the urban soils. Seasonal responses in microbial biomass P under urban soil use should establish a framework as a reference to the activity of the microorganisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    PubMed

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  8. Application of Fuzzy TOPSIS for evaluating machining techniques using sustainability metrics

    NASA Astrophysics Data System (ADS)

    Digalwar, Abhijeet K.

    2018-04-01

    Sustainable processes and techniques are getting increased attention over the last few decades due to rising concerns over the environment, improved focus on productivity and stringency in environmental as well as occupational health and safety norms. The present work analyzes the research on sustainable machining techniques and identifies techniques and parameters on which sustainability of a process is evaluated. Based on the analysis these parameters are then adopted as criteria’s to evaluate different sustainable machining techniques such as Cryogenic Machining, Dry Machining, Minimum Quantity Lubrication (MQL) and High Pressure Jet Assisted Machining (HPJAM) using a fuzzy TOPSIS framework. In order to facilitate easy arithmetic, the linguistic variables represented by fuzzy numbers are transformed into crisp numbers based on graded mean representation. Cryogenic machining was found to be the best alternative sustainable technique as per the fuzzy TOPSIS framework adopted. The paper provides a method to deal with multi criteria decision making problems in a complex and linguistic environment.

  9. Biotype-specific tcpA genes in Vibrio cholerae.

    PubMed

    Iredell, J R; Manning, P A

    1994-08-01

    The tcpA gene, encoding the structural subunit of the toxin-coregulated pilus, has been isolated from a variety of clinical isolates of Vibrio cholerae, and the nucleotide sequence determined. Strict biotype-specific conservation within both the coding and putative regulatory regions was observed, with important differences between the El Tor and classical biotypes. V. cholerae O139 Bengal strains appear to have El Tor-type tcpA genes. Environmental O1 and non-O1 isolates have sequences that bind an El Tor-specific tcpA DNA probe and that are weakly and variably amplified by tcpA-specific polymerase chain reaction primers, under conditions of reduced stringency. The data presented allow the selection of primer pairs to help distinguish between clinical and environmental isolates, and to distinguish El Tor (and Bengal) biotypes from classical biotypes of V. cholerae. While the role of TcpA in cholera vaccine preparations remains unclear, the data strongly suggest that TcpA-containing vaccines directed at O1 strains need include only the two forms of TcpA, and that such vaccines directed at (O139) Bengal strains should include the TcpA of El Tor biotype.

  10. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs.

    PubMed

    Powell, Bradford C; Hutchison, Clyde A

    2006-01-19

    Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene prediction. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

  11. Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

    PubMed Central

    Powell, Bradford C; Hutchison, Clyde A

    2006-01-01

    Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes. PMID:16423288

  12. Implementing the undergraduate mini-CEX: a tailored approach at Southampton University.

    PubMed

    Hill, Faith; Kendall, Kathleen; Galbraith, Kevin; Crossley, Jim

    2009-04-01

    The mini-clinical evaluation exercise (mini-CEX) is widely used in the UK to assess clinical competence, but there is little evidence regarding its implementation in the undergraduate setting. This study aimed to estimate the validity and reliability of the undergraduate mini-CEX and discuss the challenges involved in its implementation. A total of 3499 mini-CEX forms were completed. Validity was assessed by estimating associations between mini-CEX score and a number of external variables, examining the internal structure of the instrument, checking competency domain response rates and profiles against expectations, and by qualitative evaluation of stakeholder interviews. Reliability was evaluated by overall reliability coefficient (R), estimation of the standard error of measurement (SEM), and from stakeholders' perceptions. Variance component analysis examined the contribution of relevant factors to students' scores. Validity was threatened by various confounding variables, including: examiner status; case complexity; attachment specialty; patient gender, and case focus. Factor analysis suggested that competency domains reflect a single latent variable. Maximum reliability can be achieved by aggregating scores over 15 encounters (R = 0.73; 95% confidence interval [CI] +/- 0.28 based on a 6-point assessment scale). Examiner stringency contributed 29% of score variation and student attachment aptitude 13%. Stakeholder interviews revealed staff development needs but the majority perceived the mini-CEX as more reliable and valid than the previous long case. The mini-CEX has good overall utility for assessing aspects of the clinical encounter in an undergraduate setting. Strengths include fidelity, wide sampling, perceived validity, and formative observation and feedback. Reliability is limited by variable examiner stringency, and validity by confounding variables, but these should be viewed within the context of overall assessment strategies.

  13. Integrated assessment of global water scarcity over the 21st century - Part 2: Climate change mitigation policies

    NASA Astrophysics Data System (ADS)

    Hejazi, M. I.; Edmonds, J.; Clarke, L.; Kyle, P.; Davies, E.; Chaturvedi, V.; Eom, J.; Wise, M.; Patel, P.; Calvin, K.

    2013-03-01

    We investigate the effects of emission mitigation policies on water scarcity both globally and regionally using the Global Change Assessment Model (GCAM), a leading community integrated assessment model of energy, agriculture, climate, and water. Three climate policy scenarios with increasing mitigation stringency of 7.7, 5.5, and 4.2 W m-2 in year 2095 (equivalent to the SRES A2, B2, and B1 emission scenarios, respectively), under two carbon tax regimes (a universal carbon tax (UCT) which includes land use change emissions, and a fossil fuel and industrial emissions carbon tax (FFICT) which excludes land use change emissions) are analyzed. The results are compared to a baseline scenario (i.e. no climate change mitigation policy) with radiative forcing reaching 8.8 W m-2 (equivalent to the SRES A1Fi emission scenario) by 2095. When compared to the baseline scenario and maintaining the same baseline socioeconomic assumptions, water scarcity declines under a UCT mitigation policy but increases with a FFICT mitigation scenario by the year 2095 particularly with more stringent climate mitigation targets. The decreasing trend with UCT policy stringency is due to substitution from more water-intensive to less water-intensive choices in food and energy production, and in land use. Under the FFICT scenario, water scarcity is projected to increase driven by higher water demands for bio-energy crops. This study implies an increasingly prominent role for water availability in future human decisions, and highlights the importance of including water in integrated assessment of global change. Future research will be directed at incorporating water shortage feedbacks in GCAM to better understand how such stresses will propagate across the various human and natural systems in GCAM.

  14. Eighty routes to a ribonucleotide world; dispersion and stringency in the decisive selection.

    PubMed

    Yarus, Michael

    2018-05-21

    We examine the initial emergence of genetics; that is, of an inherited chemical capability. The crucial actors are ribonucleotides, occasionally meeting in a prebiotic landscape. Previous work identified six influential variables during such random ribonucleotide pooling. Geochemical pools can be in periodic danger (e.g., from tides) or constant danger (e.g., from unfavorable weather). Such pools receive Gaussian nucleotide amounts sporadically, at random times, or get varying substrates simultaneously. Pools use cross-templated RNA synthesis (5'-5' product from 5'-3' template) or para-templated (5'-5' product from 5'-5' template) synthesis. Pools can undergo mild or strong selection, and be recently initiated (early) or late in age. Considering > 80 combinations of these variables, selection calculations identify a superior route. Most likely, an early, sporadically fed, cross-templating pool in constant danger, receiving ≥ 1 mM nucleotides while under strong selection for a coenzyme-like product will host selection of the first encoded biochemical functions. Predominantly templated products emerge from a critical event, the starting bloc selection, which exploits inevitable differences among early pools. Favorable selection has a simple rationale; it is increased by product dispersion (sd/mean), by selection intensity (mild or strong), or by combining these factors as stringency, reciprocal fraction of pools selected (1/sfsel). To summarize: chance utility, acting via a preference for disperse, templated coenzyme-like dinucleotides, uses stringent starting bloc selection to quickly establish majority encoded/genetic expression. Despite its computational origin, starting bloc selection is largely independent of specialized assumptions. This ribodinucleotide route to inheritance may also have facilitated 5'-3' chemical RNA replication. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. Performance of Crohn's disease Clinical Trial Endpoints based upon Different Cutoffs for Patient Reported Outcomes or Endoscopic Activity: Analysis of EXTEND Data.

    PubMed

    Feagan, Brian; Sandborn, William J; Rutgeerts, Paul; Levesque, Barrett G; Khanna, Reena; Huang, Bidan; Zhou, Qian; Maa, Jen-Fue; Wallace, Kori; Lacerda, Ana; Thakkar, Roopal B; Robinson, Anne M

    2018-04-23

    Clinical trial endpoints for Crohn's disease (CD) activity correlate poorly with mucosal inflammation; to assess treatment efficacy, patient-reported outcomes and endoscopic assessments are preferred. This study assessed the impact on treatment efficacy estimations of using different definitions of clinical and endoscopic remission and endoscopic response, and of using site- or central-based endoscopy evaluation. This post hoc analysis of data fromEXTEND (extend the safety and efficacy of adalimumab through endoscopic healing), a placebo (PBO)-controlled, randomized trial of adalimumab (ADA) for mucosal healing, included adults with moderate-to-severe CD. Subsets of patients meeting specified Simplified Endoscopic Score for CD (SES-CD) inclusion criteria, according to site or central reading, and baseline stool frequency (SF) and/or abdominal pain score (AP) thresholds were evaluated. Various endpoint definitions based on the Crohn's Disease Activity Index (CDAI), its SF and AP components, SES-CD, and composite endpoints were compared between treatment groups. Increased stringency of Week 12 clinical endpoints compared to CDAI<150 to SF≤3.0/1.5&AP≤1.0 reduced PBO response rates by ≥12% and increased treatment effects by ≤10%. Amending the SES-CD endpoint from ≤4 to ≤2 reduced the treatment effect from 24% to 8%. Composite endpoints further diminished response rates and effect sizes. Site-based evaluation was associated with lower remission rates versus central reading in the PBO group and, thus, greater ADA-related treatment effects. This analysis is the first to demonstrate that increasing the stringency of clinical and endoscopic endpoint definitions in CD trials, especially lowering SF or SES-CD definitions, reduces the ability to detect treatment-related change in CD activity; focus on endpoints that reflect clinical change is warranted.

  16. Materials Selection Criteria for Nuclear Power Applications: A Decision Algorithm

    NASA Astrophysics Data System (ADS)

    Rodríguez-Prieto, Álvaro; Camacho, Ana María; Sebastián, Miguel Ángel

    2016-02-01

    An innovative methodology based on stringency levels is proposed in this paper and improves the current selection method for structural materials used in demanding industrial applications. This paper describes a new approach for quantifying the stringency of materials requirements based on a novel deterministic algorithm to prevent potential failures. We have applied the new methodology to different standardized specifications used in pressure vessels design, such as SA-533 Grade B Cl.1, SA-508 Cl.3 (issued by the American Society of Mechanical Engineers), DIN 20MnMoNi55 (issued by the German Institute of Standardization) and 16MND5 (issued by the French Nuclear Commission) specifications and determine the influence of design code selection. This study is based on key scientific publications on the influence of chemical composition on the mechanical behavior of materials, which were not considered when the technological requirements were established in the aforementioned specifications. For this purpose, a new method to quantify the efficacy of each standard has been developed using a deterministic algorithm. The process of assigning relative weights was performed by consulting a panel of experts in materials selection for reactor pressure vessels to provide a more objective methodology; thus, the resulting mathematical calculations for quantitative analysis are greatly simplified. The final results show that steel DIN 20MnMoNi55 is the best material option. Additionally, more recently developed materials such as DIN 20MnMoNi55, 16MND5 and SA-508 Cl.3 exhibit mechanical requirements more stringent than SA-533 Grade B Cl.1. The methodology presented in this paper can be used as a decision tool in selection of materials for a wide range of applications.

  17. Integrated assessment of global water scarcity over the 21st century - Part 2: Climate change mitigation policies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hejazi, Mohamad I.; Edmonds, James A.; Clarke, Leon E.

    2013-01-01

    We investigate the effects of emission mitigation policies on water scarcity both globally and regionally using the Global Change Assessment Model (GCAM), a leading community integrated assessment model of energy, agriculture, climate, and water. Three climate policy scenarios with increasing mitigation stringency of 7.7, 5.5, and 4.2 W/m2 in year 2095 (equivalent to the SRES A2, B2, and B1 emission scenarios, respectively), under two carbon tax regimes (a universal carbon tax (UCT) which includes land use change emissions, and a fossil fuel and industrial emissions carbon tax (FFICT) which excludes land use change emissions) are analyzed. The results are comparedmore » to a baseline scenario (i.e., no climate change mitigation policy) with radiative forcing reaching 8.8 W/m2 (equivalent to the SRES A1Fi emission scenario) by 2095. When compared to the baseline scenario and maintaining the same baseline underlying socioeconomic assumptions, water scarcity declines under a UCT mitigation policy while increases with a FFICT mitigation scenario by the year 2095 with more stringent climate mitigation targets. The decreasing trend with UCT policy stringency is due to substitution from more water-intensive to less water-intensive choices in food, energy, and land use. Under the FFICT scenario, water scarcity is projected to increase driven by higher water demands for bio-energy crops. This study implies an increasingly prominent role for water availability in future human decisions, and highlights the importance of including water in integrated assessment of global change. Future research will be directed at incorporating water shortage feedbacks in GCAM to better understand how such stresses will propagate across the various human and natural systems in GCAM.« less

  18. Effect of exposure to good vs poor medical trainee performance on attending physician ratings of subsequent performances.

    PubMed

    Yeates, Peter; O'Neill, Paul; Mann, Karen; Eva, Kevin W

    2012-12-05

    Competency-based models of education require assessments to be based on individuals' capacity to perform, yet the nature of human judgment may fundamentally limit the extent to which such assessment is accurately possible. To determine whether recent observations of the Mini Clinical Evaluation Exercise (Mini-CEX) performance of postgraduate year 1 physicians influence raters' scores of subsequent performances, consistent with either anchoring bias (scores biased similar to previous experience) or contrast bias (scores biased away from previous experience). Internet-based randomized, blinded experiment using videos of Mini-CEX assessments of postgraduate year 1 trainees interviewing new internal medicine patients. Participants were 41 attending physicians from England and Wales experienced with the Mini-CEX, with 20 watching and scoring 3 good trainee performances and 21 watching and scoring 3 poor performances. All then watched and scored the same 3 borderline video performances. The study was completed between July and November 2011. The primary outcome was scores assigned to the borderline videos, using a 6-point Likert scale (anchors included: 1, well below expectations; 3, borderline; 6, well above expectations). Associations were tested in a multivariable analysis that included participants' sex, years of practice, and the stringency index (within-group z score of initial 3 ratings). The mean rating scores assigned by physicians who viewed borderline video performances following exposure to good performances was 2.7 (95% CI, 2.4-3.0) vs 3.4 (95% CI, 3.1-3.7) following exposure to poor performances (difference of 0.67 [95% CI, 0.28-1.07]; P = .001). Borderline videos were categorized as consistent with failing scores in 33 of 60 assessments (55%) in those exposed to good performances and in 15 of 63 assessments (24%) in those exposed to poor performances (P < .001). They were categorized as consistent with passing scores in 5 of 60 assessments (8.3%) in those exposed to good performances compared with 25 of 63 assessments (39.5%) in those exposed to poor performances (P < .001). Sex and years of attending practice were not associated with scores. The priming condition (good vs poor performances) and the stringency index jointly accounted for 45% of the observed variation in raters' scores for the borderline videos (P < .001). In an experimental setting, attending physicians exposed to videos of good medical trainee performances rated subsequent borderline performances lower than those who had been exposed to poor performances, consistent with a contrast bias.

  19. Evasion of affinity-based selection in germinal centers by Epstein-Barr virus LMP2A.

    PubMed

    Minamitani, Takeharu; Yasui, Teruhito; Ma, Yijie; Zhou, Hufeng; Okuzaki, Daisuke; Tsai, Chiau-Yuang; Sakakibara, Shuhei; Gewurz, Benjamin E; Kieff, Elliott; Kikutani, Hitoshi

    2015-09-15

    Epstein-Barr virus (EBV) infects germinal center (GC) B cells and establishes persistent infection in memory B cells. EBV-infected B cells can cause B-cell malignancies in humans with T- or natural killer-cell deficiency. We now find that EBV-encoded latent membrane protein 2A (LMP2A) mimics B-cell antigen receptor (BCR) signaling in murine GC B cells, causing altered humoral immune responses and autoimmune diseases. Investigation of the impact of LMP2A on B-cell differentiation in mice that conditionally express LMP2A in GC B cells or all B-lineage cells found LMP2A expression enhanced not only BCR signals but also plasma cell differentiation in vitro and in vivo. Conditional LMP2A expression in GC B cells resulted in preferential selection of low-affinity antibody-producing B cells despite apparently normal GC formation. GC B-cell-specific LMP2A expression led to systemic lupus erythematosus-like autoimmune phenotypes in an age-dependent manner. Epigenetic profiling of LMP2A B cells found increased H3K27ac and H3K4me1 signals at the zinc finger and bric-a-brac, tramtrack domain-containing protein 20 locus. We conclude that LMP2A reduces the stringency of GC B-cell selection and may contribute to persistent EBV infection and pathogenesis by providing GC B cells with excessive prosurvival effects.

  20. Single cell transcriptomic analysis of prostate cancer cells.

    PubMed

    Welty, Christopher J; Coleman, Ilsa; Coleman, Roger; Lakely, Bryce; Xia, Jing; Chen, Shu; Gulati, Roman; Larson, Sandy R; Lange, Paul H; Montgomery, Bruce; Nelson, Peter S; Vessella, Robert L; Morrissey, Colm

    2013-02-16

    The ability to interrogate circulating tumor cells (CTC) and disseminated tumor cells (DTC) is restricted by the small number detected and isolated (typically <10). To determine if a commercially available technology could provide a transcriptomic profile of a single prostate cancer (PCa) cell, we clonally selected and cultured a single passage of cell cycle synchronized C4-2B PCa cells. Ten sets of single, 5-, or 10-cells were isolated using a micromanipulator under direct visualization with an inverted microscope. Additionally, two groups of 10 individual DTC, each isolated from bone marrow of 2 patients with metastatic PCa were obtained. RNA was amplified using the WT-Ovation™ One-Direct Amplification System. The amplified material was hybridized on a 44K Whole Human Gene Expression Microarray. A high stringency threshold, a mean Alexa Fluor® 3 signal intensity above 300, was used for gene detection. Relative expression levels were validated for select genes using real-time PCR (RT-qPCR). Using this approach, 22,410, 20,423, and 17,009 probes were positive on the arrays from 10-cell pools, 5-cell pools, and single-cells, respectively. The sensitivity and specificity of gene detection on the single-cell analyses were 0.739 and 0.972 respectively when compared to 10-cell pools, and 0.814 and 0.979 respectively when compared to 5-cell pools, demonstrating a low false positive rate. Among 10,000 randomly selected pairs of genes, the Pearson correlation coefficient was 0.875 between the single-cell and 5-cell pools and 0.783 between the single-cell and 10-cell pools. As expected, abundant transcripts in the 5- and 10-cell samples were detected by RT-qPCR in the single-cell isolates, while lower abundance messages were not. Using the same stringency, 16,039 probes were positive on the patient single-cell arrays. Cluster analysis showed that all 10 DTC grouped together within each patient. A transcriptomic profile can be reliably obtained from a single cell using commercially available technology. As expected, fewer amplified genes are detected from a single-cell sample than from pooled-cell samples, however this method can be used to reliably obtain a transcriptomic profile from DTC isolated from the bone marrow of patients with PCa.

  1. Lack of response to unaligned chromosomes in mammalian female gametes

    PubMed Central

    Sebestova, Jaroslava; Danylevska, Anna; Novakova, Lucia; Kubelka, Michal; Anger, Martin

    2012-01-01

    Chromosome segregation errors are highly frequent in mammalian female meiosis, and their incidence gradually increases with maternal age. The fate of aneuploid eggs is obviously dependent on the stringency of mechanisms for detecting unattached or repairing incorrectly attached kinetochores. In case of their failure, the newly formed embryo will inherit the impaired set of chromosomes, which will have severe consequences for its further development. Whether spindle assembly checkpoint (SAC) in oocytes is capable of arresting cell cycle progression in response to unaligned kinetochores was discussed for a long time. It is known that abolishing SAC increases frequency of chromosome segregation errors and causes precocious entry into anaphase; SAC, therefore, seems to be essential for normal chromosome segregation in meiosis I. However, it was also reported that for anaphase-promoting complex (APC) activation, which is a prerequisite for entering anaphase; alignment of only a critical mass of kinetochores on equatorial plane is sufficient. This indicates that the function of SAC and of cooperating chromosome attachment correction mechanisms in oocytes is different from somatic cells. To analyze this phenomenon, we used live cell confocal microscopy to monitor chromosome movements, spindle formation, APC activation and polar body extrusion (PBE) simultaneously in individual oocytes at various time points during first meiotic division. Our results, using oocytes from aged animals and interspecific crosses, demonstrate that multiple unaligned kinetochores and severe congression defects are tolerated at the metaphase to anaphase transition, although such cells retain sensitivity to nocodazole. This indicates that checkpoint mechanisms, operating in oocytes at this point, are essential for accurate timing of APC activation in meiosis I, but they are insufficient in detection or correction of unaligned chromosomes, preparing thus conditions for propagation of the aneuploidy to the embryo. PMID:22871737

  2. Use of Molecular Methods for the Rapid Mass Detection of Schistosoma mansoni (Platyhelminthes: Trematoda) in Biomphalaria spp. (Gastropoda: Planorbidae)

    PubMed Central

    Jannotti-Passos, Liana Konovaloffi; Dos Santos Carvalho, Omar

    2017-01-01

    The low stringency-polymerase chain reaction (LS-PCR) and loop-mediated isothermal amplification (LAMP) assays were used to detect the presence of S. mansoni DNA in (1) Brazilian intermediate hosts (Biomphalaria glabrata, B. straminea, and B. tenagophila) with patent S. mansoni infections, (2) B. glabrata snails with prepatent S. mansoni infections, (3) various mixtures of infected and noninfected snails; and (4) snails infected with other trematode species. The assays showed high sensitivity and specificity and could detect S. mansoni DNA when one positive snail was included in a pool of 1,000 negative specimens of Biomphalaria. These molecular approaches can provide a low-cost, effective, and rapid method for detecting the presence of S. mansoni in pooled samples of field-collected Biomphalaria. These assays should aid mapping of transmission sites in endemic areas, especially in low prevalence regions and improve schistosomiasis surveillance. It will be a useful tool to monitor low infection rates of snails in areas where control interventions are leading towards the elimination of schistosomiasis. PMID:28246533

  3. Ribosomal DNA, tri- and bi-partite pericentromeres in the permanent translocation heterozygote Rhoeo spathacea.

    PubMed

    Golczyk, Hieronim; Hasterok, Robert; Szklarczyk, Marek

    2010-12-01

    High- and low-stringency FISH and base-specific fluorescence were performed on the permanent translocation heterozygote Rhoeo spathacea (2n = 12). Our results indicate that 45S rDNA arrays, rDNA-related sequences and other GC-rich DNA fraction(s) are located within the pericentromeric regions of all twelve chromosomes, usually colocalizing with the chromomycin A(3)-positive bands. Homogenization of the pericentromeric regions appears to result from the concerted spread of GC-rich sequences, with differential amplification likely. We found new 5S rDNA patterns, which suggest a variability in the breakpoints and in the consequent chromosome reorganizations. It was found that the large 5S rDNA locus residing on each of the 8E and 9E arms consisted of two smaller loci. On each of the two chromosome arms 3b and 4b, in addition to the major subtelomeric 5S rDNA locus, a new minor locus was found interstitially about 40% along the arm length. The arrangement of cytotogenetic landmarks and chromosome arm measurements are discussed with regard to genome repatterning in Rhoeo.

  4. Genome-Wide Discovery of Long Non-Coding RNAs in Rainbow Trout.

    PubMed

    Al-Tobasei, Rafet; Paneru, Bam; Salem, Mohamed

    2016-01-01

    The ENCODE project revealed that ~70% of the human genome is transcribed. While only 1-2% of the RNAs encode for proteins, the rest are non-coding RNAs. Long non-coding RNAs (lncRNAs) form a diverse class of non-coding RNAs that are longer than 200 nt. Emerging evidence indicates that lncRNAs play critical roles in various cellular processes including regulation of gene expression. LncRNAs show low levels of gene expression and sequence conservation, which make their computational identification in genomes difficult. In this study, more than two billion Illumina sequence reads were mapped to the genome reference using the TopHat and Cufflinks software. Transcripts shorter than 200 nt, with more than 83-100 amino acids ORF, or with significant homologies to the NCBI nr-protein database were removed. In addition, a computational pipeline was used to filter the remaining transcripts based on a protein-coding-score test. Depending on the filtering stringency conditions, between 31,195 and 54,503 lncRNAs were identified, with only 421 matching known lncRNAs in other species. A digital gene expression atlas revealed 2,935 tissue-specific and 3,269 ubiquitously-expressed lncRNAs. This study annotates the lncRNA rainbow trout genome and provides a valuable resource for functional genomics research in salmonids.

  5. Relationship between microbial community dynamics and process performance during thermophilic sludge bioleaching.

    PubMed

    Chen, Shen-Yi; Chou, Li-Chieh

    2016-08-01

    Heavy metals can be removed from the sludge using bioleaching technologies at thermophilic condition, thereby providing an option for biotreatment of wasted sludge generated from wastewater treatment. The purposes of this study were to establish a molecular biology technique, real-time PCR, for the detection and enumeration of the sulfur-oxidizing bacteria during the thermophilic sludge bioleaching. The 16S rRNA gene for real-time PCR quantification targeted the bioleaching bacteria: Sulfobacillus thermosulfidooxidans, Sulfobacillus acidophilus, and Acidithiobacillus caldus. The specificity and stringency for thermophilic sulfur-oxidizing bacteria were tested before the experiments of monitoring the bacterial community, bacterial number during the thermophilic sludge bioleaching and the future application on testing various environmental samples. The results showed that S. acidophilus was identified as the dominant sulfur-oxidizing bacteria, while A. caldus and S. thermosulfidooxidans occurred in relatively low numbers. The total number of the sulfur-oxidizing bacteria increased during the thermophilic bioleaching process. Meanwhile, the decrease of pH, production of sulfate, degradation of SS/VSS, and solubilization of heavy metal were found to correlate well with the population of thermophilic sulfur-oxidizing bacteria during the bioleaching process. The real-time PCR used in this study is a suitable method to monitor numbers of thermophilic sulfur-oxidizing bacteria during the bioleaching process.

  6. Impacts of Hospital Budget Limits in Rochester, New York

    PubMed Central

    Friedman, Bernard; Wong, Herbert S.

    1995-01-01

    During 1980-87, eight hospitals in the Rochester, New York area participated in an experimental program to limit total revenue. This article analyzes: increase of costs for Rochester hospitals; trends for inputs and compensation; and cash flow margins. Real expense per case grew annually by about 3 percent less in Rochester. However, after 1984, Medicare prospective payment had an effect of similar size outside Rochester. Some capital inputs to hospital care were restrained, as were wages and particularly benefits. The program did not generally raise or stabilize hospital revenue margins, while the ratio of cash flow to debt trended down. Financial stringency of this program relative to alternatives may have contributed to its end. PMID:10151889

  7. Impacts of hospital budget limits in Rochester, New York.

    PubMed

    Friedman, B; Wong, H S

    1995-01-01

    During 1980-87, eight hospitals in the Rochester, New York area participated in an experimental program to limit total revenue. This article analyzes: increase of costs for Rochester hospitals; trends for inputs and compensation; and cash flow margins. Real expense per case grew annually by about 3 percent less in Rochester. However, after 1984, Medicare prospective payment had an effect of similar size outside Rochester. Some capital inputs to hospital care were restrained, as were wages and particularly benefits. The program did not generally raise or stabilize hospital revenue margins, while the ratio of cash flow to debt trended down. Financial stringency of this program relative to alternatives may have contributed to its end.

  8. Development and Validation of Sandwich ELISA Microarrays with Minimal Assay Interference

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gonzalez, Rachel M.; Servoss, Shannon; Crowley, Sheila A.

    Sandwich enzyme-linked immunosorbent assay (ELISA) microarrays are emerging as a strong candidate platform for multiplex biomarker analysis because of the ELISA’s ability to quantitatively measure rare proteins in complex biological fluids. Advantages of this platform are high-throughput potential, assay sensitivity and stringency, and the similarity to the standard ELISA test, which facilitates assay transfer from a research setting to a clinical laboratory. However, a major concern with the multiplexing of ELISAs is maintaining high assay specificity. In this study, we systematically determine the amount of assay interference and noise contributed by individual components of the multiplexed 24-assay system. We findmore » that non-specific reagent cross-reactivity problems are relatively rare. We did identify the presence of contaminant antigens in a “purified antigen”. We tested the validated ELISA microarray chip using paired serum samples that had been collected from four women at a 6-month interval. This analysis demonstrated that protein levels typically vary much more between individuals then within an individual over time, a result which suggests that longitudinal studies may be useful in controlling for biomarker variability across a population. Overall, this research demonstrates the importance of a stringent screening protocol and the value of optimizing the antibody and antigen concentrations when designing chips for ELISA microarrays.« less

  9. Flood Protection Decision Making Within a Coupled Human and Natural System

    NASA Astrophysics Data System (ADS)

    O'Donnell, Greg; O'Connell, Enda

    2013-04-01

    Due to the perceived threat from climate change, prediction under changing climatic and hydrological conditions has become a dominant theme of hydrological research. Much of this research has been climate model-centric, in which GCM/RCM climate projections have been used to drive hydrological system models to explore potential impacts that should inform adaptation decision-making. However, adaptation fundamentally involves how humans may respond to increasing flood and drought hazards by changing their strategies, activities and behaviours which are coupled in complex ways to the natural systems within which they live and work. Humans are major agents of change in hydrological systems, and representing human activities and behaviours in coupled human and natural hydrological system models is needed to gain insight into the complex interactions that take place, and to inform adaptation decision-making. Governments and their agencies are under pressure to make proactive investments to protect people living in floodplains from the perceived increasing flood hazard. However, adopting this as a universal strategy everywhere is not affordable, particularly in times of economic stringency and given uncertainty about future climatic conditions. It has been suggested that the assumption of stationarity, which has traditionally been invoked in making hydrological risk assessments, is no longer tenable. However, before the assumption of hydrologic nonstationarity is accepted, the ability to cope with the uncertain impacts of global warming on water management via the operational assumption of hydrologic stationarity should be carefully examined. Much can be learned by focussing on natural climate variability and its inherent changes in assessing alternative adaptation strategies. A stationary stochastic multisite flood hazard model has been developed that can exhibit increasing variability/persistence in annual maximum floods, starting with the traditional assumption of independence. This has been coupled to an agent based model of how various stakeholders interact in determining where and when flood protection investments are made in a hypothetical region with multiple sites at risk from flood hazard. Monte Carlo simulation is used to explore how government agencies with finite resources might best invest in flood protection infrastructure in a highly variable climate with a high degree of future uncertainty. Insight is provided into whether proactive or reactive strategies are to be preferred in an increasingly variable climate.

  10. Comparison of CpG island methylator phenotype (CIMP) frequency in colon cancer using different probe- and gene-specific scoring alternatives on recommended multi-gene panels.

    PubMed

    Berg, Marianne; Hagland, Hanne R; Søreide, Kjetil

    2014-01-01

    In colorectal cancer a distinct subgroup of tumours demonstrate the CpG island methylator phenotype (CIMP). However, a consensus of how to score CIMP is not reached, and variation in definition may influence the reported CIMP prevalence in tumours. Thus, we sought to compare currently suggested definitions and cut-offs for methylation markers and how they influence CIMP classification in colon cancer. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA), with subsequent fragment analysis, was used to investigate methylation of tumour samples. In total, 31 CpG sites, located in 8 different genes (RUNX3, MLH1, NEUROG1, CDKN2A, IGF2, CRABP1, SOCS1 and CACNA1G) were investigated in 64 distinct colon cancers and 2 colon cancer cell lines. The Ogino gene panel includes all 8 genes, in addition to the Weisenberger panel of which only 5 of the 8 genes included were investigated. In total, 18 alternative combinations of scoring of CIMP positivity on probe-, gene-, and panel-level were analysed and compared. For 47 samples (71%), the CIMP status was constant and independent of criteria used for scoring; 34 samples were constantly scored as CIMP negative, and 13 (20%) consistently scored as CIMP positive. Only four of 31 probes (13%) investigated showed no difference in the numbers of positive samples using the different cut-offs. Within the panels a trend was observed that increasing the gene-level stringency resulted in a larger difference in CIMP positive samples than increasing the probe-level stringency. A significant difference between positive samples using 'the most stringent' as compared to 'the least stringent' criteria (20% vs 46%, respectively; p<0.005) was demonstrated. A statistical significant variation in the frequency of CIMP depending on the cut-offs and genes included in a panel was found, with twice as many positives samples by least compared to most stringent definition used.

  11. Influence of Salinity on Bacterioplankton Communities from the Brazilian Rain Forest to the Coastal Atlantic Ocean

    PubMed Central

    Silveira, Cynthia B.; Vieira, Ricardo P.; Cardoso, Alexander M.; Paranhos, Rodolfo; Albano, Rodolpho M.; Martins, Orlando B.

    2011-01-01

    Background Planktonic bacteria are recognized as important drivers of biogeochemical processes in all aquatic ecosystems, however, the taxa that make up these communities are poorly known. The aim of this study was to investigate bacterial communities in aquatic ecosystems at Ilha Grande, Rio de Janeiro, Brazil, a preserved insular environment of the Atlantic rain forest and how they correlate with a salinity gradient going from terrestrial aquatic habitats to the coastal Atlantic Ocean. Methodology/Principal Findings We analyzed chemical and microbiological parameters of water samples and constructed 16S rRNA gene libraries of free living bacteria obtained at three marine (two coastal and one offshore) and three freshwater (water spring, river, and mangrove) environments. A total of 836 sequences were analyzed by MOTHUR, yielding 269 freshwater and 219 marine operational taxonomic units (OTUs) grouped at 97% stringency. Richness and diversity indexes indicated that freshwater environments were the most diverse, especially the water spring. The main bacterial group in freshwater environments was Betaproteobacteria (43.5%), whereas Cyanobacteria (30.5%), Alphaproteobacteria (25.5%), and Gammaproteobacteria (26.3%) dominated the marine ones. Venn diagram showed no overlap between marine and freshwater OTUs at 97% stringency. LIBSHUFF statistics and PCA analysis revealed marked differences between the freshwater and marine libraries suggesting the importance of salinity as a driver of community composition in this habitat. The phylogenetic analysis of marine and freshwater libraries showed that the differences in community composition are consistent. Conclusions/Significance Our data supports the notion that a divergent evolutionary scenario is driving community composition in the studied habitats. This work also improves the comprehension of microbial community dynamics in tropical waters and how they are structured in relation to physicochemical parameters. Furthermore, this paper reveals for the first time the pristine bacterioplankton communities in a tropical island at the South Atlantic Ocean. PMID:21408023

  12. Influence of salinity on bacterioplankton communities from the Brazilian rain forest to the coastal Atlantic Ocean.

    PubMed

    Silveira, Cynthia B; Vieira, Ricardo P; Cardoso, Alexander M; Paranhos, Rodolfo; Albano, Rodolpho M; Martins, Orlando B

    2011-03-09

    Planktonic bacteria are recognized as important drivers of biogeochemical processes in all aquatic ecosystems, however, the taxa that make up these communities are poorly known. The aim of this study was to investigate bacterial communities in aquatic ecosystems at Ilha Grande, Rio de Janeiro, Brazil, a preserved insular environment of the Atlantic rain forest and how they correlate with a salinity gradient going from terrestrial aquatic habitats to the coastal Atlantic Ocean. We analyzed chemical and microbiological parameters of water samples and constructed 16S rRNA gene libraries of free living bacteria obtained at three marine (two coastal and one offshore) and three freshwater (water spring, river, and mangrove) environments. A total of 836 sequences were analyzed by MOTHUR, yielding 269 freshwater and 219 marine operational taxonomic units (OTUs) grouped at 97% stringency. Richness and diversity indexes indicated that freshwater environments were the most diverse, especially the water spring. The main bacterial group in freshwater environments was Betaproteobacteria (43.5%), whereas Cyanobacteria (30.5%), Alphaproteobacteria (25.5%), and Gammaproteobacteria (26.3%) dominated the marine ones. Venn diagram showed no overlap between marine and freshwater OTUs at 97% stringency. LIBSHUFF statistics and PCA analysis revealed marked differences between the freshwater and marine libraries suggesting the importance of salinity as a driver of community composition in this habitat. The phylogenetic analysis of marine and freshwater libraries showed that the differences in community composition are consistent. Our data supports the notion that a divergent evolutionary scenario is driving community composition in the studied habitats. This work also improves the comprehension of microbial community dynamics in tropical waters and how they are structured in relation to physicochemical parameters. Furthermore, this paper reveals for the first time the pristine bacterioplankton communities in a tropical island at the South Atlantic Ocean.

  13. [Monitoring of health of young students of northern territories residing in conditions of ecological trouble].

    PubMed

    Nikiforova, V A

    In recent years, in sanitary science the interest in issues of young people has dramatically increased, that has been actualized by the necessity of a new objective assessment of the role of the youth in modern sanitary-ecological, sociocultural and economic processes. In this regard, a special interest is aroused by young students, the health of whom is determined largely by the condition of the habitat. So far complex assessment ofriskfactors in urbanized areas, prioritization of impacts, the establishment ofpriority impacts, the detection of informative territorial environmentally dependent indices ofpopulation health are presented to be important tasks in the solution of the regional challenges. The aim of this work was the assessment of the state of health of students of the Bratsk State University, residing in conditions of ecological trouble. In the territory of the city of Bratsk the environmental situation is characterized by long term multi-component air pollution with highly toxic vehicular and industrial emissions. In the work throughout the 4 years following-up there was executed an assessment of the physical development of students, there was determined structure and revealed the an increased level of morbidity rate of students of Bratsk state University in terms of educational space, which is characteristic for territories of ecological trouble in the city of Bratsk. Parameters of physical development of students in dynamics of training were established to be not liable to variation. It confirms the stability of the morphological signs as compared to functional ones. In the analysis of dynamics of indices of the harmonicity ofphysical development there was revealed a gain in the proportion of harmoniously developed students by the end of training. Physiometric indices of students to the fourth course of training were characterized by the increase offunctional capabilities of the respiratory system.The indices of the cardiovascular system performance had a tendency to the growth of the hypertensive response in boys and the increase in the number of people with normotensive response to physical stress by the end of training. To the IV course of training there was observed the increase in the number of young boys with stringency of mechanisms of adaptation to stress, whereas in young girls satisfactory adaptation was seen.

  14. Response mechanisms of attached premixed flames subjected to harmonic forcing

    NASA Astrophysics Data System (ADS)

    Shreekrishna

    The persistent thrust for a cleaner, greener environment has prompted air pollution regulations to be enforced with increased stringency by environmental protection bodies all over the world. This has prompted gas turbine manufacturers to move from nonpremixed combustion to lean, premixed combustion. These lean premixed combustors operate quite fuel-lean compared to the stochiometric, in order to minimize CO and NOx productions, and are very susceptible to oscillations in any of the upstream flow variables. These oscillations cause the heat release rate of the flame to oscillate, which can engage one or more acoustic modes of the combustor or gas turbine components, and under certain conditions, lead to limit cycle oscillations. This phenomenon, called thermoacoustic instabilities, is characterized by very high pressure oscillations and increased heat fluxes at system walls, and can cause significant problems in the routine operability of these combustors, not to mention the occasional hardware damages that could occur, all of which cumulatively cost several millions of dollars. In a bid towards understanding this flow-flame interaction, this research works studies the heat release response of premixed flames to oscillations in reactant equivalence ratio, reactant velocity and pressure, under conditions where the flame preheat zone is convectively compact to these disturbances, using the G-equation. The heat release response is quantified by means of the flame transfer function and together with combustor acoustics, forms a critical component of the analytical models that can predict combustor dynamics. To this end, low excitation amplitude (linear) and high excitation amplitude (nonlinear) responses of the flame are studied in this work. The linear heat release response of lean, premixed flames are seen to be dominated by responses to velocity and equivalence ratio fluctuations at low frequencies, and to pressure fluctuations at high frequencies which are in the vicinity of typical screech frequencies in gas turbine combustors. The nonlinear response problem is exclusively studied in the case of equivalence ratio coupling. Various nonlinearity mechanisms are identified, amongst which the crossover mechanisms, viz., stoichiometric and flammability crossovers, are seen to be responsible in causing saturation in the overall heat release magnitude of the flame. The response physics remain the same across various preheat temperatures and reactant pressures. Finally, comparisons between the chemiluminescence transfer function obtained experimentally and the heat release transfer functions obtained from the reduced order model (ROM) are performed for lean, CH4/Air swirl-stabilized, axisymmetric V-flames. While the comparison between the phases of the experimental and theoretical transfer functions are encouraging, their magnitudes show disagreement at lower Strouhal number gains show disagreement.

  15. Challenges facing general internal medicine in the 99th Congress.

    PubMed

    Prout, D M

    1986-01-01

    Since 1976, federal support for training in general internal medicine has been provided through the primary care residency programs under Title VII of the Public Health Service Act. Continuation of these programs is now in jeopardy because of severe fiscal pressures and the response of Congress to the resulting budgetary stringency. General internal medicine faces immediate problems in the budgetary, authorization, and appropriations arenas. However, Congressional proposals for changing the method by which Medicare pays for all graduate medical education may provide an important opportunity. Under a revised method of financing graduate medical education, general internal medicine could eliminate its historical dependence on increasingly unstable federal grant funds and could contribute to the development of new federal incentives for training in the primary care specialties.

  16. Intellectual Disability, Mild Cognitive Impairment, and Risk for Dementia

    PubMed Central

    Silverman, Wayne P.; Zigman, Warren B.; Krinsky-McHale, Sharon J.; Ryan, Robert; Schupf, Nicole

    2013-01-01

    People with intellectual disability (ID) are living longer than ever before, raising concerns about old-age associated disorders. Dementia is among the most serious of these disorders, and theories relating cognitive reserve to risk predict that older adults with ID should be particularly vulnerable. Previous estimates of relative risk for dementia associated with ID have been inconsistent, and the present analyses examined the possible influence of variation in diagnostic criteria on findings. As expected, relaxation in the stringency of case definition for adults with ID increased relative risk, underscoring the importance of developing valid criteria for defining mild cognitive impairment, early dementia, and distinguishing between the two in adults with ID. Once available, these standards will contribute to more effective evidence-based planning. PMID:24273589

  17. Solid-phase supports for the in situ assembly of quantum dot-FRET hybridization assays in channel microfluidics.

    PubMed

    Tavares, Anthony J; Noor, M Omair; Uddayasankar, Uvaraj; Krull, Ulrich J; Vannoy, Charles H

    2014-01-01

    Semiconductor quantum dots (QDs) have long served as integral components in signal transduction modalities such as Förster resonance energy transfer (FRET). The majority of bioanalytical methods using QDs for FRET-based techniques simply monitor binding-induced conformational changes. In more recent work, QDs have been incorporated into solid-phase support systems, such as microfluidic chips, to serve as physical platforms in the development of functional biosensors and bioprobes. Herein, we describe a simple strategy for the transduction of nucleic acid hybridization that combines a novel design method based on FRET with an electrokinetically controlled microfluidic technology, and that offers further potential for amelioration of sample-handling issues and for simplification of dynamic stringency control.

  18. 3'-terminal sequence of a small round structured virus (SRSV) in Japan.

    PubMed

    Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

    1994-01-01

    We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

  19. Expression of small cytoplasmic transcripts of the rat identifier element in vivo and in cultured cells.

    PubMed Central

    McKinnon, R D; Danielson, P; Brow, M A; Bloom, F E; Sutcliffe, J G

    1987-01-01

    We examined the level of expression of small RNA transcripts hybridizing to a rodent repetitive DNA element, the identifier (ID) sequence, in a variety of cell types in vivo and in cultured mammalian cells. A 160-nucleotide (160n) cytoplasmic poly(A)+ RNA (BC1) appeared in late embryonic and early postnatal rat brain development, was enriched in the cerebral cortex, and appeared to be restricted to neural tissue and the anterior pituitary gland. A 110n RNA (BC2) was specifically enriched in brain, especially the postnatal cortex, but was detectable at low levels in peripheral tissues. A third, related 75n poly(A)- RNA (T3) was found in rat brain and at lower levels in peripheral tissues but was very abundant in the testes. The BC RNAs were found in a variety of rat cell lines, and their level of expression was dependent upon cell culture conditions. A rat ID probe detected BC-like RNAs in mouse brain but not liver and detected a 200n RNA in monkey brain but not liver at lower hybridization stringencies. These RNAs were expressed by mouse and primate cell lines. Thus, tissue-specific expression of small ID-sequence-related transcripts is conserved among mammals, but the tight regulation found in vivo is lost by cells in culture. Images PMID:2439903

  20. Should a coal-fired power plant be replaced or retrofitted?

    PubMed

    Patiño-Echeverri, Dalia; Morel, Benoit; Apt, Jay; Chen, Chao

    2007-12-01

    In a cap-and-trade system, a power plant operator can choose to operate while paying for the necessary emissions allowances, retrofit emissions controls to the plant, or replace the unit with a new plant. Allowance prices are uncertain, as are the timing and stringency of requirements for control of mercury and carbon emissions. We model the evolution of allowance prices for SO2, NOx, Hg, and CO2 using geometric Brownian motion with drift, volatility, and jumps, and use an options-based analysis to find the value of the alternatives. In the absence of a carbon price, only if the owners have a planning horizon longer than 30 years would they replace a conventional coal-fired plant with a high-performance unit such as a supercritical plant; otherwise, they would install SO2 and NOx, controls on the existing unit. An expectation that the CO2 price will reach $50/t in 2020 makes the installation of an IGCC with carbon capture and sequestration attractive today, even for planning horizons as short as 20 years. A carbon price below $40/t is unlikely to produce investments in carbon capture for electric power.

  1. Intra-Platform Repeatability and Inter-Platform Comparability of MicroRNA Microarray Technology

    PubMed Central

    Sato, Fumiaki; Tsuchiya, Soken; Terasawa, Kazuya; Tsujimoto, Gozoh

    2009-01-01

    Over the last decade, DNA microarray technology has provided a great contribution to the life sciences. The MicroArray Quality Control (MAQC) project demonstrated the way to analyze the expression microarray. Recently, microarray technology has been utilized to analyze a comprehensive microRNA expression profiling. Currently, several platforms of microRNA microarray chips are commercially available. Thus, we compared repeatability and comparability of five different microRNA microarray platforms (Agilent, Ambion, Exiqon, Invitrogen and Toray) using 309 microRNAs probes, and the Taqman microRNA system using 142 microRNA probes. This study demonstrated that microRNA microarray has high intra-platform repeatability and comparability to quantitative RT-PCR of microRNA. Among the five platforms, Agilent and Toray array showed relatively better performances than the others. However, the current lineup of commercially available microRNA microarray systems fails to show good inter-platform concordance, probably because of lack of an adequate normalization method and severe divergence in stringency of detection call criteria between different platforms. This study provided the basic information about the performance and the problems specific to the current microRNA microarray systems. PMID:19436744

  2. Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation

    PubMed Central

    van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.

    2009-01-01

    Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087

  3. A novel method for detection of H9N2 influenza viruses by an aptamer-real time-PCR.

    PubMed

    Hmila, Issam; Wongphatcharachai, Manoosak; Laamiri, Nacira; Aouini, Rim; Marnissi, Boutheina; Arbi, Marwa; Sreevatsan, Srinand; Ghram, Abdeljelil

    2017-05-01

    H9N2 Influenza subtype has emerged in Tunisia causing epidemics in poultry and resulting in major economic losses. New mutations in their hemagglutinin and neuraminidase proteins were acquired, suggesting their potential to directly infect humans. Effective surveillance tools should be implemented to help prevent potential spillover of the virus across species. We have developed a highly sensitive real time immuno-polymerase chain reaction (RT-I-PCR) method for detecting H9N2 virus. The assay applies aptamers as ligands to capture and detect the virus. First, a panel of specific ssDNA aptamers was selected via a one step high stringency protocol. Next, the panel of selected aptamers was characterized for their affinities and their specificity to H9N2 virus. The aptamer showing the highest binding affinity to the virus was used as ligand to develop a highly sensitive sandwich Aptamer I-PCR. A 3-log increase in analytical sensitivity was achieved as compared to a routinely used ELISA antigen test, highlighting the potential of this approach to detect very low levels of virus particles. The test was validated using clinical samples and constitutes a rapid and a label-free platform, opening a new venue for the development of aptamer -based viability sensing for a variety of microorganisms of economic importance in Tunisia and surrounding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. An island apart? Risks and prices in the Australian cryptomarket drug trade.

    PubMed

    Cunliffe, Jack; Martin, James; Décary-Hétu, David; Aldridge, Judith

    2017-12-01

    Australia has a reputation as an anomaly with regard to cryptomarket drug trading, with seemingly disproportionately high levels of activity given its relatively small size, high prices and anecdotal accounts of it being a destination where many foreign-based vendors will not sell. This paper aims to investigate these claims from a risk and prices perspective. By analysing data for over 60,000 drug products available for purchase from eight cryptomarkets in January 2016 this work builds a descriptive picture of the Australian online market in comparison to the rest of the world, before moving onto analyse the prices of drugs available to Australian consumers, both online and though conventional drug supply routes. Results show that the Australian online illicit drugs market is of considerable size, internally isolated and with methamphetamine sales being particularly large by comparison to other countries. Australian cryptomarket vendors sell drugs at significantly higher prices than those listed by their foreign counterparts. Online prices are however broadly comparable to street prices, with the exception of methamphetamine where prices appear to be much lower online. These findings indicate that the perceived stringency of Australian border protection inadvertently increases the competitiveness and local market share of domestic cryptomarket vendors via a consumer side 'risk tariff', challenging the traditionally vendor-oriented drugs risk and prices framework. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Comprehensive characterization of glutamine synthetase-mediated selection for the establishment of recombinant CHO cells producing monoclonal antibodies.

    PubMed

    Noh, Soo Min; Shin, Seunghyeon; Lee, Gyun Min

    2018-03-29

    To characterize a glutamine synthetase (GS)-based selection system, monoclonal antibody (mAb) producing recombinant CHO cell clones were generated by a single round of selection at various methionine sulfoximine (MSX) concentrations (0, 25, and 50 μM) using two different host cell lines (CHO-K1 and GS-knockout CHO). Regardless of the host cell lines used, the clones selected at 50 μM MSX had the lowest average specific growth rate and the highest average specific production rates of toxic metabolic wastes, lactate and ammonia. Unlike CHO-K1, high producing clones could be generated in the absence of MSX using GS-knockout CHO with an improved selection stringency. Regardless of the host cell lines used, the clones selected at various MSX concentrations showed no significant difference in the GS, heavy chain, and light chain gene copies (P > 0.05). Furthermore, there was no correlation between the specific mAb productivity and these three gene copies (R 2  ≤ 0.012). Taken together, GS-mediated gene amplification does not occur in a single round of selection at a MSX concentration up to 50 μM. The use of the GS-knockout CHO host cell line facilitates the rapid generation of high producing clones with reduced production of lactate and ammonia in the absence of MSX.

  6. An optimized method for extraction and detection of Coconut cadang-cadang viroid(CCCVd) from oil palm.

    PubMed

    Mohammadi, M R; Vadamalai, G; Joseph, H

    2010-01-01

    Coconut cadong-cadong viroid (CCCVd) causes the Lethal cadang-cadang disease of coconut palms in the Philippines and it is recently reported to be associated with the orange spotting disease on oil palm in Malaysia. The low concentration of the viroid RNA in oil palm as well as the high content of polyphenols and polysaccharides in this plant which interfere with the purification steps makes it difficult to extract and detect this viroid from oil palm. A previously described method was modified and optimized for extraction and detection of CCCVd from infected oil palms. Briefly, 7 g of leaf material was homogenized in a mortar or a blender using liquid nitrogen. 10 ml of extraction buffer (100 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM EDTA) along with 100 mM 2-mercaptoethanol and 10 ml water saturated phenol was added to the frozen powder. After centrifuging at 4 degrees C, 4000 g for 30 min, the aqueous phase was extracted once more with phenol then once with chloroform-isoamyl alcohol (24:1). After adding sodium acetate, pH 5.6 to 200 mM, the mixture was precipitated with 2.5 vol ethanol overnight in -20 freezer and then the pellet was washed with 70% ethanol and air-dried. One milliliter of 8 M LiCl was added to the dried pellet and after shaking overnight at 4 degrees C and another centrifugation step the supernatant was collected and precipitated again with ethanol and then the resulting pellet was washed and air-dried. To carry out northern blotting, samples equivalent to 40 g of plant tissue were mixed with formamide buffer and loaded onto a 12% polyacrylamide gel containing 7 M urea and after separation by electrophoresis, were electroblotted onto membrane and fixed by UV cross-linking. Pre-hybridization and hybridization using hybridization buffer (50% formamide, 25%SSPE, 0.1% Ficol and PVP, 0.1 % SDS, 0.02 % DNA (5mg/ml)) was carried out at 45 degrees C for 90 min and 16 h, respectively followed by two low stringency washes (0.5 X SSC, 0.1% SDS, at room temperature for 5 min) and one high stringency wash (0.1X SSC, 0.1% SDS at 60 degrees C for 1 hour). In vitro synthesized DIG-labeled full-length CCCVd(-) RNA probe was used in hybridization step. DIG Nucleic Acid Detection Kit (Roche) instructions were followed for detection procedure and as a result the blue bands corresponding to the position of the viroid were appeared on the membrane. The result of this study showed the ability of DIG labeled probe in detection of the viroid and also provided a suitable extraction and hybridization method for the detection of CCCVd from oil palm.

  7. Proteomic Identification of Monoclonal Antibodies from Serum

    PubMed Central

    2015-01-01

    Characterizing the in vivo dynamics of the polyclonal antibody repertoire in serum, such as that which might arise in response to stimulation with an antigen, is difficult due to the presence of many highly similar immunoglobulin proteins, each specified by distinct B lymphocytes. These challenges have precluded the use of conventional mass spectrometry for antibody identification based on peptide mass spectral matches to a genomic reference database. Recently, progress has been made using bottom-up analysis of serum antibodies by nanoflow liquid chromatography/high-resolution tandem mass spectrometry combined with a sample-specific antibody sequence database generated by high-throughput sequencing of individual B cell immunoglobulin variable domains (V genes). Here, we describe how intrinsic features of antibody primary structure, most notably the interspersed segments of variable and conserved amino acid sequences, generate recurring patterns in the corresponding peptide mass spectra of V gene peptides, greatly complicating the assignment of correct sequences to mass spectral data. We show that the standard method of decoy-based error modeling fails to account for the error introduced by these highly similar sequences, leading to a significant underestimation of the false discovery rate. Because of these effects, antibody-derived peptide mass spectra require increased stringency in their interpretation. The use of filters based on the mean precursor ion mass accuracy of peptide-spectrum matches is shown to be particularly effective in distinguishing between “true” and “false” identifications. These findings highlight important caveats associated with the use of standard database search and error-modeling methods with nonstandard data sets and custom sequence databases. PMID:24684310

  8. Occurrence of H2-Uptake Hydrogenases in Bradyrhizobium sp. (Lupinus) and Their Expression in Nodules of Lupinus spp. and Ornithopus compressus1

    PubMed Central

    Murillo, Jesús; Villa, Ana; Chamber, Manuel; Ruiz-Argüeso, Tomás

    1989-01-01

    Fifty-four strains of Bradyrhizobium sp. (Lupinus) from worldwide collections were screened by a colony hybridization method for the presence of DNA sequences homologous to the structural genes of the Bradyrhizobium japonicum hydrogenase. Twelve strains exhibited strong colony hybridization signals, and subsequent Southern blot hybridization experiments showed that they fell into two different groups on the basis of the pattern of EcoRI fragments containing the homology to the hup probe. All strains in the first group (UPM860, UPM861, and 750) expressed uptake hydrogenase activity in symbiosis with Lupinus albus, Lupinus angustifolius, Lupinus luteus, and Ornithopus compressus, but both the rate of H2 uptake by bacteroids and the relative efficiency of N2 fixation (RE = 1 - [H2 evolved in air/acetylene reduced]) by nodules were markedly affected by the legume host. L. angustifolius was the less permissive host for hydrogenase expression in symbiosis with the three strains (average RE = 0.76), and O. compressus was the more permissive (average RE = 1.0). None of the strains in the second group expressed hydrogenase activity in lupine nodules, and only one exhibited low H2-uptake activity in symbiosis with O. compressus. The inability of these putative Hup+ strains to induce hydrogenase activity in lupine nodules is discussed on the basis of the legume host effect. Among the 42 strains showing no homology to the B. japonicum hup-specific probe in the colony hybridization assay, 10 were examined in symbiosis with L. angustifolius. The average RE for these strains was 0.51. However, one strain, IM43B, exhibited high RE values (higher than 0.80) and high levels of hydrogenase activity in symbiosis with L. angustifolius, L. albus, and L. luteus. In Southern blot hybridization experiments, no homology was detected between the B. japonicum hup-specific DNA probe and total DNA from vegetative cells or bacteroids from strain IM43B even under low stringency hybridization conditions. We conclude from these results that strain IM43B contains hup DNA sequences different from those in B. japonicum and in other lupine rhizobia strains. Images Figure 1 Figure 2 PMID:16666550

  9. A rapid and accurate approach for prediction of interactomes from co-elution data (PrInCE).

    PubMed

    Stacey, R Greg; Skinnider, Michael A; Scott, Nichollas E; Foster, Leonard J

    2017-10-23

    An organism's protein interactome, or complete network of protein-protein interactions, defines the protein complexes that drive cellular processes. Techniques for studying protein complexes have traditionally applied targeted strategies such as yeast two-hybrid or affinity purification-mass spectrometry to assess protein interactions. However, given the vast number of protein complexes, more scalable methods are necessary to accelerate interaction discovery and to construct whole interactomes. We recently developed a complementary technique based on the use of protein correlation profiling (PCP) and stable isotope labeling in amino acids in cell culture (SILAC) to assess chromatographic co-elution as evidence of interacting proteins. Importantly, PCP-SILAC is also capable of measuring protein interactions simultaneously under multiple biological conditions, allowing the detection of treatment-specific changes to an interactome. Given the uniqueness and high dimensionality of co-elution data, new tools are needed to compare protein elution profiles, control false discovery rates, and construct an accurate interactome. Here we describe a freely available bioinformatics pipeline, PrInCE, for the analysis of co-elution data. PrInCE is a modular, open-source library that is computationally inexpensive, able to use label and label-free data, and capable of detecting tens of thousands of protein-protein interactions. Using a machine learning approach, PrInCE offers greatly reduced run time, more predicted interactions at the same stringency, prediction of protein complexes, and greater ease of use over previous bioinformatics tools for co-elution data. PrInCE is implemented in Matlab (version R2017a). Source code and standalone executable programs for Windows and Mac OSX are available at https://github.com/fosterlab/PrInCE , where usage instructions can be found. An example dataset and output are also provided for testing purposes. PrInCE is the first fast and easy-to-use data analysis pipeline that predicts interactomes and protein complexes from co-elution data. PrInCE allows researchers without bioinformatics expertise to analyze high-throughput co-elution datasets.

  10. Characterization of Dihydrofolate Reductase Genes from Trimethoprim-Susceptible and Trimethoprim-Resistant Strains of Enterococcus faecalis

    PubMed Central

    Coque, Teresa M.; Singh, Kavindra V.; Weinstock, George M.; Murray, Barbara E.

    1999-01-01

    Enterococci are usually susceptible in vitro to trimethoprim; however, high-level resistance (HLR) (MICs, >1,024 μg/ml) has been reported. We studied Enterococcus faecalis DEL, for which the trimethoprim MIC was >1,024 μg/ml. No transfer of resistance was achieved by broth or filter matings. Two different genes that conferred trimethoprim resistance when they were cloned in Escherichia coli (MICs, 128 and >1,024 μg/ml) were studied. One gene that coded for a polypeptide of 165 amino acids (MIC, 128 μg/ml for E. coli) was identical to dfr homologs that we cloned from a trimethoprim-susceptible E. faecalis strain, and it is presumed to be the intrinsic E. faecalis dfr gene (which causes resistance in E. coli when cloned in multiple copies); this gene was designated dfrE. The nucleotide sequence 5′ to this dfr gene showed similarity to thymidylate synthetase genes, suggesting that the dfr and thy genes from E. faecalis are located in tandem. The E. faecalis gene that conferred HLR to trimethoprim in E. coli, designated dfrF, codes for a predicted polypeptide of 165 amino acids with 38 to 64% similarity with other dihydrofolate reductases from gram-positive and gram-negative organisms. The nucleotide sequence 5′ to dfrF did not show similarity to the thy sequences. A DNA probe for dfrF hybridized under high-stringency conditions only to colony lysates of enterococci for which the trimethoprim MIC was >1,024 μg/ml; there was no hybridization to plasmid DNA from the strain of origin. To confirm that this gene causes trimethoprim resistance in enterococci, we cloned it into the integrative vector pAT113 and electroporated it into RH110 (E. faecalis OG1RF::Tn916ΔEm) (trimethoprim MIC, 0.5 μg/ml), which resulted in RH110 derivatives for which the trimethoprim MIC was >1,024 μg/ml. These results indicate that dfrF is an acquired but probably chromosomally located gene which is responsible for in vitro HLR to trimethoprim in E. faecalis. PMID:9869579

  11. Strategic parenting, birth order, and school performance.

    PubMed

    Hotz, V Joseph; Pantano, Juan

    2015-10-01

    Fueled by new evidence, there has been renewed interest about the effects of birth order on human capital accumulation. The underlying causal mechanisms for such effects remain unsettled. We consider a model in which parents impose more stringent disciplinary environments in response to their earlier-born children's poor performance in school in order to deter such outcomes for their later-born offspring. We provide robust empirical evidence that school performance of children in the National Longitudinal Study Children (NLSY-C) declines with birth order as does the stringency of their parents' disciplinary restrictions. When asked how they will respond if a child brought home bad grades, parents state that they would be less likely to punish their later-born children. Taken together, these patterns are consistent with a reputation model of strategic parenting.

  12. Yeast and bacterial diversity along a transect in an acidic, As-Fe rich environment revealed by cultural approaches.

    PubMed

    Delavat, François; Lett, Marie-Claire; Lièvremont, Didier

    2013-10-01

    Acid mine drainages (AMDs) are often thought to harbour low biodiversity, yet little is known about the diversity distribution along the drainages. Using culture-dependent approaches, the microbial diversity from the Carnoulès AMD sediment was investigated for the first time along a transect showing progressive environmental stringency decrease. In total, 20 bacterial genera were detected, highlighting a higher bacterial diversity than previously thought. Moreover, this approach led to the discovery of 16 yeast species, demonstrating for the first time the presence of this important phylogenetic group in this AMD. All in all, the location of the microbes along the transect helps to better understand their distribution in a pollution gradient. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Methodological guidelines for developing accident modification functions.

    PubMed

    Elvik, Rune

    2015-07-01

    This paper proposes methodological guidelines for developing accident modification functions. An accident modification function is a mathematical function describing systematic variation in the effects of road safety measures. The paper describes ten guidelines. An example is given of how to use the guidelines. The importance of exploratory analysis and an iterative approach in developing accident modification functions is stressed. The example shows that strict compliance with all the guidelines may be difficult, but represents a level of stringency that should be strived for. Currently the main limitations in developing accident modification functions are the small number of good evaluation studies and the often huge variation in estimates of effect. It is therefore still not possible to develop accident modification functions for very many road safety measures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Open-Air Biowarfare Testing and the Evolution of Values

    PubMed Central

    2016-01-01

    The United States and the United Kingdom ended outdoor biological warfare testing in populated areas nearly half a century ago. Yet, the conduct, health effects, and propriety of those tests remain controversial. The varied views reflect the limits of currently available test information and evolving societal values on research involving human subjects. Western political culture has changed since the early days of the American and British testing programs. People have become less reluctant to question authority, and institutional review boards must now pre-approve research involving human subjects. Further, the heightened stringency of laboratory containment has accentuated the safety gap between a confined test space and one without physical boundaries. All this makes it less likely that masses of people would again be unwittingly subjected to secret open-air biological warfare tests. PMID:27564984

  15. Strategic parenting, birth order, and school performance

    PubMed Central

    Pantano, Juan

    2015-01-01

    Fueled by new evidence, there has been renewed interest about the effects of birth order on human capital accumulation. The underlying causal mechanisms for such effects remain unsettled. We consider a model in which parents impose more stringent disciplinary environments in response to their earlier-born children’s poor performance in school in order to deter such outcomes for their later-born offspring. We provide robust empirical evidence that school performance of children in the National Longitudinal Study Children (NLSY-C) declines with birth order as does the stringency of their parents’ disciplinary restrictions. When asked how they will respond if a child brought home bad grades, parents state that they would be less likely to punish their later-born children. Taken together, these patterns are consistent with a reputation model of strategic parenting. PMID:26366045

  16. Selection of stable scFv antibodies by phage display.

    PubMed

    Brockmann, Eeva-Christine

    2012-01-01

    ScFv fragments are popular recombinant antibody formats but often suffer from limited stability. Phage display is a powerful tool in antibody engineering and applicable also for stability selection. ScFv variants with improved stability can be selected from large randomly mutated phage displayed libraries with a specific antigen after the unstable variants have been inactivated by heat or GdmCl. Irreversible scFv denaturation, which is a prerequisite for efficient selection, is achieved by combining denaturation with reduction of the intradomain disulfide bonds. Repeated selection cycles of increasing stringency result in enrichment of stabilized scFv fragments. Procedures for constructing a randomly mutated scFv library by error-prone PCR and phage display selection for enrichment of stable scFv antibodies from the library are described here.

  17. Identification and characterization of novel IGFBP5 interacting protein: evidence IGFBP5-IP is a potential regulator of osteoblast cell proliferation

    PubMed Central

    Amaar, Yousef G.; Tapia, Blanca; Chen, Shin-Tai; Baylink, David J.; Mohan, Subburaman

    2010-01-01

    Insulin-like growth factor binding protein-5 (IGFBP5) is a multifunctional protein, which acts not only as a traditional binding protein, but also functions as a growth factor independent of IGFs to stimulate bone formation. It has been predicted that the intrinsic growth factor action of IGFBP5 involves binding of IGFBP5 to a putative receptor to induce downstream signaling pathways and/or nuclear translocation of IGFBP5 to influence transcription of genes involved in osteoblast cell proliferation/differentiation. Our study indentified proteins that bound to IGFBP5 using IGFBP5 as bait in a yeast two-hybrid screen of the U2 human osteosarcoma cell cDNA library. One of the clones that interacted strongly with the bait under high-stringency conditions corresponded to a novel IGFBP5 interacting protein (IGFBP5-IP) encoded by a gene that resides in mouse chromosome 10. The interaction between IGFBP5-IP and IGFBP5 is confirmed by in vitro coimmunoprecipitation studies that used pFlag and IGFBP5 polyclonal antibody, and cell lysates overexpressing both IGFBP5-IP and IGFBP5. Northern blot and RT-PCR analysis showed that the IGFBP-IP is expressed in both untransformed normal human osteoblasts and in osteosarcoma cell lines, which are known to produce IGFBP5. To determine the roles of IGFBP5-IP, we evaluated the effect of blocking the expression of IGFBP5-IP on osteoblast proliferation. We found that using a IGFBP5-IP-specific small interfering-hairpin plasmid resulted in a decrease in both basal and IGFBP5-induced osteoblast cell proliferation. On the basis of these findings, we predict that IGFBP5-IP may act as intracellular mediator of growth promoting actions of IGFBP5 and perhaps other osteoregulatory agents in bone cells. PMID:16269403

  18. Cross-reactivity profiles of legumes and tree nuts using the xMAP® multiplex food allergen detection assay.

    PubMed

    Cho, Chung Y; Oles, Carolyn; Nowatzke, William; Oliver, Kerry; Garber, Eric A E

    2017-10-01

    The homology between proteins in legumes and tree nuts makes it common for individuals with food allergies to be allergic to multiple legumes and tree nuts. This propensity for allergenic and antigenic cross-reactivity means that commonly employed commercial immunodiagnostic assays (e.g., dipsticks) for the detection of food allergens may not always accurately detect, identify, and quantitate legumes and tree nuts unless additional orthogonal analytical methods or secondary measures of analysis are employed. The xMAP ® Multiplex Food Allergen Detection Assay (FADA) was used to determine the cross-reactivity patterns and the utility of multi-antibody antigenic profiling to distinguish between legumes and tree nuts. Pure legumes and tree nuts extracted using buffered detergent displayed a high level of cross-reactivity that decreased upon dilution or by using a buffer (UD buffer) designed to increase the stringency of binding conditions and reduce the occurrence of false positives due to plant-derived lectins. Testing for unexpected food allergens or the screening for multiple food allergens often involves not knowing the identity of the allergen present, its concentration, or the degree of modification during processing. As such, the analytical response measured may represent multiple antigens of varying antigenicity (cross-reactivity). This problem of multiple potential analytes is usually unresolved and the focus becomes the primary analyte, the antigen the antibody was raised against, or quantitative interpretation of the content of the analytical sample problematic. The alternative solution offered here to this problem is the use of an antigenic profile as generated by the xMAP FADA using multiple antibodies (bead sets). By comparing the antigenic profile to standards, the allergen may be identified along with an estimate of the concentration present. Cluster analysis of the xMAP FADA data was also performed and agreed with the known phylogeny of the legumes and tree nuts being analyzed. Graphical abstract The use of cluster analysis to compare the multi-antigen profiles of food allergens.

  19. Technological change, depletion and environmental policy in the offshore oil and gas industry

    NASA Astrophysics Data System (ADS)

    Managi, Shunsuke

    Technological change is central to maintaining standards of living in modern economies with finite resources and increasingly stringent environmental goals. Successful environmental policies can contribute to efficiency by encouraging, rather than inhibiting, technological innovation. However, little research to date has focused on the design and implementation of environmental regulations that encourage technological progress, or in insuring productivity improvements in the face of depletion of natural resources and increasing stringency of environmental regulations. This study models and measures productivity change, with an application to offshore oil and gas production in the Gulf of Mexico using Data Envelopment Analysis. This is an important application because energy resources are central to sustaining our economy. The net effects of technological progress and depletion on productivity of offshore oil and gas production are measured using a unique field-level set of data of production from all wells in the Gulf of Mexico over the time period from 1946--1998. Results are consistent with the hypothesis that technological progress has mitigated depletion effects over the study period, but the pattern differs from the conventional wisdom for nonrenewable resource industries. The Porter Hypothesis was recast, and revised version was tested. The Porter Hypothesis states that well designed environmental regulations can potentially contribute to productive efficiency in the long run by encouraging innovation. The Porter Hypothesis was recast to include market and nonmarket outputs. Our results support the recast version of Porter hypothesis, which examine productivity of joint production of market and environmental outputs. But we find no evidence for the standard formulation of the Porter hypothesis, that increased stringency of environmental regulation lead to increased productivity of market outputs and therefore increased industry profits. The model is used to forecast market and environmental outputs under alternative policy scenarios. Reliable baseline forecast and response to different policy actions of production and pollution are critical to the formation of sound energy and environmental policy. Forecast of production and pollution until year 2050 are generated from the model. Detailed policy scenarios provide quantitative assessments of potential benefits that indicate the significance of potential benefits of technological change and well-designed environmental policy.

  20. Global Scenarios of Air Pollution until 2030: Combining Air Quality, Climate Change and Energy Access Policies

    NASA Astrophysics Data System (ADS)

    Rao, S.; Dentener, F. J.; Klimont, Z.; Riahi, K.

    2011-12-01

    Outdoor air pollution is increasingly recognized as a significant contributor to global health outcomes. This has led to the implementation of a number of air quality policies worldwide, with total air pollution control costs in 2005 estimated at US$195 billion. More than 80% of the world's population is still found to be exposed to PM2.5 concentrations exceeding WHO air quality guidelines and health impacts resulting from these exposures estimated at around 2-5% of the global disease burden. Key questions to answer are 1) How will pollutant emissions evolve in the future given developments in the energy system and how will energy and environmental policies influence such emission trends. 2) What implications will this have for resulting exposures and related health outcomes. In order to answer these questions, varying levels of stringency of air quality legislation are analyzed in combination with policies on universal access to clean cooking fuels and limiting global temperature change to 2°C in 2100. Bottom-up methodologies using energy emissions modeling are used to derive sector-based pollutant emission trajectories until 2030. Emissions are spatially downscaled and used in combination with a global transport chemistry model to derive ambient concentrations of PM2.5. Health impacts of these exposures are further estimated consistent with WHO data and methodology. The results indicate that currently planned air quality legislation combined with rising energy demand will be insufficient in controlling future emissions growth in developing countries. In order to achieve significant reductions in pollutant emissions of the order of more than 50% from 2005 levels and reduce exposures to levels consistent with WHO standards, it will be necessary to increase the stringency of such legislations and combine them with policies on energy access and climate change. Combined policies also result in reductions in air pollution control costs as compared to those associated with current legislations. Health related co-benefits of combined policies are also found to be large, especially in developing countries- a reduction of more than 50% in terms of pollution related mortality impacts as compared to today.

  1. Purification and characterization of a GH43 β-xylosidase from Enterobacter sp. identified and cloned from forest soil bacteria.

    PubMed

    Campos, Eleonora; Negro Alvarez, María José; Sabarís di Lorenzo, Gonzalo; Gonzalez, Sergio; Rorig, Marcela; Talia, Paola; Grasso, Daniel H; Sáez, Felicia; Manzanares Secades, Paloma; Ballesteros Perdices, Mercedes; Cataldi, Angel A

    2014-01-01

    The use of lignocellulosic biomass for second generation biofuels requires optimization of enzymatic breakdown of plant cell walls. In this work, cellulolytic bacteria were isolated from a native and two cultivated forest soil samples. Amplification of glycosyl hydrolases was attempted by using a low stringency-degenerate primer PCR strategy, using total soil DNA and bulk DNA pooled from positive colonies as template. A set of primers was designed based on Acidothermus cellulolyticus genome, by search of conserved domains of glycosyl hydrolases (GH) families of interest. Using this approach, a fragment containing an open reading frame (ORF) with 98% identity to a putative GH43 beta-xylosidase coding gene from Enterobacter cloacae was amplified and cloned. The full protein was expressed in Escherichia coli as N-terminal or C-terminal His-tagged fusions and purified under native conditions. Only N-terminal fusion protein, His-Xyl43, presented beta-xylosidase activity. On pNPX, optimal activity was achieved at pH 6 and 40 °C and Km and Kcat values were 2.92 mM and 1.32 seg(-1), respectively. Activity was also demonstrated on xylobiose (X2), with Km 17.8 mM and Kcat 380 s(-1). These results demonstrated that Xyl43 is a functional beta-xylosidase and it is the first evidence of this activity for Enterobacter sp. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Detection of cystic fibrosis transmembrane conductance regulator ΔF508 gene mutation using a paper-based nucleic acid hybridization assay and a smartphone camera.

    PubMed

    Malhotra, Karan; Noor, M Omair; Krull, Ulrich J

    2018-05-29

    Diagnostic technology that makes use of paper platforms in conjunction with the ubiquitous availability of digital cameras in cellular telephones and personal assistive devices offers opportunities for development of bioassays that are cost effective and widely distributed. Assays that operate effectively in aqueous solution require further development for implementation in paper substrates, overcoming issues associated with surface interactions on a matrix that offers a large surface-to-volume ratio and constraints on convective mixing. This report presents and compares two related methods for determination of oligonucleotides that serve as indicators of cystic fibrosis, differentiating between the normal wild-type sequence, and a mutant-type sequence that has a 3-base replacement. The transduction strategy operates by selective hybridization of oligonucleotide probes that are conjugated to fluorescent quantum dots, where hybridization of target sequences causes a molecular fluorophore to approach the quantum dot and become emissive through fluorescence resonance energy transfer. Detection can rely on hybridization of a target that is labelled with Cy3 fluorophore, or in the presence of an unlabelled target when a sandwich assay format is implemented with a labelled reporter oligonucleotide. Selectivity to determine the presence of mismatched sequences involves appropriate selection of nucleotide sequences to set melt temperatures, in conjunction with control of stringency conditions using formamide as a chaotrope. It was determined that both direct and sandwich assays on paper substrates are able to distinguish between wild-type and mutant-type samples.

  3. Air quality co-benefits of carbon pricing in China

    NASA Astrophysics Data System (ADS)

    Li, Mingwei; Zhang, Da; Li, Chiao-Ting; Mulvaney, Kathleen M.; Selin, Noelle E.; Karplus, Valerie J.

    2018-05-01

    Climate policies targeting energy-related CO2 emissions, which act on a global scale over long time horizons, can result in localized, near-term reductions in both air pollution and adverse human health impacts. Focusing on China, the largest energy-using and CO2-emitting nation, we develop a cross-scale modelling approach to quantify these air quality co-benefits, and compare them to the economic costs of climate policy. We simulate the effects of an illustrative climate policy, a price on CO2 emissions. In a policy scenario consistent with China's recent pledge to reach a peak in CO2 emissions by 2030, we project that national health co-benefits from improved air quality would partially or fully offset policy costs depending on chosen health valuation. Net health co-benefits are found to rise with increasing policy stringency.

  4. RIEMS: a software pipeline for sensitive and comprehensive taxonomic classification of reads from metagenomics datasets.

    PubMed

    Scheuch, Matthias; Höper, Dirk; Beer, Martin

    2015-03-03

    Fuelled by the advent and subsequent development of next generation sequencing technologies, metagenomics became a powerful tool for the analysis of microbial communities both scientifically and diagnostically. The biggest challenge is the extraction of relevant information from the huge sequence datasets generated for metagenomics studies. Although a plethora of tools are available, data analysis is still a bottleneck. To overcome the bottleneck of data analysis, we developed an automated computational workflow called RIEMS - Reliable Information Extraction from Metagenomic Sequence datasets. RIEMS assigns every individual read sequence within a dataset taxonomically by cascading different sequence analyses with decreasing stringency of the assignments using various software applications. After completion of the analyses, the results are summarised in a clearly structured result protocol organised taxonomically. The high accuracy and performance of RIEMS analyses were proven in comparison with other tools for metagenomics data analysis using simulated sequencing read datasets. RIEMS has the potential to fill the gap that still exists with regard to data analysis for metagenomics studies. The usefulness and power of RIEMS for the analysis of genuine sequencing datasets was demonstrated with an early version of RIEMS in 2011 when it was used to detect the orthobunyavirus sequences leading to the discovery of Schmallenberg virus.

  5. Curcumin Loaded-PLGA Nanoparticles Conjugated with Tet-1 Peptide for Potential Use in Alzheimer's Disease

    PubMed Central

    Mathew, Anila; Fukuda, Takahiro; Nagaoka, Yutaka; Hasumura, Takashi; Morimoto, Hisao; Yoshida, Yasuhiko; Maekawa, Toru; Venugopal, Kizhikkilot; Kumar, D. Sakthi

    2012-01-01

    Alzheimer's disease is a growing concern in the modern world. As the currently available medications are not very promising, there is an increased need for the fabrication of newer drugs. Curcumin is a plant derived compound which has potential activities beneficial for the treatment of Alzheimer's disease. Anti-amyloid activity and anti-oxidant activity of curcumin is highly beneficial for the treatment of Alzheimer's disease. The insolubility of curcumin in water restricts its use to a great extend, which can be overcome by the synthesis of curcumin nanoparticles. In our work, we have successfully synthesized water-soluble PLGA coated- curcumin nanoparticles and characterized it using different techniques. As drug targeting to diseases of cerebral origin are difficult due to the stringency of blood-brain barrier, we have coupled the nanoparticle with Tet-1 peptide, which has the affinity to neurons and possess retrograde transportation properties. Our results suggest that curcumin encapsulated-PLGA nanoparticles are able to destroy amyloid aggregates, exhibit anti-oxidative property and are non-cytotoxic. The encapsulation of the curcumin in PLGA does not destroy its inherent properties and so, the PLGA-curcumin nanoparticles can be used as a drug with multiple functions in treating Alzheimer's disease proving it to be a potential therapeutic tool against this dreaded disease. PMID:22403681

  6. Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

    PubMed

    Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

    2005-08-01

    In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

  7. Impact of HLA diversity on donor selection in organ and stem cell transplantation.

    PubMed

    Tiercy, Jean-Marie; Claas, Frans

    2013-01-01

    The human major histocompatibility complex is a multigene system encoding polymorphic human leucocyte antigens (HLA) that present peptides derived from pathogens to the immune system. The high diversity of HLA alleles and haplotypes in the worldwide populations represents a major barrier to organ and allogeneic hematopoietic stem cell transplantation, because HLA incompatibilities are efficiently recognized by T and B lymphocytes. In organ transplantation, pre-transplant anti-HLA antibodies need to be taken into account for organ allocation. Although HLA-incompatible transplants can be performed thanks to immunosuppressive drugs, the de novo production of anti-HLA antibodies still represents a major cause of graft failure. The HLAMatchmaker computer algorithm determines the immunogenicity of HLA mismatches and allows to define HLA antigens that will not induce an antibody response. Because of the much higher stringency of HLA compatibility criteria in stem cell transplantation, the best donor is a HLA genotypically identical sibling. However, more than 50% of the transplants are now performed with hematopoietic stem cells from volunteer donors selected from the international registry. The development of European national registries covering populations with different HLA haplotype frequencies is essential for optimizing donor search algorithms and providing the best chance for European patients to find a fully compatible donor.

  8. Stomatal kinetics and photosynthetic gas exchange along a continuum of isohydric to anisohydric regulation of plant water status.

    PubMed

    Meinzer, Frederick C; Smith, Duncan D; Woodruff, David R; Marias, Danielle E; McCulloh, Katherine A; Howard, Ava R; Magedman, Alicia L

    2017-08-01

    Species' differences in the stringency of stomatal control of plant water potential represent a continuum of isohydric to anisohydric behaviours. However, little is known about how quasi-steady-state stomatal regulation of water potential may relate to dynamic behaviour of stomata and photosynthetic gas exchange in species operating at different positions along this continuum. Here, we evaluated kinetics of light-induced stomatal opening, activation of photosynthesis and features of quasi-steady-state photosynthetic gas exchange in 10 woody species selected to represent different degrees of anisohydry. Based on a previously developed proxy for the degree of anisohydry, species' leaf water potentials at turgor loss, we found consistent trends in photosynthetic gas exchange traits across a spectrum of isohydry to anisohydry. More anisohydric species had faster kinetics of stomatal opening and activation of photosynthesis, and these kinetics were closely coordinated within species. Quasi-steady-state stomatal conductance and measures of photosynthetic capacity and performance were also greater in more anisohydric species. Intrinsic water-use efficiency estimated from leaf gas exchange and stable carbon isotope ratios was lowest in the most anisohydric species. In comparisons between gas exchange traits, species rankings were highly consistent, leading to species-independent scaling relationships over the range of isohydry to anisohydry observed. © 2017 John Wiley & Sons Ltd.

  9. Integration of zebrafish fin regeneration genes with expression data of human tumors in silico uncovers potential novel melanoma markers.

    PubMed

    Hagedorn, Martin; Siegfried, Géraldine; Hooks, Katarzyna B; Khatib, Abdel-Majid

    2016-11-01

    Tissue regeneration requires expression of a large, unknown number of genes to initiate and maintain cellular processes such as proliferation, extracellular matrix synthesis, differentiation and migration. A unique model to simulate this process in a controlled manner is the re-growth of the caudal fin of zebrafish after amputation. Within this tissue stem cells differentiate into fibroblasts, epithelial and endothelial cells as well as melanocytes. Many genes implicated in the regeneration process are deregulated in cancer. We therefore undertook a systematic gene expression study to identify genes upregulated during the re-growth of caudal fin tissue. By applying a high stringency cut-off value of 4-fold change, we identified 54 annotated genes significantly overexpressed in regenerating blastema. Further bioinformatics data mining studies showed that 22 out of the 54 regeneration genes where overexpressed in melanoma compared to normal skin or other cancers. Whereas the role of TNC (tenascin C) and FN1 (fibronectin 1) in melanoma development is well documented, implication of MARCKS, RCN3, BAMBI, PEA3/ETV4 and the FK506 family members FKBP7, FKBP10 and FKBP11 in melanoma progression is unclear. Corresponding proteins were detected in melanoma tissue but not in normal skin. High expression of FKBP7, DPYSL5 and MDK was significantly associated with poor survival. We discuss a potential role of these novel melanoma genes, which have promising potential as new therapeutic targets or diagnostic markers.

  10. Molecular blood typing augments serologic testing and allows for enhanced matching of red blood cells for transfusion in patients with sickle cell disease.

    PubMed

    Wilkinson, Katie; Harris, Samantha; Gaur, Prashant; Haile, Askale; Armour, Rosalind; Teramura, Gayle; Delaney, Meghan

    2012-02-01

    Sickle cell disease (SCD) patients have dissimilar red blood cell (RBC) phenotypes compared to the primarily Caucasian blood donor base due, in part, to underlying complex Rh and silenced Duffy expression. Gene array-based technology offers high-throughput antigen typing of blood donors and can identify patients with altered genotypes. The purpose of the study was to ascertain if RBC components drawn from predominantly Caucasian donors could provide highly antigen-matched products for molecularly typed SCD patients. SCD patients were genotyped by a molecular array (HEA Beadchip, BioArray Solutions). The extended antigen phenotype (C, c, E, e, K, k, Jk(a) , Jk(b) , Fy(a) , Fy(b) , S, s) was used to query the inventory using different matching algorithms; the resulting number of products was recorded. A mean of 96.2 RBC products was available for each patient at basic-level, 34 at mid-level, and 16.3 at high-level stringency. The number of negative antigens correlated negatively with the number of available products. The Duffy silencing mutation in the promoter region (67T>C) (GATA) was found in 96.5% of patients. Allowing Fy(b+) products for patients with GATA increased the number of available products by up to 180%, although it does not ensure prevention of Duffy antibodies in all patients. This feasibility study provides evidence that centers with primarily Caucasian donors may be able to provide highly antigen-matched products. Knowledge of the GATA status expands the inventory of antigen-matched products. Further work is needed to determine the most clinically appropriate match level for SCD patients. © 2012 American Association of Blood Banks.

  11. The relative impact of climate change mitigation policies and socioeconomic drivers on water scarcity - An integrated assessment modeling approach

    NASA Astrophysics Data System (ADS)

    Hejazi, M. I.; Edmonds, J. A.; Clarke, L. E.; Kyle, P.; Davies, E. G.; Chaturvedi, V.; Patel, P.; Eom, J.; Wise, M.; Kim, S.; Calvin, K. V.; Moss, R. H.

    2012-12-01

    We investigate the relative effects of climate emission mitigation policies and socioeconomic drivers on water scarcity conditions over the 21st century both globally and regionally, by estimating both water availability and demand within a technologically-detailed global integrated assessment model of energy, agriculture, and climate change - the Global Change Assessment Model (GCAM). We first develop a global gridded monthly hydrologic model that reproduces historical streamflow observations and simulates the future availability of freshwater under both a changing climate and an evolving landscape, and incorporate this model into GCAM. We then develop and incorporate technologically oriented representations of water demands for the agricultural (irrigation and livestock), energy (electricity generation, primary energy production and processing), industrial (manufacturing and mining), and municipal sectors. The energy, industrial, and municipal sectors are represented in fourteen geopolitical regions, with the agricultural sector further disaggregated into as many as eighteen agro-ecological zones (AEZs) within each region. To perform the water scarcity analysis at the grid scale, the global water demands for the six demand sectors are spatially downscaled to 0.5 o x 0.5o resolution to match the scale of GWAM. The water scarcity index (WSI) compares total water demand to the total amount of renewable water available, and defines extreme water scarcity in any region as demand greater than 40% of total water availability. Using a reference scenario (i.e., no climate change mitigation policy) with radiative forcing reaching 8.8 W/m2 by 2095 and a global population of 14 billion, global annual water demand grows from about 9% of total annual renewable freshwater in 2005 to about 32% by 2095. This results in almost half of the world population living under extreme water scarcity by the end of the 21st century. Regionally, the demands for water exceed the total renewable freshwater available in two GCAM regions, the Middle East and India. Additionally, 20% and 27% of the global population in years 2050 and 2095, respectively, is projected to live in areas (grid cells) that will experience greater water demands than the amount of renewable water available in a year (i.e., WSI > 1.0). We also investigate the effects of emission mitigation policies on water demand and compare them to the contribution of socioeconomic drivers both globally and regionally. Three climate policy scenarios with increasing mitigation stringency of 7.7, 5.5, and 4.2 W/m2 in year 2095, under two carbon tax regimes (a universal carbon tax (UCT) which includes land use change emissions, and a fossil fuel and industrial emissions carbon tax (FFICT) which excludes land use change emissions) are analyzed. With more stringent climate mitigation targets, water scarcity declines under a UCT mitigation policy while increases with a FFICT mitigation scenario by the year 2095. The decreasing trend with UCT policy stringency is due to substitution from more water-intensive to less water-intensive choices in food, energy, and land use. Under the FFICT scenario, water scarcity is projected to increase driven by higher water demands for bio-energy crops.

  12. Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

    PubMed

    Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

    2011-01-01

    The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

  13. Characterization of Staphylococcus caprae Clinical Isolates Involved in Human Bone and Joint Infections, Compared with Goat Mastitis Isolates.

    PubMed

    d'Ersu, J; Aubin, G G; Mercier, P; Nicollet, P; Bémer, P; Corvec, S

    2016-01-01

    Staphylococcus caprae is an emerging microorganism in human bone and joint infections (BJI). The aim of this study is to describe the features of S. caprae isolates involved in BJI (H for human) compared with those of isolates recovered in goat mastitis (A for animal). Fourteen isolates of each origin were included. Identifications were performed using a Vitek 2 GP ID card, tuf gene sequencing, and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) Vitek MS. Molecular typing was carried out using pulsed-field gel electrophoresis (PFGE) and DiversiLab technology. The crystal violet method was used to determine biofilm-forming ability. Virulence factors were searched by PCR. Vitek MS technology provides an accurate identification for the two types of isolates compared to that of gold-standard sequencing (sensitivity, 96.4%), whereas the Vitek 2 GP ID card was more effective for H isolates. Molecular typing methods revealed two distinct lineages corresponding to the origin despite few overlaps: H and A. In our experimental conditions, no significant difference was observed in biofilm production ability between H and A isolates. Nine isolates (5 H isolates and 4 A isolates) behaved as weak producers while one A isolate was a strong producer. Concerning virulence factors, the autolysin atlC and the serine aspartate adhesin (sdrZ) genes were detected in 24 isolates (86%), whereas the lipase gene was always detected, except in one H isolate (96%). The ica operon was present in 23 isolates (82%). Fibrinogen-binding (fbe) or collagen-binding (cna) genes were not detected by using primers designed for Staphylococcus aureus or Staphylococcus epidermidis, even in low stringency conditions. Although S. caprae probably remains underestimated in human infections, further studies are needed to better understand the evolution and the adaptation of this species to its host. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Deep proteomic profiling of vasopressin-sensitive collecting duct cells. I. Virtual Western blots and molecular weight distributions.

    PubMed

    Yang, Chin-Rang; Tongyoo, Pumipat; Emamian, Milad; Sandoval, Pablo C; Raghuram, Viswanathan; Knepper, Mark A

    2015-12-15

    The mouse mpkCCD cell line is a continuous cultured epithelial cell line with characteristics of renal collecting duct principal cells. This line is widely used to study epithelial transport and its regulation. To provide a data resource useful for experimental design and interpretation in studies using mpkCCD cells, we have carried out "deep" proteomic profiling of these cells using three levels of fractionation (differential centrifugation, SDS-PAGE, and HPLC) followed by tandem mass spectrometry to identify and quantify proteins. The analysis of all resulting samples generated 34.6 gigabytes of spectral data. As a result, we identified 6,766 proteins in mpkCCD cells at a high level of stringency. These proteins are expressed over eight orders of magnitude of protein abundance. The data are provided to users as a public data base (https://helixweb.nih.gov/ESBL/Database/mpkFractions/). The mass spectrometry data were mapped back to their gel slices to generate "virtual Western blots" for each protein. For most of the 6,766 proteins, the apparent molecular weight from SDS-PAGE agreed closely with the calculated molecular weight. However, a substantial fraction (>15%) of proteins was found to run aberrantly, with much higher or much lower mobilities than predicted. These proteins were analyzed to identify mechanisms responsible for altered mobility on SDS-PAGE, including high or low isoelectric point, high or low hydrophobicity, physiological cleavage, residence in the lysosome, posttranslational modifications, and expression of alternative isoforms due to alternative exon usage. Additionally, this analysis identified a previously unrecognized isoform of aquaporin-2 with apparent molecular mass <20 kDa. Copyright © 2015 the American Physiological Society.

  15. Deep proteomic profiling of vasopressin-sensitive collecting duct cells. I. Virtual Western blots and molecular weight distributions

    PubMed Central

    Yang, Chin-Rang; Tongyoo, Pumipat; Emamian, Milad; Sandoval, Pablo C.; Raghuram, Viswanathan

    2015-01-01

    The mouse mpkCCD cell line is a continuous cultured epithelial cell line with characteristics of renal collecting duct principal cells. This line is widely used to study epithelial transport and its regulation. To provide a data resource useful for experimental design and interpretation in studies using mpkCCD cells, we have carried out “deep” proteomic profiling of these cells using three levels of fractionation (differential centrifugation, SDS-PAGE, and HPLC) followed by tandem mass spectrometry to identify and quantify proteins. The analysis of all resulting samples generated 34.6 gigabytes of spectral data. As a result, we identified 6,766 proteins in mpkCCD cells at a high level of stringency. These proteins are expressed over eight orders of magnitude of protein abundance. The data are provided to users as a public data base (https://helixweb.nih.gov/ESBL/Database/mpkFractions/). The mass spectrometry data were mapped back to their gel slices to generate “virtual Western blots” for each protein. For most of the 6,766 proteins, the apparent molecular weight from SDS-PAGE agreed closely with the calculated molecular weight. However, a substantial fraction (>15%) of proteins was found to run aberrantly, with much higher or much lower mobilities than predicted. These proteins were analyzed to identify mechanisms responsible for altered mobility on SDS-PAGE, including high or low isoelectric point, high or low hydrophobicity, physiological cleavage, residence in the lysosome, posttranslational modifications, and expression of alternative isoforms due to alternative exon usage. Additionally, this analysis identified a previously unrecognized isoform of aquaporin-2 with apparent molecular mass <20 kDa. PMID:26310816

  16. Characterization of human MMTV-like (HML) elements similar to a sequence that was highly expressed in a human breast cancer: further definition of the HML-6 group.

    PubMed

    Yin, H; Medstrand, P; Kristofferson, A; Dietrich, U; Aman, P; Blomberg, J

    1999-03-30

    Previously, we found a retroviral sequence, HML-6.2BC1, to be expressed at high levels in a multifocal ductal breast cancer from a 41-year-old woman who also developed ovarian carcinoma. The sequence of a human genomic clone (HML-6.28) selected by high-stringency hybridization with HML-6.2BC1 is reported here. It was 99% identical to HML-6.2BC1 and gave the same restriction fragments as total DNA. HML-6.28 is a 4.7-kb provirus with a 5'LTR, truncated in RT. Data from two similar genomic clones and sequences found in GenBank are also reported. Overlaps between them gave a rather complete picture of the HML-6.2BC1-like human endogenous retroviral elements. Work with somatic cell hybrids and FISH localized HML-6.28 to chromosome 6, band p21, close to the MHC region. The causal role of HML-6.28 in breast cancer remains unclear. Nevertheless, the ca. 20 Myr old HML-6 sequences enabled the definition of common and unique features of type A, B, and D (ABD) retroviruses. In Gag, HML-6 has no intervening sequences between matrix and capsid proteins, unlike extant exogenous ABD viruses, possibly an ancestral feature. Alignment of the dUTPase showed it to be present in all ABD viruses, but gave a phylogenetic tree different from trees made from other ABD genes, indicating a distinct phylogeny of dUTPase. A conserved 24-mer sequence in the amino terminus of some ABD envelope genes suggested a conserved function. Copyright 1999 Academic Press.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  18. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central

    2012-01-01

    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These two factors are sequence dependent and have a large impact on probe intensity. The results presented here provide novel insight into the effect of probe synthesis errors on Affymetrix microarrays; furthermore, the algorithms developed in this work provide useful tools for the analysis of cross-hybridization, probe synthesis efficiency, fragmentation, wash stringency, temperature, and salt concentration on microarray intensities. PMID:23270536

  19. Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

    1988-05-01

    Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

  20. PlantTribes: a gene and gene family resource for comparative genomics in plants

    PubMed Central

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2008-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, called tribes, using three clustering stringencies (low, medium and high). For all tribes, we have generated protein and DNA alignments and maximum-likelihood phylogenetic trees. A parallel database of microarray experimental results is linked to the genes, which lets researchers identify groups of related genes and their expression patterns. Unified nomenclatures were developed, and tribes can be related to traditional gene families and conserved domain identifiers. SuperTribes, constructed through a second iteration of MCL clustering, connect distant, but potentially related gene clusters. The global classification of nearly 200 000 plant proteins was used as a scaffold for sorting ∼4 million additional cDNA sequences from over 200 plant species. All data and analyses are accessible through a flexible interface allowing users to explore the classification, to place query sequences within the classification, and to download results for further study. PMID:18073194

  1. An Atlas of Soybean Small RNAs Identifies Phased siRNAs from Hundreds of Coding Genes[W

    PubMed Central

    Kakrana, Atul; Huang, Kun; Zhai, Jixian; Yan, Zhe; Valdés-López, Oswaldo; Prince, Silvas; Musket, Theresa A.; Stacey, Gary

    2014-01-01

    Small RNAs are ubiquitous, versatile repressors and include (1) microRNAs (miRNAs), processed from mRNA forming stem-loops; and (2) small interfering RNAs (siRNAs), the latter derived in plants by a process typically requiring an RNA-dependent RNA polymerase. We constructed and analyzed an expression atlas of soybean (Glycine max) small RNAs, identifying over 500 loci generating 21-nucleotide phased siRNAs (phasiRNAs; from PHAS loci), of which 483 overlapped annotated protein-coding genes. Via the integration of miRNAs with parallel analysis of RNA end (PARE) data, 20 miRNA triggers of 127 PHAS loci were detected. The primary class of PHAS loci (208 or 41% of the total) corresponded to NB-LRR genes; some of these small RNAs preferentially accumulate in nodules. Among the PHAS loci, novel representatives of TAS3 and noncanonical phasing patterns were also observed. A noncoding PHAS locus, triggered by miR4392, accumulated preferentially in anthers; the phasiRNAs are predicted to target transposable elements, with their peak abundance during soybean reproductive development. Thus, phasiRNAs show tremendous diversity in dicots. We identified novel miRNAs and assessed the veracity of soybean miRNAs registered in miRBase, substantially improving the soybean miRNA annotation, facilitating an improvement of miRBase annotations and identifying at high stringency novel miRNAs and their targets. PMID:25465409

  2. Assuring SS7 dependability: A robustness characterization of signaling network elements

    NASA Astrophysics Data System (ADS)

    Karmarkar, Vikram V.

    1994-04-01

    Current and evolving telecommunication services will rely on signaling network performance and reliability properties to build competitive call and connection control mechanisms under increasing demands on flexibility without compromising on quality. The dimensions of signaling dependability most often evaluated are the Rate of Call Loss and End-to-End Route Unavailability. A third dimension of dependability that captures the concern about large or catastrophic failures can be termed Network Robustness. This paper is concerned with the dependability aspects of the evolving Signaling System No. 7 (SS7) networks and attempts to strike a balance between the probabilistic and deterministic measures that must be evaluated to accomplish a risk-trend assessment to drive architecture decisions. Starting with high-level network dependability objectives and field experience with SS7 in the U.S., potential areas of growing stringency in network element (NE) dependability are identified to improve against current measures of SS7 network quality, as per-call signaling interactions increase. A sensitivity analysis is presented to highlight the impact due to imperfect coverage of duplex network component or element failures (i.e., correlated failures), to assist in the setting of requirements on NE robustness. A benefit analysis, covering several dimensions of dependability, is used to generate the domain of solutions available to the network architect in terms of network and network element fault tolerance that may be specified to meet the desired signaling quality goals.

  3. Phylotranscriptomic analysis uncovers a wealth of tissue inhibitor of metalloproteinases variants in echinoderms

    PubMed Central

    Clouse, Ronald M.; Linchangco, Gregorio V.; Kerr, Alexander M.; Reid, Robert W.; Janies, Daniel A.

    2015-01-01

    Tissue inhibitors of metalloproteinases (TIMPs) help regulate the extracellular matrix (ECM) in animals, mostly by inhibiting matrix metalloproteinases (MMPs). They are important activators of mutable collagenous tissue (MCT), which have been extensively studied in echinoderms, and the four TIMP copies in humans have been studied for their role in cancer. To understand the evolution of TIMPs, we combined 405 TIMPs from an echinoderm transcriptome dataset built from 41 specimens representing all five classes of echinoderms with variants from protostomes and chordates. We used multiple sequence alignment with various stringencies of alignment quality to cull highly divergent sequences and then conducted phylogenetic analyses using both nucleotide and amino acid sequences. Phylogenetic hypotheses consistently recovered TIMPs as diversifying in the ancestral deuterostome and these early lineages continuing to diversify in echinoderms. The four vertebrate TIMPs diversified from a single copy in the ancestral chordate, all other copies being lost. Consistent with greater MCT needs owing to body wall liquefaction, evisceration, autotomy and reproduction by fission, holothuroids had significantly more TIMPs and higher read depths per contig. Ten cysteine residues, an HPQ binding site and several other residues were conserved in at least 70% of all TIMPs. The conservation of binding sites and the placement of echinoderm TIMPs involved in MCT modification suggest that ECM regulation remains the primary function of TIMP genes, although within this role there are a large number of specialized copies. PMID:27017967

  4. Changes in gene expression in human renal proximal tubule cells exposed to low concentrations of S-(1,2-dichlorovinyl)-L-cysteine, a metabolite of trichloroethylene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lock, Edward A.; Barth, Jeremy L.; Argraves, Scott W.

    2006-10-15

    Epidemiology studies suggest that there may be a weak association between high level exposure to trichloroethylene (TCE) and renal tubule cell carcinoma. Laboratory animal studies have shown an increased incidence of renal tubule carcinoma in male rats but not mice. TCE can undergo metabolism via glutathione (GSH) conjugation to form metabolites that are known to be nephrotoxic. The GSH conjugate, S-(1,2-dichlorovinyl)glutathione (DCVG), is processed further to the cysteine conjugate, S-(1,2-dichlorovinyl)-L-cysteine (DCVC), which is the penultimate nephrotoxic species. We have cultured human renal tubule cells (HRPTC) in serum-free medium under a variety of different culture conditions and observed growth, respiratory controlmore » and glucose transport over a 20 day period in medium containing low glucose. Cell death was time- and concentration-dependent, with the EC{sub 5} for DCVG being about 3 {mu}M and for DCVC about 7.5 {mu}M over 10 days. Exposure of HRPTC to sub-cytotoxic doses of DCVC (0.1 {mu}M and 1 {mu}M for 10 days) led to a small number of changes in gene expression, as determined by transcript profiling with Affymetrix human genome chips. Using the criterion of a mean 2-fold change over control for the four samples examined, 3 genes at 0.1 {mu}M DCVC increased, namely, adenosine kinase, zinc finger protein X-linked and an enzyme with lyase activity. At 1 {mu}M DCVC, two genes showed a >2-fold decrease, N-acetyltransferase 8 and complement factor H. At a lower stringency (1.5-fold change), a total of 63 probe sets were altered at 0.1 {mu}M DCVC and 45 at 1 {mu}M DCVC. Genes associated with stress, apoptosis, cell proliferation and repair and DCVC metabolism were altered, as were a small number of genes that did not appear to be associated with the known mode of action of DCVC. Some of these genes may serve as molecular markers of TCE exposure and effects in the human kidney.« less

  5. Mapping-by-sequencing of Ligon-lintless-1 (Li 1 ) reveals a cluster of neighboring genes with correlated expression in developing fibers of Upland cotton (Gossypium hirsutum L.).

    PubMed

    Thyssen, Gregory N; Fang, David D; Turley, Rickie B; Florane, Christopher; Li, Ping; Naoumkina, Marina

    2015-09-01

    Mapping-by-sequencing and SNP marker analysis were used to fine map the Ligon-lintless-1 ( Li 1 ) short fiber mutation in tetraploid cotton to a 255-kb region that contains 16 annotated proteins. The Ligon-lintless-1 (Li 1 ) mutant of cotton (Gossypium hirsutum L.) has been studied as a model for cotton fiber development since its identification in 1929; however, the causative mutation has not been identified yet. Here we report the fine genetic mapping of the mutation to a 255-kb region that contains only 16 annotated genes in the reference Gossypium raimondii genome. We took advantage of the incompletely dominant dwarf vegetative phenotype to identify 100 mutants (Li 1 /Li 1 ) and 100 wild-type (li 1 /li 1 ) homozygotes from a mapping population of 2567 F2 plants, which we bulked and deep sequenced. Since only homozygotes were sequenced, we were able to use a high stringency in SNP calling to rapidly narrow down the region harboring the Li 1 locus, and designed subgenome-specific SNP markers to test the population. We characterized the expression of all sixteen genes in the region by RNA sequencing of elongating fibers and by RT-qPCR at seven time points spanning fiber development. One of the most highly expressed genes found in this interval in wild-type fiber cells is 40-fold under-expressed at the day of anthesis (DOA) in the mutant fiber cells.  This gene is a major facilitator superfamily protein, part of the large family of proteins that includes auxin and sugar transporters. Interestingly, nearly all genes in this region were most highly expressed at DOA and showed a high degree of co-expression. Further characterization is required to determine if transport of hormones or carbohydrates is involved in both the dwarf and lintless phenotypes of Li 1 plants.

  6. Effect of government actions on technological innovation for SO2 control.

    PubMed

    Taylor, Margaret R; Rubin, Edward S; Hounshell, David A

    2003-10-15

    The relationship between government actions and innovation in environmental control technology is important for the design of cost-effective policies to achieve environmental goals. This paper examines such relationships for the case of sulfur dioxide control technology for U.S. coal-fired power plants. The study employs several complementary research methods, including analyses of key government actions, technology patenting activity, technology performance and cost trends, knowledge transfer activities, and expert elicitations. Our results indicate that government regulation appears to be a greater stimulus to inventive activity than government-sponsored research support alone, and that the anticipation of regulation also spurs inventive activity. Regulatory stringency focuses this activity along particular technical pathways and is a key factor in creating markets for environmental technologies. We also find that with greater technology adoption, both new and existing systems experience notable efficiency improvements and capital cost reductions. The important role of government in fostering knowledge transfer via technical conferences and other measures is also seen as an important factor in promoting environmental technology innovation.

  7. Correlation between Mitochondrial Reactive Oxygen and Severity of Atherosclerosis.

    PubMed

    Dorighello, Gabriel G; Paim, Bruno A; Kiihl, Samara F; Ferreira, Mônica S; Catharino, Rodrigo R; Vercesi, Anibal E; Oliveira, Helena C F

    2016-01-01

    Atherosclerosis has been associated with mitochondria dysfunction and damage. Our group demonstrated previously that hypercholesterolemic mice present increased mitochondrial reactive oxygen (mtROS) generation in several tissues and low NADPH/NADP+ ratio. Here, we investigated whether spontaneous atherosclerosis in these mice could be modulated by treatments that replenish or spare mitochondrial NADPH, named citrate supplementation, cholesterol synthesis inhibition, or both treatments simultaneously. Robust statistical analyses in pooled group data were performed in order to explain the variation of atherosclerosis lesion areas as related to the classic atherosclerosis risk factors such as plasma lipids, obesity, and oxidative stress, including liver mtROS. Using three distinct statistical tools (univariate correlation, adjusted correlation, and multiple regression) with increasing levels of stringency, we identified a novel significant association and a model that reliably predicts the extent of atherosclerosis due to variations in mtROS. Thus, results show that atherosclerosis lesion area is positively and independently correlated with liver mtROS production rates. Based on these findings, we propose that modulation of mitochondrial redox state influences the atherosclerosis extent.

  8. The Effects of Climate Sensitivity and Carbon Cycle Interactions on Mitigation Policy Stringency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Calvin, Katherine V.; Bond-Lamberty, Benjamin; Edmonds, James A.

    2015-07-01

    Climate sensitivity and climate-carbon cycle feedbacks interact to determine how global carbon and energy cycles will change in the future. While the science of these connections is well documented, their economic implications are not well understood. Here we examine the effect of climate change on the carbon cycle, the uncertainty in climate outcomes inherent in any given policy target, and the economic implications. We examine three policy scenarios—a no policy “Reference” (REF) scenario, and two policies that limit total radiative forcing—with four climate sensitivities using a coupled integrated assessment model. Like previous work, we find that, within a given scenario,more » there is a wide range of temperature change and sea level rise depending on the realized climate sensitivity. We expand on this previous work to show that temperature-related feedbacks on the carbon cycle result in more mitigation required as climate sensitivity increases. Thus, achieving a particular radiative forcing target becomes increasingly expensive as climate sensitivity increases.« less

  9. Selective Bottlenecks Shape Evolutionary Pathways Taken during Mammalian Adaptation of a 1918-like Avian Influenza Virus.

    PubMed

    Moncla, Louise H; Zhong, Gongxun; Nelson, Chase W; Dinis, Jorge M; Mutschler, James; Hughes, Austin L; Watanabe, Tokiko; Kawaoka, Yoshihiro; Friedrich, Thomas C

    2016-02-10

    Avian influenza virus reassortants resembling the 1918 human pandemic virus can become transmissible among mammals by acquiring mutations in hemagglutinin (HA) and polymerase. Using the ferret model, we trace the evolutionary pathway by which an avian-like virus evolves the capacity for mammalian replication and airborne transmission. During initial infection, within-host HA diversity increased drastically. Then, airborne transmission fixed two polymerase mutations that do not confer a detectable replication advantage. In later transmissions, selection fixed advantageous HA1 variants. Transmission initially involved a "loose" bottleneck, which became strongly selective after additional HA mutations emerged. The stringency and evolutionary forces governing between-host bottlenecks may therefore change throughout host adaptation. Mutations occurred in multiple combinations in transmitted viruses, suggesting that mammalian transmissibility can evolve through multiple genetic pathways despite phenotypic constraints. Our data provide a glimpse into avian influenza virus adaptation in mammals, with broad implications for surveillance on potentially zoonotic viruses. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Architecture of human translation initiation factor 3

    PubMed Central

    Querol-Audi, Jordi; Sun, Chaomin; Vogan, Jacob M.; Smith, Duane; Gu, Yu; Cate, Jamie; Nogales, Eva

    2013-01-01

    SUMMARY Eukaryotic translation initiation factor 3 (eIF3) plays a central role in protein synthesis by organizing the formation of the 43S preinitiation complex. Using genetic tag visualization by electron microscopy, we reveal the molecular organization of ten human eIF3 subunits, including an octameric core. The structure of eIF3 bears a close resemblance to that of the proteasome lid, with a conserved spatial organization of eight core subunits containing PCI and MPN domains that coordinate functional interactions in both complexes. We further show that eIF3 subunits a and c interact with initiation factors eIF1 and eIF1A, which control the stringency of start codon selection. Finally, we find that subunit j, which modulates messenger RNA interactions with the small ribosomal subunit, makes multiple independent interactions with the eIF3 octameric core. These results highlight the conserved architecture of eIF3 and how it scaffolds key factors that control translation initiation in higher eukaryotes, including humans. PMID:23623729

  11. REGRES: A FORTRAN-77 program to calculate nonparametric and ``structural'' parametric solutions to bivariate regression equations

    NASA Astrophysics Data System (ADS)

    Rock, N. M. S.; Duffy, T. R.

    REGRES allows a range of regression equations to be calculated for paired sets of data values in which both variables are subject to error (i.e. neither is the "independent" variable). Nonparametric regressions, based on medians of all possible pairwise slopes and intercepts, are treated in detail. Estimated slopes and intercepts are output, along with confidence limits, Spearman and Kendall rank correlation coefficients. Outliers can be rejected with user-determined stringency. Parametric regressions can be calculated for any value of λ (the ratio of the variances of the random errors for y and x)—including: (1) major axis ( λ = 1); (2) reduced major axis ( λ = variance of y/variance of x); (3) Y on Xλ = infinity; or (4) X on Y ( λ = 0) solutions. Pearson linear correlation coefficients also are output. REGRES provides an alternative to conventional isochron assessment techniques where bivariate normal errors cannot be assumed, or weighting methods are inappropriate.

  12. Daubert v. Merrell: Opening floodgates of scientific uncertainty?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bibko, P.N.

    1994-12-31

    At last year`s plenary session on May 27, 1993, Col. John Glass, Deputy Director of the Army`s environmental program, acknowledged public pressure to expedite site restoration. A few days later, Gary Vest, Deputy Assistant Secretary for the Air Force told a Senate committee that clean-up levels should be relaxed depending upon intended land use. Soon after, EPA publicly announced support for relaxed clean-up levels depending upon use after restoration. Ironically, also on May 27, 1993, while EPA and the Department of Defense were considering the stringency of clean-up levels, the Environmental Defense Fund and Physicians for Social Responsibility were warningmore » the White House of the increasing health risks due to environmental contamination. The author emphasizes the need to set clean-up standards at levels that will assure protection of public health, and at the same time minimize the legal liability of those involved with the disposal or storage of hazardous waste.« less

  13. Simulation Studies of Satellite Laser CO2 Mission Concepts

    NASA Technical Reports Server (NTRS)

    Kawa, Stephan Randy; Mao, J.; Abshire, J. B.; Collatz, G. J.; Sun X.; Weaver, C. J.

    2011-01-01

    Results of mission simulation studies are presented for a laser-based atmospheric CO2 sounder. The simulations are based on real-time carbon cycle process modeling and data analysis. The mission concept corresponds to ASCENDS as recommended by the US National Academy of Sciences Decadal Survey. Compared to passive sensors, active (lidar) sensing of CO2 from space has several potentially significant advantages that hold promise to advance CO2 measurement capability in the next decade. Although the precision and accuracy requirements remain at unprecedented levels of stringency, analysis of possible instrument technology indicates that such sensors are more than feasible. Radiative transfer model calculations, an instrument model with representative errors, and a simple retrieval approach complete the cycle from "nature" run to "pseudodata" CO2. Several mission and instrument configuration options are examined, and the sensitivity to key design variables is shown. Examples are also shown of how the resulting pseudo-measurements might be used to address key carbon cycle science questions.

  14. Human ESP1/CRP2, a member of the LIM domain protein family: Characterization of the cDNA and assignment of the gene locus to chromosome 14q32.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karim, Mohammad Azharul; Ohta, Kohji; Matsuda, Ichiro

    1996-01-15

    The LIM domain is present in a wide variety of proteins with diverse functions and exhibits characteristic arrangements of Cys and His residues with a novel zinc-binding motif. LIM domain proteins have been implicated in development, cell regulation, and cell structure. A LIM domain protein was identified by screening a human cDNA library with rat cysteine-rich intestinal protein (CRIP) as a probe, under conditions of low stringency. Comparison of the predicted amino acid sequence with several LIM domain proteins revealed 93% of the residues to be identical to rat LIM domain protein, termed ESP1 or CRP2. Thus, the protein ismore » hereafter referred to as human ESP1/CRP2. The cDNA encompasses a 1171-base region, including 26, 624, and 521 bases in the 5{prime}-noncoding region, coding region, and 3{prime}-noncoding regions, respectively, and encodes the entire ESP1/CRP2 protein has two LIM domains, and each shares 35.1% and 77 or 79% identical residues with human cysteine-rich protein (CRP) and rat CRIP, respectively. Northern blot analysis of ESP1/CRP2 in various human tissues showed distinct tissue distributions compared with CRP and CRIP, suggesting that each might serve related but specific roles in tissue organization or function. Using a panel of human-rodent somatic cell hybrids, the ESP1/CRP2 locus was assigned to chromosome 14. Fluorescence in situ hybridization, using cDNA and a genome DNA fragment of the ESP1/CRP2 as probes, confirms this assignment and relegates regional localization to band 14q32.3 47 refs., 7 figs.« less

  15. Sequential Elution Interactome Analysis of the Mind Bomb 1 Ubiquitin Ligase Reveals a Novel Role in Dendritic Spine Outgrowth*

    PubMed Central

    Mertz, Joseph; Tan, Haiyan; Pagala, Vishwajeeth; Bai, Bing; Chen, Ping-Chung; Li, Yuxin; Cho, Ji-Hoon; Shaw, Timothy; Wang, Xusheng; Peng, Junmin

    2015-01-01

    The mind bomb 1 (Mib1) ubiquitin ligase is essential for controlling metazoan development by Notch signaling and possibly the Wnt pathway. It is also expressed in postmitotic neurons and regulates neuronal morphogenesis and synaptic activity by mechanisms that are largely unknown. We sought to comprehensively characterize the Mib1 interactome and study its potential function in neuron development utilizing a novel sequential elution strategy for affinity purification, in which Mib1 binding proteins were eluted under different stringency and then quantified by the isobaric labeling method. The strategy identified the Mib1 interactome with both deep coverage and the ability to distinguish high-affinity partners from low-affinity partners. A total of 817 proteins were identified during the Mib1 affinity purification, including 56 high-affinity partners and 335 low-affinity partners, whereas the remaining 426 proteins are likely copurified contaminants or extremely weak binding proteins. The analysis detected all previously known Mib1-interacting proteins and revealed a large number of novel components involved in Notch and Wnt pathways, endocytosis and vesicle transport, the ubiquitin-proteasome system, cellular morphogenesis, and synaptic activities. Immunofluorescence studies further showed colocalization of Mib1 with five selected proteins: the Usp9x (FAM) deubiquitinating enzyme, alpha-, beta-, and delta-catenins, and CDKL5. Mutations of CDKL5 are associated with early infantile epileptic encephalopathy-2 (EIEE2), a severe form of mental retardation. We found that the expression of Mib1 down-regulated the protein level of CDKL5 by ubiquitination, and antagonized CDKL5 function during the formation of dendritic spines. Thus, the sequential elution strategy enables biochemical characterization of protein interactomes; and Mib1 analysis provides a comprehensive interactome for investigating its role in signaling networks and neuronal development. PMID:25931508

  16. An Arrayed Genome-Scale Lentiviral-Enabled Short Hairpin RNA Screen Identifies Lethal and Rescuer Gene Candidates

    PubMed Central

    Bhinder, Bhavneet; Antczak, Christophe; Ramirez, Christina N.; Shum, David; Liu-Sullivan, Nancy; Radu, Constantin; Frattini, Mark G.

    2013-01-01

    Abstract RNA interference technology is becoming an integral tool for target discovery and validation.; With perhaps the exception of only few studies published using arrayed short hairpin RNA (shRNA) libraries, most of the reports have been either against pooled siRNA or shRNA, or arrayed siRNA libraries. For this purpose, we have developed a workflow and performed an arrayed genome-scale shRNA lethality screen against the TRC1 library in HeLa cells. The resulting targets would be a valuable resource of candidates toward a better understanding of cellular homeostasis. Using a high-stringency hit nomination method encompassing criteria of at least three active hairpins per gene and filtered for potential off-target effects (OTEs), referred to as the Bhinder–Djaballah analysis method, we identified 1,252 lethal and 6 rescuer gene candidates, knockdown of which resulted in severe cell death or enhanced growth, respectively. Cross referencing individual hairpins with the TRC1 validated clone database, 239 of the 1,252 candidates were deemed independently validated with at least three validated clones. Through our systematic OTE analysis, we have identified 31 microRNAs (miRNAs) in lethal and 2 in rescuer genes; all having a seed heptamer mimic in the corresponding shRNA hairpins and likely cause of the OTE observed in our screen, perhaps unraveling a previously unknown plausible essentiality of these miRNAs in cellular viability. Taken together, we report on a methodology for performing large-scale arrayed shRNA screens, a comprehensive analysis method to nominate high-confidence hits, and a performance assessment of the TRC1 library highlighting the intracellular inefficiencies of shRNA processing in general. PMID:23198867

  17. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Devor, E.J.; Dill-Devor, R.M.

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCRmore » assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.« less

  18. Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30)

    PubMed Central

    Burgess, S. C.; Young, J. R.; Baaten, B. J. G.; Hunt, L.; Ross, L. N. J.; Parcells, M. S.; Kumar, P. M.; Tregaskes, C. A.; Lee, L. F.; Davison, T. F.

    2004-01-01

    Animal models are essential for elucidating the molecular mechanisms of carcinogenesis. Hodgkin's and many diverse non-Hodgkin's lymphomas overexpress the Hodgkin's disease antigen CD30 (CD30hi), a tumor necrosis factor receptor II family member. Here we show that chicken Marek's disease (MD) lymphoma cells are also CD30hi and are a unique natural model for CD30hi lymphoma. Chicken CD30 resembles an ancestral form, and we identify a previously undescribed potential cytoplasmic signaling domain conserved in chicken, human, and mouse CD30. Our phylogeneic analysis defines a relationship between the structures of human and mouse CD30 and confirms that mouse CD30 represents the ancestral mammalian gene structure. CD30 expression by MD virus (MDV)-transformed lymphocytes correlates with expression of the MDV Meq putative oncogene (a c-Jun homologue) in vivo. The chicken CD30 promoter has 15 predicted high-stringency Meq-binding transcription factor recognition motifs, and Meq enhances transcription from the CD30 promoter in vitro. Plasma proteomics identified a soluble form of CD30. CD30 overexpression is evolutionarily conserved and defines one class of neoplastic transformation events, regardless of etiology. We propose that CD30 is a component of a critical intracellular signaling pathway perturbed in neoplastic transformation. Specific anti-CD30 Igs occurred after infection of genetically MD-resistant chickens with oncogenic MDV, suggesting immunity to CD30 could play a role in MD lymphoma regression. PMID:15356338

  19. Trends in Kindergarten Rates of Vaccine Exemption and State-Level Policy, 2011–2016

    PubMed Central

    Porter, Rachael M; Allen, Kristen; Salmon, Daniel A; Bednarczyk, Robert A

    2018-01-01

    Abstract Background Kindergarten-entry vaccination requirements have played an important role in controlling vaccine-preventable diseases in the United States. Forty-eight states and the District of Colombia offer nonmedical exemptions to vaccines, ranging in stringency. Methods We analyzed state-level exemption data from 2011 to 2012 through 2015 to 2016 school years. States were categorized by exemption ease and type of exemption allowed. We calculated nonmedical exemption rates for each year in the sample and stratified by exemption ease, type, and 2 trend categories: 2011–12 through 2012–13 and 2013–14 through 2015–16 school years. Using generalized estimating equations, we created regression models estimating (1) the average annual change in nonmedical exemption rates and (2) relative differences in rates by state classification. Results The nonmedical exemption rate was higher during the 2013–2014 through 2015–2016 period (2.25%) compared to 2011–2012 through 2012–2013 (1.75%); more importantly, the average annual change in the latter period plateaued. The nonmedical exemption rate in states allowing philosophical and religious exemptions was 2.41 times as high as in states allowing only religious exemptions (incidence rate ratio = 2.41; 95% confidence interval, 1.71–3.41). Conclusions There was an increase in nonmedical exemption rates through the 2012–2013 school year; however, rates stabilized through the 2015–2016 school year, showing an important shift in trend. PMID:29423420

  20. Smoking as a Crucial Independent Determinant of Stroke

    PubMed Central

    Paul, Seana L; Thrift, Amanda G; Donnan, Geoffrey A

    2004-01-01

    Background Although smoking is known to be powerful risk factor for other vascular diseases, such as cardiac and peripheral vascular disease, only relatively recently has evidence for the role of smoking in the development of stroke been established. The reasons for this advance lie in the acknowledgement that stroke is a heterogeneous disease, in which its subtypes are associated with different risk factors. Furthermore, improvements in the stringency of epidemiological studies and the greater use of CT scanning have enabled the role of smoking in the development of stroke to be elucidated. Summary of review This is a qualitative examination of high quality epidemiological studies in which the role of smoking and passive smoking, as a risk factor for cerebral infarction, intracerebral haemorrhage and subarachnoid haemorrhage, is examined. In addition, the pathological mechanisms by which smoking or passive smoking may contribute to the development of stroke are reviewed. Conclusion Smoking is a crucial independent determinant of cerebral infarction and subarachnoid haemorrhage, however its role in intracerebral haemorrhage is unclear. Although studies are limited, there is evidence that exposure to passive smoking may also increase the risk of stroke. Smoking appears to be involved in the pathogenesis of stroke via direct injury to the vasculature and also by altering haemodynamic factors within the circulation. Importantly, smoking is modifiable risk factor for stroke. Therefore, the encouragement of smoking cessation may result in a substantial reduction in the incidence of this devastating disease.

  1. Smoking as a Crucial Independent Determinant of Stroke

    PubMed Central

    Paul, Seana L; Thrift, Amanda G; Donnan, Geoffrey A

    2004-01-01

    Background Although smoking is known to be powerful risk factor for other vascular diseases, such as cardiac and peripheral vascular disease, only relatively recently has evidence for the role of smoking in the development of stroke been established. The reasons for this advance lie in the acknowledgement that stroke is a heterogeneous disease, in which its subtypes are associated with different risk factors. Furthermore, improvements in the stringency of epidemiological studies and the greater use of CT scanning have enabled the role of smoking in the development of stroke to be elucidated. Summary of review This is a qualitative examination of high quality epidemiological studies in which the role of smoking and passive smoking, as a risk factor for cerebral infarction, intracerebral haemorrhage and subarachnoid haemorrhage, is examined. In addition, the pathological mechanisms by which smoking or passive smoking may contribute to the development of stroke are reviewed. Conclusion Smoking is a crucial independent determinant of cerebral infarction and subarachnoid haemorrhage, however its role in intracerebral haemorrhage is unclear. Although studies are limited, there is evidence that exposure to passive smoking may also increase the risk of stroke. Smoking appears to be involved in the pathogenesis of stroke via direct injury to the vasculature and also by altering haemodynamic factors within the circulation. Importantly, smoking is modifiable risk factor for stroke. Therefore, the encouragement of smoking cessation may result in a substantial reduction in the incidence of this devastating disease. PMID:19570273

  2. Association of acute adverse effects with high local SAR induced in the brain from prolonged RF head and neck hyperthermia

    NASA Astrophysics Data System (ADS)

    Adibzadeh, F.; Verhaart, R. F.; Verduijn, G. M.; Fortunati, V.; Rijnen, Z.; Franckena, M.; van Rhoon, G. C.; Paulides, M. M.

    2015-02-01

    To provide an adequate level of protection for humans from exposure to radio-frequency (RF) electromagnetic fields (EMF) and to assure that any adverse health effects are avoided. The basic restrictions in terms of the specific energy absorption rate (SAR) were prescribed by IEEE and ICNIRP. An example of a therapeutic application of non-ionizing EMF is hyperthermia (HT), in which intense RF energy is focused at a target region. Deep HT in the head and neck (H&N) region involves inducing energy at 434 MHz for 60 min on target. Still, stray exposure of the brain is considerable, but to date only very limited side-effects were observed. The objective of this study is to investigate the stringency of the current basic restrictions by relating the induced EM dose in the brain of patients treated with deep head and neck (H&N) HT to the scored acute health effects. We performed a simulation study to calculate the induced peak 10 g spatial-averaged SAR (psSAR10g) in the brains of 16 selected H&N patients who received the highest SAR exposure in the brain, i.e. who had the minimum brain-target distance and received high forwarded power during treatment. The results show that the maximum induced SAR in the brain of the patients can exceed the current basic restrictions (IEEE and ICNIRP) on psSAR10g for occupational environments by 14 times. Even considering the high local SAR in the brain, evaluation of acute effects by the common toxicity criteria (CTC) scores revealed no indication of a serious acute neurological effect. In addition, this study provides pioneering quantitative human data on the association between maximum brain SAR level and acute adverse effects when brains are exposed to prolonged RF EMF.

  3. Impact of Antiretroviral Therapy on the Incidence of Tuberculosis: The Brazilian Experience, 1995–2001

    PubMed Central

    Miranda, Abraham; Morgan, Meade; Jamal, Leda; Laserson, Kayla; Barreira, Draurio; Silva, Guida; Santos, Joseney; Wells, Charles; Paine, Patricia; Garrett, Denise

    2007-01-01

    Background The human immunodeficiency virus (HIV) fuels tuberculosis (TB) epidemics. In controlled clinical trials, antiretroviral therapy (ART) reduces TB incidence in HIV-infected patients. In this study we determine if, under programmatic conditions, Brazil's policy of universal ART access has impacted TB incidence among HIV-infected patients. Methods We abstracted clinical information from records of HIV-infected patients managed in the public sector in 11 Brazilian states between 1/1/1995 and 12/31/2001. Case ascertainment (TB and HIV) utilized guidelines (with added stringency) published by Brazil's Ministry of Health. We determined TB incidence and hazards ratio (HR) for ART-naïve and ART-treated [including highly active ART (HAART)] patients employing Cox proportional hazards analysis. Results Information from 463 HIV-infected patients met study criteria. The median age of the study population was 34 years, 70% were male, and mean follow-up to primary endpoints—TB, death, and last clinic visit—was 330, 1059, and 1125 days, respectively. Of the 463 patients, 76 (16%) remained ART-naïve. Of the patients who never received HAART (n = 157) 81 were treated with ART non-HAART. Of the patients who received any ART (n = 387), 306 were treated with HAART (includes those patients who later switched from ART non-HAART to HAART). Tuberculosis developed in 39/463 (8%) patients. Compared to HAART- and ART non-HAART-treated patient groups, TB incidence was 10- (p<0.001) and 2.5-fold (p = 0.03) higher in ART-naïve patients, respectively. The median baseline absolute CD4+ T-lymphocyte count for patients who developed TB was not significantly different from that of patients who remained TB free. In multivariate analysis, the incidence of TB was statistically significantly lower in HAART-treated [HR 0.2; 95% (CI 0.1, 0.6); p<0.01] compared to ART naïve patients. A baseline CD4+ T-lymphocyte count <200 cells/mm3 [HR 2.5; (95% CI 1.2, 5.4); p<0.01], prior hospitalization [HR 4.2; (95% CI 2.0, 8.8); p<0.001], prior incarceration [HR 4.1; 95% CI 1.6, 10.3); p<0.01], and a positive tuberculin skin test [HR 3.1; (95% CI 1.1, 9.0); p = 0.04] were independently and positively associated with incident TB. Conclusion In this population-based study we demonstrate an 80% reduction in incident TB, under programmatic conditions, in HAART-treated HIV-infected patients compared to ART-naïve patients. PMID:17786198

  4. Orchestration of DNA Damage Checkpoint Dynamics across the Human Cell Cycle.

    PubMed

    Chao, Hui Xiao; Poovey, Cere E; Privette, Ashley A; Grant, Gavin D; Chao, Hui Yan; Cook, Jeanette G; Purvis, Jeremy E

    2017-11-22

    Although molecular mechanisms that prompt cell-cycle arrest in response to DNA damage have been elucidated, the systems-level properties of DNA damage checkpoints are not understood. Here, using time-lapse microscopy and simulations that model the cell cycle as a series of Poisson processes, we characterize DNA damage checkpoints in individual, asynchronously proliferating cells. We demonstrate that, within early G1 and G2, checkpoints are stringent: DNA damage triggers an abrupt, all-or-none cell-cycle arrest. The duration of this arrest correlates with the severity of DNA damage. After the cell passes commitment points within G1 and G2, checkpoint stringency is relaxed. By contrast, all of S phase is comparatively insensitive to DNA damage. This checkpoint is graded: instead of halting the cell cycle, increasing DNA damage leads to slower S phase progression. In sum, we show that a cell's response to DNA damage depends on its exact cell-cycle position and that checkpoints are phase-dependent, stringent or relaxed, and graded or all-or-none. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Regulatory policy and the location of bio-pharmaceutical foreign direct investment in Europe.

    PubMed

    Koenig, Pamina; Macgarvie, Megan

    2011-09-01

    This paper examines the relationship between cross-country differences in drug price regulation and the location of biopharmaceutical Foreign Direct Investment (FDI) in Europe. Simple theory predicts that price regulation in one country might affect total investment, but not the location of that investment, if sales are global. Nevertheless, some manufacturers threaten that the introduction of price regulation in a country will motivate them to move their investments to other countries. Are such threats cheap talk, or is there evidence that firms avoid price-controlling countries when making FDI location choices? We use data on 527 investments initiated in 27 European countries between 2002 and 2009 and find that investors are less likely to choose countries with price controls, after controlling for other determinants of investment. We also observe a relative decline in investment in countries that increased the stringency of regulatory regimes during our sample period. The effect is restricted to non-manufacturing investments and is most robust for those related to administrative functions. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Just health care (II): Is equality too much?

    PubMed

    Fleck, L M

    1989-12-01

    In a previous essay I criticized Engelhardt's libertarian conception of justice, which grounds the view that society's obligation to assure access to adequate health care for all is a matter of beneficence. Beneficence fails to capture the moral stringency associated with many claims for access to health care. In the present paper I argue that these claims are really matters of justice proper, where justice is conceived along moderate egalitarian lines, such as those suggested by Rawls and Daniels, rather than strong egalitarian lines. Further, given the empirical complexity associated with the distribution of contemporary health care, I argue that what we really need to address the relevant policy issues adequately is a theory of health care justice, as opposed to an all-purpose conception of justice. Daniels has made an important start toward that goal, though there are some large policy areas which I discuss that his account of health care justice does not really speak to. Finally, practical matters of health care justice really need to be addressed in a 'non-ideal' mode, a framework in which philosophers have done little.

  7. Identifying technical aliases in SELDI mass spectra of complex mixtures of proteins

    PubMed Central

    2013-01-01

    Background Biomarker discovery datasets created using mass spectrum protein profiling of complex mixtures of proteins contain many peaks that represent the same protein with different charge states. Correlated variables such as these can confound the statistical analyses of proteomic data. Previously we developed an algorithm that clustered mass spectrum peaks that were biologically or technically correlated. Here we demonstrate an algorithm that clusters correlated technical aliases only. Results In this paper, we propose a preprocessing algorithm that can be used for grouping technical aliases in mass spectrometry protein profiling data. The stringency of the variance allowed for clustering is customizable, thereby affecting the number of peaks that are clustered. Subsequent analysis of the clusters, instead of individual peaks, helps reduce difficulties associated with technically-correlated data, and can aid more efficient biomarker identification. Conclusions This software can be used to pre-process and thereby decrease the complexity of protein profiling proteomics data, thus simplifying the subsequent analysis of biomarkers by decreasing the number of tests. The software is also a practical tool for identifying which features to investigate further by purification, identification and confirmation. PMID:24010718

  8. Quantifying The Food And Drug Administration's rulemaking delays highlights the need for transparency.

    PubMed

    Hwang, Thomas J; Avorn, Jerry; Carpenter, Daniel; Kesselheim, Aaron S

    2014-02-01

    The Food and Drug Administration (FDA) frequently uses its rulemaking process to establish or modify the way it regulates drugs, medical devices, and other medical products. The federal agency's rulemaking is controversial because of its perceived complexity, lack of transparency, and lengthy duration. To shed light on the FDA's rulemaking process, we examined the evolution of significant rules that the agency published during 2000-12 for drugs, devices, and other medical products. We found that the rules' median time to finalization was 7.3 years, with the pre-rule phase and postreview deliberation within the FDA accounting for the majority of that time. Rules that involved mandatory cost-benefit analyses were associated with an additional delay of approximately two years. We also found that longer review times were significantly associated with a reduction in the stringency of final rules, compared to the originally proposed versions. We recommend improving FDA's rulemaking by allocating additional resources to increase efficiency and by embarking on initiatives to promote transparency by the FDA and other parts of the executive branch.

  9. The effect of environmental regulation on firms' competitive performance: the case of the building & construction sector in some EU regions.

    PubMed

    Testa, Francesco; Iraldo, Fabio; Frey, Marco

    2011-09-01

    There is a considerable debate on the effects of environmental regulation on competitive performance. Based on survey data, this paper analyzes the two main research questions, derived from literature, on the links between environmental regulation and competitiveness, by focusing on firms operating in the building and construction sector, i.e.: 1) whether environmental policy stringency affects the competitive performance of firms in the building and construction sector 2) and how a specific form of environmental regulation (direct regulation, economic instruments and soft instruments) affects this performance? By applying a regression analysis, we find that a more stringent environmental regulation, measured by inspection frequency, provides a positive impulse for increasing investments in advanced technological equipment and innovative products and on business performance. Moreover, a well-designed "direct regulation" appears to be the most effective policy instrument for prompting the positive impact of environmental policies on innovation and intangible performance while economic instruments do negatively affect business performance. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. The origin and evolution of vertebrate sex chromosomes and dosage compensation

    PubMed Central

    Livernois, A M; Graves, J A M; Waters, P D

    2012-01-01

    In mammals, birds, snakes and many lizards and fish, sex is determined genetically (either male XY heterogamy or female ZW heterogamy), whereas in alligators, and in many reptiles and turtles, the temperature at which eggs are incubated determines sex. Evidently, different sex-determining systems (and sex chromosome pairs) have evolved independently in different vertebrate lineages. Homology shared by Xs and Ys (and Zs and Ws) within species demonstrates that differentiated sex chromosomes were once homologous, and that the sex-specific non-recombining Y (or W) was progressively degraded. Consequently, genes are left in single copy in the heterogametic sex, which results in an imbalance of the dosage of genes on the sex chromosomes between the sexes, and also relative to the autosomes. Dosage compensation has evolved in diverse species to compensate for these dose differences, with the stringency of compensation apparently differing greatly between lineages, perhaps reflecting the concentration of genes on the original autosome pair that required dosage compensation. We discuss the organization and evolution of amniote sex chromosomes, and hypothesize that dosage insensitivity might predispose an autosome to evolving function as a sex chromosome. PMID:22086077

  11. Professional medical associations and their relationships with industry: a proposal for controlling conflict of interest.

    PubMed

    Rothman, David J; McDonald, Walter J; Berkowitz, Carol D; Chimonas, Susan C; DeAngelis, Catherine D; Hale, Ralph W; Nissen, Steven E; Osborn, June E; Scully, James H; Thomson, Gerald E; Wofsy, David

    2009-04-01

    Professional medical associations (PMAs) play an essential role in defining and advancing health care standards. Their conferences, continuing medical education courses, practice guidelines, definitions of ethical norms, and public advocacy positions carry great weight with physicians and the public. Because many PMAs receive extensive funding from pharmaceutical and device companies, it is crucial that their guidelines manage both real and perceived conflict of interests. Any threat to the integrity of PMAs must be thoroughly and effectively resolved. Current PMA policies, however, are not uniform and often lack stringency. To address this situation, the authors first identified and analyzed conflicts of interest that may affect the activities, leadership, and members of PMAs. The authors then went on to formulate guidelines, both short-term and long-term, to prevent the appearance or reality of undue industry influence. The recommendations are rigorous and would require many PMAs to transform their mode of operation and perhaps, to forgo valuable activities. To maintain integrity, sacrifice may be required. Nevertheless, these changes are in the best interest of the PMAs, the profession, their members, and the larger society.

  12. Chagas disease reactivation in a heart transplant patient infected by domestic Trypanosoma cruzi discrete typing unit I (TcIDOM).

    PubMed

    Costales, Jaime A; Kotton, Camille N; Zurita-Leal, Andrea C; Garcia-Perez, Josselyn; Llewellyn, Martin S; Messenger, Louisa A; Bhattacharyya, Tapan; Burleigh, Barbara A

    2015-08-25

    Trypanosoma cruzi, causative agent of Chagas disease, displays high intraspecific genetic diversity: six genetic lineages or discrete typing units (DTUs) are currently recognized, termed TcI through TcVI. Each DTU presents a particular distribution pattern across the Americas, and is loosely associated with different transmission cycles and hosts. Several DTUs are known to circulate in Central America. It has been previously suggested that TcI infection is benign and does not lead to chronic chagasic cardiomyopathy (CCC). In this study, we genotyped T. cruzi parasites circulating in the blood and from explanted cardiac tissue of an El Salvadorian patient who developed reactivation Chagas disease while on immunosuppressive medications after undergoing heart transplant in the U.S. as treatment for end-stage CCC. Parasite typing was performed through molecular methods (restriction fragment length polymorphism of polymerase reaction chain amplified products, microsatellite typing, maxicircle sequence typing and low-stringency single primer PCR, [LSSP-PCR]) as well as lineage-specific serology. We show that the parasites infecting the patient belong to the TcI DTU exclusively. Our data indicate that the parasites isolated from the patient belong to a genotype frequently associated with human infection throughout the Americas (TcIDOM). Our results constitute compelling evidence in support of TcI DTU's ability to cause end-stage CCC and help dispel any residual bias that infection with this lineage is benign, pointing to the need for increased surveillance for dissemination of this genotype in endemic regions, the USA and globally.

  13. Bayesian Redshift Classification of Emission-line Galaxies with Photometric Equivalent Widths

    NASA Astrophysics Data System (ADS)

    Leung, Andrew S.; Acquaviva, Viviana; Gawiser, Eric; Ciardullo, Robin; Komatsu, Eiichiro; Malz, A. I.; Zeimann, Gregory R.; Bridge, Joanna S.; Drory, Niv; Feldmeier, John J.; Finkelstein, Steven L.; Gebhardt, Karl; Gronwall, Caryl; Hagen, Alex; Hill, Gary J.; Schneider, Donald P.

    2017-07-01

    We present a Bayesian approach to the redshift classification of emission-line galaxies when only a single emission line is detected spectroscopically. We consider the case of surveys for high-redshift Lyα-emitting galaxies (LAEs), which have traditionally been classified via an inferred rest-frame equivalent width (EW {W}{Lyα }) greater than 20 Å. Our Bayesian method relies on known prior probabilities in measured emission-line luminosity functions and EW distributions for the galaxy populations, and returns the probability that an object in question is an LAE given the characteristics observed. This approach will be directly relevant for the Hobby-Eberly Telescope Dark Energy Experiment (HETDEX), which seeks to classify ˜106 emission-line galaxies into LAEs and low-redshift [{{O}} {{II}}] emitters. For a simulated HETDEX catalog with realistic measurement noise, our Bayesian method recovers 86% of LAEs missed by the traditional {W}{Lyα } > 20 Å cutoff over 2 < z < 3, outperforming the EW cut in both contamination and incompleteness. This is due to the method’s ability to trade off between the two types of binary classification error by adjusting the stringency of the probability requirement for classifying an observed object as an LAE. In our simulations of HETDEX, this method reduces the uncertainty in cosmological distance measurements by 14% with respect to the EW cut, equivalent to recovering 29% more cosmological information. Rather than using binary object labels, this method enables the use of classification probabilities in large-scale structure analyses. It can be applied to narrowband emission-line surveys as well as upcoming large spectroscopic surveys including Euclid and WFIRST.

  14. Infection control practices and zoonotic disease risks among veterinarians in the United States.

    PubMed

    Wright, Jennifer G; Jung, Sherry; Holman, Robert C; Marano, Nina N; McQuiston, Jennifer H

    2008-06-15

    OBJECTIVE-To assess the knowledge and use of infection control practices (ICPs) among US veterinarians. DESIGN-Anonymous mail-out population survey. PROCEDURES-In 2005 a questionnaire was mailed to US small animal, large animal, and equine veterinarians who were randomly selected from the AVMA membership to assess precaution awareness (PA) and veterinarians' perceptions of zoonotic disease risks. Respondents were assigned a PA score (0 to 4) on the basis of their responses (higher scores representing higher stringency of ICPs); within a practice type, respondents' scores were categorized as being within the upper 25% or lower 75% of scores (high and low PA ranking, respectively). Characteristics associated with low PA rankings were assessed. RESULTS-Generally, respondents did not engage in protective behaviors or use personal protective equipment considered appropriate to protect against zoonotic disease transmission. Small animal and equine veterinarians employed in practices that had no written infection control policy were significantly more likely to have low PA ranking. Male gender was associated with low PA ranking among small animal and large animal veterinarians; equine practitioners not working in a teaching or referral hospital were more likely to have low PA ranking than equine practitioners working in such institutions. CONCLUSIONS AND CLINICAL RELEVANCE-Results indicated that most US veterinarians are not aware of appropriate personal protective equipment use and do not engage in practices that may help reduce zoonotic disease transmission. Gender differences may influence personal choices for ICPs. Provision of information and training on ICPs and establishment of written infection control policies could be effective means of improving ICPs in veterinary practices.

  15. In Silico Analysis of Antibiotic Resistance Genes in the Gut Microflora of Individuals from Diverse Geographies and Age-Groups

    PubMed Central

    Ghosh, Tarini Shankar; Gupta, Sourav Sen; Nair, Gopinath Balakrish; Mande, Sharmila S.

    2013-01-01

    The spread of antibiotic resistance, originating from the rampant and unrestrictive use of antibiotics in humans and livestock over the past few decades has emerged as a global health problem. This problem has been further compounded by recent reports implicating the gut microbial communities to act as reservoirs of antibiotic resistance. We have profiled the presence of probable antibiotic resistance genes in the gut flora of 275 individuals from eight different nationalities. For this purpose, available metagenomic data sets corresponding to 275 gut microbiomes were analyzed. Sequence similarity searches of the genomic fragments constituting each of these metagenomes were performed against genes conferring resistance to around 240 antibiotics. Potential antibiotic resistance genes conferring resistance against 53 different antibiotics were detected in the human gut microflora analysed in this study. In addition to several geography/country-specific patterns, four distinct clusters of gut microbiomes, referred to as ‘Resistotypes’, exhibiting similarities in their antibiotic resistance profiles, were identified. Groups of antibiotics having similarities in their resistance patterns within each of these clusters were also detected. Apart from this, mobile multi-drug resistance gene operons were detected in certain gut microbiomes. The study highlighted an alarmingly high abundance of antibiotic resistance genes in two infant gut microbiomes. The results obtained in the present study presents a holistic ‘big picture’ on the spectra of antibiotic resistance within our gut microbiota across different geographies. Such insights may help in implementation of new regulations and stringency on the existing ones. PMID:24391833

  16. Diverse patterns of genomic targeting by transcriptional regulators in Drosophila melanogaster.

    PubMed

    Slattery, Matthew; Ma, Lijia; Spokony, Rebecca F; Arthur, Robert K; Kheradpour, Pouya; Kundaje, Anshul; Nègre, Nicolas; Crofts, Alex; Ptashkin, Ryan; Zieba, Jennifer; Ostapenko, Alexander; Suchy, Sarah; Victorsen, Alec; Jameel, Nader; Grundstad, A Jason; Gao, Wenxuan; Moran, Jennifer R; Rehm, E Jay; Grossman, Robert L; Kellis, Manolis; White, Kevin P

    2014-07-01

    Annotation of regulatory elements and identification of the transcription-related factors (TRFs) targeting these elements are key steps in understanding how cells interpret their genetic blueprint and their environment during development, and how that process goes awry in the case of disease. One goal of the modENCODE (model organism ENCyclopedia of DNA Elements) Project is to survey a diverse sampling of TRFs, both DNA-binding and non-DNA-binding factors, to provide a framework for the subsequent study of the mechanisms by which transcriptional regulators target the genome. Here we provide an updated map of the Drosophila melanogaster regulatory genome based on the location of 84 TRFs at various stages of development. This regulatory map reveals a variety of genomic targeting patterns, including factors with strong preferences toward proximal promoter binding, factors that target intergenic and intronic DNA, and factors with distinct chromatin state preferences. The data also highlight the stringency of the Polycomb regulatory network, and show association of the Trithorax-like (Trl) protein with hotspots of DNA binding throughout development. Furthermore, the data identify more than 5800 instances in which TRFs target DNA regions with demonstrated enhancer activity. Regions of high TRF co-occupancy are more likely to be associated with open enhancers used across cell types, while lower TRF occupancy regions are associated with complex enhancers that are also regulated at the epigenetic level. Together these data serve as a resource for the research community in the continued effort to dissect transcriptional regulatory mechanisms directing Drosophila development. © 2014 Slattery et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

    PubMed Central

    Matthews, R J; Cahir, E D; Thomas, M L

    1990-01-01

    Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

  18. SNP discovery by high-throughput sequencing in soybean

    PubMed Central

    2010-01-01

    Background With the advance of new massively parallel genotyping technologies, quantitative trait loci (QTL) fine mapping and map-based cloning become more achievable in identifying genes for important and complex traits. Development of high-density genetic markers in the QTL regions of specific mapping populations is essential for fine-mapping and map-based cloning of economically important genes. Single nucleotide polymorphisms (SNPs) are the most abundant form of genetic variation existing between any diverse genotypes that are usually used for QTL mapping studies. The massively parallel sequencing technologies (Roche GS/454, Illumina GA/Solexa, and ABI/SOLiD), have been widely applied to identify genome-wide sequence variations. However, it is still remains unclear whether sequence data at a low sequencing depth are enough to detect the variations existing in any QTL regions of interest in a crop genome, and how to prepare sequencing samples for a complex genome such as soybean. Therefore, with the aims of identifying SNP markers in a cost effective way for fine-mapping several QTL regions, and testing the validation rate of the putative SNPs predicted with Solexa short sequence reads at a low sequencing depth, we evaluated a pooled DNA fragment reduced representation library and SNP detection methods applied to short read sequences generated by Solexa high-throughput sequencing technology. Results A total of 39,022 putative SNPs were identified by the Illumina/Solexa sequencing system using a reduced representation DNA library of two parental lines of a mapping population. The validation rates of these putative SNPs predicted with low and high stringency were 72% and 85%, respectively. One hundred sixty four SNP markers resulted from the validation of putative SNPs and have been selectively chosen to target a known QTL, thereby increasing the marker density of the targeted region to one marker per 42 K bp. Conclusions We have demonstrated how to quickly identify large numbers of SNPs for fine mapping of QTL regions by applying massively parallel sequencing combined with genome complexity reduction techniques. This SNP discovery approach is more efficient for targeting multiple QTL regions in a same genetic population, which can be applied to other crops. PMID:20701770

  19. Advancements in Aptamer Discovery Technologies.

    PubMed

    Gotrik, Michael R; Feagin, Trevor A; Csordas, Andrew T; Nakamoto, Margaret A; Soh, H Tom

    2016-09-20

    Affinity reagents that specifically bind to their target molecules are invaluable tools in nearly every field of modern biomedicine. Nucleic acid-based aptamers offer many advantages in this domain, because they are chemically synthesized, stable, and economical. Despite these compelling features, aptamers are currently not widely used in comparison to antibodies. This is primarily because conventional aptamer-discovery techniques such as SELEX are time-consuming and labor-intensive and often fail to produce aptamers with comparable binding performance to antibodies. This Account describes a body of work from our laboratory in developing advanced methods for consistently producing high-performance aptamers with higher efficiency, fewer resources, and, most importantly, a greater probability of success. We describe our efforts in systematically transforming each major step of the aptamer discovery process: selection, analysis, and characterization. To improve selection, we have developed microfluidic devices (M-SELEX) that enable discovery of high-affinity aptamers after a minimal number of selection rounds by precisely controlling the target concentration and washing stringency. In terms of improving aptamer pool analysis, our group was the first to use high-throughput sequencing (HTS) for the discovery of new aptamers. We showed that tracking the enrichment trajectory of individual aptamer sequences enables the identification of high-performing aptamers without requiring full convergence of the selected aptamer pool. HTS is now widely used for aptamer discovery, and open-source software has become available to facilitate analysis. To improve binding characterization, we used HTS data to design custom aptamer arrays to measure the affinity and specificity of up to ∼10(4) DNA aptamers in parallel as a means to rapidly discover high-quality aptamers. Most recently, our efforts have culminated in the invention of the "particle display" (PD) screening system, which transforms solution-phase aptamers into "aptamer particles" that can be individually screened at high-throughput via fluorescence-activated cell sorting. Using PD, we have shown the feasibility of rapidly generating aptamers with exceptional affinities, even for proteins that have previously proven intractable to aptamer discovery. We are confident that these advanced aptamer-discovery methods will accelerate the discovery of aptamer reagents with excellent affinities and specificities, perhaps even exceeding those of the best monoclonal antibodies. Since aptamers are reproducible, renewable, stable, and can be distributed as sequence information, we anticipate that these affinity reagents will become even more valuable tools for both research and clinical applications.

  20. Potential reductions in ambient NO2 concentrations from meeting diesel vehicle emissions standards

    NASA Astrophysics Data System (ADS)

    von Schneidemesser, Erika; Kuik, Friderike; Mar, Kathleen A.; Butler, Tim

    2017-11-01

    Exceedances of the concentration limit value for ambient nitrogen dioxide (NO2) at roadside sites are an issue in many cities throughout Europe. This is linked to the emissions of light duty diesel vehicles which have on-road emissions that are far greater than the regulatory standards. These exceedances have substantial implications for human health and economic loss. This study explores the possible gains in ambient air quality if light duty diesel vehicles were able to meet the regulatory standards (including both emissions standards from Europe and the United States). We use two independent methods: a measurement-based and a model-based method. The city of Berlin is used as a case study. The measurement-based method used data from 16 monitoring stations throughout the city of Berlin to estimate annual average reductions in roadside NO2 of 9.0 to 23 µg m-3 and in urban background NO2 concentrations of 1.2 to 2.7 µg m-3. These ranges account for differences in fleet composition assumptions, and the stringency of the regulatory standard. The model simulations showed reductions in urban background NO2 of 2.0 µg m-3, and at the scale of the greater Berlin area of 1.6 to 2.0 µg m-3 depending on the setup of the simulation and resolution of the model. Similar results were found for other European cities. The similarities in results using the measurement- and model-based methods support our ability to draw robust conclusions that are not dependent on the assumptions behind either methodology. The results show the significant potential for NO2 reductions if regulatory standards for light duty diesel vehicles were to be met under real-world operating conditions. Such reductions could help improve air quality by reducing NO2 exceedances in urban areas, but also have broader implications for improvements in human health and other benefits.

  1. Field testing of new-technology ambient air ozone monitors.

    PubMed

    Ollison, Will M; Crow, Walt; Spicer, Chester W

    2013-07-01

    Multibillion-dollar strategies control ambient air ozone (O3) levels in the United States, so it is essential that the measurements made to assess compliance with regulations be accurate. The predominant method employed to monitor O3 is ultraviolet (UV) photometry. Instruments employ a selective manganese dioxide or heated silver wool "scrubber" to remove O3 to provide a zero reference signal. Unfortunately, such scrubbers remove atmospheric constituents that absorb 254-nm light, causing measurement interference. Water vapor also interferes with the measurement under some circumstances. We report results of a 3-month field test of two new instruments designed to minimize interferences (2B Technologies model 211; Teledyne-API model 265E) that were operated in parallel with a conventional Thermo Scientific model 49C O3 monitor. The field test was hosted by the Houston Regional Monitoring Corporation (HRM). The model 211 photometer scrubs O3 with excess nitric oxide (NO) generated in situ by photolysis of added nitrous oxide (N2O) to provide a reference signal, eliminating the need for a conventional O3 scrubber. The model 265E analyzer directly measures O3-NO chemiluminescence from added excess NO to quantify O3 in the sample stream. Extensive quality control (QC) and collocated monitoring data are assessed to evaluate potential improvements to the accuracy of O3 compliance monitoring. Two new-technology ozone monitors were compared with a conventional monitor under field conditions. Over 3 months the conventional monitor reported more exceedances of the current standard than the new instruments, which could potentially result in an area being misjudged as "nonattainment." Instrument drift can affect O3 data accuracy, and the same degree of drift has a proportionally greater compliance effect as standard stringency is increased. Enhanced data quality assurance and data adjustment may be necessary to achieve the improved accuracy required to judge compliance with tighter standards.

  2. Amplicon-based semiconductor sequencing of human exomes: performance evaluation and optimization strategies.

    PubMed

    Damiati, E; Borsani, G; Giacopuzzi, Edoardo

    2016-05-01

    The Ion Proton platform allows to perform whole exome sequencing (WES) at low cost, providing rapid turnaround time and great flexibility. Products for WES on Ion Proton system include the AmpliSeq Exome kit and the recently introduced HiQ sequencing chemistry. Here, we used gold standard variants from GIAB consortium to assess the performances in variants identification, characterize the erroneous calls and develop a filtering strategy to reduce false positives. The AmpliSeq Exome kit captures a large fraction of bases (>94 %) in human CDS, ClinVar genes and ACMG genes, but with 2,041 (7 %), 449 (13 %) and 11 (19 %) genes not fully represented, respectively. Overall, 515 protein coding genes contain hard-to-sequence regions, including 90 genes from ClinVar. Performance in variants detection was maximum at mean coverage >120×, while at 90× and 70× we measured a loss of variants of 3.2 and 4.5 %, respectively. WES using HiQ chemistry showed ~71/97.5 % sensitivity, ~37/2 % FDR and ~0.66/0.98 F1 score for indels and SNPs, respectively. The proposed low, medium or high-stringency filters reduced the amount of false positives by 10.2, 21.2 and 40.4 % for indels and 21.2, 41.9 and 68.2 % for SNP, respectively. Amplicon-based WES on Ion Proton platform using HiQ chemistry emerged as a competitive approach, with improved accuracy in variants identification. False-positive variants remain an issue for the Ion Torrent technology, but our filtering strategy can be applied to reduce erroneous variants.

  3. Prevalence of human papillomavirus among STD clinic attenders in Jamaica: association of younger age and increased sexual activity.

    PubMed

    Figueroa, J P; Ward, E; Luthi, T E; Vermund, S H; Brathwaite, A R; Burk, R D

    1995-01-01

    Human papillomavirus is the major etiologic agent of cervical cancer. Although the incidence of cancer of the cervix is high in Jamaica, the prevalence of human papillomavirus among Jamaican women has not been defined. To estimate the prevalence of human papillomavirus infection and associated risk factors in women attending an STD clinic in Kingston, Jamaica. A cross-sectional survey was done of 202 women attending an STD clinic in Kingston in 1990. Cervical and vaginal cells were collected by lavage, and human papillomavirus genomes were detected in extracted DNA using low-stringency Southern blot hybridization. Fifty-eight (28.7%) women were identified as HPV positive. Prevalence of HPV by age group was 39% in women 15-19 years old, 33% of women 20-24 years old, 31% in women 25-29 years old, and 17% in those 30 years or older. Increasing age was significantly associated with a lower prevalence of human papillomavirus infection (test for trend, P = 0.025). The effect of age was independent of years of sexual activity. Women reporting more than one sexual partner per month on average were found to have a significantly higher HPV prevalence (odds ratio 2.87, 95% confidence Interval 1.29-6.38), as were women who reported more frequent sex (test for trend, P = 0.006). Sexual behavior is associated with risk of human papillomavirus infection. The decrease of human papillomavirus prevalence in older women agrees with other studies that argue in favor of a biological effect, such as increased immunity to human papillomavirus with age. A better understanding of why immunity to human papillomavirus may develop in older women may provide the basis for developing an effective vaccine to prevent cancer of the cervix.

  4. Isolation of genes negatively or positively co-expressed with human recombination activating gene 1 (RAG1) by differential display PCR (DD RT-PCR).

    PubMed

    Verkoczy, L K; Berinstein, N L

    1998-10-01

    Differential display PCR (DD RT-PCR) has been extensively used for analysis of differential gene expression, but continues to be hampered by technical limitations that impair its effectiveness. In order to isolate novel genes co-expressing with human RAG1, we have developed an effective, multi-tiered screening/purification approach which effectively complements the standard DD RT-PCR methodology. In 'primary' screens, standard DD RT-PCR was used, detecting 22 reproducible differentially expressed amplicons between clonally related cell variants with differential constitutive expression of RAG mRNAs. 'Secondary' screens used differential display (DD) amplicons as probes in low and high stringency northern blotting. Eight of 22 independent DD amplicons detected nine independent differentially expressed transcripts. 'Tertiary' screens used reconfirmed amplicons as probes in northern analysis of multiple RAG-and RAG+sources. Reconfirmed DD amplicons detected six independent RAG co-expressing transcripts. All DD amplicons reconfirmed by northern blot were a heterogeneous mixture of cDNAs, necessitating further purification to isolate single cDNAs prior to subcloning and sequencing. To effectively select the appropriate cDNAs from DD amplicons, we excised and eluted the cDNA(s) directly from regions of prior northern blots in which differentially expressed transcripts were detected. Sequences of six purified cDNA clones specifically detecting RAG co-expressing transcripts included matches to portions of the human RAG2 and BSAP regions and to four novel partial cDNAs (three with homologies to human ESTs). Overall, our results also suggest that even when using clonally related variants from the same cell line in addition to all appropriate internal controls previously reported, further screening and purification steps are still required in order to efficiently and specifically isolate differentially expressed genes by DD RT-PCR.

  5. 2,4-Dichlorophenoxyacetic acid-degrading bacteria contain mosaics of catabolic genes.

    PubMed Central

    Fulthorpe, R R; McGowan, C; Maltseva, O V; Holben, W E; Tiedje, J M

    1995-01-01

    DNA from 32 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria from diverse locations was probed with the first three genes of the well-known 2,4-D degradation pathway found in Alcaligenes eutrophus JMP134(pJP4). The majority of strains did not show high levels of homology to the first three genes of the 2,4-D degradation pathway, tfdA, -B, and -C. Most strains showed combinations of tfdA-, B-, and C-like elements that exhibited various degrees of homology to the gene probes. Strains having the same genomic fingerprints (as determined by repetitive extragenic palindromic PCR) exhibited the same hybridization pattern regardless of the geographic origin of the strain, with the exception of a strain isolated from Puerto Rico. This strain had the same genomic fingerprint as that of numerous other strains in the collection but differed in its hybridization against the tfdA gene probe. Members of the beta subdivision of the Proteobacteria class, specifically Alcaligenes, Burkholderia, and Rhodoferax species, carried DNA fragments with 60% or more sequence similarity to tfdA of pJP4, and most carried fragments showing at least 60% homology to tfdB. However, many strains did not hybridize with tfdC, although they exhibited chlorocatechol dioxygenase activity. Members of the alpha subdivision of the Proteobacteria class, mostly of the genus Sphingomonas, did not hybridize to either tfdA or tfdC, but some hybridized at low stringency to tfdB. The data suggest that extensive interspecies transfer of a variety of homologous degradative genes has been involved in the evolution of 2,4-D-degrading bacteria. PMID:7574638

  6. Induction of the heat shock regulon of Escherichia coli markedly increases production of bacterial viruses at high temperatures.

    PubMed Central

    Wiberg, J S; Mowrey-McKee, M F; Stevens, E J

    1988-01-01

    Production of bacteriophages T2, T4, and T6 at 42.8 to 44 degrees C was increased from 8- to 260-fold by adapting the Escherichia coli host (grown at 30 degrees C) to growth at the high temperature for 8 min before infection; this increase was abolished if the host htpR (rpoH) gene was inactive. Others have shown that the htpR protein increases or activates the synthesis of at least 17 E. coli heat shock proteins upon raising the growth temperature above a certain level. At 43.8 to 44 degrees C in T4-infected, unadapted cells, the rates of RNA, DNA, and protein synthesis were about 100, 70, and 70%, respectively, of those in T4-infected, adapted cells. Production of the major processed capsid protein, gp23, was reduced significantly more than that of most other T4 proteins in unadapted cells relative to adapted cells. Only 4.6% of the T4 DNA made in unadapted cells was resistant to micrococcal nuclease, versus 50% in adapted cells. Thus, defective maturation of T4 heads appears to explain the failure of phage production in unadapted cells. Overproduction of the heat shock protein GroEL from plasmids restored T4 production in unadapted cells to about 50% of that seen in adapted cells. T4-infected, adapted E. coli B at around 44 degrees C exhibited a partial tryptophan deficiency; this correlated with reduced uptake of uracil that is probably caused by partial induction of stringency. Production of bacteriophage T7 at 44 degrees C was increased two- to fourfold by adapting the host to 44 degrees C before infection; evidence against involvement of the htpR (rpoH) gene is presented. This work and recent work with bacteriophage lambda (C. Waghorne and C.R. Fuerst, Virology 141:51-64, 1985) appear to represent the first demonstrations for any virus that expression of the heat shock regulon of a host is necessary for virus production at high temperature. Images PMID:2446014

  7. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  8. Coal fired air turbine cogeneration

    NASA Astrophysics Data System (ADS)

    Foster-Pegg, R. W.

    Fuel options and generator configurations for installation of cogenerator equipment are reviewed, noting that the use of oil or gas may be precluded by cost or legislation within the lifetime of any cogeneration equipment yet to be installed. A coal fueled air turbine cogenerator plant is described, which uses external combustion in a limestone bed at atmospheric pressure and in which air tubes are sunk to gain heat for a gas turbine. The limestone in the 26 MW unit absorbs sulfur from the coal, and can be replaced by other sorbents depending on types of coal available and stringency of local environmental regulations. Low temperature combustion reduces NOx formation and release of alkali salts and corrosion. The air heat is exhausted through a heat recovery boiler to produce process steam, then can be refed into the combustion chamber to satisfy preheat requirements. All parts of the cogenerator are designed to withstand full combustion temperature (1500 F) in the event of air flow stoppage. Costs are compared with those of a coal fired boiler and purchased power, and it is shown that the increased capital requirements for cogenerator apparatus will yield a 2.8 year payback. Detailed flow charts, diagrams and costs schedules are included.

  9. Moderate relationships between NAA and cognitive ability in healthy adults: implications for cognitive spectroscopy.

    PubMed

    Patel, Tulpesh; Blyth, Jacqueline C; Griffiths, Gareth; Kelly, Deirdre; Talcott, Joel B

    2014-01-01

    Proton Magnetic Resonance Spectroscopy ((1)H-MRS) is a non-invasive imaging technique that enables quantification of neurochemistry in vivo and thereby facilitates investigation of the biochemical underpinnings of human cognitive variability. Studies in the field of cognitive spectroscopy have commonly focused on relationships between measures of N-acetyl aspartate (NAA), a surrogate marker of neuronal health and function, and broad measures of cognitive performance, such as IQ. In this study, we used (1)H-MRS to interrogate single-voxels in occipitoparietal and frontal cortex, in parallel with assessments of psychometric intelligence, in a sample of 40 healthy adult participants. We found correlations between NAA and IQ that were within the range reported in previous studies. However, the magnitude of these effects was significantly modulated by the stringency of data screening and the extent to which outlying values contributed to statistical analyses. (1)H-MRS offers a sensitive tool for assessing neurochemistry non-invasively, yet the relationships between brain metabolites and broad aspects of human behavior such as IQ are subtle. We highlight the need to develop an increasingly rigorous analytical and interpretive framework for collecting and reporting data obtained from cognitive spectroscopy studies of this kind.

  10. Baseline characteristics of different strata of astronaut corps

    NASA Technical Reports Server (NTRS)

    Hamm, Peggy B.; Pepper, L. J.

    1993-01-01

    The Longitudinal Study of Astronaut Health (LSAH) is an epidemiological study designed to study the effects of the occupational exposures incurred by astronauts in health outcomes and changes in physiological variables. Between 1959 and 1991, 195 individuals were selected for the program. The medical standards for selection have remained essentially unchanged since the Mercury Program, but the range and stringency of these criteria have been modified. Demographic and physiological variables identified during the selection year are examined for various strata of the Astronaut Corps. Specifically, age, sex, race, education, usual occupation, military affiliation, medical history, family medical history, visual and hearing measurements, physical exam variables, and specific laboratory values are investigated. Differences are examined in astronauts for the following criteria: (1) were selected prior to 1970 (n = 73) versus those selected after 1970 (n = 122); (2) have flown multiple missions versus those who have flown less than two missions; (3) have walked in space versus all others; (4) have more than 500 hours of mission time versus all others; and (5) have gone to the Moon versus all others. Length of time served in the Astronaut Corps is examined for each of these strata.

  11. Red Cell Alloantibodies in Multiple Transfused Thalassaemia Patients.

    PubMed

    Chaudhari, C N

    2011-01-01

    Thalassaemia major patients require lifelong transfusion support due to which they are prone for alloimmunization to foreign RBCs. Alloimmunization can be prevented by extended phenotype match blood transfusion. The study was conducted to know the extent of problem of alloimmunization and to find important red cell antibodies in thalassaemia patients. A cross-sectional study was conducted. A total of 32 thalassaemia patients were enrolled. The specimen was subjected to red cell alloantibody and autoantibody by column gel agglutination technique. R 1 (w) R 1 , R 2 R 2 , rr (papaine and non papain) and 11 cell panel reagent cells were used in screening and identification of alloantibodies respectively. Six (18.8 %) subjects were alloimmunized. All alloimmunized subjects were recipient of more than 20 units of transfusion. Total seven clinically significant alloantibodies were identified. Anti E and anti c were commonest antibodies in four (12.5%) patients. Red cell alloimmunization is an important risk in thalassaemia patient. 71.4% of alloantibodies were anti E and anti c type. Extended phenotype match blood transfusion for Rh-c and Rh-E antigens or level 2 antigen matching stringency needs to be explored in preventing alloimmunization in thalassaemia patients.

  12. Evaluating biomarkers for prognostic enrichment of clinical trials.

    PubMed

    Kerr, Kathleen F; Roth, Jeremy; Zhu, Kehao; Thiessen-Philbrook, Heather; Meisner, Allison; Wilson, Francis Perry; Coca, Steven; Parikh, Chirag R

    2017-12-01

    A potential use of biomarkers is to assist in prognostic enrichment of clinical trials, where only patients at relatively higher risk for an outcome of interest are eligible for the trial. We investigated methods for evaluating biomarkers for prognostic enrichment. We identified five key considerations when considering a biomarker and a screening threshold for prognostic enrichment: (1) clinical trial sample size, (2) calendar time to enroll the trial, (3) total patient screening costs and the total per-patient trial costs, (4) generalizability of trial results, and (5) ethical evaluation of trial eligibility criteria. Items (1)-(3) are amenable to quantitative analysis. We developed the Biomarker Prognostic Enrichment Tool for evaluating biomarkers for prognostic enrichment at varying levels of screening stringency. We demonstrate that both modestly prognostic and strongly prognostic biomarkers can improve trial metrics using Biomarker Prognostic Enrichment Tool. Biomarker Prognostic Enrichment Tool is available as a webtool at http://prognosticenrichment.com and as a package for the R statistical computing platform. In some clinical settings, even biomarkers with modest prognostic performance can be useful for prognostic enrichment. In addition to the quantitative analysis provided by Biomarker Prognostic Enrichment Tool, investigators must consider the generalizability of trial results and evaluate the ethics of trial eligibility criteria.

  13. U.S. Air Quality and Health Benefits from Avoided Climate Change under Greenhouse Gas Mitigation.

    PubMed

    Garcia-Menendez, Fernando; Saari, Rebecca K; Monier, Erwan; Selin, Noelle E

    2015-07-07

    We evaluate the impact of climate change on U.S. air quality and health in 2050 and 2100 using a global modeling framework and integrated economic, climate, and air pollution projections. Three internally consistent socioeconomic scenarios are used to value health benefits of greenhouse gas mitigation policies specifically derived from slowing climate change. Our projections suggest that climate change, exclusive of changes in air pollutant emissions, can significantly impact ozone (O3) and fine particulate matter (PM2.5) pollution across the U.S. and increase associated health effects. Climate policy can substantially reduce these impacts, and climate-related air pollution health benefits alone can offset a significant fraction of mitigation costs. We find that in contrast to cobenefits from reductions to coemitted pollutants, the climate-induced air quality benefits of policy increase with time and are largest between 2050 and 2100. Our projections also suggest that increasing climate policy stringency beyond a certain degree may lead to diminishing returns relative to its cost. However, our results indicate that the air quality impacts of climate change are substantial and should be considered by cost-benefit climate policy analyses.

  14. Adaptive-filtering of trisomy 21: risk of Down syndrome depends on family size and age of previous child

    NASA Astrophysics Data System (ADS)

    Neuhäuser, Markus; Krackow, Sven

    2007-02-01

    The neonatal incidence rate of Down syndrome (DS) is well-known to accelerate strongly with maternal age. This non-linearity renders mere accumulation of defects at recombination during prolonged first meiotic prophase implausible as an explanation for DS rate increase with maternal age, but might be anticipated from chromosomal drive (CD) for trisomy 21. Alternatively, as there is selection against genetically disadvantaged embryos, the screening system that eliminates embryos with trisomy 21 might decay with maternal age. In this paper, we provide the first evidence for relaxed filtering stringency (RFS) to represent an adaptive maternal response that could explain accelerating DS rates with maternal age. Using historical data, we show that the proportion of aberrant live births decrease with increased family size in older mothers, that inter-birth intervals are longer before affected neonates than before normal ones, and that primiparae exhibit elevated levels of DS incidence at higher age. These findings are predicted by adaptive RFS but cannot be explained by the currently available alternative non-adaptive hypotheses, including CD. The identification of the relaxation control mechanism and therapeutic restoration of a stringent screen may have considerable medical implications.

  15. Evaluating the effects of local floodplain management policies on property owner behavior

    NASA Astrophysics Data System (ADS)

    Bollens, Scott A.; Kaiser, Edward J.; Burby, Raymond J.

    1988-05-01

    Floodplain management programs have been adopted by more than 85% of local governments in the nation with designated flood hazard areas. Yet, there has been little evaluation of the influence of floodplain policies on private sector decisions. This article examines the degree to which riverine floodplain management affects purchase and mitigation decisions made by owners of developed floodplain property in ten selected cities in the United States. We find that the stringency of such policies does not lessen floodplain property buying because of the overriding importance of site amenity factors. Indeed, flood protection measures incorporated into development projects appear to add to the attractiveness of floodplain location by increasing the perceived safety from the hazard. Property owner responses to the flood hazard after occupancy involve political action more often than individual on-site mitigation. Floodplain programs only minimally encourage on-site mitigation by the owner because most owners have not experienced a flood and many are unaware of the flood threat. It is suggested that floodplain programs will be more effective in meeting their objectives if they are directed at intervention points earlier in the land conversion process.

  16. Isoform specificity of progesterone receptor antibodies.

    PubMed

    Fabris, Victoria; Abascal, María F; Giulianelli, Sebastián; May, María; Sequeira, Gonzalo R; Jacobsen, Britta; Lombès, Marc; Han, Julie; Tran, Luan; Molinolo, Alfredo; Lanari, Claudia

    2017-10-01

    Progesterone receptors (PR) are prognostic and predictive biomarkers in hormone-dependent cancers. Two main PR isoforms have been described, PRB and PRA, that differ only in that PRB has 164 extra N-terminal amino acids. It has been reported that several antibodies empirically exclusively recognize PRA in formalin-fixed paraffin-embedded (FFPE) tissues. To confirm these findings, we used human breast cancer xenograft models, T47D-YA and -YB cells expressing PRA or PRB, respectively, MDA-MB-231 cells modified to synthesize PRB, and MDA-MB-231/iPRAB cells which can bi-inducibly express either PRA or PRB. Cells were injected into immunocompromised mice to generate tumours exclusively expressing PRA or PRB. PR isoform expression was verified using immunoblots. FFPE samples from the same tumours were studied by immunohistochemistry using H-190, clone 636, clone 16, and Ab-6 anti-PR antibodies, the latter exclusively recognizing PRB. Except for Ab-6, all antibodies displayed a similar staining pattern. Our results indicate that clones 16, 636, and the H-190 antibody recognize both PR isoforms. They point to the need for more stringency in evaluating the true specificity of purported PRA-specific antibodies as the PRA/PRB ratio may have prognostic and predictive value in breast cancer.

  17. Impact of variations in the chemical composition of vitreous mineral fibers on biopersistence in rat lungs and consequences for regulation.

    PubMed

    Bellmann, Bernd; Schaeffer, Helmut A; Muhle, Hartwig

    2010-08-01

    The chronic toxicity of vitreous fibers is substantially dependent on their biopersistence. Removal of fibers deposited in the respiratory tract is dependent on a combination of physiological clearance processes (like mechanical translocation) and physico-chemical processes like dissolution and leaching. This publication presents data of about 60 different fibers investigated in the biopersistence test which was standardized in the European Union. This test is based on in vivo investigation of biopersistence after intratracheal instillation in rats of a respirable fiber fraction, and it is a basis for the regulatory classification of vitreous fibers. Regression analysis is carried out employing the data of glass fiber compositions and the corresponding results of biopersistence tests (half-times). The study leads to a model that enables prediction of half-times for stone wool fibers as well as for glass wool fibers on the basis of their chemical composition. The aim of this paper was to investigate the stringency of the existing limits for the range of the chemical composition of glass and stone wools in view of the currently available data base. For regulatory purposes, however, this model is currently not sufficient to replace biopersistence tests completely.

  18. Simple Penalties on Maximum-Likelihood Estimates of Genetic Parameters to Reduce Sampling Variation

    PubMed Central

    Meyer, Karin

    2016-01-01

    Multivariate estimates of genetic parameters are subject to substantial sampling variation, especially for smaller data sets and more than a few traits. A simple modification of standard, maximum-likelihood procedures for multivariate analyses to estimate genetic covariances is described, which can improve estimates by substantially reducing their sampling variances. This is achieved by maximizing the likelihood subject to a penalty. Borrowing from Bayesian principles, we propose a mild, default penalty—derived assuming a Beta distribution of scale-free functions of the covariance components to be estimated—rather than laboriously attempting to determine the stringency of penalization from the data. An extensive simulation study is presented, demonstrating that such penalties can yield very worthwhile reductions in loss, i.e., the difference from population values, for a wide range of scenarios and without distorting estimates of phenotypic covariances. Moreover, mild default penalties tend not to increase loss in difficult cases and, on average, achieve reductions in loss of similar magnitude to computationally demanding schemes to optimize the degree of penalization. Pertinent details required for the adaptation of standard algorithms to locate the maximum of the likelihood function are outlined. PMID:27317681

  19. A microscopy-based screen employing multiplex genome sequencing identifies cargo-specific requirements for dynein velocity

    PubMed Central

    Tan, Kaeling; Roberts, Anthony J.; Chonofsky, Mark; Egan, Martin J.; Reck-Peterson, Samara L.

    2014-01-01

    The timely delivery of membranous organelles and macromolecules to specific locations within the majority of eukaryotic cells depends on microtubule-based transport. Here we describe a screening method to identify mutations that have a critical effect on intracellular transport and its regulation using mutagenesis, multicolor-fluorescence microscopy, and multiplex genome sequencing. This screen exploits the filamentous fungus Aspergillus nidulans, which has many of the advantages of yeast molecular genetics but uses long-range microtubule-based transport in a manner more similar to metazoan cells. Using this method, we identified seven mutants that represent novel alleles of components of the intracellular transport machinery: specifically, kinesin-1, cytoplasmic dynein, and the dynein regulators Lis1 and dynactin. The two dynein mutations identified in our screen map to dynein's AAA+ catalytic core. Single-molecule studies reveal that both mutations reduce dynein's velocity in vitro. In vivo these mutants severely impair the distribution and velocity of endosomes, a known dynein cargo. In contrast, another dynein cargo, the nucleus, is positioned normally in these mutants. These results reveal that different dynein functions have distinct stringencies for motor performance. PMID:24403603

  20. An in vivo library-versus-library selection of optimized protein-protein interactions.

    PubMed

    Pelletier, J N; Arndt, K M; Plückthun, A; Michnick, S W

    1999-07-01

    We describe a rapid and efficient in vivo library-versus-library screening strategy for identifying optimally interacting pairs of heterodimerizing polypeptides. Two leucine zipper libraries, semi-randomized at the positions adjacent to the hydrophobic core, were genetically fused to either one of two designed fragments of the enzyme murine dihydrofolate reductase (mDHFR), and cotransformed into Escherichia coli. Interaction between the library polypeptides reconstituted enzymatic activity of mDHFR, allowing bacterial growth. Analysis of the resulting colonies revealed important biases in the zipper sequences relative to the original libraries, which are consistent with selection for stable, heterodimerizing pairs. Using more weakly associating mDHFR fragments, we increased the stringency of selection. We enriched the best-performing leucine zipper pairs by multiple passaging of the pooled, selected colonies in liquid culture, as the best pairs allowed for better bacterial propagation. This competitive growth allowed small differences among the pairs to be amplified, and different sequence positions were enriched at different rates. We applied these selection processes to a library-versus-library sample of 2.0 x 10(6) combinations and selected a novel leucine zipper pair that may be appropriate for use in further in vivo heterodimerization strategies.

  1. Does certificate of need law enhance competition in inpatient care market? An empirical analysis.

    PubMed

    Paul, Jomon A; Ni, Huan; Bagchi, Aniruddha

    2017-06-29

    This article investigates the impact of Certificate of Need (CON) laws on competition in the inpatient care market. One of the major criticisms of these laws is that it may hinder competition in the health care market, which can lead to higher prices. However, from a theoretical standpoint, CON laws could also promote competition by limiting excessive expansion from incumbents. Our main conclusion is that CON laws by and large enhanced competition in the inpatient market during the period of our study. This indicates that the effects of CON laws to hinder predatory behavior could dominate its effects of preventing new entrants into the inpatient care market. We do not find statistically significant evidence to reject the exogeneity assumption of either CON laws or their stringency in our study. We also find factors such as proportion of population aged 18-44, proportion of Asian American population, obesity rate, political environment, etc., in a state significantly impact competition. Our findings could shed some light to public policy makers when deciding the appropriate health programs or legislative framework to promote health care market competition and thereby facilitate quality health care.

  2. The d4 gene family in the human genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chestkov, A.V.; Baka, I.D.; Kost, M.V.

    1996-08-15

    The d4 domain, a novel zinc finger-like structural motif, was first revealed in the rat neuro-d4 protein. Here we demonstrate that the d4 domain is conserved in evolution and that three related genes form a d4 family in the human genome. The human neuro-d4 is very similar to rat neuro-d4 at both the amino acid and the nucleotide levels. Moreover, the same splice variants have been detected among rat and human neuro-d4 transcripts. This gene has been localized on chromosome 19, and two other genes, members of the d4 family isolated by screening of the human genomic library at lowmore » stringency, have been mapped to chromosomes 11 and 14. The gene on chromosome 11 is the homolog of the ubiquitously expressed mouse gene ubi-d4/requiem, which is required for cell death after deprivation of trophic factors. A gene with a conserved d4 domain has been found in the genome of the nematode Caenorhabditis elegans. The conservation of d4 proteins from nematodes to vertebrates suggests that they have a general importance, but a diversity of d4 proteins expressed in vertebrate nervous systems suggests that some family members have special functions. 11 refs., 2 figs.« less

  3. CombiROC: an interactive web tool for selecting accurate marker combinations of omics data.

    PubMed

    Mazzara, Saveria; Rossi, Riccardo L; Grifantini, Renata; Donizetti, Simone; Abrignani, Sergio; Bombaci, Mauro

    2017-03-30

    Diagnostic accuracy can be improved considerably by combining multiple markers, whose performance in identifying diseased subjects is usually assessed via receiver operating characteristic (ROC) curves. The selection of multimarker signatures is a complicated process that requires integration of data signatures with sophisticated statistical methods. We developed a user-friendly tool, called CombiROC, to help researchers accurately determine optimal markers combinations from diverse omics methods. With CombiROC data from different domains, such as proteomics and transcriptomics, can be analyzed using sensitivity/specificity filters: the number of candidate marker panels rising from combinatorial analysis is easily optimized bypassing limitations imposed by the nature of different experimental approaches. Leaving to the user full control on initial selection stringency, CombiROC computes sensitivity and specificity for all markers combinations, performances of best combinations and ROC curves for automatic comparisons, all visualized in a graphic interface. CombiROC was designed without hard-coded thresholds, allowing a custom fit to each specific data: this dramatically reduces the computational burden and lowers the false negative rates given by fixed thresholds. The application was validated with published data, confirming the marker combination already originally described or even finding new ones. CombiROC is a novel tool for the scientific community freely available at http://CombiROC.eu.

  4. Moderate relationships between NAA and cognitive ability in healthy adults: implications for cognitive spectroscopy

    PubMed Central

    Patel, Tulpesh; Blyth, Jacqueline C.; Griffiths, Gareth; Kelly, Deirdre; Talcott, Joel B.

    2014-01-01

    Background: Proton Magnetic Resonance Spectroscopy (1H-MRS) is a non-invasive imaging technique that enables quantification of neurochemistry in vivo and thereby facilitates investigation of the biochemical underpinnings of human cognitive variability. Studies in the field of cognitive spectroscopy have commonly focused on relationships between measures of N-acetyl aspartate (NAA), a surrogate marker of neuronal health and function, and broad measures of cognitive performance, such as IQ. Methodology/Principal Findings: In this study, we used 1H-MRS to interrogate single-voxels in occipitoparietal and frontal cortex, in parallel with assessments of psychometric intelligence, in a sample of 40 healthy adult participants. We found correlations between NAA and IQ that were within the range reported in previous studies. However, the magnitude of these effects was significantly modulated by the stringency of data screening and the extent to which outlying values contributed to statistical analyses. Conclusions/Significance: 1H-MRS offers a sensitive tool for assessing neurochemistry non-invasively, yet the relationships between brain metabolites and broad aspects of human behavior such as IQ are subtle. We highlight the need to develop an increasingly rigorous analytical and interpretive framework for collecting and reporting data obtained from cognitive spectroscopy studies of this kind. PMID:24592224

  5. A Platform for Combined DNA and Protein Microarrays Based on Total Internal Reflection Fluorescence

    PubMed Central

    Asanov, Alexander; Zepeda, Angélica; Vaca, Luis

    2012-01-01

    We have developed a novel microarray technology based on total internal reflection fluorescence (TIRF) in combination with DNA and protein bioassays immobilized at the TIRF surface. Unlike conventional microarrays that exhibit reduced signal-to-background ratio, require several stages of incubation, rinsing and stringency control, and measure only end-point results, our TIRF microarray technology provides several orders of magnitude better signal-to-background ratio, performs analysis rapidly in one step, and measures the entire course of association and dissociation kinetics between target DNA and protein molecules and the bioassays. In many practical cases detection of only DNA or protein markers alone does not provide the necessary accuracy for diagnosing a disease or detecting a pathogen. Here we describe TIRF microarrays that detect DNA and protein markers simultaneously, which reduces the probabilities of false responses. Supersensitive and multiplexed TIRF DNA and protein microarray technology may provide a platform for accurate diagnosis or enhanced research studies. Our TIRF microarray system can be mounted on upright or inverted microscopes or interfaced directly with CCD cameras equipped with a single objective, facilitating the development of portable devices. As proof-of-concept we applied TIRF microarrays for detecting molecular markers from Bacillus anthracis, the pathogen responsible for anthrax. PMID:22438738

  6. The effect of genome-wide association scan quality control on imputation outcome for common variants.

    PubMed

    Southam, Lorraine; Panoutsopoulou, Kalliope; Rayner, N William; Chapman, Kay; Durrant, Caroline; Ferreira, Teresa; Arden, Nigel; Carr, Andrew; Deloukas, Panos; Doherty, Michael; Loughlin, John; McCaskie, Andrew; Ollier, William E R; Ralston, Stuart; Spector, Timothy D; Valdes, Ana M; Wallis, Gillian A; Wilkinson, J Mark; Marchini, Jonathan; Zeggini, Eleftheria

    2011-05-01

    Imputation is an extremely valuable tool in conducting and synthesising genome-wide association studies (GWASs). Directly typed SNP quality control (QC) is thought to affect imputation quality. It is, therefore, common practise to use quality-controlled (QCed) data as an input for imputing genotypes. This study aims to determine the effect of commonly applied QC steps on imputation outcomes. We performed several iterations of imputing SNPs across chromosome 22 in a dataset consisting of 3177 samples with Illumina 610 k (Illumina, San Diego, CA, USA) GWAS data, applying different QC steps each time. The imputed genotypes were compared with the directly typed genotypes. In addition, we investigated the correlation between alternatively QCed data. We also applied a series of post-imputation QC steps balancing elimination of poorly imputed SNPs and information loss. We found that the difference between the unQCed data and the fully QCed data on imputation outcome was minimal. Our study shows that imputation of common variants is generally very accurate and robust to GWAS QC, which is not a major factor affecting imputation outcome. A minority of common-frequency SNPs with particular properties cannot be accurately imputed regardless of QC stringency. These findings may not generalise to the imputation of low frequency and rare variants.

  7. Single genome retrieval of context-dependent variability in mutation rates for human germline.

    PubMed

    Sahakyan, Aleksandr B; Balasubramanian, Shankar

    2017-01-13

    Accurate knowledge of the core components of substitution rates is of vital importance to understand genome evolution and dynamics. By performing a single-genome and direct analysis of 39,894 retrotransposon remnants, we reveal sequence context-dependent germline nucleotide substitution rates for the human genome. The rates are characterised through rate constants in a time-domain, and are made available through a dedicated program (Trek) and a stand-alone database. Due to the nature of the method design and the imposed stringency criteria, we expect our rate constants to be good estimates for the rates of spontaneous mutations. Benefiting from such data, we study the short-range nucleotide (up to 7-mer) organisation and the germline basal substitution propensity (BSP) profile of the human genome; characterise novel, CpG-independent, substitution prone and resistant motifs; confirm a decreased tendency of moieties with low BSP to undergo somatic mutations in a number of cancer types; and, produce a Trek-based estimate of the overall mutation rate in human. The extended set of rate constants we report may enrich our resources and help advance our understanding of genome dynamics and evolution, with possible implications for the role of spontaneous mutations in the emergence of pathological genotypes and neutral evolution of proteomes.

  8. The freckle plot (daily turnaround time chart): a technique for timely and effective quality improvement of test turnaround times.

    PubMed

    Pellar, T G; Ward, P J; Tuckerman, J F; Henderson, A R

    1993-06-01

    Test turnaround times are often monitored on a monthly basis. However, such an interval usually means that not all causes for delay in test reporting can be unequivocally identified for institution of remedial action. We have devised a daily chart--the freckle plot--that graphically displays the test turnaround times by laboratory receipt time. Different symbols are used to designate specimens reported within the test's turnaround time limit, those within 10 min beyond that limit, and those well outside the limit. These categories are adjustable to suit different limits of stringency. Freckle plots are produced on a daily basis and can be used to track down causes for test delays. Using the 1-h turnaround time "stat" potassium test as a model, we found 16 causes for test delay, of which 9 were potentially remediable. By applying these remedies, we were able to increase test compliance, in the day shift, from 91.5% (95% confidence interval 88.8%-93.7%) to 97.6% (95% confidence interval 96.4-98.55%), which is significant at P < 10(-7). This daily plot is a useful quality assurance tool, supplementing the more conventional tests used to ensure laboratory quality improvement.

  9. Isoform specificity of progesterone receptor antibodies

    PubMed Central

    Fabris, Victoria; Abascal, María F; Giulianelli, Sebastián; May, María; Sequeira, Gonzalo R; Jacobsen, Britta; Lombès, Marc; Han, Julie; Tran, Luan; Molinolo, Alfredo

    2017-01-01

    Abstract Progesterone receptors (PR) are prognostic and predictive biomarkers in hormone‐dependent cancers. Two main PR isoforms have been described, PRB and PRA, that differ only in that PRB has 164 extra N‐terminal amino acids. It has been reported that several antibodies empirically exclusively recognize PRA in formalin‐fixed paraffin‐embedded (FFPE) tissues. To confirm these findings, we used human breast cancer xenograft models, T47D‐YA and ‐YB cells expressing PRA or PRB, respectively, MDA‐MB‐231 cells modified to synthesize PRB, and MDA‐MB‐231/iPRAB cells which can bi‐inducibly express either PRA or PRB. Cells were injected into immunocompromised mice to generate tumours exclusively expressing PRA or PRB. PR isoform expression was verified using immunoblots. FFPE samples from the same tumours were studied by immunohistochemistry using H‐190, clone 636, clone 16, and Ab‐6 anti‐PR antibodies, the latter exclusively recognizing PRB. Except for Ab‐6, all antibodies displayed a similar staining pattern. Our results indicate that clones 16, 636, and the H‐190 antibody recognize both PR isoforms. They point to the need for more stringency in evaluating the true specificity of purported PRA‐specific antibodies as the PRA/PRB ratio may have prognostic and predictive value in breast cancer. PMID:29085663

  10. Tobacco smoke exposure and impact of smoking legislation on rural and non-rural hospitality venues in North Dakota.

    PubMed

    Buettner-Schmidt, Kelly; Lobo, Marie L; Travers, Mark J; Boursaw, Blake

    2015-08-01

    The purpose of this cross-sectional study in a stratified random sample of 135 bars and restaurants in North Dakota was to describe factors that influenced tobacco smoke pollution levels in the venues; to compare the quantity of tobacco smoke pollution by rurality and by presence of local ordinances; and to assess compliance with state and local laws. In data collection in 2012, we measured the indoor air quality indicator of particulate matter (2.5 microns aerodynamic diameter or smaller), calculated average smoking density and occupant density, and determined compliance with state and local smoking ordinances using observational methods. As rurality increased, tobacco smoke pollution in bars increased. A significant association was found between stringency of local laws and level of tobacco smoke pollution, but the strength of the association varied by venue type. Compliance was significantly lower in venues in communities without local ordinances. Controlling for venue type, 69.2% of smoke-free policy's impact on tobacco smoke pollution levels was mediated by observed smoking. This study advances scientific knowledge on the factors influencing tobacco smoke pollution and informs public health advocates and decision makers on policy needs, especially in rural areas. © 2015 Wiley Periodicals, Inc.

  11. A monoallelic-to-biallelic T-cell transcriptional switch regulates GATA3 abundance

    PubMed Central

    Ku, Chia-Jui; Lim, Kim-Chew; Kalantry, Sundeep; Maillard, Ivan; Engel, James Douglas; Hosoya, Tomonori

    2015-01-01

    Protein abundance must be precisely regulated throughout life, and nowhere is the stringency of this requirement more evident than during T-cell development: A twofold increase in the abundance of transcription factor GATA3 results in thymic lymphoma, while reduced GATA3 leads to diminished T-cell production. GATA3 haploinsufficiency also causes human HDR (hypoparathyroidism, deafness, and renal dysplasia) syndrome, often accompanied by immunodeficiency. Here we show that loss of one Gata3 allele leads to diminished expansion (and compromised development) of immature T cells as well as aberrant induction of myeloid transcription factor PU.1. This effect is at least in part mediated transcriptionally: We discovered that Gata3 is monoallelically expressed in a parent of origin-independent manner in hematopoietic stem cells and early T-cell progenitors. Curiously, half of the developing cells switch to biallelic Gata3 transcription abruptly at midthymopoiesis. We show that the monoallelic-to-biallelic transcriptional switch is stably maintained and therefore is not a stochastic phenomenon. This unique mechanism, if adopted by other regulatory genes, may provide new biological insights into the rather prevalent phenomenon of monoallelic expression of autosomal genes as well as into the variably penetrant pathophysiological spectrum of phenotypes observed in many human syndromes that are due to haploinsufficiency of the affected gene. PMID:26385963

  12. A compromise too far: a review of Canadian cases of direct-to-consumer advertising regulation.

    PubMed

    Lexchin, Joel; Mintzes, Barbara

    2014-01-01

    Since the mid 1990's, Canada has introduced partial direct-to-consumer advertising (DTCA) of prescription drugs through administrative policy shifts. Little documentation exists on how regulation occurs in practice. To evaluate Health Canada's response to complaints about DTCA. We use case studies about DTCA spanning from 2000 to 2011 to examine the stringency of regulation by Health Canada. The aim was to identify key themes in Health Canada's approach to regulation from a public health perspective. All of the material related to the cases was independently read by each of the authors and any disagreements in interpretation were resolved through discussion. We identified six weaknesses in how Health Canada deals with DTCA: failure to act on concerns about promotion for unapproved "off-label" uses, possible financial inducements to use a product, advertisements perceived to stimulate unwarranted fear about disease risks, and advertising of products with serious safety concerns identified in Health Canada safety advisories; ineffective enforcement actions undertaken by Health Canada; and lack of transparency in Health Canada's decision-making. There is an astonishing degree of discordance between public health priorities and regulation of DTCA in Canada. The current approach to enforcement is notable both for its lack of teeth and lack of accountability and transparency.

  13. Collaborative decision-making on wind power projects based on AHP method

    NASA Astrophysics Data System (ADS)

    Badea, A.; Proştean, G.; Tămăşilă, M.; Vârtosu, A.

    2017-01-01

    The complexity of projects implementation in Renewable Energy Sources (RES) requires finding collaborative alliances between suppliers and project developers in RES. Links activities in supply chain in RES, respectively, transportation of heavy components, processing orders to purchase quality raw materials, storage and materials handling, packaging, and other complex activities requiring a logistics system collaboratively to be permanently dimensioned properly selected and monitored. Requirements imposed by stringency of wind power energy projects implementation inevitably involves constraints in infrastructure, implementation and logistics. Thus, following an extensive research in RES project, to eliminate these constraints were identified alternative collaboration to provide feasible solutions on different levels of performance. The paper presents a critical analysis of different collaboration alternatives in supply chain for RES projects, selecting the ones most suitable for particular situations by using decision-making method Analytic Hierarchy Process (AHP). The role of AHP method was to formulate a decision model by which can be establish the collaboration alternative choice through mathematical calculation to reduce the impact created by constraints encountered. The solution provided through AHP provides a framework for detecting optimal alternative collaboration between suppliers and project developers in RES and avoids some breaks in the chain by resizing safety buffers for leveling orders in RES projects.

  14. Cynefin as Reference Framework to Facilitate Insight and Decision-Making in Complex Contexts of Biomedical Research.

    PubMed

    Kempermann, Gerd

    2017-01-01

    The Cynefin scheme is a concept of knowledge management, originally devised to support decision making in management, but more generally applicable to situations, in which complexity challenges the quality of insight, prediction, and decision. Despite the fact that life itself, and especially the brain and its diseases, are complex to the extent that complexity could be considered their cardinal feature, complex problems in biomedicine are often treated as if they were actually not more than the complicated sum of solvable sub-problems. Because of the emergent properties of complex contexts this is not correct. With a set of clear criteria Cynefin helps to set apart complex problems from "simple/obvious," "complicated," "chaotic," and "disordered" contexts in order to avoid misinterpreting the relevant causality structures. The distinction comes with the insight, which specific kind of knowledge is possible in each of these categories and what are the consequences for resulting decisions and actions. From student's theses over the publication and grant writing process to research politics, misinterpretation of complexity can have problematic or even dangerous consequences, especially in clinical contexts. Conceptualization of problems within a straightforward reference language like Cynefin improves clarity and stringency within projects and facilitates communication and decision-making about them.

  15. Transcriptome Profiling of microRNA by Next-Gen Deep Sequencing Reveals Known and Novel miRNA Species in the Lipid Fraction of Human Breast Milk

    PubMed Central

    Benham, Ashley L.; Pejerrey, Sasha M.; Showalter, Lori; Hu, Min; Shope, Cynthia D.; Maningat, Patricia D.; Gunaratne, Preethi H.; Haymond, Morey; Aagaard, Kjersti

    2013-01-01

    While breast milk has unique health advantages for infants, the mechanisms by which it regulates the physiology of newborns are incompletely understood. miRNAs have been described as functioning transcellularly, and have been previously isolated in cell-free and exosomal form from bodily liquids (serum, saliva, urine) and tissues, including mammary tissue. We hypothesized that breast milk in general, and milk fat globules in particular, contain significant numbers of known and limited novel miRNA species detectable with massively parallel sequencing. Extracted RNA from lactating mothers before and following short-term treatment with recombinant human growth hormone (rhGH) was smRNA-enriched. smRNA-Seq was performed to generate 124,110,646 36-nt reads. Of these, 31,102,927 (25%) exactly matched known human miRNAs; with relaxing of stringency, 74,716,151 (60%) matched known miRNAs including 308 of the 1018 (29%) mature miRNAs (miRBase 16.0). These miRNAs are predicted to target 9074 genes; the 10 most abundant of these predicted to target 2691 genes with enrichment for transcriptional regulation of metabolic and immune responses. We identified 21 putative novel miRNAs, of which 12 were confirmed in a large validation set that included cohorts of lactating women consuming enriched diets. Of particular interest, we observed that expression of several novel miRNAs were altered by the perturbed maternal diet, notably following a high-fat intake (p<0.05). Our findings suggest that known and novel miRNAs are enriched in breast milk fat globules, and expression of several novel miRNA species is regulated by maternal diet. Based on robust pathway mapping, our data supports the notion that these maternally secreted miRNAs (stable in the milk fat globules) play a regulatory role in the infant and account in part for the health benefits of breast milk. We further speculate that regulation of these miRNA by a high fat maternal diet enables modulation of fetal metabolism to accommodate significant dietary challenges. PMID:23418415

  16. Selection of clc, cba, and fcb Chlorobenzoate-Catabolic Genotypes from Groundwater and Surface Waters Adjacent to the Hyde Park, Niagara Falls, Chemical Landfill

    PubMed Central

    Peel, Michelle C.; Wyndham, R. Campbell

    1999-01-01

    The frequency of isolation of three nonhomologous chlorobenzoate catabolic genotypes (clc, cba, and fcb) was determined for 464 isolates from freshwater sediments and groundwater in the vicinity of the Hyde Park industrial landfill site in the Niagara watershed. Samples were collected from both contaminated and noncontaminated sites during spring, summer, and fall and enriched at 4, 22, or 32°C with micromolar to millimolar concentrations of chlorobenzoates and 3-chlorobiphenyl (M. C. Peel and R. C. Wyndham, Microb. Ecol: 33:59–68, 1997). Hybridization at moderate stringency to restriction-digested genomic DNA with DNA probes revealed the chlorocatechol 1,2-dioxygenase operon (clcABD), the 3-chlorobenzoate 3,4-(4,5)-dioxygenase operon (cbaABC), and the 4-chlorobenzoate dehalogenase (fcbB) gene in isolates enriched from all contaminated sites in the vicinity of the industrial landfill. Nevertheless, the known genes were found in less than 10% of the isolates from the contaminated sites, indicating a high level of genetic diversity in the microbial community. The known genotypes were not enriched from the noncontaminated control sites nearby. The clc, cba, and fcb isolates were distributed across five phenotypically distinct groups based on Biolog carbon source utilization, with the breadth of the host range decreasing in the order clc > cba > fcb. Restriction fragment length polymorphism (RFLP) patterns showed that the cba genes were conserved in all isolates whereas the clc and fcb genes exhibited variation in RFLP patterns. These observations are consistent with the recent spread of the cba genes by horizontal transfer as part of transposon Tn5271 in response to contaminant exposure at Hyde Park. Consistent with this hypothesis, IS1071, the flanking element in Tn5271, was found in all isolates that carried the cba genes. Interestingly, IS1071 was also found in a high proportion of isolates from Hyde Park carrying the clc and fcb genes, as well as in type strains carrying the clcABD operon and the biphenyl (bph) catabolic genes. PMID:10103260

  17. Spintronic microfluidic platform for biomedical and environmental applications

    NASA Astrophysics Data System (ADS)

    Cardoso, F. A.; Martins, V. C.; Fonseca, L. P.; Germano, J.; Sousa, L. A.; Piedade, M. S.; Freitas, P. P.

    2010-09-01

    Faster, more sensitive and easy to operate biosensing devices still are a need at important areas such as biomedical diagnostics, food control and environmental monitoring. Recently, spintronic-devices have emerged as a promising alternative to the existent technologies [1-3]. A number of advantages, namely high sensitivity, easy integration, miniaturization, scalability, robustness and low cost make these devices potentially capable of responding to the existent technological need. In parallel, the field of microfluidics has shown great advances [4]. Microfluidic systems allow the analysis of small sample volumes (from micro- down to pico-liters), often by automate sample processing with the ability to integrate several steps into a single device (analyte amplification, concentration, separation and/or labeling), all in a reduced assay time (minutes to hours) and affordable cost. The merging of these two technologies, magnetoresistive biochips and microfluidics, will enable the development of highly competitive devices. This work reports the integration of a magnetoresistive biochip with a microfluidic system inside a portable and autonomous electronic platform aiming for a fully integrated device. A microfluidic structure fabricated in polydimethylsiloxane with dimensions of W: 0.5mm, H: 0.1mm, L: 10mm, associated to a mechanical system to align and seal the channel by pressure is presented (Fig. 1) [5]. The goal is to perform sample loading and transportation over the chip and simultaneously control the stringency and uniformity of the wash-out process. The biochip output is acquired by an electronic microsystem incorporating the circuitry to control, address and read-out the 30 spin-valve sensors sequentially (Fig. 1) [2]. This platform is being applied to the detection of water-borne microbial pathogens (e.g. Salmonella and Escherichia coli) and genetic diseases diagnosis (e.g. cystic fibrosis) through DNA hybridization assays. Open chamber measurements were performed as described elsewhere [2]. Briefly, a 20 μl sample droplet is manually dispensed over the chip, limited by a polymeric frame. When using the microfluidic system for sample loading, a known volume of sample is introduced into the fluidic system through the help of a syringe pump at a controlled velocity.

  18. Improving the efficiency of CHO cell line generation using glutamine synthetase gene knockout cells.

    PubMed

    Fan, Lianchun; Kadura, Ibrahim; Krebs, Lara E; Hatfield, Christopher C; Shaw, Margaret M; Frye, Christopher C

    2012-04-01

    Although Chinese hamster ovary (CHO) cells, with their unique characteristics, have become a major workhorse for the manufacture of therapeutic recombinant proteins, one of the major challenges in CHO cell line generation (CLG) is how to efficiently identify those rare, high-producing clones among a large population of low- and non-productive clones. It is not unusual that several hundred individual clones need to be screened for the identification of a commercial clonal cell line with acceptable productivity and growth profile making the cell line appropriate for commercial application. This inefficiency makes the process of CLG both time consuming and laborious. Currently, there are two main CHO expression systems, dihydrofolate reductase (DHFR)-based methotrexate (MTX) selection and glutamine synthetase (GS)-based methionine sulfoximine (MSX) selection, that have been in wide industrial use. Since selection of recombinant cell lines in the GS-CHO system is based on the balance between the expression of the GS gene introduced by the expression plasmid and the addition of the GS inhibitor, L-MSX, the expression of GS from the endogenous GS gene in parental CHOK1SV cells will likely interfere with the selection process. To study endogenous GS expression's potential impact on selection efficiency, GS-knockout CHOK1SV cell lines were generated using the zinc finger nuclease (ZFN) technology designed to specifically target the endogenous CHO GS gene. The high efficiency (∼2%) of bi-allelic modification on the CHO GS gene supports the unique advantages of the ZFN technology, especially in CHO cells. GS enzyme function disruption was confirmed by the observation of glutamine-dependent growth of all GS-knockout cell lines. Full evaluation of the GS-knockout cell lines in a standard industrial cell culture process was performed. Bulk culture productivity improved two- to three-fold through the use of GS-knockout cells as parent cells. The selection stringency was significantly increased, as indicated by the large reduction of non-producing and low-producing cells after 25 µM L-MSX selection, and resulted in a six-fold efficiency improvement in identifying similar numbers of high-productive cell lines for a given recombinant monoclonal antibody. The potential impact of GS-knockout cells on recombinant protein quality is also discussed. Copyright © 2011 Wiley Periodicals, Inc.

  19. Rescue karyotyping: a case series of array-based comparative genomic hybridization evaluation of archival conceptual tissue

    PubMed Central

    2014-01-01

    Background Determination of fetal aneuploidy is central to evaluation of recurrent pregnancy loss (RPL). However, obtaining this information at the time of a miscarriage is not always possible or may not have been ordered. Here we report on “rescue karyotyping”, wherein DNA extracted from archived paraffin-embedded pregnancy loss tissue from a prior dilation and curettage (D&C) is evaluated by array-based comparative genomic hybridization (aCGH). Methods A retrospective case series was conducted at an academic medical center. Patients included had unexplained RPL and a prior pregnancy loss for which karyotype information would be clinically informative but was unavailable. After extracting DNA from slides of archived tissue, aCGH with a reduced stringency approach was performed, allowing for analysis of partially degraded DNA. Statistics were computed using STATA v12.1 (College Station, TX). Results Rescue karyotyping was attempted on 20 specimens from 17 women. DNA was successfully extracted in 16 samples (80.0%), enabling analysis at either high or low resolution. The longest interval from tissue collection to DNA extraction was 4.2 years. There was no significant difference in specimen sufficiency for analysis in the collection-to-extraction interval (p = 0.14) or gestational age at pregnancy loss (p = 0.32). Eight specimens showed copy number variants: 3 trisomies, 2 partial chromosomal deletions, 1 mosaic abnormality and 2 unclassified variants. Conclusions Rescue karyotyping using aCGH on DNA extracted from paraffin-embedded tissue provides the opportunity to obtain critical fetal cytogenetic information from a prior loss, even if it occurred years earlier. Given the ubiquitous archiving of paraffin embedded tissue obtained during a D&C and the ease of obtaining results despite long loss-to-testing intervals or early gestational age at time of fetal demise, this may provide a useful technique in the evaluation of couples with recurrent pregnancy loss. PMID:24589081

  20. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  1. Characterisation of false-positive observations in botanical surveys

    PubMed Central

    2017-01-01

    Errors in botanical surveying are a common problem. The presence of a species is easily overlooked, leading to false-absences; while misidentifications and other mistakes lead to false-positive observations. While it is common knowledge that these errors occur, there are few data that can be used to quantify and describe these errors. Here we characterise false-positive errors for a controlled set of surveys conducted as part of a field identification test of botanical skill. Surveys were conducted at sites with a verified list of vascular plant species. The candidates were asked to list all the species they could identify in a defined botanically rich area. They were told beforehand that their final score would be the sum of the correct species they listed, but false-positive errors counted against their overall grade. The number of errors varied considerably between people, some people create a high proportion of false-positive errors, but these are scattered across all skill levels. Therefore, a person’s ability to correctly identify a large number of species is not a safeguard against the generation of false-positive errors. There was no phylogenetic pattern to falsely observed species; however, rare species are more likely to be false-positive as are species from species rich genera. Raising the threshold for the acceptance of an observation reduced false-positive observations dramatically, but at the expense of more false negative errors. False-positive errors are higher in field surveying of plants than many people may appreciate. Greater stringency is required before accepting species as present at a site, particularly for rare species. Combining multiple surveys resolves the problem, but requires a considerable increase in effort to achieve the same sensitivity as a single survey. Therefore, other methods should be used to raise the threshold for the acceptance of a species. For example, digital data input systems that can verify, feedback and inform the user are likely to reduce false-positive errors significantly. PMID:28533972

  2. Isolation and Identification of Genes Activating Uas2-Dependent Adh2 Expression in Saccharomyces Cerevisiae

    PubMed Central

    Donoviel, M. S.; Young, E. T.

    1996-01-01

    Two cis-acting elements have been identified that act synergistically to regulate expression of the glucose-repressed alcohol dehydrogenase 2 (ADH2) gene. UAS1 is bound by the trans-activator Adr1p. UAS2 is thought to be the binding site for an unidentified regulatory protein. A genetic selection based on a UAS2-dependent ADH2 reporter was devised to isolate genes capable of activating UAS2-dependent transcription. One set of UAS2-dependent genes contained SPT6/CRE2/SSN20. Multicopy SPT6 caused improper expression of chromosomal ADH2. A second set of UAS2-dependent clones contained a previously uncharacterized open reading frame designated MEU1 (Multicopy Enhancer of UAS2). A frame shift mutation in MEU1 abolished its ability to activate UAS2-dependent gene expression. Multicopy MEU1 expression suppressed the constitutive ADH2 expression caused by cre2-1. Disruption of MEU1 reduced endogenous ADH2 expression about twofold but had no effect on cell viability or growth. No homologues of MEU1 were identified by low-stringency Southern hybridization of yeast genomic DNA, and no significant homologues were found in the sequence data bases. A MEU1/β-gal fusion protein was not localized to a particular region of the cell. MEU1 is linked to PPR1 on chromosome XII. PMID:8807288

  3. Cotransduction with MGMT and Ubiquitous or Erythroid-Specific GFP Lentiviruses Allows Enrichment of Dual-Positive Hematopoietic Progenitor Cells In Vivo

    PubMed Central

    Roth, Justin C.; Ismail, Mourad; Reese, Jane S.; Lingas, Karen T.; Ferrari, Giuliana; Gerson, Stanton L.

    2012-01-01

    The P140K point mutant of MGMT allows robust hematopoietic stem cell (HSC) enrichment in vivo. Thus, dual-gene vectors that couple MGMT and therapeutic gene expression have allowed enrichment of gene-corrected HSCs in animal models. However, expression levels from dual-gene vectors are often reduced for one or both genes. Further, it may be desirable to express selection and therapeutic genes at distinct stages of cell differentiation. In this regard, we evaluated whether hematopoietic cells could be efficiently cotransduced using low MOIs of two separate single-gene lentiviruses, including MGMT for dual-positive cell enrichment. Cotransduction efficiencies were evaluated using a range of MGMT : GFP virus ratios, MOIs, and selection stringencies in vitro. Cotransduction was optimal when equal proportions of each virus were used, but low MGMT : GFP virus ratios resulted in the highest proportion of dual-positive cells after selection. This strategy was then evaluated in murine models for in vivo selection of HSCs cotransduced with a ubiquitous MGMT expression vector and an erythroid-specific GFP vector. Although the MGMT and GFP expression percentages were variable among engrafted recipients, drug selection enriched MGMT-positive leukocyte and GFP-positive erythroid cell populations. These data demonstrate cotransduction as a mean to rapidly enrich and evaluate therapeutic lentivectors in vivo. PMID:22888445

  4. Induced abortion patterns and determinants among married women in China: 1979 to 2010.

    PubMed

    Wang, Cuntong

    2014-05-01

    China has launched the one-child policy to control its rapidly expanding population since 1979. Local governments, tasked with limiting regional birth rates, commonly imposed induced abortions. After 1994, China's family planning policy was relatively loosened and mandatory induced abortion gradually gave way to client-centered and informed-choice contraceptive policy and the "Compensation" Fee policy. This study assesses trends in and determinants of induced abortion among married women aged 20-49 in China from 1979 to 2010, using data from national statistics and nationally representative sample surveys. The incidence of induced abortions among married women aged 20-49 began to decrease in the mid-1990s. The induced abortion rate reached its highest level in the early 1980s (56.07%) and its lowest level in the 2000s (18.04%), with an average annual rate of 28.95% among married women 20-49 years old. The likelihood of a pregnant woman undergoing an induced abortion during this period depended not only on individual characteristics (including ethnicity, age, education level, household registration, number of children, and sex of children), but also on the stringency of the family planning policy in place. The less stringent the family planning policy, the less likely married women were to undergo an induced abortion. Copyright © 2014 Reproductive Health Matters. Published by Elsevier Ltd. All rights reserved.

  5. Governing change: land-use change and the prevention of nonpoint source pollution in the north coastal basin of California.

    PubMed

    Short, Anne G

    2013-01-01

    Many rural areas in the United States and throughout much of the postindustrial world are undergoing significant ecological, socioeconomic, and political transformations. The migration of urban and suburban dwellers into rural areas has led to the subdivision of large tracts of land into smaller parcels, which can complicate efforts to govern human-environmental problems. Non-point source (NPS) pollution from private rural lands is a particularly pressing human-environmental challenge that may be aggravated by changing land tenure. In this article, I report on a study of the governance and management of sediment (a common NPS pollutant) in the North Coastal basin of California, a region undergoing a transition from traditional extractive and agricultural land uses to rural residential and other alternative land uses. I focus on the differences in the governance and management across private timber, ranch, residential, vacation, and other lands in the region. I find that (1) the stringency and strength of sediment regulations differ by land use, (2) nonregulatory programs tend to target working landscapes, and (3) rural residential landowners have less knowledge of sediment control and report using fewer sediment-control techniques than landowners using their land for timber production or ranching. I conclude with an exploration of the consequences of these differences on an evolving rural landscape.

  6. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  7. Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees and whole-genome-based data.

    PubMed

    Edwards, J D; Baldo, A M; Mueller, L A

    2016-01-01

    Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining datasets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data and molecular marker fragment size data. Rice research has benefited from early adoption and extensive use of simple sequence repeat (SSR) markers; however, the majority of rice SSR markers were developed prior to the latest rice pseudomolecule assembly. Interpretation of new research using SNPs in the context of literature citing SSRs requires a common coordinate system. A new pipeline, using a stepwise relaxation of stringency, was used to map SSR primers onto the latest rice pseudomolecule assembly. The SSR markers and experimentally assayed amplicon sizes are presented in a relational database with a web-based front end, and are available as a track loaded in a genome browser with links connecting the browser and database. The combined capabilities of Ricebase link genetic markers, genome context, allele states across rice germplasm and potentially user curated phenotypic interpretations as a community resource for genetic discovery and breeding in rice. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the United States.

  8. Governing Change: Land-Use Change and the Prevention of Nonpoint Source Pollution in the North Coastal Basin of California

    NASA Astrophysics Data System (ADS)

    Short, Anne G.

    2013-01-01

    Many rural areas in the United States and throughout much of the postindustrial world are undergoing significant ecological, socioeconomic, and political transformations. The migration of urban and suburban dwellers into rural areas has led to the subdivision of large tracts of land into smaller parcels, which can complicate efforts to govern human-environmental problems. Non-point source (NPS) pollution from private rural lands is a particularly pressing human-environmental challenge that may be aggravated by changing land tenure. In this article, I report on a study of the governance and management of sediment (a common NPS pollutant) in the North Coastal basin of California, a region undergoing a transition from traditional extractive and agricultural land uses to rural residential and other alternative land uses. I focus on the differences in the governance and management across private timber, ranch, residential, vacation, and other lands in the region. I find that (1) the stringency and strength of sediment regulations differ by land use, (2) nonregulatory programs tend to target working landscapes, and (3) rural residential landowners have less knowledge of sediment control and report using fewer sediment-control techniques than landowners using their land for timber production or ranching. I conclude with an exploration of the consequences of these differences on an evolving rural landscape.

  9. Understanding critical factors for the quality and shelf-life of MAP fresh meat: a review.

    PubMed

    Singh, Preeti; Wani, Ali Abas; Saengerlaub, Sven; Langowski, Horst-Christian

    2011-02-01

    Due to increased demands for greater stringency in relation to hygiene and safety issues associated with fresh food products, coupled with ever-increasing demands by retailers for cost-effective extensions to product shelf-lives and the requirement to meet consumer expectations in relation to convenience and quality, the food packaging industry has rapidly developed to meet and satisfy expectations. One of the areas of research that has shown promise, and had success, is modified atmosphere packaging (MAP). The success of MAP-fresh meat depends on many factors including good initial product quality, good hygiene from the source plants, correct packaging material selection, the appropriate gas mix for the product, reliable packaging equipment, and maintenance of controlled temperatures and humidity levels. Advances in plastic materials and equipment have propelled advances in MAP, but other technological and logistical considerations are needed for successful MAP systems for raw chilled meat. Although several parameters critical for the quality of MA packed meat have been studied and each found to be crucial, understanding of the interactions between the parameters is needed. This review was undertaken to present the most comprehensive and current overview of the widely available, scattered information about the various integrated critical factors responsible for the quality and shelf life of MA packed meat with an interest to stimulate further research to optimize different quality parameters.

  10. Evaluating oversight systems for emerging technologies: a case study of genetically engineered organisms.

    PubMed

    Kuzma, Jennifer; Najmaie, Pouya; Larson, Joel

    2009-01-01

    The U.S. oversight system for genetically engineered organisms (GEOs) was evaluated to develop hypotheses and derive lessons for oversight of other emerging technologies, such as nanotechnology. Evaluation was based upon quantitative expert elicitation, semi-standardized interviews, and historical literature analysis. Through an interdisciplinary policy analysis approach, blending legal, ethical, risk analysis, and policy sciences viewpoints, criteria were used to identify strengths and weaknesses of GEOs oversight and explore correlations among its attributes and outcomes. From the three sources of data, hypotheses and broader conclusions for oversight were developed. Our analysis suggests several lessons for oversight of emerging technologies: the importance of reducing complexity and uncertainty in oversight for minimizing financial burdens on small product developers; consolidating multi-agency jurisdictions to avoid gaps and redundancies in safety reviews; consumer benefits for advancing acceptance of GEO products; rigorous and independent pre- and post-market assessment for environmental safety; early public input and transparency for ensuring public confidence; and the positive role of public input in system development, informed consent, capacity, compliance, incentives, and data requirements and stringency in promoting health and environmental safety outcomes, as well as the equitable distribution of health impacts. Our integrated approach is instructive for more comprehensive analyses of oversight systems, developing hypotheses for how features of oversight systems affect outcomes, and formulating policy options for oversight of future technological products, especially nanotechnology products.

  11. Therapeutic play to prepare children for invasive procedures: a systematic review.

    PubMed

    Silva, Rosalia Daniela Medeiros da; Austregésilo, Silvia Carréra; Ithamar, Lucas; Lima, Luciane Soares de

    To analyze the available evidence regarding the efficacy of using therapeutic play on behavior and anxiety in children undergoing invasive procedures. The systematic review search was performed in the MEDLINE, LILACS, CENTRAL and CINAHL databases. There was no limitation on the year or language. The literature search found 1892 articles and selected 22 for full reading. Eight articles were excluded, as they did not address the objectives assessed in this review. Twelve studies, representing 14 articles, were included. The studies were conducted between 1983 and 2015, five in Brazil, one in the United States, five in China, one in Lebanon, one in Taiwan, and one in Iran. Most studies showed that intervention with therapeutic play promotes reduction in the level of anxiety and promotes collaborative behavior and acceptance of the invasive procedure. Evidence related to the use of therapeutic play on anxiety and behavior of children undergoing invasive procedures is still questionable. The absence, in most studies, of the creation of a random sequence to assign the subjects to either the control or the experimental group, as well as allocation concealment, are factors that contribute to these questions. Another issue that characterizes an important source of bias is the absence of blinded evaluators. It is necessary to perform further studies that will take into account greater methodological stringency. Copyright © 2016 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  12. Examining the target levels of state renewable portfolio standards

    NASA Astrophysics Data System (ADS)

    Helwig, Laurence Douglas

    At present 37 U.S. states have passed Renewable Portfolio Standards (RPS) or have a legislative driven goal that supports investment in renewable energy (RE) technologies. Previous research has identified economic, governmental, ideological and infrastructural characteristics as key predictors of policy adoption and renewable energy deployment efforts (Carley, 2009; Davis & Davis, 2009; Bohn & Lant, 2009; Lyon & Yin, 2010). To date, only a few studies have investigated the target levels of renewable portfolio standards. Carley & Miller (2012) found that policies of differing stringencies were motivated by systematically different factors that included governmental ideology. The purpose of this dissertation is to replicate and expand upon earlier models that predicted RPS adoption and RE deployment efforts by adding regulatory, infrastructural and spatial characteristics to predict RPS target levels. Hypotheses were tested using three alternative measurements of RPS target level strength to determine to what extent a combination of explanatory variables explain variation in policy target levels. Multivariate linear regression and global spatial autocorrelation results indicated that multiple state internal determinants influenced RPS target level including average electricity price, state government ideology and to a lesser extent actual RE potential capacity. In addition, some diffusion effects were found to exist that indicated that states are setting their RPS target levels lower than their neighboring states and a local geo-spatial clustering effect was observed in the target levels for a grouping of northeastern states.

  13. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

  14. Identification of a Gal/GalNAc Lectin in the Protozoan Hartmannella vermiformis as a Potential Receptor for Attachment and Invasion by the Legionnaires' Disease Bacterium

    PubMed Central

    Venkataraman, Chandrasekar; Haack, Bradley J.; Bondada, Subbarao; Kwaik, Yousef Abu

    1997-01-01

    The Legionnaire's disease bacterium, Legionella pneumophila, is a facultative intracellular pathogen which invades and replicates within two evolutionarily distant hosts, free-living protozoa and mammalian cells. Invasion and intracellular replication within protozoa are thought to be major factors in the transmission of Legionnaire's disease. Although attachment and invasion of human macrophages by L. pneumophila is mediated in part by the complement receptors CR1 and CR3, the protozoan receptor involved in bacterial attachment and invasion has not been identified. To define the molecular events involved in invasion of protozoa by L. pneumophila, we examined the role of protein tyrosine phosphorylation of the protozoan host Hartmannella vermiformis upon attachment and invasion by L. pneumophila. Bacterial attachment and invasion were associated with a time-dependent tyrosine dephosphorylation of multiple host cell proteins. This host cell response was highly specific for live L. pneumophila, required contact with viable bacteria, and was completely reversible following washing off the bacteria from the host cell surface. Tyrosine dephosphorylation of host proteins was blocked by a tyrosine phosphatase inhibitor but not by tyrosine kinase inhibitors. One of the tyrosine dephosphorylated proteins was identified as the 170-kD galactose/N-acetylgalactosamine–inhibitable lectin (Gal/GalNAc) using immunoprecipitation and immunoblotting by antibodies generated against the Gal/GalNAc lectin of the protozoan Entamoeba histolytica. This Gal/GalNAc–inhibitable lectin has been shown previously to mediate adherence of E. histolytica to mammalian epithelial cells. Uptake of L. pneumophila by H. vermiformis was specifically inhibited by two monovalent sugars, Gal and GalNAc, and by mABs generated against the 170-kD lectin of E. histolytica. Interestingly, inhibition of invasion by Gal and GalNAc was associated with inhibition of bacterial-induced tyrosine dephosphorylation of H. vermiformis proteins. High stringency DNA hybridization confirmed the presence of the 170-kD lectin gene in H. vermiformis. We conclude that attachment of L. pneumophila to the H. vermiformis 170-kD lectin is required for invasion and is associated with tyrosine dephosphorylation of the Gal lectin and other host proteins. This is the first demonstration of a potential receptor used by L. pneumophila to invade protozoa. PMID:9254652

  15. Integrated assessment of global water scarcity over the 21st century under multiple climate change mitigation policies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hejazi, Mohamad I.; Edmonds, James A.; Clarke, Leon E.

    2014-08-01

    Water scarcity conditions over the 21st century both globally and regionally are assessed in the context of climate change and climate mitigation policies, by estimating both water availability and water demand within the Global Change Assessment Model (GCAM), a leading community integrated assessment model of energy, agriculture, climate, and water. To quantify changes in future water availability, a new gridded water-balance global hydrologic model – namely, the Global Water Availability Model (GWAM) – is developed and evaluated. Global water demands for six major demand sectors (irrigation, livestock, domestic, electricity generation, primary energy production, and manufacturing) are modeled in GCAM atmore » the regional scale (14 geopolitical regions, 151 sub-regions) and then spatially downscaled to 0.5 o x 0.5o resolution to match the scale of GWAM. Using a baseline scenario (i.e., no climate change mitigation policy) with radiative forcing reaching 8.8 W/m2 (equivalent to the SRES A1Fi emission scenario) and three climate policy scenarios with increasing mitigation stringency of 7.7, 5.5, and 4.2 W/m2 (equivalent to the SRES A2, B2, and B1 emission scenarios, respectively), we investigate the effects of emission mitigation policies on water scarcity. Two carbon tax regimes (a universal carbon tax (UCT) which includes land use change emissions, and a fossil fuel and industrial emissions carbon tax (FFICT) which excludes land use change emissions) are analyzed. The baseline scenario results in more than half of the world population living under extreme water scarcity by the end of the 21st century. Additionally, in years 2050 and 2095, 36% (28%) and 44% (39%) of the global population, respectively, is projected to live in grid cells (in basins) that will experience greater water demands than the amount of available water in a year (i.e., the water scarcity index (WSI) > 1.0). When comparing the climate policy scenarios to the baseline scenario while maintaining the same baseline socioeconomic assumptions, water scarcity declines under a UCT mitigation policy but increases with a FFICT mitigation scenario by the year 2095 particularly with more stringent climate mitigation targets. Under the FFICT scenario, water scarcity is projected to increase driven by higher water demands for bio-energy crops.« less

  16. Integrated assessment of global water scarcity over the 21st century under multiple climate change mitigation policies

    NASA Astrophysics Data System (ADS)

    Hejazi, M. I.; Edmonds, J.; Clarke, L.; Kyle, P.; Davies, E.; Chaturvedi, V.; Wise, M.; Patel, P.; Eom, J.; Calvin, K.

    2014-08-01

    Water scarcity conditions over the 21st century both globally and regionally are assessed in the context of climate change and climate mitigation policies, by estimating both water availability and water demand within the Global Change Assessment Model (GCAM), a leading community-integrated assessment model of energy, agriculture, climate, and water. To quantify changes in future water availability, a new gridded water-balance global hydrologic model - namely, the Global Water Availability Model (GWAM) - is developed and evaluated. Global water demands for six major demand sectors (irrigation, livestock, domestic, electricity generation, primary energy production, and manufacturing) are modeled in GCAM at the regional scale (14 geopolitical regions, 151 sub-regions) and then spatially downscaled to 0.5° × 0.5° resolution to match the scale of GWAM. Using a baseline scenario (i.e., no climate change mitigation policy) with radiative forcing reaching 8.8 W m-2 (equivalent to the SRES A1Fi emission scenario) and three climate policy scenarios with increasing mitigation stringency of 7.7, 5.5, and 4.2 W m-2 (equivalent to the SRES A2, B2, and B1 emission scenarios, respectively), we investigate the effects of emission mitigation policies on water scarcity. Two carbon tax regimes (a universal carbon tax (UCT) which includes land use change emissions, and a fossil fuel and industrial emissions carbon tax (FFICT) which excludes land use change emissions) are analyzed. The baseline scenario results in more than half of the world population living under extreme water scarcity by the end of the 21st century. Additionally, in years 2050 and 2095, 36% (28%) and 44% (39%) of the global population, respectively, is projected to live in grid cells (in basins) that will experience greater water demands than the amount of available water in a year (i.e., the water scarcity index (WSI) > 1.0). When comparing the climate policy scenarios to the baseline scenario while maintaining the same baseline socioeconomic assumptions, water scarcity declines under a UCT mitigation policy but increases with a FFICT mitigation scenario by the year 2095, particularly with more stringent climate mitigation targets. Under the FFICT scenario, water scarcity is projected to increase, driven by higher water demands for bio-energy crops.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dillon, Heather E.; Antonopoulos, Chrissi A.; Solana, Amy E.

    As the model energy codes are improved to reach efficiency levels 50 percent greater than current codes, use of on-site renewable energy generation is likely to become a code requirement. This requirement will be needed because traditional mechanisms for code improvement, including envelope, mechanical and lighting, have been pressed to the end of reasonable limits. Research has been conducted to determine the mechanism for implementing this requirement (Kaufman 2011). Kaufmann et al. determined that the most appropriate way to structure an on-site renewable requirement for commercial buildings is to define the requirement in terms of an installed power density permore » unit of roof area. This provides a mechanism that is suitable for the installation of photovoltaic (PV) systems on future buildings to offset electricity and reduce the total building energy load. Kaufmann et al. suggested that an appropriate maximum for the requirement in the commercial sector would be 4 W/ft{sup 2} of roof area or 0.5 W/ft{sup 2} of conditioned floor area. As with all code requirements, there must be an alternative compliance path for buildings that may not reasonably meet the renewables requirement. This might include conditions like shading (which makes rooftop PV arrays less effective), unusual architecture, undesirable roof pitch, unsuitable building orientation, or other issues. In the short term, alternative compliance paths including high performance mechanical equipment, dramatic envelope changes, or controls changes may be feasible. These options may be less expensive than many renewable systems, which will require careful balance of energy measures when setting the code requirement levels. As the stringency of the code continues to increase however, efficiency trade-offs will be maximized, requiring alternative compliance options to be focused solely on renewable electricity trade-offs or equivalent programs. One alternate compliance path includes purchase of Renewable Energy Credits (RECs). Each REC represents a specified amount of renewable electricity production and provides an offset of environmental externalities associated with non-renewable electricity production. The purpose of this paper is to explore the possible issues with RECs and comparable alternative compliance options. Existing codes have been examined to determine energy equivalence between the energy generation requirement and the RECs alternative over the life of the building. The price equivalence of the requirement and the alternative are determined to consider the economic drivers for a market decision. This research includes case studies that review how the few existing codes have incorporated RECs and some of the issues inherent with REC markets. Section 1 of the report reviews compliance options including RECs, green energy purchase programs, shared solar agreements and leases, and other options. Section 2 provides detailed case studies on codes that include RECs and community based alternative compliance methods. The methods the existing code requirements structure alternative compliance options like RECs are the focus of the case studies. Section 3 explores the possible structure of the renewable energy generation requirement in the context of energy and price equivalence. The price of RECs have shown high variation by market and over time which makes it critical to for code language to be updated frequently for a renewable energy generation requirement or the requirement will not remain price-equivalent over time. Section 4 of the report provides a maximum case estimate for impact to the PV market and the REC market based on the Kaufmann et al. proposed requirement levels. If all new buildings in the commercial sector complied with the requirement to install rooftop PV arrays, nearly 4,700 MW of solar would be installed in 2012, a major increase from EIA estimates of 640 MW of solar generation capacity installed in 2009. The residential sector could contribute roughly an additional 2,300 MW based on the same code requirement levels of 4 W/ft{sup 2} of roof area. Section 5 of the report provides a basic framework for draft code language recommendations based on the analysis of the alternative compliance levels.« less

  18. Assessing the environmental impacts of aircraft noise and emissions

    NASA Astrophysics Data System (ADS)

    Mahashabde, Anuja; Wolfe, Philip; Ashok, Akshay; Dorbian, Christopher; He, Qinxian; Fan, Alice; Lukachko, Stephen; Mozdzanowska, Aleksandra; Wollersheim, Christoph; Barrett, Steven R. H.; Locke, Maryalice; Waitz, Ian A.

    2011-01-01

    With the projected growth in demand for commercial aviation, many anticipate increased environmental impacts associated with noise, air quality, and climate change. Therefore, decision-makers and stakeholders are seeking policies, technologies, and operational procedures that balance environmental and economic interests. The main objective of this paper is to address shortcomings in current decision-making practices for aviation environmental policies. We review knowledge of the noise, air quality, and climate impacts of aviation, and demonstrate how including environmental impact assessment and quantifying uncertainties can enable a more comprehensive evaluation of aviation environmental policies. A comparison is presented between the cost-effectiveness analysis currently used for aviation environmental policy decision-making and an illustrative cost-benefit analysis. We focus on assessing a subset of the engine NO X emissions certification stringency options considered at the eighth meeting of the International Civil Aviation Organization’s Committee on Aviation Environmental Protection. The FAA Aviation environmental Portfolio Management Tool (APMT) is employed to conduct the policy assessments. We show that different conclusions may be drawn about the same policy options depending on whether benefits and interdependencies are estimated in terms of health and welfare impacts versus changes in NO X emissions inventories as is the typical practice. We also show that these conclusions are sensitive to a variety of modeling uncertainties. While our more comprehensive analysis makes the best policy option less clear, it represents a more accurate characterization of the scientific and economic uncertainties underlying impacts and the policy choices.

  19. Impact of California firearms sales laws and dealer regulations on the illegal diversion of guns.

    PubMed

    Pierce, Glenn L; Braga, Anthony A; Wintemute, Garen J

    2015-06-01

    The available evidence suggests that more restrictive state firearm sales laws can reduce criminal access to guns. California has firearm-related laws that are more stringent than many other states and regulates its retail firearms dealers to a unique degree. This research seeks to examine the effect of more restrictive state gun laws and regulations on the illegal diversion of guns to criminals. Survival analyses are used to determine whether state firearm sales laws, particularly California's legal context and regulatory regime, impact the distribution of time-to-crime of recovered firearms in that state relative to other US states. USA. 225,392 traced firearms, where the first retail purchasers and the gun possessors were different individuals, recovered by law enforcement agencies between 2003 and 2006. The increased stringency of state-level firearms laws and regulations leads to consistently older firearms being recovered. California was associated with the oldest recovered crime guns compared with guns associated with other states. These patterns persisted regardless of whether firearms were first purchased within the recovery state or in another state. These findings suggest that more restrictive gun sales laws and gun dealer regulations do make it more difficult for criminals to acquire new guns first purchased at retail outlets. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. [Invasive fungal infections in children with cancer, neutropenia and fever, in Chile].

    PubMed

    Lucero, Yalda; Brücher, Roberto; Alvarez, Ana María; Becker, Ana; Cofré, José; Enríquez, Nancy; Payá, Ernesto; Salgado, Carmen; Santolaya, María Elena; Tordecilla, Juan; Varas, Mónica; Villarroel, Milena; Viviani, Tamara; Zubieta, Marcela; O'Ryan, Miguel

    2002-10-01

    Invasive fungal infections (IFI) cause prolonged hospitalizations and increase the possibility of death among patients with cancer and febrile neutropenia (FN). Up to 10% of febrile neutropenic episodes may be caused by IFI. To estimate the incidence of IFI among a large group of Chilean children with cancer and FN. Clinical and laboratory information was collected from a data base provided by the "Programa Infantil Nacional de Drogas Antineoplásicas" (PINDA) that included 445 FN episodes occurring in five hospitals in Santiago, Chile. This information was used to identify children that presented with signs and symptoms compatible with an IFI. According to predefined criteria based on a literature review, IFI episodes were categorized as "proven", "probable" or "possible". A total of 41/445 episodes (9.2%) were compatible with an IFI of which 4 (0.9%) were proven, 23 (5.2%) probable, and 14 (3.1%) possible. Hospitalization was longer (27 vs 8 days, p < .01), new infectious foci appeared with higher frequency (71 vs 38%, p < .01), and mortality was higher (10 vs 1.6%, p < .001) in children with IFI compatible episodes, when compared to children who did not have an IFI. The estimated incidence of IFI in Chilean children with cancer and FN ranged between 6-9% depending on the stringency of criteria selection used for classification. This estimate is similar to that reported by other studies. The low detection yield of clinically compatible IFI underscores the need of improved diagnosis of fungal infections in this population.

  1. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  2. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  3. Implementing US-style anti-fraud laws in the Australian pharmaceutical and health care industries.

    PubMed

    Faunce, Thomas A; Urbas, Gregor; Skillen, Lesley

    2011-05-02

    This article critically analyses the prospects for introducing United States anti-fraud (or anti-false claims) laws in the Australian health care setting. Australian governments spend billions of dollars each year on medicines and health care. A recent report estimates that the money lost to corporate fraud in Australia is growing at an annual rate of 7%, but that only a third of the losses are currently being detected. In the US, qui tam provisions - the component of anti-fraud or anti-false claims laws involving payments to whistleblowers - have been particularly successful in providing critical evidence allowing public prosecutors to recover damages for fraud and false claims made by corporations in relation to federal and state health care programs. The US continues to strengthen such anti-fraud measures and to successfully apply them to a widening range of areas involving large public investment. Australia still suffers from the absence of any comprehensive scheme that not only allows treble damages recovery for fraud on the public purse, but crucially supports such actions by providing financial encouragement for whistleblowing corporate insiders to expose evidence of fraud. Potential areas of application could include direct and indirect government expenditure on health care service provision, pharmaceuticals, medical devices, defence, carbon emissions compensation and tobacco-related illness. The creation in Australia of an equivalent to US anti-false claims legislation should be a policy priority, particularly in a period of financial stringency.

  4. The EU pledge for responsible marketing of food and beverages to children: implementation in food companies.

    PubMed

    Jensen, J D; Ronit, K

    2015-08-01

    Increasing political pressure on the food industry's marketing activities stimulated the formation of the collective EU Pledge for responsible marketing of foods and beverages to children. The objective of the study is to evaluate the commitments made by companies in joining the pledge for the purpose of assessing its effectiveness in regulating signatory companies' marketing activities. Data on company commitments in relation to the EU Pledge were collected, analyzed and recalculated in order to enable comparison across companies and with general nutritional recommendations. Data on companies' product portfolio and market orientation were collected from their most recent available annual reports. Data on the companies' product profiles were generated via review of the companies' main websites. Similar data were generated for a reference group of companies outside the EU Pledge. Compared with a reference group of large food and beverage companies, EU Pledge signatory companies have a public image strongly based on products with appeal to children. The EU Pledge sets common standards for regulating signatory companies' marketing behaviour towards children. Further scrutiny of the companies' stated commitments revealed considerable variation in their actual content and in their de facto bindingness on the companies' marketing behavior--for example, in the definition of target audience for advertising or in nutritional characteristics making products eligible for advertising to children. In order for voluntary self-regulation schemes such as the EU Pledge to be a credible alternative to public regulation of marketing behaviour, more transparency and stringency are needed.

  5. Workplace status and risk of hypertension among hourly and salaried aluminum manufacturing employees

    PubMed Central

    Clougherty, Jane Ellen; Eisen, Ellen A; Slade, Martin D; Kawachi, Ichiro; Cullen, Mark R

    2009-01-01

    An inverse relationship between workplace status and morbidity is well established; higher job status has been associated with reduced risks of heart disease, hypertension, and injury. Most research on job status, however, has focused on salaried populations, and it remains unclear whether job status operates similarly among hourly workers. Our objectives were to examine whether hourly status itself influences risk of hypertension after adjustment for socioeconomic confounders, and to explore the role of fine-scale job grade on hypertension incidence within hourly and salaried groups. We examined data for 14,999 aluminum manufacturing employees in 11 plants across the U.S., using logistic regression with adjustment for age, sex, race/ ethnicity and other individual characteristics. Propensity score restriction was used to identify comparable groups of hourly and salaried employees, reducing confounding by socio-demographic characteristics. Job grade (coded 1 through 30, within hourly and salaried groups) was examined as a more refined measure of job status. Hourly status was associated with an increased risk of hypertension, after propensity restriction and adjustment for confounders. The observed effect of hourly status was stronger among women, although the propensity-restricted cohort was disproportionately male (96 %). Among salaried workers, higher job grade was not consistently associated with decreased risk; among hourly employees, however, there was a significant trend, with higher job grades more protective against hypertension. Increasing the stringency of hypertension case criteria also increased the risk of severe or persistent hypertension for hourly employees. PMID:19027215

  6. Workplace status and risk of hypertension among hourly and salaried aluminum manufacturing employees.

    PubMed

    Clougherty, Jane Ellen; Eisen, Ellen A; Slade, Martin D; Kawachi, Ichiro; Cullen, Mark R

    2009-01-01

    An inverse relationship between workplace status and morbidity is well established; higher job status has been associated with reduced risks of heart disease, hypertension, and injury. Most research on job status, however, has focused on salaried populations, and it remains unclear whether job status operates similarly among hourly workers. Our objectives were to examine whether hourly status itself influences risk of hypertension after adjustment for socioeconomic confounders, and to explore the role of fine-scale job grade on hypertension incidence within hourly and salaried groups. We examined data for 14,999 aluminum manufacturing employees in 11 plants across the U.S., using logistic regression with adjustment for age, sex, race/ethnicity and other individual characteristics. Propensity score restriction was used to identify comparable groups of hourly and salaried employees, reducing confounding by sociodemographic characteristics. Job grade (coded 1 through 30, within hourly and salaried groups) was examined as a more refined measure of job status. Hourly status was associated with an increased risk of hypertension, after propensity restriction and adjustment for confounders. The observed effect of hourly status was stronger among women, although the propensity-restricted cohort was disproportionately male (96%). Among salaried workers, higher job grade was not consistently associated with decreased risk; among hourly employees, however, there was a significant trend, with higher job grades more protective against hypertension. Increasing the stringency of hypertension case criteria also increased the risk of severe or persistent hypertension for hourly employees.

  7. Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

    PubMed

    Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

    2006-12-20

    We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

  8. Observing System Simulations for the NASA ASCENDS Lidar CO2 Mission Concept: Substantiating Science Measurement Requirements

    NASA Technical Reports Server (NTRS)

    Kawa, Stephan R.; Baker, David Frank; Schuh, Andrew E.; Abshire, James Brice; Browell, Edward V.; Michalak, Anna M.

    2012-01-01

    The NASA ASCENDS mission (Active Sensing of Carbon Emissions, Nights, Days, and Seasons) is envisioned as the next generation of dedicated, space-based CO2 observing systems, currently planned for launch in about the year 2022. Recommended by the US National Academy of Sciences Decadal Survey, active (lidar) sensing of CO2 from space has several potentially significant advantages, in comparison to current and planned passive CO2 instruments, that promise to advance CO2 measurement capability and carbon cycle understanding into the next decade. Assessment and testing of possible lidar instrument technologies indicates that such sensors are more than feasible, however, the measurement precision and accuracy requirements remain at unprecedented levels of stringency. It is, therefore, important to quantitatively and consistently evaluate the measurement capabilities and requirements for the prospective active system in the context of advancing our knowledge of carbon flux distributions and their dependence on underlying physical processes. This amounts to establishing minimum requirements for precision, relative accuracy, spatial/temporal coverage and resolution, vertical information content, interferences, and possibly the tradeoffs among these parameters, while at the same time framing a mission that can be implemented within a constrained budget. Here, we present results of observing system simulation studies, commissioned by the ASCENDS Science Requirements Definition Team, for a range of possible mission implementation options that are intended to substantiate science measurement requirements for a laser-based CO2 space instrument.

  9. A Quantitative Climate-Match Score for Risk-Assessment Screening of Reptile and Amphibian Introductions

    NASA Astrophysics Data System (ADS)

    van Wilgen, Nicola J.; Roura-Pascual, Núria; Richardson, David M.

    2009-09-01

    Assessing climatic suitability provides a good preliminary estimate of the invasive potential of a species to inform risk assessment. We examined two approaches for bioclimatic modeling for 67 reptile and amphibian species introduced to California and Florida. First, we modeled the worldwide distribution of the biomes found in the introduced range to highlight similar areas worldwide from which invaders might arise. Second, we modeled potentially suitable environments for species based on climatic factors in their native ranges, using three sources of distribution data. Performance of the three datasets and both approaches were compared for each species. Climate match was positively correlated with species establishment success (maximum predicted suitability in the introduced range was more strongly correlated with establishment success than mean suitability). Data assembled from the Global Amphibian Assessment through NatureServe provided the most accurate models for amphibians, while ecoregion data compiled by the World Wide Fund for Nature yielded models which described reptile climatic suitability better than available point-locality data. We present three methods of assigning a climate-match score for use in risk assessment using both the mean and maximum climatic suitabilities. Managers may choose to use different methods depending on the stringency of the assessment and the available data, facilitating higher resolution and accuracy for herpetofaunal risk assessment. Climate-matching has inherent limitations and other factors pertaining to ecological interactions and life-history traits must also be considered for thorough risk assessment.

  10. KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    PubMed Central

    Alvarenga, Janaína Sousa Campos; Ligeiro, Carla Maia; Gontijo, Célia Maria Ferreira; Cortes, Sofia; Campino, Lenea; Vago, Annamaria Ravara; Melo, Maria Norma

    2012-01-01

    Background Visceral Leishmaniasis (VL) caused by species from the Leishmania donovani complex is the most severe form of the disease, lethal if untreated. VL caused by Leishmania infantum is a zoonosis with an increasing number of human cases and millions of dogs infected in the Old and the New World. In this study, L. infantum (syn. L.chagasi) strains were isolated from human and canine VL cases. The strains were obtained from endemic areas from Brazil and Portugal and their genetic polymorphism was ascertained using the LSSP-PCR (Low-Stringency Single Specific Primer PCR) technique for analyzing the kinetoplastid DNA (kDNA) minicircles hypervariable region. Principal Findings KDNA genetic signatures obtained by minicircle LSSP-PCR analysis of forty L. infantum strains allowed the grouping of strains in several clades. Furthermore, LSSP-PCR profiles of L. infantum subpopulations were closely related to the host origin (human or canine). To our knowledge this is the first study which used this technique to compare genetic polymorphisms among strains of L. infantum originated from both the Old and the New World. Conclusions LSSP-PCR profiles obtained by analysis of L. infantum kDNA hypervariable region of parasites isolated from human cases and infected dogs from Brazil and Portugal exhibited a genetic correlation among isolates originated from the same reservoir, human or canine. However, no association has been detected among the kDNA signatures and the geographical origin of L. infantum strains. PMID:22912862

  11. Correlation of Periodontal Disease With Inflammatory Arthritis in the Time Before Modern Medical Intervention.

    PubMed

    Rothschild, Bruce

    2017-03-01

    Controversy exists regarding possible correlation of periodontal disease with rheumatoid arthritis (RA) and ankylosing spondylitis (AS). Confounding factors may relate to stringency of inflammatory disease diagnosis and the effect of therapeutic intervention for RA on periodontal disease. These factors are investigated in this study. Forty-five individuals with documented RA (n = 15), spondyloarthropathy (n = 15), and calcium pyrophosphate deposition disease (CPPD) (n = 15), from the Hamann-Todd collection of human skeletons compiled from 1912 to 1938, and 15 individuals contemporarily incorporated in the collection were examined for tooth loss, cavity occurrence, average and maximum lingual and buccal depth of space between tooth and bone, periosteal reaction, serpentine bone resorption, abscess formation, and root penetration of the bone surface and analyzed by analysis of variance. Tooth loss was common, but actual number of teeth lost, cavity occurrence, average and maximum lingual and buccal depth of space between tooth and bone, periosteal reaction, serpentine grooving surrounding teeth (considered a sign of inflammation), abscess formation, and root exposure (penetration of bone surface) were indistinguishable among controls and individuals with RA, spondyloarthropathy, and CPPD. Although many factors can affect periodontal disease, presence of inflammatory arthritis does not appear to be one of them. The implication is that dental disease was common in the general population and not necessarily associated with arthritis, at least before the advent of modern rheumatologic medications. As specific diagnosis did not affect prevalence, perhaps current prevalence controversy may relate to current intervention, a subject for further study.

  12. Economic impacts of bio-refinery and resource cascading systems: an applied general equilibrium analysis for Poland.

    PubMed

    Ignaciuk, Adriana M; Sanders, Johan

    2007-12-01

    Due to more stringent energy and climate policies, it is expected that many traditional chemicals will be replaced by their biomass-based substitutes, bio-chemicals. These innovations, however, can influence land allocation since the demand for land dedicated to specific crops might increase. Moreover, it can have an influence on traditional agricultural production. In this paper, we use an applied general equilibrium framework, in which we include two different bio-refinery processes and incorporate so-called cascading mechanisms. The bio-refinery processes use grass, as one of the major inputs, to produce bio-nylon and propane-diol (1,3PDO) to substitute currently produced fossil fuel-based nylon and ethane-diol. We examine the impact of specific climate policies on the bioelectricity share in total electricity production, land allocation, and production quantities and prices of selected commodities. The novel technologies become competitive, with an increased stringency of climate policies. This switch, however, does not induce a higher share of bioelectricity. The cascade does stimulate the production of bioelectricity, but it induces more of a shift in inputs in the bioelectricity sector (from biomass to the cascaded bio-nylon and 1, 3PDO) than an increase in production level of bioelectricity. We conclude that dedicated biomass crops will remain the main option for bioelectricity production: the contribution of the biomass systems remains limited. Moreover, the bioelectricity sector looses a competition for land for biomass production with bio-refineries.

  13. Analysis of β-Subgroup Proteobacterial Ammonia Oxidizer Populations in Soil by Denaturing Gradient Gel Electrophoresis Analysis and Hierarchical Phylogenetic Probing

    PubMed Central

    Stephen, John R.; Kowalchuk, George A.; Bruns, Mary-Ann V.; McCaig, Allison E.; Phillips, Carol J.; Embley, T. Martin; Prosser, James I.

    1998-01-01

    A combination of denaturing gradient gel electrophoresis (DGGE) and oligonucleotide probing was used to investigate the influence of soil pH on the compositions of natural populations of autotrophic β-subgroup proteobacterial ammonia oxidizers. PCR primers specific to this group were used to amplify 16S ribosomal DNA (rDNA) from soils maintained for 36 years at a range of pH values, and PCR products were analyzed by DGGE. Genus- and cluster-specific probes were designed to bind to sequences within the region amplified by these primers. A sequence specific to all β-subgroup ammonia oxidizers could not be identified, but probes specific for Nitrosospira clusters 1 to 4 and Nitrosomonas clusters 6 and 7 (J. R. Stephen, A. E. McCaig, Z. Smith, J. I. Prosser, and T. M. Embley, Appl. Environ. Microbiol. 62:4147–4154, 1996) were designed. Elution profiles of probes against target sequences and closely related nontarget sequences indicated a requirement for high-stringency hybridization conditions to distinguish between different clusters. DGGE banding patterns suggested the presence of Nitrosomonas cluster 6a and Nitrosospira clusters 2, 3, and 4 in all soil plots, but results were ambiguous because of overlapping banding patterns. Unambiguous band identification of the same clusters was achieved by combined DGGE and probing of blots with the cluster-specific radiolabelled probes. The relative intensities of hybridization signals provided information on the apparent selection of different Nitrosospira genotypes in samples of soil of different pHs. The signal from the Nitrosospira cluster 3 probe decreased significantly, relative to an internal control probe, with decreasing soil pH in the range of 6.6 to 3.9, while Nitrosospira cluster 2 hybridization signals increased with increasing soil acidity. Signals from Nitrosospira cluster 4 were greatest at pH 5.5, decreasing at lower and higher values, while Nitrosomonas cluster 6a signals did not vary significantly with pH. These findings are in agreement with a previous molecular study (J. R. Stephen, A. E. McCaig, Z. Smith, J. I. Prosser, and T. M. Embley, Appl. Environ. Microbiol 62:4147–4154, 1996) of the same sites, which demonstrated the presence of the same four clusters of ammonia oxidizers and indicated that selection might be occurring for clusters 2 and 3 at acid and neutral pHs, respectively. The two studies used different sets of PCR primers for amplification of 16S rDNA sequences from soil, and the similar findings suggest that PCR bias was unlikely to be a significant factor. The present study demonstrates the value of DGGE and probing for rapid analysis of natural soil communities of β-subgroup proteobacterial ammonia oxidizers, indicates significant pH-associated differences in Nitrosospira populations, and suggests that Nitrosospira cluster 2 may be of significance for ammonia-oxidizing activity in acid soils. PMID:9687457

  14. Spanning the genomics era: the vital role of a single institution biorepository for childhood cancer research over a decade

    PubMed Central

    Zhou, Li

    2015-01-01

    The ‘genomics era’ is considered to have begun with the commencement of the Human Genome Project. As translational genomic studies can only be established when human tissue samples are available for analysis, biospecimens are now proven to be an essential element for their success. During the genomics era the necessity for more extensive biobanking infrastructure has been highlighted. With the increased number of genomic studies into cancer, it is considered that the availability of biospecimens will become the rate limiting step. Despite the efforts in international biobanking, translational genomics is hampered when there low numbers of biospecimens for a particular rare diseases and is most apparent for paediatric cancer. As there is a call for biobanking practice to be responsive to the current experimental needs of the time and for more expansive systems of tissue procurement to be established we have asked the question what role does a single institution biorepository play in the current highly networked world of translational genomics. Here we describe such a case. The Tumour Bank at The Children’s Hospital at Westmead (TB-CHW) in the western suburbs of Sydney was formally established in 1998 as a key resource for translational paediatric cancer research. During the genomics era, we show that the TB-CHW has developed into a key biospecimen repository for the cancer research community, during which time it has increasingly found itself having a vital role in the establishment of translational genomics for paediatric cancer. Here we detail metrics that demonstrate how as a single institution biorepository, the TB-CHW has been a strong participant in the advancement of translational genomics throughout the genomics era. This paper describes the significant contribution of a single institutional hospital embedded tumour biobank to the genomic research community. Despite the increased stringencies placed on biobanking practice, the TB-CHW has shown that a single institution biorespository can have a consistent and effective contribution to translational research into rare paediatric malignancy demonstrating its long term benefit throughout the genomics era. PMID:26835365

  15. The harmonization of the regulation of blood products: a European perspective.

    PubMed

    Seitz, R; Heiden, M; Nübling, C M; Unger, G; Löwer, J

    2008-05-01

    The development of blood products as medicines initially took place on the national level in various countries, which resulted in considerable diversity of mechanisms and stringency of regulatory oversight. The scenario changed dramatically with the catastrophic experience that severe virus infections had been transmitted by blood products world-wide. Blood products, which had been regulated differently in the member states, became subject to the European pharmaceutical legislation in 1989. A specialized directive regulating the blood transfusion sector and the collection of plasma for fractionation was enacted in 2002. The European Community, particularly the Commission and the European Medicines Agency, is continuously refining the requirements, providing detailed technical and scientific guidance. In addition, institutions of the Council of Europe play an important role in the transfusion sector, the elaboration of the European Pharmacopoeia prescriptions, and the co-ordination of Official Medicines Control Laboratory or Laboratories batch release. However, further and sustained efforts towards international harmonization are needed. There are already important mechanisms in place, such as the International Conference on Harmonization initiative, which is producing internationally recognized guidelines on central issues. Another important achievement is the common technical document format, which enables the use of uniform applications for marketing authorization. However, there is still room for progress, for example, questions regarding regulatory requirements for licensing of in vitro diagnostic devices, or mutual recognition of inspections. The World Health Organization continues to play an important role in harmonization, both substantially by the production of high-level guidance documents or the establishment of physical international standard preparations, and in a more general sense by providing a platform for international collaboration. A very important aspect is the transparency of the creation and refinement of regulatory requirements. It is currently the rule that draft legal texts, monographs and guidelines are published for a consultation period before adoption. Effort and attention are required to keep track of the developments. However, in the era of modern electronic communication tools, the necessary information can be found on websites and comments can easily be submitted. Networking and exchange of information will continue to be crucial for development and maintenance of sound and balanced regulatory requirements.

  16. Protected area effectiveness against land development in Spain.

    PubMed

    Rodríguez-Rodríguez, David; Martínez-Vega, Javier

    2018-06-01

    Land use-land cover (LULC) changes towards artificial covers are one of the main global threats to biodiversity conservation. In this comprehensive study, we tested a number of methodological and research hypotheses, and a new covariate control technique in order to address common protected area (PA) assessment issues and accurately assess whether different PA networks have had an effect at preventing development of artificial LULCs in Spain, a highly biodiverse country that has experienced massive socioeconomic transformations in the past two decades. We used digital census data for four PA networks designated between 1990 and 2000: Nature Reserves (NRs), Nature Parks (NPs), Sites of Community Importance (SCIs) and Special Protection Areas (SPAs). We analysed the effect of explanatory variables on the ecological effectiveness of protected polygons (PPs): Legislation stringency, cummulative legal designations, management, size, age and bio-physical characteristics. A multiple Before-After-Control-Impact (BACI) semi-experimental research design was used whereby artificial land cover increase (ALCI) and proportional artificial land cover increase (PALCI) results were compared inside and outside PAs, using 1 km and 5 km buffer areas surrounding PAs as controls. LULC data were retrieved from Corine Land Cover (CLC) 1990 and 2006 data. Results from three spatial-statistical models using progressively restrictive criteria to select control areas increasingly more accurate and similar to the assessed PPs were compared. PAs were a generally effective territorial policy to prevent land development in Spain. NRs were the most effective PA category, with no new artificial land covers in the assessed period, although exact causality could not be attributed due to legal overlaps. SPAs were the least effective category, with worse ALCI data than their control areas. Legal protection was effective against land development, which was influenced by most bio-physical variables. However, cumulative legal designations and PA management did not seem to influence land development. The spatial-statistical technique used to make cases and control environmentally similar did not produce consistent outcomes and should be refined. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Stringency of substrate specificity of Escherichia coli malate dehydrogenase.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boernke, W. E.; Millard, C. S.; Stevens, P. W.

    1995-09-10

    Malate dehydrogenase and lactate dehydrogenase are members of the structurally and functionally homologous family of 2-ketoacid dehydrogenases. Both enzymes display high specificity for their respective keto substrates, oxaloacetate and pyruvate. Closer analysis of their specificity, however, reveals that the specificity of malate dehydrogenase is much stricter and less malleable than that of lactate dehydrogenase. Site-specific mutagenesis of the two enzymes in an attempt to reverse their specificity has met with contrary results. Conversion of a specific active-site glutamine to arginine in lactate dehydrogenase from Bacillus stearothermophilus generated an enzyme that displayed activity toward oxaloacetate equal to that of the nativemore » enzyme toward pyruvate (H. M. Wilks et al. (1988) Science 242, 1541-1544). We have constructed a series of mutants in the mobile, active site loop of the Escherichia coli malate dehydrogenase that incorporate the complementary change, conversion of arginine 81 to glutamine, to evaluate the role of charge distribution and conformational flexibility within this loop in defining the substrate specificity of these enzymes. Mutants incorporating the change R81Q all had reversed specificity, displaying much higher activity toward pyruvate than to the natural substrate, oxaloacetate. In contrast to the mutated lactate dehydrogenase, these reversed-specificity mutants were much less active than the native enzyme. Secondary mutations within the loop of the E. coli enzyme (A80N, A80P, A80P/M85E/D86T) had either no or only moderately beneficial effects on the activity of the mutant enzyme toward pyruvate. The mutation A80P, which can be expected to reduce the overall flexibility of the loop, modestly improved activity toward pyruvate. The possible physiological relevance of the stringent specificity of malate dehydrogenase was investigated. In normal strains of E. coli, fermentative metabolism was not affected by expression of the mutant malate dehydrogenase. However, when expressed in a strain of E. coli unable to ferment glucose, the mutant enzyme restored growth and produced lactic acid as the sole fermentation product.« less

  18. The impact of market and organizational characteristics on nursing care facility service innovation: a resource dependency perspective.

    PubMed

    Banaszak-Holl, J; Zinn, J S; Mor, V

    1996-04-01

    Using resource dependency theory as a conceptual framework, this study investigates both the organizational and environmental factors associated with an emerging health care service delivery innovation, the provision of specialty care in designated units in nursing care facilities. We consider two types of specialty units, Alzheimer's Disease and subacute care. The Medicare/Medicaid Automated Certification Survey (MMACS) data file was merged with local market area data obtained from the 1992 Area Resource File and with state level regulatory data. The likelihood of providing Alzheimer's Disease or subacute care in dedicated units was estimated by separate logistic regressions. Results indicate that facilities with fewer Medicare patients are more likely to operate a dedicated Alzheimer's care unit, while facilities located in markets with a large HMO population and greater hospital supply are more likely to operate a subacute care unit. While competition among nursing homes, for the most part, is an incentive to innovate, greater regulatory stringency appears to constrain the development of specialty care units of both types. Finally, organizational characteristics (e.g., size and proprietary status) appear to be important enabling factors influencing the propensity to provide specialty care in dedicated units. Nursing care facilities are moving toward providing specialty care units partly as a response to a growing demand by resource providers and to maintain a competitive edge in tighter markets. Loosening regulation directed at cost containment would further encourage the development of specialty care but should be preceded by some evaluation of population needs for specialty care and the effectiveness of specialty care units.

  19. Transcriptome dynamics in the asexual cycle of the chordate Botryllus schlosseri.

    PubMed

    Campagna, Davide; Gasparini, Fabio; Franchi, Nicola; Vitulo, Nicola; Ballin, Francesca; Manni, Lucia; Valle, Giorgio; Ballarin, Loriano

    2016-04-02

    We performed an analysis of the transcriptome during the blastogenesis of the chordate Botryllus schlosseri, focusing in particular on genes involved in cell death by apoptosis. The tunicate B. schlosseri is an ascidian forming colonies characterized by the coexistence of three blastogenetic generations: filter-feeding adults, buds on adults, and budlets on buds. Cyclically, adult tissues undergo apoptosis and are progressively resorbed and replaced by their buds originated by asexual reproduction. This is a feature of colonial tunicates, the only known chordates that can reproduce asexually. Thanks to a newly developed web-based platform ( http://botryllus.cribi.unipd.it ), we compared the transcriptomes of the mid-cycle, the pre-take-over, and the take-over phases of the colonial blastogenetic cycle. The platform is equipped with programs for comparative analysis and allows to select the statistical stringency. We enriched the genome annotation with 11,337 new genes; 581 transcripts were resolved as complete open reading frames, translated in silico into amino acid sequences and then aligned onto the non-redundant sequence database. Significant differentially expressed genes were classified within the gene ontology categories. Among them, we recognized genes involved in apoptosis activation, de-activation, and regulation. With the current work, we contributed to the improvement of the first released B. schlosseri genome assembly and offer an overview of the transcriptome changes during the blastogenetic cycle, showing up- and down-regulated genes. These results are important for the comprehension of the events underlying colony growth and regression, cell proliferation, colony homeostasis, and competition among different generations.

  20. Clinical outcomes of elite controllers, viremic controllers, and long-term nonprogressors in the US Department of Defense HIV natural history study.

    PubMed

    Okulicz, Jason F; Marconi, Vincent C; Landrum, Michael L; Wegner, Scott; Weintrob, Amy; Ganesan, Anuradha; Hale, Braden; Crum-Cianflone, Nancy; Delmar, Judith; Barthel, Vincent; Quinnan, Gerald; Agan, Brian K; Dolan, Matthew J

    2009-12-01

    Durable control of human immunodeficiency virus (HIV) replication and lack of disease progression in the absence of antiretroviral therapy were studied in a military cohort of 4586 subjects. We examined groups of elite controllers (ie, subjects with plasma HIV RNA levels of <50 copies/mL; prevalence, 0.55% [95% confidence interval {CI}, 0.35%-0.80%]), viremic controllers (ie, subjects with plasma HIV RNA levels of 50-2000 copies/mL; prevalence, 3.34% [95% CI, 2.83%-3.91%]), and subjects with a lack of disease progression (ie, long-term nonprogressors [LTNPs]) through 7 years of follow-up (LTNP7s; prevalence, 3.32% [95% CI, 2.70%-4.01%]) or 10 years of follow-up (LTNP10s; prevalence, 2.04% [95% CI, 1.52%-2.68%]). For elite and viremic controllers, spontaneous virologic control was established early and was typically observed when the initial viral load measurement was obtained within 1 year of estimated seroconversion. Elite controllers had favorable time to development of AIDS (P=.048), a CD4 cell count of 350 cells/microL (P= .009), and more-stable CD4 cell trends, compared with viremic controllers. LTNPs defined by 10-year versus 7-year criteria had a longer survival time (P=.001), even after adjustment for differing periods of invulnerability (P= .042). Definitions of controllers and LTNPs describe distinct populations whose differing clinical outcomes improve with the stringency of criteria, underscoring the need for comparability between study populations.

  1. Developing Performance Cost Index Targets for ASHRAE Standard 90.1 Appendix G – Performance Rating Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosenberg, Michael I.; Hart, Philip R.

    2016-02-16

    Appendix G, the Performance Rating Method in ASHRAE Standard 90.1 has been updated to make two significant changes for the 2016 edition, to be published in October of 2016. First, it allows Appendix G to be used as a third path for compliance with the standard in addition to rating beyond code building performance. This prevents modelers from having to develop separate building models for code compliance and beyond code programs. Using this new version of Appendix G to show compliance with the 2016 edition of the standard, the proposed building design needs to have a performance cost index (PCI)more » less than targets shown in a new table based on building type and climate zone. The second change is that the baseline design is now fixed at a stable level of performance set approximately equal to the 2004 code. Rather than changing the stringency of the baseline with each subsequent edition of the standard, compliance with new editions will simply require a reduced PCI (a PCI of zero is a net-zero building). Using this approach, buildings of any era can be rated using the same method. The intent is that any building energy code or beyond code program can use this methodology and merely set the appropriate PCI target for their needs. This report discusses the process used to set performance criteria for compliance with ASHRAE Standard 90.1-2016 and suggests a method for demonstrating compliance with other codes and beyond code programs.« less

  2. Developing Performance Cost Index Targets for ASHRAE Standard 90.1 Appendix G – Performance Rating Method - Rev.1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosenberg, Michael I.; Hart, Philip R.

    2016-03-01

    Appendix G, the Performance Rating Method in ASHRAE Standard 90.1 has been updated to make two significant changes for the 2016 edition, to be published in October of 2016. First, it allows Appendix G to be used as a third path for compliance with the standard in addition to rating beyond code building performance. This prevents modelers from having to develop separate building models for code compliance and beyond code programs. Using this new version of Appendix G to show compliance with the 2016 edition of the standard, the proposed building design needs to have a performance cost index (PCI)more » less than targets shown in a new table based on building type and climate zone. The second change is that the baseline design is now fixed at a stable level of performance set approximately equal to the 2004 code. Rather than changing the stringency of the baseline with each subsequent edition of the standard, compliance with new editions will simply require a reduced PCI (a PCI of zero is a net-zero building). Using this approach, buildings of any era can be rated using the same method. The intent is that any building energy code or beyond code program can use this methodology and merely set the appropriate PCI target for their needs. This report discusses the process used to set performance criteria for compliance with ASHRAE Standard 90.1-2016 and suggests a method for demonstrating compliance with other codes and beyond code programs.« less

  3. Some controversial multiple testing problems in regulatory applications.

    PubMed

    Hung, H M James; Wang, Sue-Jane

    2009-01-01

    Multiple testing problems in regulatory applications are often more challenging than the problems of handling a set of mathematical symbols representing multiple null hypotheses under testing. In the union-intersection setting, it is important to define a family of null hypotheses relevant to the clinical questions at issue. The distinction between primary endpoint and secondary endpoint needs to be considered properly in different clinical applications. Without proper consideration, the widely used sequential gate keeping strategies often impose too many logical restrictions to make sense, particularly to deal with the problem of testing multiple doses and multiple endpoints, the problem of testing a composite endpoint and its component endpoints, and the problem of testing superiority and noninferiority in the presence of multiple endpoints. Partitioning the null hypotheses involved in closed testing into clinical relevant orderings or sets can be a viable alternative to resolving the illogical problems requiring more attention from clinical trialists in defining the clinical hypotheses or clinical question(s) at the design stage. In the intersection-union setting there is little room for alleviating the stringency of the requirement that each endpoint must meet the same intended alpha level, unless the parameter space under the null hypothesis can be substantially restricted. Such restriction often requires insurmountable justification and usually cannot be supported by the internal data. Thus, a possible remedial approach to alleviate the possible conservatism as a result of this requirement is a group-sequential design strategy that starts with a conservative sample size planning and then utilizes an alpha spending function to possibly reach the conclusion early.

  4. The economics of subnational carbon policy interactions and integration

    NASA Astrophysics Data System (ADS)

    Rahman, Fadli

    An integrated, nationwide carbon policy is essential to achieve US environmental targets relating to carbon emissions. The carbon policy literature is loaded with qualitative analysis of the implications or mechanisms of an integrated emissions market across the US, but current quantitative studies do not offer solutions regarding the interactions of coexisting US regional emission markets and other policy instruments. Therefore, this dissertation attempts to answer three fundamental concerns about US carbon policy. The second chapter analyzes the welfare implications of different relative stringencies of cap-setting under a proposed integration of two emissions markets, considering the attributes relevant to each market. The third chapter extends this market integration analysis by adding an intertemporal feature to analyze the consequences of integrating existing emission markets in the US (i.e., California and RGGI). The fourth chapter examines the adverse economic implications of adopting several overlapping carbon policy instruments to regulate carbon emissions in a region. The second and third chapters employ a simple structural model with a stochastic variable to account for uncertainties in emissions. The fourth chapter utilizes a static general equilibrium framework based on IMPLAN data for California to comprehensively evaluate the reactions of the state-wide economy to various carbon policy settings. In general, the results show that integrating existing emissions markets could generate both positive and negative effects on economic welfare. The positive effects result from gains from trading permits, while negative results come from perverse second-best interactions. Policymakers are expected to carefully consider the factors and attributes of all regions prior to setting their policy targets and designing an integrated system of carbon reduction.

  5. Assessing the interactions among U.S. climate policy, biomass energy, and agricultural trade

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wise, Marshall A.; McJeon, Haewon C.; Calvin, Katherine V.

    Energy from biomass is potentially an important contributor to U.S. climate change mitigation efforts. However, an important consideration to large-scale implementation of bioenergy is that the production of biomass competes with other uses of land. This includes traditionally economically productive uses, such as agriculture and forest products, as well as storage of carbon in forests and non-commercial lands. In addition, in the future, biomass may be more easily traded, meaning that increased U.S. reliance on bioenergy could come with it greater reliance on imported energy. Several approaches could be implemented to address these issues, including limits on U.S. biomass importsmore » and protection of U.S. and global forests. This paper explores these dimensions of bioenergy’s role in U.S. climate policy and the relationship to these alternative measures for ameliorating the trade and land use consequences of bioenergy. It first demonstrates that widespread use of biomass in the U.S. could lead to imports; and it highlights that the relative stringency of domestic and international carbon mitigation policy will heavily influence the degree to which it is imported. Next, it demonstrates that while limiting biomass imports would prevent any reliance on other countries for this energy supply, it would most likely alter the balance of trade in other agricultural products against which biomass competes; for example, it might turn the U.S. from a corn exporter to a corn importer. Finally, it shows that increasing efforts to protect both U.S. and international forests could also affect the balance of trade in other agricultural products.« less

  6. Molecular detection of native and invasive marine invertebrate larvae present in ballast and open water environmental samples collected in Puget Sound

    USGS Publications Warehouse

    Harvey, J.B.J.; Hoy, M.S.; Rodriguez, R.J.

    2009-01-01

    Non-native marine species have been and continue to be introduced into Puget Sound via several vectors including ship's ballast water. Some non-native species become invasive and negatively impact native species or near shore habitats. We present a new methodology for the development and testing of taxon specific PCR primers designed to assess environmental samples of ocean water for the presence of native and non-native bivalves, crustaceans and algae. The intergenic spacer regions (IGS; ITS1, ITS2 and 5.8S) of the ribosomal DNA were sequenced for adult samples of each taxon studied. We used these data along with those available in Genbank to design taxon and group specific primers and tested their stringency against artificial populations of plasmid constructs containing the entire IGS region for each of the 25 taxa in our study, respectively. Taxon and group specific primer sets were then used to detect the presence or absence of native and non-native planktonic life-history stages (propagules) from environmental samples of ballast water and plankton tow net samples collected in Puget Sound. This methodology provides an inexpensive and efficient way to test the discriminatory ability of taxon specific oligonucleotides (PCR primers) before creating molecular probes or beacons for use in molecular ecological applications such as probe hybridizations or microarray analyses. This work addresses the current need to develop molecular tools capable of diagnosing the presence of planktonic life-history stages from non-native marine species (potential invaders) in ballast water and other environmental samples. ?? 2008 Elsevier B.V.

  7. CRISPR-Cas Adaptive Immune Systems of the Sulfolobales: Unravelling Their Complexity and Diversity

    PubMed Central

    Garrett, Roger A.; Shah, Shiraz A.; Erdmann, Susanne; Liu, Guannan; Mousaei, Marzieh; León-Sobrino, Carlos; Peng, Wenfang; Gudbergsdottir, Soley; Deng, Ling; Vestergaard, Gisle; Peng, Xu; She, Qunxin

    2015-01-01

    The Sulfolobales have provided good model organisms for studying CRISPR-Cas systems of the crenarchaeal kingdom of the archaea. These organisms are infected by a wide range of exceptional archaea-specific viruses and conjugative plasmids, and their CRISPR-Cas systems generally exhibit extensive structural and functional diversity. They carry large and multiple CRISPR loci and often multiple copies of diverse Type I and Type III interference modules as well as more homogeneous adaptation modules. These acidothermophilic organisms have recently provided seminal insights into both the adaptation process, the diverse modes of interference, and their modes of regulation. The functions of the adaptation and interference modules tend to be loosely coupled and the stringency of the crRNA-DNA sequence matching during DNA interference is relatively low, in contrast to some more streamlined CRISPR-Cas systems of bacteria. Despite this, there is evidence for a complex and differential regulation of expression of the diverse functional modules in response to viral infection. Recent work also supports critical roles for non-core Cas proteins, especially during Type III-directed interference, and this is consistent with these proteins tending to coevolve with core Cas proteins. Various novel aspects of CRISPR-Cas systems of the Sulfolobales are considered including an alternative spacer acquisition mechanism, reversible spacer acquisition, the formation and significance of antisense CRISPR RNAs, and a novel mechanism for avoidance of CRISPR-Cas defense. Finally, questions regarding the basis for the complexity, diversity, and apparent redundancy, of the intracellular CRISPR-Cas systems are discussed. PMID:25764276

  8. Use of allele scores as instrumental variables for Mendelian randomization

    PubMed Central

    Burgess, Stephen; Thompson, Simon G

    2013-01-01

    Background An allele score is a single variable summarizing multiple genetic variants associated with a risk factor. It is calculated as the total number of risk factor-increasing alleles for an individual (unweighted score), or the sum of weights for each allele corresponding to estimated genetic effect sizes (weighted score). An allele score can be used in a Mendelian randomization analysis to estimate the causal effect of the risk factor on an outcome. Methods Data were simulated to investigate the use of allele scores in Mendelian randomization where conventional instrumental variable techniques using multiple genetic variants demonstrate ‘weak instrument’ bias. The robustness of estimates using the allele score to misspecification (for example non-linearity, effect modification) and to violations of the instrumental variable assumptions was assessed. Results Causal estimates using a correctly specified allele score were unbiased with appropriate coverage levels. The estimates were generally robust to misspecification of the allele score, but not to instrumental variable violations, even if the majority of variants in the allele score were valid instruments. Using a weighted rather than an unweighted allele score increased power, but the increase was small when genetic variants had similar effect sizes. Naive use of the data under analysis to choose which variants to include in an allele score, or for deriving weights, resulted in substantial biases. Conclusions Allele scores enable valid causal estimates with large numbers of genetic variants. The stringency of criteria for genetic variants in Mendelian randomization should be maintained for all variants in an allele score. PMID:24062299

  9. Pseudosynapsis and Decreased Stringency of Meiotic Repair Pathway Choice on the Hemizygous Sex Chromosome of Caenorhabditis elegans Males

    PubMed Central

    Checchi, Paula M.; Lawrence, Katherine S.; Van, Mike V.; Larson, Braden J.; Engebrecht, JoAnne

    2014-01-01

    During meiosis, accurate chromosome segregation relies on homology to mediate chromosome pairing, synapsis, and crossover recombination. Crossovers are dependent upon formation and repair of double-strand breaks (DSBs) by homologous recombination (HR). In males of many species, sex chromosomes are largely hemizygous, yet DSBs are induced along nonhomologous regions. Here we analyzed the genetic requirements for meiotic DSB repair on the completely hemizygous X chromosome of Caenorhabditis elegans males. Our data reveal that the kinetics of DSB formation, chromosome pairing, and synapsis are tightly linked in the male germ line. Moreover, DSB induction on the X is concomitant with a brief period of pseudosynapsis that may allow X sister chromatids to masquerade as homologs. Consistent with this, neither meiotic kleisins nor the SMC-5/6 complex are essential for DSB repair on the X. Furthermore, early processing of X DSBs is dependent on the CtIP/Sae2 homolog COM-1, suggesting that as with paired chromosomes, HR is the preferred pathway. In contrast, the X chromosome is refractory to feedback mechanisms that ensure crossover formation on autosomes. Surprisingly, neither RAD-54 nor BRC-2 are essential for DSB repair on the X, suggesting that unlike autosomes, the X is competent for repair in the absence of HR. When both RAD-54 and the structure-specific nuclease XPF-1 are abrogated, X DSBs persist, suggesting that single-strand annealing is engaged in the absence of HR. Our findings indicate that alteration in sister chromatid interactions and flexibility in DSB repair pathway choice accommodate hemizygosity on sex chromosomes. PMID:24939994

  10. Slower postnatal motor development in infants of mothers with latent toxoplasmosis during the first 18 months of life.

    PubMed

    Kaňková, Sárka; Sulc, Jan; Křivohlavá, Romana; Kuběna, Aleš; Flegr, Jaroslav

    2012-11-01

    Toxoplasmosis, a zoonosis caused by a protozoan, Toxoplasma gondii, is probably the most widespread human parasitosis in developed countries. Pregnant women with latent toxoplasmosis have seemingly younger fetuses especially in the 16th week of gestation, which suggests that fetuses of Toxoplasma-infected mothers have slower rates of development in the first trimester of pregnancy. In the present retrospective cohort study, we analyzed data on postnatal motor development of infants from 331 questionnaire respondents including 53 Toxoplasma-infected mothers to search for signs of early postnatal development disorders. During the first year of life, a slower postnatal motor development was observed in infants of mothers with latent toxoplasmosis. These infants significantly later developed the ability to control the head position (p=0.039), to roll from supine to prone position (p=0.022) and were slightly later to begin crawling (p=0.059). Our results are compatible with the hypothesis that the difference in the rates of prenatal and early postnatal development between children of Toxoplasma-negative and Toxoplasma-positive mothers might be caused by a decreased stringency of embryo quality control in partly immunosuppressed Toxoplasma-positive mothers resulting in a higher proportion of infants with genetic or developmental disorders in offspring. However, because of relatively low return rate of questionnaires and an associated risk of a sieve effect, our results should be considered as preliminary and performing a large scale prospective study in the future is critically needed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Pro: Pretransplant weight loss: yes.

    PubMed

    Lentine, Krista L

    2015-11-01

    The obesity epidemic has not spared the population with renal failure. Obesity impacts prognosis after kidney transplantation, as markers of obesity are associated with worse outcomes (e.g. delayed graft function, graft failure, cardiovascular disease, costs) compared with ideal values in most studies. Obesity is also potentially modifiable. Kidney transplants are a scarce resource and the obligation to steward organs to good outcomes is inherent in transplant practice. Thus, it is appropriate to establish pretransplant weight loss targets and engage obese patients seeking transplantation in shared responsibility agreements to strive to reach goals. Nonetheless, important caveats may qualify the stringency of pretransplant weight loss requirements. Obese patients (who are otherwise healthy enough for transplant) may benefit from transplantation compared with long-term dialysis based on metrics such as improved long-term survival and lower cardiac risk. When optimal weight loss is difficult to achieve, factors in a given program's ability to extend the limits of obesity acceptable for safe and effective transplantation include expertise (e.g. surgical approaches and clinical management), tolerance for risk based on overall performance and tolerance for costs. More research is needed, including formal cost-effectiveness studies of transplantation in obese patients to determine if payers (e.g. Medicare) and society should be compensating programs for clinical and financial risks, and whether the risks are worth taking. To generate evidence to better guide management, prospective evaluations of the impact of intentional weight loss strategies in this population, including studies of dietary change, monitored exercise and bariatric surgery, are also urgently needed. © The Author 2015. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

  12. The '333' integrated strategy for effective pollution control and its application to the heavily polluted Jialu River in north China.

    PubMed

    Huang, Yu; Sun, Jie; Li, Aimin; Xie, Xianchuan

    2018-05-01

    In this study, an integrated approach named the '333' strategy was applied to pollution control in the Jialu River, in northern China, which is heavily burdened with anthropogenic pollution. Due to a deficiency of the natural ecological inflow, the Jialu River receives predominantly industrial and municipal effluent. The '333' strategy is composed of three steps of pollution control including industrial point-source pollution control, advanced treatment of municipal wastewater, and ecological restoration; three increased stringency emission standards; and three stages of reclamation. Phase 1 of the '333' strategy focuses on industrial point-source pollution control; phase 2 aims to harness municipal wastewater and minimize sewage effluents using novel techniques for advanced water purification; phase 3 of the '333' strategy focuses on the further purification of effluents flowing into Jialu River with the employment of an engineering-based ecological restoration project. The application of the '333' strategy resulted in the development of novel techniques for water purification including modified magnetic resins (NDMP resin), a two-stage internal circulation anaerobic reactor (IC reactor) and an ecological restoration system. The results indicate that water quality in the river was significantly improved, with increased concentrations of dissolved oxygen (DO), as well as reduction of COD by 42.8% and NH 3 -N by 61.4%. In addition, it was observed that the total population of phytoplankton in treated river water notably increased from only one prior to restoration to 8 following restoration. This system also provides a tool for pollution control of other similar industrial and anthropogenic source polluted rivers.

  13. Accessing the Soil Metagenome for Studies of Microbial Diversity▿ †

    PubMed Central

    Delmont, Tom O.; Robe, Patrick; Cecillon, Sébastien; Clark, Ian M.; Constancias, Florentin; Simonet, Pascal; Hirsch, Penny R.; Vogel, Timothy M.

    2011-01-01

    Soil microbial communities contain the highest level of prokaryotic diversity of any environment, and metagenomic approaches involving the extraction of DNA from soil can improve our access to these communities. Most analyses of soil biodiversity and function assume that the DNA extracted represents the microbial community in the soil, but subsequent interpretations are limited by the DNA recovered from the soil. Unfortunately, extraction methods do not provide a uniform and unbiased subsample of metagenomic DNA, and as a consequence, accurate species distributions cannot be determined. Moreover, any bias will propagate errors in estimations of overall microbial diversity and may exclude some microbial classes from study and exploitation. To improve metagenomic approaches, investigate DNA extraction biases, and provide tools for assessing the relative abundances of different groups, we explored the biodiversity of the accessible community DNA by fractioning the metagenomic DNA as a function of (i) vertical soil sampling, (ii) density gradients (cell separation), (iii) cell lysis stringency, and (iv) DNA fragment size distribution. Each fraction had a unique genetic diversity, with different predominant and rare species (based on ribosomal intergenic spacer analysis [RISA] fingerprinting and phylochips). All fractions contributed to the number of bacterial groups uncovered in the metagenome, thus increasing the DNA pool for further applications. Indeed, we were able to access a more genetically diverse proportion of the metagenome (a gain of more than 80% compared to the best single extraction method), limit the predominance of a few genomes, and increase the species richness per sequencing effort. This work stresses the difference between extracted DNA pools and the currently inaccessible complete soil metagenome. PMID:21183646

  14. Funding health and social services for older people - a qualitative study of care recipients in the last year of life.

    PubMed

    Hanratty, Barbara; Lowson, Elizabeth; Holmes, Louise; Grande, Gunn; Addington-Hall, Julia; Payne, Sheila; Seymour, Jane

    2012-05-01

    This study explores the views of older adults who are receiving health and social care at the end of their lives, on how services should be funded, and describes their health-related expenditure. Qualitative interview study. North West England. 30 people aged 69-93 years, diagnosed with lung cancer, heart failure or stroke and judged by health professionals to be in their last year of life. Sixteen participants lived in disadvantaged areas. Views of older adults on funding of services. Participants expressed a belief in an earned entitlement to services funded from taxation, based on a broad sense of being a good citizen. Irrespective of social background, older people felt that those who could afford to pay for social care, should do so. Sale of assets and use of children's inheritance to fund care was widely perceived as an injustice. The costs of living with illness are a burden, and families are filling many of the gaps left by welfare provision. People who had worked in low-wage occupations were most concerned to justify their current acceptance of services, and distance themselves from what they described as welfare 'spongers' or 'layabouts.' There is a gap between the health and social care system that older adults expect and what may be provided by a reformed welfare state at a time of financial stringencies. The values that underpinned the views expressed--mutuality, care for the most needy, and the importance of working to contribute to society--are an important contribution to the debate on welfare funding.

  15. Prevalence and comparison of Streptococcus infantarius subsp. infantarius and Streptococcus gallolyticus subsp. macedonicus in raw and fermented dairy products from East and West Africa.

    PubMed

    Jans, Christoph; Kaindi, Dasel Wambua Mulwa; Böck, Désirée; Njage, Patrick Murigu Kamau; Kouamé-Sina, Sylvie Mireille; Bonfoh, Bassirou; Lacroix, Christophe; Meile, Leo

    2013-10-15

    Streptococcus infantarius subsp. infantarius (Sii) and Streptococcus gallolyticus subsp. macedonicus are members of the Streptococcus bovis/Streptococcus equinus complex (SBSEC) associated with human infections. SBSEC-related endocarditis was furthermore associated with rural residency in Southern Europe. SBSEC members are increasingly isolated as predominant species from fermented dairy products in Europe, Asia and Africa. African variants of Sii displayed dairy adaptations to lactose metabolism paralleling those of Streptococcus thermophilus including genome decay. In this study, the aim was to assess the prevalence of Sii and possibly other SBSEC members in dairy products of East and West Africa in order to identify their habitat, estimate their importance in dairy fermentation processes and determine geographic areas affected by this potential health risk. Presumptive SBSEC members were isolated on semi-selective M17 and SM agar media. Subsequent genotypic identification of isolates was based on rep-PCR fingerprinting and SBSEC-specific16S rRNA gene PCR assay. Detailed identification was achieved through application of novel primers enhancing the binding stringency in partial groES/groEL gene amplification and subsequent DNA sequencing. The presence of S. thermophilus-like lacS and lacZ genes in the SBSEC isolates was determined to elucidate the prevalence of this dairy adaptation. Isolates (n = 754) were obtained from 72 raw and 95 fermented milk samples from Côte d'Ivoire and Kenya on semi-selective agar media. Colonies of Sii were not detected from raw milk despite high microbial titers of approximately 10(6)CFU/mL on M17 agar medium. However, after spontaneous milk fermentation Sii was genotypically identified in 94.1% of Kenyan samples and 60.8% of Kenyan isolates. Sii prevalence in Côte d'Ivoire displayed seasonal variations in samples from 32.3% (June) to 40.0% (Dec/Jan) and isolates from 20.5% (June) to 27.7% (Dec/Jan) present at titers of 10(6)-10(8)CFU/mL. lacS and lacZ genes were detected in all Kenyan and 25.8% (June) to 65.4% (Dec/Jan) of Ivorian Sii isolates. Regional differences in prevalence of Sii and dairy adaptations were observed, but no clear effect of dairy animal, fermentation procedure and climate was revealed. Conclusively, the high prevalence of Sii in Kenya, Côte d'Ivoire in addition to Somalia, Sudan and Mali strongly indicates a pivotal role of Sii in traditional African dairy fermentations potentially paralleling that of typical western dairy species S. thermophilus. Putative health risks associated with the consumption of high amounts of live Sii and potential different degrees of evolutionary adaptation or ecological colonization require further epidemiologic and genomic investigations, particularly in Africa. © 2013.

  16. Prevalence and comparison of Streptococcus infantarius subsp. infantarius and Streptococcus gallolyticus subsp. macedonicus in raw and fermented dairy products from East and West Africa

    PubMed Central

    Jans, Christoph; Kaindi, Dasel Wambua Mulwa; Böck, Désirée; Njage, Patrick Murigu Kamau; Kouamé-Sina, Sylvie Mireille; Bonfoh, Bassirou; Lacroix, Christophe; Meile, Leo

    2016-01-01

    Streptococcus infantarius subsp. infantarius (Sii) and Streptococcus gallolyticus subsp. macedonicus are members of the Streptococcus bovis/Streptococcus equinus complex (SBSEC) associated with human infections. SBSEC-related endocarditis was furthermore associated with rural residency in Southern Europe. SBSEC members are increasingly isolated as predominant species from fermented dairy products in Europe, Asia and Africa. African variants of Sii displayed dairy adaptations to lactose metabolism paralleling those of Streptococcus thermophilus including genome decay. In this study, the aim was to assess the prevalence of Sii and possibly other SBSEC members in dairy products of East and West Africa in order to identify their habitat, estimate their importance in dairy fermentation processes and determine geographic areas affected by this potential health risk. Presumptive SBSEC members were isolated on semi-selective M17 and SM agar media. Subsequent genotypic identification of isolates was based on rep-PCR fingerprinting and SBSEC-specific16S rRNA gene PCR assay. Detailed identification was achieved through application of novel primers enhancing the binding stringency in partial groES/groEL gene amplification and subsequent DNA sequencing. The presence of S. thermophilus-like lacS and lacZ genes in the SBSEC isolates was determined to elucidate the prevalence of this dairy adaptation. Isolates (n = 754) were obtained from 72 raw and 95 fermented milk samples from Côte d'Ivoire and Kenya on semi-selective agar media. Colonies of Sii were not detected from raw milk despite high microbial titers of approximately 106 CFU/mL on M17 agar medium. However, after spontaneous milk fermentation Sii was genotypically identified in 94.1% of Kenyan samples and 60.8% of Kenyan isolates. Sii prevalence in Côte d'Ivoire displayed seasonal variations in samples from 32.3% (June) to 40.0% (Dec/Jan) and isolates from 20.5% (June) to 27.7% (Dec/Jan) present at titers of 106–108 CFU/mL. lacS and lacZ genes were detected in all Kenyan and 25.8% (June) to 65.4% (Dec/Jan) of Ivorian Sii isolates. Regional differences in prevalence of Sii and dairy adaptations were observed, but no clear effect of dairy animal, fermentation procedure and climate was revealed. Conclusively, the high prevalence of Sii in Kenya, Côte d'Ivoire in addition to Somalia, Sudan and Mali strongly indicates a pivotal role of Sii in traditional African dairy fermentations potentially paralleling that of typical western dairy species S. thermophilus. Putative health risks associated with the consumption of high amounts of live Sii and potential different degrees of evolutionary adaptation or ecological colonization require further epidemiologic and genomic investigations, particularly in Africa. PMID:24131584

  17. Chagas' disease in Aboriginal and Creole communities from the Gran Chaco Region of Argentina: Seroprevalence and molecular parasitological characterization.

    PubMed

    Lucero, R H; Brusés, B L; Cura, C I; Formichelli, L B; Juiz, N; Fernández, G J; Bisio, M; Deluca, G D; Besuschio, S; Hernández, D O; Schijman, A G

    2016-07-01

    Most indigenous ethnias from Northern Argentina live in rural areas of "the Gran Chaco" region, where Trypanosoma cruzi is endemic. Serological and parasitological features have been poorly characterized in Aboriginal populations and scarce information exist regarding relevant T. cruzi discrete typing units (DTU) and parasitic loads. This study was focused to characterize T. cruzi infection in Qom, Mocoit, Pit'laxá and Wichi ethnias (N=604) and Creole communities (N=257) inhabiting rural villages from two highly endemic provinces of the Argentinean Gran Chaco. DNA extracted using Hexadecyltrimethyl Ammonium Bromide reagent from peripheral blood samples was used for conventional PCR targeted to parasite kinetoplastid DNA (kDNA) and identification of DTUs using nuclear genomic markers. In kDNA-PCR positive samples from three rural Aboriginal communities of "Monte Impenetrable Chaqueño", minicircle signatures were characterized by Low stringency single primer-PCR and parasitic loads calculated using Real-Time PCR. Seroprevalence was higher in Aboriginal (47.98%) than in Creole (27.23%) rural communities (Chi square, p=4.e(-8)). A low seroprevalence (4.3%) was detected in a Qom settlement at the suburbs of Resistencia city (Fisher Exact test, p=2.e(-21)).The kDNA-PCR positivity was 42.15% in Aboriginal communities and 65.71% in Creole populations (Chi square, p=5.e(-4)). Among Aboriginal communities kDNA-PCR positivity was heterogeneous (Chi square, p=1.e(-4)). Highest kDNA-PCR positivity (79%) was detected in the Qom community of Colonia Aborigen and the lowest PCR positivity in two different surveys at the Wichi community of Misión Nueva Pompeya (33.3% in 2010 and 20.8% in 2014). TcV (or TcII/V/VI) was predominant in both Aboriginal and Creole communities, in agreement with DTU distribution reported for the region. Besides, two subjects were infected with TcVI, one with TcI and four presented mixed infections of TcV plus TcII/VI. Most minicircle signatures clustered according to their original localities, but in a few cases, signatures from one locality clustered with signatures from other village, suggesting circulation of the same strains in the area. Parasitic loads ranged from undetectable to around 50 parasite equivalents/mL, showing higher values than those generally observed in chronic Chagas disease patients living in urban centers of Argentina. Our findings reveal the persistence of high levels of infection in these neglected populations. Copyright © 2016. Published by Elsevier B.V.

  18. Rational confederation of genes and diseases: NGS interpretation via GeneCards, MalaCards and VarElect.

    PubMed

    Rappaport, Noa; Fishilevich, Simon; Nudel, Ron; Twik, Michal; Belinky, Frida; Plaschkes, Inbar; Stein, Tsippi Iny; Cohen, Dana; Oz-Levi, Danit; Safran, Marilyn; Lancet, Doron

    2017-08-18

    A key challenge in the realm of human disease research is next generation sequencing (NGS) interpretation, whereby identified filtered variant-harboring genes are associated with a patient's disease phenotypes. This necessitates bioinformatics tools linked to comprehensive knowledgebases. The GeneCards suite databases, which include GeneCards (human genes), MalaCards (human diseases) and PathCards (human pathways) together with additional tools, are presented with the focus on MalaCards utility for NGS interpretation as well as for large scale bioinformatic analyses. VarElect, our NGS interpretation tool, leverages the broad information in the GeneCards suite databases. MalaCards algorithms unify disease-related terms and annotations from 69 sources. Further, MalaCards defines hierarchical relatedness-aliases, disease families, a related diseases network, categories and ontological classifications. GeneCards and MalaCards delineate and share a multi-tiered, scored gene-disease network, with stringency levels, including the definition of elite status-high quality gene-disease pairs, coming from manually curated trustworthy sources, that includes 4500 genes for 8000 diseases. This unique resource is key to NGS interpretation by VarElect. VarElect, a comprehensive search tool that helps infer both direct and indirect links between genes and user-supplied disease/phenotype terms, is robustly strengthened by the information found in MalaCards. The indirect mode benefits from GeneCards' diverse gene-to-gene relationships, including SuperPaths-integrated biological pathways from 12 information sources. We are currently adding an important information layer in the form of "disease SuperPaths", generated from the gene-disease matrix by an algorithm similar to that previously employed for biological pathway unification. This allows the discovery of novel gene-disease and disease-disease relationships. The advent of whole genome sequencing necessitates capacities to go beyond protein coding genes. GeneCards is highly useful in this respect, as it also addresses 101,976 non-protein-coding RNA genes. In a more recent development, we are currently adding an inclusive map of regulatory elements and their inferred target genes, generated by integration from 4 resources. MalaCards provides a rich big-data scaffold for in silico biomedical discovery within the gene-disease universe. VarElect, which depends significantly on both GeneCards and MalaCards power, is a potent tool for supporting the interpretation of wet-lab experiments, notably NGS analyses of disease. The GeneCards suite has thus transcended its 2-decade role in biomedical research, maturing into a key player in clinical investigation.

  19. Violence, Sex, and Profanity in Films: Correlation of Movie Ratings With Content

    PubMed Central

    Thompson, Kimberly M; Yokota, Fumie

    2004-01-01

    Context Children's exposure to violence, sexual themes, profanity, and the depiction of substances in movies remains a source of parental and public health concern. However, limited research quantifies the correlations between movie content, ratings, and economics or addresses the issue of ratings "creep." Objectives To characterize available information about violence, sex, and profanity content of movies as a function of rating; quantitatively explore the relationships between content, ratings, and economic information; compare the amount of violence in animated and non-animated G-rated films; and test for a trend of decreased stringency of rating criteria (ie, "ratings creep") as a function of time. Design We developed a complete database of movie ratings available from the Motion Picture Association of America(MPAA) to characterize the content information (including any indicated reasons noted for ratings) for all movies released between January 1, 1992 and December 31, 2003. We then added to the database the three Kids-in-Mind content-based scores for: (1) violence and gore, (2) sex and nudity, and (3) profanity; and the 15 categories of information from Screen It!, which began providing information in mid-1996. Finally, we obtained information on gross revenues and movie budgets from the IMDbPro. We performed statistical analyses to correlate the content-based scores with the overall rating and rating reasons assigned by the MPAA; to test the hypothesis that age-based ratings became less stringent over time; to explore correlations between film content, ratings, and available economic information; to compare the amount of violence in animated and non-animated G-rated films; and to characterize the available information about the depiction of substances in films. Main Outcome Measures Description of movie ratings, correlation of content with rating, and statistical results. Results Comparing the content-based scores for different movie ratings, we find large variability exists in the types of content that receive different MPAA ratings, and good correlation between the content-based scores assigned by Kids-in-Mind and Screen It! The MPAA rating reasons correlate with higher scores assigned to content-based ratings, and the number of reasons indicated increases with the age-based rating category. We found significantly higher rated content in movies as a function of time, suggesting that the MPAA applied less stringency in its age-based ratings over time for the period of 1992-2003. Animated films rated G by the MPAA received a significantly higher content-based score for violence on average than non-animated films rated G (P < .05). With respect to information about the depiction of substances, the MPAA mentioned alcohol or drugs in its rating reason for 226 films (18%), while Screen It! identified depiction or use of tobacco, alcohol, and/or drugs in 1211 films (95%), including 26 of the 51 G-rated films (51%). We found significantly higher gross revenues for PG-13- and R-rated films when comparing films that received an MPAA rating reason for violence compared with those films that did not (P < .001 based on 2-sided t-tests with unequal variances for both of the separate tests of PG-13- and R-rated films). Conclusions Parents and physicians should be aware that movies with the same rating can differ significantly in the amount and types of potentially objectionable content. Age-based ratings alone do not provide good information about the depiction of violence, sex, profanity, and other content, and the criteria for rating movies became less stringent over the last decade. The MPAA rating reasons provide important information about content, but they do not identify all types of content found in films and they may particularly miss the depiction of substances. PMID:15520625

  20. Techno-Economic Analysis of Indian Draft Standard Levels for RoomAir Conditioners

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McNeil, Michael A.; Iyer, Maithili

    The Indian Bureau of Energy Efficiency (BEE) finalized its first set of efficiency standards and labels for room air conditioners in July of 2006. These regulations followed soon after the publication of levels for frost-free refrigerators in the same year. As in the case of refrigerators, the air conditioner program introduces Minimum Efficiency Performance Standards (MEPS) and comparative labels simultaneously, with levels for one to five stars. Also like the refrigerator program, BEE defined several successive program phases of increasing stringency. In support of BEE's refrigerator program, Lawrence Berkeley National Laboratory (LBNL) produced an analysis of national impacts of standardsmore » in collaboration with the Collaborative Labeling and Standards Program (CLASP). That analysis drew on LBNL's experience with standards programs in the United States, as well as many other countries. Subsequently, as part of the process for setting optimal levels for air conditioner regulations, CLASP commissioned LBNL to provide support to BEE in the form of a techno-economic evaluation of air conditioner efficiency technologies. This report describes the methodology and results of this techno-economic evaluation. The analysis consists of three components: (1) Cost effectiveness to consumers of efficiency technologies relative to current baseline. (2) Impacts on the current market from efficiency regulations. (3) National energy and financial impacts. The analysis relied on detailed and up-to-date technical data made available by BEE and industry representatives. Technical parameters were used in conjunction with knowledge about air conditioner use patterns in the residential and commercial sectors, and prevailing marginal electricity prices, in order to give an estimate of per-unit financial impacts. In addition, the overall impact of the program was evaluated by combining unit savings with market forecasts in order to yield national impacts. LBNL presented preliminary results of these analyses in May 2006, at a meeting of BEEs Technical Committee for Air Conditioners. This meeting was attended by a wide array of stakeholder, including industry representatives, engineers and consumer advocates. Comments made by stakeholders at this meeting are incorporated into the final analysis presented in this report. The current analysis begins with the Rating Plan drafted by BEE in 2006, along with an evaluation of the market baseline according to test data submitted by manufacturers. MEPS, label rating levels, and baseline efficiencies are presented in Section 2. First, we compare Indian MEPS with current standards in other countries, and assess their relative stringency. Baseline efficiencies are then used to estimate the fraction of models likely to remain on the market at each phase of the program, and the impact on market-weighted efficiency levels. Section 3 deals with cost-effectiveness of higher efficiency design options. The cost-benefit analysis is grounded in technical parameters provided by industry representatives in India. This data allows for an assessment of financial costs and benefits to consumers as a result of the standards and labeling program. A Life-Cycle Cost (LCC) calculation is used to evaluate the impacts of the program at the unit level, thus providing some insight into the appropriateness of the levels chosen, and additional opportunities for further ratcheting. In addition to LCC, we also calculate payback periods, cost of conserved energy (CCE), and return on investment (ROI). Finally, Section 4 covers national impacts. This is an extension of unit level estimates in the two previous sections. Extrapolation to the national level depends on a forecast of air conditioner purchases (shipments), which we describe here. Following the cost-benefit analysis, we construct several efficiency scenarios including the BEE plan, but also considering further potential for efficiency improvement. These are combined with shipments through a stock accounting model in order to forecast air conditioner energy consumption in each scenario, and associated electricity savings and carbon emission mitigation. Finally, financial costs and savings are scaled to the national level to evaluate net fiscal benefits.« less

  1. Genetic validation of bipolar disorder identified by automated phenotyping using electronic health records.

    PubMed

    Chen, Chia-Yen; Lee, Phil H; Castro, Victor M; Minnier, Jessica; Charney, Alexander W; Stahl, Eli A; Ruderfer, Douglas M; Murphy, Shawn N; Gainer, Vivian; Cai, Tianxi; Jones, Ian; Pato, Carlos N; Pato, Michele T; Landén, Mikael; Sklar, Pamela; Perlis, Roy H; Smoller, Jordan W

    2018-04-18

    Bipolar disorder (BD) is a heritable mood disorder characterized by episodes of mania and depression. Although genomewide association studies (GWAS) have successfully identified genetic loci contributing to BD risk, sample size has become a rate-limiting obstacle to genetic discovery. Electronic health records (EHRs) represent a vast but relatively untapped resource for high-throughput phenotyping. As part of the International Cohort Collection for Bipolar Disorder (ICCBD), we previously validated automated EHR-based phenotyping algorithms for BD against in-person diagnostic interviews (Castro et al. Am J Psychiatry 172:363-372, 2015). Here, we establish the genetic validity of these phenotypes by determining their genetic correlation with traditionally ascertained samples. Case and control algorithms were derived from structured and narrative text in the Partners Healthcare system comprising more than 4.6 million patients over 20 years. Genomewide genotype data for 3330 BD cases and 3952 controls of European ancestry were used to estimate SNP-based heritability (h 2 g ) and genetic correlation (r g ) between EHR-based phenotype definitions and traditionally ascertained BD cases in GWAS by the ICCBD and Psychiatric Genomics Consortium (PGC) using LD score regression. We evaluated BD cases identified using 4 EHR-based algorithms: an NLP-based algorithm (95-NLP) and three rule-based algorithms using codified EHR with decreasing levels of stringency-"coded-strict", "coded-broad", and "coded-broad based on a single clinical encounter" (coded-broad-SV). The analytic sample comprised 862 95-NLP, 1968 coded-strict, 2581 coded-broad, 408 coded-broad-SV BD cases, and 3 952 controls. The estimated h 2 g were 0.24 (p = 0.015), 0.09 (p = 0.064), 0.13 (p = 0.003), 0.00 (p = 0.591) for 95-NLP, coded-strict, coded-broad and coded-broad-SV BD, respectively. The h 2 g for all EHR-based cases combined except coded-broad-SV (excluded due to 0 h 2 g ) was 0.12 (p = 0.004). These h 2 g were lower or similar to the h 2 g observed by the ICCBD + PGCBD (0.23, p = 3.17E-80, total N = 33,181). However, the r g between ICCBD + PGCBD and the EHR-based cases were high for 95-NLP (0.66, p = 3.69 × 10 -5 ), coded-strict (1.00, p = 2.40 × 10 -4 ), and coded-broad (0.74, p = 8.11 × 10 -7 ). The r g between EHR-based BD definitions ranged from 0.90 to 0.98. These results provide the first genetic validation of automated EHR-based phenotyping for BD and suggest that this approach identifies cases that are highly genetically correlated with those ascertained through conventional methods. High throughput phenotyping using the large data resources available in EHRs represents a viable method for accelerating psychiatric genetic research.

  2. Bone morphogenetic protein and Notch signalling crosstalk in poor-prognosis, mesenchymal-subtype colorectal cancer.

    PubMed

    Irshad, Shazia; Bansal, Mukesh; Guarnieri, Paolo; Davis, Hayley; Al Haj Zen, Ayman; Baran, Brygida; Pinna, Claudia Maria Assunta; Rahman, Haseeb; Biswas, Sujata; Bardella, Chiara; Jeffery, Rosemary; Wang, Lai Mun; East, James Edward; Tomlinson, Ian; Lewis, Annabelle; Leedham, Simon John

    2017-06-01

    The functional role of bone morphogenetic protein (BMP) signalling in colorectal cancer (CRC) is poorly defined, with contradictory results in cancer cell line models reflecting the inherent difficulties of assessing a signalling pathway that is context-dependent and subject to genetic constraints. By assessing the transcriptional response of a diploid human colonic epithelial cell line to BMP ligand stimulation, we generated a prognostic BMP signalling signature, which was applied to multiple CRC datasets to investigate BMP heterogeneity across CRC molecular subtypes. We linked BMP and Notch signalling pathway activity and function in human colonic epithelial cells, and normal and neoplastic tissue. BMP induced Notch through a γ-secretase-independent interaction, regulated by the SMAD proteins. In homeostasis, BMP/Notch co-localization was restricted to cells at the top of the intestinal crypt, with more widespread interaction in some human CRC samples. BMP signalling was downregulated in the majority of CRCs, but was conserved specifically in mesenchymal-subtype tumours, where it interacts with Notch to induce an epithelial-mesenchymal transition (EMT) phenotype. In intestinal homeostasis, BMP-Notch pathway crosstalk is restricted to differentiating cells through stringent pathway segregation. Conserved BMP activity and loss of signalling stringency in mesenchymal-subtype tumours promotes a synergistic BMP-Notch interaction, and this correlates with poor patient prognosis. BMP signalling heterogeneity across CRC subtypes and cell lines can account for previous experimental contradictions. Crosstalk between the BMP and Notch pathways will render mesenchymal-subtype CRC insensitive to γ-secretase inhibition unless BMP activation is concomitantly addressed. © 2017 The Authors. Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. © 2017 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

  3. Cost per response for abatacept versus adalimumab in rheumatoid arthritis by ACPA subgroups in Germany, Italy, Spain, US and Canada.

    PubMed

    Weijers, Laure; Baerwald, Christoph; Mennini, Francesco S; Rodríguez-Heredia, José M; Bergman, Martin J; Choquette, Denis; Herrmann, Kirsten H; Attinà, Giulia; Nappi, Carmela; Merino, Silvia Jimenez; Patel, Chad; Mtibaa, Mondher; Foo, Jason

    2017-07-01

    Rheumatoid arthritis (RA) is a chronic inflammatory disorder leading to disability and reduced quality of life. Effective treatment with biologic DMARDs poses a significant economic burden. The Abatacept versus Adalimumab Comparison in Biologic-Naïve RA Subjects with Background Methotrexate (AMPLE) trial was a head-to-head, randomized study comparing abatacept in serum anti-citrullinated protein antibody (ACPA)-positive patients, with increasing efficacy across ACPA quartile levels. The aim of this study was to evaluate the cost per response accrued using abatacept versus adalimumab in ACPA-positive and ACPA-negative patients with RA from the health care perspective in Germany, Italy, Spain, the US and Canada. A cost-consequence analysis (CCA) was designed to compare the monthly costs per responding patient/patient in remission. Efficacy, safety and resource use inputs were based on the AMPLE trial. A one-way deterministic sensitivity analysis (OWSA) was also performed to assess the impact of model inputs on the results for total incremental costs. Cost per response in ACPA-positive patients favoured abatacept compared with adalimumab (ACR20, ACR90 and HAQ-DI). Subgroup analysis favoured abatacept with increasing stringency of response criteria and serum ACPA levels. Cost per remission (DAS28-CRP) favoured abatacept in ACPA-negative patients, while cost per CDAI and SDAI favoured abatacept in ACPA-positive patients. Abatacept was consistently favoured in ACPA-Q4 patients across all outcomes and countries. Cost savings were greater with abatacept when more stringent response criteria were applied and also with increasing ACPA levels, which could lead to a lower overall health care budget impact with abatacept compared with adalimumab.

  4. Abortion.

    PubMed

    Savage, A

    1979-09-15

    I refer for termination anyone who requests it for--pace Mr V Tunkel, (28 July, p 253)--the law is generally regarded as being one of "abortion on demand." I have some misgivings as I do not believe that women in early pregnancy are always in a fit state to make a considered decision, and they cannot in the nature of things be given time. I have, however, become increasingly worried about the morbidity arising from the procedure, and it is interesting that letters on the subject (25 August, pp 495 and 496) should be followed by one reporting rupture of the uterus during prostaglandin-induced abortion--yet another complication to add to those of cervical incompetence, pelvic sepsis, and permanent neurological damage. In so far as these tragedies usually follow late terminations Mr John Corrie's Bill is to be welcomed. A few further points. I am not so cynical as to think that every impregnation is the result of a thoughtless act of male lust. Unlike Professor Peter Huntingford (25 August, p 496), I listen to men as well as women, and many of them are deeply involved emotionally in the pregnancy they have helped to produce. Certainly I think a man should have the right to be consulted if his wife is to undergo a procedure that might damage her health. It is unfair contemptuously to dismiss as "whims" opinions that differ from ones own. These may result from genuine conscientious doubts or inability to cope from overwork and understaffing. Abortion is quite the most expensive form of contraception, and perhaps in these days of financial stringency this should be taken into account. "Bigotry" is defined in my dictionary as "blind zeal." This could be said of those who enthusiastically promote a course of action without regard to circumstances, safety, or cost.

  5. The impact of market and organizational characteristics on nursing care facility service innovation: a resource dependency perspective.

    PubMed Central

    Banaszak-Holl, J; Zinn, J S; Mor, V

    1996-01-01

    OBJECTIVE. Using resource dependency theory as a conceptual framework, this study investigates both the organizational and environmental factors associated with an emerging health care service delivery innovation, the provision of specialty care in designated units in nursing care facilities. We consider two types of specialty units, Alzheimer's Disease and subacute care. DATA SOURCES. The Medicare/Medicaid Automated Certification Survey (MMACS) data file was merged with local market area data obtained from the 1992 Area Resource File and with state level regulatory data. STUDY DESIGN. The likelihood of providing Alzheimer's Disease or subacute care in dedicated units was estimated by separate logistic regressions. PRINCIPAL FINDINGS. Results indicate that facilities with fewer Medicare patients are more likely to operate a dedicated Alzheimer's care unit, while facilities located in markets with a large HMO population and greater hospital supply are more likely to operate a subacute care unit. While competition among nursing homes, for the most part, is an incentive to innovate, greater regulatory stringency appears to constrain the development of specialty care units of both types. Finally, organizational characteristics (e.g., size and proprietary status) appear to be important enabling factors influencing the propensity to provide specialty care in dedicated units. CONCLUSIONS. Nursing care facilities are moving toward providing specialty care units partly as a response to a growing demand by resource providers and to maintain a competitive edge in tighter markets. Loosening regulation directed at cost containment would further encourage the development of specialty care but should be preceded by some evaluation of population needs for specialty care and the effectiveness of specialty care units. PMID:8617612

  6. Surgeon-industry conflict of interest: survey of North Americans' opinions regarding surgeons consulting with industry.

    PubMed

    DiPaola, Christian P; Dea, Nicolas; Noonan, Vanessa K; Bailey, Christopher S; Dvorak, Marcel F S; Fisher, Charles G

    2014-04-01

    Surgeon-industry conflict of interest (COI) has become a source of considerable interest. Professional medical societies, industry, and policy makers have attempted to regulate potential COI without consideration for public opinion. The objective of this study was to report on the opinions of individuals representing the general public regarding surgeon-industry consulting relationships. Web-based survey. Survey was administered using a "spine Web site," and opinions are collected on surgeon-industry consulting and regulation. Associations among responses to similar questions were assessed to ensure validity and subgroup analysis performed for respondent age, sex, education, insurance, employment, and patient status. Six hundred ten of 642 surveys had complete data. The sample population comprised more females and was older and more educated than the American population. About 80% of respondents felt it was ethical and either beneficial or of no influence to the quality of health care if surgeons were consultants for surgical device companies. Most felt disclosure of an industry relationship was important and paying surgeons royalties for devices, other than those they directly implant, would not affect quality of care. Respondents support multidisciplinary surgeon-industry COI regulation and trust doctors and their professional societies to head this effort. Despite the known potential negative impact of surgeon-industry COI on patient care, this study revealed that this does not seem to be reflected in the opinion of the general public. The respondents felt that disclosure is deemed one of the most important means of self-regulation and COI management, which is in agreement with current trends of most spine societies and journals that are increasing the stringency of disclosure policies. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Nutritional management of cow's milk allergy in children: An update.

    PubMed

    Dupont, C; Chouraqui, J-P; Linglart, A; Bocquet, A; Darmaun, D; Feillet, F; Frelut, M-L; Girardet, J-P; Hankard, R; Rozé, J-C; Simeoni, U; Briend, A

    2018-04-01

    Cow's milk is one of the most common foods responsible for allergic reactions in children. Cow's milk allergy (CMA) involves immunoglobulin E (IgE)- and non-IgE-mediated reactions, the latter being both variable and nonspecific. Guidelines thus emphasize the need for physicians to recognize the specific syndromes of CMA and to respect strict diagnostic modalities. Whatever the clinical pattern of CMA, the mainstay of treatment is the elimination from the diet of cow's milk proteins. The challenge is that both the disease and the elimination diet may result in insufficient height and weight gain and bone mineralization. If, during CMA, the mother is not able or willing to breastfeed, the child must be fed a formula adapted to CMA dietary management, during infancy and later, if the disease persists. This type of formula must be adequate in terms of allergic efficacy and nutritional safety. In older children, when CMA persists, the use of cow's milk baked or heated at a sufficient temperature, frequently tolerated by children with CMA, may help alleviate the stringency of the elimination diet. Guidance on the implementation of the elimination diet by qualified healthcare professionals is always necessary. This guidance should also include advice to ensure adequate bone growth, especially relating to calcium intake. Specific attention should be given to children presenting with several risk factors for weak bone mineral density, i.e., multiple food allergies, vitamin D deficiency, poor sun exposure, steroid use, or severe eczema. When CMA is outgrown, a prolonged elimination diet may negatively impact the quality of the diet over the long term. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  8. DNA sequence divergence among derivatives of Escherichia coli K-12 detected by arbitrary primer PCR (random amplified polymorphic DNA) fingerprinting.

    PubMed Central

    Brikun, I; Suziedelis, K; Berg, D E

    1994-01-01

    Derivatives of Escherichia coli K-12 of known ancestry were characterized by random amplified polymorphic DNA (RAPD) fingerprinting to better understand genome evolution in this family of closely related strains. This sensitive method entails PCR amplification with arbitrary primers at low stringency and yields arrays of anonymous DNA fragments that are strain specific. Among 150 fragments scored, eight were polymorphic in that they were produced from some but not all strains. Seven polymorphic bands were chromosomal, and one was from the F-factor plasmid. Five of the six mapped polymorphic chromosomal bands came from just 7% of the genome, a 340-kb segment that includes the terminus of replication. Two of these were from the cryptic Rac prophage, and the inability to amplify them from strains was attributable to deletion (excision) or to rearrangement of Rac. Two other terminus-region segments that resulted in polymorphic bands appeared to have sustained point mutations that affected the ability to amplify them. Control experiments showed that RAPD bands from the 340-kb terminus-region segment and also from two plasmids (P1 and F) were represented in approximate proportion to their size. Optimization experiments showed that the concentration of thermostable polymerase strongly affected the arrays of RAPD products obtained. Comparison of RAPD polymorphisms and positions of strains exhibiting them in the pedigree suggests that many sequence changes occurred in these historic E. coli strains during their storage. We propose that the clustering of such mutations near the terminus reflects errors during completion of chromosome replication, possibly during slow growth in the stab cultures that were often used to store E. coli strains in the early years of bacterial genetics. Images PMID:8132463

  9. Moving from institutional dependence to entrepreneurialism. Creating and funding a collaborative research and practice development position.

    PubMed

    Darbyshire, Philip; Downes, Maeve; Collins, Carmel; Dyer, Susan

    2005-09-01

    The paper describes the creation of, the rationale behind and the external funding of a collaborative research-clinical practice development position. The paper also demonstrates the benefits of nursing's collaboration with external funding bodies and the value of moving from our traditional position of assuming that 'the hospital' will always provide. There is a constant refrain that nursing must become more 'research-based' and develop an active research culture. In harsh financial times however, funding for research development is scarce. Nurses can respond to this by bemoaning the lack of money or by taking an entrepreneurial approach, creating innovative project proposals that develop new partnerships and attract external funding. Institutional support for clinical research is often more verbal than financial as most health care systems are experiencing extreme financial stringencies. Nurses need to reconsider the notion that every initiative must automatically be funded by the institution. In this paper we show how in a busy major hospital, clinicians and researchers collaborated to create and fund the kind of innovative research and practice development position that may be impossible to fund through existing budgets. With creativity and determination, nurses can challenge the orthodoxy that they are solely dependent on institutional funding. If there is a clear project vision, a convincing rationale, a strongly argued 'business case' and a passionate and persistent team, then innovative new projects and positions can be realized. Developing clinical focused, practice based research is now a worldwide policy and practice imperative for nurses. Unfortunately, current levels of institutional funding are unlikely to support research promotion positions and initiatives. This paper outlines an approach to securing funding for research initiatives that can create exciting new positions and develop productive partnerships between researchers, clinicians and external agencies.

  10. Analyzing key constraints to biogas production from crop residues and manure in the EU—A spatially explicit model

    PubMed Central

    Persson, U. Martin

    2017-01-01

    This paper presents a spatially explicit method for making regional estimates of the potential for biogas production from crop residues and manure, accounting for key technical, biochemical, environmental and economic constraints. Methods for making such estimates are important as biofuels from agricultural residues are receiving increasing policy support from the EU and major biogas producers, such as Germany and Italy, in response to concerns over unintended negative environmental and social impacts of conventional biofuels. This analysis comprises a spatially explicit estimate of crop residue and manure production for the EU at 250 m resolution, and a biogas production model accounting for local constraints such as the sustainable removal of residues, transportation of substrates, and the substrates’ biochemical suitability for anaerobic digestion. In our base scenario, the EU biogas production potential from crop residues and manure is about 0.7 EJ/year, nearly double the current EU production of biogas from agricultural substrates, most of which does not come from residues or manure. An extensive sensitivity analysis of the model shows that the potential could easily be 50% higher or lower, depending on the stringency of economic, technical and biochemical constraints. We find that the potential is particularly sensitive to constraints on the substrate mixtures’ carbon-to-nitrogen ratio and dry matter concentration. Hence, the potential to produce biogas from crop residues and manure in the EU depends to large extent on the possibility to overcome the challenges associated with these substrates, either by complementing them with suitable co-substrates (e.g. household waste and energy crops), or through further development of biogas technology (e.g. pretreatment of substrates and recirculation of effluent). PMID:28141827

  11. Temporal and Spatial Diversity of Bacterial Communities in Coastal Waters of the South China Sea

    PubMed Central

    Du, Jikun; Xiao, Kai; Li, Li; Ding, Xian; Liu, Helu; Lu, Yongjun; Zhou, Shining

    2013-01-01

    Bacteria are recognized as important drivers of biogeochemical processes in all aquatic ecosystems. Temporal and geographical patterns in ocean bacterial communities have been observed in many studies, but the temporal and spatial patterns in the bacterial communities from the South China Sea remained unexplored. To determine the spatiotemporal patterns, we generated 16S rRNA datasets for 15 samples collected from the five regularly distributed sites of the South China Sea in three seasons (spring, summer, winter). A total of 491 representative sequences were analyzed by MOTHUR, yielding 282 operational taxonomic units (OTUs) grouped at 97% stringency. Significant temporal variations of bacterial diversity were observed. Richness and diversity indices indicated that summer samples were the most diverse. The main bacterial group in spring and summer samples was Alphaproteobacteria, followed by Cyanobacteria and Gammaproteobacteria, whereas Cyanobacteria dominated the winter samples. Spatial patterns in the samples were observed that samples collected from the coastal (D151, D221) waters and offshore (D157, D1512, D224) waters clustered separately, the coastal samples harbored more diverse bacterial communities. However, the temporal pattern of the coastal site D151 was contrary to that of the coastal site D221. The LIBSHUFF statistics revealed noticeable differences among the spring, summer and winter libraries collected at five sites. The UPGMA tree showed there were temporal and spatial heterogeneity of bacterial community composition in coastal waters of the South China Sea. The water salinity (P=0.001) contributed significantly to the bacteria-environment relationship. Our results revealed that bacterial community structures were influenced by environmental factors and community-level changes in 16S-based diversity were better explained by spatial patterns than by temporal patterns. PMID:23785512

  12. Sequence conservation on the Y chromosome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gibson, L.H.; Yang-Feng, L.; Lau, C.

    The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less

  13. Applying the food safety objective and related standards to thermal inactivation of Salmonella in poultry meat.

    PubMed

    Membré, Jeanne-Marie; Bassett, John; Gorris, Leon G M

    2007-09-01

    The objective of this study was to investigate the practicality of designing a heat treatment process in a food manufacturing operation for a product governed by a Food Safety Objective (FSO). Salmonella in cooked poultry meat was taken as the working example. Although there is no FSO for this product in current legislation, this may change in the (near) future. Four different process design calculations were explored by means of deterministic and probabilistic approaches to mathematical data handling and modeling. It was found that the probabilistic approach was a more objective, transparent, and quantifiable approach to establish the stringency of food safety management systems. It also allowed the introduction of specific prevalence rates. The key input analyzed in this study was the minimum time required for the heat treatment at a fixed temperature to produce a product that complied with the criterion for product safety, i.e., the FSO. By means of the four alternative process design calculations, the minimum time requirement at 70 degrees C was established and ranged from 0.26 to 0.43 min. This is comparable to the U.S. regulation recommendations and significantly less than that of 2 min at 70 degrees C used, for instance, in the United Kingdom regulation concerning vegetative microorganisms in ready-to-eat foods. However, the objective of this study was not to challenge existing regulations but to provide an illustration of how an FSO established by a competent authority can guide decisions on safe product and process designs in practical operation; it hopefully contributes to the collaborative work between regulators, academia, and industries that need to continue learning and gaining experience from each other in order to translate risk-based concepts such as the FSO into everyday operational practice.

  14. Development and implementation of an international proficiency testing program for a neutralizing antibody assay for HIV-1 in TZM-bl cells.

    PubMed

    Todd, Christopher A; Greene, Kelli M; Yu, Xuesong; Ozaki, Daniel A; Gao, Hongmei; Huang, Yunda; Wang, Maggie; Li, Gary; Brown, Ronald; Wood, Blake; D'Souza, M Patricia; Gilbert, Peter; Montefiori, David C; Sarzotti-Kelsoe, Marcella

    2012-01-31

    Recent advances in assay technology have led to major improvements in how HIV-1 neutralizing antibodies are measured. A luciferase reporter gene assay performed in TZM-bl (JC53bl-13) cells has been optimized and validated. Because this assay has been adopted by multiple laboratories worldwide, an external proficiency testing program was developed to ensure data equivalency across laboratories performing this neutralizing antibody assay for HIV/AIDS vaccine clinical trials. The program was optimized by conducting three independent rounds of testing, with an increased level of stringency from the first to third round. Results from the participating domestic and international laboratories improved each round as factors that contributed to inter-assay variability were identified and minimized. Key contributors to increased agreement were experience among laboratories and standardization of reagents. A statistical qualification rule was developed using a simulation procedure based on the three optimization rounds of testing, where a laboratory qualifies if at least 25 of the 30 ID50 values lie within the acceptance ranges. This ensures no more than a 20% risk that a participating laboratory fails to qualify when it should, as defined by the simulation procedure. Five experienced reference laboratories were identified and tested a series of standardized reagents to derive the acceptance ranges for pass-fail criteria. This Standardized Proficiency Testing Program is the first available for the evaluation and documentation of assay equivalency for laboratories performing HIV-1 neutralizing antibody assays and may provide guidance for the development of future proficiency testing programs for other assay platforms. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. Effect of certificate of need law on emergency department length of stay.

    PubMed

    Paul, Jomon Aliyas; Ni, Huan; Bagchi, Aniruddha

    2014-10-01

    The impact of the Certificate of Need (CON) law on Emergency Department (ED) care remains elusive in the academic literature. We study the impact of CON law on ED Length of Stay (LOS). We examine ED LOS to detect any statistically significant difference between CON and non-CON states. We then estimate the effects of CON law on ED LOS by treating CON as an exogenous (endogenous) variable. We find that the CON legislation positively impacts ED care by reducing ED LOS (95% confidence interval [CI] -61.3 to -10.3), and we can't reject the hypothesis that the CON legislation can be treated as an exogenous variable in our model. An increase in the stringency of the CON law (measured by the threshold on equipment expenditure that is subject to a CON review) tends to diminish this positive impact on ED LOS (95% CI 9.9-68.0). The party affiliation of the Governor (95% CI 10.3-37.5), the political environment as a function of the agreement on voting between state senators (95% CI-64.8 to -12.9), proportion of young population (0-17 years) when compared with the elderly (>65 years) (95% CI-2299.7 to -184.1), proportion of population covered by privately purchased insurance (95% CI-819.3 to -59.9), etc., are found to significantly impact ED LOS in a state. This study provides a better understanding of the impact of CON law on ED care, which extends the previous literature that has mainly focused on CON effects on inpatient care. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. A computationally simplistic poly-phasic approach to explore microbial communities from the Yucatan aquifer as a potential sources of novel natural products.

    PubMed

    Marfil-Santana, Miguel David; O'Connor-Sánchez, Aileen; Ramírez-Prado, Jorge Humberto; De Los Santos-Briones, Cesar; López-Aguiar; Lluvia, Korynthia; Rojas-Herrera, Rafael; Lago-Lestón, Asunción; Prieto-Davó, Alejandra

    2016-11-01

    The need for new antibiotics has sparked a search for the microbes that might potentially produce them. Current sequencing technologies allow us to explore the biotechnological potential of microbial communities in diverse environments without the need for cultivation, benefitting natural product discovery in diverse ways. A relatively recent method to search for the possible production of novel compounds includes studying the diverse genes belonging to polyketide synthase pathways (PKS), as these complex enzymes are an important source of novel therapeutics. In order to explore the biotechnological potential of the microbial community from the largest underground aquifer in the world located in the Yucatan, we used a polyphasic approach in which a simple, non-computationally intensive method was coupled with direct amplification of environmental DNA to assess the diversity and novelty of PKS type I ketosynthase (KS) domains. Our results suggest that the bioinformatic method proposed can indeed be used to assess the novelty of KS enzymes; nevertheless, this in silico study did not identify some of the KS diversity due to primer bias and stringency criteria outlined by the metagenomics pipeline. Therefore, additionally implementing a method involving the direct cloning of KS domains enhanced our results. Compared to other freshwater environments, the aquifer was characterized by considerably less diversity in relation to known ketosynthase domains; however, the metagenome included a family of KS type I domains phylogenetically related, but not identical, to those found in the curamycin pathway, as well as an outstanding number of thiolases. Over all, this first look into the microbial community found in this large Yucatan aquifer and other fresh water free living microbial communities highlights the potential of these previously overlooked environments as a source of novel natural products.

  17. Optimized Probe Masking for Comparative Transcriptomics of Closely Related Species

    PubMed Central

    Poeschl, Yvonne; Delker, Carolin; Trenner, Jana; Ullrich, Kristian Karsten; Quint, Marcel; Grosse, Ivo

    2013-01-01

    Microarrays are commonly applied to study the transcriptome of specific species. However, many available microarrays are restricted to model organisms, and the design of custom microarrays for other species is often not feasible. Hence, transcriptomics approaches of non-model organisms as well as comparative transcriptomics studies among two or more species often make use of cost-intensive RNAseq studies or, alternatively, by hybridizing transcripts of a query species to a microarray of a closely related species. When analyzing these cross-species microarray expression data, differences in the transcriptome of the query species can cause problems, such as the following: (i) lower hybridization accuracy of probes due to mismatches or deletions, (ii) probes binding multiple transcripts of different genes, and (iii) probes binding transcripts of non-orthologous genes. So far, methods for (i) exist, but these neglect (ii) and (iii). Here, we propose an approach for comparative transcriptomics addressing problems (i) to (iii), which retains only transcript-specific probes binding transcripts of orthologous genes. We apply this approach to an Arabidopsis lyrata expression data set measured on a microarray designed for Arabidopsis thaliana, and compare it to two alternative approaches, a sequence-based approach and a genomic DNA hybridization-based approach. We investigate the number of retained probe sets, and we validate the resulting expression responses by qRT-PCR. We find that the proposed approach combines the benefit of sequence-based stringency and accuracy while allowing the expression analysis of much more genes than the alternative sequence-based approach. As an added benefit, the proposed approach requires probes to detect transcripts of orthologous genes only, which provides a superior base for biological interpretation of the measured expression responses. PMID:24260119

  18. Estimating the supply and demand for deep geologic CO2 storage capacity over the course of the 21st Century: A meta-analysis of the literature

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dooley, James J.

    2013-08-05

    Whether there is sufficient geologic CO2 storage capacity to allow CCS to play a significant role in mitigating climate change has been the subject of debate since the 1990s. This paper presents a meta- analysis of a large body of recently published literature to derive updated estimates of the global deep geologic storage resource as well as the potential demand for this geologic CO2 storage resource over the course of this century. This analysis reveals that, for greenhouse gas emissions mitigation scenarios that have end-of-century atmospheric CO2 concentrations of between 350 ppmv and 725 ppmv, the average demand for deepmore » geologic CO2 storage over the course of this century is between 410 GtCO2 and 1,670 GtCO2. The literature summarized here suggests that -- depending on the stringency of criteria applied to calculate storage capacity – global geologic CO2 storage capacity could be: 35,300 GtCO2 of “theoretical” capacity; 13,500 GtCO2 of “effective” capacity; 3,900 GtCO2, of “practical” capacity; and 290 GtCO2 of “matched” capacity for the few regions where this narrow definition of capacity has been calculated. The cumulative demand for geologic CO2 storage is likely quite small compared to global estimates of the deep geologic CO2 storage capacity, and therefore, a “lack” of deep geologic CO2 storage capacity is unlikely to be an impediment for the commercial adoption of CCS technologies in this century.« less

  19. Diagnostic Accuracy of the Veteran Affairs' Traumatic Brain Injury Screen.

    PubMed

    Louise Bender Pape, Theresa; Smith, Bridget; Babcock-Parziale, Judith; Evans, Charlesnika T; Herrold, Amy A; Phipps Maieritsch, Kelly; High, Walter M

    2018-01-31

    To comprehensively estimate the diagnostic accuracy and reliability of the Department of Veterans Affairs (VA) Traumatic Brain Injury (TBI) Clinical Reminder Screen (TCRS). Cross-sectional, prospective, observational study using the Standards for Reporting of Diagnostic Accuracy criteria. Three VA Polytrauma Network Sites. Operation Iraqi Freedom, Operation Enduring Freedom veterans (N=433). TCRS, Comprehensive TBI Evaluation, Structured TBI Diagnostic Interview, Symptom Attribution and Classification Algorithm, and Clinician-Administered Posttraumatic Stress Disorder (PTSD) Scale. Forty-five percent of veterans screened positive on the TCRS for TBI. For detecting occurrence of historical TBI, the TCRS had a sensitivity of .56 to .74, a specificity of .63 to .93, a positive predictive value (PPV) of 25% to 45%, a negative predictive value (NPV) of 91% to 94%, and a diagnostic odds ratio (DOR) of 4 to 13. For accuracy of attributing active symptoms to the TBI, the TCRS had a sensitivity of .64 to .87, a specificity of .59 to .89, a PPV of 26% to 32%, an NPV of 92% to 95%, and a DOR of 6 to 9. The sensitivity was higher for veterans with PTSD (.80-.86) relative to veterans without PTSD (.57-.82). The specificity, however, was higher among veterans without PTSD (.75-.81) relative to veterans with PTSD (.36-.49). All indices of diagnostic accuracy changed when participants with questionably valid (QV) test profiles were eliminated from analyses. The utility of the TCRS to screen for mild TBI (mTBI) depends on the stringency of the diagnostic reference standard to which it is being compared, the presence/absence of PTSD, and QV test profiles. Further development, validation, and use of reproducible diagnostic algorithms for symptom attribution after possible mTBI would improve diagnostic accuracy. Published by Elsevier Inc.

  20. Evaluation of different methods used to assess disease activity in rheumatoid arthritis: analyses of abatacept clinical trial data

    PubMed Central

    Dougados, M; Schmidely, N; Le Bars, M; Lafosse, C; Schiff, M; Smolen, J S; Aletaha, D; van Riel, P; Wells, G

    2009-01-01

    Objectives: To evaluate different methods of reporting response to treatment or disease status for their ability to discriminate between active therapy and placebo, or to reflect structural progression or patient satisfaction with treatment using an exploratory analysis of the Abatacept in Inadequate Responders to Methotrexate (AIM) trial. Methods: 424 active (abatacept ∼10 mg/kg) and 214 placebo-treated patients with rheumatoid arthritis (RA) were evaluated. Methods of reporting included: (1) response (American College of Rheumatology (ACR) criteria) versus state (disease activity score in 28 joints (DAS28) criteria); (2) stringency (ACR20 vs 50 vs 70; moderate disease activity state (MDAS; DAS28 <5.1) vs low disease activity state (LDAS; DAS28 ⩽3.2) vs DAS28-defined remission (DAS28 <2.6)); (3) time to onset (time to first ACR50/LDAS) and (4) sustainability of ACR50/LDAS for consecutive visits. Methods were assessed according to: (1) discriminatory capacity (number of patients needed to study (NNS)); (2) structural progression (Genant-modified Sharp score) and (3) patient satisfaction with treatment. Positive likelihood ratios (LR) evaluated the ability of the above methods to reflect structural damage and patient satisfaction. Results: MDAS and ACR20 had the highest discriminatory capacity (NNS 49 and 69). Sustained LDAS best reflected no radiographic progression (positive LR ⩾2). More stringent criteria (at least ACR50/LDAS), faster onset (⩽3 months) and sustainability (>3 visits) of ACR50/LDAS best reflected patient satisfaction (positive LR >10). Conclusions: The optimal method for reporting a measure of disease activity may differ depending on the outcome of interest. Time to onset and sustainability can be important factors when evaluating treatment response and disease status in patients with RA. PMID:19074177

  1. A comparison of Thellier-type and multispecimen paleointensity determinations on Pleistocene and historical lava flows from Lanzarote (Canary Islands, Spain)

    NASA Astrophysics Data System (ADS)

    Calvo-Rathert, Manuel; Morales-Contreras, Juan; Carrancho, Ángel; Goguitchaichvili, Avto

    2016-09-01

    Sixteen Miocene, Pleistocene, and historic lava flows have been sampled in Lanzarote (Canary Islands) for paleointensity analysis with both the Coe and multispecimen methods. Besides obtaining new data, the main goal of the study was the comparison of paleointensity results determined with two different techniques. Characteristic Remanent Magnetization (ChRM) directions were obtained in 15 flows, and 12 were chosen for paleointensity determination. In Thellier-type experiments, a selection of reliable paleointensity determinations (43 of 78 studied samples) was performed using sets of criteria of different stringency, trying to relate the quality of results to the strictness of the chosen criteria. Uncorrected and fraction and domain-state corrected multispecimen paleointensity results were obtained in all flows. Results with the Coe method on historical flows either agree with the expected values or show moderately lower ones, but multispecimen determinations display a large deviation from the expected result in one case. No relation can be detected between correct or anomalous results and paleointensity determination quality or rock-magnetic properties. However, results on historical flows suggest that agreement between both methods could be a good indicator of correct determinations. Comparison of results obtained with both methods on seven Pleistocene flows yields an excellent agreement in four and disagreements in three cases. Pleistocene determinations were only accepted if either results from both methods agreed or a result was based on a sufficiently large number (n > 4) of individual Thellier-type determinations. In most Pleistocene flows, a VADM around 5 × 1022 Am2 was observed, although two flows displayed higher values around 9 × 1022 Am2.

  2. Genetic variability and molecular identification of Brazilian Biomphalaria species (Mollusca: Planorbidae).

    PubMed

    Carvalho, S; Caldeira, R L; Simpson, A J; Vidigal, T H

    2001-01-01

    Freshwater snails belonging to the genus Biomphalaria are intermediate hosts of the trematode Schistosoma mansoni in the Neotropical region and Africa. In Brazil, one subspecies and ten species of Biomphalaria have been identified: B. glabrata, B. tenagophila, B. straminea, B. occidentalis, B. peregrina, B. kuhniana, B. schrammi, B. amazonica, B. oligoza, B. intermedia and B.t. guaibensis. However, only the first three species are found naturally infected with S. mansoni. The classical identification of these planorbids is based on comparison of morphological characteristics of the shell and male and female reproductive organs, which is greatly complicated by the extensive intra-specific variation. Several molecular techniques have been used in studies on the identification, genetic structure as well as phylogenetic relationships between these groups of organisms. Using the randomly amplified polymorphic DNAs (RAPD) analysis we demonstrated that B. glabrata exhibits a remarkable degree of intra-specific polymorphism. Thus, the genetics of the snail host may be more important to the epidemiology of schistosomiasis than those of the parasite itself. Using the simple sequence repeat anchored polymerase chain reaction (SSR-PCR) in intra-populational and intra-specific studies we have demonstrated that snails belonging to the B. straminea complex (B. straminea, B. kuhniana and B. intermedia) clearly presented higher heterogeneity. Using the low stringency polymerase chain reaction (LS-PCR) technique we were able to separate B. glabrata from B. tenagophila and B. tenagophila from B. occidentalis. To separate all Brazilian Biomphalaria species we used the restriction fragment length polymorphism (PCR-RFLP) of the internal transcribed spacer region (ITS) of the DNA gene. The method also proved to be efficient for the specific identification of DNA extracted from snail eggs. Recently we have sequenced the ITS2 region for phylogenetic studies of all Biomphalaria snails from Brazil.

  3. Analyzing key constraints to biogas production from crop residues and manure in the EU-A spatially explicit model.

    PubMed

    Einarsson, Rasmus; Persson, U Martin

    2017-01-01

    This paper presents a spatially explicit method for making regional estimates of the potential for biogas production from crop residues and manure, accounting for key technical, biochemical, environmental and economic constraints. Methods for making such estimates are important as biofuels from agricultural residues are receiving increasing policy support from the EU and major biogas producers, such as Germany and Italy, in response to concerns over unintended negative environmental and social impacts of conventional biofuels. This analysis comprises a spatially explicit estimate of crop residue and manure production for the EU at 250 m resolution, and a biogas production model accounting for local constraints such as the sustainable removal of residues, transportation of substrates, and the substrates' biochemical suitability for anaerobic digestion. In our base scenario, the EU biogas production potential from crop residues and manure is about 0.7 EJ/year, nearly double the current EU production of biogas from agricultural substrates, most of which does not come from residues or manure. An extensive sensitivity analysis of the model shows that the potential could easily be 50% higher or lower, depending on the stringency of economic, technical and biochemical constraints. We find that the potential is particularly sensitive to constraints on the substrate mixtures' carbon-to-nitrogen ratio and dry matter concentration. Hence, the potential to produce biogas from crop residues and manure in the EU depends to large extent on the possibility to overcome the challenges associated with these substrates, either by complementing them with suitable co-substrates (e.g. household waste and energy crops), or through further development of biogas technology (e.g. pretreatment of substrates and recirculation of effluent).

  4. Funding health and social services for older people – a qualitative study of care recipients in the last year of life

    PubMed Central

    Hanratty, Barbara; Lowson, Elizabeth; Holmes, Louise; Grande, Gunn; Addington-Hall, Julia; Payne, Sheila; Seymour, Jane

    2012-01-01

    Objectives This study explores the views of older adults who are receiving health and social care at the end of their lives, on how services should be funded, and describes their health-related expenditure. Design Qualitative interview study Setting North West England Participants 30 people aged 69–93 years, diagnosed with lung cancer, heart failure or stroke and judged by health professionals to be in their last year of life. Sixteen participants lived in disadvantaged areas. Main outcome measures Views of older adults on funding of services. Results Participants expressed a belief in an earned entitlement to services funded from taxation, based on a broad sense of being a good citizen. Irrespective of social background, older people felt that those who could afford to pay for social care, should do so. Sale of assets and use of children's inheritance to fund care was widely perceived as an injustice. The costs of living with illness are a burden, and families are filling many of the gaps left by welfare provision. People who had worked in low-wage occupations were most concerned to justify their current acceptance of services, and distance themselves from what they described as welfare ‘spongers’ or ‘layabouts.’ Conclusions There is a gap between the health and social care system that older adults expect and what may be provided by a reformed welfare state at a time of financial stringencies. The values that underpinned the views expressed – mutuality, care for the most needy, and the importance of working to contribute to society – are an important contribution to the debate on welfare funding. PMID:22537882

  5. Psychometric characterization of the obstetric communication assessment tool for medical education: a pilot study.

    PubMed

    Rodriguez, A Noel; DeWitt, Peter; Fisher, Jennifer; Broadfoot, Kirsten; Hurt, K Joseph

    2016-06-11

    To characterize the psychometric properties of a novel Obstetric Communication Assessment Tool (OCAT) in a pilot study of standardized difficult OB communication scenarios appropriate for undergraduate medical evaluation. We developed and piloted four challenging OB Standardized Patient (SP) scenarios in a sample of twenty-one third year OB/GYN clerkship students: Religious Beliefs (RB), Angry Father (AF), Maternal Smoking (MS), and Intimate Partner Violence (IPV). Five trained Standardized Patient Reviewers (SPRs) independently scored twenty-four randomized video-recorded encounters using the OCAT. Cronbach's alpha and Intraclass Correlation Coefficient-2 (ICC-2) were used to estimate internal consistency (IC) and inter-rater reliability (IRR), respectively. Systematic variation in reviewer scoring was assessed using the Stuart-Maxwell test. IC was acceptable to excellent with Cronbach's alpha values (and 95% Confidence Intervals [CI]): RB 0.91 (0.86, 0.95), AF 0.76 (0.62, 0.87), MS 0.91 (0.86, 0.95), and IPV 0.94 (0.91, 0.97). IRR was unacceptable to poor with ICC-2 values: RB 0.46 (0.40, 0.53), AF 0.48 (0.41, 0.54), MS 0.52 (0.45, 0.58), and IPV 0.67 (0.61, 0.72). Stuart-Maxwell analysis indicated systematic differences in reviewer stringency. Our initial characterization of the OCAT demonstrates important issues in communications assessment. We identify scoring inconsistencies due to differences in SPR rigor that require enhanced training to improve assessment reliability. We outline a rational process for initial communication tool validation that may be useful in undergraduate curriculum development, and acknowledge that rigorous validation of OCAT training and implementation is needed to create a valuable OB communication assessment tool.

  6. The efficacy of vaginal clindamycin for the treatment of abnormal genital tract flora in pregnancy.

    PubMed

    Lamont, Ronald F; Jones, Brian M; Mandal, Debashis; Hay, Philip E; Sheehan, Marie

    2003-01-01

    To assess the efficacy of 2% clindamycin vaginal cream (CVC) to treat bacterial vaginosis (BV) in pregnancy. A prospective, randomized, double-blind, placebo-controlled, tricenter study. Four hundred and four women with BV on Gram stain at their first antenatal clinic visit were randomized to receive a 3-day course of 2% CVC or placebo. The outcome was assessed using an intention to treat analysis at 3 weeks and 6 weeks post-treatment according to three different diagnostic methods based on five criteria (Gram stain and all four elements of clinical composite criteria: vaginal discharge, abnormal vaginal pH, clue cells, amine odor), three criteria (vaginal pH, clue cells, amine odor) or two criteria (clue cells and amine odor) to reflect stringency of diagnosis, historical precedence and government agency recommendations respectively. Using five diagnostic criteria, 18% of CVC patients were cured and 70.8% either cured and/or improved compared to 1.6% and 12% of placebo patients respectively (p < 0.0001). Using three diagnostic criteria, 44.8% of CVC patients were cured and 77.3% were either cured and/or improved compared to 9.3% and 28.8% of placebo patients respectively (p < 0.000 1). Using two diagnostic criteria, 75.0% of CVC patients were cured compared to 18.0% of placebo patients (p < 0.0001 ). Recurrence rates in those CVC patients successfully treated were approximately 6% at 6 weeks post baseline and 10% at 28 to 34 weeks gestation. A 3-day course of CVC appears to be well tolerated by the mother and statistically significantly more efficacious than placebo in the treatment of BV during the second trimester of pregnancy.

  7. NMR structure of the bovine prion protein

    PubMed Central

    López García, Francisco; Zahn, Ralph; Riek, Roland; Wüthrich, Kurt

    2000-01-01

    The NMR structures of the recombinant 217-residue polypeptide chain of the mature bovine prion protein, bPrP(23–230), and a C-terminal fragment, bPrP(121–230), include a globular domain extending from residue 125 to residue 227, a short flexible chain end of residues 228–230, and an N-terminal flexibly disordered “tail” comprising 108 residues for the intact protein and 4 residues for bPrP(121–230), respectively. The globular domain contains three α-helices comprising the residues 144–154, 173–194, and 200–226, and a short antiparallel β-sheet comprising the residues 128–131 and 161–164. The best-defined parts of the globular domain are the central portions of the helices 2 and 3, which are linked by the only disulfide bond in bPrP. Significantly increased disorder and mobility is observed for helix 1, the loop 166–172 leading from the β-strand 2 to helix 2, the end of helix 2 and the following loop, and the last turn of helix 3. Although there are characteristic local differences relative to the conformations of the murine and Syrian hamster prion proteins, the bPrP structure is essentially identical to that of the human prion protein. On the other hand, there are differences between bovine and human PrP in the surface distribution of electrostatic charges, which then appears to be the principal structural feature of the “healthy” PrP form that might affect the stringency of the species barrier for transmission of prion diseases between humans and cattle. PMID:10899999

  8. A randomized and blinded comparison of qPCR and NGS-based detection of aneuploidy in a cell line mixture model of blastocyst biopsy mosaicism.

    PubMed

    Goodrich, David; Tao, Xin; Bohrer, Chelsea; Lonczak, Agnieszka; Xing, Tongji; Zimmerman, Rebekah; Zhan, Yiping; Scott, Richard T; Treff, Nathan R

    2016-11-01

    A subset of preimplantation stage embryos may possess mosaicism of chromosomal constitution, representing a possible limitation to the clinical predictive value of comprehensive chromosome screening (CCS) from a single biopsy. However, contemporary methods of CCS may be capable of predicting mosaicism in the blastocyst by detecting intermediate levels of aneuploidy within a trophectoderm biopsy. This study evaluates the sensitivity and specificity of aneuploidy detection by two CCS platforms using a cell line mixture model of a mosaic trophectoderm biopsy. Four cell lines with known karyotypes were obtained and mixed together at specific ratios of six total cells (0:6, 1:5, 2:4, 3:3, 4:2, 5:1, and 6:0). A female euploid and a male trisomy 18 cell line were used for one set, and a male trisomy 13 and a male trisomy 15 cell line were used for another. Replicates of each mixture were prepared, randomized, and blinded for analysis by one of two CCS platforms (quantitative polymerase chain reaction (qPCR) or VeriSeq next-generation sequencing (NGS)). Sensitivity and specificity of aneuploidy detection at each level of mosaicism was determined and compared between platforms. With the default settings for each platform, the sensitivity of qPCR and NGS were not statistically different, and 100 % specificity was observed (no false positives) at all levels of mosaicism. However, the use of previously published custom criteria for NGS increased sensitivity but also significantly decreased specificity (33 % false-positive prediction of aneuploidy). By demonstrating increased false-positive diagnoses when reducing the stringency of predicting an abnormality, these data illustrate the importance of preclinical evaluation of new testing paradigms before clinical implementation.

  9. Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform

    PubMed Central

    Van Nostrand, Joy D.; Ning, Daliang; Sun, Bo; Xue, Kai; Liu, Feifei; Deng, Ye; Liang, Yuting; Zhou, Jizhong

    2017-01-01

    Illumina’s MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered, the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1–3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility. PMID:28453559

  10. Cloning and characterization of the Drosophila homolog of the xeroderma pigmentosum complementation-group B correcting gene, ERCC3.

    PubMed Central

    Koken, M H; Vreeken, C; Bol, S A; Cheng, N C; Jaspers-Dekker, I; Hoeijmakers, J H; Eeken, J C; Weeda, G; Pastink, A

    1992-01-01

    Previously the human nucleotide excision repair gene ERCC3 was shown to be responsible for a rare combination of the autosomal recessive DNA repair disorders xeroderma pigmentosum (complementation group B) and Cockayne's syndrome (complementation group C). The human and mouse ERCC3 proteins contain several sequence motifs suggesting that it is a nucleic acid or chromatin binding helicase. To study the significance of these domains and the overall evolutionary conservation of the gene, the homolog from Drosophila melanogaster was isolated by low stringency hybridizations using two flanking probes of the human ERCC3 cDNA. The flanking probe strategy selects for long stretches of nucleotide sequence homology, and avoids isolation of small regions with fortuitous homology. In situ hybridization localized the gene onto chromosome III 67E3/4, a region devoid of known D.melanogaster mutagen sensitive mutants. Northern blot analysis showed that the gene is continuously expressed in all stages of fly development. A slight increase (2-3 times) of ERCC3Dm transcript was observed in the later stages. Two almost full length cDNAs were isolated, which have different 5' untranslated regions (UTR). The SD4 cDNA harbours only one long open reading frame (ORF) coding for ERCC3Dm. Another clone (SD2), however, has the potential to encode two proteins: a 170 amino acids polypeptide starting at the optimal first ATG has no detectable homology with any other proteins currently in the data bases, and another ORF beginning at the suboptimal second startcodon which is identical to that of SD4. Comparison of the encoded ERCC3Dm protein with the homologous proteins of mouse and man shows a strong amino acid conservation (71% identity), especially in the postulated DNA binding region and seven 'helicase' domains. The ERCC3Dm sequence is fully consistent with the presumed functions and the high conservation of these regions strengthens their functional significance. Microinjection and DNA transfection of ERCC3Dm into human xeroderma pigmentosum (c.g. B) fibroblasts and group 3 rodent mutants did not yield detectable correction. One of the possibilities to explain these negative findings is that the D.melanogaster protein may be unable to function in a mammalian repair context. Images PMID:1454518

  11. Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wen, Chongqing; Wu, Liyou; Qin, Yujia

    Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered,more » the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.« less

  12. Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform

    DOE PAGES

    Wen, Chongqing; Wu, Liyou; Qin, Yujia; ...

    2017-04-28

    Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered,more » the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.« less

  13. Insertion and deletion polymorphisms of the ancient AluS family in the human genome.

    PubMed

    Kryatova, Maria S; Steranka, Jared P; Burns, Kathleen H; Payer, Lindsay M

    2017-01-01

    Polymorphic Alu elements account for 17% of structural variants in the human genome. The majority of these belong to the youngest AluY subfamilies, and most structural variant discovery efforts have focused on identifying Alu polymorphisms from these currently retrotranspositionally active subfamilies. In this report we analyze polymorphisms from the evolutionarily older AluS subfamily, whose peak activity was tens of millions of years ago. We annotate the AluS polymorphisms, assess their likely mechanism of origin, and evaluate their contribution to structural variation in the human genome. Of 52 previously reported polymorphic AluS elements ascertained for this study, 48 were confirmed to belong to the AluS subfamily using high stringency subfamily classification criteria. Of these, the majority (77%, 37/48) appear to be deletion polymorphisms. Two polymorphic AluS elements (4%) have features of non-classical Alu insertions and one polymorphic AluS element (2%) likely inserted by a mechanism involving internal priming. Seven AluS polymorphisms (15%) appear to have arisen by the classical target-primed reverse transcription (TPRT) retrotransposition mechanism. These seven TPRT products are 3' intact with 3' poly-A tails, and are flanked by target site duplications; L1 ORF2p endonuclease cleavage sites were also observed, providing additional evidence that these are L1 ORF2p endonuclease-mediated TPRT insertions. Further sequence analysis showed strong conservation of both the RNA polymerase III promoter and SRP9/14 binding sites, important for mediating transcription and interaction with retrotransposition machinery, respectively. This conservation of functional features implies that some of these are fairly recent insertions since they have not diverged significantly from their respective retrotranspositionally competent source elements. Of the polymorphic AluS elements evaluated in this report, 15% (7/48) have features consistent with TPRT-mediated insertion, thus suggesting that some AluS elements have been more active recently than previously thought, or that fixation of AluS insertion alleles remains incomplete. These data expand the potential significance of polymorphic AluS elements in contributing to structural variation in the human genome. Future discovery efforts focusing on polymorphic AluS elements are likely to identify more such polymorphisms, and approaches tailored to identify deletion alleles may be warranted.

  14. Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform.

    PubMed

    Wen, Chongqing; Wu, Liyou; Qin, Yujia; Van Nostrand, Joy D; Ning, Daliang; Sun, Bo; Xue, Kai; Liu, Feifei; Deng, Ye; Liang, Yuting; Zhou, Jizhong

    2017-01-01

    Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered, the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.

  15. The impact of state energy programs and other contextual factors on U.S. buildings energy consumption

    NASA Astrophysics Data System (ADS)

    Ofori-Boadu, Andrea N. Y. A.

    High energy consumption in the United States has been influenced by populations, climates, income and other contextual factors. In the past decades, U.S. energy policies have pursued energy efficiency as a national strategy for reducing U.S. environmental degradation and dependence on foreign oils. The quest for improved energy efficiency has led to the development of energy efficient technologies and programs. The implementation of energy programs in the complex U.S. socio-technical environment is believed to promote the diffusion of energy efficiency technologies. However, opponents doubt the fact that these programs have the capacity to significantly reduce U.S. energy consumption. In order to contribute to the ongoing discussion, this quantitative study investigated the relationships existing among electricity consumption/ intensity, energy programs and contextual factors in the U.S. buildings sector. Specifically, this study sought to identify the significant predictors of electricity consumption and intensity, as well as estimate the overall impact of selected energy programs on electricity consumption and intensity. Using state-level secondary data for 51 U.S. states from 2006 to 2009, seven random effects panel data regression models confirmed the existence of significant relationships among some energy programs, contextual factors, and electricity consumption/intensity. The most significant predictors of improved electricity efficiency included the price of electricity, public benefits funds program, building energy codes program, financial and informational incentives program and the Leadership in Energy and Environmental Design (LEED) program. Consistently, the Southern region of the U.S. was associated with high electricity consumption and intensity; while the U.S. commercial sector was the greater benefactor from energy programs. On the average, energy programs were responsible for approximately 7% of the variation observed in electricity consumption and intensity, over and above the variation associated with the contextual factors. This study also had implications in program implementation theory, and revealed that resource availability, stringency and adherence had significant impacts on program outcomes. Using seven classification tables, this study categorized and matched the predictors of electricity consumption and intensity with the specific energy sectors in which they demonstrated significance. Project developers, energy advocates, policy makers, program administrators, building occupants and other stakeholders could use study findings in conjunction with other empirical findings, to make informed decisions regarding the adoption, continuation or discontinuation of energy programs, while taking contextual factors into consideration. The adoption and efficient implementation of the most significant programs could reduce U.S. electricity consumption, and in the long term, probably reduce U.S. energy waste, environmental degradation, energy imports, energy prices, and demands for expanding energy generation and distribution infrastructure.

  16. 78 FR 27033 - Safety Zone; High Water Conditions; Illinois River

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-09

    ...-AA00 Safety Zone; High Water Conditions; Illinois River AGENCY: Coast Guard, DHS. ACTION: Temporary... current extreme high-water conditions. This safety zone is necessary to protect the general public, levee... dangerously high water conditions, the Coast Guard established a safety zone on the Illinois River from Mile...

  17. The Shared Socioeconomic Pathways and their energy, land use, and greenhouse gas emissions implications: An overview

    DOE PAGES

    Riahi, Keywan; van Vuuren, Detlef P.; Kriegler, Elmar; ...

    2017-09-09

    This study presents the overview of the Shared Socioeconomic Pathways (SSPs) and their energy, land use, and emissions implications. The SSPs are part of a new scenario framework, established by the climate change research community in order to facilitate the integrated analysis of future climate impacts, vulnerabilities, adaptation, and mitigation. The pathways were developed over the last years as a joint community effort and describe plausible major global developments that together would lead in the future to different challenges for mitigation and adaptation to climate change. The SSPs are based on five narratives describing alternative socio-economic developments, including sustainable development,more » regional rivalry, inequality, fossil-fueled development, and middle-of-the-road development. The long-term demographic and economic projections of the SSPs depict a wide uncertainty range consistent with the scenario literature. A multi-model approach was used for the elaboration of the energy, land-use and the emissions trajectories of SSP-based scenarios. The baseline scenarios lead to global energy consumption of 400–1200 EJ in 2100, and feature vastly different land-use dynamics, ranging from a possible reduction in cropland area up to a massive expansion by more than 700 million hectares by 2100. The associated annual CO 2 emissions of the baseline scenarios range from about 25 GtCO 2 to more than 120 GtCO 2 per year by 2100. With respect to mitigation, we find that associated costs strongly depend on three factors: (1) the policy assumptions, (2) the socio-economic narrative, and (3) the stringency of the target. The carbon price for reaching the target of 2.6 W/m 2 that is consistent with a temperature change limit of 2 °C, differs in our analysis thus by about a factor of three across the SSP marker scenarios. Moreover, many models could not reach this target from the SSPs with high mitigation challenges. While the SSPs were designed to represent different mitigation and adaptation challenges, the resulting narratives and quantifications span a wide range of different futures broadly representative of the current literature. This allows their subsequent use and development in new assessments and research projects. Critical next steps for the community scenario process will, among others, involve regional and sectoral extensions, further elaboration of the adaptation and impacts dimension, as well as employing the SSP scenarios with the new generation of earth system models as part of the 6th climate model intercomparison project (CMIP6).« less

  18. The Shared Socioeconomic Pathways and their energy, land use, and greenhouse gas emissions implications: An overview

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riahi, Keywan; van Vuuren, Detlef P.; Kriegler, Elmar

    This study presents the overview of the Shared Socioeconomic Pathways (SSPs) and their energy, land use, and emissions implications. The SSPs are part of a new scenario framework, established by the climate change research community in order to facilitate the integrated analysis of future climate impacts, vulnerabilities, adaptation, and mitigation. The pathways were developed over the last years as a joint community effort and describe plausible major global developments that together would lead in the future to different challenges for mitigation and adaptation to climate change. The SSPs are based on five narratives describing alternative socio-economic developments, including sustainable development,more » regional rivalry, inequality, fossil-fueled development, and middle-of-the-road development. The long-term demographic and economic projections of the SSPs depict a wide uncertainty range consistent with the scenario literature. A multi-model approach was used for the elaboration of the energy, land-use and the emissions trajectories of SSP-based scenarios. The baseline scenarios lead to global energy consumption of 400–1200 EJ in 2100, and feature vastly different land-use dynamics, ranging from a possible reduction in cropland area up to a massive expansion by more than 700 million hectares by 2100. The associated annual CO 2 emissions of the baseline scenarios range from about 25 GtCO 2 to more than 120 GtCO 2 per year by 2100. With respect to mitigation, we find that associated costs strongly depend on three factors: (1) the policy assumptions, (2) the socio-economic narrative, and (3) the stringency of the target. The carbon price for reaching the target of 2.6 W/m 2 that is consistent with a temperature change limit of 2 °C, differs in our analysis thus by about a factor of three across the SSP marker scenarios. Moreover, many models could not reach this target from the SSPs with high mitigation challenges. While the SSPs were designed to represent different mitigation and adaptation challenges, the resulting narratives and quantifications span a wide range of different futures broadly representative of the current literature. This allows their subsequent use and development in new assessments and research projects. Critical next steps for the community scenario process will, among others, involve regional and sectoral extensions, further elaboration of the adaptation and impacts dimension, as well as employing the SSP scenarios with the new generation of earth system models as part of the 6th climate model intercomparison project (CMIP6).« less

  19. Global and regional health effects of future food production under climate change: a modelling study.

    PubMed

    Springmann, Marco; Mason-D'Croz, Daniel; Robinson, Sherman; Garnett, Tara; Godfray, H Charles J; Gollin, Douglas; Rayner, Mike; Ballon, Paola; Scarborough, Peter

    2016-05-07

    One of the most important consequences of climate change could be its effects on agriculture. Although much research has focused on questions of food security, less has been devoted to assessing the wider health impacts of future changes in agricultural production. In this modelling study, we estimate excess mortality attributable to agriculturally mediated changes in dietary and weight-related risk factors by cause of death for 155 world regions in the year 2050. For this modelling study, we linked a detailed agricultural modelling framework, the International Model for Policy Analysis of Agricultural Commodities and Trade (IMPACT), to a comparative risk assessment of changes in fruit and vegetable consumption, red meat consumption, and bodyweight for deaths from coronary heart disease, stroke, cancer, and an aggregate of other causes. We calculated the change in the number of deaths attributable to climate-related changes in weight and diets for the combination of four emissions pathways (a high emissions pathway, two medium emissions pathways, and a low emissions pathway) and three socioeconomic pathways (sustainable development, middle of the road, and more fragmented development), which each included six scenarios with variable climatic inputs. The model projects that by 2050, climate change will lead to per-person reductions of 3·2% (SD 0·4%) in global food availability, 4·0% (0·7%) in fruit and vegetable consumption, and 0·7% (0·1%) in red meat consumption. These changes will be associated with 529,000 climate-related deaths worldwide (95% CI 314,000-736,000), representing a 28% (95% CI 26-33) reduction in the number of deaths that would be avoided because of changes in dietary and weight-related risk factors between 2010 and 2050. Twice as many climate-related deaths were associated with reductions in fruit and vegetable consumption than with climate-related increases in the prevalence of underweight, and most climate-related deaths were projected to occur in south and east Asia. Adoption of climate-stabilisation pathways would reduce the number of climate-related deaths by 29-71%, depending on their stringency. The health effects of climate change from changes in dietary and weight-related risk factors could be substantial, and exceed other climate-related health impacts that have been estimated. Climate change mitigation could prevent many climate-related deaths. Strengthening of public health programmes aimed at preventing and treating diet and weight-related risk factors could be a suitable climate change adaptation strategy. Oxford Martin Programme on the Future of Food. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. How prepared are college freshmen athletes for the rigors of college strength and conditioning? A survey of college strength and conditioning coaches.

    PubMed

    Wade, Susan M; Pope, Zachary C; Simonson, Shawn R

    2014-10-01

    Training programs for high school athletes have changed over the last 20 years. High school physical education classes have transformed into sport-specific conditioning classes with intensities matching college or professional athlete programming. In addition, involvement in private, sport-specific, training increased; but despite these advanced training methods, are high school athletes prepared for collegiate sport competition? An anonymous survey was sent to 195 Division I strength and conditioning coaches (SCC) to discern incoming college freshman athletes' physical and psychological preparedness for the rigors of collegiate training and sport competition. Fifty-seven (29%) responses were received. Strength and conditioning coaches stated that incoming college freshman athletes lack lower extremity strength, overall flexibility, and core strength as well as proper Olympic lifting technique. Strength and conditioning coaches also stated that athletes lacked the mental toughness to endure collegiate sport training in addition to claiming incoming athletes lacked knowledge of correct nutrition and recovery principles. These results suggest a lack of collegiate training/sport preparedness of high school athletes. High school strength and conditioning specialist's goal is to produce better athletes and doing so requires the strength and conditioning coach/trainer to have knowledge of how to train high school athletes. One way to assure adequate knowledge of strength and conditioning training principles is for high school coaches/trainers to be certified in the field. Strength and conditioning certifications among high school strength and conditioning coaches/trainers would encourage developmentally appropriate training and would provide universities with athletes who are prepared for the rigors of collegiate sport training/competition.

  1. Rigid shells enhance survival of gekkotan eggs.

    PubMed

    Andrews, Robin M

    2015-11-01

    The majority of lizards and snakes produce permeable parchment-shelled eggs that require high moisture conditions for successful embryonic development. One clade of gekkotan lizards is an exception; females produce relatively impermeable rigid-shelled eggs that normally incubate successfully under low moisture conditions. I tested the hypothesis that the rigid-shell increases egg survival during incubation, but only under low moisture conditions. To test this hypothesis, I incubated rigid-shelled eggs of Chondrodactylus turneri under low and under high moisture conditions. Eggs were incubated with parchment-shelled eggs of Eublepharis macularius to insure that incubation conditions were suitable for parchment-shelled eggs. Chondrodactylus turneri eggs had very high survival (>90%) when they were incubated under low moisture conditions. In contrast, eggs incubated under high moisture conditions had low survival overall, and lower survival than those of the parchment-shelled eggs of E. macularius. Mortality of C. turneri and E. macularius eggs incubated under high moisture conditions was the result of fungal infection, a common source of egg mortality for squamates under laboratory and field conditions. These observations document high survival of rigid-shelled eggs under low moisture conditions because eggs escape from fungal infection. Highly mineralized rigid shells also make egg survival independent of moisture availability and may also provide protection from small invertebrates in nature. Enhanced egg survival could thus compensate for the low reproductive output of gekkotans that produce rigid-shelled eggs. © 2015 Wiley Periodicals, Inc.

  2. 40 CFR 31.12 - Special grant or subgrant conditions for “high-risk” grantees.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... for âhigh-riskâ grantees. 31.12 Section 31.12 Protection of Environment ENVIRONMENTAL PROTECTION... for “high-risk” grantees. (a) A grantee or subgrantee may be considered “high risk” if an awarding..., special conditions and/or restrictions shall correspond to the high risk condition and shall be included...

  3. Autoantibodies as Biomarkers for the Prediction of Neuropsychiatric Events in Systemic Lupus Erythematosus

    PubMed Central

    Hanly, J G; Urowitz, M B; Su, L; Bae, S-C; Gordon, C; Sanchez-Guerrero, J; Clarke, A; Bernatsky, S; Vasudevan, A; Isenberg, D; Rahman, A; Wallace, D J; Fortin, P R; Gladman, D; Dooley, M A; Bruce, I; Steinsson, K; Khamashta, M; Manzi, S; Ramsey-Goldman, R; Sturfelt, G; Nived, O; van Vollenhoven, R; Ramos-Casals, M; Aranow, C; Mackay, M; Kalunian, K; Alarcón, G S; Fessler, B J; Ruiz-Irastorza, G; Petri, M; Lim, S; Kamen, D; Peschken, C; Farewell, V; Thompson, K; Theriault, C; Merrill, J T

    2015-01-01

    Objective Neuropsychiatric (NP) events occur unpredictably in systemic lupus erythematosus (SLE) and most biomarker associations remain to be prospectively validated. We examined a disease inception cohort of 1047 SLE patients to determine which autoantibodies at enrollment predicted subsequent NP events. Methods Patients with recent SLE diagnosis were assessed prospectively for up to 10 years for NP events using ACR case definitions. Decision rules of graded stringency determined whether NP events were attributable to SLE. Associations between the first NP event and baseline autoantibodies (lupus anticoagulant, anticardiolipin, anti-β2 glycoprotein-I, anti-ribosomal P and anti-NR2 glutamate receptor) were tested by Cox proportional hazards regression. Results Disease duration at enrollment was 5.4±4.2 months, followup was 3.6±2.6 years. Patients were 89.1% female with mean (±SD) age 35.2±13.7 years. 495/1047 (47.3%) developed ≥1 NP event (total 917 events). NP events attributed to SLE were 15.4% (model A) and 28.2% (model B). At enrollment 21.9% of patients had lupus anticoagulant, 13.4% anticardiolipin, 15.1% anti-β2 glycoprotein-I, 9.2% anti-ribosomal P and 13.7% anti-NR2 antibodies. Lupus anticoagulant at baseline was associated with subsequent intracranial thrombosis (total n=22) attributed to SLE (model B) (Hazard ratio, HR 2.54 (95% CI: 1.08–5.94). Anti-ribosomal P antibody was associated with subsequent psychosis (total n=14) attributed to SLE (model B) (HR: 3.92 (95% CI:1.23–12.5); p=0.02). Other autoantibodies did not predict NP events. Conclusion In a prospective study of 1047 recently diagnosed SLE patients, lupus anticoagulant and anti-ribosomal P antibodies are associated with an increased future risk for intracranial thrombosis and lupus psychosis respectively PMID:21893582

  4. Ratcheting ambition to limit warming to 1.5 °C–trade-offs between emission reductions and carbon dioxide removal

    NASA Astrophysics Data System (ADS)

    Holz, Christian; Siegel, Lori S.; Johnston, Eleanor; Jones, Andrew P.; Sterman, John

    2018-06-01

    Mitigation scenarios to limit global warming to 1.5 °C or less in 2100 often rely on large amounts of carbon dioxide removal (CDR), which carry significant potential social, environmental, political and economic risks. A precautionary approach to scenario creation is therefore indicated. This letter presents the results of such a precautionary modelling exercise in which the models C-ROADS and En-ROADS were used to generate a series of 1.5 °C mitigation scenarios that apply increasingly stringent constraints on the scale and type of CDR available. This allows us to explore the trade-offs between near-term stringency of emission reductions and assumptions about future availability of CDR. In particular, we find that regardless of CDR assumptions, near-term ambition increase (‘ratcheting’) is required for any 1.5 °C pathway, making this letter timely for the facilitative, or Talanoa, dialogue to be conducted by the UNFCCC in 2018. By highlighting the difference between net and gross reduction rates, often obscured in scenarios, we find that mid-term gross CO2 emission reduction rates in scenarios with CDR constraints increase to levels without historical precedence. This in turn highlights, in addition to the need to substantially increase CO2 reduction rates, the need to improve emission reductions for non-CO2 greenhouse gases. Further, scenarios in which all or part of the CDR is implemented as non-permanent storage exhibit storage loss emissions, which partly offset CDR, highlighting the importance of differentiating between net and gross CDR in scenarios. We find in some scenarios storage loss trending to similar values as gross CDR, indicating that gross CDR would have to be maintained simply to offset the storage losses of CO2 sequestered earlier, without any additional net climate benefit.

  5. Modelling the pre-assessment learning effects of assessment: evidence in the validity chain

    PubMed Central

    Cilliers, Francois J; Schuwirth, Lambert W T; van der Vleuten, Cees P M

    2012-01-01

    OBJECTIVES We previously developed a model of the pre-assessment learning effects of consequential assessment and started to validate it. The model comprises assessment factors, mechanism factors and learning effects. The purpose of this study was to continue the validation process. For stringency, we focused on a subset of assessment factor–learning effect associations that featured least commonly in a baseline qualitative study. Our aims were to determine whether these uncommon associations were operational in a broader but similar population to that in which the model was initially derived. METHODS A cross-sectional survey of 361 senior medical students at one medical school was undertaken using a purpose-made questionnaire based on a grounded theory and comprising pairs of written situational tests. In each pair, the manifestation of an assessment factor was varied. The frequencies at which learning effects were selected were compared for each item pair, using an adjusted alpha to assign significance. The frequencies at which mechanism factors were selected were calculated. RESULTS There were significant differences in the learning effect selected between the two scenarios of an item pair for 13 of this subset of 21 uncommon associations, even when a p-value of < 0.00625 was considered to indicate significance. Three mechanism factors were operational in most scenarios: agency; response efficacy, and response value. CONCLUSIONS For a subset of uncommon associations in the model, the role of most assessment factor–learning effect associations and the mechanism factors involved were supported in a broader but similar population to that in which the model was derived. Although model validation is an ongoing process, these results move the model one step closer to the stage of usefully informing interventions. Results illustrate how factors not typically included in studies of the learning effects of assessment could confound the results of interventions aimed at using assessment to influence learning. Discuss ideas arising from this article at ‘http://www.mededuc.com discuss’ PMID:23078685

  6. Modelling the pre-assessment learning effects of assessment: evidence in the validity chain.

    PubMed

    Cilliers, Francois J; Schuwirth, Lambert W T; van der Vleuten, Cees P M

    2012-11-01

    We previously developed a model of the pre-assessment learning effects of consequential assessment and started to validate it. The model comprises assessment factors, mechanism factors and learning effects. The purpose of this study was to continue the validation process. For stringency, we focused on a subset of assessment factor-learning effect associations that featured least commonly in a baseline qualitative study. Our aims were to determine whether these uncommon associations were operational in a broader but similar population to that in which the model was initially derived. A cross-sectional survey of 361 senior medical students at one medical school was undertaken using a purpose-made questionnaire based on a grounded theory and comprising pairs of written situational tests. In each pair, the manifestation of an assessment factor was varied. The frequencies at which learning effects were selected were compared for each item pair, using an adjusted alpha to assign significance. The frequencies at which mechanism factors were selected were calculated. There were significant differences in the learning effect selected between the two scenarios of an item pair for 13 of this subset of 21 uncommon associations, even when a p-value of < 0.00625 was considered to indicate significance. Three mechanism factors were operational in most scenarios: agency; response efficacy, and response value. For a subset of uncommon associations in the model, the role of most assessment factor-learning effect associations and the mechanism factors involved were supported in a broader but similar population to that in which the model was derived. Although model validation is an ongoing process, these results move the model one step closer to the stage of usefully informing interventions. Results illustrate how factors not typically included in studies of the learning effects of assessment could confound the results of interventions aimed at using assessment to influence learning. © Blackwell Publishing Ltd 2012.

  7. MRMaid, the web-based tool for designing multiple reaction monitoring (MRM) transitions.

    PubMed

    Mead, Jennifer A; Bianco, Luca; Ottone, Vanessa; Barton, Chris; Kay, Richard G; Lilley, Kathryn S; Bond, Nicholas J; Bessant, Conrad

    2009-04-01

    Multiple reaction monitoring (MRM) of peptides uses tandem mass spectrometry to quantify selected proteins of interest, such as those previously identified in differential studies. Using this technique, the specificity of precursor to product transitions is harnessed for quantitative analysis of multiple proteins in a single sample. The design of transitions is critical for the success of MRM experiments, but predicting signal intensity of peptides and fragmentation patterns ab initio is challenging given existing methods. The tool presented here, MRMaid (pronounced "mermaid") offers a novel alternative for rapid design of MRM transitions for the proteomics researcher. The program uses a combination of knowledge of the properties of optimal MRM transitions taken from expert practitioners and literature with MS/MS evidence derived from interrogation of a database of peptide identifications and their associated mass spectra. The tool also predicts retention time using a published model, allowing ordering of transition candidates. By exploiting available knowledge and resources to generate the most reliable transitions, this approach negates the need for theoretical prediction of fragmentation and the need to undertake prior "discovery" MS studies. MRMaid is a modular tool built around the Genome Annotating Proteomic Pipeline framework, providing a web-based solution with both descriptive and graphical visualizations of transitions. Predicted transition candidates are ranked based on a novel transition scoring system, and users may filter the results by selecting optional stringency criteria, such as omitting frequently modified residues, constraining the length of peptides, or omitting missed cleavages. Comparison with published transitions showed that MRMaid successfully predicted the peptide and product ion pairs in the majority of cases with appropriate retention time estimates. As the data content of the Genome Annotating Proteomic Pipeline repository increases, the coverage and reliability of MRMaid are set to increase further. MRMaid is freely available over the internet as an executable web-based service at www.mrmaid.info.

  8. Gene Trapping Using Gal4 in Zebrafish

    PubMed Central

    Balciuniene, Jorune; Balciunas, Darius

    2013-01-01

    Large clutch size and external development of optically transparent embryos make zebrafish an exceptional vertebrate model system for in vivo insertional mutagenesis using fluorescent reporters to tag expression of mutated genes. Several laboratories have constructed and tested enhancer- and gene-trap vectors in zebrafish, using fluorescent proteins, Gal4- and lexA- based transcriptional activators as reporters 1-7. These vectors had two potential drawbacks: suboptimal stringency (e.g. lack of ability to differentiate between enhancer- and gene-trap events) and low mutagenicity (e.g. integrations into genes rarely produced null alleles). Gene Breaking Transposon (GBTs) were developed to address these drawbacks 8-10. We have modified one of the first GBT vectors, GBT-R15, for use with Gal4-VP16 as the primary gene trap reporter and added UAS:eGFP as the secondary reporter for direct detection of gene trap events. Application of Gal4-VP16 as the primary gene trap reporter provides two main advantages. First, it increases sensitivity for genes expressed at low expression levels. Second, it enables researchers to use gene trap lines as Gal4 drivers to direct expression of other transgenes in very specific tissues. This is especially pertinent for genes with non-essential or redundant functions, where gene trap integration may not result in overt phenotypes. The disadvantage of using Gal4-VP16 as the primary gene trap reporter is that genes coding for proteins with N-terminal signal sequences are not amenable to trapping, as the resulting Gal4-VP16 fusion proteins are unlikely to be able to enter the nucleus and activate transcription. Importantly, the use of Gal4-VP16 does not pre-select for nuclear proteins: we recovered gene trap mutations in genes encoding proteins which function in the nucleus, the cytoplasm and the plasma membrane. PMID:24121167

  9. Tracking 20 Years of Compound-to-Target Output from Literature and Patents

    PubMed Central

    Southan, Christopher; Varkonyi, Peter; Boppana, Kiran; Jagarlapudi, Sarma A.R.P.; Muresan, Sorel

    2013-01-01

    The statistics of drug development output and declining yield of approved medicines has been the subject of many recent reviews. However, assessing research productivity that feeds development is more difficult. Here we utilise an extensive database of structure-activity relationships extracted from papers and patents. We have used this database to analyse published compounds cumulatively linked to nearly 4000 protein target identifiers from multiple species over the last 20 years. The compound output increases up to 2005 followed by a decline that parallels a fall in pharmaceutical patenting. Counts of protein targets have plateaued but not fallen. We extended these results by exploring compounds and targets for one large pharmaceutical company. In addition, we examined collective time course data for six individual protease targets, including average molecular weight of the compounds. We also tracked the PubMed profile of these targets to detect signals related to changes in compound output. Our results show that research compound output had decreased 35% by 2012. The major causative factor is likely to be a contraction in the global research base due to mergers and acquisitions across the pharmaceutical industry. However, this does not rule out an increasing stringency of compound quality filtration and/or patenting cost control. The number of proteins mapped to compounds on a yearly basis shows less decline, indicating the cumulative published target capacity of global research is being sustained in the region of 300 proteins for large companies. The tracking of six individual targets shows uniquely detailed patterns not discernible from cumulative snapshots. These are interpretable in terms of events related to validation and de-risking of targets that produce detectable follow-on surges in patenting. Further analysis of the type we present here can provide unique insights into the process of drug discovery based on the data it actually generates. PMID:24204758

  10. Direct carbon dioxide emissions from civil aircraft

    NASA Astrophysics Data System (ADS)

    Grote, Matt; Williams, Ian; Preston, John

    2014-10-01

    Global airlines consume over 5 million barrels of oil per day, and the resulting carbon dioxide (CO2) emitted by aircraft engines is of concern. This article provides a contemporary review of the literature associated with the measures available to the civil aviation industry for mitigating CO2 emissions from aircraft. The measures are addressed under two categories - policy and legal-related measures, and technological and operational measures. Results of the review are used to develop several insights into the challenges faced. The analysis shows that forecasts for strong growth in air-traffic will result in civil aviation becoming an increasingly significant contributor to anthropogenic CO2 emissions. Some mitigation-measures can be left to market-forces as the key-driver for implementation because they directly reduce airlines' fuel consumption, and their impact on reducing fuel-costs will be welcomed by the industry. Other mitigation-measures cannot be left to market-forces. Speed of implementation and stringency of these measures will not be satisfactorily resolved unattended, and the current global regulatory-framework does not provide the necessary strength of stewardship. A global regulator with ‘teeth' needs to be established, but investing such a body with the appropriate level of authority requires securing an international agreement which history would suggest is going to be very difficult. If all mitigation-measures are successfully implemented, it is still likely that traffic growth-rates will continue to out-pace emissions reduction-rates. Therefore, to achieve an overall reduction in CO2 emissions, behaviour change will be necessary to reduce demand for air-travel. However, reducing demand will be strongly resisted by all stakeholders in the industry; and the ticket price-increases necessary to induce the required reduction in traffic growth-rates place a monetary-value on CO2 emissions of approximately 7-100 times greater than other common valuations. It is clear that, whilst aviation must remain one piece of the transport-jigsaw, environmentally a global regulator with ‘teeth' is urgently required.

  11. MRMaid, the Web-based Tool for Designing Multiple Reaction Monitoring (MRM) Transitions*

    PubMed Central

    Mead, Jennifer A.; Bianco, Luca; Ottone, Vanessa; Barton, Chris; Kay, Richard G.; Lilley, Kathryn S.; Bond, Nicholas J.; Bessant, Conrad

    2009-01-01

    Multiple reaction monitoring (MRM) of peptides uses tandem mass spectrometry to quantify selected proteins of interest, such as those previously identified in differential studies. Using this technique, the specificity of precursor to product transitions is harnessed for quantitative analysis of multiple proteins in a single sample. The design of transitions is critical for the success of MRM experiments, but predicting signal intensity of peptides and fragmentation patterns ab initio is challenging given existing methods. The tool presented here, MRMaid (pronounced “mermaid”) offers a novel alternative for rapid design of MRM transitions for the proteomics researcher. The program uses a combination of knowledge of the properties of optimal MRM transitions taken from expert practitioners and literature with MS/MS evidence derived from interrogation of a database of peptide identifications and their associated mass spectra. The tool also predicts retention time using a published model, allowing ordering of transition candidates. By exploiting available knowledge and resources to generate the most reliable transitions, this approach negates the need for theoretical prediction of fragmentation and the need to undertake prior “discovery” MS studies. MRMaid is a modular tool built around the Genome Annotating Proteomic Pipeline framework, providing a web-based solution with both descriptive and graphical visualizations of transitions. Predicted transition candidates are ranked based on a novel transition scoring system, and users may filter the results by selecting optional stringency criteria, such as omitting frequently modified residues, constraining the length of peptides, or omitting missed cleavages. Comparison with published transitions showed that MRMaid successfully predicted the peptide and product ion pairs in the majority of cases with appropriate retention time estimates. As the data content of the Genome Annotating Proteomic Pipeline repository increases, the coverage and reliability of MRMaid are set to increase further. MRMaid is freely available over the internet as an executable web-based service at www.mrmaid.info. PMID:19011259

  12. Food safety objective approach for controlling Clostridium botulinum growth and toxin production in commercially sterile foods.

    PubMed

    Anderson, N M; Larkin, J W; Cole, M B; Skinner, G E; Whiting, R C; Gorris, L G M; Rodriguez, A; Buchanan, R; Stewart, C M; Hanlin, J H; Keener, L; Hall, P A

    2011-11-01

    As existing technologies are refined and novel microbial inactivation technologies are developed, there is a growing need for a metric that can be used to judge equivalent levels of hazard control stringency to ensure food safety of commercially sterile foods. A food safety objective (FSO) is an output-oriented metric that designates the maximum level of a hazard (e.g., the pathogenic microorganism or toxin) tolerated in a food at the end of the food supply chain at the moment of consumption without specifying by which measures the hazard level is controlled. Using a risk-based approach, when the total outcome of controlling initial levels (H(0)), reducing levels (ΣR), and preventing an increase in levels (ΣI) is less than or equal to the target FSO, the product is considered safe. A cross-disciplinary international consortium of specialists from industry, academia, and government was organized with the objective of developing a document to illustrate the FSO approach for controlling Clostridium botulinum toxin in commercially sterile foods. This article outlines the general principles of an FSO risk management framework for controlling C. botulinum growth and toxin production in commercially sterile foods. Topics include historical approaches to establishing commercial sterility; a perspective on the establishment of an appropriate target FSO; a discussion of control of initial levels, reduction of levels, and prevention of an increase in levels of the hazard; and deterministic and stochastic examples that illustrate the impact that various control measure combinations have on the safety of well-established commercially sterile products and the ways in which variability all levels of control can heavily influence estimates in the FSO risk management framework. This risk-based framework should encourage development of innovative technologies that result in microbial safety levels equivalent to those achieved with traditional processing methods.

  13. A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

    PubMed Central

    Martin, Jennifer A.; Smith, Joshua E.; Warren, Mercedes; Chávez, Jorge L.; Hagen, Joshua A.; Kelley-Loughnane, Nancy

    2015-01-01

    Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health and performance. Nucleic acid aptamers have been increasingly applied as recognition elements on biosensor platforms, but selecting aptamers toward small molecule targets requires special design considerations. This work describes modification and critical steps of a method designed to select structure-switching aptamers to small molecule targets. Binding sequences from a DNA library hybridized to complementary DNA capture probes on magnetic beads are separated from nonbinders via a target-induced change in conformation. This method is advantageous because sequences binding the support matrix (beads) will not be further amplified, and it does not require immobilization of the target molecule. However, the melting temperature of the capture probe and library is kept at or slightly above RT, such that sequences that dehybridize based on thermodynamics will also be present in the supernatant solution. This effectively limits the partitioning efficiency (ability to separate target binding sequences from nonbinders), and therefore many selection rounds will be required to remove background sequences. The reported method differs from previous structure-switching aptamer selections due to implementation of negative selection steps, simplified enrichment monitoring, and extension of the length of the capture probe following selection enrichment to provide enhanced stringency. The selected structure-switching aptamers are advantageous in a gold nanoparticle assay platform that reports the presence of a target molecule by the conformational change of the aptamer. The gold nanoparticle assay was applied because it provides a simple, rapid colorimetric readout that is beneficial in a clinical or deployed environment. Design and optimization considerations are presented for the assay as proof-of-principle work in buffer to provide a foundation for further extension of the work toward small molecule biosensing in physiological fluids. PMID:25870978

  14. Effect of Fuel Injection and Mixing Characteristics on Pulse-Combustor Performance at High-Pressure

    NASA Technical Reports Server (NTRS)

    Yungster, Shaye; Paxson, Daniel E.; Perkins, Hugh D.

    2014-01-01

    Recent calculations of pulse-combustors operating at high-pressure conditions produced pressure gains significantly lower than those observed experimentally and computationally at atmospheric conditions. The factors limiting the pressure-gain at high-pressure conditions are identified, and the effects of fuel injection and air mixing characteristics on performance are investigated. New pulse-combustor configurations were developed, and the results show that by suitable changes to the combustor geometry, fuel injection scheme and valve dynamics the performance of the pulse-combustor operating at high-pressure conditions can be increased to levels comparable to those observed at atmospheric conditions. In addition, the new configurations can significantly reduce the levels of NOx emissions. One particular configuration resulted in extremely low levels of NO, producing an emission index much less than one, although at a lower pressure-gain. Calculations at representative cruise conditions demonstrated that pulse-combustors can achieve a high level of performance at such conditions.

  15. 77 FR 32006 - Special Conditions: Gulfstream Model GVI Airplane; High Incidence Protection

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-31

    ... Special Conditions No. 25-423-SC] Special Conditions: Gulfstream Model GVI Airplane; High Incidence... pertaining to a high incidence protection system that replaces the stall warning system during normal... V SR and not greater than 1.3 V SR . (6) The high incidence protection function disabled, or...

  16. Lipopolysaccharide (LPS)-stimulated iNOS Induction Is Increased by Glucosamine under Normal Glucose Conditions but Is Inhibited by Glucosamine under High Glucose Conditions in Macrophage Cells*

    PubMed Central

    Hwang, Ji-Sun; Kwon, Mi-Youn; Kim, Kyung-Hong; Lee, Yunkyoung; Lyoo, In Kyoon; Kim, Jieun E.; Oh, Eok-Soo; Han, Inn-Oc

    2017-01-01

    We investigated the regulatory effect of glucosamine (GlcN) for the production of nitric oxide (NO) and expression of inducible NO synthase (iNOS) under various glucose conditions in macrophage cells. At normal glucose concentrations, GlcN dose dependently increased LPS-stimulated production of NO/iNOS. However, GlcN suppressed NO/iNOS production under high glucose culture conditions. Moreover, GlcN suppressed LPS-induced up-regulation of COX-2, IL-6, and TNF-α mRNAs under 25 mm glucose conditions yet did not inhibit up-regulation under 5 mm glucose conditions. Glucose itself dose dependently increased LPS-induced iNOS expression. LPS-induced MAPK and IκB-α phosphorylation did not significantly differ at normal and high glucose conditions. The activity of LPS-induced nuclear factor-κB (NF-κB) and DNA binding of c-Rel to the iNOS promoter were inhibited under high glucose conditions in comparison with no significant changes under normal glucose conditions. In addition, we found that the LPS-induced increase in O-GlcNAcylation as well as DNA binding of c-Rel to the iNOS promoter were further increased by GlcN under normal glucose conditions. However, both O-GlcNAcylation and DNA binding of c-Rel decreased under high glucose conditions. The NF-κB inhibitor, pyrrolidine dithiocarbamate, inhibited LPS-induced iNOS expression under high glucose conditions but it did not influence iNOS induction under normal glucose conditions. In addition, pyrrolidine dithiocarbamate inhibited NF-κB DNA binding and c-Rel O-GlcNAcylation only under high glucose conditions. By blocking transcription with actinomycin D, we found that stability of LPS-induced iNOS mRNA was increased by GlcN under normal glucose conditions. These results suggest that GlcN regulates inflammation by sensing energy states of normal and fuel excess. PMID:27927986

  17. Sensitivity enhancement of OD- and OD-CNT-based humidity sensors by high gravity thin film deposition technique

    NASA Astrophysics Data System (ADS)

    Karimov, Kh. S.; Fatima, Noshin; Sulaiman, Khaulah; Mahroof Tahir, M.; Ahmad, Zubair; Mateen, A.

    2015-03-01

    The humidity sensing properties of the thin films of an organic semiconductor material orange dye (OD) and its composite with CNTs deposited at high gravity conditions have been reported. Impedance, phase angle, capacitance and dissipation of the samples were measured at 1 kHz and room temperature conditions. The impedance decreases and capacitance increases with an increase in the humidity level. It was found that the sensitivity of the OD-based thin film samples deposited at high gravity condition is higher than the samples deposited at low gravity condition. The impedances and capacitance sensitivities of the of the samples deposited under high gravity condition are 6.1 times and 1.6 times higher than the films deposited under low gravity condition.

  18. 14 CFR 91.144 - Temporary restriction on flight operations during abnormally high barometric pressure conditions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... during abnormally high barometric pressure conditions. 91.144 Section 91.144 Aeronautics and Space... flight operations during abnormally high barometric pressure conditions. (a) Special flight restrictions. When any information indicates that barometric pressure on the route of flight currently exceeds or...

  19. 15 CFR 14.14 - High risk special award conditions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false High risk special award conditions. 14.14 Section 14.14 Commerce and Foreign Trade Office of the Secretary of Commerce UNIFORM...-PROFIT, AND COMMERCIAL ORGANIZATIONS Pre-Award Requirements § 14.14 High risk special award conditions...

  20. Synoptic-scale fire weather conditions in Alaska

    NASA Astrophysics Data System (ADS)

    Hayasaka, Hiroshi; Tanaka, Hiroshi L.; Bieniek, Peter A.

    2016-09-01

    Recent concurrent widespread fires in Alaska are evaluated to assess their associated synoptic-scale weather conditions. Several periods of high fire activity from 2003 to 2015 were identified using Moderate Resolution Imaging Spectroradiometer (MODIS) hotspot data by considering the number of daily hotspots and their continuity. Fire weather conditions during the top six periods of high fire activity in the fire years of 2004, 2005, 2009, and 2015 were analyzed using upper level (500 hPa) and near surface level (1000 hPa) atmospheric reanalysis data. The top four fire-periods occurred under similar unique high-pressure fire weather conditions related to Rossby wave breaking (RWB). Following the ignition of wildfires, fire weather conditions related to RWB events typically result in two hotspot peaks occurring before and after high-pressure systems move from south to north across Alaska. A ridge in the Gulf of Alaska resulted in southwesterly wind during the first hotspot peak. After the high-pressure system moved north under RWB conditions, the Beaufort Sea High developed and resulted in relatively strong easterly wind in Interior Alaska and a second (largest) hotspot peak during each fire period. Low-pressure-related fire weather conditions occurring under cyclogenesis in the Arctic also resulted in high fire activity under southwesterly wind with a single large hot-spot peak.

  1. The Epidemiology of Overuse Conditions in Youth Football and High School Football Players.

    PubMed

    Morris, Kevin; Simon, Janet E; Grooms, Dustin R; Starkey, Chad; Dompier, Thomas P; Kerr, Zachary Y

    2017-10-01

      High-intensity sport training at the youth level has led to increased concern for overuse conditions. Few researchers have examined overuse conditions in youth sports.   To examine the rates, risks, and distributions of overuse conditions between youth and high school football players.   Descriptive epidemiologic study.   Youth and high school football teams.   The Youth Football Safety Study (YFSS) investigated youth football athletes from age 5 to 14 years. The National Athletic Treatment, Injury and Outcomes Network (NATION) focused on high school football athletes 14 to 18 years old. The YFSS data consisted of 210 team-seasons, and the NATION data consisted of 138 team-seasons.   Athletic trainers collected football injury and exposure data during the 2012 and 2013 seasons. Injury rates, risks, and distributions were calculated, with injury rate ratios, risk ratios, and injury proportion ratios with 95% confidence intervals (CIs) comparing youth and high school football players.   The YFSS reported 1488 injuries, of which 53 (3.6%) were overuse conditions. The NATION reported 12 013 injuries, of which 339 (2.8%) were overuse conditions. The overuse condition rate did not differ between high school and youth football (3.93 versus 3.72/10 000 athlete-exposures; injury rate ratio = 1.06; 95% CI = 0.79, 1.41). However, the 1-season risk of overuse condition was higher in high school than in youth football players (2.66% versus 1.05%; risk ratio = 2.53; 95% CI = 1.84, 3.47). Compared with high school football players, youth football players had greater proportions of overuse conditions that were nontime loss (ie, <24 hours participation-restriction time; 83.0% versus 67.0%; injury proportion ratio = 1.24; 95% CI = 1.07, 1.43) and affecting the lower extremity (92.5% versus 62.5%; injury proportion ratio = 1.48; 95% CI = 1.32, 1.65).   Overuse conditions may not present a primary concern in youth and high school football players. However, differences existed between the 2 levels of competition. Although additional research on the incidence of overuse conditions across all youth and high school sports is needed, these findings may highlight the need for programming that is specific to competition level.

  2. The Reduced Effectiveness of EGR to Mitigate Knock at High Loads in Boosted SI Engines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szybist, James P.; Wagnon, Scott W.; Splitter, Derek A.

    Numerous studies have demonstrated that exhaust gas recirculation (EGR) can attenuate knock propensity in spark ignition (SI) engines at naturally aspirated or lightly boosted conditions. In this paper, we investigate the role of cooled EGR under higher load conditions with multiple fuel compositions, where highly retarded combustion phasing typical of modern SI engines was used. It was found that under these conditions, EGR attenuation of knock is greatly reduced, where EGR doesn’t allow significant combustion phasing advance as it does under lighter load conditions. Detailed combustion analysis shows that when EGR is added, the polytropic coefficient increases causing the compressivemore » pressure and temperature to increase. At sufficiently highly boosted conditions, the increase in polytropic coefficient and additional trapped mass from EGR can sufficiently reduce fuel ignition delay to overcome knock attenuation effects. Kinetic modeling demonstrates that the effectiveness of EGR to mitigate knock is highly dependent on the pressure-temperature condition. Experiments at 2000 rpm have confirmed reduced fuel ignition delay under highly boosted conditions relevant to modern downsized boosted SI engines, where in-cylinder pressure is higher and the temperature is cooler. Finally, at these conditions, charge reactivity increases compared to naturally aspirated conditions, and attenuation of knock by EGR is reduced.« less

  3. The Reduced Effectiveness of EGR to Mitigate Knock at High Loads in Boosted SI Engines

    DOE PAGES

    Szybist, James P.; Wagnon, Scott W.; Splitter, Derek A.; ...

    2017-09-04

    Numerous studies have demonstrated that exhaust gas recirculation (EGR) can attenuate knock propensity in spark ignition (SI) engines at naturally aspirated or lightly boosted conditions. In this paper, we investigate the role of cooled EGR under higher load conditions with multiple fuel compositions, where highly retarded combustion phasing typical of modern SI engines was used. It was found that under these conditions, EGR attenuation of knock is greatly reduced, where EGR doesn’t allow significant combustion phasing advance as it does under lighter load conditions. Detailed combustion analysis shows that when EGR is added, the polytropic coefficient increases causing the compressivemore » pressure and temperature to increase. At sufficiently highly boosted conditions, the increase in polytropic coefficient and additional trapped mass from EGR can sufficiently reduce fuel ignition delay to overcome knock attenuation effects. Kinetic modeling demonstrates that the effectiveness of EGR to mitigate knock is highly dependent on the pressure-temperature condition. Experiments at 2000 rpm have confirmed reduced fuel ignition delay under highly boosted conditions relevant to modern downsized boosted SI engines, where in-cylinder pressure is higher and the temperature is cooler. Finally, at these conditions, charge reactivity increases compared to naturally aspirated conditions, and attenuation of knock by EGR is reduced.« less

  4. The Effects of Tempo and Intensity on Hyperactive Children.

    DTIC Science & Technology

    1984-08-01

    randomly assigned to one of four treatment conditions. Treatment conditions consisted of listening to music that varied according to intensity (high...and low) and tempo (fast and slow). The four combinations of -l music were high and fast, high and slow, low and fast, and low and P slow. The subjects...performed a cognitive task during the assigned treatment condition and also during a no- music condition. Behavioral observations and ratings were also

  5. Quality of our groundwater resources: Arsenic and fluoride

    USGS Publications Warehouse

    Nordstrom, D. Kirk

    2011-01-01

    Groundwater often contains arsenic or fluoride concentrations too high for drinking or cooking. These constituents, often naturally occurring, are not easy to remove. The right combination of natural or manmade conditions can lead to elevated arsenic or fluoride which includes continental source rocks, high alkalinity and pH, reducing conditions for arsenic, high phosphate, high temperature and high silica. Agencies responsible for safe drinking water should be aware of these conditions, be prepared to monitor, and treat if necessary.

  6. Learning and interactivity in solving a transformation problem.

    PubMed

    Guthrie, Lisa G; Vallée-Tourangeau, Frédéric; Vallée-Tourangeau, Gaëlle; Howard, Chelsea

    2015-07-01

    Outside the psychologist's laboratory, thinking proceeds on the basis of a great deal of interaction with artefacts that are recruited to augment problem-solving skills. The role of interactivity in problem solving was investigated using a river-crossing problem. In Experiment 1A, participants completed the same problem twice, once in a low interactivity condition, and once in a high interactivity condition (with order counterbalanced across participants). Learning, as gauged in terms of latency to completion, was much more pronounced when the high interactivity condition was experienced second. When participants first completed the task in the high interactivity condition, transfer to the low interactivity condition during the second attempt was limited; Experiment 1B replicated this pattern of results. Participants thus showed greater facility to transfer their experience of completing the problem from a low to a high interactivity condition. Experiment 2 was designed to determine the amount of learning in a low and high interactivity condition; in this experiment participants completed the problem twice, but level of interactivity was manipulated between subjects. Learning was evident in both the low and high interactivity groups, but latency per move was significantly faster in the high interactivity group, in both presentations. So-called problem isomorphs instantiated in different task ecologies draw upon different skills and abilities; a distributed cognition analysis may provide a fruitful perspective on learning and transfer.

  7. [A comparison of leak compensation in six acute care ventilators during non-invasive ventilation].

    PubMed

    Hu, X S; Wang, Y; Wang, Z T; Yan, P; Zhang, X G; Zhao, S F; Xie, F; Gu, H J; Xie, L X

    2017-02-12

    Objective: To compare the ability of leak compensation in 6 medical ventilators during non-invasive ventilation. Methods: Six medical ventilators were selected, including 3 non-invasive ventilators (V60, Flexo and Stellar150), and 3 invasive ventilators(Avea, Servo I and BellaVist). Using a lung simulator, the ability of leak compensation was evaluated during triggering and cycling in 2 respiratory mechanics conditions (high airway resistance condition and high elastance resistance condition), and each condition was performed under 2 PEEP levels (4, and 8 cmH(2)O, 1 mmHg=0.098 kPa) at 4 air leak level conditions (L0: 2-3 L/min, L1: 8-10 L/min, L2: 22-27 L/min, L3: 35-40 L/min). Results: In the high elastance resistance condition (L2, L3)with different leak levels, the number of auto-triggering and miss-triggering of the non-invasive ventilator Flexo was significantly less than those of the others (L2: 1, 1; L3: 1.67, 1.33, P <0.01), and had better synchronization (L2: 2.33, 2.33; L3: 3.33, 3.33, P <0.01). In the high airway resistance condition with PEEP 4 cmH(2)O, V60 had less number of auto-triggering than other ventilators ( P <0.01), while in the high airway resistance condition with PEEP 8 cmH(2)O, Stellar150 had less number of miss-triggering than other ventilators (1, 0.67, 0, P <0.01). Flexo had a shorter trigger delay time than other ventilators in both high airway resistance and high elastance resistance conditions with L0 and L1 leak levels and PEEP levels [ARDS, PEEP=4: (109.8±1.8) ms, (112.0±0.6) ms; ARDS, PEEP=8: (103.1±0.7) ms, (109.7±0.7) ms; COPD, PEEP=4: (207.3±1.1) ms, (220.8±1.1) ms; COPD, PEEP=8: (195.6±6.7) ms, (200.0±1.2) ms , P <0.01]. Stellar150 had the shortest trigger delay time in high airway resistance condition with PEEP 4 cmH(2)O and high leak level L3[(262.8±0.8) ms , P <0.01]. V60 had a good performance on trigger delay time in high elastance resistance condition with PEEP 4 and 8 cmH(2)O, and also was most stable in increasing leak levels. Conclusion: In high airway resistance and high elastance resistance conditions with different PEEP levels and leak levels, V60, Stellar150, Flexo and BellaVista ventilators could be synchronized, among which V60, Stellar150 and Flexo presented a good performance features in specific conditions.

  8. 45 CFR 1183.12 - Special grant or subgrant conditions for “high-risk” grantees.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Special grant or subgrant conditions for âhigh...) NATIONAL FOUNDATION ON THE ARTS AND THE HUMANITIES INSTITUTE OF MUSEUM AND LIBRARY SERVICES UNIFORM... Requirements § 1183.12 Special grant or subgrant conditions for “high-risk” grantees. (a) A grantee or...

  9. Phobias and Preparedness - Republished Article.

    PubMed

    Seligman, Martin E P

    2016-09-01

    Some inadequacies of the classical conditioning analysis of phobias are discussed: phobias are highly resistant to extinction, whereas laboratory fear conditioning, unlike avoidance conditioning, extinguishes rapidly; phobias comprise a nonarbitrary and limited set of objects, whereas fear conditioning is thought to occur to an unlimited range of conditioned stimuli. Furthermore, phobias, unlike laboratory fear conditioning, are often acquired in one trial and seem quite resistant to change by "cognitive" means. An analysis of phobias using a more contemporary model of fear conditioning is proposed. In this view, phobias are seen as instances of highly "prepared" learning (Seligman, 1970). Such prepared learning is selective, highly resistant to extinction, probably noncognitive and can be acquired in one trial. A reconstruction of the notion of symbolism is suggested. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A strategy for oxygen conditioning at high altitude: comparison with air conditioning.

    PubMed

    West, John B

    2015-09-15

    Large numbers of people live or work at high altitude, and many visit to trek or ski. The inevitable hypoxia impairs physical working capacity, and at higher altitudes there is also cognitive impairment. Twenty years ago oxygen enrichment of room air was introduced to reduce the hypoxia, and this is now used in dormitories, hotels, mines, and telescopes. However, recent advances in technology now allow large amounts of oxygen to be obtained from air or cryogenic oxygen sources. As a result it is now feasible to oxygenate large buildings and even institutions such as hospitals. An analogy can be drawn between air conditioning that has improved the living and working conditions of millions of people who live in hot climates and oxygen conditioning that can do the same at high altitude. Oxygen conditioning is similar to air conditioning except that instead of cooling the air, the oxygen concentration is raised, thus reducing the equivalent altitude. Oxygen conditioning on a large scale could transform living and working conditions at high altitude, where it could be valuable in homes, hospitals, schools, dormitories, company headquarters, banks, and legislative settings. Copyright © 2015 the American Physiological Society.

  11. Bioremediation of coal contaminated soil under sulfate-reducing condition.

    PubMed

    Kuwano, Y; Shimizu, Y

    2006-01-01

    The objective of this study was to investigate the biodegradation of coal-derived hydrocarbons, especially high molecular weight (HMW) components, under anaerobic conditions. For this purpose biodegradation experiments were performed, using specifically designed soil column bioreactors. For the experiment, coal-contaminated soil was prepared, which contains high molecular weight hydrocarbons at high concentration (approx. 55.5 mgC g-drysoil(-1)). The experiment was carried out in two different conditions: sulfate reducing (SR) condition (SO4(2-) = 10 mmol l(-1) in the liquid medium) and control condition (SO4(2-)<0.5 mmol l(-1)). Although no degradation was observed under the control condition, the resin fraction decreased to half (from 6,541 to 3,386 mgC g-soil(-1)) under SR condition, with the concomitant increase of two PAHs (phenanthrene and fluoranthene, 9 and 2.5 times, respectively). From these results, we could conclude that high molecular hydrocarbons were biodegradable and transformed to low molecular weight PAHs under the sulfate-reducing condition. Since these PAHs are known to be biologically degraded under aerobic condition, a serial combination of anaerobic (sulfate reducing) and then aerobic bioremediations could be effective and useful for the soil pollution by petroleum and/or coal derived hydrocarbons.

  12. Diagnosis isn't enough: Understanding the connections between high health care utilization, chronic conditions and disabilities among U.S. working age adults.

    PubMed

    Reichard, Amanda; Gulley, Stephen P; Rasch, Elizabeth K; Chan, Leighton

    2015-10-01

    Under the ACA, new programs are being developed to enhance care coordination and reduce health care costs among people with chronic conditions, disabilities, and high utilization of health care. However, the relationships between these groups are not well understood. Our aims were to (1) identify high utilizers of health care in the U.S. working age (18-64) population, (2) examine the overlap between this group and people with chronic conditions and/or disabilities, (3) identify predictors of high service use or cost among these subpopulations, and (4) recommend approaches for stratification of individuals with high health care utilization. Using pooled national data from the Medical Expenditure Panel Survey (2006-2008), we created indices to identify elevated or high utilization and cost groups. We performed descriptive analyses, bivariate comparisons and multivariate analyses to examine the relations between these populations and individuals with chronic conditions and/or disabilities. While the large majority of persons with high use/cost had chronic conditions, the minority of persons with chronic conditions had high health care utilization. However, among persons with chronic conditions, disability was a significant predictor of high utilization. Annual expenditures were significantly elevated among people with disabilities, particularly when activities of daily living were limited. We conclude that medical diagnosis alone is insufficient for the development of eligibility criteria for, or the evaluation of, programs intended to better the delivery or coordination of services for high utilizers of health care services. New approaches are needed to assess functional limitations and identify ongoing needs for services and supports. Published by Elsevier Inc.

  13. Green chiral HPLC study of the stability of Chiralcel OD under high temperature liquid chromatography and subcritical water conditions.

    PubMed

    Droux, S; Roy, M; Félix, G

    2014-10-01

    We report here the study of the stability under subcritical water conditions of one of the most popular polysaccharide chiral stationary phase (CSP): Chiralcel OD. This CSP was used under high temperature and reversed phase conditions with acetonitrile and 2-propanol as modifier, respectively. The evolution of selectivity and resolution was investigated both in normal and reversed mode conditions with five racemates after packing, heating at 150 °C and separations of some racemic compounds under different high temperatures and mobile phase conditions. The results show that after using at high temperature and subcritical water conditions the selectivity was only moderately affected while the resolution fell dramatically especially in reversed mode due to the creation of a void at the head of the columns which reflects the dissolution of the silica matrix. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. High Versus Low Theoretical Fidelity Pedometer Intervention Using Social-Cognitive Theory on Steps and Self-Efficacy.

    PubMed

    Raedeke, Thomas D; Dlugonski, Deirdre

    2017-12-01

    This study was designed to compare a low versus high theoretical fidelity pedometer intervention applying social-cognitive theory on step counts and self-efficacy. Fifty-six public university employees participated in a 10-week randomized controlled trial with 2 conditions that varied in theoretical fidelity. Participants in the high theoretical fidelity condition wore a pedometer and participated in a weekly group walk followed by a meeting to discuss cognitive-behavioral strategies targeting self-efficacy. Participants in the low theoretical fidelity condition met for a group walk and also used a pedometer as a motivational tool and to monitor steps. Step counts were assessed throughout the 10-week intervention and after a no-treatment follow-up (20 weeks and 30 weeks). Self-efficacy was measured preintervention and postintervention. Participants in the high theoretical fidelity condition increased daily steps by 2,283 from preintervention to postintervention, whereas participants in the low fidelity condition demonstrated minimal change during the same time period (p = .002). Individuals attending at least 80% of the sessions in the high theoretical fidelity condition showed an increase of 3,217 daily steps (d = 1.03), whereas low attenders increased by 925 (d = 0.40). Attendance had minimal impact in the low theoretical fidelity condition. Follow-up data revealed that step counts were at least somewhat maintained. For self-efficacy, participants in the high, compared with those in the low, theoretical fidelity condition showed greater improvements. Findings highlight the importance of basing activity promotion efforts on theory. The high theoretical fidelity intervention that included cognitive-behavioral strategies targeting self-efficacy was more effective than the low theoretical fidelity intervention, especially for those with high attendance.

  15. Trait Anxiety and Perceptual Load as Determinants of Emotion Processing in a Fear Conditioning Paradigm

    PubMed Central

    Fox, Elaine; Yates, Alan; Ashwin, Chris

    2012-01-01

    The impact of trait anxiety and perceptual load on selective attention was examined in a fear conditioning paradigm. A fear-conditioned angry face (CS+), an unconditioned angry face (CS−), or an unconditioned face with a neutral or happy expression were used in distractor interference and attentional probe tasks. In Experiments 1 and 2, participants classified centrally presented letters under two conditions of perceptual load. When perceptual load was high, distractors had no effect on selective attention, even with aversive conditioning. However, when perceptual load was low, strong response interference effects for CS+ face distractors were found for low trait-anxious participants. Across both experiments, this enhanced distractor interference reversed to strong facilitation effects for those reporting high trait anxiety. Thus, high trait-anxious participants were faster, rather than slower, when ignoring CS+ distractors. Using an attentional probe task in Experiment 3, it was found that fear conditioning resulted in strong attentional avoidance in a high trait-anxious group, which contrasted with enhanced vigilance in a low trait-anxious group. These results demonstrate that the impact of fear conditioning on attention is modulated by individual variation in trait anxiety when perceptual load is low. Fear conditioning elicits an avoidance of threat-relevant stimuli in high trait-anxious participants. PMID:21875186

  16. Metabolic flux of the oxidative pentose phosphate pathway under low light conditions in Synechocystis sp. PCC 6803.

    PubMed

    Ueda, Kentaro; Nakajima, Tsubasa; Yoshikawa, Katsunori; Toya, Yoshihiro; Matsuda, Fumio; Shimizu, Hiroshi

    2018-02-27

    The role of the oxidative pentose phosphate pathway (oxPPP) in Synechocystis sp. PCC 6803 under mixotrophic conditions was investigated by 13 C metabolic flux analysis. Cells were cultured under low (10 μmol m -2  s -1 ) and high light intensities (100 μmol m -2  s -1 ) in the presence of glucose. The flux of CO 2 fixation by ribulose bisphosphate carboxylase/oxygenase under the high light condition was approximately 3-fold higher than that under the low light condition. Although no flux of the oxPPP was observed under the high light condition, flux of 0.08-0.19 mmol gDCW -1  h -1 in the oxPPP was observed under the low light condition. The balance between the consumption and production of NADPH suggested that approximately 10% of the total NADPH production was generated by the oxPPP under the low light condition. The growth phenotype of a mutant with deleted zwf, which encodes glucose-6-phosphate dehydrogenase in the oxPPP, was compared to that of the parental strain under low and high light conditions. Growth of the Δzwf mutant nearly stopped during the late growth phase under the low light condition, whereas the growth rates of the two strains were identical under the high light condition. These results indicate that NADPH production in the oxPPP is essential for anabolism under low light conditions. The oxPPP appears to play an important role in producing NADPH from glucose and ATP to compensate for NADPH shortage under low light conditions. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. [Adaptive mechanisms and behavioural recommendations: playing football in heat, cold and high altitude conditions].

    PubMed

    Born, D-P; Hoppe, M W; Lindner, N; Freiwald, J; Holmberg, H-C; Sperlich, B

    2014-03-01

    Football is played worldwide and players often have to cope with hot and cold temperatures as well as high altitude conditions. The upcoming and past world championships in Brazil, Qatar and South Africa illustrate the necessity for behavioural strategies and adaptation to extreme environmental conditions. When playing football in the heat or cold, special clothing, hydration and nutritional and acclimatisation strategies are vital for high-level performance. When playing at high altitude, the reduced oxygen partial pressure impairs endurance performance and alters the technical and tactical requirements. Special high-altitude adaptation and preparation strategies are essential for football teams based at sea-level in order to perform well and compete successfully. Therefore, the aim of the underlying review is: 1) to highlight the difficulties and needs of football teams competing in extreme environmental conditions, 2) to summarise the thermoregulatory, physiological, neuronal and psychological mechanism, and 3) to provide recommendations for coping with extreme environmental conditions in order to perform at a high level when playing football in the heat, cold and at high altitude. © Georg Thieme Verlag KG Stuttgart · New York.

  18. Role of nicotine dose and sensory cues in the regulation of smoke intake.

    PubMed

    Rose, J E; Behm, F M; Levin, E D

    1993-04-01

    We investigated the role of nicotine dose and sensory cues in the regulation of ad lib smoke intake. The smoking behavior of 12 adult male smokers was assessed in three conditions, presenting either high-nicotine cigarette smoke (high nicotine, high sensory), diluted cigarette smoke (low nicotine, low sensory), or an aerosol containing cigarette smoke constituents suspended in solution, which was low in nicotine, yet high in sensory impact. Subjects showed marked compensatory increases in smoking with the dilute smoke conditions, whereas they puffed and inhaled the aerosol to a similar extent as the high-nicotine cigarette. Thus, subjects regulated their smoking behavior to equate sensory intensity rather than nicotine intake. Moreover, the aerosol and high-nicotine cigarette conditions lowered craving to a greater degree than the dilute smoke condition. Other mood indices, such as arousal and negative affect, were more effectively relieved by the high-nicotine dose condition. These results highlight the importance of sensory cues in the regulation of smoke intake and modulation of craving and suggest the clinical application of techniques for providing relief of cigarette craving during smoking cessation.

  19. Ligninolytic enzyme production in selected sub-tropical white rot fungi under different culture conditions.

    PubMed

    Tekere, M; Zvauya, R; Read, J S

    2001-01-01

    Lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase activities in selected sub-tropical white rot fungal species from Zimbabwe were determined. The enzyme activities were assayed at varying concentrations of C, N and Mn2+. Manganese peroxidase and laccase activities were the only expressed activities in the fungi under the culture conditions tested. Trametes species, T. cingulata, T. elegans and T. pocas produced the highest manganese peroxidase activities in a medium containing high carbon and low nitrogen conditions. High nitrogen conditions favoured high manganese peroxidase activity in DSPM95, L. velutinus and Irpex spp. High manganese peroxidase activity was notable for T. versicolor when both carbon and nitrogen in the medium were present at high levels. Laccase production by the isolates was highest under conditions of high nitrogen and those conditions with both nitrogen and carbon at high concentration. Mn2+ concentrations between 11-25 ppm gave the highest manganese peroxidase activity compared to a concentration of 40 ppm or when there was no Mn2+ added. Laccase activity was less influenced by Mn2+ levels. While some laccase activity was produced in the absence of Mn2+, the enzyme levels were higher when Mn2+ was added to the culture medium.

  20. Assessment and Classification of Cognitive Decrements Associated with High Workload and Extended Work Periods in a UAV Setting

    DTIC Science & Technology

    2008-07-01

    Percentage of distracters hit for the high workload condition as a function of time-on- task...a function of time-on- task .... 8 Figure 4. Effort scores for the high workload condition as a function of time-on-task ................ 9...Figure 5. Mental demand for the high workload condition as a function of time-on-task ........... 9 Figure 6. Average power for site Oz, alpha band

  1. Combustion of Gaseous Fuels with High Temperature Air in Normal- and Micro-gravity Conditions

    NASA Technical Reports Server (NTRS)

    Wang, Y.; Gupta, A. K.

    2001-01-01

    The objective of this study is determine the effect of air preheat temperature on flame characteristics in normal and microgravity conditions. We have obtained qualitative (global flame features) and some quantitative information on the features of flames using high temperature combustion air under normal gravity conditions with propane and methane as the fuels. This data will be compared with the data under microgravity conditions. The specific focus under normal gravity conditions has been on determining the global flame features as well as the spatial distribution of OH, CH, and C2 from flames using high temperature combustion air at different equivalence ratio.

  2. Quantile Regression for Analyzing Heterogeneity in Ultra-high Dimension

    PubMed Central

    Wang, Lan; Wu, Yichao

    2012-01-01

    Ultra-high dimensional data often display heterogeneity due to either heteroscedastic variance or other forms of non-location-scale covariate effects. To accommodate heterogeneity, we advocate a more general interpretation of sparsity which assumes that only a small number of covariates influence the conditional distribution of the response variable given all candidate covariates; however, the sets of relevant covariates may differ when we consider different segments of the conditional distribution. In this framework, we investigate the methodology and theory of nonconvex penalized quantile regression in ultra-high dimension. The proposed approach has two distinctive features: (1) it enables us to explore the entire conditional distribution of the response variable given the ultra-high dimensional covariates and provides a more realistic picture of the sparsity pattern; (2) it requires substantially weaker conditions compared with alternative methods in the literature; thus, it greatly alleviates the difficulty of model checking in the ultra-high dimension. In theoretic development, it is challenging to deal with both the nonsmooth loss function and the nonconvex penalty function in ultra-high dimensional parameter space. We introduce a novel sufficient optimality condition which relies on a convex differencing representation of the penalized loss function and the subdifferential calculus. Exploring this optimality condition enables us to establish the oracle property for sparse quantile regression in the ultra-high dimension under relaxed conditions. The proposed method greatly enhances existing tools for ultra-high dimensional data analysis. Monte Carlo simulations demonstrate the usefulness of the proposed procedure. The real data example we analyzed demonstrates that the new approach reveals substantially more information compared with alternative methods. PMID:23082036

  3. High oxygen condition facilitates the differentiation of mouse and human pluripotent stem cells into pancreatic progenitors and insulin-producing cells.

    PubMed

    Hakim, Farzana; Kaitsuka, Taku; Raeed, Jamiruddin Mohd; Wei, Fan-Yan; Shiraki, Nobuaki; Akagi, Tadayuki; Yokota, Takashi; Kume, Shoen; Tomizawa, Kazuhito

    2014-04-04

    Pluripotent stem cells have potential applications in regenerative medicine for diabetes. Differentiation of stem cells into insulin-producing cells has been achieved using various protocols. However, both the efficiency of the method and potency of differentiated cells are insufficient. Oxygen tension, the partial pressure of oxygen, has been shown to regulate the embryonic development of several organs, including pancreatic β-cells. In this study, we tried to establish an effective method for the differentiation of induced pluripotent stem cells (iPSCs) into insulin-producing cells by culturing under high oxygen (O2) conditions. Treatment with a high O2 condition in the early stage of differentiation increased insulin-positive cells at the terminus of differentiation. We found that a high O2 condition repressed Notch-dependent gene Hes1 expression and increased Ngn3 expression at the stage of pancreatic progenitors. This effect was caused by inhibition of hypoxia-inducible factor-1α protein level. Moreover, a high O2 condition activated Wnt signaling. Optimal stage-specific treatment with a high O2 condition resulted in a significant increase in insulin production in both mouse embryonic stem cells and human iPSCs and yielded populations containing up to 10% C-peptide-positive cells in human iPSCs. These results suggest that culturing in a high O2 condition at a specific stage is useful for the efficient generation of insulin-producing cells.

  4. Characteristics of Gaseous Diffusion Flames with High Temperature Combustion Air in Microgravity

    NASA Technical Reports Server (NTRS)

    Ghaderi, M.; Gupta, A. K.

    2003-01-01

    The characteristics of gaseous diffusion flames have been obtained using high temperature combustion air under microgravity conditions. The time resolved flame images under free fall microgravity conditions were obtained from the video images obtained. The tests results reported here were conducted using propane as the fuel and about 1000 C combustion air. The burner included a 0.686 mm diameter central fuel jet injected into the surrounding high temperature combustion air. The fuel jet exit Reynolds number was 63. Several measurements were taken at different air preheats and fuel jet exit Reynolds number. The resulting hybrid color flame was found to be blue at the base of the flame followed by a yellow color flame. The length and width of flame during the entire free fall conditions has been examined. Also the relative flame length and width for blue and yellow portion of the flame has been examined under microgravity conditions. The results show that the flame length decreases and width increases with high air preheats in microgravity condition. In microgravity conditions the flame length is larger with normal temperature combustion air than high temperature air.

  5. [Effect of Bushen Huoxue Compound on Retinal Müller Cells in High Glucose or AGEs Conditions].

    PubMed

    Xie, Xue-jun; Song, Ming-xia; Zhang, Mei; Qin, Wei; Wan, Li; Fang, Yang

    2015-06-01

    To explore the effect of Bushen Huoxue Compound (BHC) on lactate dehydrogenase (LDH) leakage, expressions of vascular endothelial growth factor (VEGF) and VEGF mRNA in retinal Muller cells under high glucose condition or advanced glycosylation end products (AGEs) condition by using serum pharmacological method. The retinal Müller cells of 5-7 days post-natal Sprague Dawley (SD) rats were cultured with modified enzyme-digestion method. Purified retinal Muller cells were cultured in normal conditions, high glucose condition (50 mmol/L) or AGEs (50 mg/L and 100 mg/L) conditions, and BHC-containing serum was added to culture medium. The LDH leakage and VEGF expressions were measured by enzyme-linked immunosorbent assay (ELISA). In addition, the relative expression of VEGF mRNA was tested by reverse transcription polymerase chain reaction (RT-PCR). Compared with the normal control group, expressions of VEGF and VEGF mRNA were significantly increased in the high glucose group, the low dose AGEs group and the high dose AGEs group (all P < 0.01). The LDH leakage was obviously increased in the high dose AGEs group, when compared with the normal control group and the high glucose group (P < 0.01). The LDH leakage, expressions of VEGF and VEGF mRNA were obviously decreased by BHC-containing serum both in high glucose and AGEs conditions (P < 0.05, P < 0.01). BHC-containing serum had no significant effect on the LDH leakage and expressions of VEGF and VEGF mRNA in normal conditions (P > 0.05). AGEs intervention could obviously lower the stability of Müller cell membrane. Up-regulated expressions of VEGF and VEGF mRNA in cultured Müller cells could be induced by AGEs or high glucose. BHC-containing serum could stabilize the stability of Müller cell membrane, inhibit the transcription of VEGF mRNA and decrease the protein expression of VEGF, which might be one of important mechanisms for preventing and treating diabetic retinopathy.

  6. Learning in an interactive simulation tool against landslide risks: the role of strength and availability of experiential feedback

    NASA Astrophysics Data System (ADS)

    Chaturvedi, Pratik; Arora, Akshit; Dutt, Varun

    2018-06-01

    Feedback via simulation tools is likely to help people improve their decision-making against natural disasters. However, little is known on how differing strengths of experiential feedback and feedback's availability in simulation tools influence people's decisions against landslides. We tested the influence of differing strengths of experiential feedback and feedback's availability on people's decisions against landslides in Mandi, Himachal Pradesh, India. Experiential feedback (high or low) and feedback's availability (present or absent) were varied across four between-subject conditions in a tool called the Interactive Landslide Simulation (ILS): high damage with feedback present, high damage with feedback absent, low damage with feedback present, and low damage with feedback absent. In high-damage conditions, the probabilities of damages to life and property due to landslides were 10 times higher than those in the low-damage conditions. In feedback-present conditions, experiential feedback was provided in numeric, text, and graphical formats in ILS. In feedback-absent conditions, the probabilities of damages were described; however, there was no experiential feedback present. Investments were greater in conditions where experiential feedback was present and damages were high compared to conditions where experiential feedback was absent and damages were low. Furthermore, only high-damage feedback produced learning in ILS. Simulation tools like ILS seem appropriate for landslide risk communication and for performing what-if analyses.

  7. High-Performance Fully Printable Perovskite Solar Cells via Blade-Coating Technique under the Ambient Condition

    DOE PAGES

    Yang, Zhibin; Chueh, Chu-Chen; Zuo, Fan; ...

    2015-04-30

    A fully printable perovskite solar cell (PVSC) is demonstrated using a blade-coating technique under ambient conditions with controlled humidity. The influence of humidity on perovskite's crystallization is systematically investigated to realize the ambient processing condition. A high power conversion efficiency of 10.44% is achieved after optimizing the blade-coating process and, more importantly, a high-performance flexible PVSC is demonstrated for the first time. A high efficiency of 7.14% is achieved.

  8. Trait anxiety and perceptual load as determinants of emotion processing in a fear conditioning paradigm.

    PubMed

    Fox, Elaine; Yates, Alan; Ashwin, Chris

    2012-04-01

    The impact of trait anxiety and perceptual load on selective attention was examined in a fear conditioning paradigm. A fear-conditioned angry face (CS+), an unconditioned angry face (CS-), or an unconditioned face with a neutral or happy expression were used in distractor interference and attentional probe tasks. In Experiments 1 and 2, participants classified centrally presented letters under two conditions of perceptual load. When perceptual load was high, distractors had no effect on selective attention, even with aversive conditioning. However, when perceptual load was low, strong response interference effects for CS+ face distractors were found for low trait-anxious participants. Across both experiments, this enhanced distractor interference reversed to strong facilitation effects for those reporting high trait anxiety. Thus, high trait-anxious participants were faster, rather than slower, when ignoring CS+ distractors. Using an attentional probe task in Experiment 3, it was found that fear conditioning resulted in strong attentional avoidance in a high trait-anxious group, which contrasted with enhanced vigilance in a low trait-anxious group. These results demonstrate that the impact of fear conditioning on attention is modulated by individual variation in trait anxiety when perceptual load is low. Fear conditioning elicits an avoidance of threat-relevant stimuli in high trait-anxious participants. (PsycINFO Database Record (c) 2012 APA, all rights reserved).

  9. Got political skill? The impact of justice on the importance of political skill for job performance.

    PubMed

    Andrews, Martha C; Kacmar, K Michele; Harris, Kenneth J

    2009-11-01

    The present study examined the moderating effects of procedural and distributive justice on the relationships between political skill and task performance and organizational citizenship behavior (OCB) among 175 supervisor-subordinate dyads of a government organization. Using Mischel's (1968) situationist perspective, high justice conditions were considered "strong situations," whereas low justice conditions were construed as "weak situations." We found that when both procedural and distributive justice were low, political skill was positively related to performance. Under conditions of both high procedural and high distributive justice, political skill was negatively related to performance. Finally, under conditions of low distributive justice, political skill was positively related to OCB, whereas under conditions of high distributive justice, political skill had little effect on OCB. These results highlight the importance of possessing political skill in weak but not strong situations.

  10. Boundary and Interface Conditions for High Order Finite Difference Methods Applied to the Euler and Navier-Strokes Equations

    NASA Technical Reports Server (NTRS)

    Nordstrom, Jan; Carpenter, Mark H.

    1998-01-01

    Boundary and interface conditions for high order finite difference methods applied to the constant coefficient Euler and Navier-Stokes equations are derived. The boundary conditions lead to strict and strong stability. The interface conditions are stable and conservative even if the finite difference operators and mesh sizes vary from domain to domain. Numerical experiments show that the new conditions also lead to good results for the corresponding nonlinear problems.

  11. Melt Conditioning of Light Metals by Application of High Shear for Improved Microstructure and Defect Control

    NASA Astrophysics Data System (ADS)

    Patel, Jayesh B.; Yang, Xinliang; Mendis, Chamini L.; Fan, Zhongyun

    2017-04-01

    Casting is the first step toward the production of majority of metal products whether the final processing step is casting or other thermomechanical processes such as extrusion or forging. The high shear melt conditioning provides an easily adopted pathway to producing castings with a more uniform fine-grained microstructure along with a more uniform distribution of the chemical composition leading to fewer defects as a result of reduced shrinkage porosities and the presence of large oxide films through the microstructure. The effectiveness of high shear melt conditioning in improving the microstructure of processes used in industry illustrates the versatility of the high shear melt conditioning technology. The application of high shear process to direct chill and twin roll casting process is demonstrated with examples from magnesium melts.

  12. High Order Finite Difference Methods, Multidimensional Linear Problems and Curvilinear Coordinates

    NASA Technical Reports Server (NTRS)

    Nordstrom, Jan; Carpenter, Mark H.

    1999-01-01

    Boundary and interface conditions are derived for high order finite difference methods applied to multidimensional linear problems in curvilinear coordinates. The boundary and interface conditions lead to conservative schemes and strict and strong stability provided that certain metric conditions are met.

  13. Post carbon removal nitrifying MBBR operation at high loading and exposure to starvation conditions.

    PubMed

    Young, Bradley; Delatolla, Robert; Kennedy, Kevin; LaFlamme, Edith; Stintzi, Alain

    2017-09-01

    This study investigates the performance of MBBR nitrifying biofilm post carbon removal at high loading and starvation conditions. The nitrifying MBBR, treating carbon removal lagoon effluent, achieved a maximum SARR of 2.13gN/m 2 d with complete conversion of ammonia to nitrate. The results also show the MBBR technology is capable of maintaining a stable biofilm under starvation conditions in systems that nitrify intermittently. The biomass exhibited a higher live fraction of total cells in the high loaded reactors (73-100%) as compared to the reactors operated in starvation condition (26-82%). For both the high loaded and starvation condition, the microbial communities significantly changed with time of operation. The nitrifying community, however, remained steady with the family Nitrosomonadacea as the primary AOBs and Nitrospira as the primary NOB. During starvation conditions, the relative abundance of AOBs decreased and Nitrospira increased corresponding to an NOB/AOB ratio of 5.2-12.1. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Collaborate and share: an experimental study of the effects of task and reward interdependencies in online games.

    PubMed

    Choi, Boreum; Lee, Inseong; Choi, Dongseong; Kim, Jinwoo

    2007-08-01

    Today millions of players interact with one another in online games, especially massively multiplayer online role-playing games (MMORPGs). These games promote interaction among players by offering interdependency features, but to date few studies have asked what interdependency design factors of MMORPGs make them fun for players, produce experiences of flow, or enhance player performance. In this study, we focused on two game design features: task and reward interdependency. We conducted a controlled experiment that compared the interaction effects of low and high task-interdependency conditions and low and high reward-interdependency conditions on three dependent variables: fun, flow, and performance. We found that in a low task-interdependency condition, players had more fun, experienced higher levels of flow, and perceived better performance when a low reward-interdependency condition also obtained. In contrast, in a high task-interdependency condition, all of these measures were higher when a high reward-interdependency condition also obtained.

  15. 78 FR 19981 - Special Conditions: Embraer S.A., Model EMB-550 Airplanes; Flight Envelope Protection: High Speed...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-03

    ...; Flight Envelope Protection: High Speed Limiting AGENCY: Federal Aviation Administration (FAA), DOT... protection: high speed limiting. As published, the document contained an error in that the Special Conditions...

  16. Experimental and Theoretical Investigations on the Nanoscale Kinetic Friction in Ambient Environmental Conditions.

    PubMed

    Gueye, Birahima; Zhang, Yan; Wang, Yujuan; Chen, Yunfei

    2015-07-08

    The liquid lubrication, thermolubricity and dynamic lubricity due to mechanical oscillations are investigated with an atomic force microscope in ambient environmental conditions with different relative humidity (RH) levels. Experimental results demonstrate that high humidity at low-temperature regime enhances the liquid lubricity while at high-temperature regime it hinders the effect of the thermolubricity due to the formation of liquid bridges. Friction response to the dynamic lubricity in both high- and low-temperature regimes keeps the same trends, namely the friction force decreases with increasing the amplitude of the applied vibration on the tip regardless of the RH levels. An interesting finding is that for the dynamic lubricity at high temperature, high-humidity condition leads to the friction forces higher than that at low-humidity condition while at low temperature the opposite trend is observed. An extended two-dimensional dynamic model accounting for the RH is proposed to interpret the frictional mechanism in ambient conditions.

  17. Assessment of rural soundscapes with high-speed train noise.

    PubMed

    Lee, Pyoung Jik; Hong, Joo Young; Jeon, Jin Yong

    2014-06-01

    In the present study, rural soundscapes with high-speed train noise were assessed through laboratory experiments. A total of ten sites with varying landscape metrics were chosen for audio-visual recording. The acoustical characteristics of the high-speed train noise were analyzed using various noise level indices. Landscape metrics such as the percentage of natural features (NF) and Shannon's diversity index (SHDI) were adopted to evaluate the landscape features of the ten sites. Laboratory experiments were then performed with 20 well-trained listeners to investigate the perception of high-speed train noise in rural areas. The experiments consisted of three parts: 1) visual-only condition, 2) audio-only condition, and 3) combined audio-visual condition. The results showed that subjects' preference for visual images was significantly related to NF, the number of land types, and the A-weighted equivalent sound pressure level (LAeq). In addition, the visual images significantly influenced the noise annoyance, and LAeq and NF were the dominant factors affecting the annoyance from high-speed train noise in the combined audio-visual condition. In addition, Zwicker's loudness (N) was highly correlated with the annoyance from high-speed train noise in both the audio-only and audio-visual conditions. © 2013.

  18. Influenza A (H1N1) 2009 monovalent and seasonal influenza vaccination among adults 25 to 64 years of age with high-risk conditions—United States, 2010

    PubMed Central

    Lu, Peng-jun; Gonzalez-Feliciano, Amparo; Ding, Helen; Bryan, Leah N.; Yankey, David; Monsell, Elizabeth A.; Greby, Stacie M.; Euler, Gary L.

    2018-01-01

    Background Seasonal influenza vaccination has been routinely recommended for adults with high-risk conditions. The Advisory Committee on Immunization Practices recommended that persons 25 to 64 years of age with high-risk conditions be one of the initial target groups to receive H1N1 vaccination during the 2009-2010 season. Methods We used data from the 2009-2010 Behavioral Risk Factor Surveillance System survey. Vaccination levels of H1N1 and seasonal influenza vaccination among respondents 25 to 64 years with high-risk conditions were assessed. Multivariable logistic regression models were performed to identify factors independently associated with vaccination. Results Overall, 24.8% of adults 25 to 64 years of age were identified to have high-risk conditions. Among adults 25 to 64 years of age with high-risk conditions, H1N1 and seasonal vaccination coverage were 26.3% and 47.6%, respectively. Characteristics independently associated with an increased likelihood of H1N1 vaccination were as follows: higher age; Hispanic race/ethnicity; medical insurance; ability to see a doctor if needed; having a primary doctor; a routine checkup in the previous year; not being a current smoker; and having high-risk conditions other than asthma, diabetes, and heart disease. Characteristics independently associated with seasonal influenza vaccination were similar compared with factors associated with H1N1 vaccination. Conclusion Immunization programs should work with provider organizations to review efforts made to reach adults with high-risk conditions during the recent pandemic and assess how and where they can increase vaccination coverage during future pandemics. PMID:23419613

  19. Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration

    PubMed Central

    Voss, Bradley J.; Loh, John T.; Hill, Salisha; Rose, Kristie L.; McDonald, W. Hayes; Cover, Timothy L.

    2015-01-01

    Purpose Helicobacter pylori infection and a high dietary salt intake are each risk factors for the development of gastric cancer. We hypothesize that changes in environmental salt concentrations lead to alterations in the H. pylori membrane proteome. Experimental Design Label-free and iTRAQ methods were used to identify H. pylori proteins that change in abundance in response to alterations in environmental salt concentrations. In addition, we biotinylated intact bacteria that were grown under high- or low-salt conditions, and thereby analyzed salt-induced changes in the abundance of surface-exposed proteins. Results Proteins with increased abundance in response to high salt conditions included CagA, the outer membrane protein HopQ, and fibronectin domain-containing protein HP0746. Proteins with increased abundance in response to low salt conditions included VacA, two VacA-like proteins (ImaA and FaaA), outer-membrane iron transporter FecA3, and several proteins involved in flagellar activity. Consistent with the proteomic data, bacteria grown in high salt conditions exhibited decreased motility compared to bacteria grown in lower salt conditions. Conclusions and clinical relevance Alterations in the H. pylori membrane proteome in response to high salt conditions may contribute to the increased risk of gastric cancer associated with a high salt diet. PMID:26109032

  20. The relationship between high residential density in student dormitories and anxiety, binge eating and Internet addiction: a study of Chinese college students.

    PubMed

    Tao, Zhuoli; Wu, Gao; Wang, Zeyuan

    2016-01-01

    Although various studies have indicated that high residential density may affect health and psychological outcomes, to our knowledge, there have been no studies regarding the predictive nature of crowded living conditions on binge eating and the use of the Internet as coping strategies. A total of 1048 Chinese college students (540 males and 508 females) were randomly selected and asked to complete a battery of questionnaires that included the Zung's Self-Rating Anxiety Scale, the Internet Addiction Test, and Rosenbaum's Self-Control Scale. Binge eating behaviors and compensatory behaviors were also reported, and variables about residential density were measured. Among female participants, binge eating scores were significantly predicted by anxiety caused by high-density living conditions (P = 0.008), and similarly, the frequency of compensatory behaviors was significantly predicted by anxiety caused by high-density living conditions (P = 0.000) and self-control (P = 0.003). Furthermore, the Internet Addiction Test scores were significantly predicted by the anxiety caused by high -density living conditions (P = 0.000) and self-control (P = 0.000). Among male participants, not only were the binge eating scores significantly predicted by the anxiety caused by high-density living conditions (P = 0.000) and self-control (P = 0.000), but the frequency of compensatory behaviors was also significantly predicted by the anxiety caused by high-density living conditions (P = 0.000) and self-control (P = 0.01). Furthermore, Internet Addiction Test scores were significantly predicted by anxiety caused by high-density living conditions (P = 0.000) and self-control (P = 0.000). It was further found that for both genders, subjective factors such as self-control, and the anxiety caused by high-density living conditions had a stronger impact on Internet addiction than objective factors, such as the size of the student's dormitory room. Moreover, self-control was found to act as a moderator in the relationship between anxiety and Internet addiction among male participants. Binge eating and Internet use could be considered coping strategies for Chinese college students facing high residential density in their dormitories.

  1. Irradiation Tests Supporting LEU Conversion of Very High Power Research Reactors in the US

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woolstenhulme, N. E.; Cole, J. I.; Glagolenko, I.

    The US fuel development team is developing a high density uranium-molybdenum alloy monolithic fuel to enable conversion of five high-power research reactors. Previous irradiation tests have demonstrated promising behavior for this fuel design. A series of future irradiation tests will enable selection of final fuel fabrication process and provide data to qualify the fuel at moderately-high power conditions for use in three of these five reactors. The remaining two reactors, namely the Advanced Test Reactor and High Flux Isotope Reactor, require additional irradiation tests to develop and demonstrate the fuel’s performance with even higher power conditions, complex design features, andmore » other unique conditions. This paper reviews the program’s current irradiation testing plans for these moderately-high irradiation conditions and presents conceptual testing strategies to illustrate how subsequent irradiation tests will build upon this initial data package to enable conversion of these two very-high power research reactors.« less

  2. ERP Evidence for the Activation of Syntactic Structure During Comprehension of Lexical Idiom.

    PubMed

    Zhang, Meichao; Lu, Aitao; Song, Pingfang

    2017-10-01

    The present study used event-related potentials to investigate whether the syntactic structure was activated in the comprehension of lexical idioms, and if so, whether it varied as a function of familiarity and semantic transparency. Participants were asked to passively read the "1+2" structural Chinese lexical idioms with each being presented following 3-5 contextual "1+2" (congruent-structure condition) or "2+1" structural Chinese phrases (incongruent-structure condition). The N400 ERP responses showed more positivity in congruent-structure condition relative to incongruent-structure condition in idioms with high familiarity and high semantic transparency, but less positivity in congruent-structure condition in idioms with high familiarity but low semantic transparency, idioms with low familiarity but high semantic transparency, and idioms with low familiarity and low semantic transparency. Our results suggest that syntactic structure, as the unnecessarity of lexical idiomatic words, was nevertheless activated, independent of familiarity and semantic transparency.

  3. Self-Controlled Feedback Facilitates Motor Learning in Both High and Low Activity Individuals

    PubMed Central

    Fairbrother, Jeffrey T.; Laughlin, David D.; Nguyen, Timothy V.

    2012-01-01

    The purpose of this study was to determine if high and low activity individuals differed in terms of the effects of self-controlled feedback on the performance and learning of a movement skill. The task consisted of a blindfolded beanbag toss using the non-preferred arm. Participants were pre-screened according to their physical activity level using the International Physical Activity Questionnaire. An equal number of high activity (HA) and low activity (LA) participants were assigned to self-control (SC) and yoked (YK) feedback conditions, creating four groups: Self-Control-High Activity; Self-Control-Low Activity; Yoked-High Activity; and Yoked-Low Activity. SC condition participants were provided feedback whenever they requested it, while YK condition participants received feedback according to a schedule created by their SC counterpart. Results indicated that the SC condition was more accurate than the YK condition during acquisition and transfer phases, and the HA condition was more accurate than the LA condition during all phases of the experiment. A post-training questionnaire indicated that participants in the SC condition asked for feedback mostly after what they perceived to be “good” trials; those in the YK condition indicated that they would have preferred to receive feedback after “good” trials. This study provided further support for the advantages of self-controlled feedback when learning motor skills, additionally showing benefits for both active and less active individuals. The results suggested that the provision of self-controlled feedback to less active learners may be a potential avenue to teaching motor skills necessary to engage in greater amounts of physical activity. PMID:22969745

  4. A problem with double-blind photospread procedures: photospread administrators use one eyewitness's confidence to influence the identification of another eyewitness.

    PubMed

    Douglass, Amy Bradfield; Smith, Caroline; Fraser-Thill, Rebecca

    2005-10-01

    In Experiment 1, photospread administrators (PAs, N = 50) showed a target-absent photospread to a confederate eyewitness (CW), who was randomly assigned to identify one photo with either high or low confidence. PAs subsequently administered the same target-absent photospread to participant eyewitnesses (PWs, N = 50), all of whom had viewed a live staged crime 1 week earlier. CWs were rated by the PAs as significantly more confident in the high-confidence condition versus low-confidence condition. More importantly, the confidence of the CW affected the identification decision of the PW. In the low-confidence condition, the photo identified by the CW was identified by the PW significantly more than the other photos; there was no significant difference in photo choice in the high-confidence condition. In spite of the obvious influence exerted in the low-confidence condition, observers were not able to detect bias in the photospread procedures. A second experiment was conducted to test a post-hoc explanation for the results of Experiment 1: PAs exerted influence in the low-confidence condition because they perceived the task as more difficult for the eyewitness than in the high-confidence condition. Independent observers (N = 84) rated the difficulty of the confederate's task as higher in the low-confidence condition compared with the high-confidence condition, suggesting that expectations of task difficulty might be driving the effect observed in Experiment 1. Results support recommendations for double-blind photospreads and emphasize that the same investigator should not administer photo lineups to multiple eyewitnesses in an investigation.

  5. Early and late maturing grain sorghum under variable climatic conditions in the Texas High Plains

    USDA-ARS?s Scientific Manuscript database

    In the Texas High Plains, variable climatic conditions prevail between and within growing seasons. As this area continues to experience drought conditions, and water resources for irrigation become more limited, sorghum [Sorghum bicolor (L.) Moench] production may become a more popular choice to sus...

  6. Secondary Hypertension

    MedlinePlus

    Secondary hypertension Overview Secondary hypertension (secondary high blood pressure) is high blood pressure that's caused by another medical condition. Secondary hypertension can be caused by conditions that affect your kidneys, ...

  7. Effects of Stress and Task Difficulty on Working Memory and Cortical Networking.

    PubMed

    Kim, Yujin; Woo, Jihwan; Woo, Minjung

    2017-12-01

    This study investigated interactive effects of stress and task difficulty on working memory and cortico-cortical communication during memory encoding. Thirty-eight adolescent participants (mean age of 15.7 ± 1.5 years) completed easy and hard working memory tasks under low- and high-stress conditions. We analyzed the accuracy and reaction time (RT) of working memory performance and inter- and intrahemispheric electroencephalogram coherences during memory encoding. Working memory accuracy was higher, and RT shorter, in the easy versus the hard task. RT was shorter under the high-stress (TENS) versus low-stress (no-TENS) condition, while there was no difference in memory accuracy between the two stress conditions. For electroencephalogram coherence, we found higher interhemispheric coherence in all bands but only at frontal electrode sites in the easy versus the hard task. On the other hand, intrahemispheric coherence was higher in the left hemisphere in the easy (versus hard task) and higher in the right hemisphere (with one exception) in the hard (versus easy task). Inter- and intracoherences were higher in the low- versus high-stress condition. Significant interactions between task difficulty and stress condition were observed in coherences of the beta frequency band. The difference in coherence between low- and high-stress conditions was greater in the hard compared with the easy task, with lower coherence under the high-stress condition relative to the low-stress condition. Stress seemed to cause a decrease in cortical network communications between memory-relevant cortical areas as task difficulty increased.

  8. People Are More Generous to a Partner Who Pays Attention to Them.

    PubMed

    Ohtsubo, Yohsuke; Yamaguchi, Chiaki

    2017-01-01

    People use relatively low-cost signals to maintain close relationships, in which they engage in costlier exchanges of tangible support. Paying attention to a partner allows an individual to communicate his or her interest in the relationship with the partner. Previous studies have revealed that when Person A pays attention to Person B, B's feeling of intimacy toward A increases. If social attention strengthens the bond between A and B, it is predicted that A's attention will also increase B's generous behavior toward A. This study tested this prediction. Participants first engaged in a collaborative task using computers. In the task, the putative partner (a computer program) either paid or did not pay attention to participants (high attention condition vs. low attention condition). In the control condition, the partner could not choose when to pay attention to participants. They then played three rounds of the dictator game with the partner. Confirming the previous finding, perceived intimacy was highest in the high attention condition, in the middle in the control condition, and lowest in the low attention condition. More importantly, participants in the high attention condition decided to give more resources to their partner than those in the low attention condition (but the difference between the high attention condition and the control condition was not significant). In addition, self-reported intimacy was positively correlated with the resource allocated to the partner. The results of this study demonstrated that social attention fosters a partner's generosity.

  9. Cuticular antifungals in spiders: density- and condition dependence.

    PubMed

    González-Tokman, Daniel; Ruch, Jasmin; Pulpitel, Tamara; Ponton, Fleur

    2014-01-01

    Animals living in groups face a high risk of disease contagion. In many arthropod species, cuticular antimicrobials constitute the first protective barrier that prevents infections. Here we report that group-living spiders produce cuticular chemicals which inhibit fungal growth. Given that cuticular antifungals may be costly to produce, we explored whether they can be modulated according to the risk of contagion (i.e. under high densities). For this purpose, we quantified cuticular antifungal activity in the subsocial crab spider Diaea ergandros in both natural nests and experimentally manipulated nests of varying density. We quantified the body-condition of spiders to test whether antifungal activity is condition dependent, as well as the effect of spider density on body-condition. We predicted cuticular antifungal activity to increase and body-condition to decrease with high spider densities, and that antifungal activity would be inversely related to body-condition. Contrary to our predictions, antifungal activity was neither density- nor condition-dependent. However, body-condition decreased with density in natural nests, but increased in experimental nests. We suggest that pathogen pressure is so important in nature that it maintains high levels of cuticular antifungal activity in spiders, impacting negatively on individual energetic condition. Future studies should identify the chemical structure of the isolated antifungal compounds in order to understand the physiological basis of a trade-off between disease prevention and energetic condition caused by group living, and its consequences in the evolution of sociality in spiders.

  10. Cuticular Antifungals in Spiders: Density- and Condition Dependence

    PubMed Central

    González-Tokman, Daniel; Ruch, Jasmin; Pulpitel, Tamara; Ponton, Fleur

    2014-01-01

    Animals living in groups face a high risk of disease contagion. In many arthropod species, cuticular antimicrobials constitute the first protective barrier that prevents infections. Here we report that group-living spiders produce cuticular chemicals which inhibit fungal growth. Given that cuticular antifungals may be costly to produce, we explored whether they can be modulated according to the risk of contagion (i.e. under high densities). For this purpose, we quantified cuticular antifungal activity in the subsocial crab spider Diaea ergandros in both natural nests and experimentally manipulated nests of varying density. We quantified the body-condition of spiders to test whether antifungal activity is condition dependent, as well as the effect of spider density on body-condition. We predicted cuticular antifungal activity to increase and body-condition to decrease with high spider densities, and that antifungal activity would be inversely related to body-condition. Contrary to our predictions, antifungal activity was neither density- nor condition-dependent. However, body-condition decreased with density in natural nests, but increased in experimental nests. We suggest that pathogen pressure is so important in nature that it maintains high levels of cuticular antifungal activity in spiders, impacting negatively on individual energetic condition. Future studies should identify the chemical structure of the isolated antifungal compounds in order to understand the physiological basis of a trade-off between disease prevention and energetic condition caused by group living, and its consequences in the evolution of sociality in spiders. PMID:24637563

  11. Calcareous nannofossil assemblage changes across the Paleocene-Eocene thermal maximum: Evidence from a shelf setting

    USGS Publications Warehouse

    Self-Trail, Jean M.; Powars, David S.; Watkins, David K.; Wandless, Gregory A.

    2012-01-01

    Biotic response of calcareous nannoplankton to abrupt warming across the Paleocene/Eocene boundary reflects a primary response to climatically induced parameters including increased continental runoff of freshwater, global acidification of seawater, high sedimentation rates, and calcareous nannoplankton assemblage turnover. We identify ecophenotypic nannofossil species adapted to low pH conditions (Discoaster anartios, D. araneus, Rhomboaster spp.), excursion taxa adapted to the extremely warm climatic conditions (Bomolithus supremus and Coccolithus bownii), three species of the genus Toweius (T. serotinus, T. callosus, T. occultatus) adapted to warm, rather than cool, water conditions, opportunists adapted to high productivity conditions (Coronocyclus bramlettei, Neochiastozygus junctus), and species adapted to oligotropic and/or cool‐water conditions that went into refugium during the PETM (Zygrablithus bijugatus, Calcidiscus? parvicrucis and Chiasmolithus bidens). Discoaster anartios was adapted to meso- to eutrophic, rather than oligotrophic, conditions. Comparison of these data to previous work on sediments deposited on shelf settings suggests that local conditions such as high precipitation rates and possible increase in major storms such as hurricanes resulted in increased continental runoff and high sedimentation rates that affected assemblage response to the PETM.

  12. Working memory load modulates microsaccadic rate.

    PubMed

    Dalmaso, Mario; Castelli, Luigi; Scatturin, Pietro; Galfano, Giovanni

    2017-03-01

    Microsaccades are tiny eye movements that individuals perform unconsciously during fixation. Despite that the nature and the functions of microsaccades are still lively debated, recent evidence has shown an association between these micro eye movements and higher order cognitive processes. Here, in two experiments, we specifically focused on working memory and addressed whether differential memory load could be reflected in a modulation of microsaccade dynamics. In Experiment 1, participants memorized a numerical sequence composed of either two (low-load condition) or five digits (high-load condition), appearing at fixation. The results showed a reduction in the microsaccadic rate in the high-load compared to the low-load condition. In Experiment 2, five red or green digits were always presented at fixation. Participants either memorized the color (low-load condition) or the five digits (high-load condition). Hence, visual stimuli were exactly the same in both conditions. Consistent with Experiment 1, microsaccadic rate was lower in the high-load than in the low-load condition. Overall, these findings reveal that an engagement of working memory can have an impact on microsaccadic rate, consistent with the view that microsaccade generation is pervious to top-down processes.

  13. Interhemispheric modulation of dual-mode, noninvasive brain stimulation on motor function.

    PubMed

    Park, Eunhee; Kim, Yun-Hee; Chang, Won Hyuk; Kwon, Tae Gun; Shin, Yong-Il

    2014-06-01

    To investigate the effects of simultaneous, bihemispheric, dual-mode stimulation using repetitive transcranial magnetic stimulation (rTMS) and transcranial direct current stimulation (tDCS) on motor functions and cortical excitability in healthy individuals. Twenty-five healthy, right-handed volunteers (10 men, 15 women; mean age, 25.5 years) were enrolled. All participants received four randomly arranged, dual-mode, simultaneous stimulations under the following conditions: condition 1, high-frequency rTMS over the right primary motor cortex (M1) and sham tDCS over the left M1; condition 2, high-frequency rTMS over the right M1 and anodal tDCS over the left M1; condition 3, high-frequency rTMS over the right M1 and cathodal tDCS over the left M1; and condition 4, sham rTMS and sham tDCS. The cortical excitability of the right M1 and motor functions of the left hand were assessed before and after each simulation. Motor evoked potential (MEP) amplitudes after stimulation were significantly higher than before stimulation, under the conditions 1 and 2. The MEP amplitude in condition 2 was higher than both conditions 3 and 4, while the MEP amplitude in condition 1 was higher than condition 4. The results of the Purdue Pegboard test and the box and block test showed significant improvement in conditions 1 and 2 after stimulation. Simultaneous stimulation by anodal tDCS over the left M1 with high-frequency rTMS over the right M1 could produce interhemispheric modulation and homeostatic plasticity, which resulted in modulation of cortical excitability and motor functions.

  14. Electrostatic Studies for the 2008 Hubble Service Repair Mission

    NASA Technical Reports Server (NTRS)

    Buhler, C. R.; Clements, J. S.; Calle, C. I.

    2012-01-01

    High vacuum triboelectric testing of space materials was required to identify possible Electrostatic Discharge (ESD) concerns for the astronauts in space during electronics board replacement on the Hubble Space Telescope. Testing under high vacuum conditions with common materials resulted in some interesting results. Many materials were able to charge to high levels which did not dissipate quickly even when grounded. Certain materials were able to charge up in contact with grounded metals while others were not. An interesting result was that like materials did not exchange electrostatic charge under high vacuum conditions. The most surprising experimental result is the lack of brush discharges from charged insulators under high vacuum conditions.

  15. Featured Article: Inhibition of diabetic cataract by glucose tolerance factor extracted from yeast

    PubMed Central

    Cohen, Revital; Eliaz, Anat; Dovrat, Ahuva

    2016-01-01

    Diabetes leads to many complications; among them is the development of cataract. Hyperglycemia brings to increased polyol concentration in the lens, to glycation of lens proteins, and to elevated level of ROS (Reactive Oxygen Species) causing oxidative stress. The glucose tolerance factor (GTF) was found by several groups to decrease hyperglycemia and oxidative stress both in diabetic animals and humans. The aim of our study was to explore the damages induced by high glucose to the eye lens and to assess the protective effects of GTF both in vivo and in vitro. The in vivo study included control healthy rats, streptozotocin (STZ) diabetic untreated rats, and STZ diabetic rats orally treated with 15 doses of GTF. The diabetic untreated rats developed cataracts, whereas the development of cataract was totally or partially prevented in GTF treated animals. In vitro studies were done on bovine lenses incubated for 14 days. Half of the lenses were incubated in normal glucose conditions, and half in high glucose conditions (450 mg%). To one group of the normal or high glucose condition GTF was added. The optical quality of all the lenses was measured daily by an automated scanning laser system. The control lenses, whether with or without GTF addition, did not show any reduction in their quality. High glucose conditions induced optical damage to the lenses. Addition of GTF to high glucose conditions prevented this damage. High glucose conditions affected the activity of aldose reductase and sodium potassium ATPase in lens epithelial cell. Addition of GTF decreased the destructive changes induced by high glucose conditions. The amount of soluble cortical lens proteins was decreased and structural changes were detected in lenses incubated in high glucose medium. These changes could be prevented when GTF was added to high glucose medium. Our findings demonstrate the anticataractogenic potential of GTF. PMID:26825353

  16. Modulation of ventral striatal activity by cognitive effort

    PubMed Central

    Dobryakova, Ekaterina; Jessup, Ryan K; Tricomi, Elizabeth

    2016-01-01

    Effort discounting theory suggests that the value of a reward should be lower if it was effortful to obtain, whereas contrast theory suggests that the contrast between the costly effort and the reward makes the reward seem more valuable. To test these alternative hypotheses, we used functional magnetic resonance imaging (fMRI) as participants engaged in feedback-based learning that required low or high cognitive effort to obtain positive feedback, while the objective amount of information provided by feedback remained constant. In the low effort condition, a single image was presented with four response options. In the high effort condition, two images were presented, each with two response options, and correct feedback was presented only when participants responded correctly to both of the images. Accuracy was significantly lower for the high effort condition, and all participants reported that the high effort condition was more difficult. A region of the ventral striatum selected for sensitivity to feedback value also showed increased activation to feedback presentation associated with the high effort condition relative to the low effort condition, when controlling for activation from corresponding control conditions where feedback was random. These results suggest that increased cognitive effort produces corresponding increases in positive feedback-related ventral striatum activity, in line with the predictions made by contrast theory. The accomplishment of obtaining a hard-earned intrinsic reward, such as positive feedback, may be particularly likely to promote reward-related brain activity. PMID:27989778

  17. Studying the Interface between Nanomaterials and Biomolecules

    NASA Astrophysics Data System (ADS)

    Torelli, Marco Diego

    As engineered nanomaterials become ubiquitous among society, their inevitable entrance into the environment invites questions as to potential implications. As the field of nanotechnology progresses, responsible development of nanomaterials requires a broad availability of useful tools. To this aim, this work seeks to improve analytical abilities to address fundamental molecular interactions of nanomaterials with biological systems that can be expanded broadly, divided into the following: (1) A model applicable to X-ray photoelectron spectroscopy was developed and validated to correct the over-estimated signal for core:shell nanomaterials that can occur at small particle sizes approaching the electron attenuation length of the material being investigated. (2) To understand the role of underlying substrate in particle interactions, diamond and gold functionalized with a protein resisting molecule (hexaethylene glycol) were compared to test the ability of each to resist adsorption of charged proteins. It was demonstrated that the underlying substrate can have an effect on the ability of to properly resist proteins, with charged proteins adsorbing to gold, believed to be due to the ability of gold to form an image dipole. (3) To advance the use of nanodiamond in biological settings, methods to create robust chemical linkages at single digit sizes were developed. Alkene based oligo(ethylene glycol) molecules were successfully photochemically grafted to fully disaggregated detonation nanodiamond. Because the scalability of such methods currently limits such functionalization broadly, polyelectrolytic wrapping of nanodiamond was developed as a useful and scalable method to produce diamond nanoparticles with varying amine based functionalities. (4) Phage display was adapted as a method to determine chemical functionalities that interact with anatase titanium dioxide below 20 nm. In contrast to finding specific, individual inorganic binding sequences, we lowered the selection stringency to allow for a broader number of peptides to be samples. While no statistical size dependent differences were observed in the amino acid chemistries that interact with anatase TiO2, chemical functionalities and motifs that appear to be important for interaction with nano-anatase were identified. Specifically, positively charged and aromatic motifs working in concert were found to be important.

  18. Comparison of Gene Expression by Sheep and Human Blood Stimulated with the TLR4 Agonists Lipopolysaccharide and Monophosphoryl Lipid A

    PubMed Central

    Enkhbaatar, Perenlei; Nelson, Christina; Salsbury, John R.; Carmical, Joseph R.; Torres, Karen E. O.; Herndon, David; Prough, Donald S.; Luan, Liming; Sherwood, Edward R.

    2015-01-01

    Background Animal models that mimic human biology are important for successful translation of basic science discoveries into the clinical practice. Recent studies in rodents have demonstrated the efficacy of TLR4 agonists as immunomodulators in models of infection. However, rodent models have been criticized for not mimicking important characteristics of the human immune response to microbial products. The goal of this study was to compare genomic responses of human and sheep blood to the TLR4 agonists lipopolysaccharide (LPS) and monophosphoryl lipid A (MPLA). Methods Venous blood, withdrawn from six healthy human adult volunteers (~ 28 years old) and six healthy adult female sheep (~3 years old), was mixed with 30 μL of PBS, LPS (1μg/mL) or MPLA (10μg/mL) and incubated at room temperature for 90 minutes on a rolling rocker. After incubation, 2.5 mL of blood was transferred to Paxgene Blood RNA tubes. Gene expression analysis was performed using an Agilent Bioanalyzer with the RNA6000 Nano Lab Chip. Agilent gene expression microarrays were scanned with a G2565 Microarray Scanner. Differentially expressed genes were identified. Results 11,431 human and 4,992 sheep probes were detected above background. Among them 1,029 human and 175 sheep genes were differentially expressed at a stringency of 1.5-fold change (p<0.05). Of the 175 sheep genes, 54 had a known human orthologue. Among those genes, 22 had > 1.5-fold changes in human samples. Genes of major inflammatory mediators, such as IL-1, IL-6 and IL-8, TNF alpha, NF-kappaB, ETS2, PTGS2, PTX3, CXCL16, KYNU, and CLEC4E were similarly (>2-fold) upregulated by LPS and MPLA in both species. Conclusion The genomic responses of peripheral blood to LPS and MPLA in sheep are quite similar to those observed in humans, supporting the use of the ovine model for translational studies that mimic human inflammatory diseases and the study of TLR-based immunomodulators. PMID:26640957

  19. Comparison of Gene Expression by Sheep and Human Blood Stimulated with the TLR4 Agonists Lipopolysaccharide and Monophosphoryl Lipid A.

    PubMed

    Enkhbaatar, Perenlei; Nelson, Christina; Salsbury, John R; Carmical, Joseph R; Torres, Karen E O; Herndon, David; Prough, Donald S; Luan, Liming; Sherwood, Edward R

    2015-01-01

    Animal models that mimic human biology are important for successful translation of basic science discoveries into the clinical practice. Recent studies in rodents have demonstrated the efficacy of TLR4 agonists as immunomodulators in models of infection. However, rodent models have been criticized for not mimicking important characteristics of the human immune response to microbial products. The goal of this study was to compare genomic responses of human and sheep blood to the TLR4 agonists lipopolysaccharide (LPS) and monophosphoryl lipid A (MPLA). Venous blood, withdrawn from six healthy human adult volunteers (~ 28 years old) and six healthy adult female sheep (~3 years old), was mixed with 30 μL of PBS, LPS (1μg/mL) or MPLA (10μg/mL) and incubated at room temperature for 90 minutes on a rolling rocker. After incubation, 2.5 mL of blood was transferred to Paxgene Blood RNA tubes. Gene expression analysis was performed using an Agilent Bioanalyzer with the RNA6000 Nano Lab Chip. Agilent gene expression microarrays were scanned with a G2565 Microarray Scanner. Differentially expressed genes were identified. 11,431 human and 4,992 sheep probes were detected above background. Among them 1,029 human and 175 sheep genes were differentially expressed at a stringency of 1.5-fold change (p<0.05). Of the 175 sheep genes, 54 had a known human orthologue. Among those genes, 22 had > 1.5-fold changes in human samples. Genes of major inflammatory mediators, such as IL-1, IL-6 and IL-8, TNF alpha, NF-kappaB, ETS2, PTGS2, PTX3, CXCL16, KYNU, and CLEC4E were similarly (>2-fold) upregulated by LPS and MPLA in both species. The genomic responses of peripheral blood to LPS and MPLA in sheep are quite similar to those observed in humans, supporting the use of the ovine model for translational studies that mimic human inflammatory diseases and the study of TLR-based immunomodulators.

  20. The influence of government actions on innovative activities in the development of environmental technologies to control sulfur dioxide emissions from stationary sources

    NASA Astrophysics Data System (ADS)

    Taylor, Margaret R.

    2001-12-01

    A better understanding of the influence of government actions on innovation is needed to inform future policy endeavors in areas ranging from industrial competitiveness to environmentally sustainable growth. Environmental control technology is a rich area for the study of this influence, since government has stronger incentives to promote innovation in these technologies than does the private sector. This dissertation investigated the case of sulfur dioxide (SO2) control technologies for electric power plants. In studying innovation in these technologies, it was very important to understand the details of these technologies as well as their long organizational history. These technologies have been affected by government actions ranging from government-sponsored research and technology transfer mechanisms to national regulatory events. The dissertation integrated insights from several complementary and repeatable innovation evaluation methods; this approach supported a fuller understanding of innovation while it structured the research results for potential future comparative analysis. Innovative activities were investigated through: patent activity analysis; technical content analysis and researcher co-authorship network analysis in a conference held for over twenty years; learning curve analysis for eighty-eight U.S. power plants; and a dozen expert interviews from a variety of innovative actors. Innovative outcomes were investigated through: analysis of observed improvements in newly installed technologies over time; evaluation of historic cost studies on standardized systems; and expert interviews. Several policy-relevant findings resulted from this dissertation. (1) The existence of national government regulation stimulated inventive activity more than government research support alone. (2) The existence and the anticipation of government regulation appeared to spur inventive activity, while regulatory stringency appeared to drive inventive activity and the communication process underlying knowledge transfer and diffusion. (3) The regulatory-forced adoption of SO2 control technologies led to a learning curve effect in which operating experience with the equipment resulted in significant cost improvements. This learning curve effect is comparable with findings in many other industries and is likely to be useful in predictions of the costs of future environmental technologies. (4) Performance improvements and cost reductions occurred in a quantifiable fashion as the technology became more widely adopted.

  1. Social cost of carbon pricing of power sector CO2: accounting for leakage and other social implications from subnational policies

    NASA Astrophysics Data System (ADS)

    Bistline, John E.; Rose, Steven K.

    2018-01-01

    In environments where climate policy has partial coverage or unequal participation, carbon dioxide (CO2) emissions or economic activity may shift to locations and sectors where emissions are unregulated. This is referred to as leakage. Leakage can offset or augment emissions reductions associated with a policy, which has important environmental and economic implications. Although leakage has been studied at national levels, analysis of leakage for subnational policies is limited. This is despite greater market integration and many existing state and regional environmental regulations in the US. This study explores leakage potential, net emissions changes, and other social implications in the US energy system with regionally differentiated pricing of power sector CO2 emissions. We undertake an economic analysis using EPRI’s US-REGEN model, where power sector CO2 emissions are priced in individual US regions with a range of social cost of carbon (SCC) values. SCC estimates are being considered by policy-makers for valuing potential societal damages from CO2 emissions. In this study, we evaluate the emissions implications within the SCC pricing region, within the power sector outside the SCC region, and outside the power sector (i.e. in the rest of the energy system). Results indicate that CO2 leakage is possible within and outside the electric sector, ranging from negative 70% to over 80% in our scenarios, with primarily positive leakage outcomes. Typically ignored in policy analysis, leakage would affect CO2 reduction benefits. We also observe other potential societal effects within and across regions, such as higher electricity prices, changes in power sector investments, and overall consumption losses. Efforts to reduce leakage, such as constraining power imports into the SCC pricing region likely reduce leakage, but could also result in lower net emissions reductions, as well as larger price increases. Thus, it is important to look beyond leakage and consider a broader set of environmental and economic metrics. Leakage rates, net emissions outcomes, electricity price changes, fuel market effects, and macroeconomic costs vary by region of the country, time, policy stringency, policy design (e.g. leakage mitigation provisions), policy environment in neighboring regions, and price responsiveness of demand.

  2. Inert gas narcosis disrupts encoding but not retrieval of long term memory.

    PubMed

    Hobbs, Malcolm; Kneller, Wendy

    2015-05-15

    Exposure to increased ambient pressure causes inert gas narcosis of which one symptom is long-term memory (LTM) impairment. Narcosis is posited to impair LTM by disrupting information encoding, retrieval (self-guided search), or both. The effect of narcosis on the encoding and retrieval of LTM was investigated by testing the effect of learning-recall pressure and levels of processing (LoP) on the free-recall of word lists in divers underwater. All participants (n=60) took part in four conditions in which words were learnt and then recalled at either low pressure (1.4-1.9atm/4-9msw) or high pressure (4.4-5.0atm/34-40msw), as manipulated by changes in depth underwater: low-low (LL), low-high(LH), high-high (HH), and high-low (HL). In addition, participants were assigned to either a deep or shallow processing condition, using LoP methodology. Free-recall memory ability was significantly impaired only when words were initially learned at high pressure (HH & HL conditions). When words were learned at low pressure and then recalled at low pressure (LL condition) or high pressure (LH condition) free-recall was not impaired. Although numerically superior in several conditions, deeper processing failed to significantly improve free-recall ability in any of the learning-recall conditions. This pattern of results support the hypothesis that narcosis disrupts encoding of information into LTM, while retrieval appears to be unaffected. These findings are discussed in relation to similar effects reported by some memory impairing drugs and the practical implications for workers in pressurised environments. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. A Neutral Control Condition for Hypnosis Experiments: "Wiki" Text.

    PubMed

    Varga, Katalin; Kekecs, Zoltán; Myhre, P S; Józsa, Emese

    2017-01-01

    A new control condition called Wiki is introduced. Key themes of each test suggestion of the Stanford Hypnotic Susceptibility Scale, Form C, were matched by a corresponding extract from Wikipedia.org. The authors compared phenomenological reports of participants across 4 conditions: hypnosis split into high and low hypnotizable subgroups, music, and Wiki condition, using the Phenomenology of Consciousness Inventory. High hypnotizables undergoing hypnosis reported higher altered experience and altered states of awareness than individuals in the Wiki condition, supporting the authors' hypothesis that the Wiki condition does not evoke an altered state of consciousness (internal dialogue, volitional control, and self-awareness did not differ). Wiki might be a viable control condition in hypnosis research given further examination.

  4. Homeland Security Advisory System: An Assessment of Its Ability to Formulate a Risk Message

    DTIC Science & Technology

    2010-06-01

    37 C. ELEVATED CONDITION ( YELLOW ) .....................................................38 D. HIGH CONDITION (ORANGE...Low = Green, Guarded = Blue, Elevated = Yellow , High = Orange and Severe = Red. Each threat condition is associated with specific protective measures...i.e., hazardous material spills, nuclear materials releases), geological events (i.e., earthquakes, volcanoes ), climatological events (i.e., tornados

  5. Genetic and Biochemical Analysis of High Iron Toxicity in Yeast

    PubMed Central

    Lin, Huilan; Li, Liangtao; Jia, Xuan; Ward, Diane McVey; Kaplan, Jerry

    2011-01-01

    Iron storage in yeast requires the activity of the vacuolar iron transporter Ccc1. Yeast with an intact CCC1 are resistant to iron toxicity, but deletion of CCC1 renders yeast susceptible to iron toxicity. We used genetic and biochemical analysis to identify suppressors of high iron toxicity in Δccc1 cells to probe the mechanism of high iron toxicity. All genes identified as suppressors of high iron toxicity in aerobically grown Δccc1 cells encode organelle iron transporters including mitochondrial iron transporters MRS3, MRS4, and RIM2. Overexpression of MRS3 suppressed high iron toxicity by decreasing cytosolic iron through mitochondrial iron accumulation. Under anaerobic conditions, Δccc1 cells were still sensitive to high iron toxicity, but overexpression of MRS3 did not suppress iron toxicity and did not result in mitochondrial iron accumulation. We conclude that Mrs3/Mrs4 can sequester iron within mitochondria under aerobic conditions but not anaerobic conditions. We show that iron toxicity in Δccc1 cells occurred under both aerobic and anaerobic conditions. Microarray analysis showed no evidence of oxidative damage under anaerobic conditions, suggesting that iron toxicity may not be solely due to oxidative damage. Deletion of TSA1, which encodes a peroxiredoxin, exacerbated iron toxicity in Δccc1 cells under both aerobic and anaerobic conditions, suggesting a unique role for Tsa1 in iron toxicity. PMID:21115478

  6. On High-Order Radiation Boundary Conditions

    NASA Technical Reports Server (NTRS)

    Hagstrom, Thomas

    1995-01-01

    In this paper we develop the theory of high-order radiation boundary conditions for wave propagation problems. In particular, we study the convergence of sequences of time-local approximate conditions to the exact boundary condition, and subsequently estimate the error in the solutions obtained using these approximations. We show that for finite times the Pade approximants proposed by Engquist and Majda lead to exponential convergence if the solution is smooth, but that good long-time error estimates cannot hold for spatially local conditions. Applications in fluid dynamics are also discussed.

  7. Xanthoma

    MedlinePlus

    ... among older adults and people with high blood lipids (fats). Xanthomas vary in size. Some are very ... medical condition that involves an increase in blood lipids. Such conditions include: Certain cancers Diabetes High blood ...

  8. Assessing Marine Microbial Induced Corrosion at Santa Catalina Island, California

    PubMed Central

    Ramírez, Gustavo A.; Hoffman, Colleen L.; Lee, Michael D.; Lesniewski, Ryan A.; Barco, Roman A.; Garber, Arkadiy; Toner, Brandy M.; Wheat, Charles G.; Edwards, Katrina J.; Orcutt, Beth N.

    2016-01-01

    High iron and eutrophic conditions are reported as environmental factors leading to accelerated low-water corrosion, an enhanced form of near-shore microbial induced corrosion. To explore this hypothesis, we deployed flow-through colonization systems in laboratory-based aquarium tanks under a continuous flow of surface seawater from Santa Catalina Island, CA, USA, for periods of 2 and 6 months. Substrates consisted of mild steel – a major constituent of maritime infrastructure – and the naturally occurring iron sulfide mineral pyrite. Four conditions were tested: free-venting “high-flux” conditions; a “stagnant” condition; an “active” flow-through condition with seawater slowly pumped over the substrates; and an “enrichment” condition where the slow pumping of seawater was supplemented with nutrient rich medium. Electron microscopy analyses of the 2-month high flux incubations document coating of substrates with “twisted stalks,” resembling iron oxyhydroxide bioprecipitates made by marine neutrophilic Fe-oxidizing bacteria (FeOB). Six-month incubations exhibit increased biofilm and substrate corrosion in the active flow and nutrient enriched conditions relative to the stagnant condition. A scarcity of twisted stalks was observed for all 6 month slow-flow conditions compared to the high-flux condition, which may be attributable to oxygen concentrations in the slow-flux conditions being prohibitively low for sustained growth of stalk-producing bacteria. All substrates developed microbial communities reflective of the original seawater input, as based on 16S rRNA gene sequencing. Deltaproteobacteria sequences increased in relative abundance in the active flow and nutrient enrichment conditions, whereas Gammaproteobacteria sequences were relatively more abundant in the stagnant condition. These results indicate that (i) high-flux incubations with higher oxygen availability favor the development of biofilms with twisted stalks resembling those of marine neutrophilic FeOB and (ii) long-term nutrient stimulation results in substrate corrosion and biofilms with different bacterial community composition and structure relative to stagnant and non-nutritionally enhanced incubations. Similar microbial succession scenarios, involving increases in nutritional input leading to the proliferation of anaerobic iron and sulfur-cycling guilds, may occur at the nearby Port of Los Angeles and cause potential damage to maritime port infrastructure. PMID:27826293

  9. Rats with ventral hippocampal damage are impaired at various forms of learning including conditioned inhibition, spatial navigation, and discriminative fear conditioning to similar contexts.

    PubMed

    McDonald, Robert J; Balog, R J; Lee, Justin Q; Stuart, Emily E; Carrels, Brianna B; Hong, Nancy S

    2018-10-01

    The ventral hippocampus (vHPC) has been implicated in learning and memory functions that seem to differ from its dorsal counterpart. The goal of this series of experiments was to provide further insight into the functional contributions of the vHPC. Our previous work implicated the vHPC in spatial learning, inhibitory learning, and fear conditioning to context. However, the specific role of vHPC on these different forms of learning are not clear. Accordingly, we assessed the effects of neurotoxic lesions of the ventral hippocampus on retention of a conditioned inhibitory association, early versus late spatial navigation in the water task, and discriminative fear conditioning to context under high ambiguity conditions. The results showed that the vHPC was necessary for the expression of conditioned inhibition, early spatial learning, and discriminative fear conditioning to context when the paired and unpaired contexts have high cue overlap. We argue that this pattern of effects, combined with previous work, suggests a key role for vHPC in the utilization of broad contextual representations for inhibition and discriminative memory in high ambiguity conditions. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Automated condition-invariable neurite segmentation and synapse classification using textural analysis-based machine-learning algorithms

    PubMed Central

    Kandaswamy, Umasankar; Rotman, Ziv; Watt, Dana; Schillebeeckx, Ian; Cavalli, Valeria; Klyachko, Vitaly

    2013-01-01

    High-resolution live-cell imaging studies of neuronal structure and function are characterized by large variability in image acquisition conditions due to background and sample variations as well as low signal-to-noise ratio. The lack of automated image analysis tools that can be generalized for varying image acquisition conditions represents one of the main challenges in the field of biomedical image analysis. Specifically, segmentation of the axonal/dendritic arborizations in brightfield or fluorescence imaging studies is extremely labor-intensive and still performed mostly manually. Here we describe a fully automated machine-learning approach based on textural analysis algorithms for segmenting neuronal arborizations in high-resolution brightfield images of live cultured neurons. We compare performance of our algorithm to manual segmentation and show that it combines 90% accuracy, with similarly high levels of specificity and sensitivity. Moreover, the algorithm maintains high performance levels under a wide range of image acquisition conditions indicating that it is largely condition-invariable. We further describe an application of this algorithm to fully automated synapse localization and classification in fluorescence imaging studies based on synaptic activity. Textural analysis-based machine-learning approach thus offers a high performance condition-invariable tool for automated neurite segmentation. PMID:23261652

  11. Mechanical characterization of alloys in extreme conditions of high strain rates and high temperature

    NASA Astrophysics Data System (ADS)

    Cadoni, Ezio

    2018-03-01

    The aim of this paper is the description of the mechanical characterization of alloys under extreme conditions of temperature and loading. In fact, in the frame of the Cost Action CA15102 “Solutions for Critical Raw Materials Under Extreme Conditions (CRM-EXTREME)” this aspect is crucial and many industrial applications have to consider the dynamic response of materials. Indeed, for a reduction and substitution of CRMs in alloys is necessary to design the materials and understand if the new materials behave better or if the substitution or reduction badly affect their performance. For this reason, a deep knowledge of the mechanical behaviour at high strain-rates of considered materials is required. In general, machinery manufacturing industry or transport industry as well as energy industry have important dynamic phenomena that are simultaneously affected by extended strain, high strain-rate, damage and pressure, as well as conspicuous temperature gradients. The experimental results in extreme conditions of high strain rate and high temperature of an austenitic stainless steel as well as a high-chromium tempered martensitic reduced activation steel Eurofer97 are presented.

  12. Mental imagery and post-event processing in anticipation of a speech performance among socially anxious individuals.

    PubMed

    Brozovich, Faith A; Heimberg, Richard G

    2013-12-01

    The present study investigated whether post-event processing (PEP) involving mental imagery about a past speech is particularly detrimental for socially anxious individuals who are currently anticipating giving a speech. One hundred fourteen high and low socially anxious participants were told they would give a 5 min impromptu speech at the end of the experimental session. They were randomly assigned to one of three manipulation conditions: post-event processing about a past speech incorporating imagery (PEP-Imagery), semantic post-event processing about a past speech (PEP-Semantic), or a control condition, (n=19 per experimental group, per condition [high vs low socially anxious]). After the condition inductions, individuals' anxiety, their predictions of performance in the anticipated speech, and their interpretations of other ambiguous social events were measured. Consistent with predictions, high socially anxious individuals in the PEP-Imagery condition displayed greater anxiety than individuals in the other conditions immediately following the induction and before the anticipated speech task. They also interpreted ambiguous social scenarios in a more socially anxious manner than socially anxious individuals in the control condition. High socially anxious individuals made more negative predictions about their upcoming speech performance than low anxious participants in all conditions. The impact of imagery during post-event processing in social anxiety and its implications are discussed. © 2013.

  13. Acquisition and Maintenance of Scripts in Aphasia: A Comparison of Two Cuing Conditions

    PubMed Central

    Cherney, Leora R.; Kaye, Rosalind C.; van Vuuren, Sarel

    2014-01-01

    Purpose This study was designed to compare acquisition and maintenance of scripts under two conditions: High Cue which provided numerous multimodality cues designed to minimize errors, and Low Cue which provided minimal cues. Methods In a randomized controlled cross-over study, eight individuals with chronic aphasia received intensive computer-based script training under two cuing conditions. Each condition lasted three weeks, with a three-week washout period. Trained and untrained scripts were probed for accuracy and rate at baseline, during treatment, immediately post-treatment, and at three and six weeks post-treatment. Significance testing was conducted on gain scores and effect sizes were calculated. Results Training resulted in significant gains in script acquisition with maintenance of skills at three and six weeks post-treatment. Differences between cuing conditions were not significant. When severity of aphasia was considered, there also were no significant differences between conditions, although magnitude of change was greater in the High Cue condition versus the Low Cue condition for those with more severe aphasia. Conclusions Both cuing conditions were effective in acquisition and maintenance of scripts. The High Cue condition may be advantageous for those with more severe aphasia. Findings support the clinical use of script training and importance of considering aphasia severity. PMID:24686911

  14. Improving Reading Comprehension of At-Risk High-School Students: The ART of Reading Program

    ERIC Educational Resources Information Center

    McCallum, R. Steve; Krohn, Katherine R.; Skinner, Christopher H.; Hilton-Prillhart, Angela; Hopkins, Michael; Waller, Steven; Polite, Fritz

    2011-01-01

    Participants (115 low-socioeconomic-status [SES], inner-city, high-school students) were exposed to three reading conditions: (1) a control condition in which students silently read brief selected passages; (2) an experimental condition in which students were prompted to perform a three-part (Ask, Read, and Tell [ART]) comprehension enhancement…

  15. Infants' Perception of Affordances of Slopes under High- and Low-Friction Conditions

    ERIC Educational Resources Information Center

    Adolph, Karen E.; Joh, Amy S.; Eppler, Marion A.

    2010-01-01

    Three experiments investigated whether 14- and 15-month-old infants use information for both friction and slant for prospective control of locomotion down slopes. In Experiment 1, high- and low-friction conditions were interleaved on a range of shallow and steep slopes. In Experiment 2, friction conditions were blocked. In Experiment 3, the…

  16. Communities that thrive in extreme conditions captured from a freshwater lake.

    PubMed

    Low-Décarie, Etienne; Fussmann, Gregor F; Dumbrell, Alex J; Bell, Graham

    2016-09-01

    Organisms that can grow in extreme conditions would be expected to be confined to extreme environments. However, we were able to capture highly productive communities of algae and bacteria capable of growing in acidic (pH 2), basic (pH 12) and saline (40 ppt) conditions from an ordinary freshwater lake. Microbial communities may thus include taxa that are highly productive in conditions that are far outside the range of conditions experienced in their host ecosystem. The organisms we captured were not obligate extremophiles, but were capable of growing in both extreme and benign conditions. The ability to grow in extreme conditions may thus be a common functional attribute in microbial communities. © 2016 The Author(s).

  17. AGEs Induce Apoptosis in Rat Osteoblast Cells by Activating the Caspase-3 Signaling Pathway Under a High-Glucose Environment In Vitro.

    PubMed

    Liu, Jiaqiang; Mao, Jing; Jiang, Yi; Xia, Lunguo; Mao, Lixia; Wu, Yong; Ma, Pan; Fang, Bing

    2016-03-01

    Advanced glycation end products (AGEs) accumulate under high-glucose conditions and affect the healing of bone damage through various pathways; however, the detail mechanisms underlying these changes are unknown. In this study, we investigated the effects of AGEs on the apoptosis of in vitro-cultured rat osteoblasts under high-glucose conditions and explored the underlying mechanisms of these effects. First, we cultured rat osteoblasts and determined the accumulation of AGEs in the culture medium under high-glucose conditions. Then, we cultured rat osteoblasts under a high glucose concentration (35 mM), a normal glucose concentration (5.5 mM), and a normal glucose concentration (5.5 mM) in the presence of AGEs. We examined the effects of high glucose and AGEs on the apoptosis of rat osteoblasts at different time points and further analyzed the activity and changes in the levels of procaspase-3, caspase-3, and the caspase-3 substrate poly ADP-ribose polymerase (PARP). Finally, we added sRAGE (soluble RAGE) (an AGE inhibitor) or DEVD (a caspase-3 inhibitor) to each culture group and examined apoptosis under each culture condition and the changes in the levels of procaspase-3, caspase-3, and its substrate PARP. The results showed that the high-glucose condition and the addition of AGEs increased the apoptosis of rat osteoblast cells and simultaneously increased the activity and quantity of caspase-3. These increases could be inhibited by the AGE inhibitor sRAGE or the caspase-3 inhibitor DEVD. The above results demonstrate that high-glucose conditions lead to the accumulation of AGEs and activation of the caspase-3 signaling pathway, resulting in the increased apoptosis of cultured rat osteoblast cells.

  18. Gas diffusion layers coated with a microporous layer containing hydrophilic carbon nanotubes for performance enhancement of polymer electrolyte fuel cells under both low and high humidity conditions

    NASA Astrophysics Data System (ADS)

    Kitahara, Tatsumi; Nakajima, Hironori; Okamura, Kosuke

    2015-06-01

    Gas diffusion layers (GDLs) coated with a hydrophobic microporous layer (MPL) composed of carbon black and polytetrafluoroethylene (PTFE) have been commonly used to improve the water management characteristics of polymer electrolyte fuel cells (PEFCs). However, the hydrophobic MPL coated GDL designed to prevent dehydration of the membrane under low humidity conditions is generally inferior at reducing flooding under high humidity conditions. It is therefore important to develop a robust MPL coated GDL that can enhance the PEFC performance regardless of the humidity conditions. In the present study, a GDL coated with an MPL containing hydrophilic carbon nanotubes (CNTs) was developed. The less hydrophobic pores incorporating CNTs are effective at conserving the membrane humidity under low humidity conditions. The MPL with CNTs is also effective at expelling excess water from the catalyst layer while maintaining oxygen flow pathways from the GDL substrate, allowing the mean flow pore diameter to be decreased to 2 μm without reducing the ability of the MPL to prevent flooding under high humidity conditions. An MPL coated GDL with a CNT content of 4 mass% exhibits significantly higher performance under both low and high humidity conditions than a hydrophobic MPL coated GDL.

  19. An efficient protocol for the synthesis of highly sensitive indole imines utilizing green chemistry: optimization of reaction conditions.

    PubMed

    Nisar, Bushra; Rubab, Syeda Laila; Raza, Abdul Rauf; Tariq, Sobia; Sultan, Ayesha; Tahir, Muhammad Nawaz

    2018-04-11

    Novel and highly sensitive indole-based imines have been synthesized. Their synthesis has been compared employing a variety of protocols. Ultimately, a convenient, economical and high yielding set of conditions employing green chemistry have been designed for their synthesis.

  20. Rapid prefrontal cortex activation towards aversively paired faces and enhanced contingency detection are observed in highly trait-anxious women under challenging conditions

    PubMed Central

    Rehbein, Maimu Alissa; Wessing, Ida; Zwitserlood, Pienie; Steinberg, Christian; Eden, Annuschka Salima; Dobel, Christian; Junghöfer, Markus

    2015-01-01

    Relative to healthy controls, anxiety-disorder patients show anomalies in classical conditioning that may either result from, or provide a risk factor for, clinically relevant anxiety. Here, we investigated whether healthy participants with enhanced anxiety vulnerability show abnormalities in a challenging affective-conditioning paradigm, in which many stimulus-reinforcer associations had to be acquired with only few learning trials. Forty-seven high and low trait-anxious females underwent MultiCS conditioning, in which 52 different neutral faces (CS+) were paired with an aversive noise (US), while further 52 faces (CS−) remained unpaired. Emotional learning was assessed by evaluative (rating), behavioral (dot-probe, contingency report), and neurophysiological (magnetoencephalography) measures before, during, and after learning. High and low trait-anxious groups did not differ in evaluative ratings or response priming before or after conditioning. High trait-anxious women, however, were better than low trait-anxious women at reporting CS+/US contingencies after conditioning, and showed an enhanced prefrontal cortex (PFC) activation towards CS+ in the M1 (i.e., 80–117 ms) and M170 time intervals (i.e., 140–160 ms) during acquisition. These effects in MultiCS conditioning observed in individuals with elevated trait anxiety are consistent with theories of enhanced conditionability in anxiety vulnerability. Furthermore, they point towards increased threat monitoring and detection in highly trait-anxious females, possibly mediated by alterations in visual working memory. PMID:26113814

Top