Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

An oligonucleotide array for the identification and differentiation of bacteria pathogenic on potato.

PubMed

Fessehaie, Anania; De Boer, Solke H; Lévesque, C André

2003-03-01

ABSTRACT Oligonucleotides, 16 to 24 bases long, were selected from the 3' end of the 16S gene and the 16S-23S intergenic spacer regions of bacteria pathogenic on potato, including Clavibacter michiganensis subsp. sepedonicus, Ralstonia solanacearum, and the pectolytic erwinias, including Erwinia carotovora subsp. atroseptica and carotovora and E. chrysanthemi. Oligonucleotides were designed and formatted into an array by pin spotting on nylon membranes. Genomic DNA from bacterial cultures was amplified by polymerase chain reaction using conserved ribosomal primers and labeled simultaneously with digoxigenin-dUTP. Hybridization of amplicons to the array and subsequent serological detection of digoxigenin label revealed different hybridization patterns that were distinct for each species and subspecies tested. Hybridization of amplicons generally was restricted to appropriate homologous oligonucleotides and cross-hybridization with heterologous oligonucleotides was rare. Hybridization patterns were recorded as separate gray values for each hybridized spot and revealed a consistent pattern for multiple strains of each species or subspecies isolated from diverse geographical regions. In preliminary tests, bacteria could be correctly identified and detected by hybridizing to the array amplicons from mixed cultures and inoculated potato tissue.

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Photolithographic Synthesis of High-Density DNA and RNA Arrays on Flexible, Transparent, and Easily Subdivided Plastic Substrates.

PubMed

Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M

2015-11-17

The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.

A Complex 6p25 Rearrangement in a Child With Multiple Epiphyseal Dysplasia

PubMed Central

Bedoyan, Jirair K.; Lesperance, Marci M.; Ackley, Todd; Iyer, Ramaswamy K.; Innis, Jeffrey W.; Misra, Vinod K.

2015-01-01

Genomic rearrangements are increasingly recognized as important contributors to human disease. Here we report on an 11½-year-old child with myopia, Duane retraction syndrome, bilateral mixed hearing loss, skeletal anomalies including multiple epiphyseal dysplasia, and global developmental delay, and a complex 6p25 genomic rearrangement. We have employed oligonucleotide-based comparative genomic hybridization arrays (aCGH) of different resolutions (44 and 244K) as well as a 1 M single nucleotide polymorphism (SNP) array to analyze this complex rearrangement. Our analyses reveal a complex rearrangement involving a ~2.21 Mb interstitial deletion, a ~240 kb terminal deletion, and a 70–80 kb region in between these two deletions that shows maintenance of genomic copy number. The interstitial deletion contains eight known genes, including three Forkhead box containing (FOX) transcription factors (FOXQ1, FOXF2, and FOXC1). The region maintaining genomic copy number partly overlaps the dual specificity protein phosphatase 22 (DUSP22) gene. Array analyses suggest a homozygous loss of genomic material at the 5′ end of DUSP22, which was corroborated using TaqMan® copy number analysis. It is possible that this homozygous genomic loss may render both copies of DUSP22 or its products non-functional. Our analysis suggests a rearrangement mechanism distinct from a previously reported replication-based error-prone mechanism without template switching for a specific 6p25 rearrangement with a 1.22 Mb interstitial deletion. Our study demonstrates the utility and limitations of using oligonucleotide-based aCGH and SNP array technologies of increasing resolutions in order to identify complex DNA rearrangements and gene disruptions. PMID:21204225

Customized Oligonucleotide Array-Based Comparative Genomic Hybridization as a Clinical Assay for Genomic Profiling of Chronic Lymphocytic Leukemia

PubMed Central

Sargent, Rachel; Jones, Dan; Abruzzo, Lynne V.; Yao, Hui; Bonderover, Jaime; Cisneros, Marissa; Wierda, William G.; Keating, Michael J.; Luthra, Rajyalakshmi

2009-01-01

Chromosome gains and losses used for risk stratification in chronic lymphocytic leukemia (CLL) are commonly assessed by multiprobe fluorescence in situ hybridization (FISH) studies. We designed and validated a customized array-comparative genomic hybridization (aCGH) platform as a clinical assay for CLL genomic profiling. A 60-mer, 44,000-probe oligonucleotide array with a 50-kb average spatial resolution was augmented with high-density probe tiling at loci that are frequently aberrant in CLL. Aberrations identified by aCGH were compared with those identified by a FISH panel, including locus-specific probes to ATM (11q22.3), the centromeric region of chromosome 12 (12p11.1–q11), D13S319 (13q14.3), LAMP1 (13q34), and TP53 (17p13.1). In 100 CLL samples, aCGH/FISH concordance was seen for 89% of FISH-called aberrations at the ATM (n = 18), D13S319 (n = 42), LAMP (n = 12), and TP53 (n = 22) loci and for chromosome 12 (n = 14). Eighty-four percentage of FISH/aCGH discordant calls were in samples either at or below the limit of aCGH sensitivity (10% to 25% FISH aberration-containing cells). Therefore, aCGH profiling is a feasible routine clinical test with comparable results to multiprobe FISH studies; however, it may be less sensitive than FISH in cases with low-level aberrations. Further, a customized array design can provide comprehensive genomic profiling with additional accuracy in both identifying and defining the extent of small aberrations at target loci. PMID:19074592

Custom oligonucleotide array-based CGH: a reliable diagnostic tool for detection of exonic copy-number changes in multiple targeted genes

PubMed Central

Vasson, Aurélie; Leroux, Céline; Orhant, Lucie; Boimard, Mathieu; Toussaint, Aurélie; Leroy, Chrystel; Commere, Virginie; Ghiotti, Tiffany; Deburgrave, Nathalie; Saillour, Yoann; Atlan, Isabelle; Fouveaut, Corinne; Beldjord, Cherif; Valleix, Sophie; Leturcq, France; Dodé, Catherine; Bienvenu, Thierry; Chelly, Jamel; Cossée, Mireille

2013-01-01

The frequency of disease-related large rearrangements (referred to as copy-number mutations, CNMs) varies among genes, and search for these mutations has an important place in diagnostic strategies. In recent years, CGH method using custom-designed high-density oligonucleotide-based arrays allowed the development of a powerful tool for detection of alterations at the level of exons and made it possible to provide flexibility through the possibility of modeling chips. The aim of our study was to test custom-designed oligonucleotide CGH array in a diagnostic laboratory setting that analyses several genes involved in various genetic diseases, and to compare it with conventional strategies. To this end, we designed a 12-plex CGH array (135k; 135 000 probes/subarray) (Roche Nimblegen) with exonic and intronic oligonucleotide probes covering 26 genes routinely analyzed in the laboratory. We tested control samples with known CNMs and patients for whom genetic causes underlying their disorders were unknown. The contribution of this technique is undeniable. Indeed, it appeared reproducible, reliable and sensitive enough to detect heterozygous single-exon deletions or duplications, complex rearrangements and somatic mosaicism. In addition, it improves reliability of CNM detection and allows determination of boundaries precisely enough to direct targeted sequencing of breakpoints. All of these points, associated with the possibility of a simultaneous analysis of several genes and scalability ‘homemade' make it a valuable tool as a new diagnostic approach of CNMs. PMID:23340513

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Multichannel microchip electrophoresis device fabricated in polycarbonate with an integrated contact conductivity sensor array.

PubMed

Shadpour, Hamed; Hupert, Mateusz L; Patterson, Donald; Liu, Changgeng; Galloway, Michelle; Stryjewski, Wieslaw; Goettert, Jost; Soper, Steven A

2007-02-01

A 16-channel microfluidic chip with an integrated contact conductivity sensor array is presented. The microfluidic network consisted of 16 separation channels that were hot-embossed into polycarbonate (PC) using a high-precision micromilled metal master. All channels were 40 microm deep and 60 microm wide with an effective separation length of 40 mm. A gold (Au) sensor array was lithographically patterned onto a PC cover plate and assembled to the fluidic chip via thermal bonding in such a way that a pair of Au microelectrodes (60 microm wide with a 5 microm spacing) was incorporated into each of the 16 channels and served as independent contact conductivity detectors. The spacing between the corresponding fluidic reservoirs for each separation channel was set to 9 mm, which allowed for loading samples and buffers to all 40 reservoirs situated on the microchip in only five pipetting steps using an 8-channel pipettor. A printed circuit board (PCB) with platinum (Pt) wires was used to distribute the electrophoresis high-voltage to all reservoirs situated on the fluidic chip. Another PCB was used for collecting the conductivity signals from the patterned Au microelectrodes. The device performance was evaluated using microchip capillary zone electrophoresis (mu-CZE) of amino acid, peptide, and protein mixtures as well as oligonucleotides that were separated via microchip capillary electrochromatography (mu-CEC). The separations were performed with an electric field (E) of 90 V/cm and were completed in less than 4 min in all cases. The conductivity detection was carried out using a bipolar pulse voltage waveform with a pulse amplitude of +/-0.6 V and a frequency of 6.0 kHz. The conductivity sensor array concentration limit of detection (SNR = 3) was determined to be 7.1 microM for alanine. The separation efficiency was found to be 6.4 x 10(4), 2.0 x 10(3), 4.8 x 10(3), and 3.4 x 10(2) plates for the mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins, respectively, with an average channel-to-channel migration time reproducibility of 2.8%. The average resolution obtained for mu-CEC of the oligonucleotides and mu-CZE of the amino acids, peptides, and proteins was 4.6, 1.0, 0.9, and 1.0, respectively. To the best of our knowledge, this report is the first to describe a multichannel microchip electrophoresis device with integrated contact conductivity sensor array.

Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

PubMed

Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

2006-08-15

Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

PubMed Central

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian; Ulrich, Eldon L.; Zhao, Qin; Wrobel, Russell L.; Newman, Craig S.; Fox, Brian G.; Phillips, George N.; Markley, John L.; Sussman, Michael R.

2005-01-01

Using a maskless photolithography method, we produced DNA oligonucleotide microarrays with probe sequences tiled throughout the genome of the plant Arabidopsis thaliana. RNA expression was determined for the complete nuclear, mitochondrial, and chloroplast genomes by tiling 5 million 36-mer probes. These probes were hybridized to labeled mRNA isolated from liquid grown T87 cells, an undifferentiated Arabidopsis cell culture line. Transcripts were detected from at least 60% of the nearly 26,330 annotated genes, which included 151 predicted genes that were not identified previously by a similar genome-wide hybridization study on four different cell lines. In comparison with previously published results with 25-mer tiling arrays produced by chromium masking-based photolithography technique, 36-mer oligonucleotide probes were found to be more useful in identifying intron–exon boundaries. Using two-dimensional HPLC tandem mass spectrometry, a small-scale proteomic analysis was performed with the same cells. A large amount of strongly hybridizing RNA was found in regions “antisense” to known genes. Similarity of antisense activities between the 25-mer and 36-mer data sets suggests that it is a reproducible and inherent property of the experiments. Transcription activities were also detected for many of the intergenic regions and the small RNAs, including tRNA, small nuclear RNA, small nucleolar RNA, and microRNA. Expression of tRNAs correlates with genome-wide amino acid usage. PMID:15755812

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian;

Carbon Nanotube Nanoelectrode Array for Ultrasensitive DNA Detection

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

2003-01-01

A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6. The open-end of MWNTs present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. Oligonucleotide probes are selectively functionalized at the open ends cf the nanotube array and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of subattomoles of PCR amplified DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the Ru(bpy)32' amplification mechanism. This system provides a general platform of molecular diagnostics for applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparations.

Integrated analysis of copy number alteration and RNA expression profiles of cancer using a high-resolution whole-genome oligonucleotide array.

PubMed

Jung, Seung-Hyun; Shin, Seung-Hun; Yim, Seon-Hee; Choi, Hye-Sun; Lee, Sug-Hyung; Chung, Yeun-Jun

2009-07-31

Recently, microarray-based comparative genomic hybridization (array-CGH) has emerged as a very efficient technology with higher resolution for the genome-wide identification of copy number alterations (CNA). Although CNAs are thought to affect gene expression, there is no platform currently available for the integrated CNA-expression analysis. To achieve high-resolution copy number analysis integrated with expression profiles, we established human 30k oligoarray-based genome-wide copy number analysis system and explored the applicability of this system for integrated genome and transcriptome analysis using MDA-MB-231 cell line. We compared the CNAs detected by the oligoarray with those detected by the 3k BAC array for validation. The oligoarray identified the single copy difference more accurately and sensitively than the BAC array. Seventeen CNAs detected by both platforms in MDA-MB-231 such as gains of 5p15.33-13.1, 8q11.22-8q21.13, 17p11.2, and losses of 1p32.3, 8p23.3-8p11.21, and 9p21 were consistently identified in previous studies on breast cancer. There were 122 other small CNAs (mean size 1.79 mb) that were detected by oligoarray only, not by BAC-array. We performed genomic qPCR targeting 7 CNA regions, detected by oligoarray only, and one non-CNA region to validate the oligoarray CNA detection. All qPCR results were consistent with the oligoarray-CGH results. When we explored the possibility of combined interpretation of both DNA copy number and RNA expression profiles, mean DNA copy number and RNA expression levels showed a significant correlation. In conclusion, this 30k oligoarray-CGH system can be a reasonable choice for analyzing whole genome CNAs and RNA expression profiles at a lower cost.

Soft Lithography for Oligonucleotide Arrays Fabrication

DTIC Science & Technology

2001-10-25

adenosine; Abbreviated T, C, G, A respectively), the other synthesis reagents and solvents except oxidation agent (seen in Table 1) were purchased...dried by cold blowing before hybridization. Oligonucleotide arrays were hybridized in 200 nM 3’-TCC TCC GAT TCA GAG AGT CC- HEX (PE Biosystems... citrate buffer), 0.1% SDS in 0.1xSSC respectively. The probe array was scanned on the Scanarray Microarray Systems (Packard Biochip Technologies, USA

Immunomodulatory oligonucleotide IMT504: Effects on mesenchymal stem cells as a first-in-class immunoprotective/immunoregenerative therapy

PubMed Central

Zorzopulos, Jorge; Opal, Steven M; Hernando-Insúa, Andrés; Rodriguez, Juan M; Elías, Fernanda; Fló, Juan; López, Ricardo A; Chasseing, Norma A; Lux-Lantos, Victoria A; Coronel, Maria F; Franco, Raul; Montaner, Alejandro D; Horn, David L

2017-01-01

The immune responses of humans and animals to insults (i.e., infections, traumas, tumoral transformation and radiation) are based on an intricate network of cells and chemical messengers. Abnormally high inflammation immediately after insult or abnormally prolonged pro-inflammatory stimuli bringing about chronic inflammation can lead to life-threatening or severely debilitating diseases. Mesenchymal stem cell (MSC) transplant has proved to be an effective therapy in preclinical studies which evaluated a vast diversity of inflammatory conditions. MSCs lead to resolution of inflammation, preparation for regeneration and actual regeneration, and then ultimate return to normal baseline or homeostasis. However, in clinical trials of transplanted MSCs, the expectations of great medical benefit have not yet been fulfilled. As a practical alternative to MSC transplant, a synthetic drug with the capacity to boost endogenous MSC expansion and/or activation may also be effective. Regarding this, IMT504, the prototype of a major class of immunomodulatory oligonucleotides, induces in vivo expansion of MSCs, resulting in a marked improvement in preclinical models of neuropathic pain, osteoporosis, diabetes and sepsis. IMT504 is easily manufactured and has an excellent preclinical safety record. In the small number of patients studied thus far, IMT504 has been well-tolerated, even at very high dosage. Further clinical investigation is necessary to demonstrate the utility of IMT504 for resolution of inflammation and regeneration in a broad array of human diseases that would likely benefit from an immunoprotective/immunoregenerative therapy. PMID:28396715

Integrated high-resolution array CGH and SKY analysis of homozygous deletions and other genomic alterations present in malignant mesothelioma cell lines.

PubMed

Klorin, Geula; Rozenblum, Ester; Glebov, Oleg; Walker, Robert L; Park, Yoonsoo; Meltzer, Paul S; Kirsch, Ilan R; Kaye, Frederic J; Roschke, Anna V

2013-05-01

High-resolution oligonucleotide array comparative genomic hybridization (aCGH) and spectral karyotyping (SKY) were applied to a panel of malignant mesothelioma (MMt) cell lines. SKY has not been applied to MMt before, and complete karyotypes are reported based on the integration of SKY and aCGH results. A whole genome search for homozygous deletions (HDs) produced the largest set of recurrent and non-recurrent HDs for MMt (52 recurrent HDs in 10 genomic regions; 36 non-recurrent HDs). For the first time, LINGO2, RBFOX1/A2BP1, RPL29, DUSP7, and CCSER1/FAM190A were found to be homozygously deleted in MMt, and some of these genes could be new tumor suppressor genes for MMt. Integration of SKY and aCGH data allowed reconstruction of chromosomal rearrangements that led to the formation of HDs. Our data imply that only with acquisition of structural and/or numerical karyotypic instability can MMt cells attain a complete loss of tumor suppressor genes located in 9p21.3, which is the most frequently homozygously deleted region. Tetraploidization is a late event in the karyotypic progression of MMt cells, after HDs in the 9p21.3 region have already been acquired. Published by Elsevier Inc.

Novel Multiplex Oligonucleotide-Conjugated Bead Suspension Array for Rapid Identification of Enterovirus 71 Subgenogroups▿ §

PubMed Central

Wu, Y.; Tan, E. L.; Yeo, A.; Chan, K. P.; Nishimura, H.; Cardosa, M. J.; Poh, C. L.; Quak, S. H.; Chow, Vincent T.

2011-01-01

A high-throughput multiplex bead suspension array was developed for the rapid subgenogrouping of EV71 strains, based on single nucleotide polymorphisms observed within the VP1 region with a high sensitivity as low as 1 PFU. Of 33 viral isolates and 55 clinical samples, all EV71 strains were successfully detected and correctly subgenogrouped. PMID:21084510

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

PubMed

Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

2016-01-01

Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

Identification of clinically relevant viridans streptococci by an oligonucleotide array.

PubMed

Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

2005-04-01

Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

PubMed Central

Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

2009-01-01

Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

High-density, microsphere-based fiber optic DNA microarrays.

PubMed

Epstein, Jason R; Leung, Amy P K; Lee, Kyong Hoon; Walt, David R

2003-05-01

A high-density fiber optic DNA microarray has been developed consisting of oligonucleotide-functionalized, 3.1-microm-diameter microspheres randomly distributed on the etched face of an imaging fiber bundle. The fiber bundles are comprised of 6000-50000 fused optical fibers and each fiber terminates with an etched well. The microwell array is capable of housing complementary-sized microspheres, each containing thousands of copies of a unique oligonucleotide probe sequence. The array fabrication process results in random microsphere placement. Determining the position of microspheres in the random array requires an optical encoding scheme. This array platform provides many advantages over other array formats. The microsphere-stock suspension concentration added to the etched fiber can be controlled to provide inherent sensor redundancy. Examining identical microspheres has a beneficial effect on the signal-to-noise ratio. As other sequences of interest are discovered, new microsphere sensing elements can be added to existing microsphere pools and new arrays can be fabricated incorporating the new sequences without altering the existing detection capabilities. These microarrays contain the smallest feature sizes (3 microm) of any DNA array, allowing interrogation of extremely small sample volumes. Reducing the feature size results in higher local target molecule concentrations, creating rapid and highly sensitive assays. The microsphere array platform is also flexible in its applications; research has included DNA-protein interaction profiles, microbial strain differentiation, and non-labeled target interrogation with molecular beacons. Fiber optic microsphere-based DNA microarrays have a simple fabrication protocol enabling their expansion into other applications, such as single cell-based assays.

Combined array CGH plus SNP genome analyses in a single assay for optimized clinical testing

PubMed Central

Wiszniewska, Joanna; Bi, Weimin; Shaw, Chad; Stankiewicz, Pawel; Kang, Sung-Hae L; Pursley, Amber N; Lalani, Seema; Hixson, Patricia; Gambin, Tomasz; Tsai, Chun-hui; Bock, Hans-Georg; Descartes, Maria; Probst, Frank J; Scaglia, Fernando; Beaudet, Arthur L; Lupski, James R; Eng, Christine; Wai Cheung, Sau; Bacino, Carlos; Patel, Ankita

2014-01-01

In clinical diagnostics, both array comparative genomic hybridization (array CGH) and single nucleotide polymorphism (SNP) genotyping have proven to be powerful genomic technologies utilized for the evaluation of developmental delay, multiple congenital anomalies, and neuropsychiatric disorders. Differences in the ability to resolve genomic changes between these arrays may constitute an implementation challenge for clinicians: which platform (SNP vs array CGH) might best detect the underlying genetic cause for the disease in the patient? While only SNP arrays enable the detection of copy number neutral regions of absence of heterozygosity (AOH), they have limited ability to detect single-exon copy number variants (CNVs) due to the distribution of SNPs across the genome. To provide comprehensive clinical testing for both CNVs and copy-neutral AOH, we enhanced our custom-designed high-resolution oligonucleotide array that has exon-targeted coverage of 1860 genes with 60 000 SNP probes, referred to as Chromosomal Microarray Analysis – Comprehensive (CMA-COMP). Of the 3240 cases evaluated by this array, clinically significant CNVs were detected in 445 cases including 21 cases with exonic events. In addition, 162 cases (5.0%) showed at least one AOH region >10 Mb. We demonstrate that even though this array has a lower density of SNP probes than other commercially available SNP arrays, it reliably detected AOH events >10 Mb as well as exonic CNVs beyond the detection limitations of SNP genotyping. Thus, combining SNP probes and exon-targeted array CGH into one platform provides clinically useful genetic screening in an efficient manner. PMID:23695279

Enzymatic production of single-molecule FISH and RNA capture probes.

PubMed

Gaspar, Imre; Wippich, Frank; Ephrussi, Anne

2017-10-01

Arrays of singly labeled short oligonucleotides that hybridize to a specific target revolutionized RNA biology, enabling quantitative, single-molecule microscopy analysis and high-efficiency RNA/RNP capture. Here, we describe a simple and efficient method that allows flexible functionalization of inexpensive DNA oligonucleotides by different fluorescent dyes or biotin using terminal deoxynucleotidyl transferase and custom-made functional group conjugated dideoxy-UTP. We show that (i) all steps of the oligonucleotide labeling-including conjugation, enzymatic synthesis, and product purification-can be performed in a standard biology laboratory, (ii) the process yields >90%, often >95% labeled product with minimal carryover of impurities, and (iii) the oligonucleotides can be labeled with different dyes or biotin, allowing single-molecule FISH, RNA affinity purification, and Northern blot analysis to be performed. © 2017 Gaspar et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Sieve-based device for MALDI sample preparation. I. Influence of sample deposition conditions in oligonucleotide analysis to achieve significant increases in both sensitivity and resolution.

PubMed

Molin, Laura; Cristoni, Simone; Crotti, Sara; Bernardi, Luigi Rossi; Seraglia, Roberta; Traldi, Pietro

2008-11-01

Spraying of oligonucleotide-matrix solutions through a stainless steel (ss) sieve (38 microm, 450 mesh) leads to the formation, on the matrix-assisted laser desorption/ionization (MALDI) sample holder, of uniformly distributed microcrystals, well separated from each other. When the resulting sample holder surface is irradiated by laser, abundant molecular species form, with a clear increase in both intensity and resolution with respect to values obtained by 'Dried Droplet', 'Double Layer', and 'Sandwich' deposition methods. In addition, unlike the usual situation, the sample is perfectly homogeneous, and identical spectra are obtained by irradiating different areas. On one hand, the data indicate that this method is highly effective for oligonucleotide MALDI analysis, and on the other, that it can be validly employed for fully automated MALDI procedures.

Genomic analysis using high density SNP based oligonucleotide arrays and MLPA provides a comprehensive analysis of INI1/SMARCB1 in malignant rhabdoid tumors

PubMed Central

Jackson, Eric M.; Sievert, Angela J.; Gai, Xiaowu; Hakonarson, Hakon; Judkins, Alexander R; Tooke, Laura; Perin, Juan Carlos; Xie, Hongbo; Shaikh, Tamim H.; Biegel, Jaclyn A.

2009-01-01

Translational Relevance Previous reports suggested that abnormalities of INI1 could be detected in 70–75% of malignant rhabdoid tumors. The mechanism of inactivation in the other 25% remained unclear. The goal of this study was to perform a high-resolution genomic analysis of a large series of rhabdoid tumors with the expectation of identifying additional loci related to the initiation or progression of these malignancies. We also developed a comprehensive set of assays, including a new MLPA assay, to interrogate the INI1 locus in 22q11.2. Intragenic deletions could be detected using the Illumina 550K Beadchip, whereas single exon deletions could be detected using MLPA. The current study demonstrates that with a multi-platform approach, alterations at the INI1 locus can be detected in almost all cases. Thus, appropriate molecular genetic testing can be used as an aid in the diagnosis and for treatment planning for most patients. Purpose A high-resolution genomic profiling and comprehensive targeted analysis of INI1/SMARCB1 of a large series of pediatric rhabdoid tumors was performed. The aim was to identify regions of copy number change and loss of heterozygosity that might pinpoint additional loci involved in the development or progression of rhabdoid tumors, and define the spectrum of genomic alterations of INI1 in this malignancy. Experimental Design A multi-platform approach, utilizing Illumina single nucleotide polymorphism (SNP) based oligonucleotide arrays, multiplex ligation dependent probe amplification (MLPA), fluorescence in situ hybridization (FISH), and coding sequence analysis was used to characterize genome wide copy number changes, loss of heterozygosity, and genomic alterations of INI1/SMARCB1 in a series of pediatric rhabdoid tumors. Results The bi-allelic alterations of INI1 that led to inactivation were elucidated in 50 of 51 tumors. INI1 inactivation was demonstrated by a variety of mechanisms, including deletions, mutations, and loss of heterozygosity. The results from the array studies highlighted the complexity of rearrangements of chromosome 22, compared to the low frequency of alterations involving the other chromosomes. Conclusions The results from the genome wide SNP-array analysis suggest that INI1 is the primary tumor suppressor gene involved in the development of rhabdoid tumors with no second locus identified. In addition, we did not identify hot spots for the breakpoints in sporadic tumors with deletions of chromosome 22q11.2. By employing a multimodality approach, the wide spectrum of alterations of INI1 can be identified in the majority of patients, which increases the clinical utility of molecular diagnostic testing. PMID:19276269

Tuning the Cavity Size and Chirality of Self-Assembling 3D DNA Crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, Chad R.; Zhang, Fei; MacCulloch, Tara

The foundational goal of structural DNA nanotechnology—the field that uses oligonucleotides as a molecular building block for the programmable self-assembly of nanostructured systems—was to use DNA to construct three-dimensional (3D) lattices for solving macromolecular structures. The programmable nature of DNA makes it an ideal system for rationally constructing self-assembled crystals and immobilizing guest molecules in a repeating 3D array through their specific stereospatial interactions with the scaffold. In this work, we have extended a previously described motif (4 × 5) by expanding the structure to a system that links four double-helical layers; we use a central weaving oligonucleotide containing amore » sequence of four six-base repeats (4 × 6), forming a matrix of layers that are organized and dictated by a series of Holliday junctions. In addition, we have assembled mirror image crystals (l-DNA) with the identical sequence that are completely resistant to nucleases. Bromine and selenium derivatives were obtained for the l- and d-DNA forms, respectively, allowing phase determination for both forms and solution of the resulting structures to 3.0 and 3.05 Å resolution. Both right- and left-handed forms crystallized in the trigonal space groups with mirror image 3-fold helical screw axes P32 and P31 for each motif, respectively. The structures reveal a highly organized array of discrete and well-defined cavities that are suitable for hosting guest molecules and allow us to dictate a priori the assembly of guest–DNA conjugates with a specified crystalline hand.« less

Single scan parameterization of space-variant point spread functions in image space via a printed array: the impact for two PET/CT scanners.

PubMed

Kotasidis, F A; Matthews, J C; Angelis, G I; Noonan, P J; Jackson, A; Price, P; Lionheart, W R; Reader, A J

2011-05-21

Incorporation of a resolution model during statistical image reconstruction often produces images of improved resolution and signal-to-noise ratio. A novel and practical methodology to rapidly and accurately determine the overall emission and detection blurring component of the system matrix using a printed point source array within a custom-made Perspex phantom is presented. The array was scanned at different positions and orientations within the field of view (FOV) to examine the feasibility of extrapolating the measured point source blurring to other locations in the FOV and the robustness of measurements from a single point source array scan. We measured the spatially-variant image-based blurring on two PET/CT scanners, the B-Hi-Rez and the TruePoint TrueV. These measured spatially-variant kernels and the spatially-invariant kernel at the FOV centre were then incorporated within an ordinary Poisson ordered subset expectation maximization (OP-OSEM) algorithm and compared to the manufacturer's implementation using projection space resolution modelling (RM). Comparisons were based on a point source array, the NEMA IEC image quality phantom, the Cologne resolution phantom and two clinical studies (carbon-11 labelled anti-sense oligonucleotide [(11)C]-ASO and fluorine-18 labelled fluoro-l-thymidine [(18)F]-FLT). Robust and accurate measurements of spatially-variant image blurring were successfully obtained from a single scan. Spatially-variant resolution modelling resulted in notable resolution improvements away from the centre of the FOV. Comparison between spatially-variant image-space methods and the projection-space approach (the first such report, using a range of studies) demonstrated very similar performance with our image-based implementation producing slightly better contrast recovery (CR) for the same level of image roughness (IR). These results demonstrate that image-based resolution modelling within reconstruction is a valid alternative to projection-based modelling, and that, when using the proposed practical methodology, the necessary resolution measurements can be obtained from a single scan. This approach avoids the relatively time-consuming and involved procedures previously proposed in the literature.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Salivary gland carcinosarcoma: oligonucleotide array CGH reveals similar genomic profiles in epithelial and mesenchymal components.

PubMed

Vékony, Hedy; Leemans, C René; Ylstra, Bauke; Meijer, Gerrit A; van der Waal, Isaäc; Bloemena, Elisabeth

2009-03-01

In this study, we present a case of parotid gland de novo carcinosarcoma. Salivary gland carcinosarcoma (or true malignant mixed tumor) is a rare biphasic neoplasm, composed of both malignant epithelial and malignant mesenchymal components. It is yet unclear whether these two phenotypes occur by collision of two independent tumors or if they are of clonal origin. To analyze the clonality of the different morphologic tumor components, oligonucleotide microarray-based comparative genomic hybridization (oaCGH) was performed on the carcinoma and the sarcoma entity separately. This technique enables a high-resolution, genome-wide overview of the chromosomal alterations in the distinct tumor elements. Analysis of both fractions showed a high number of DNA copy number changes. Losses were more prevalent than gains (82 and 49, respectively). The carcinomatous element displayed more chromosomal aberrations than the sarcomatous component. Specific amplifications of MUC20 (in mesenchymal element) and BMI-1 (in both elements) loci were observed. Overall homology between the two genomic profiles was 75%. DNA copy number profiles of the epithelial and mesenchymal components in this salivary gland carcinosarcoma displayed extensive overlap, indicating a monoclonal origin. Since losses are shared to a larger extent than gains, they seem to be more essential for initial oncogenic events. Furthermore, specific amplifications of a mucin and a Polycomb group gene imply these proteins in the tumorigenesis of carcinosarcomas.

Arrays of carbon nanofibers as a platform for biosensing at the molecular level and for tissue engineering and implantation.

PubMed

Koehne, Jessica E; Chen, Hua; Cassell, Alan; Liu, Gang-yu; Li, Jun; Meyyappan, M

2009-01-01

Arrays of Carbon nanofibers (CNFs) harness the advantages of individual CNF as well the collective property of assemblies, which made them promising materials in biosensing and tissue engineering or implantation. Here, we report two studies to explore the applications of vertically aligned CNFs. First, a nanoelectrode array (NEA) based on vertically aligned CNFs embedded in SiO(2) is used for ultrasensitive DNA detection. Oligonucleotide probes are selectively functionalized at the open ends of the CNFs and specifically hybridized with oligonucleotide targets. The guanine groups are employed as the signal moieties in the electrochemical measurements. Ru(bpy)(3)(2+) mediator is used to further amplify the guanine oxidation signal. The hybridization of less than approximately 1000 molecules of PCR amplified DNA targets are detected electrochemically by combining the CNF nanoelectrode array with the Ru(bpy)(3)(2+) amplification mechanism. Second, the SiO(2) matrix was etched back to produce needle-like protruding nanoelectrode arrays to be used as cell interfacing fibers for investigating gene transfection, electrical stimulation and detection of cellular processes. Our goal is to take advantage of the nanostructure of CNFs for unconventional biomolecular studies requiring ultrahigh sensitivity, high-degree of miniaturization and selective biofunctionalization.

Template-Directed Ligation of Peptides to Oligonucleotides

NASA Technical Reports Server (NTRS)

Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

1996-01-01

Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

PubMed Central

Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

2017-01-01

Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

Molecular Diagnostic Tools for Detection and Differentiation of Phytoplasmas Based on Chaperonin-60 Reveal Differences in Host Plant Infection Patterns

PubMed Central

Dumonceaux, Tim J.; Green, Margaret; Hammond, Christine; Perez, Edel; Olivier, Chrystel

2014-01-01

Phytoplasmas (‘Candidatus Phytoplasma’ spp.) are insect-vectored bacteria that infect a wide variety of plants, including many agriculturally important species. The infections can cause devastating yield losses by inducing morphological changes that dramatically alter inflorescence development. Detection of phytoplasma infection typically utilizes sequences located within the 16S–23S rRNA-encoding locus, and these sequences are necessary for strain identification by currently accepted standards for phytoplasma classification. However, these methods can generate PCR products >1400 bp that are less divergent in sequence than protein-encoding genes, limiting strain resolution in certain cases. We describe a method for accessing the chaperonin-60 (cpn60) gene sequence from a diverse array of ‘Ca.Phytoplasma’ spp. Two degenerate primer sets were designed based on the known sequence diversity of cpn60 from ‘Ca.Phytoplasma’ spp. and used to amplify cpn60 gene fragments from various reference samples and infected plant tissues. Forty three cpn60 sequences were thereby determined. The cpn60 PCR-gel electrophoresis method was highly sensitive compared to 16S-23S-targeted PCR-gel electrophoresis. The topology of a phylogenetic tree generated using cpn60 sequences was congruent with that reported for 16S rRNA-encoding genes. The cpn60 sequences were used to design a hybridization array using oligonucleotide-coupled fluorescent microspheres, providing rapid diagnosis and typing of phytoplasma infections. The oligonucleotide-coupled fluorescent microsphere assay revealed samples that were infected simultaneously with two subtypes of phytoplasma. These tools were applied to show that two host plants, Brassica napus and Camelina sativa, displayed different phytoplasma infection patterns. PMID:25551224

Genome-wide comparison of paired fresh frozen and formalin-fixed paraffin-embedded gliomas by custom BAC and oligonucleotide array comparative genomic hybridization: facilitating analysis of archival gliomas

PubMed Central

Mohapatra, Gayatry; Engler, David A.; Starbuck, Kristen D.; Kim, James C.; Bernay, Derek C.; Scangas, George A.; Rousseau, Audrey; Batchelor, Tracy T.; Betensky, Rebecca A.; Louis, David N.

2010-01-01

Molecular genetic analysis of cancer is rapidly evolving as a result of improvement in genomic technologies and the growing applicability of such analyses to clinical oncology. Array based comparative genomic hybridization (aCGH) is a powerful tool for detecting DNA copy number alterations (CNA), particularly in solid tumors, and has been applied to the study of malignant gliomas. In the clinical setting, however, gliomas are often sampled by small biopsies and thus formalin-fixed paraffin-embedded (FFPE) blocks are often the only tissue available for genetic analysis, especially for rare types of gliomas. Moreover, the biological basis for the marked intratumoral heterogeneity in gliomas is most readily addressed in FFPE material. Therefore, for gliomas, the ability to use DNA from FFPE tissue is essential for both clinical and research applications. In this study, we have constructed a custom bacterial artificial chromosome (BAC) array and show excellent sensitivity and specificity for detecting CNAs in a panel of paired frozen and FFPE glioma samples. Our study demonstrates a high concordance rate between CNAs detected in FFPE compared to frozen DNA. We have also developed a method of labeling DNA from FFPE tissue that allows efficient hybridization to oligonucleotide arrays. This labeling technique was applied to a panel of biphasic anaplastic oligoastrocytomas (AOA) to identify genetic changes unique to each component. Together, results from these studies suggest that BAC and oligonucleotide aCGH are sensitive tools for detecting CNAs in FFPE DNA, and can enable genome-wide analysis of rare, small and/or histologically heterogeneous gliomas. PMID:21080181

Hetero-oligonucleotide Nanoscale Tiles Capable of Two-Dimensional Lattice Formation as Testbeds for a Rapid, Affordable Purification Methodology

DTIC Science & Technology

2013-01-01

SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide

Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

NASA Technical Reports Server (NTRS)

Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

2002-01-01

MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays.

PubMed

Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

2003-07-01

Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an overview of these parameters. We present here a flexible tool named OligoWiz for designing oligonucleotides for multiple purposes. OligoWiz presents a set of parameter scores in a graphical interface to facilitate an overview for the user. Additional custom parameter scores can easily be added to the program to extend the default parameters: homology, DeltaTm, low-complexity, position and GATC-only. Furthermore we present an analysis of the limitations in designing oligonucleotide sets that can detect transcripts from multiple organisms. OligoWiz is available at www.cbs.dtu.dk/services/OligoWiz/.

Human Leukocyte Antigen Typing Using a Knowledge Base Coupled with a High-Throughput Oligonucleotide Probe Array Analysis

PubMed Central

Zhang, Guang Lan; Keskin, Derin B.; Lin, Hsin-Nan; Lin, Hong Huang; DeLuca, David S.; Leppanen, Scott; Milford, Edgar L.; Reinherz, Ellis L.; Brusic, Vladimir

2014-01-01

Human leukocyte antigens (HLA) are important biomarkers because multiple diseases, drug toxicity, and vaccine responses reveal strong HLA associations. Current clinical HLA typing is an elimination process requiring serial testing. We present an alternative in situ synthesized DNA-based microarray method that contains hundreds of thousands of probes representing a complete overlapping set covering 1,610 clinically relevant HLA class I alleles accompanied by computational tools for assigning HLA type to 4-digit resolution. Our proof-of-concept experiment included 21 blood samples, 18 cell lines, and multiple controls. The method is accurate, robust, and amenable to automation. Typing errors were restricted to homozygous samples or those with very closely related alleles from the same locus, but readily resolved by targeted DNA sequencing validation of flagged samples. High-throughput HLA typing technologies that are effective, yet inexpensive, can be used to analyze the world’s populations, benefiting both global public health and personalized health care. PMID:25505899

ASSESSMENT OF THE SWINE PROTEIN-ANNOTATED OLIGONUCLEOTIDE MICROARRAY AND UTILITY OF THE ARRAYS FOR EQTL AND TRANSCRIPTIONAL PROFILING STUDIES

USDA-ARS?s Scientific Manuscript database

We have evaluated the new Swine Protein-Annotated Oligonucleotide Microarray (http://www.pigoligoarray.org) by analyzing transcriptional profiles for longissimus dorsi muscle (LD), Bronchial lymph node (BLN) and Lung. Four LD samples were used to assess the stringency of hybridization conditions com...

Real-Time and Accurate Identification of Single Oligonucleotide Photoisomers via an Aerolysin Nanopore.

PubMed

Hu, Zheng-Li; Li, Zi-Yuan; Ying, Yi-Lun; Zhang, Junji; Cao, Chan; Long, Yi-Tao; Tian, He

2018-04-03

Identification of the configuration for the photoresponsive oligonucleotide plays an important role in the ingenious design of DNA nanomolecules and nanodevices. Due to the limited resolution and sensitivity of present methods, it remains a challenge to determine the accurate configuration of photoresponsive oligonucleotides, much less a precise description of their photoconversion process. Here, we used an aerolysin (AeL) nanopore-based confined space for real-time determination and quantification of the absolute cis/ trans configuration of each azobenzene-modified oligonucleotide (Azo-ODN) with a single molecule resolution. The two completely separated current distributions with narrow peak widths at half height (<0.62 pA) are assigned to cis/ trans-Azo-ODN isomers, respectively. Due to the high current sensitivity, each isomer of Azo-ODN could be undoubtedly identified, which gives the accurate photostationary conversion values of 82.7% for trans-to- cis under UV irradiation and 82.5% for cis-to- trans under vis irradiation. Further real-time kinetic evaluation reveals that the photoresponsive rate constants of Azo-ODN from trans-to- cis and cis-to -trans are 0.43 and 0.20 min -1 , respectively. This study will promote the sophisticated design of photoresponsive ODN to achieve an efficient and applicable photocontrollable process.

A novel computational method to simulate non-enzymatic self-replication. [Abstract only

NASA Technical Reports Server (NTRS)

Navarro-Gonzalez, Rafael; Reggia, James A.; Wu, Jayoung; Chou, Hui-Hsien

1994-01-01

Non-enzymatic, template-directed synthesis of oligonucleotides has been extensively studied in the laboratory as a model to understand the kind of chemical processes that might have contributed to the origin of life on Earth. Several oligonucleotides have been shown to catalyze the synthesis of their complements from activated mononucleotides; however, a restricted number of them have been found to self-replicate. Recently we developed an efficient modified cellular automata method that supports the study of self-replicating oligonucleotides. With this method the oligonucleotide molecules are represented as active cells imbedded in a two-dimensional array of inactive cells symbolizing the environment. Random movements and probability-governed chemical reactions occurring in a cellular space can effectively simulate the experimental behavior observed in self-directed replication of oligonucleotides.

Practical guidelines for interpreting copy number gains detected by high-resolution array in routine diagnostics

PubMed Central

Hanemaaijer, Nicolien M; Sikkema-Raddatz, Birgit; van der Vries, Gerben; Dijkhuizen, Trijnie; Hordijk, Roel; van Essen, Anthonie J; Veenstra-Knol, Hermine E; Kerstjens-Frederikse, Wilhelmina S; Herkert, Johanna C; Gerkes, Erica H; Leegte, Lamberta K; Kok, Klaas; Sinke, Richard J; van Ravenswaaij-Arts, Conny M A

2012-01-01

The correct interpretation of copy number gains in patients with developmental delay and multiple congenital anomalies is hampered by the large number of copy number variations (CNVs) encountered in healthy individuals. The variable phenotype associated with copy number gains makes interpretation even more difficult. Literature shows that inheritence, size and presence in healthy individuals are commonly used to decide whether a certain copy number gain is pathogenic, but no general consensus has been established. We aimed to develop guidelines for interpreting gains detected by array analysis using array CGH data of 300 patients analysed with the 105K Agilent oligo array in a diagnostic setting. We evaluated the guidelines in a second, independent, cohort of 300 patients. In the first 300 patients 797 gains of four or more adjacent oligonucleotides were observed. Of these, 45.4% were de novo and 54.6% were familial. In total, 94.8% of all de novo gains and 87.1% of all familial gains were concluded to be benign CNVs. Clinically relevant gains ranged from 288 to 7912 kb in size, and were significantly larger than benign gains and gains of unknown clinical relevance (P<0.001). Our study showed that a threshold of 200 kb is acceptable in a clinical setting, whereas heritability does not exclude a pathogenic nature of a gain. Evaluation of the guidelines in the second cohort of 300 patients revealed that the interpretation guidelines were clear, easy to follow and efficient. PMID:21934709

High-Resolution Array with Prony, MUSIC, and ESPRIT Algorithms

DTIC Science & Technology

1992-08-25

N avalI Research La bora tory AD-A255 514 Washington, DC 20375-5320 NRL/FR/5324-92-9397 High-resolution Array with Prony, music , and ESPRIT...unlimited t"orm n pprovoiREPORT DOCUMENTATION PAGE OMB. o 0 104 0188 4. TITLE AND SUBTITLE S. FUNDING NUMBERS High-resolution Array with Prony. MUSIC . and...the array high-resolution properties of three algorithms: the Prony algo- rithm, the MUSIC algorithm, and the ESPRIT algorithm. MUSIC has been much

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-09-29

The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, Tuan

1998-01-01

The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-02-24

The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-07-21

The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

A method for high-throughput production of sequence-verified DNA libraries and strain collections.

PubMed

Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

2017-02-13

The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Carbon Nanotube Nanoelectrode Array as an Electronic Chip for Ultrasensitive Label-free DNA Detection

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Fan, Wendy; Ye, Qi; Han, Jie; Meyyappan, M.

2003-01-01

A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in SiO2 is used for ultrasensitive DNA detection. Characteristic nanoelectrode behavior is observed using low-density MWNT arrays for measuring both bulk and surface immobilized redox species such as K4Fe(CN)6 and ferrocene derivatives. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes with wide potential window, flexible chemical functionalities, and good biocompatibility. BRCA1 related oligonucleotide probes with 18 bp are selectively functionalized at the open ends of the nanotube array and specifically hybridized with oligonucleotide targets incorporated with a polyG tag. The guanine groups are employed as the signal moieties in the electrochemical measurements. R(bpy)(sup 2+, sub 3) mediator is used to further amplify the guanine oxidation signal. The hybridization of sub-attomoles of DNA targets is detected electrochemically by combining the MWNT nanoelectrode array with the R(bpy)(sup 2+, sub 3) amplification mechanism. This technique was employed for direct electrochemical detection of label-free PCR amplicon from a healthy donor through specific hybridization with the BRCA1 probe. The detection limit is estimated to be less than 1000 DNA molecules since abundant guanine bases in the PCR amplicon provides a large signal. This system provides a general platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, and simple sample preparation, and low-cost operation.

ChIP-chip.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting.

PubMed

Seipp, Michael T; Durtschi, Jacob D; Liew, Michael A; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V; Wittwer, Carl T

2007-07-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39 degrees C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments.

The estimation of quantitative parameters of oligonucleotides immobilization on mica surface

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-05-01

Immobilization of nucleic acids on the surface of various materials is increasingly being used in research and some practical applications. Currently, the DNA chip technology is rapidly developing. The basis of the immobilization process can be both physical adsorption and chemisorption. A useful way to control the immobilization of nucleic acids on a surface is to use atomic force microscopy. It allows you to investigate the topography of the surface by its direct imaging with high resolution. Usually, to fix the DNA on the surface of mica are used cations which mediate the interaction between the mica surface and the DNA molecules. In our work we have developed a method for estimation of quantitative parameter of immobilization of oligonucleotides is their degree of aggregation depending on the fixation conditions on the surface of mica. The results on study of aggregation of oligonucleotides immobilized on mica surface will be presented. The single oligonucleotides molecules have been imaged clearly, whereas their surface areas have been calculated and calibration curve has been plotted.

An Undergraduate Laboratory Exercise to Study the Effect of Darkness on Plant Gene Expression Using DNA Microarray

ERIC Educational Resources Information Center

Chang, Ming-Mei; Briggs, George M.

2007-01-01

DNA microarrays are microscopic arrays on a solid surface, typically a glass slide, on which DNA oligonucleotides are deposited or synthesized in a high-density matrix with a predetermined spatial order. Several types of DNA microarrays have been developed and used for various biological studies. Here, we developed an undergraduate laboratory…

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Circuit for high resolution decoding of multi-anode microchannel array detectors

NASA Technical Reports Server (NTRS)

Kasle, David B. (Inventor)

1995-01-01

A circuit for high resolution decoding of multi-anode microchannel array detectors consisting of input registers accepting transient inputs from the anode array; anode encoding logic circuits connected to the input registers; midpoint pipeline registers connected to the anode encoding logic circuits; and pixel decoding logic circuits connected to the midpoint pipeline registers is described. A high resolution algorithm circuit operates in parallel with the pixel decoding logic circuit and computes a high resolution least significant bit to enhance the multianode microchannel array detector's spatial resolution by halving the pixel size and doubling the number of pixels in each axis of the anode array. A multiplexer is connected to the pixel decoding logic circuit and allows a user selectable pixel address output according to the actual multi-anode microchannel array detector anode array size. An output register concatenates the high resolution least significant bit onto the standard ten bit pixel address location to provide an eleven bit pixel address, and also stores the full eleven bit pixel address. A timing and control state machine is connected to the input registers, the anode encoding logic circuits, and the output register for managing the overall operation of the circuit.

Flexible CRISPR library construction using parallel oligonucleotide retrieval

PubMed Central

Read, Abigail; Gao, Shaojian; Batchelor, Eric

2017-01-01

Abstract CRISPR/Cas9-based gene knockout libraries have emerged as a powerful tool for functional screens. We present here a set of pre-designed human and mouse sgRNA sequences that are optimized for both high on-target potency and low off-target effect. To maximize the chance of target gene inactivation, sgRNAs were curated to target both 5΄ constitutive exons and exons that encode conserved protein domains. We describe here a robust and cost-effective method to construct multiple small sized CRISPR library from a single oligo pool generated by array synthesis using parallel oligonucleotide retrieval. Together, these resources provide a convenient means for individual labs to generate customized CRISPR libraries of variable size and coverage depth for functional genomics application. PMID:28334828

Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proudnikov, D.; Kirillov, E.; Chumakov, K.

2000-01-01

This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements.more » Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.« less

Correction of Spatial Bias in Oligonucleotide Array Data

PubMed Central

Lemieux, Sébastien

2013-01-01

Background. Oligonucleotide microarrays allow for high-throughput gene expression profiling assays. The technology relies on the fundamental assumption that observed hybridization signal intensities (HSIs) for each intended target, on average, correlate with their target's true concentration in the sample. However, systematic, nonbiological variation from several sources undermines this hypothesis. Background hybridization signal has been previously identified as one such important source, one manifestation of which appears in the form of spatial autocorrelation. Results. We propose an algorithm, pyn, for the elimination of spatial autocorrelation in HSIs, exploiting the duality of desirable mutual information shared by probes in a common probe set and undesirable mutual information shared by spatially proximate probes. We show that this correction procedure reduces spatial autocorrelation in HSIs; increases HSI reproducibility across replicate arrays; increases differentially expressed gene detection power; and performs better than previously published methods. Conclusions. The proposed algorithm increases both precision and accuracy, while requiring virtually no changes to users' current analysis pipelines: the correction consists merely of a transformation of raw HSIs (e.g., CEL files for Affymetrix arrays). A free, open-source implementation is provided as an R package, compatible with standard Bioconductor tools. The approach may also be tailored to other platform types and other sources of bias. PMID:23573083

Gene expression profiling of single cells on large-scale oligonucleotide arrays

PubMed Central

Hartmann, Claudia H.; Klein, Christoph A.

2006-01-01

Over the last decade, important insights into the regulation of cellular responses to various stimuli were gained by global gene expression analyses of cell populations. More recently, specific cell functions and underlying regulatory networks of rare cells isolated from their natural environment moved to the center of attention. However, low cell numbers still hinder gene expression profiling of rare ex vivo material in biomedical research. Therefore, we developed a robust method for gene expression profiling of single cells on high-density oligonucleotide arrays with excellent coverage of low abundance transcripts. The protocol was extensively tested with freshly isolated single cells of very low mRNA content including single epithelial, mature and immature dendritic cells and hematopoietic stem cells. Quantitative PCR confirmed that the PCR-based global amplification method did not change the relative ratios of transcript abundance and unsupervised hierarchical cluster analysis revealed that the histogenetic origin of an individual cell is correctly reflected by the gene expression profile. Moreover, the gene expression data from dendritic cells demonstrate that cellular differentiation and pathway activation can be monitored in individual cells. PMID:17071717

CNV detection method optimized for high-resolution arrayCGH by normality test.

PubMed

Ahn, Jaegyoon; Yoon, Youngmi; Park, Chihyun; Park, Sanghyun

2012-04-01

High-resolution arrayCGH platform makes it possible to detect small gains and losses which previously could not be measured. However, current CNV detection tools fitted to early low-resolution data are not applicable to larger high-resolution data. When CNV detection tools are applied to high-resolution data, they suffer from high false-positives, which increases validation cost. Existing CNV detection tools also require optimal parameter values. In most cases, obtaining these values is a difficult task. This study developed a CNV detection algorithm that is optimized for high-resolution arrayCGH data. This tool operates up to 1500 times faster than existing tools on a high-resolution arrayCGH of whole human chromosomes which has 42 million probes whose average length is 50 bases, while preserving false positive/negative rates. The algorithm also uses a normality test, thereby removing the need for optimal parameters. To our knowledge, this is the first formulation for CNV detecting problems that results in a near-linear empirical overall complexity for real high-resolution data. Copyright © 2012 Elsevier Ltd. All rights reserved.

Application of HLA-DRB1 genotyping by oligonucleotide micro-array technology in forensic medicine.

PubMed

Jiang, Bin; Li, Yao; Wu, Hai; He, Xianmin; Li, Chengtao; Li, Li; Tang, Rong; Xie, Yi; Mao, Yumin

2006-10-16

The human leukocyte antigen (HLA) system is known to be the most complex polymorphic system in the human genome. Among all of the HLA loci, HLA-DRB1 has the second largest number of alleles. The purpose of this study is to develop an oligonucleotide micro-array based HLA-DRB1 typing system for use in forensic identification, anthropology, tissue transplantation, and other genetic research fields. The system was developed by analyzing the HLA-DRB1 (DRB1) genotypes in 1198 unrelated healthy Chinese Han individuals originating from various parts of China and residing in Shanghai, China. Polymerase chain reaction (PCR) coupled with the oligonucleotide micro-array technology was used to detect and type HLA-DRB1 alleles of the sample individuals. The reliability, sensitivity, consistency and specificity were evaluated for use in forensic identification. Furthermore, a meta-analysis was carried out by comparing the allele frequencies of the HLA-DRB1 locus with those of other Chinese Han groups, Chinese minorities and other ethnic populations. All the DNA samples yielded a 273 bp amplification product, with no other amplification products in this length range. The minimum quantity of DNA detected by this method is 15 ng in a PCR reaction system of 25 microl. The population studied appeared to be not in Hardy-Weinberg equilibrium. Observed heterozygosity (Ho), expected heterozygosity (He), expected probability of exclusion (PE), polymorphic information content (PIC), and discrimination power (DP) of the HLA-DRB1 locus from the Shanghai Han ethnic group were evaluated to be 0.8022, 0.8870, 0.7741, 0.8771, 0.9750, respectively. A total of 25 HLA-DRB1 alleles were identified. HLA-DRB1*09XX, *04XX, *12XX and *15XX were the most frequent DRB1 alleles, which were observed in 58.76% of the sample. One hundred and sixteen genotypes were found. The five most frequent genotypes were: *04XX/*04XX (0.0626), *09XX/*09XX (0.0593), *04XX/*09XX (0.0551), *09XX/*15XX (0.0384) and *08XX/*12XX (0.0351). The meta-analysis showed that there were uniquely distributed features of DRB1 alleles among various ethnic populations and among the studied population groups from various regions with the same ethnic origin. An HLA-DRB1 genotyping system has been developed and established based on the oligonucleotide micro-array technology. The HLA-DRB1 typing of the Han population in Shanghai has revealed a relatively high heterogeneity. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology research. Large-scale micro-array detection is highly accurate and reliable for DNA-based HLA-DRB1 genotyping. These results suggest that HLA-DRB1 DNA polymorphisms and the database of the Shanghai Han group have useful applications in processing forensic casework (as personal identification, paternity test), tracing population migration and genetic diagnosis.

Line scanning system for direct digital chemiluminescence imaging of DNA sequencing blots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karger, A.E.; Weiss, R.; Gesteland, R.F.

A cryogenically cooled charge-coupled device (CCD) camera equipped with an area CCD array is used in a line scanning system for low-light-level imaging of chemiluminescent DNA sequencing blots. Operating the CCD camera in time-delayed integration (TDI) mode results in continuous data acquisition independent of the length of the CCD array. Scanning is possible with a resolution of 1.4 line pairs/mm at the 50% level of the modulation transfer function. High-sensitivity, low-light-level scanning of chemiluminescent direct-transfer electrophoresis (DTE) DNA sequencing blots is shown. The detection of DNA fragments on the blot involves DNA-DNA hybridization with oligonucleotide-alkaline phosphatase conjugate and 1,2-dioxetane-based chemiluminescence.more » The width of the scan allows the recording of up to four sequencing reactions (16 lanes) on one scan. The scan speed of 52 cm/h used for the sequencing blots corresponds to a data acquisition rate of 384 pixels/s. The chemiluminescence detection limit on the scanned images is 3.9 [times] 10[sup [minus]18] mol of plasmid DNA. A conditional median filter is described to remove spikes caused by cosmic ray events from the CCD images. 39 refs., 9 refs.« less

Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

PubMed

Hu, Jianhua; Wright, Fred A

2007-03-01

The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

Data-adaptive test statistics for microarray data.

PubMed

Mukherjee, Sach; Roberts, Stephen J; van der Laan, Mark J

2005-09-01

An important task in microarray data analysis is the selection of genes that are differentially expressed between different tissue samples, such as healthy and diseased. However, microarray data contain an enormous number of dimensions (genes) and very few samples (arrays), a mismatch which poses fundamental statistical problems for the selection process that have defied easy resolution. In this paper, we present a novel approach to the selection of differentially expressed genes in which test statistics are learned from data using a simple notion of reproducibility in selection results as the learning criterion. Reproducibility, as we define it, can be computed without any knowledge of the 'ground-truth', but takes advantage of certain properties of microarray data to provide an asymptotically valid guide to expected loss under the true data-generating distribution. We are therefore able to indirectly minimize expected loss, and obtain results substantially more robust than conventional methods. We apply our method to simulated and oligonucleotide array data. By request to the corresponding author.

Discovery and mapping of single feature polymorphisms in wheat using Affymetrix arrays

PubMed Central

Bernardo, Amy N; Bradbury, Peter J; Ma, Hongxiang; Hu, Shengwa; Bowden, Robert L; Buckler, Edward S; Bai, Guihua

2009-01-01

Background Wheat (Triticum aestivum L.) is a staple food crop worldwide. The wheat genome has not yet been sequenced due to its huge genome size (~17,000 Mb) and high levels of repetitive sequences; the whole genome sequence may not be expected in the near future. Available linkage maps have low marker density due to limitation in available markers; therefore new technologies that detect genome-wide polymorphisms are still needed to discover a large number of new markers for construction of high-resolution maps. A high-resolution map is a critical tool for gene isolation, molecular breeding and genomic research. Single feature polymorphism (SFP) is a new microarray-based type of marker that is detected by hybridization of DNA or cRNA to oligonucleotide probes. This study was conducted to explore the feasibility of using the Affymetrix GeneChip to discover and map SFPs in the large hexaploid wheat genome. Results Six wheat varieties of diverse origins (Ning 7840, Clark, Jagger, Encruzilhada, Chinese Spring, and Opata 85) were analyzed for significant probe by variety interactions and 396 probe sets with SFPs were identified. A subset of 164 unigenes was sequenced and 54% showed polymorphism within probes. Microarray analysis of 71 recombinant inbred lines from the cross Ning 7840/Clark identified 955 SFPs and 877 of them were mapped together with 269 simple sequence repeat markers. The SFPs were randomly distributed within a chromosome but were unevenly distributed among different genomes. The B genome had the most SFPs, and the D genome had the least. Map positions of a selected set of SFPs were validated by mapping single nucleotide polymorphism using SNaPshot and comparing with expressed sequence tags mapping data. Conclusion The Affymetrix array is a cost-effective platform for SFP discovery and SFP mapping in wheat. The new high-density map constructed in this study will be a useful tool for genetic and genomic research in wheat. PMID:19480702

Standard, Random, and Optimum Array conversions from Two-Pole resistance data

DOE PAGES

Rucker, D. F.; Glaser, Danney R.

2014-09-01

We present an array evaluation of standard and nonstandard arrays over a hydrogeological target. We develop the arrays by linearly combining data from the pole-pole (or 2-pole) array. The first test shows that reconstructed resistances for the standard Schlumberger and dipoledipole arrays are equivalent or superior to the measured arrays in terms of noise, especially at large geometric factors. The inverse models for the standard arrays also confirm what others have presented in terms of target resolvability, namely the dipole-dipole array has the highest resolution. In the second test, we reconstruct random electrode combinations from the 2-pole data segregated intomore » inner, outer, and overlapping dipoles. The resistance data and inverse models from these randomized arrays show those with inner dipoles to be superior in terms of noise and resolution and that overlapping dipoles can cause model instability and low resolution. Finally, we use the 2-pole data to create an optimized array that maximizes the model resolution matrix for a given electrode geometry. The optimized array produces the highest resolution and target detail. Thus, the tests demonstrate that high quality data and high model resolution can be achieved by acquiring field data from the pole-pole array.« less

Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

2004-01-01

There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

Unlabeled Oligonucleotides as Internal Temperature Controls for Genotyping by Amplicon Melting

PubMed Central

Seipp, Michael T.; Durtschi, Jacob D.; Liew, Michael A.; Williams, Jamie; Damjanovich, Kristy; Pont-Kingdon, Genevieve; Lyon, Elaine; Voelkerding, Karl V.; Wittwer, Carl T.

2007-01-01

Amplicon melting is a closed-tube method for genotyping that does not require probes, real-time analysis, or allele-specific polymerase chain reaction. However, correct differentiation of homozygous mutant and wild-type samples by melting temperature (Tm) requires high-resolution melting and closely controlled reaction conditions. When three different DNA extraction methods were used to isolate DNA from whole blood, amplicon Tm differences of 0.03 to 0.39°C attributable to the extractions were observed. To correct for solution chemistry differences between samples, complementary unlabeled oligonucleotides were included as internal temperature controls to shift and scale the temperature axis of derivative melting plots. This adjustment was applied to a duplex amplicon melting assay for the methylenetetrahydrofolate reductase variants 1298A>C and 677C>T. High- and low-temperature controls bracketing the amplicon melting region decreased the Tm SD within homozygous genotypes by 47 to 82%. The amplicon melting assay was 100% concordant to an adjacent hybridization probe (HybProbe) melting assay when temperature controls were included, whereas a 3% error rate was observed without temperature correction. In conclusion, internal temperature controls increase the accuracy of genotyping by high-resolution amplicon melting and should also improve results on lower resolution instruments. PMID:17591926

Development of depth encoding small animal PET detectors using dual-ended readout of pixelated scintillator arrays with SiPMs.

PubMed

Kuang, Zhonghua; Sang, Ziru; Wang, Xiaohui; Fu, Xin; Ren, Ning; Zhang, Xianming; Zheng, Yunfei; Yang, Qian; Hu, Zhanli; Du, Junwei; Liang, Dong; Liu, Xin; Zheng, Hairong; Yang, Yongfeng

2018-02-01

The performance of current small animal PET scanners is mainly limited by the detector performance and depth encoding detectors are required to develop PET scanner to simultaneously achieve high spatial resolution and high sensitivity. Among all depth encoding PET detector approaches, dual-ended readout detector has the advantage to achieve the highest depth of interaction (DOI) resolution and spatial resolution. Silicon photomultiplier (SiPM) is believed to be the photodetector of the future for PET detector due to its excellent properties as compared to the traditional photodetectors such as photomultiplier tube (PMT) and avalanche photodiode (APD). The purpose of this work is to develop high resolution depth encoding small animal PET detector using dual-ended readout of finely pixelated scintillator arrays with SiPMs. Four lutetium-yttrium oxyorthosilicate (LYSO) arrays with 11 × 11 crystals and 11.6 × 11.6 × 20 mm 3 outside dimension were made using ESR, Toray and BaSO 4 reflectors. The LYSO arrays were read out with Hamamatsu 4 × 4 SiPM arrays from both ends. The SiPM array has a pixel size of 3 × 3 mm 2 , 0.2 mm gap in between the pixels and a total active area of 12.6 × 12.6 mm 2 . The flood histograms, DOI resolution, energy resolution and timing resolution of the four detector modules were measured and compared. All crystals can be clearly resolved from the measured flood histograms of all four arrays. The BaSO 4 arrays provide the best and the ESR array provides the worst flood histograms. The DOI resolution obtained from the DOI profiles of the individual crystals of the four array is from 2.1 to 2.35 mm for events with E > 350 keV. The DOI ratio variation among crystals is bigger for the BaSO 4 arrays as compared to both the ESR and Toray arrays. The BaSO 4 arrays provide worse detector based DOI resolution. The photopeak amplitude of the Toray array had the maximum change with depth, it provides the worst energy resolution of 21.3%. The photopeak amplitude of the BaSO 4 array with 80 μm reflector almost doesn't change with depth, it provides the best energy resolution of 12.9%. A maximum timing shift of 1.37 ns to 1.61 ns among the corner and the center crystals in the four arrays was obtained due to the use of resistor network readout. A crystal based timing resolution of 0.68 ns to 0.83 ns and a detector based timing resolution of 1.26 ns to 1.45 ns were obtained for the four detector modules. Four high resolution depth encoding small animal PET detectors were developed using dual-ended readout of pixelated scintillator arrays with SiPMs. The performance results show that those detectors can be used to build a small animal PET scanner to simultaneously achieve uniform high spatial resolution and high sensitivity. © 2017 American Association of Physicists in Medicine.

Current progress on aptamer-targeted oligonucleotide therapeutics

PubMed Central

Dassie, Justin P; Giangrande, Paloma H

2014-01-01

Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

Fabrication of 3D Reconstituted Organoid Arrays by DNA-programmed Assembly of Cells (DPAC)

PubMed Central

Todhunter, Michael E; Weber, Robert J; Farlow, Justin; Jee, Noel Y; Cerchiari, Alec E; Gartner, Zev J

2016-01-01

Tissues are the organizational units of function in metazoan organisms. Tissues comprise an assortment of cellular building blocks, soluble factors, and extracellular matrix (ECM) that are composed into specific three dimensional (3D) structures. The capacity to reconstitute tissues in vitro with the structural complexity observed in vivo is key to understanding processes such as morphogenesis, homeostasis, and disease. In this unit, we describe DNA-programmed Assembly of Cells (DPAC), a method to fabricate viable, functional arrays of organoid-like tissues within 3D ECM gels. In DPAC, dissociated cells are chemically functionalized with degradable oligonucleotide “velcro,” allowing rapid, specific, and reversible cell adhesion to a two-dimensional (2D) template patterned with complementary DNA. An iterative assembly process builds up organoids, layer-by-layer, from this initial 2D template and into the third dimension. Cleavage of the DNA releases the completed array of tissues that are captured and fully embedded in ECM gels for culture and observation. DPAC controls the size, shape, composition, and spatial heterogeneity of organoids, and permits positioning constituent cells with single-cell resolution even within cultures several centimeters long. PMID:27622567

Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

PubMed

Xiao, Lu; Guo, Jia

2018-01-01

Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array

USDA-ARS?s Scientific Manuscript database

A large number of genetic variations have been identified in rice. Such variations must in many cases control phenotypic differences in abiotic stress tolerance and other traits. A single feature polymorphism (SFP) is an oligonucleotide array-based polymorphism which can be used for identification o...

High-resolution array comparative genomic hybridization analysis of human bronchial and salivary adenoid cystic carcinoma.

PubMed

Bernheim, Alain; Toujani, Saloua; Saulnier, Patrick; Robert, Thomas; Casiraghi, Odile; Validire, Pierre; Temam, Stéphane; Menard, Philippe; Dessen, Philippe; Fouret, Pierre

2008-05-01

Adenoid cystic carcinoma (ACC) is a rare but distinctive tumor. Oligonucleotide array comparative genomic hybridization has been applied for cataloging genomic copy number alterations (CNAs) in 17 frozen salivary or bronchial tumors. Only four whole chromosome CNAs were found, and most cases had 2-4 segmental CNAs. No high level amplification was observed. There were recurrent gains at 7p15.2, 17q21-25, and 22q11-13, and recurrent losses at 1p35, 6q22-25, 8q12-13, 9p21, 12q12-13, and 17p11-13. The minimal region of gain at 7p15.2 contained the HOXA cluster. The minimal common regions of deletions contained the CDKN2A/CDKN2B, TP53, and LIMA1 tumor suppressor genes. The recurrent deletion at 8q12.3-13.1 contained no straightforward tumor suppressor gene, but the MIRN124A2 microRNA gene, whose product regulates MMP2 and CDK6. Among unique CNAs, gains harbored CCND1, KIT/PDGFRA/KDR, MDM2, and JAK2. The CNAs involving CCND1, MDM2, KIT, CDKN2A/2B, and TP53 were validated by FISH and/or multiplex ligation-dependent probe amplification. Although most tumors overexpressed cyclin D1 compared with surrounding glands, the only case to overexpress MDM2 had the corresponding CNA. In conclusion, our report suggests that ACC is characterized by a relatively low level of structural complexity. Array CGH and immunohistochemical data implicate MDM2 as the oncogene targeted at 12q15. The gain at 4q12 warrants further exploration as it contains a cluster of receptor kinase genes (KIT/PDGFRA/KDR), whose products can be responsive to specific therapies.

The pitfalls of platform comparison: DNA copy number array technologies assessed

PubMed Central

2009-01-01

Background The accurate and high resolution mapping of DNA copy number aberrations has become an important tool by which to gain insight into the mechanisms of tumourigenesis. There are various commercially available platforms for such studies, but there remains no general consensus as to the optimal platform. There have been several previous platform comparison studies, but they have either described older technologies, used less-complex samples, or have not addressed the issue of the inherent biases in such comparisons. Here we describe a systematic comparison of data from four leading microarray technologies (the Affymetrix Genome-wide SNP 5.0 array, Agilent High-Density CGH Human 244A array, Illumina HumanCNV370-Duo DNA Analysis BeadChip, and the Nimblegen 385 K oligonucleotide array). We compare samples derived from primary breast tumours and their corresponding matched normals, well-established cancer cell lines, and HapMap individuals. By careful consideration and avoidance of potential sources of bias, we aim to provide a fair assessment of platform performance. Results By performing a theoretical assessment of the reproducibility, noise, and sensitivity of each platform, notable differences were revealed. Nimblegen exhibited between-replicate array variances an order of magnitude greater than the other three platforms, with Agilent slightly outperforming the others, and a comparison of self-self hybridizations revealed similar patterns. An assessment of the single probe power revealed that Agilent exhibits the highest sensitivity. Additionally, we performed an in-depth visual assessment of the ability of each platform to detect aberrations of varying sizes. As expected, all platforms were able to identify large aberrations in a robust manner. However, some focal amplifications and deletions were only detected in a subset of the platforms. Conclusion Although there are substantial differences in the design, density, and number of replicate probes, the comparison indicates a generally high level of concordance between platforms, despite differences in the reproducibility, noise, and sensitivity. In general, Agilent tended to be the best aCGH platform and Affymetrix, the superior SNP-CGH platform, but for specific decisions the results described herein provide a guide for platform selection and study design, and the dataset a resource for more tailored comparisons. PMID:19995423

Advances in organic polymer-based monolithic column technology for high-resolution liquid chromatography-mass spectrometry profiling of antibodies, intact proteins, oligonucleotides, and peptides.

PubMed

Eeltink, Sebastiaan; Wouters, Sam; Dores-Sousa, José Luís; Svec, Frantisek

2017-05-19

This review focuses on the preparation of organic polymer-based monolithic stationary phases and their application in the separation of biomolecules, including antibodies, intact proteins and protein isoforms, oligonucleotides, and protein digests. Column and material properties, and the optimization of the macropore structure towards kinetic performance are also discussed. State-of-the-art liquid chromatography-mass spectrometry biomolecule separations are reviewed and practical aspects such as ion-pairing agent selection and carryover are presented. Finally, advances in comprehensive two-dimensional LC separations using monolithic columns, in particular ion-exchange×reversed-phase and reversed-phase×reversed-phase LC separations conducted at high and low pH, are shown. Copyright © 2017 Elsevier B.V. All rights reserved.

Simulation of Mean Flow and Turbulence over a 2D Building Array Using High-Resolution CFD and a Distributed Drag Force Approach

DTIC Science & Technology

2016-06-16

procedure. The predictive capabilities of the high-resolution computational fluid dynamics ( CFD ) simulations of urban flow are validated against a very...turbulence over a 2D building array using high-resolution CFD and a distributed drag force approach a Department of Mechanical Engineering, University

Towards MRI microarrays.

PubMed

Hall, Andrew; Mundell, Victoria J; Blanco-Andujar, Cristina; Bencsik, Martin; McHale, Glen; Newton, Michael I; Cave, Gareth W V

2010-04-14

Superparamagnetic iron oxide nanometre scale particles have been utilised as contrast agents to image staked target binding oligonucleotide arrays using MRI to correlate the signal intensity and T(2)* relaxation times in different NMR fluids.

WebaCGH: an interactive online tool for the analysis and display of array comparative genomic hybridisation data.

PubMed

Frankenberger, Casey; Wu, Xiaolin; Harmon, Jerry; Church, Deanna; Gangi, Lisa M; Munroe, David J; Urzúa, Ulises

2006-01-01

Gene copy number variations occur both in normal cells and in numerous pathologies including cancer and developmental diseases. Array comparative genomic hybridisation (aCGH) is an emerging technology that allows detection of chromosomal gains and losses in a high-resolution format. When aCGH is performed on cDNA and oligonucleotide microarrays, the impact of DNA copy number on gene transcription profiles may be directly compared. We have created an online software tool, WebaCGH, that functions to (i) upload aCGH and gene transcription results from multiple experiments; (ii) identify significant aberrant regions using a local Z-score threshold in user-selected chromosomal segments subjected to smoothing with moving averages; and (iii) display results in a graphical format with full genome and individual chromosome views. In the individual chromosome display, data can be zoomed in/out in both dimensions (i.e. ratio and physical location) and plotted features can have 'mouse over' linking to outside databases to identify loci of interest. Uploaded data can be stored indefinitely for subsequent retrieval and analysis. WebaCGH was created as a Java-based web application using the open-source database MySQL. WebaCGH is freely accessible at http://129.43.22.27/WebaCGH/welcome.htm Xiaolin Wu (forestwu@mail.nih.gov) or Ulises Urzúa (uurzua@med.uchile.cl).

New approach to the determination phosphorothioate oligonucleotides by ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry.

PubMed

Studzińska, Sylwia; Mounicou, Sandra; Szpunar, Joanna; Łobiński, Ryszard; Buszewski, Bogusław

2015-01-15

This text presents a novel method for the separation and detection of phosphorothioate oligonucleotides with the use of ion pair ultra high performance liquid chromatography coupled with inductively coupled plasma mass spectrometry The research showed that hexafluoroisopropanol/triethylamine based mobile phases may be successfully used when liquid chromatography is coupled with such elemental detection. However, the concentration of both HFIP and TEA influences the final result. The lower concentration of HFIP, the lower the background in ICP-MS and the greater the sensitivity. The method applied for the analysis of serum samples was based on high resolution inductively coupled plasma mass spectrometry. Utilization of this method allows determination of fifty times lower quantity of phosphorothioate oligonucleotides than in the case of quadrupole mass analyzer. Monitoring of (31)P may be used to quantify these compounds at the level of 80 μg L(-1), while simultaneous determination of sulfur is very useful for qualitative analysis. Moreover, the results presented in this paper demonstrate the practical applicability of coupling LC with ICP-MS in determining phosphorothioate oligonucleotides and their metabolites in serum within 7 min with a very good sensitivity. The method was linear in the concentration range between 0.2 and 3 mg L(-1). The limit of detection was in the range of 0.07 and 0.13 mg L(-1). Accuracy varied with concentration, but was in the range of 3%. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of ultrahigh resolution alpha particle imaging detector using 1 mm channel size Si-PM array

NASA Astrophysics Data System (ADS)

Yamamoto, Seiichi; Kawaguchi, Wataru

2018-06-01

For precise distribution measurements of alpha particles, a high-resolution alpha particle imaging detector is required. Although combining a thin scintillator with a silicon photomultiplier (Si-PM) array is a promising method for achieving high resolution, the spatial resolution is limited. Reducing the size of the Si-PM array is a possible approach to improving the spatial resolution of the alpha particle imaging detector. Consequently, we employed a 1 mm channel size Si-PM array combined with a thin ZnS(Ag) sheet to form an alpha particle imaging detector and evaluated the performance. For the developed alpha particle imaging detector, an Si-PM array with 1 mm x 1 mm channel size arranged 8 x 8 was optically coupled to a ZnS(Ag) sheet with a 1-mm-thick light guide between them. The size of the alpha particle imaging detector was 9.5 mm x 9.5 mm. The spatial resolution of the developed alpha particle imaging detector was 0.14 mm FWHM, and the energy resolution was 74% FWHM for 5.5 MeV alpha particles. The uniformity of the imaging detector at the central part of the field of view (FOV) was ±4.7%. The background count rate was 0.06 counts/min. We obtained various high-resolution phantom images for alpha particles with the developed system. We conclude that the developed imaging detector is promising for high-resolution distribution measurements of alpha particles.

Genetics Home Reference: mycosis fungoides

MedlinePlus

... Cigudosa JC, Barranco C, Serrano S, Dummer R, Tensen CP, Solé F, Pujol RM, Espinet B. Oligonucleotide array- ... K, Knijnenburg J, Boer JM, Willemze R, Tensen CP. Oncogenomic analysis of mycosis fungoides reveals major differences ...

A robust method to analyze copy number alterations of less than 100 kb in single cells using oligonucleotide array CGH.

PubMed

Möhlendick, Birte; Bartenhagen, Christoph; Behrens, Bianca; Honisch, Ellen; Raba, Katharina; Knoefel, Wolfram T; Stoecklein, Nikolas H

2013-01-01

Comprehensive genome wide analyses of single cells became increasingly important in cancer research, but remain to be a technically challenging task. Here, we provide a protocol for array comparative genomic hybridization (aCGH) of single cells. The protocol is based on an established adapter-linker PCR (WGAM) and allowed us to detect copy number alterations as small as 56 kb in single cells. In addition we report on factors influencing the success of single cell aCGH downstream of the amplification method, including the characteristics of the reference DNA, the labeling technique, the amount of input DNA, reamplification, the aCGH resolution, and data analysis. In comparison with two other commercially available non-linear single cell amplification methods, WGAM showed a very good performance in aCGH experiments. Finally, we demonstrate that cancer cells that were processed and identified by the CellSearch® System and that were subsequently isolated from the CellSearch® cartridge as single cells by fluorescence activated cell sorting (FACS) could be successfully analyzed using our WGAM-aCGH protocol. We believe that even in the era of next-generation sequencing, our single cell aCGH protocol will be a useful and (cost-) effective approach to study copy number alterations in single cells at resolution comparable to those reported currently for single cell digital karyotyping based on next generation sequencing data.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

PubMed

Jain, K K

2001-02-01

Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

A depth-of-interaction PET detector using mutual gain-equalized silicon photomultiplier

DOE Office of Scientific and Technical Information (OSTI.GOV)

W. Xi, A.G, Weisenberger, H. Dong, Brian Kross, S. Lee, J. McKisson, Carl Zorn

We developed a prototype high resolution, high efficiency depth-encoding detector for PET applications based on dual-ended readout of LYSO array with two silicon photomultipliers (SiPMs). Flood images, energy resolution, and depth-of-interaction (DOI) resolution were measured for a LYSO array - 0.7 mm in crystal pitch and 10 mm in thickness - with four unpolished parallel sides. Flood images were obtained such that individual crystal element in the array is resolved. The energy resolution of the entire array was measured to be 33%, while individual crystal pixel elements utilizing the signal from both sides ranged from 23.3% to 27%. By applyingmore » a mutual-gain equalization method, a DOI resolution of 2 mm for the crystal array was obtained in the experiments while simulations indicate {approx}1 mm DOI resolution could possibly be achieved. The experimental DOI resolution can be further improved by obtaining revised detector supporting electronics with better energy resolutions. This study provides a detailed detector calibration and DOI response characterization of the dual-ended readout SiPM-based PET detectors, which will be important in the design and calibration of a PET scanner in the future.« less

A functional genomics tool for the Pacific bluefin tuna: Development of a 44K oligonucleotide microarray from whole-genome sequencing data for global transcriptome analysis.

PubMed

Yasuike, Motoshige; Fujiwara, Atushi; Nakamura, Yoji; Iwasaki, Yuki; Nishiki, Issei; Sugaya, Takuma; Shimizu, Akio; Sano, Motohiko; Kobayashi, Takanori; Ototake, Mitsuru

2016-02-01

Bluefin tunas are one of the most important fishery resources worldwide. Because of high market values, bluefin tuna farming has been rapidly growing during recent years. At present, the most common form of the tuna farming is based on the stocking of wild-caught fish. Therefore, concerns have been raised about the negative impact of the tuna farming on wild stocks. Recently, the Pacific bluefin tuna (PBT), Thunnus orientalis, has succeeded in completing the reproduction cycle under aquaculture conditions, but production bottlenecks remain to be solved because of very little biological information on bluefin tunas. Functional genomics approaches promise to rapidly increase our knowledge on biological processes in the bluefin tuna. Here, we describe the development of the first 44K PBT oligonucleotide microarray (oligo-array), based on whole-genome shotgun (WGS) sequencing and large-scale expressed sequence tags (ESTs) data. In addition, we also introduce an initial 44K PBT oligo-array experiment using in vitro grown peripheral blood leukocytes (PBLs) stimulated with immunostimulants such as lipopolysaccharide (LPS: a cell wall component of Gram-negative bacteria) or polyinosinic:polycytidylic acid (poly I:C: a synthetic mimic of viral infection). This pilot 44K PBT oligo-array analysis successfully addressed distinct immune processes between LPS- and poly I:C- stimulated PBLs. Thus, we expect that this oligo-array will provide an excellent opportunity to analyze global gene expression profiles for a better understanding of diseases and stress, as well as for reproduction, development and influence of nutrition on tuna aquaculture production. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

The CHARA optical array

NASA Astrophysics Data System (ADS)

McAlister, Harold A.

1992-11-01

The Center for High Angular Resolution Astronomy (CHARA) was established in the College of Arts and Sciences at Georgia State University in 1984 with the goals of designing, constructing, and then operating a facility for very high spatial resolution astronomy. The interest in such a facility grew out of the participants' decade of activity in speckle interferometry. Although speckle interferometry continues to provide important astrophysical measurements of a variety of objects, many pressing problems require resolution far beyond that which can be expected from single aperture telescopes. In early 1986, CHARA received a grant from the National Science Foundation which has permitted a detailed exploration of the feasibility of constructing a facility which will provide a hundred-fold increase in angular resolution over what is possible by speckle interferometry at the largest existing telescopes. The design concept for the CHARA Array was developed initially with the contractural collaboration of United Technologies Optical Systems, Inc., in West Palm Beach, Florida, an arrangement that expired in August 1987. In late November 1987, the Georgia Tech Research Institute joined with CHARA to continue and complete the design concept study. Very high-resolution imaging at optical wavelengths is clearly coming of age in astronomy. The CHARA Array and other related projects will be important and necessary milestones along the way toward the development of a major national facility for high-resolution imaging--a true optical counterpart to the Very Large Array. Ground-based arrays and their scientific output will lead to high resolution facilities in space and, ultimately, on the Moon.

Long linear MWIR and LWIR HgCdTe infrared detection arrays for high resolution imaging

NASA Astrophysics Data System (ADS)

Chamonal, Jean-Paul; Audebert, Patrick; Medina, Philippe; Destefanis, Gérard; Deschamps, Joel R.; Girard, Michel; Chatard, Jean-Pierre

2018-04-01

This paper, "Long linear MWIR and LWIR HgCdTe infrared detection arrays for high resolution imaging," was presented as part of International Conference on Space Optics—ICSO 1997, held in Toulouse, France.

Design, Fabrication and Characterization of A Bi-Frequency Co-Linear Array

PubMed Central

Wang, Zhuochen; Li, Sibo; Czernuszewicz, Tomasz J; Gallippi, Caterina M.; Liu, Ruibin; Geng, Xuecang

2016-01-01

Ultrasound imaging with high resolution and large penetration depth has been increasingly adopted in medical diagnosis, surgery guidance, and treatment assessment. Conventional ultrasound works at a particular frequency, with a −6 dB fractional bandwidth of ~70 %, limiting the imaging resolution or depth of field. In this paper, a bi-frequency co-linear array with resonant frequencies of 8 MHz and 20 MHz was investigated to meet the requirements of resolution and penetration depth for a broad range of ultrasound imaging applications. Specifically, a 32-element bi-frequency co-linear array was designed and fabricated, followed by element characterization and real-time sectorial scan (S-scan) phantom imaging using a Verasonics system. The bi-frequency co-linear array was tested in four different modes by switching between low and high frequencies on transmit and receive. The four modes included the following: (1) transmit low, receive low, (2) transmit low, receive high, (3) transmit high, receive low, (4) transmit high, receive high. After testing, the axial and lateral resolutions of all modes were calculated and compared. The results of this study suggest that bi-frequency co-linear arrays are potential aids for wideband fundamental imaging and harmonic/sub-harmonic imaging. PMID:26661069

Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua

2014-02-01

Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissilemore » phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.« less

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

High-Frequency Ultrasonic Imaging of the Anterior Segment Using an Annular Array Transducer

PubMed Central

Silverman, Ronald H.; Ketterling, Jeffrey A.; Coleman, D. Jackson

2006-01-01

Objective Very-high-frequency (>35 MHz) ultrasound (VHFU) allows imaging of anterior segment structures of the eye with a resolution of less than 40-μm. The low focal ratio of VHFU transducers, however, results in a depth-of-field (DOF) of less than 1-mm. Our aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity and resolution compared to conventional transducers. Design Experimental Study Participants Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. Methods A spherically curved annular array ultrasound transducer was fabricated. The array consisted of five concentric rings of equal area, had an overall aperture of 6 mm and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit/receive annuli combinations. The echo data were then synthetically focused and composite images produced. Transducer operation was tested by scanning a test object consisting of a series of 25-μm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit and human cadaver eyes. Main Outcome Measures Depth of field, resolution and sensitivity. Results The wire scans verified the operation of the array and demonstrated a 6.0 mm DOF compared to the 1.0 mm DOF of a conventional single-element transducer of comparable frequency, aperture and focal length. B-mode images of ex vivo bovine, in vivo rabbit and cadaver eyes showed that while the single-element transducer had high sensitivity and resolution within 1–2 mm of its focus, the array with synthetic focusing maintained this quality over a 6 mm DOF. Conclusion An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved depth-of-field, sensitivity and lateral resolution compared to single-element fixed focus transducers currently used for VHFU imaging of the eye. PMID:17141314

High-frequency ultrasonic imaging of the anterior segment using an annular array transducer.

PubMed

Silverman, Ronald H; Ketterling, Jeffrey A; Coleman, D Jackson

2007-04-01

Very high-frequency ultrasound (VHFU; >35 megahertz [MHz]) allows imaging of anterior segment structures of the eye with a resolution of less than 40 microm. The low focal ratio of VHFU transducers, however, results in a depth of field (DOF) of less than 1 mm. The aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity, and resolution compared with conventional transducers. Experimental study. Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. A spherically curved annular array ultrasound transducer was fabricated. The array consisted of 5 concentric rings of equal area, had an overall aperture of 6 mm, and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data were recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit-and-receive annuli combinations. The echo data then were focused synthetically and composite images were produced. Transducer operation was tested by scanning a test object consisting of a series of 25-microm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit, and human cadaver eyes. Depth of field, resolution, and sensitivity. The wire scans verified the operation of the array and demonstrated a 6.0-mm DOF, compared with the 1.0-mm DOF of a conventional single-element transducer of comparable frequency, aperture, and focal length. B-mode images of ex vivo bovine, in vivo rabbit, and cadaver eyes showed that although the single-element transducer had high sensitivity and resolution within 1 to 2 mm of its focus, the array with synthetic focusing maintained this quality over a 6-mm DOF. An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved DOF, sensitivity, and lateral resolution compared with single-element fixed focus transducers currently used for VHFU imaging of the eye.

Real-Time Continuous Identification of Greenhouse Plant Pathogens Based on Recyclable Microfluidic Bioassay System.

PubMed

Qu, Xiangmeng; Li, Min; Zhang, Hongbo; Lin, Chenglie; Wang, Fei; Xiao, Mingshu; Zhou, Yi; Shi, Jiye; Aldalbahi, Ali; Pei, Hao; Chen, Hong; Li, Li

2017-09-20

The development of a real-time continuous analytical platform for the pathogen detection is of great scientific importance for achieving better disease control and prevention. In this work, we report a rapid and recyclable microfluidic bioassay system constructed from oligonucleotide arrays for selective and sensitive continuous identification of DNA targets of fungal pathogens. We employ the thermal denaturation method to effectively regenerate the oligonucleotide arrays for multiple sample detection, which could considerably reduce the screening effort and costs. The combination of thermal denaturation and laser-induced fluorescence detection technique enables real-time continuous identification of multiple samples (<10 min per sample). As a proof of concept, we have demonstrated that two DNA targets of fungal pathogens (Botrytis cinerea and Didymella bryoniae) can be sequentially analyzed using our rapid microfluidic bioassay system, which provides a new paradigm in the design of microfluidic bioassay system and will be valuable for chemical and biomedical analysis.

Microfabricated Fountain Pens for High-Density DNA Arrays

PubMed Central

Reese, Matthew O.; van Dam, R. Michae; Scherer, Axel; Quake, Stephen R.

2003-01-01

We used photolithographic microfabrication techniques to create very small stainless steel fountain pens that were installed in place of conventional pens on a microarray spotter. Because of the small feature size produced by the microfabricated pens, we were able to print arrays with up to 25,000 spots/cm2, significantly higher than can be achieved by other deposition methods. This feature density is sufficiently large that a standard microscope slide can contain multiple replicates of every gene in a complex organism such as a mouse or human. We tested carryover during array printing with dye solution, labeled DNA, and hybridized DNA, and we found it to be indistinguishable from background. Hybridization also showed good sequence specificity to printed oligonucleotides. In addition to improved slide capacity, the microfabrication process offers the possibility of low-cost mass-produced pens and the flexibility to include novel pen features that cannot be machined with conventional techniques. PMID:12975313

Discovery of novel variants in genotyping arrays improves genotype retention and reduces ascertainment bias

PubMed Central

2012-01-01

Background High-density genotyping arrays that measure hybridization of genomic DNA fragments to allele-specific oligonucleotide probes are widely used to genotype single nucleotide polymorphisms (SNPs) in genetic studies, including human genome-wide association studies. Hybridization intensities are converted to genotype calls by clustering algorithms that assign each sample to a genotype class at each SNP. Data for SNP probes that do not conform to the expected pattern of clustering are often discarded, contributing to ascertainment bias and resulting in lost information - as much as 50% in a recent genome-wide association study in dogs. Results We identified atypical patterns of hybridization intensities that were highly reproducible and demonstrated that these patterns represent genetic variants that were not accounted for in the design of the array platform. We characterized variable intensity oligonucleotide (VINO) probes that display such patterns and are found in all hybridization-based genotyping platforms, including those developed for human, dog, cattle, and mouse. When recognized and properly interpreted, VINOs recovered a substantial fraction of discarded probes and counteracted SNP ascertainment bias. We developed software (MouseDivGeno) that identifies VINOs and improves the accuracy of genotype calling. MouseDivGeno produced highly concordant genotype calls when compared with other methods but it uniquely identified more than 786000 VINOs in 351 mouse samples. We used whole-genome sequence from 14 mouse strains to confirm the presence of novel variants explaining 28000 VINOs in those strains. We also identified VINOs in human HapMap 3 samples, many of which were specific to an African population. Incorporating VINOs in phylogenetic analyses substantially improved the accuracy of a Mus species tree and local haplotype assignment in laboratory mouse strains. Conclusion The problems of ascertainment bias and missing information due to genotyping errors are widely recognized as limiting factors in genetic studies. We have conducted the first formal analysis of the effect of novel variants on genotyping arrays, and we have shown that these variants account for a large portion of miscalled and uncalled genotypes. Genetic studies will benefit from substantial improvements in the accuracy of their results by incorporating VINOs in their analyses. PMID:22260749

Genome-Wide Mapping of Copy Number Variation in Humans: Comparative Analysis of High Resolution Array Platforms

PubMed Central

Haraksingh, Rajini R.; Abyzov, Alexej; Gerstein, Mark; Urban, Alexander E.; Snyder, Michael

2011-01-01

Accurate and efficient genome-wide detection of copy number variants (CNVs) is essential for understanding human genomic variation, genome-wide CNV association type studies, cytogenetics research and diagnostics, and independent validation of CNVs identified from sequencing based technologies. Numerous, array-based platforms for CNV detection exist utilizing array Comparative Genome Hybridization (aCGH), Single Nucleotide Polymorphism (SNP) genotyping or both. We have quantitatively assessed the abilities of twelve leading genome-wide CNV detection platforms to accurately detect Gold Standard sets of CNVs in the genome of HapMap CEU sample NA12878, and found significant differences in performance. The technologies analyzed were the NimbleGen 4.2 M, 2.1 M and 3×720 K Whole Genome and CNV focused arrays, the Agilent 1×1 M CGH and High Resolution and 2×400 K CNV and SNP+CGH arrays, the Illumina Human Omni1Quad array and the Affymetrix SNP 6.0 array. The Gold Standards used were a 1000 Genomes Project sequencing-based set of 3997 validated CNVs and an ultra high-resolution aCGH-based set of 756 validated CNVs. We found that sensitivity, total number, size range and breakpoint resolution of CNV calls were highest for CNV focused arrays. Our results are important for cost effective CNV detection and validation for both basic and clinical applications. PMID:22140474

High resolution CsI(Tl)/Si-PIN detector development for breast imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patt, B.E.; Iwanczyk, J.S.; Tull, C.R.

High resolution multi-element (8x8) imaging arrays with collimators, size matched to discrete CsI(Tl) scintillator arrays and Si-PIN photodetector arrays (PDA`s) were developed as prototypes for larger arrays for breast imaging. Photodetector pixels were each 1.5 {times} 1.5 mm{sup 2} with 0.25 mm gaps. A 16-element quadrant of the detector was evaluated with a segmented CsI(Tl) scintillator array coupled to the silicon array. The scintillator thickness of 6 mm corresponds to >85% total gamma efficiency at 140 keV. Pixel energy resolution of <8% FWHM was obtained for Tc-99m. Electronic noise was 41 e{sup {minus}} RMS corresponding to a 3% FWHM contributionmore » to the 140 keV photopeak. Detection efficiency uniformity measured with a Tc-99m flood source was 4.3% for an {approximately}10% energy photopeak window. Spatial resolution was 1.53 mm FWHM and pitch was 1.75 mm as measured from the Co-57 (122 keV) line spread function. Signal to background was 34 and contrast was 0.94. The energy resolution and spatial characteristics of the new imaging detector exceed those of other scintillator based imaging detectors. A camera based on this technology will allow: (1) Improved Compton scatter rejection; (2) Detector positioning in close proximity to the breast to increase signal to noise; (3) Improved spatial resolution; and (4) Improved efficiency compared to high resolution collimated gamma cameras for the anticipated compressed breast geometries.« less

High Frequency High Spectral Resolution Focal Plane Arrays for AtLAST

NASA Astrophysics Data System (ADS)

Baryshev, Andrey

2018-01-01

Large collecting area single dish telescope such as ATLAST will be especially effective for medium (R 1000) and high (R 50000) spectral resolution observations. Large focal plane array is a natural solution to increase mapping speed. For medium resolution direct detectors with filter banks (KIDs) and or heterodyne technology can be employed. We will analyze performance limits of comparable KID and SIS focal plane array taking into account quantum limit and high background condition of terrestrial observing site. For large heterodyne focal plane arrays, a high current density AlN junctions open possibility of large instantaneous bandwidth >40%. This and possible multi frequency band FPSs presents a practical challenge for spatial sampling and scanning strategies. We will discuss phase array feeds as a possible solution, including a modular back-end system, which can be shared between KID and SIS based FPA. Finally we will discuss achievable sensitivities and pixel co unts for a high frequency (>500 GHz) FPAs and address main technical challenges: LO distribution, wire counts, bias line multiplexing, and monolithic vs. discrete mixer component integration.

Combinatorial algorithms for design of DNA arrays.

PubMed

Hannenhalli, Sridhar; Hubell, Earl; Lipshutz, Robert; Pevzner, Pavel A

2002-01-01

Optimal design of DNA arrays requires the development of algorithms with two-fold goals: reducing the effects caused by unintended illumination (border length minimization problem) and reducing the complexity of masks (mask decomposition problem). We describe algorithms that reduce the number of rectangles in mask decomposition by 20-30% as compared to a standard array design under the assumption that the arrangement of oligonucleotides on the array is fixed. This algorithm produces provably optimal solution for all studied real instances of array design. We also address the difficult problem of finding an arrangement which minimizes the border length and come up with a new idea of threading that significantly reduces the border length as compared to standard designs.

Mercuric iodide room-temperature array detectors for gamma-ray imaging

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patt, B.

Significant progress has been made recently in the development of mercuric iodide detector arrays for gamma-ray imaging, making real the possibility of constructing high-performance small, light-weight, portable gamma-ray imaging systems. New techniques have been applied in detector fabrication and then low noise electronics which have produced pixel arrays with high-energy resolution, high spatial resolution, high gamma stopping efficiency. Measurements of the energy resolution capability have been made on a 19-element protypical array. Pixel energy resolutions of 2.98% fwhm and 3.88% fwhm were obtained at 59 keV (241-Am) and 140-keV (99m-Tc), respectively. The pixel spectra for a 14-element section of themore » data is shown together with the composition of the overlapped individual pixel spectra. These techniques are now being applied to fabricate much larger arrays with thousands of pixels. Extension of these principles to imaging scenarios involving gamma-ray energies up to several hundred keV is also possible. This would enable imaging of the 208 keV and 375-414 keV 239-Pu and 240-Pu structures, as well as the 186 keV line of 235-U.« less

Thin polymer etalon arrays for high-resolution photoacoustic imaging

PubMed Central

Hou, Yang; Huang, Sheng-Wen; Ashkenazi, Shai; Witte, Russell; O’Donnell, Matthew

2009-01-01

Thin polymer etalons are demonstrated as high-frequency ultrasound sensors for three-dimensional (3-D) high-resolution photoacoustic imaging. The etalon, a Fabry-Perot optical resonator, consists of a thin polymer slab sandwiched between two gold layers. It is probed with a scanning continuous-wave (CW) laser for ultrasound array detection. Detection bandwidth of a 20-μm-diam array element exceeds 50 MHz, and the ultrasound sensitivity is comparable to polyvinylidene fluoride (PVDF) equivalents of similar size. In a typical photoacoustic imaging setup, a pulsed laser beam illuminates the imaging target, where optical energy is absorbed and acoustic waves are generated through the thermoelastic effect. An ultrasound detection array is formed by scanning the probing laser beam on the etalon surface in either a 1-D or a 2-D configuration, which produces 2-D or 3-D images, respectively. Axial and lateral resolutions have been demonstrated to be better than 20 μm. Detailed characterizations of the optical and acoustical properties of the etalon, as well as photoacoustic imaging results, suggest that thin polymer etalon arrays can be used as ultrasound detectors for 3-D high-resolution photoacoustic imaging applications. PMID:19123679

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

Application of dot-matrix illumination of liquid crystal phase space light modulator in 3D imaging of APD array

NASA Astrophysics Data System (ADS)

Wang, Shuai; Sun, Huayan; Guo, Huichao

2018-01-01

Aiming at the problem of beam scanning in low-resolution APD array in three-dimensional imaging, a method of beam scanning with liquid crystal phase-space optical modulator is proposed to realize high-resolution imaging by low-resolution APD array. First, a liquid crystal phase spatial light modulator is used to generate a beam array and then a beam array is scanned. Since the sub-beam divergence angle in the beam array is smaller than the field angle of a single pixel in the APD array, the APD's pixels respond only to the three-dimensional information of the beam illumination position. Through the scanning of the beam array, a single pixel is used to collect the target three-dimensional information multiple times, thereby improving the resolution of the APD detector. Finally, MATLAB is used to simulate the algorithm in this paper by using two-dimensional scalar diffraction theory, which realizes the splitting and scanning with a resolution of 5 x 5. The feasibility is verified theoretically.

A method of incident angle estimation for high resolution spectral recovery in filter-array-based spectrometers

NASA Astrophysics Data System (ADS)

Kim, Cheolsun; Lee, Woong-Bi; Ju, Gun Wu; Cho, Jeonghoon; Kim, Seongmin; Oh, Jinkyung; Lim, Dongsung; Lee, Yong Tak; Lee, Heung-No

2017-02-01

In recent years, there has been an increasing interest in miniature spectrometers for research and development. Especially, filter-array-based spectrometers have advantages of low cost and portability, and can be applied in various fields such as biology, chemistry and food industry. Miniaturization in optical filters causes degradation of spectral resolution due to limitations on spectral responses and the number of filters. Nowadays, many studies have been reported that the filter-array-based spectrometers have achieved resolution improvements by using digital signal processing (DSP) techniques. The performance of the DSP-based spectral recovery highly depends on the prior information of transmission functions (TFs) of the filters. The TFs vary with respect to an incident angle of light onto the filter-array. Conventionally, it is assumed that the incident angle of light on the filters is fixed and the TFs are known to the DSP. However, the incident angle is inconstant according to various environments and applications, and thus TFs also vary, which leads to performance degradation of spectral recovery. In this paper, we propose a method of incident angle estimation (IAE) for high resolution spectral recovery in the filter-array-based spectrometers. By exploiting sparse signal reconstruction of the L1- norm minimization, IAE estimates an incident angle among all possible incident angles which minimizes the error of the reconstructed signal. Based on IAE, DSP effectively provides a high resolution spectral recovery in the filter-array-based spectrometers.

Rearranging the lenslet array of the compact passive interference imaging system with high resolution

NASA Astrophysics Data System (ADS)

Liu, Gang; Wen, Desheng; Song, Zongxi

2017-10-01

With the development of aeronautics and astronautics, higher resolution requirement of the telescope was necessary. However, the increase in resolution of conventional telescope required larger apertures, whose size, weight and power consumption could be prohibitively expensive. This limited the further development of the telescope. This paper introduced a new imaging technology using interference—Compact Passive Interference Imaging Technology with High Resolution, and proposed a rearranging method for the arrangement of the lenslet array to obtain continuously object spatial frequency.

Effects of reflector and crystal surface on the performance of a depth-encoding PET detector with dual-ended readout

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Silin; Yang, Yongfeng, E-mail: yfyang@ucdavis.edu; Cherry, Simon R.

Purpose: Depth encoding detectors are required to improve the spatial resolution and spatial resolution uniformity of small animal positron emission tomography (PET) scanners, as well as dedicated breast and brain scanners. Depth of interaction (DOI) can be measured by using dual-ended readout of lutetium oxyorthosilicate (LSO) scintillator arrays with position-sensitive avalanche photodiodes. Inter-crystal reflectors and crystal surface treatments play important roles in determining the performance of dual-ended detectors. In this paper, the authors evaluated five LSO arrays made with three different intercrystal reflectors and with either polished or unpolished crystal surfaces. Methods: The crystal size in all arrays was 1.5more » mm, which is typical of the detector size used in small animal and dedicated breast scanners. The LSO arrays were measured with dual-ended readout and were compared in terms of flood histogram, energy resolution, and DOI resolution performance. Results: The four arrays using enhanced specular reflector (ESR) and Toray reflector provided similar quality flood histograms and the array using Crystal Wrap reflector gave the worst flood histogram. The two arrays using ESR reflector provided the best energy resolution and the array using Crystal Wrap reflector yielded the worst energy resolution. All arrays except the polished ESR array provided good DOI resolution ranging from 1.9 mm to 2.9 mm. DOI resolution improved as the gradient in light collection efficiency with depth (GLCED) increased. The geometric mean energies were also calculated for these dual-ended readout detectors as an alternative to the conventional summed total energy. It was shown that the geometric mean energy is advantageous in that it provides more uniform photopeak amplitude at different depths for arrays with high GLCED, and is beneficial in event selection by allowing a fixed energy window independent of depth. A new method of DOI calculation that improved the linearity of DOI ratio vs depth and simplifies the DOI calibration procedure also was developed and tested. Conclusions: The results of these studies provide useful guidance in selecting the proper reflectors and crystal surface treatments when LSO arrays are used for high-resolution PET applications in small animal scanners or dedicated breast and brain scanners.« less

Performance of a high-resolution depth-encoding PET detector module using linearly-graded SiPM arrays

NASA Astrophysics Data System (ADS)

Du, Junwei; Bai, Xiaowei; Gola, Alberto; Acerbi, Fabio; Ferri, Alessandro; Piemonte, Claudio; Yang, Yongfeng; Cherry, Simon R.

2018-02-01

The goal of this study was to exploit the excellent spatial resolution characteristics of a position-sensitive silicon photomultiplier (SiPM) and develop a high-resolution depth-of-interaction (DOI) encoding positron emission tomography (PET) detector module. The detector consists of a 30  ×  30 array of 0.445  ×  0.445  ×  20 mm3 polished LYSO crystals coupled to two 15.5  ×  15.5 mm2 linearly-graded SiPM (LG-SiPM) arrays at both ends. The flood histograms show that all the crystals in the LYSO array can be resolved. The energy resolution, the coincidence timing resolution and the DOI resolution were 21.8  ±  5.8%, 1.23  ±  0.10 ns and 3.8  ±  1.2 mm, respectively, at a temperature of -10 °C and a bias voltage of 35.0 V. The performance did not degrade significantly for event rates of up to 130 000 counts s-1. This detector represents an attractive option for small-bore PET scanner designs that simultaneously emphasize high spatial resolution and high detection efficiency, important, for example, in preclinical imaging of the rodent brain with neuroreceptor ligands.

Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

PubMed

Jung, Ki-Hong; Dardick, Christopher; Bartley, Laura E; Cao, Peijian; Phetsom, Jirapa; Canlas, Patrick; Seo, Young-Su; Shultz, Michael; Ouyang, Shu; Yuan, Qiaoping; Frank, Bryan C; Ly, Eugene; Zheng, Li; Jia, Yi; Hsia, An-Ping; An, Kyungsook; Chou, Hui-Hsien; Rocke, David; Lee, Geun Cheol; Schnable, Patrick S; An, Gynheung; Buell, C Robin; Ronald, Pamela C

2008-10-06

Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa). We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org). The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

Sub-attomole oligonucleotide and p53 cDNA determinations via a high-resolution surface plasmon resonance combined with oligonucleotide-capped gold nanoparticle signal amplification.

PubMed

Yao, Xin; Li, Xin; Toledo, Freddy; Zurita-Lopez, Cecilia; Gutova, Margarita; Momand, Jamil; Zhou, Feimeng

2006-07-15

Oligonucleotide (ODN)-capped gold nanoparticles (Au-NPs) were used in a sandwich assay of ODN or polynucleotide by a flow injection surface plasmon resonance (SPR). A carboxylated dextran film was immobilized onto the SPR sensor surface to eliminate nonspecific adsorption of ODN-capped Au-NPs. The tandem use of signal amplification via the adlayer of the ODN-capped Au-NPs and the differential signal detection by the bicell detector on the SPR resulted in a remarkable DNA detection level. A 39-mer target at a quantity as low as 2.1 x 10(-20)mol, corresponding to 1.38 fM in a 15 microl solution, can be measured. To our knowledge, both the concentration and quantity detection levels are the lowest among all the gene analyses conducted with SPR to this point. The method is shown to be reproducible (relative standard deviation values <16%) and to possess high sequence specificity. It is also demonstrated to be viable for sequence-specific p53 cDNA analysis. The successful elimination of nonspecific adsorption of, and the signal amplification by, ODN-capped Au-NPs renders the SPR attractive for cases where the DNA concentration is extremely low and the sample availability is severely limited.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

Paper-based solid-phase multiplexed nucleic acid hybridization assay with tunable dynamic range using immobilized quantum dots as donors in fluorescence resonance energy transfer.

PubMed

Noor, M Omair; Krull, Ulrich J

2013-08-06

A multiplexed solid-phase nucleic acid hybridization assay on a paper-based platform is presented using multicolor immobilized quantum dots (QDs) as donors in fluorescence resonance energy transfer (FRET). The surface of paper was modified with imidazole groups to immobilize two types of QD-probe oligonucleotide conjugates that were assembled in solution. Green-emitting QDs (gQDs) and red-emitting QDs (rQDs) served as donors with Cy3 and Alexa Fluor 647 (A647) acceptors. The gQD/Cy3 FRET pair served as an internal standard, while the rQD/A647 FRET pair served as a detection channel, combining the control and analytical test zones in one physical location. Hybridization of dye-labeled oligonucleotide targets provided the proximity for FRET sensitized emission from the acceptor dyes, which served as an analytical signal. Hybridization assays in the multicolor format provided a limit of detection of 90 fmol and an upper limit of dynamic range of 3.5 pmol. The use of an array of detection zones was designed to provide improved analytical figures of merit compared to that which could be achieved on one type of array design in terms of relative concentration of multicolor QDs. The hybridization assays showed excellent resistance to nonspecific adsorption of oligonucleotides. Selectivity of the two-plex hybridization assay was demonstrated by single nucleotide polymorphism (SNP) detection at a contrast ratio of 50:1. Additionally, it is shown that the use of preformed QD-probe oligonucleotide conjugates and consideration of the relative number density of the two types of QD-probe conjugates in the two-color assay format is advantageous to maximize assay sensitivity and the upper limit of dynamic range.

Modulation of Stat3 Alternative Splicing in Breast Cancer

DTIC Science & Technology

2010-09-01

using morpholino oligonucleotides covalently linked to an octaguanidine dendrimer (vivo- morpholinos) [54]. Since delivery of vivo-morpholino oligos...Li, and S. Jiang, Vivo-Morpholinos: a non-peptide transporter delivers Morpholinos into a wide array of mouse tissues. Biotechniques, 2008. 45(6

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

PubMed Central

Jin, Lian-Qun; Li, Jun-Wen; Wang, Sheng-Qi; Chao, Fu-Huan; Wang, Xin-Wei; Yuan, Zheng-Quan

2005-01-01

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost. PMID:16437687

Three Dimensional High-Resolution Reconstruction of the Ionosphere Over the Very Large Array

DTIC Science & Technology

2010-12-15

Watts Progress Report, Dec 10; 1 Final Report: Three Dimensional High-Resolution Reconstruction of the Ionosphere over the Very Large Array...proposed research is reconstruct the three-dimensional regional electron density profile of Earth’s ionosphere with spatial resolution of better than 10 km...10x better sensitivity to total electron content (TEC, or chord integrated density) in the ionosphere that does GPS. The proposal funds the

Linear model for fast background subtraction in oligonucleotide microarrays.

PubMed

Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

2009-11-16

One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

High-resolution dynamic pressure sensor array based on piezo-phototronic effect tuned photoluminescence imaging.

PubMed

Peng, Mingzeng; Li, Zhou; Liu, Caihong; Zheng, Qiang; Shi, Xieqing; Song, Ming; Zhang, Yang; Du, Shiyu; Zhai, Junyi; Wang, Zhong Lin

2015-03-24

A high-resolution dynamic tactile/pressure display is indispensable to the comprehensive perception of force/mechanical stimulations such as electronic skin, biomechanical imaging/analysis, or personalized signatures. Here, we present a dynamic pressure sensor array based on pressure/strain tuned photoluminescence imaging without the need for electricity. Each sensor is a nanopillar that consists of InGaN/GaN multiple quantum wells. Its photoluminescence intensity can be modulated dramatically and linearly by small strain (0-0.15%) owing to the piezo-phototronic effect. The sensor array has a high pixel density of 6350 dpi and exceptional small standard deviation of photoluminescence. High-quality tactile/pressure sensing distribution can be real-time recorded by parallel photoluminescence imaging without any cross-talk. The sensor array can be inexpensively fabricated over large areas by semiconductor product lines. The proposed dynamic all-optical pressure imaging with excellent resolution, high sensitivity, good uniformity, and ultrafast response time offers a suitable way for smart sensing, micro/nano-opto-electromechanical systems.

Array-scale performance of TES X-ray Calorimeters Suitable for Constellation-X

NASA Technical Reports Server (NTRS)

Kilbourne, C. A.; Bandler, S. R.; Brown, A. D.; Chervenak, J. A.; Eckart, M. E.; Finkbeiner, F. M.; Iyomoto, N.; Kelley, R. L.; Porter, F. S.; Smith, S. J.;

Parallel Spectral Acquisition with an Ion Cyclotron Resonance Cell Array.

PubMed

Park, Sung-Gun; Anderson, Gordon A; Navare, Arti T; Bruce, James E

2016-01-19

Mass measurement accuracy is a critical analytical figure-of-merit in most areas of mass spectrometry application. However, the time required for acquisition of high-resolution, high mass accuracy data limits many applications and is an aspect under continual pressure for development. Current efforts target implementation of higher electrostatic and magnetic fields because ion oscillatory frequencies increase linearly with field strength. As such, the time required for spectral acquisition of a given resolving power and mass accuracy decreases linearly with increasing fields. Mass spectrometer developments to include multiple high-resolution detectors that can be operated in parallel could further decrease the acquisition time by a factor of n, the number of detectors. Efforts described here resulted in development of an instrument with a set of Fourier transform ion cyclotron resonance (ICR) cells as detectors that constitute the first MS array capable of parallel high-resolution spectral acquisition. ICR cell array systems consisting of three or five cells were constructed with printed circuit boards and installed within a single superconducting magnet and vacuum system. Independent ion populations were injected and trapped within each cell in the array. Upon filling the array, all ions in all cells were simultaneously excited and ICR signals from each cell were independently amplified and recorded in parallel. Presented here are the initial results of successful parallel spectral acquisition, parallel mass spectrometry (MS) and MS/MS measurements, and parallel high-resolution acquisition with the MS array system.

Compact, high-resolution, gamma ray imaging for scintimammography and other medical diagostic applications

DOEpatents

Majewski, Stanislaw; Weisenberger, Andrew G.; Wojcik, Randolph F.; Steinbach, Daniela

1999-01-01

A high resolution gamma ray imaging device includes an aluminum housing, a lead screen collimator at an opened end of the housing, a crystal scintillator array mounted behind the lead screen collimator, a foam layer between the lead screen collimator and the crystal scintillator array, a photomultiplier window coupled to the crystal with optical coupling grease, a photomultiplier having a dynode chain body and a base voltage divider with anodes, anode wire amplifiers each connected to four anodes and a multi pin connector having pin connections to each anode wire amplifier. In one embodiment the crystal scintillator array includes a yttrium aluminum perovskite (YAP) crystal array. In an alternate embodiment, the crystal scintillator array includes a gadolinium oxyorthosilicate (GSO) crystal array.

Linear-array based full-view high-resolution photoacoustic computed tomography of whole mouse brain functions in vivo

NASA Astrophysics Data System (ADS)

Li, Lei; Zhang, Pengfei; Wang, Lihong V.

2018-02-01

Photoacoustic computed tomography (PACT) is a non-invasive imaging technique offering high contrast, high resolution, and deep penetration in biological tissues. We report a photoacoustic computed tomography (PACT) system equipped with a high frequency linear array for anatomical and functional imaging of the mouse whole brain. The linear array was rotationally scanned in the coronal plane to achieve the full-view coverage. We investigated spontaneous neural activities in the deep brain by monitoring the hemodynamics and observed strong interhemispherical correlations between contralateral regions, both in the cortical layer and in the deep regions.

Dynamic-Receive Focusing with High-Frequency Annular Arrays

NASA Astrophysics Data System (ADS)

Ketterling, J. A.; Mamou, J.; Silverman, R. H.

High-frequency ultrasound is commonly employed for ophthalmic and small-animal imaging because of the fine-resolution images it affords. Annular arrays allow improved depth of field and lateral resolution versus commonly used single-element, focused transducers. The best image quality from an annular array is achieved by using synthetic transmit-to-receive focusing while utilizing data from all transmit-to-receive element combinations. However, annular arrays must be laterally scanned to form an image and this requires one pass for each of the array elements when implementing full synthetic transmit-to-receive focusing. A dynamic-receive focusing approach permits a single pass, although at a sacrifice of depth of field and lateral resolution. A five-element, 20-MHz annular array is examined to determine the acoustic beam properties for synthetic and dynamic-receive focusing. A spatial impulse response model is used to simulate the acoustic beam properties for each focusing case and then data acquired from a human eye-bank eye are processed to demonstrate the effect of each approach on image quality.

ASSESSING THE USE OF OLIGONUCLEOTIDE MICROARRAYS FOR FATHEAD MINNOW (PIMEPHALES PROMELAS) TO EXAMINE EXPOSURE VARIABLES

EPA Science Inventory

Microarray technology has proven to be a useful tool for analyzing the transcriptome of various organisms representing conditions such as disease states, developmental stages, and responses to chemical exposure. Although most commercially available arrays are limited to organism...

Development and characterization of a microheater array device for real-time DNA mutation detection

NASA Astrophysics Data System (ADS)

Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

2008-04-01

DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

Development and characterization of a microheater array device for real-time DNA mutation detection

NASA Astrophysics Data System (ADS)

Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

2008-02-01

DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

Adaptive resolution simulation of oligonucleotides

NASA Astrophysics Data System (ADS)

Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

2016-12-01

Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

DOEpatents

Smither, Robert K [Hinsdale, IL

2011-05-17

A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

Radiometric infrared focal plane array imaging system for thermographic applications

NASA Technical Reports Server (NTRS)

Esposito, B. J.; Mccafferty, N.; Brown, R.; Tower, J. R.; Kosonocky, W. F.

1992-01-01

This document describes research performed under the Radiometric Infrared Focal Plane Array Imaging System for Thermographic Applications contract. This research investigated the feasibility of using platinum silicide (PtSi) Schottky-barrier infrared focal plane arrays (IR FPAs) for NASA Langley's specific radiometric thermal imaging requirements. The initial goal of this design was to develop a high spatial resolution radiometer with an NETD of 1 percent of the temperature reading over the range of 0 to 250 C. The proposed camera design developed during this study and described in this report provides: (1) high spatial resolution (full-TV resolution); (2) high thermal dynamic range (0 to 250 C); (3) the ability to image rapid, large thermal transients utilizing electronic exposure control (commandable dynamic range of 2,500,000:1 with exposure control latency of 33 ms); (4) high uniformity (0.5 percent nonuniformity after correction); and (5) high thermal resolution (0.1 C at 25 C background and 0.5 C at 250 C background).

Radiometric infrared focal plane array imaging system for thermographic applications

NASA Astrophysics Data System (ADS)

Esposito, B. J.; McCafferty, N.; Brown, R.; Tower, J. R.; Kosonocky, W. F.

1992-11-01

This document describes research performed under the Radiometric Infrared Focal Plane Array Imaging System for Thermographic Applications contract. This research investigated the feasibility of using platinum silicide (PtSi) Schottky-barrier infrared focal plane arrays (IR FPAs) for NASA Langley's specific radiometric thermal imaging requirements. The initial goal of this design was to develop a high spatial resolution radiometer with an NETD of 1 percent of the temperature reading over the range of 0 to 250 C. The proposed camera design developed during this study and described in this report provides: (1) high spatial resolution (full-TV resolution); (2) high thermal dynamic range (0 to 250 C); (3) the ability to image rapid, large thermal transients utilizing electronic exposure control (commandable dynamic range of 2,500,000:1 with exposure control latency of 33 ms); (4) high uniformity (0.5 percent nonuniformity after correction); and (5) high thermal resolution (0.1 C at 25 C background and 0.5 C at 250 C background).

Magnetic Resonance Imaging of the anal canal using high resolution sequences and phased array coil: visualization of anal sphincter complex.

PubMed

Laghi, A; Iafrate, F; Paolantonio, P; Iannaccone, R; Baeli, I; Ferrari, R; Catalano, C; Passariello, R

2002-04-01

To assess the normal anatomy of the anal sphincter complex using high-resolution MR imaging with phased -array coil. Twenty patients, 13 males and 7 females, ranging in age between 27 and 56 years underwent MRI evaluation of the pelvic region, using a superconductive 1.5 T magnet (maximum gradient strength, 25 mT/m; minimum rise time 600 microseconds, equipped with phased-array coil. High-resolution T2-weighted Turbo Spin Echo sequences (TR, 4055 ms; TE, 132 ms; matrix 390x512; in-plane resolution, 0.67x0.57 mm) were acquired on multiple axial, sagittal and coronal planes. Images were reviewed by two experienced gastrointestinal radiologists in order to evaluate the normal anal sphincter complex. Optimal image quality of the anal sphincter complex was obtained in all cases. Different muscular layers were observed between the upper and lower aspects of the anal canal. In the lower part of the anal canal, internal and external sphincter muscles could be observed; in the upper part, puborectal and internal sphincter muscles were depicted. Good visualization of intersphincteric space, levator ani muscle and ischioanal space was also obtained in all cases. High-resolution MR images with phased-array coil provide optimal depiction of the anal canal and the anal sphincter complex.

Characterization of fiber Bragg grating-based sensor array for high resolution manometry

NASA Astrophysics Data System (ADS)

Becker, Martin; Rothhardt, Manfred; Schröder, Kerstin; Voigt, Sebastian; Mehner, Jan; Teubner, Andreas; Lüpke, Thomas; Thieroff, Christoph; Krüger, Matthias; Chojetzki, Christoph; Bartelt, Hartmut

2012-04-01

The combination of fiber Bragg grating arrays integrated in a soft plastic tube is promising for high resolution manometry (HRM) where pressure measurements are done with high spatial resolution. The application as a medical device and in vivo experiments have to be anticipated by characterization with a measurement setup that simulates natural conditions. Good results are achieved with a pressure chamber which applies a well-defined pressure with a soft tubular membrane. It is shown that the proposed catheter design reaches accuracies down to 1 mbar and 1 cm.

Multienzyme-nanoparticles amplification for sensitive virus genotyping in microfluidic microbeads array using Au nanoparticle probes and quantum dots as labels.

PubMed

Zhang, He; Liu, Lian; Li, Cheuk-Wing; Fu, Huayang; Chen, Yao; Yang, Mengsu

2011-11-15

A novel microfluidic device with microbeads array was developed and sensitive genotyping of human papillomavirus was demonstrated using a multiple-enzyme labeled oligonucleotide-Au nanoparticle bioconjugate as the detection tool. This method utilizes microbeads as sensing platform that was functionalized with the capture probes and modified electron rich proteins, and uses the horseradish peroxidase (HRP)-functionalized gold nanoparticles as label with a secondary DNA probe. The functionalized microbeads were independently introduced into the arrayed chambers using the loading chip slab. A single channel was used to generate weir structures to confine the microbeads and make the beads array accessible by microfluidics. Through "sandwich" hybridization, the enzyme-functionalized Au nanoparticles labels were brought close to the surface of microbeads. The oxidation of biotin-tyramine by hydrogen peroxide resulted in the deposition of multiple biotin moieties onto the surface of beads. This deposition is markedly increased in the presence of immobilized electron rich proteins. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Enhanced detection sensitivity was achieved where the large surface area of Au nanoparticle carriers increased the amount HRP bound per sandwiched hybridization. The on-chip genotyping method could discriminate as low as 1fmol/L (10zmol/chip, SNR>3) synthesized HPV oligonucleotides DNA. The chip-based signal enhancement of the amplified assay resulted in 1000 times higher sensitivity than that of off-chip test. In addition, this on-chip format could discriminate and genotype 10copies/μL HPV genomic DNA using the PCR products. These results demonstrated that this on-chip approach can achieve highly sensitive detection and genotyping of target DNA and can be further developed for detection of disease-related biomolecules at the lowest level at their earliest incidence. Copyright © 2011 Elsevier B.V. All rights reserved.

Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies

PubMed Central

2013-01-01

Background The most important challenge of performing insitu transcriptional profiling of the human ocular surface epithelial regions is obtaining samples in sufficient amounts, without contamination from adjacent tissue, as the region of interest is microscopic and closely apposed to other tissues regions. We have effectively collected ocular surface (OS) epithelial tissue samples from the Limbal Epithelial Crypt (LEC), limbus, cornea and conjunctiva of post-mortem cadaver eyes with laser microdissection (LMD) technique for gene expression studies with spotted oligonucleotide microarrays and Gene 1.0 ST arrays. Methods Human donor eyes (4 pairs for spotted oligonucleotide microarrays, 3 pairs for Gene 1.0 ST arrays) consented for research were included in this study with due ethical approval of the Nottingham Research Ethics Committee. Eye retrieval was performed within 36 hours of post-mortem period. The dissected corneoscleral buttons were immersed in OCT media and frozen in liquid nitrogen and stored at −80°C till further use. Microscopic tissue sections of interest were taken on PALM slides and stained with Toluidine Blue for laser microdissection with PALM microbeam systems. Optimisation of the laser microdissection technique was crucial for efficient and cost effective sample collection. Results The starting concentration of RNA as stipulated by the protocol of microarray platforms was taken as the cut-off concentration of RNA samples in our studies. The area of LMD tissue processed for spotted oligonucleotide microarray study ranged from 86,253 μm2 in LEC to 392,887 μm2 in LEC stroma. The RNA concentration of the LMD samples ranged from 22 to 92 pg/μl. The recommended starting concentration of the RNA samples used for Gene 1.0 ST arrays was 6 ng/5 μl. To achieve the desired RNA concentration the area of ocular surface epithelial tissue sample processed for the Gene 1.0 ST array experiments was approximately 100,0000 μm2 to 130,0000 μm2. RNA concentration of these samples ranged from 10.88 ng/12 μl to 25.8 ng/12 μl, with the RNA integrity numbers (RIN) for these samples from 3.3 to 7.9. RNA samples with RIN values below 2, that had failed to amplify satisfactorily were discarded. Conclusions The optimised protocol for sample collection and laser microdissection improved the RNA yield of the insitu ocular surface epithelial regions for effective microarray studies on spotted oligonucleotide and affymetrix platforms. PMID:24160452

Toroidal sensor arrays for real-time photoacoustic imaging

NASA Astrophysics Data System (ADS)

Bychkov, Anton S.; Cherepetskaya, Elena B.; Karabutov, Alexander A.; Makarov, Vladimir A.

2017-07-01

This article addresses theoretical and numerical investigation of image formation in photoacoustic (PA) imaging with complex-shaped concave sensor arrays. The spatial resolution and the size of sensitivity region of PA and laser ultrasonic (LU) imaging systems are assessed using sensitivity maps and spatial resolution maps in the image plane. This paper also discusses the relationship between the size of high-sensitivity regions and the spatial resolution of real-time imaging systems utilizing toroidal arrays. It is shown that the use of arrays with toroidal geometry significantly improves the diagnostic capabilities of PA and LU imaging to investigate biological objects, rocks, and composite materials.

High-resolution 3D laser imaging based on tunable fiber array link

NASA Astrophysics Data System (ADS)

Zhao, Sisi; Ruan, Ningjuan; Yang, Song

2017-10-01

Airborne photoelectric reconnaissance system with the bore sight down to the ground is an important battlefield situational awareness system, which can be used for reconnaissance and surveillance of complex ground scene. Airborne 3D imaging Lidar system is recognized as the most potential candidates for target detection under the complex background, and is progressing in the directions of high resolution, long distance detection, high sensitivity, low power consumption, high reliability, eye safe and multi-functional. However, the traditional 3D laser imaging system has the disadvantages of lower imaging resolutions because of the small size of the existing detector, and large volume. This paper proposes a high resolution laser 3D imaging technology based on the tunable optical fiber array link. The echo signal is modulated by a tunable optical fiber array link and then transmitted to the focal plane detector. The detector converts the optical signal into electrical signals which is given to the computer. Then, the computer accomplishes the signal calculation and image restoration based on modulation information, and then reconstructs the target image. This paper establishes the mathematical model of tunable optical fiber array signal receiving link, and proposes the simulation and analysis of the affect factors on high density multidimensional point cloud reconstruction.

Synthetic aperture ultrasound imaging with a ring transducer array: preliminary ex vivo results.

PubMed

Qu, Xiaolei; Azuma, Takashi; Yogi, Takeshi; Azuma, Shiho; Takeuchi, Hideki; Tamano, Satoshi; Takagi, Shu

2016-10-01

The conventional medical ultrasound imaging has a low lateral spatial resolution, and the image quality depends on the depth of the imaging location. To overcome these problems, this study presents a synthetic aperture (SA) ultrasound imaging method using a ring transducer array. An experimental ring transducer array imaging system was constructed. The array was composed of 2048 transducer elements, and had a diameter of 200 mm and an inter-element pitch of 0.325 mm. The imaging object was placed in the center of the ring transducer array, which was immersed in water. SA ultrasound imaging was then employed to scan the object and reconstruct the reflection image. Both wire phantom and ex vivo experiments were conducted. The proposed method was found to be capable of producing isotropic high-resolution images of the wire phantom. In addition, preliminary ex vivo experiments using porcine organs demonstrated the ability of the method to reconstruct high-quality images without any depth dependence. The proposed ring transducer array and SA ultrasound imaging method were shown to be capable of producing isotropic high-resolution images whose quality was independent of depth.

Flat-panel video resolution LED display system

NASA Astrophysics Data System (ADS)

Wareberg, P. G.; Kennedy, D. I.

The system consists of a 128 x 128 element X-Y addressable LED array fabricated from green-emitting gallium phosphide. The LED array is interfaced with a 128 x 128 matrix TV camera. Associated electronics provides for seven levels of grey scale above zero with a grey scale ratio of square root of 2. Picture elements are on 0.008 inch centers resulting in a resolution of 125 lines-per-inch and a display area of approximately 1 sq. in. The LED array concept lends itself to modular construction, permitting assembly of a flat panel screen of any desired size from 1 x 1 inch building blocks without loss of resolution. A wide range of prospective aerospace applications exist extending from helmet-mounted systems involving small dedicated arrays to multimode cockpit displays constructed as modular screens. High-resolution LED arrays are already used as CRT replacements in military film-marking reconnaissance applications.

“Ultra-high resolution optical trap with single fluorophore sensitivity”

PubMed Central

Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

2013-01-01

We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

Flexible Integration of Both High Imaging Resolution and High Power Arrays for Ultrasound-Induced Thermal Strain Imaging (US-TSI)

PubMed Central

Stephens, Douglas N.; Mahmoud, Ahmed M.; Ding, Xuan; Lucero, Steven; Dutta, Debaditya; Yu, Francois T.H.; Chen, Xucai

2013-01-01

Ultrasound-induced thermal strain imaging (US-TSI) for carotid artery plaque detection requires both high imaging resolution (<100 μm) and sufficient US induced heating to elevate the tissue temperature (~1-3°C within 1-3 cardiac cycles) in order to produce a noticeable change in sound speed in the targeted tissues. Since the optimization of both imaging and heating in a monolithic array design is particularly expensive and inflexible, a new integrated approach is presented that utilizes independent ultrasound arrays to meet the requirements for this particular application. This work demonstrates a new approach in dual-array construction. A 3D printed manifold was built to support both a high resolution 20 MHz commercial imaging array and 6 custom heating elements operating in the 3.5-4 MHz range. For the application of US-TSI on carotid plaque characterization, the tissue target site is 20 to 30 mm deep, with a typical target volume of 2 mm (elevation) × 8 mm (azimuthal) × 5 mm (depth). The custom heating array performance was fully characterized for two design variants (flat and spherical apertures), and can easily deliver 30 W of total acoustic power to produce intensities greater than 15 W/cm2 in tissue target region. PMID:24297029

Toshiba TDF-500 High Resolution Viewing And Analysis System

NASA Astrophysics Data System (ADS)

Roberts, Barry; Kakegawa, M.; Nishikawa, M.; Oikawa, D.

1988-06-01

A high resolution, operator interactive, medical viewing and analysis system has been developed by Toshiba and Bio-Imaging Research. This system provides many advanced features including high resolution displays, a very large image memory and advanced image processing capability. In particular, the system provides CRT frame buffers capable of update in one frame period, an array processor capable of image processing at operator interactive speeds, and a memory system capable of updating multiple frame buffers at frame rates whilst supporting multiple array processors. The display system provides 1024 x 1536 display resolution at 40Hz frame and 80Hz field rates. In particular, the ability to provide whole or partial update of the screen at the scanning rate is a key feature. This allows multiple viewports or windows in the display buffer with both fixed and cine capability. To support image processing features such as windowing, pan, zoom, minification, filtering, ROI analysis, multiplanar and 3D reconstruction, a high performance CPU is integrated into the system. This CPU is an array processor capable of up to 400 million instructions per second. To support the multiple viewer and array processors' instantaneous high memory bandwidth requirement, an ultra fast memory system is used. This memory system has a bandwidth capability of 400MB/sec and a total capacity of 256MB. This bandwidth is more than adequate to support several high resolution CRT's and also the fast processing unit. This fully integrated approach allows effective real time image processing. The integrated design of viewing system, memory system and array processor are key to the imaging system. It is the intention to describe the architecture of the image system in this paper.

High Resolution PET with 250 micrometer LSO Detectors and Adaptive Zoom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cherry, Simon R.; Qi, Jinyi

2012-01-08

There have been impressive improvements in the performance of small-animal positron emission tomography (PET) systems since their first development in the mid 1990s, both in terms of spatial resolution and sensitivity, which have directly contributed to the increasing adoption of this technology for a wide range of biomedical applications. Nonetheless, current systems still are largely dominated by the size of the scintillator elements used in the detector. Our research predicts that developing scintillator arrays with an element size of 250 {micro}m or smaller will lead to an image resolution of 500 {micro}m when using 18F- or 64Cu-labeled radiotracers, giving amore » factor of 4-8 improvement in volumetric resolution over the highest resolution research systems currently in existence. This proposal had two main objectives: (i) To develop and evaluate much higher resolution and efficiency scintillator arrays that can be used in the future as the basis for detectors in a small-animal PET scanner where the spatial resolution is dominated by decay and interaction physics rather than detector size. (ii) To optimize one such high resolution, high sensitivity detector and adaptively integrate it into the existing microPET II small animal PET scanner as a 'zoom-in' detector that provides higher spatial resolution and sensitivity in a limited region close to the detector face. The knowledge gained from this project will provide valuable information for building future PET systems with a complete ring of very high-resolution detector arrays and also lay the foundations for utilizing high-resolution detectors in combination with existing PET systems for localized high-resolution imaging.« less

Development and Operation of Arrays of TES x-ray Microcalorimeters Suitable for Constellation-X

NASA Technical Reports Server (NTRS)

Kilbourne, C. A.; Bandler, S. R.; Brown, A. D.; Chervenak, J. A.; Eckart, M. E.; Finkbeiner, F. M.; Iyomoto, N.; Kelley, R. L.; Porter, F. S.; Smith, S. J.;

Germanium detectors in homeland security at PNNL

DOE PAGES

Stave, S.

2015-05-01

Neutron and gamma-ray detection is used for non-proliferation and national security applications. While lower energy resolution detectors such as NaI(Tl) have their place, high purity germanium (HPGe) also has a role to play. A detection with HPGe is often a characterization due to the very high energy resolution. However, HPGe crystals remain small and expensive leaving arrays of smaller crystals as an excellent solution. PNNL has developed two similar HPGe arrays for two very different applications. One array, the Multisensor Aerial Radiation Survey (MARS) detector is a fieldable array that has been tested on trucks, boats, and helicopters. The CASCADESmore » HPGe array is an array designed to assay samples in a low background environment. The history of HPGe arrays at PNNL and the development of MARS and CASCADES will be detailed in this paper along with some of the other applications of HPGe at PNNL.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stave, Sean C.

Neutron and gamma-ray detection is used for non-proliferation and national security applications. While lower energy resolution detectors such as NaI(Tl) have their place, high purity germanium (HPGe) also has a role to play. A detection with HPGe is often a characterization due to the very high energy resolution. However, HPGe crystals remain small and expensive leaving arrays of smaller crystals as an excellent solution. PNNL has developed two similar HPGe arrays for two very different applications. One array, the Multisensor Aerial Radiation Survey (MARS) detector is a fieldable array that has been tested on trucks, boats, and helicopters. The CASCADESmore » HPGe array is an array designed to assay samples in a low background environment. The history of HPGe arrays at PNNL and the development of MARS and CASCADES will be detailed in this paper along with some of the other applications of HPGe at PNNL.« less

Large gamma-ray detector arrays and electromagnetic separators

NASA Astrophysics Data System (ADS)

Lee, I.-Yang

2013-12-01

The use of large gamma-ray detector arrays with electromagnetic separators is a powerful combination. Various types of gamma-ray detectors have been used; some provide high detector efficiency such as scintillation detector array, others use Ge detectors for good energy resolution, and recently developed Ge energy tracking arrays gives both high peak-to-background ratio and position resolution. Similarly, different types of separators were used to optimize the performance under different experimental requirements and conditions. For example, gas-filled separators were used in heavy element studies for their large efficiency and beam rejection factor. Vacuum separators with good isotope resolution were used in transfer and fragmentation reactions for the study of nuclei far from stability. This paper presents results from recent experiments using gamma-ray detector arrays in combination with electromagnetic separators, and discusses the physics opportunities provided by these instruments. In particular, we review the performance of the instruments currently in use, and discuss the requirements of instruments for future radioactive beam accelerator facilities.

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

Optimized 14 + 1 receive coil array and position system for 3D high-resolution MRI of dental and maxillomandibular structures.

PubMed

Sedlacik, Jan; Kutzner, Daniel; Khokale, Arun; Schulze, Dirk; Fiehler, Jens; Celik, Turgay; Gareis, Daniel; Smeets, Ralf; Friedrich, Reinhard E; Heiland, Max; Assaf, Alexandre T

2016-01-01

The purpose of this study was to design, build and test a multielement receive coil array and position system, which is optimized for three-dimensional (3D) high-resolution dental and maxillomandibular MRI with high patient comfort. A 14 + 1 coil array and positioning system, allowing easy handling by the technologists, reproducible positioning of the patients and high patient comfort, was tested with three healthy volunteers using a 3.0-T MRI machine (Siemens Skyra; Siemens Medical Solutions, Erlangen, Germany). High-resolution 3D T1 weighted, water excitation T1 weighted and fat-saturated T2 weighted imaging sequences were scanned, and 3D image data were reformatted in different orientations and curvatures to aid diagnosis. The high number of receiving coils and the comfortable positioning of the coil array close to the patient's face provided a high signal-to-noise ratio and allowed high quality, high resolution, 3D image data to be acquired within reasonable scan times owing to the possibility of parallel image acquisition acceleration. Reformatting the isotropic 3D image data in different views is helpful for diagnosis, e.g. panoramic reconstruction. The visibility of soft tissues such as the mandibular canal, nutritive canals and periodontal ligaments was exquisite. The optimized MRI receive coil array and positioning system for dental and oral-maxillofacial imaging provides a valuable tool for detecting and diagnosing pathologies in dental and oral-maxillofacial structures while avoiding radiation dose. The high patient comfort, as achieved by our design, is very crucial, since image artefacts due to movement or failing to complete the examination jeopardize the diagnostic value of MRI examinations.

Design, Construction, and Initial Test of High Spatial Resolution Thermometry Arrays for Detection of Surface Temperature Profiles on SRF Cavities in Super Fluid Helium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ari Palczewski, Rongli Geng, Grigory Eremeev

2011-07-01

We designed and built two high resolution (0.6-0.55mm special resolution [1.1-1.2mm separation]) thermometry arrays prototypes out of the Allen Bradley 90-120 ohm 1/8 watt resistor to measure surface temperature profiles on SRF cavities. One array was designed to be physically flexible and conform to any location on a SRF cavity; the other was modeled after the common G-10/stycast 2850 thermometer and designed to fit on the equator of an ILC (Tesla 1.3GHz) SRF cavity. We will discuss the advantages and disadvantages of each array and their construction. In addition we will present a case study of the arrays performance onmore » a real SRF cavity TB9NR001. TB9NR001 presented a unique opportunity to test the performance of each array as it contained a dual (4mm separation) cat eye defect which conventional methods such as OST (Oscillating Superleak second-sound Transducers) and full coverage thermometry mapping were unable to distinguish between. We will discuss the new arrays ability to distinguish between the two defects and their preheating performance.« less

High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals

DOEpatents

Smither, Robert K [Hinsdale, IL

2008-12-23

A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

Sequence requirements of oligonucleotide chiral selectors for the capillary electrophoresis resolution of low-affinity DNA binders.

PubMed

Tohala, Luma; Oukacine, Farid; Ravelet, Corinne; Peyrin, Eric

2017-05-01

We recently reported that a great variety of DNA oligonucleotides (ONs) used as chiral selectors in partial-filling capillary electrophoresis (CE) exhibited interesting enantioresolution properties toward low-affinity DNA binders. Herein, the sequence prerequisites of ONs for the CE enantioseparation process were studied. First, the chiral resolution properties of a series of homopolymeric sequences (Poly-dT) of different lengths (from 5 to 60-mer) were investigated. It was shown that the size increase-dependent random coil-like conformation of Poly-dT favorably acted on the apparent selectivity and resolution. The base-unpairing state constituted also an important factor in the chiral resolution ability of ONs as the switch from the single-stranded to double-stranded structure was responsible for a significant decrease in the analyte selectivity range. Finally, the chemical diversity enhanced the enantioresolution ability of single-stranded ONs. The present work could lay the foundation for the design of performant ON chiral selectors for the CE separation of weak DNA binder enantiomers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

Next generation miniature simultaneous multi-hyperspectral imaging systems

NASA Astrophysics Data System (ADS)

Hinnrichs, Michele; Gupta, Neelam

2014-03-01

The concept for a hyperspectral imaging system using a Fabry-Perot tunable filter (FPTF) array that is fabricated using "miniature optical electrical mechanical system" (MOEMS) technology. [1] Using an array of FPTF as an approach to hyperspectral imaging relaxes wavelength tuning requirements considerably because of the reduced portion of the spectrum that is covered by each element in the array. In this paper, Pacific Advanced Technology and ARL present the results of a concept design and performed analysis of a MOEMS based tunable Fabry-Perot array (FPTF) to perform simultaneous multispectral and hyperspectral imaging with relatively high spatial resolution. The concept design was developed with support of an Army SBIR Phase I program The Fabry-Perot tunable MOEMS filter array was combined with a miniature optics array and a focal plane array of 1024 x 1024 pixels to produce 16 colors every frame of the camera. Each color image has a spatial resolution of 256 x 256 pixels with an IFOV of 1.7 mrads and FOV of 25 degrees. The spectral images are collected simultaneously allowing high resolution spectral-spatial-temporal information in each frame of the camera, thus enabling the implementation of spectral-temporal-spatial algorithms in real-time to provide high sensitivity for the detection of weak signals in a high clutter background environment with low sensitivity to camera motion. The challenge in the design was the independent actuation of each Fabry Perot element in the array allowing for individual tuning. An additional challenge was the need to maximize the fill factor to improve the spatial coverage with minimal dead space. This paper will only address the concept design and analysis of the Fabry-Perot tunable filter array. A previous paper presented at SPIE DSS in 2012 explained the design of the optical array.

Signal detectability in diffusive media using phased arrays in conjunction with detector arrays.

PubMed

Kang, Dongyel; Kupinski, Matthew A

2011-06-20

We investigate Hotelling observer performance (i.e., signal detectability) of a phased array system for tasks of detecting small inhomogeneities and distinguishing adjacent abnormalities in uniform diffusive media. Unlike conventional phased array systems where a single detector is located on the interface between two sources, we consider a detector array, such as a CCD, on a phantom exit surface for calculating the Hotelling observer detectability. The signal detectability for adjacent small abnormalities (2 mm displacement) for the CCD-based phased array is related to the resolution of reconstructed images. Simulations show that acquiring high-dimensional data from a detector array in a phased array system dramatically improves the detectability for both tasks when compared to conventional single detector measurements, especially at low modulation frequencies. It is also observed in all studied cases that there exists the modulation frequency optimizing CCD-based phased array systems, where detectability for both tasks is consistently high. These results imply that the CCD-based phased array has the potential to achieve high resolution and signal detectability in tomographic diffusive imaging while operating at a very low modulation frequency. The effect of other configuration parameters, such as a detector pixel size, on the observer performance is also discussed.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

Optical Demonstration of a Medical Imaging System with an EMCCD-Sensor Array for Use in a High Resolution Dynamic X-ray Imager

PubMed Central

Qu, Bin; Huang, Ying; Wang, Weiyuan; Sharma, Prateek; Kuhls-Gilcrist, Andrew T.; Cartwright, Alexander N.; Titus, Albert H.; Bednarek, Daniel R.; Rudin, Stephen

2011-01-01

Use of an extensible array of Electron Multiplying CCDs (EMCCDs) in medical x-ray imager applications was demonstrated for the first time. The large variable electronic-gain (up to 2000) and small pixel size of EMCCDs provide effective suppression of readout noise compared to signal, as well as high resolution, enabling the development of an x-ray detector with far superior performance compared to conventional x-ray image intensifiers and flat panel detectors. We are developing arrays of EMCCDs to overcome their limited field of view (FOV). In this work we report on an array of two EMCCD sensors running simultaneously at a high frame rate and optically focused on a mammogram film showing calcified ducts. The work was conducted on an optical table with a pulsed LED bar used to provide a uniform diffuse light onto the film to simulate x-ray projection images. The system can be selected to run at up to 17.5 frames per second or even higher frame rate with binning. Integration time for the sensors can be adjusted from 1 ms to 1000 ms. Twelve-bit correlated double sampling AD converters were used to digitize the images, which were acquired by a National Instruments dual-channel Camera Link PC board in real time. A user-friendly interface was programmed using LabVIEW to save and display 2K × 1K pixel matrix digital images. The demonstration tiles a 2 × 1 array to acquire increased-FOV stationary images taken at different gains and fluoroscopic-like videos recorded by scanning the mammogram simultaneously with both sensors. The results show high resolution and high dynamic range images stitched together with minimal adjustments needed. The EMCCD array design allows for expansion to an M×N array for arbitrarily larger FOV, yet with high resolution and large dynamic range maintained. PMID:23505330

Chromatic Modulator for High Resolution CCD or APS Devices

NASA Technical Reports Server (NTRS)

Hartley, Frank T. (Inventor); Hull, Anthony B. (Inventor)

2003-01-01

A system for providing high-resolution color separation in electronic imaging. Comb drives controllably oscillate a red-green-blue (RGB) color strip filter system (or otherwise) over an electronic imaging system such as a charge-coupled device (CCD) or active pixel sensor (APS). The color filter is modulated over the imaging array at a rate three or more times the frame rate of the imaging array. In so doing, the underlying active imaging elements are then able to detect separate color-separated images, which are then combined to provide a color-accurate frame which is then recorded as the representation of the recorded image. High pixel resolution is maintained. Registration is obtained between the color strip filter and the underlying imaging array through the use of electrostatic comb drives in conjunction with a spring suspension system.

The Highly Robust Electrical Interconnects and Ultrasensitive Biosensors Based on Embedded Carbon Nanotube Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Cassell, Alan; Koehne, Jessica; Chen, Hua; Ng, Hou Tee; Ye, Qi; Stevens, Ramsey; Han, Jie; Meyyappan, M.

2003-01-01

We report on our recent breakthroughs in two different applications using well-aligned carbon nanotube (CNT) arrays on Si chips, including (1) a novel processing solution for highly robust electrical interconnects in integrated circuit manufacturing, and (2) the development of ultrasensitive electrochemical DNA sensors. Both of them rely on the invention of a bottom-up fabrication scheme which includes six steps, including: (a) lithographic patterning, (b) depositing bottom conducting contacts, (c) depositing metal catalysts, (d) CNT growth by plasma enhanced chemical vapor deposition (PECVD), (e) dielectric gap-filling, and (f) chemical mechanical polishing (CMP). Such processes produce a stable planarized surface with only the open end of CNTs exposed, whch can be further processed or modified for different applications. By depositing patterned top contacts, the CNT can serve as vertical interconnects between the two conducting layers. This method is fundamentally different fiom current damascene processes and avoids problems associated with etching and filling of high aspect ratio holes at nanoscales. In addition, multiwalled CNTs (MWCNTs) are highly robust and can carry a current density of 10(exp 9) A/square centimeters without degradation. It has great potential to help extending the current Si technology. The embedded MWCNT array without the top contact layer can be also used as a nanoelectrode array in electrochemical biosensors. The cell time-constant and sensitivity can be dramatically improved. By functionalizing the tube ends with specific oligonucleotide probes, specific DNA targets can be detected with electrochemical methods down to subattomoles.

Basic performance evaluation of a Si-PM array-based LGSO phoswich DOI block detector for a high-resolution small animal PET system.

PubMed

Yamamoto, Seiichi

2013-07-01

The silicon photomultiplier (Si-PM) is a promising photodetector for PET. However, it remains unclear whether Si-PM can be used for a depth-of-interaction (DOI) detector based on the decay time differences of the scintillator where pulse shape analysis is used. For clarification, we tested the Hamamatsu 4 × 4 Si-PM array (S11065-025P) combined with scintillators that used different decay times to develop DOI block detectors using the pulse shape analysis. First, Ce-doped Gd(2)SiO(5) (GSO) scintillators of 0.5 mol% Ce were arranged in a 4 × 4 matrix and were optically coupled to the center of each pixel of the Si-PM array for measurement of the energy resolution as well as its gain variations according to the temperature. Then two types of Ce-doped Lu(1.9)Gd(0.1)Si0(5) (LGSO) scintillators, 0.025 mol% Ce (decay time: ~31 ns) and 0.75 mol% Ce (decay time: ~46 ns), were optically coupled in the DOI direction, arranged in a 11 × 7 matrix, and optically coupled to a Si-PM array for testing of the possibility of a high-resolution DOI detector. The energy resolution of the Si-PM array-based GSO block detector was 18 ± 4.4 % FWHM for a Cs-137 gamma source (662 keV). Less than 1 mm crystals were clearly resolved in the position map of the LGSO DOI block detector. The peak-to-valley ratio (P/V) derived from the pulse shape spectra of the LGSO DOI block detector was 2.2. These results confirmed that Si-PM array-based DOI block detectors are promising for high-resolution small animal PET systems.

Thin-film sparse boundary array design for passive acoustic mapping during ultrasound therapy.

PubMed

Coviello, Christian M; Kozick, Richard J; Hurrell, Andrew; Smith, Penny Probert; Coussios, Constantin-C

2012-10-01

A new 2-D hydrophone array for ultrasound therapy monitoring is presented, along with a novel algorithm for passive acoustic mapping using a sparse weighted aperture. The array is constructed using existing polyvinylidene fluoride (PVDF) ultrasound sensor technology, and is utilized for its broadband characteristics and its high receive sensitivity. For most 2-D arrays, high-resolution imagery is desired, which requires a large aperture at the cost of a large number of elements. The proposed array's geometry is sparse, with elements only on the boundary of the rectangular aperture. The missing information from the interior is filled in using linear imaging techniques. After receiving acoustic emissions during ultrasound therapy, this algorithm applies an apodization to the sparse aperture to limit side lobes and then reconstructs acoustic activity with high spatiotemporal resolution. Experiments show verification of the theoretical point spread function, and cavitation maps in agar phantoms correspond closely to predicted areas, showing the validity of the array and methodology.

Visualizing Microbial Biogeochemistry: NanoSIMS and Stable Isotope Probing (Invited)

NASA Astrophysics Data System (ADS)

Pett-Ridge, J.; Weber, P. K.

2009-12-01

Linking phylogenetic information to function in microbial communities is a key challenge for microbial ecology. Isotope-labeling experiments provide a useful means to investigate the ecophysiology of microbial populations and cells in the environment and allow measurement of nutrient transfers between cell types, symbionts and consortia. The combination of Nano-Secondary Ion Mass Spectrometry (NanoSIMS) analysis, in situ labeling and high resolution microscopy allows isotopic analysis to be linked to phylogeny and morphology and holds great promise for fine-scale studies of microbial systems. In NanoSIMS analysis, samples are sputtered with an energetic primary beam (Cs+, O-) liberating secondary ions that are separated by the mass spectrometer and detected in a suite of electron multipliers. Five isotopic species may be analyzed concurrently with spatial resolution as fine as 50nm. A high sensitivity isotope ratio ‘map’ can then be generated for the analyzed area. NanoSIMS images of 13C, 15N and Mo (a nitrogenase co-factor) localization in diazotrophic cyanobacteria show how cells differentially allocate resources within filaments and allow calculation of nutrient uptake rates on a cell by cell basis. Images of AM fungal hyphae-root and cyanobacteria-rhizobia associations indicate the mobilization and sharing (stealing?) of newly fixed C and N. In a related technique, “El-FISH”, stable isotope labeled biomass is probed with oligonucleotide-elemental labels and then imaged by NanoSIMS. In microbial consortia and cyanobacterial mats, this technique helps link microbial structure and function simultaneously even in systems with unknown and uncultivated microbes. Finally, the combination of re-engineered universal 16S oligonucleotide microarrays with NanoSIMS analyses may allow microbial identity to be linked to functional roles in complex systems such as mats and cellulose degrading hindgut communities. These newly developed methods provide correlated oligonucleotide, functional enzyme and metabolic image data and should help unravel the metabolic processes of complex microbial communities in soils, biofilms and aquatic systems.

DNA detection on ultrahigh-density optical fiber-based nanoarrays.

PubMed

Tam, Jenny M; Song, Linan; Walt, David R

2009-04-15

Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

Annular solid-immersion lenslet array super-resolution optical microscopy

NASA Astrophysics Data System (ADS)

Liau, Z. L.

2012-10-01

We describe a novel solid-immersion lenslet array, micro-fabricated in a chip form in the high-index (3.45) gallium phosphide. The innovatively designed lenslet features an annular aperture with appropriately patterned light absorbers and antireflection coatings. The array chip is easy to handle and enables the direct deposition of the specimen of interest onto its back-plane for tight adhesion and good optical coupling. The ensuing diffraction from the near field can yield supercritical rays inside the high-index lenslet and can, therefore, overcome the refraction and critical-angle limitations. This model showed agreement with the experimental observation of the solid-immersion fluorescence microscopy imaging, in which the refracted rays were completely blocked by the annular aperture. A large longitudinal (depth) magnification effect was also predicted and showed agreement with experiment. The annular lenslet's additional advantages of improved resolution and contrast were also discussed. Resolution of nested-L patterns with grating pitch as small as 100 nm was experimentally demonstrated. The demonstrated annular solid-immersion lenslet array concept is promising for a wider use in super-resolution optical microscopy.

Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

PubMed Central

Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

2008-01-01

Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

Isotropic-resolution linear-array-based photoacoustic computed tomography through inverse Radon transform

NASA Astrophysics Data System (ADS)

Li, Guo; Xia, Jun; Li, Lei; Wang, Lidai; Wang, Lihong V.

2015-03-01

Linear transducer arrays are readily available for ultrasonic detection in photoacoustic computed tomography. They offer low cost, hand-held convenience, and conventional ultrasonic imaging. However, the elevational resolution of linear transducer arrays, which is usually determined by the weak focus of the cylindrical acoustic lens, is about one order of magnitude worse than the in-plane axial and lateral spatial resolutions. Therefore, conventional linear scanning along the elevational direction cannot provide high-quality three-dimensional photoacoustic images due to the anisotropic spatial resolutions. Here we propose an innovative method to achieve isotropic resolutions for three-dimensional photoacoustic images through combined linear and rotational scanning. In each scan step, we first elevationally scan the linear transducer array, and then rotate the linear transducer array along its center in small steps, and scan again until 180 degrees have been covered. To reconstruct isotropic three-dimensional images from the multiple-directional scanning dataset, we use the standard inverse Radon transform originating from X-ray CT. We acquired a three-dimensional microsphere phantom image through the inverse Radon transform method and compared it with a single-elevational-scan three-dimensional image. The comparison shows that our method improves the elevational resolution by up to one order of magnitude, approaching the in-plane lateral-direction resolution. In vivo rat images were also acquired.

Spatiotemporal norepinephrine mapping using a high-density CMOS microelectrode array.

PubMed

Wydallis, John B; Feeny, Rachel M; Wilson, William; Kern, Tucker; Chen, Tom; Tobet, Stuart; Reynolds, Melissa M; Henry, Charles S

2015-10-21

A high-density amperometric electrode array containing 8192 individually addressable platinum working electrodes with an integrated potentiostat fabricated using Complementary Metal Oxide Semiconductor (CMOS) processes is reported. The array was designed to enable electrochemical imaging of chemical gradients with high spatiotemporal resolution. Electrodes are arranged over a 2 mm × 2 mm surface area into 64 subarrays consisting of 128 individual Pt working electrodes as well as Pt pseudo-reference and auxiliary electrodes. Amperometric measurements of norepinephrine in tissue culture media were used to demonstrate the ability of the array to measure concentration gradients in complex media. Poly(dimethylsiloxane) microfluidics were incorporated to control the chemical concentrations in time and space, and the electrochemical response at each electrode was monitored to generate electrochemical heat maps, demonstrating the array's imaging capabilities. A temporal resolution of 10 ms can be achieved by simultaneously monitoring a single subarray of 128 electrodes. The entire 2 mm × 2 mm area can be electrochemically imaged in 64 seconds by cycling through all subarrays at a rate of 1 Hz per subarray. Monitoring diffusional transport of norepinephrine is used to demonstrate the spatiotemporal resolution capabilities of the system.

The ALMA Phasing System: A Beamforming Capability for Ultra-high-resolution Science at (Sub)Millimeter Wavelengths

NASA Astrophysics Data System (ADS)

Matthews, L. D.; Crew, G. B.; Doeleman, S. S.; Lacasse, R.; Saez, A. F.; Alef, W.; Akiyama, K.; Amestica, R.; Anderson, J. M.; Barkats, D. A.; Baudry, A.; Broguière, D.; Escoffier, R.; Fish, V. L.; Greenberg, J.; Hecht, M. H.; Hiriart, R.; Hirota, A.; Honma, M.; Ho, P. T. P.; Impellizzeri, C. M. V.; Inoue, M.; Kohno, Y.; Lopez, B.; Martí-Vidal, I.; Messias, H.; Meyer-Zhao, Z.; Mora-Klein, M.; Nagar, N. M.; Nishioka, H.; Oyama, T.; Pankratius, V.; Perez, J.; Phillips, N.; Pradel, N.; Rottmann, H.; Roy, A. L.; Ruszczyk, C. A.; Shillue, B.; Suzuki, S.; Treacy, R.

2018-01-01

The Atacama Millimeter/submillimeter Array (ALMA) Phasing Project (APP) has developed and deployed the hardware and software necessary to coherently sum the signals of individual ALMA antennas and record the aggregate sum in Very Long Baseline Interferometry (VLBI) Data Exchange Format. These beamforming capabilities allow the ALMA array to collectively function as the equivalent of a single large aperture and participate in global VLBI arrays. The inclusion of phased ALMA in current VLBI networks operating at (sub)millimeter wavelengths provides an order of magnitude improvement in sensitivity, as well as enhancements in u–v coverage and north–south angular resolution. The availability of a phased ALMA enables a wide range of new ultra-high angular resolution science applications, including the resolution of supermassive black holes on event horizon scales and studies of the launch and collimation of astrophysical jets. It also provides a high-sensitivity aperture that may be used for investigations such as pulsar searches at high frequencies. This paper provides an overview of the ALMA Phasing System design, implementation, and performance characteristics.

Ultra-high-throughput microarray generation and liquid dispensing using multiple disposable piezoelectric ejectors.

PubMed

Hsieh, Huangpin Ben; Fitch, John; White, Dave; Torres, Frank; Roy, Joy; Matusiak, Robert; Krivacic, Bob; Kowalski, Bob; Bruce, Richard; Elrod, Scott

2004-03-01

The authors have constructed an array of 12 piezoelectric ejectors for printing biological materials. A single-ejector footprint is 8 mm in diameter, standing 4 mm high with 2 reservoirs totaling 76 micro L. These ejectors have been tested by dispensing various fluids in several environmental conditions. Reliable drop ejection can be expected in both humidity-controlled and ambient environments over extended periods of time and in hot and cold room temperatures. In a prototype system, 12 ejectors are arranged in a rack, together with an X - Y stage, to allow printing any pattern desired. Printed arrays of features are created with a biological solution containing bovine serum albumin conjugated oligonucleotides, dye, and salty buffer. This ejector system is designed for the ultra-high-throughput generation of arrays on a variety of surfaces. These single or racked ejectors could be used as long-term storage vessels for materials such as small molecules, nucleic acids, proteins, or cell libraries, which would allow for efficient preprogrammed selection of individual clones and greatly reduce the chance of cross-contamination and loss due to transfer. A new generation of design ideas includes plastic injection molded ejectors that are inexpensive and disposable and handheld personal pipettes for liquid transfer in the nanoliter regime.

Performance characterization of high quantum efficiency metal package photomultiplier tubes for time-of-flight and high-resolution PET applications.

PubMed

Ko, Guen Bae; Lee, Jae Sung

2015-01-01

Metal package photomultiplier tubes (PMTs) with a metal channel dynode structure have several advanced features for devising such time-of-flight (TOF) and high spatial resolution positron emission tomography (PET) detectors, thanks to their high packing density, large effective area ratio, fast time response, and position encoding capability. Here, we report on an investigation of new metal package PMTs with high quantum efficiency (QE) for high-resolution PET and TOF PET detector modules. The latest metal package PMT, the Hamamatsu R11265 series, is served with two kinds of photocathodes that have higher quantum efficiency than normal bialkali (typical QE ≈ 25%), super bialkali (SBA; QE ≈ 35%), and ultra bialkali (UBA; QE ≈ 43%). In this study, the authors evaluated the performance of the new PMTs with SBA and UBA photocathodes as a PET detector by coupling various crystal arrays. They also investigated the performance improvements of high QE, focusing in particular on a block detector coupled with a lutetium-based scintillator. A single 4 × 4 × 10 mm(3) LYSO, a 7 × 7 array of 3 × 3 × 20 mm(3) LGSO, a 9 × 9 array of 1.2 × 1.2 × 10 mm(3) LYSO, and a 6 × 6 array of 1.5 × 1.5 × 7 mm(3) LuYAP were used for evaluation. All coincidence data were acquired with a DRS4 based fast digitizer. This new PMT shows promising crystal positioning accuracy, energy and time discrimination performance for TOF, and high-resolution PET applications. The authors also found that a metal channel PMT with SBA was enough for both TOF and high-resolution application, although UBA gave a minor improvement to time resolution. However, significant performance improvement was observed in relative low light output crystals (LuYAP) coupled with UBA. The results of this study will be of value as a useful reference to select PMTs for high-performance PET detectors.

Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

NASA Astrophysics Data System (ADS)

Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

2018-04-01

DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

PubMed Central

Karampetsou, Evangelia; Morrogh, Deborah; Chitty, Lyn

2014-01-01

The advantage of microarray (array) over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP) and designs (targeted, whole genome, whole genome, and targeted, custom) and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations. PMID:26237396

Fabrication of Ultrasensitive TES Bolometric Detectors for HIRMES

NASA Astrophysics Data System (ADS)

Brown, Ari-David; Brekosky, Regis; Franz, David; Hsieh, Wen-Ting; Kutyrev, Alexander; Mikula, Vilem; Miller, Timothy; Moseley, S. Harvey; Oxborrow, Joseph; Rostem, Karwan; Wollack, Edward

2018-04-01

The high-resolution mid-infrared spectrometer (HIRMES) is a high resolving power (R 100,000) instrument operating in the 25-122 μm spectral range and will fly on board the Stratospheric Observatory for Far-Infrared Astronomy in 2019. Central to HIRMES are its two transition edge sensor (TES) bolometric cameras, an 8 × 16 detector high-resolution array and a 64 × 16 detector low-resolution array. Both types of detectors consist of Mo/Au TES fabricated on leg-isolated Si membranes. Whereas the high-resolution detectors, with a noise equivalent power (NEP) 1.5 × 10-18 W/rt (Hz), are fabricated on 0.45 μm Si substrates, the low-resolution detectors, with NEP 1.0 × 10-17 W/rt (Hz), are fabricated on 1.40 μm Si. Here, we discuss the similarities and differences in the fabrication methodologies used to realize the two types of detectors.

Fabrication of Ultrasensitive Transition Edge Sensor Bolometric Detectors for HIRMES

NASA Technical Reports Server (NTRS)

Brown, Ari-David; Brekosky, Regis; Franz, David; Hsieh, Wen-Ting; Kutyrev, Alexander; Mikula, Vilem; Miller, Timothy; Moseley, S. Harvey; Oxborrow, Joseph; Rostem, Karwan;

Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant

PubMed Central

Hannes, F D; Sharp, A J; Mefford, H C; de Ravel, T; Ruivenkamp, C A; Breuning, M H; Fryns, J-P; Devriendt, K; Van Buggenhout, G; Vogels, A; Stewart, H; Hennekam, R C; Cooper, G M; Regan, R; Knight, S J L; Eichler, E E; Vermeesch, J R

2009-01-01

Background: Genomic disorders are often caused by non-allelic homologous recombination between segmental duplications. Chromosome 16 is especially rich in a chromosome-specific low copy repeat, termed LCR16. Methods and Results: A bacterial artificial chromosome (BAC) array comparative genome hybridisation (CGH) screen of 1027 patients with mental retardation and/or multiple congenital anomalies (MR/MCA) was performed. The BAC array CGH screen identified five patients with deletions and five with apparently reciprocal duplications of 16p13 covering 1.65 Mb, including 15 RefSeq genes. In addition, three atypical rearrangements overlapping or flanking this region were found. Fine mapping by high-resolution oligonucleotide arrays suggests that these deletions and duplications result from non-allelic homologous recombination (NAHR) between distinct LCR16 subunits with >99% sequence identity. Deletions and duplications were either de novo or inherited from unaffected parents. To determine whether these imbalances are associated with the MR/MCA phenotype or whether they might be benign variants, a population of 2014 normal controls was screened. The absence of deletions in the control population showed that 16p13.11 deletions are significantly associated with MR/MCA (p = 0.0048). Despite phenotypic variability, common features were identified: three patients with deletions presented with MR, microcephaly and epilepsy (two of these had also short stature), and two other deletion carriers ascertained prenatally presented with cleft lip and midline defects. In contrast to its previous association with autism, the duplication seems to be a common variant in the population (5/1682, 0.29%). Conclusion: These findings indicate that deletions inherited from clinically normal parents are likely to be causal for the patients’ phenotype whereas the role of duplications (de novo or inherited) in the phenotype remains uncertain. This difference in knowledge regarding the clinical relevance of the deletion and the duplication causes a paradigm shift in (cyto)genetic counselling. PMID:18550696

THz holography in reflection using a high resolution microbolometer array.

PubMed

Zolliker, Peter; Hack, Erwin

2015-05-04

We demonstrate a digital holographic setup for Terahertz imaging of surfaces in reflection. The set-up is based on a high-power continuous wave (CW) THz laser and a high-resolution (640 × 480 pixel) bolometer detector array. Wave propagation to non-parallel planes is used to reconstruct the object surface that is rotated relative to the detector plane. In addition we implement synthetic aperture methods for resolution enhancement and compare Fourier transform phase retrieval to phase stepping methods. A lateral resolution of 200 μm and a relative phase sensitivity of about 0.4 rad corresponding to a depth resolution of 6 μm are estimated from reconstructed images of two specially prepared test targets, respectively. We highlight the use of digital THz holography for surface profilometry as well as its potential for video-rate imaging.

In-situ device integration of large-area patterned organic nanowire arrays for high-performance optical sensors

PubMed Central

Wu, Yiming; Zhang, Xiujuan; Pan, Huanhuan; Deng, Wei; Zhang, Xiaohong; Zhang, Xiwei; Jie, Jiansheng

2013-01-01

Single-crystalline organic nanowires (NWs) are important building blocks for future low-cost and efficient nano-optoelectronic devices due to their extraordinary properties. However, it remains a critical challenge to achieve large-scale organic NW array assembly and device integration. Herein, we demonstrate a feasible one-step method for large-area patterned growth of cross-aligned single-crystalline organic NW arrays and their in-situ device integration for optical image sensors. The integrated image sensor circuitry contained a 10 × 10 pixel array in an area of 1.3 × 1.3 mm2, showing high spatial resolution, excellent stability and reproducibility. More importantly, 100% of the pixels successfully operated at a high response speed and relatively small pixel-to-pixel variation. The high yield and high spatial resolution of the operational pixels, along with the high integration level of the device, clearly demonstrate the great potential of the one-step organic NW array growth and device construction approach for large-scale optoelectronic device integration. PMID:24287887

Flexible, phase-matched, linear receive arrays for high-field MRI in monkeys.

PubMed

Goense, Jozien; Logothetis, Nikos K; Merkle, Hellmut

2010-10-01

High signal-to-noise ratios (SNR) are essential for high-resolution anatomical and functional MRI. Phased arrays are advantageous for this but have the drawback that they often have inflexible and bulky configurations. Particularly in experiments where functional MRI is combined with simultaneous electrophysiology, space constraints can be prohibitive. To this end we developed a highly flexible multiple receive element phased array for use on anesthetized monkeys. The elements are interchangeable and different sizes and combinations of coil elements can be used, for instance, combinations of single and overlapped elements. The preamplifiers including control electronics are detachable and can serve a variety of prefabricated and phase matched arrays of different configurations, allowing the elements to always be placed in close proximity to the area of interest. Optimizing performance of the individual elements ensured high SNR at the cortical surface as well as in deeper laying structures. Performance of a variety of arrangements of gapped linear arrays was evaluated at 4.7 and 7T in high-resolution anatomical and functional MRI. Copyright © 2010 Elsevier Inc. All rights reserved.

Optogenetic Stimulation of Peripheral Vagus Nerves using Flexible OLED Display Technology to Treat Chronic Inflammatory Disease and Mental Health Disorders

DTIC Science & Technology

2016-03-31

transcutaneously via the outer ear using a high-resolution, addressable array of organic light emitting diodes (OLEDs) manufactured on a flexible...therapeutic optical stimulation in optogenetically modified neural tissue. Keywords: Optogenetics; neuromodulation; organic light emitting diode ...the outer ear using a high-resolution, two-dimensional (2-D), addressable array of red organic light - emitting diodes (OLEDs) manufactured on a thin

Wide-bandwidth high-resolution search for extraterrestrial intelligence

NASA Technical Reports Server (NTRS)

Horowitz, Paul

1993-01-01

Research accomplished during the third 6-month period is summarized. Research covered the following: dual-horn antenna performance; high electron mobility transistors (HEMT) low-noise amplifiers; downconverters; fast Fourier transform (FFT) array; and backend 'feature recognizer' array.

High-Resolution Spin-on-Patterning of Perovskite Thin Films for a Multiplexed Image Sensor Array.

PubMed

Lee, Woongchan; Lee, Jongha; Yun, Huiwon; Kim, Joonsoo; Park, Jinhong; Choi, Changsoon; Kim, Dong Chan; Seo, Hyunseon; Lee, Hakyong; Yu, Ji Woong; Lee, Won Bo; Kim, Dae-Hyeong

2017-10-01

Inorganic-organic hybrid perovskite thin films have attracted significant attention as an alternative to silicon in photon-absorbing devices mainly because of their superb optoelectronic properties. However, high-definition patterning of perovskite thin films, which is important for fabrication of the image sensor array, is hardly accomplished owing to their extreme instability in general photolithographic solvents. Here, a novel patterning process for perovskite thin films is described: the high-resolution spin-on-patterning (SoP) process. This fast and facile process is compatible with a variety of spin-coated perovskite materials and perovskite deposition techniques. The SoP process is successfully applied to develop a high-performance, ultrathin, and deformable perovskite-on-silicon multiplexed image sensor array, paving the road toward next-generation image sensor arrays. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Lifetimes of the Vibrational States of DNA Molecules in Functionalized Complexes of Semiconductor Quantum Dots

NASA Astrophysics Data System (ADS)

Bayramov, F. B.; Poloskin, E. D.; Chernev, A. L.; Toporov, V. V.; Dubina, M. V.; Sprung, C.; Lipsanen, H. K.; Bairamov, B. Kh.

2018-01-01

Results of studying nanocrystalline nc-Si/SiO2 quantum dots (QDs) functionalized by short oligonucleotides show that complexes of isolated crystalline semiconductor QDs are unique objects for detecting the manifestation of new quantum confinement phenomena. It is established that narrow lines observed in high-resolution spectra of inelastic light scattering can be used for determining the characteristic time scale of vibrational excitations of separate nucleotide molecules and for studying structural-dynamic properties of fast oscillatory processes in biomacromolecules.

sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

PubMed

Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

2009-07-16

Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

Molecular identification of common Salmonella serovars using multiplex DNA sensor-based suspension array.

PubMed

Aydin, Muhsin; Carter-Conger, Jacqueline; Gao, Ning; Gilmore, David F; Ricke, Steven C; Ahn, Soohyoun

2018-04-01

Salmonella is one of major foodborne pathogens and the leading cause of foodborne illness-related hospitalizations and deaths. It is critical to develop a sensitive and rapid detection assay that can identify Salmonella to ensure food safety. In this study, a DNA sensor-based suspension array system of high multiplexing ability was developed to identify eight Salmonella serovars commonly associated with foodborne outbreaks to the serotype level. Each DNA sensor was prepared by activating pre-encoded microspheres with oligonucleotide probes that are targeting virulence genes and serovar-specific regions. The mixture of 12 different types of DNA sensors were loaded into a 96-well microplate and used as a 12-plex DNA sensor array platform. DNA isolated from Salmonella was amplified by multiplex polymerase chain reaction (mPCR), and the presence of Salmonella was determined by reading fluorescent signals from hybridization between probes on DNA sensors and fluorescently labeled target DNA using the Bio-Plex® system. The developed multiplex array was able to detect synthetic DNA at the concentration as low as 100 fM and various Salmonella serovars as low as 100 CFU/mL within 1 h post-PCR. Sensitivity of this assay was further improved to 1 CFU/mL with 6-h enrichment. The array system also correctly and specifically identified serotype of tested Salmonella strains without any cross-reactivity with other common foodborne pathogens. Our results indicate the developed DNA sensor suspension array can be a rapid and reliable high-throughput method for simultaneous detection and molecular identification of common Salmonella serotypes.

Implementation of a Virtual Microphone Array to Obtain High Resolution Acoustic Images

PubMed Central

Izquierdo, Alberto; Suárez, Luis; Suárez, David

2017-01-01

Using arrays with digital MEMS (Micro-Electro-Mechanical System) microphones and FPGA-based (Field Programmable Gate Array) acquisition/processing systems allows building systems with hundreds of sensors at a reduced cost. The problem arises when systems with thousands of sensors are needed. This work analyzes the implementation and performance of a virtual array with 6400 (80 × 80) MEMS microphones. This virtual array is implemented by changing the position of a physical array of 64 (8 × 8) microphones in a grid with 10 × 10 positions, using a 2D positioning system. This virtual array obtains an array spatial aperture of 1 × 1 m2. Based on the SODAR (SOund Detection And Ranging) principle, the measured beampattern and the focusing capacity of the virtual array have been analyzed, since beamforming algorithms assume to be working with spherical waves, due to the large dimensions of the array in comparison with the distance between the target (a mannequin) and the array. Finally, the acoustic images of the mannequin, obtained for different frequency and range values, have been obtained, showing high angular resolutions and the possibility to identify different parts of the body of the mannequin. PMID:29295485

eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

NASA Astrophysics Data System (ADS)

Reed, Michael R.; Coty, William A.

We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

A compact high-resolution 3-D imaging spectrometer for discovering Oases on Mars

USGS Publications Warehouse

Ge, J.; Ren, D.; Lunine, J.I.; Brown, R.H.; Yelle, R.V.; Soderblom, L.A.; ,

2002-01-01

A new design for a very lightweight, very high throughput reflectance sectrometer enabled by two new technologies being developed is presented. These new technologies include integral field unit optics to enable simultaneous imaging and spectroscopy at high spatial resolution with an infrared (IR) array, and silicon grisms to enable compact and high-resolution spectroscopy.

16-channel bow tie antenna transceiver array for cardiac MR at 7.0 tesla.

PubMed

Oezerdem, Celal; Winter, Lukas; Graessl, Andreas; Paul, Katharina; Els, Antje; Weinberger, Oliver; Rieger, Jan; Kuehne, Andre; Dieringer, Matthias; Hezel, Fabian; Voit, Dirk; Frahm, Jens; Niendorf, Thoralf

2016-06-01

To design, evaluate, and apply a bow tie antenna transceiver radiofrequency (RF) coil array tailored for cardiac MRI at 7.0 Tesla (T). The radiofrequency (RF) coil array comprises 16 building blocks each containing a bow tie shaped λ/2-dipole antenna. Numerical simulations were used for transmission field homogenization and RF safety validation. RF characteristics were examined in a phantom study. The array's suitability for high spatial resolution two-dimensional (2D) CINE imaging and for real time imaging of the heart was examined in a volunteer study. The arrays transmission fields and RF characteristics are suitable for cardiac MRI at 7.0T. The coil performance afforded a spatial resolution as good as (0.8 × 0.8 × 2.5) mm(3) for segmented 2D CINE MRI at 7.0T which is by a factor of 12 superior versus standardized protocols used in clinical practice at 1.5T. The proposed transceiver array supports 1D acceleration factors of up to R = 6 without impairing image quality significantly. The 16-channel bow tie antenna transceiver array supports accelerated and high spatial resolution cardiac MRI. The array is compatible with multichannel transmission and provides a technological basis for future clinical assessment of parallel transmission techniques at 7.0 Tesla. Magn Reson Med 75:2553-2565, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

Rapid, sensitive and label-free detection of Shiga-toxin producing Escherichia coli O157 using carbon nanotube biosensors.

PubMed

Subramanian, Sowmya; Aschenbach, Konrad H; Evangelista, Jennifer P; Najjar, Mohamed Badaoui; Song, Wenxia; Gomez, Romel D

2012-02-15

An electronic platform to detect very small amounts of genomic DNA from bacteria without the need for PCR amplification and molecular labeling is described. The system uses carbon nanotube field-effect transistor (FET) arrays whose electrical properties are affected by minute electrical charges localized on their active regions. Two pathogenic strains of E. coli are used to evaluate the detection properties of the transistor arrays. Described herein are the results for detection of synthetic oligomers, unpurified and highly purified genomic DNA at various concentrations and their comparison against non-specific binding. In particular, the capture of genomic DNA of E. coli O157:H7 by a specific oligonucleotide probe coated onto the transistor array results in a significant shift in the threshold (gate-source) voltage (V(th)). By contrast the signal under the same procedure using a different strain, E. coli O45 that is non-complementary to the probe remained nearly constant. This work highlights the detection sensitivity and efficacy of this biosensor without stringent requirement for DNA sample preparation. Copyright © 2011 Elsevier B.V. All rights reserved.

Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans.

PubMed

Haraksingh, Rajini R; Abyzov, Alexej; Urban, Alexander Eckehart

2017-04-24

High-resolution microarray technology is routinely used in basic research and clinical practice to efficiently detect copy number variants (CNVs) across the entire human genome. A new generation of arrays combining high probe densities with optimized designs will comprise essential tools for genome analysis in the coming years. We systematically compared the genome-wide CNV detection power of all 17 available array designs from the Affymetrix, Agilent, and Illumina platforms by hybridizing the well-characterized genome of 1000 Genomes Project subject NA12878 to all arrays, and performing data analysis using both manufacturer-recommended and platform-independent software. We benchmarked the resulting CNV call sets from each array using a gold standard set of CNVs for this genome derived from 1000 Genomes Project whole genome sequencing data. The arrays tested comprise both SNP and aCGH platforms with varying designs and contain between ~0.5 to ~4.6 million probes. Across the arrays CNV detection varied widely in number of CNV calls (4-489), CNV size range (~40 bp to ~8 Mbp), and percentage of non-validated CNVs (0-86%). We discovered strikingly strong effects of specific array design principles on performance. For example, some SNP array designs with the largest numbers of probes and extensive exonic coverage produced a considerable number of CNV calls that could not be validated, compared to designs with probe numbers that are sometimes an order of magnitude smaller. This effect was only partially ameliorated using different analysis software and optimizing data analysis parameters. High-resolution microarrays will continue to be used as reliable, cost- and time-efficient tools for CNV analysis. However, different applications tolerate different limitations in CNV detection. Our study quantified how these arrays differ in total number and size range of detected CNVs as well as sensitivity, and determined how each array balances these attributes. This analysis will inform appropriate array selection for future CNV studies, and allow better assessment of the CNV-analytical power of both published and ongoing array-based genomics studies. Furthermore, our findings emphasize the importance of concurrent use of multiple analysis algorithms and independent experimental validation in array-based CNV detection studies.

Evolutionarily diverse determinants of meiotic DNA break and recombination landscapes across the genome

PubMed Central

Fowler, Kyle R.; Sasaki, Mariko; Milman, Neta

2014-01-01

Fission yeast Rec12 (Spo11 homolog) initiates meiotic recombination by forming developmentally programmed DNA double-strand breaks (DSBs). DSB distributions influence patterns of heredity and genome evolution, but the basis of the highly nonrandom choice of Rec12 cleavage sites is poorly understood, largely because available maps are of relatively low resolution and sensitivity. Here, we determined DSBs genome-wide at near-nucleotide resolution by sequencing the oligonucleotides attached to Rec12 following DNA cleavage. The single oligonucleotide size class allowed us to deeply sample all break events. We find strong evidence across the genome for differential DSB repair accounting for crossover invariance (constant cM/kb in spite of DSB hotspots). Surprisingly, about half of all crossovers occur in regions where DSBs occur at low frequency and are widely dispersed in location from cell to cell. These previously undetected, low-level DSBs thus play an outsized and crucial role in meiosis. We further find that the influence of underlying nucleotide sequence and chromosomal architecture differs in multiple ways from that in budding yeast. DSBs are not strongly restricted to nucleosome-depleted regions, as they are in budding yeast, but are nevertheless spatially influenced by chromatin structure. Our analyses demonstrate that evolutionarily fluid factors contribute to crossover initiation and regulation. PMID:25024163

Modelling and simulation of high-frequency (100 MHz) ultrasonic linear arrays based on single crystal LiNbO3.

PubMed

Zhang, J Y; Xu, W J; Carlier, J; Ji, X M; Nongaillard, B; Queste, S; Huang, Y P

2012-01-01

High-frequency ultrasonic transducer arrays are essential for high resolution imaging in clinical analysis and Non-Destructive Evaluation (NDE). However, the fabrication of conventional backing-layer structure, which requires a pitch (distance between the centers of two adjacent elements) of half wavelength in medium, is really a great challenge. Here we present an alternative buffer-layer structure with a silicon lens for volumetric imaging. The requirement for the size of the pitch is less critical for this structure, making it possible to fabricate high-frequency (100MHz) ultrasonic linear array transducers. Using silicon substrate also makes it possible to integrate the arrays with IC (Integrated Circuit). To compare with the conventional backing-layer structure, a finite element tool, COMSOL, is employed to investigate the performances of acoustic beam focusing, the influence of pitch size for the buffer-layer configuration, and to calculate the electrical properties of the arrays, including crosstalk effect and electrical impedance. For a 100MHz 10-element array of buffer-layer structure, the ultrasound beam in azimuth plane in water could be electronically focused to obtain a spatial resolution (a half-amplitude width) of 86μm at the focal depth. When decreasing from half wavelength in silicon (42μm) to half wavelength in water (7.5μm), the pitch sizes weakly affect the focal resolution. The lateral spatial resolution is increased by 4.65% when the pitch size decreases from 42μm to 7.5μm. The crosstalk between adjacent elements at the central frequency is, respectively, -95dB, -39.4dB, and -60.5dB for the 10-element buffer, 49-element buffer and 49-element backing arrays. Additionally, the electrical impedance magnitudes for each structure are, respectively, 4kΩ, 26.4kΩ, and 24.2kΩ, which is consistent with calculation results using Krimholtz, Leedom, and Matthaei (KLM) model. These results show that the buffer-layer configuration is a promising alternative for the fabrication of high-frequency ultrasonic linear arrays dedicated to volumetric imaging. Copyright © 2011 Elsevier B.V. All rights reserved.

High-resolution ionization detector and array of such detectors

DOEpatents

McGregor, Douglas S [Ypsilanti, MI; Rojeski, Ronald A [Pleasanton, CA

2001-01-16

A high-resolution ionization detector and an array of such detectors are described which utilize a reference pattern of conductive or semiconductive material to form interaction, pervious and measurement regions in an ionization substrate of, for example, CdZnTe material. The ionization detector is a room temperature semiconductor radiation detector. Various geometries of such a detector and an array of such detectors produce room temperature operated gamma ray spectrometers with relatively high resolution. For example, a 1 cm.sup.3 detector is capable of measuring .sup.137 Cs 662 keV gamma rays with room temperature energy resolution approaching 2% at FWHM. Two major types of such detectors include a parallel strip semiconductor Frisch grid detector and the geometrically weighted trapezoid prism semiconductor Frisch grid detector. The geometrically weighted detector records room temperature (24.degree. C.) energy resolutions of 2.68% FWHM for .sup.137 Cs 662 keV gamma rays and 2.45% FWHM for .sup.60 Co 1.332 MeV gamma rays. The detectors perform well without any electronic pulse rejection, correction or compensation techniques. The devices operate at room temperature with simple commercially available NIM bin electronics and do not require special preamplifiers or cooling stages for good spectroscopic results.

High Resolution Radar for NASA and Space Situational Awareness for Observation and Monitoring

NASA Astrophysics Data System (ADS)

Geldzahler, B.; D'Addario, L.; Ott, M.; Birr, R.; Woods, G.; Miller, M.

2014-09-01

NASA has embarked on a series of demonstrations that will enable the implementation of a high power, high resolution X/Ka-band radar system using a phased array of widely spaced 12m antennas to better track and characterize near Earth objects and orbital debris. This radar system also has applications for cost effective space situational awareness. Ka band can provide 5cm ranging resolution, and, with arrays in the western United States and Australia used in an astrometric mode, ? 10 cm resolution at GEO. Here we report the results of a successful X-band demonstration of coherent uplink arraying with real time compensation for atmospheric phase fluctuations at the Kennedy Space Center (KSC) using a system simplified from work previously undertaken. The X-band system is a prelude to the Ka-band work currently underway. The target satellites were components of the DSCS and WGS systems. KSC was chosen for the demonstration site because [a] of reduced implementation costs, [b] there is a lot of water vapor in the air (not Ka-band friendly), and [c] some of the test satellites have low elevations thereby adding more attenuation and turbulence to the demonstration. When Ka-band coherent uplink arraying is demonstrated to work at KSC, it will work and can be deployed anywhere.

SPICA, Stellar Parameters and Images with a Cophased Array: a 6T visible combiner for the CHARA array.

PubMed

Mourard, Denis; Bério, Philippe; Perraut, Karine; Clausse, Jean-Michel; Creevey, Orlagh; Martinod, Marc-Antoine; Meilland, Anthony; Millour, Florentin; Nardetto, Nicolas

2017-05-01

High angular resolution studies of stars in the optical domain have highly progressed in recent years. After the results obtained with the visible instrument Visible spEctroGraph and polArimeter (VEGA) on the Center for High Angular Resolution Astronomy (CHARA) array and the recent developments on adaptive optics and fibered interferometry, we have started the design and study of a new six-telescope visible combiner with single-mode fibers. It is designed as a low spectral resolution instrument for the measurement of the angular diameter of stars to make a major step forward in terms of magnitude and precision with respect to the present situation. For a large sample of bright stars, a medium spectral resolution mode will allow unprecedented spectral imaging of stellar surfaces and environments for higher accuracy on stellar/planetary parameters. To reach the ultimate performance of the instrument in terms of limiting magnitude (Rmag≃8 for diameter measurements and Rmag≃4 to 5 for imaging), Stellar Parameters and Images with a Cophased Array (SPICA) includes the development of a dedicated fringe tracking system in the H band to reach "long" (200 ms to 30 s) exposures of the fringe signal in the visible.

Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

PubMed

Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

2016-07-01

Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.

Degenerative encephalopathy in a coastal mountain kingsnake (Lampropeltis zonata multifasciata) due to adenoviral-like infection.

PubMed

Raymond, James T; Lamm, Marnie; Nordhausen, Robert; Latimer, Ken; Garner, Michael M

2003-04-01

In March 2000, an approximately 30-yr-old, male coastal mountain kingsnake (Lampropeltis zonata multifasciata) presented with disequilibrium and unresponsiveness to stimuli that ultimately lead to euthanasia. Histologically, there were foci of gliosis primarily within the caudal cerebrum, brainstem, and cervical spinal cord. Several glial cells and endothelial cells contained magenta, intranuclear inclusion bodies. Electron microscopy of the inclusions revealed paracrystalline arrays of 79-82 nm, viral-like particles. DNA in situ hybridization of sections of formalin-fixed brain using a mixture of two digoxigenin-end-labeled, adenovirus specific, oligonucleotide probes at low and high stringency was positive for adenovirus.

Multiplex Identification of Microbes ▿ †

PubMed Central

Hyman, Richard W.; St.Onge, Robert P.; Allen, Edward A.; Miranda, Molly; Aparicio, Ana Maria; Fukushima, Marilyn; Davis, Ronald W.

2010-01-01

We have adapted molecular inversion probe technology to identify microbes in a highly multiplexed procedure. This procedure does not require growth of the microbes. Rather, the technology employs DNA homology twice: once for the molecular probe to hybridize to its homologous DNA and again for the 20-mer oligonucleotide barcode on the molecular probe to hybridize to a commercially available molecular barcode array. As proof of concept, we have designed, tested, and employed 192 molecular probes for 40 microbes. While these particular molecular probes are aimed at our interest in the microbes in the human vagina, this molecular probe method could be employed to identify the microbes in any ecological niche. PMID:20418427

The development of high resolution silicon x-ray microcalorimeters

NASA Astrophysics Data System (ADS)

Porter, F. S.; Kelley, R. L.; Kilbourne, C. A.

2005-12-01

Recently we have produced x-ray microcalorimeters with resolving powers approaching 2000 at 5.9 keV using a spare XRS microcalorimeter array. We attached 400 um square, 8 um thick HgTe absorbers using a variety of attachment methods to an XRS array and ran the detector array at temperatures between 40 and 60 mK. The best results were for absorbers attached using the standard XRS absorber-pixel thermal isolation scheme utilizing SU8 polymer tubes. In this scenario we achieved a resolution of 3.2 eV FWHM at 5.9 keV. Substituting a silicon spacer for the SU8 tubes also yielded sub-4eV results. In contrast, absorbers attached directly to the thermistor produced significant position dependence and thus degraded resolution. Finally, we tested standard 640um-square XRS detectors at reduced bias power at 50mK and achieved a resolution of 3.7eV, a 50% improvement over the XRS flight instrument. Implanted silicon microcalorimeters are a mature flight-qualified technology that still has a substantial phase space for future development. We will discuss these new high resolution results, the various absorber attachment schemes, planned future improvements, and, finally, their relevance to future high resolution x-ray spectrometers including Constellation-X.

Ka Band Objects: Observation and Monitoring (KaBOOM)

NASA Astrophysics Data System (ADS)

Geldzahler, B.

2012-09-01

NASA has embarked on a path that will enable the implementation of a high power, high resolution X/Ka band radar system using widely spaced 12m antennas to better track and characterize near Earth objects and orbital debris. This radar system also has applications for cost effective space situational awareness. We shall demonstrate Ka band coherent uplink arraying with real-time atmospheric compensation using three 12m antennas at the Kennedy Space Center (KSC). Our proposed radar system can complement and supplement the activities of the Space Fence. The proposed radar array has the advantages of filling the gap between dusk and dawn and offers the possibility of high range resolution (4 cm) and high spatial resolution (?10 cm at GEO) when used in a VLBI mode. KSC was chosen because [a] of reduced implementation costs, [b] there is a lot of water vapor in the air (not Ka band friendly), and [c] the test satellites have a low elevation adding more attenuation and turbulence to the demonstration. If Ka band coherent uplink arraying can be made to work at KSC, it will work anywhere. We expect to rebaseline X-band in 2013, and demonstrate Ka band uplink arraying in 2014.

Design and Fabrication of Two-Dimensional Semiconducting Bolometer Arrays for the High Resolution Airborne Wideband Camera (HAWC) and the Submillimeter High Angular Resolution Camera II (SHARC-II)

NASA Technical Reports Server (NTRS)

Voellmer, George M.; Allen, Christine A.; Amato, Michael J.; Babu, Sachidananda R.; Bartels, Arlin E.; Benford, Dominic J.; Derro, Rebecca J.; Dowell, C. Darren; Harper, D. Al; Jhabvala, Murzy D.;

Design and Fabrication of Two-Dimensional Semiconducting Bolometer Arrays for the High Resolution Airborne Wideband Camera (HAWC) and the Submillimeter High Angular Resolution Camera II (SHARC-II)

NASA Technical Reports Server (NTRS)

Voellmer, George M.; Allen, Christine A.; Amato, Michael J.; Babu, Sachidananda R.; Bartels, Arlin E.; Benford, Dominic J.; Derro, Rebecca J.; Dowell, C. Darren; Harper, D. Al; Jhabvala, Murzy D.

2002-01-01

The High resolution Airborne Wideband Camera (HAWC) and the Submillimeter High Angular Resolution Camera II (SHARC II) will use almost identical versions of an ion-implanted silicon bolometer array developed at the National Aeronautics and Space Administration's Goddard Space Flight Center (GSFC). The GSFC 'Pop-up' Detectors (PUD's) use a unique folding technique to enable a 12 x 32-element close-packed array of bolometers with a filling factor greater than 95 percent. A kinematic Kevlar(trademark) suspension system isolates the 200 mK bolometers from the helium bath temperature, and GSFC - developed silicon bridge chips make electrical connection to the bolometers, while maintaining thermal isolation. The JFET preamps operate at 120 K. Providing good thermal heat sinking for these, and keeping their conduction and radiation from reaching the nearby bolometers, is one of the principal design challenges encountered. Another interesting challenge is the preparation of the silicon bolometers. They are manufactured in 32-element, planar rows using Micro Electro Mechanical Systems (MEMS) semiconductor etching techniques, and then cut and folded onto a ceramic bar. Optical alignment using specialized jigs ensures their uniformity and correct placement. The rows are then stacked to create the 12 x 32-element array. Engineering results from the first light run of SHARC II at the Caltech Submillimeter Observatory (CSO) are presented.

Characterization of Large-Area SiPM Array for PET Applications

NASA Astrophysics Data System (ADS)

Du, Junwei; Yang, Yongfeng; Bai, Xiaowei; Judenhofer, Martin S.; Berg, Eric; Di, Kun; Buckley, Steve; Jackson, Carl; Cherry, Simon R.

2016-02-01

The performance of an 8 ×8 array of 6.0 ×6.0 mm2 (active area) SiPMs was evaluated for PET applications using crystal arrays with different pitch sizes (3.4, 1.5, 1.35, and 1.2 mm) and custom designed five-channel front-end readout electronics (four channels for position information and one channel for timing information). The total area of this SiPM array is 57.4 ×57.4 mm2, and the pitch size is 7.2 mm. It was fabricated using enhanced blue sensitivity SiPMs (MicroFB-60035-SMT) with peak spectral sensitivity at 420 nm. The performance of the SiPM array was characterized by measuring flood histogram decoding quality, energy resolution, timing resolution and saturation at several bias voltages (from 25.0 to 30.0 V in 0.5 V intervals) and two different temperatures ( 5° C and 20°C). Results show that the best flood histogram was obtained at a bias voltage of 28.0 V and 5°C and an array of polished LSO crystals with a pitch as small as 1.2 mm can be resolved. No saturation was observed up to a bias voltage of 29.5 V during the experiments, due to adequate light sharing between SiPMs. Energy resolution and timing resolution at 5°C ranged from 12.7 ±0.8% to 14.6 ±1.4% and 1.58 ±0.13 ns to 2.50 ±0.44 ns, for crystal array pitch sizes of 3.4 and 1.2 mm, respectively. Superior flood histogram quality, energy resolution and timing resolution were obtained with larger crystal array pitch sizes and at lower temperature. Based on our findings, we conclude that this large-area SiPM array can serve as a suitable photodetector for high-resolution small-animal PET or dedicated human brain PET scanners.

Analysis of Chinese women with primary ovarian insufficiency by high resolution array-comparative genomic hybridization.

PubMed

Liao, Can; Fu, Fang; Yang, Xin; Sun, Yi-Min; Li, Dong-Zhi

2011-06-01

Primary ovarian insufficiency (POI) is defined as a primary ovarian defect characterized by absent menarche (primary amenorrhea) or premature depletion of ovarian follicles before the age of 40 years. The etiology of primary ovarian insufficiency in human female patients is still unclear. The purpose of this study is to investigate the potential genetic causes in primary amenorrhea patients by high resolution array based comparative genomic hybridization (array-CGH) analysis. Following the standard karyotyping analysis, genomic DNA from whole blood of 15 primary amenorrhea patients and 15 normal control women was hybridized with Affymetrix cytogenetic 2.7M arrays following the standard protocol. Copy number variations identified by array-CGH were confirmed by real time polymerase chain reaction. All the 30 samples were negative by conventional karyotyping analysis. Microdeletions on chromosome 17q21.31-q21.32 with approximately 1.3 Mb were identified in four patients by high resolution array-CGH analysis. This included the female reproductive secretory pathway related factor N-ethylmaleimide-sensitive factor (NSF) gene. The results of the present study suggest that there may be critical regions regulating primary ovarian insufficiency in women with a 17q21.31-q21.32 microdeletion. This effect might be due to the loss of function of the NSF gene/genes within the deleted region or to effects on contiguous genes.

Development of a 20-MHz wide-bandwidth PMN-PT single crystal phased-array ultrasound transducer.

PubMed

Wong, Chi-Man; Chen, Yan; Luo, Haosu; Dai, Jiyan; Lam, Kwok-Ho; Chan, Helen Lai-Wa

2017-01-01

In this study, a 20-MHz 64-element phased-array ultrasound transducer with a one-wavelength pitch is developed using a PMN-30%PT single crystal and double-matching layer scheme. High piezoelectric (d 33 >1000pC/N) and electromechanical coupling (k 33 >0.8) properties of the single crystal with an optimized fabrication process involving the photolithography technique have been demonstrated to be suitable for wide-bandwidth (⩾70%) and high-sensitivity (insertion loss ⩽30dB) phased-array transducer application. A -6dBbandwidth of 91% and an insertion loss of 29dBfor the 20-MHz 64-element phased-array transducer were achieved. This result shows that the bandwidth is improved comparing with the investigated high-frequency (⩾20MHz) ultrasound transducers using piezoelectric ceramic and single crystal materials. It shows that this phased-array transducer has potential to improve the resolution of biomedical imaging, theoretically. Based on the hypothesis of resolution improvement, this phased-array transducer is capable for small animal (i.e. mouse and zebrafish) studies. Copyright © 2016 Elsevier B.V. All rights reserved.

Arrays of microscopic organic LEDs for high-resolution optogenetics

PubMed Central

Steude, Anja; Witts, Emily C.; Miles, Gareth B.; Gather, Malte C.

2016-01-01

Optogenetics is a paradigm-changing new method to study and manipulate the behavior of cells with light. Following major advances of the used genetic constructs over the last decade, the light sources required for optogenetic control are now receiving increased attention. We report a novel optogenetic illumination platform based on high-density arrays of microscopic organic light-emitting diodes (OLEDs). Because of the small dimensions of each array element (6 × 9 μm2) and the use of ultrathin device encapsulation, these arrays enable illumination of cells with unprecedented spatiotemporal resolution. We show that adherent eukaryotic cells readily proliferate on these arrays, and we demonstrate specific light-induced control of the ionic current across the membrane of individual live cells expressing different optogenetic constructs. Our work paves the way for the use of OLEDs for cell-specific optogenetic control in cultured neuronal networks and for acute brain slices, or as implants in vivo. PMID:27386540

Wide bandwidth and high resolution planar filter array based on DBR-metasurface-DBR structures

DOE PAGES

Horie, Yu; Arbabi, Amir; Arbabi, Ehsan; ...

2016-05-19

Here, we propose and experimentally demonstrate a planar array of optical bandpass filters composed of low loss dielectric metasurface layers sandwiched between two distributed Bragg reflectors (DBRs). The two DBRs form a Fabry-Perot resonator whose center wavelength is controlled by the design of the transmissive metasurface layer which functions as a phase shifting element. We demonstrate an array of bandpass filters with spatially varying center wavelengths covering a wide range of operation wavelengths of 250nm around λ = 1550nm (Δλ/λ = 16%). The center wavelengths of each filter are independently controlled only by changing the in-plane geometry of the sandwichedmore » metasurfaces, and the experimentally measured quality factors are larger than 700. The demonstrated filter array can be directly integrated on top of photodetector arrays to realize on-chip high-resolution spectrometers with free-space coupling.« less

CdS nanorods/organic hybrid LED array and the piezo-phototronic effect of the device for pressure mapping.

PubMed

Bao, Rongrong; Wang, Chunfeng; Dong, Lin; Shen, Changyu; Zhao, Kun; Pan, Caofeng

2016-04-21

As widely applied in light-emitting diodes and optical devices, CdS has attracted the attention of many researchers due to its nonlinear properties and piezo-electronic effect. Here, we demonstrate a LED array composed of PSS and CdS nanorods and research the piezo-photonic effect of the array device. The emission intensity of the device depends on the electron-hole recombination at the interface of the p-n junction which can be adjusted using the piezo-phototronic effect and can be used to map the pressure applied on the surface of the device with spatial resolution as high as 1.5 μm. A flexible LED device array has been prepared using a CdS nanorod array on a Au/Cr/kapton substrate. This device may be used in the field of strain mapping using its high pressure spatial-resolution and flexibility.

Demonstration of nanoimprinted hyperlens array for high-throughput sub-diffraction imaging

NASA Astrophysics Data System (ADS)

Byun, Minsueop; Lee, Dasol; Kim, Minkyung; Kim, Yangdoo; Kim, Kwan; Ok, Jong G.; Rho, Junsuk; Lee, Heon

2017-04-01

Overcoming the resolution limit of conventional optics is regarded as the most important issue in optical imaging science and technology. Although hyperlenses, super-resolution imaging devices based on highly anisotropic dispersion relations that allow the access of high-wavevector components, have recently achieved far-field sub-diffraction imaging in real-time, the previously demonstrated devices have suffered from the extreme difficulties of both the fabrication process and the non-artificial objects placement. This results in restrictions on the practical applications of the hyperlens devices. While implementing large-scale hyperlens arrays in conventional microscopy is desirable to solve such issues, it has not been feasible to fabricate such large-scale hyperlens array with the previously used nanofabrication methods. Here, we suggest a scalable and reliable fabrication process of a large-scale hyperlens device based on direct pattern transfer techniques. We fabricate a 5 cm × 5 cm size hyperlenses array and experimentally demonstrate that it can resolve sub-diffraction features down to 160 nm under 410 nm wavelength visible light. The array-based hyperlens device will provide a simple solution for much more practical far-field and real-time super-resolution imaging which can be widely used in optics, biology, medical science, nanotechnology and other closely related interdisciplinary fields.

Photovoltaic restoration of sight with high visual acuity

PubMed Central

Lorach, Henri; Goetz, Georges; Smith, Richard; Lei, Xin; Mandel, Yossi; Kamins, Theodore; Mathieson, Keith; Huie, Philip; Harris, James; Sher, Alexander; Palanker, Daniel

2015-01-01

Patients with retinal degeneration lose sight due to gradual demise of photoreceptors. Electrical stimulation of the surviving retinal neurons provides an alternative route for delivery of visual information. We demonstrate that subretinal arrays with 70 μm photovoltaic pixels provide highly localized stimulation, with electrical and visual receptive fields of comparable sizes in rat retinal ganglion cells. Similarly to normal vision, retinal response to prosthetic stimulation exhibits flicker fusion at high frequencies, adaptation to static images and non-linear spatial summation. In rats with retinal degeneration, these photovoltaic arrays provide spatial resolution of 64 ± 11 μm, corresponding to half of the normal visual acuity in pigmented rats. Ease of implantation of these wireless and modular arrays, combined with their high resolution opens the door to functional restoration of sight. PMID:25915832

Identification of Essential Sensitive Regions of the Aerolysin Nanopore for Single Oligonucleotide Analysis.

PubMed

Wang, Ya-Qian; Li, Meng-Yin; Qiu, Hu; Cao, Chan; Wang, Ming-Bo; Wu, Xue-Yuan; Huang, Jin; Ying, Yi-Lun; Long, Yi-Tao

2018-06-11

The aerolysin nanopore channel is one of the confined spaces for single molecule analysis which displays high spatial and temporal resolution for the discrimination of single nucleotides, identification of DNA base modification, and analyzing the structural transition of DNAs. However, to overcome the challenge of achieving the ultimate goal of the widespread real analytical application, it is urgent to probe the sensing regions of the aerolysin to further improve the sensitivity. In this paper, we explore the sensing regions of the aerolysin nanopore by a series of well-designed mutant nanopore experiments combined with molecular dynamics simulations-based electrostatic analysis. The positively charged lumen-exposed Lys-238, identified as one of the key sensing sites due to the presence of a deep valley in the electrostatic potentials, was replaced by different charged and sized amino acids. The results show that the translocation time of oligonucleotides through the nanopore can be readily modulated by the choice of the target amino acid at the 238 site. In particular, a 7-fold slower translocation at a voltage bias of +120 mV is observed with respect to the wild-type aerolysin, which provides a high resolution for methylated cytosine discrimination. We further determine that both the electrostatic properties and geometrical structure of the aerolysin nanopore are crucial to its sensing ability. These insights open ways for rationally designing the sensing mechanism of the aerolysin nanopore, thus providing a novel paradigm for nanopore sensing.

Zonal wavefront sensing with enhanced spatial resolution.

PubMed

Pathak, Biswajit; Boruah, Bosanta R

2016-12-01

In this Letter, we introduce a scheme to enhance the spatial resolution of a zonal wavefront sensor. The zonal wavefront sensor comprises an array of binary gratings implemented by a ferroelectric spatial light modulator (FLCSLM) followed by a lens, in lieu of the array of lenses in the Shack-Hartmann wavefront sensor. We show that the fast response of the FLCSLM device facilitates quick display of several laterally shifted binary grating patterns, and the programmability of the device enables simultaneous capturing of each focal spot array. This eventually leads to a wavefront estimation with an enhanced spatial resolution without much sacrifice on the sensor frame rate, thus making the scheme suitable for high spatial resolution measurement of transient wavefronts. We present experimental and numerical simulation results to demonstrate the importance of the proposed wavefront sensing scheme.

Evaluation of Matrix9 silicon photomultiplier array for small-animal PET.

PubMed

Du, Junwei; Schmall, Jeffrey P; Yang, Yongfeng; Di, Kun; Roncali, Emilie; Mitchell, Gregory S; Buckley, Steve; Jackson, Carl; Cherry, Simon R

2015-02-01

The MatrixSL-9-30035-OEM (Matrix9) from SensL is a large-area silicon photomultiplier (SiPM) photodetector module consisting of a 3 × 3 array of 4 × 4 element SiPM arrays (total of 144 SiPM pixels) and incorporates SensL's front-end electronics board and coincidence board. Each SiPM pixel measures 3.16 × 3.16 mm(2) and the total size of the detector head is 47.8 × 46.3 mm(2). Using 8 × 8 polished LSO/LYSO arrays (pitch 1.5 mm) the performance of this detector system (SiPM array and readout electronics) was evaluated with a view for its eventual use in small-animal positron emission tomography (PET). Measurements of noise, signal, signal-to-noise ratio, energy resolution, flood histogram quality, timing resolution, and array trigger error were obtained at different bias voltages (28.0-32.5 V in 0.5 V intervals) and at different temperatures (5 °C-25 °C in 5 °C degree steps) to find the optimal operating conditions. The best measured signal-to-noise ratio and flood histogram quality for 511 keV gamma photons were obtained at a bias voltage of 30.0 V and a temperature of 5 °C. The energy resolution and timing resolution under these conditions were 14.2% ± 0.1% and 4.2 ± 0.1 ns, respectively. The flood histograms show that all the crystals in the 1.5 mm pitch LSO array can be clearly identified and that smaller crystal pitches can also be resolved. Flood histogram quality was also calculated using different center of gravity based positioning algorithms. Improved and more robust results were achieved using the local 9 pixels for positioning along with an energy offset calibration. To evaluate the front-end detector readout, and multiplexing efficiency, an array trigger error metric is introduced and measured at different lower energy thresholds. Using a lower energy threshold greater than 150 keV effectively eliminates any mispositioning between SiPM arrays. In summary, the Matrix9 detector system can resolve high-resolution scintillator arrays common in small-animal PET with adequate energy resolution and timing resolution over a large detector area. The modular design of the Matrix9 detector allows it to be used as a building block for simple, low channel-count, yet high performance, small animal PET or PET/MRI systems.

Evaluation of Matrix9 silicon photomultiplier array for small-animal PET

PubMed Central

Du, Junwei; Schmall, Jeffrey P.; Yang, Yongfeng; Di, Kun; Roncali, Emilie; Mitchell, Gregory S.; Buckley, Steve; Jackson, Carl; Cherry, Simon R.

2015-01-01

Purpose: The MatrixSL-9-30035-OEM (Matrix9) from SensL is a large-area silicon photomultiplier (SiPM) photodetector module consisting of a 3 × 3 array of 4 × 4 element SiPM arrays (total of 144 SiPM pixels) and incorporates SensL’s front-end electronics board and coincidence board. Each SiPM pixel measures 3.16 × 3.16 mm2 and the total size of the detector head is 47.8 × 46.3 mm2. Using 8 × 8 polished LSO/LYSO arrays (pitch 1.5 mm) the performance of this detector system (SiPM array and readout electronics) was evaluated with a view for its eventual use in small-animal positron emission tomography (PET). Methods: Measurements of noise, signal, signal-to-noise ratio, energy resolution, flood histogram quality, timing resolution, and array trigger error were obtained at different bias voltages (28.0–32.5 V in 0.5 V intervals) and at different temperatures (5 °C–25 °C in 5 °C degree steps) to find the optimal operating conditions. Results: The best measured signal-to-noise ratio and flood histogram quality for 511 keV gamma photons were obtained at a bias voltage of 30.0 V and a temperature of 5 °C. The energy resolution and timing resolution under these conditions were 14.2% ± 0.1% and 4.2 ± 0.1 ns, respectively. The flood histograms show that all the crystals in the 1.5 mm pitch LSO array can be clearly identified and that smaller crystal pitches can also be resolved. Flood histogram quality was also calculated using different center of gravity based positioning algorithms. Improved and more robust results were achieved using the local 9 pixels for positioning along with an energy offset calibration. To evaluate the front-end detector readout, and multiplexing efficiency, an array trigger error metric is introduced and measured at different lower energy thresholds. Using a lower energy threshold greater than 150 keV effectively eliminates any mispositioning between SiPM arrays. Conclusions: In summary, the Matrix9 detector system can resolve high-resolution scintillator arrays common in small-animal PET with adequate energy resolution and timing resolution over a large detector area. The modular design of the Matrix9 detector allows it to be used as a building block for simple, low channel-count, yet high performance, small animal PET or PET/MRI systems. PMID:25652479

Evaluation of Matrix9 silicon photomultiplier array for small-animal PET

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, Junwei, E-mail: jwdu@ucdavis.edu; Schmall, Jeffrey P.; Yang, Yongfeng

Purpose: The MatrixSL-9-30035-OEM (Matrix9) from SensL is a large-area silicon photomultiplier (SiPM) photodetector module consisting of a 3 × 3 array of 4 × 4 element SiPM arrays (total of 144 SiPM pixels) and incorporates SensL’s front-end electronics board and coincidence board. Each SiPM pixel measures 3.16 × 3.16 mm{sup 2} and the total size of the detector head is 47.8 × 46.3 mm{sup 2}. Using 8 × 8 polished LSO/LYSO arrays (pitch 1.5 mm) the performance of this detector system (SiPM array and readout electronics) was evaluated with a view for its eventual use in small-animal positron emission tomographymore » (PET). Methods: Measurements of noise, signal, signal-to-noise ratio, energy resolution, flood histogram quality, timing resolution, and array trigger error were obtained at different bias voltages (28.0–32.5 V in 0.5 V intervals) and at different temperatures (5 °C–25 °C in 5 °C degree steps) to find the optimal operating conditions. Results: The best measured signal-to-noise ratio and flood histogram quality for 511 keV gamma photons were obtained at a bias voltage of 30.0 V and a temperature of 5 °C. The energy resolution and timing resolution under these conditions were 14.2% ± 0.1% and 4.2 ± 0.1 ns, respectively. The flood histograms show that all the crystals in the 1.5 mm pitch LSO array can be clearly identified and that smaller crystal pitches can also be resolved. Flood histogram quality was also calculated using different center of gravity based positioning algorithms. Improved and more robust results were achieved using the local 9 pixels for positioning along with an energy offset calibration. To evaluate the front-end detector readout, and multiplexing efficiency, an array trigger error metric is introduced and measured at different lower energy thresholds. Using a lower energy threshold greater than 150 keV effectively eliminates any mispositioning between SiPM arrays. Conclusions: In summary, the Matrix9 detector system can resolve high-resolution scintillator arrays common in small-animal PET with adequate energy resolution and timing resolution over a large detector area. The modular design of the Matrix9 detector allows it to be used as a building block for simple, low channel-count, yet high performance, small animal PET or PET/MRI systems.« less

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Hyperlens-array-implemented optical microscopy

NASA Astrophysics Data System (ADS)

Iwanaga, Masanobu

2014-08-01

Limit of resolution of conventional optical microscopes has never reached below 100 nm under visible light illumination. We show that numerically designed high-transmittance hyperlens array (HLA) is implemented in an optical microscope and works in practice for achieving one-shot-recording optical images of in-situ placed objects with sub 50 nm resolution in lateral direction. Direct resolution test employing well-defined nanopatterns proves that the HLA-implemented imaging is super-resolution optical microscopy, which works even under nW/mm2 visible illumination for objects. The HLA implementation makes the resolution of conventional microscopes one-scale higher, leading to the 1/10 illumination wavelength range, that is, mesoscopic range.

A Specialized Multi-Transmit Head Coil for High Resolution fMRI of the Human Visual Cortex at 7T.

PubMed

Sengupta, Shubharthi; Roebroeck, Alard; Kemper, Valentin G; Poser, Benedikt A; Zimmermann, Jan; Goebel, Rainer; Adriany, Gregor

2016-01-01

To design, construct and validate radiofrequency (RF) transmit and receive phased array coils for high-resolution visual cortex imaging at 7 Tesla. A 4 channel transmit and 16 channel receive array was constructed on a conformal polycarbonate former. Transmit field efficiency and homogeneity were simulated and validated, along with the Specific Absorption Rate, using [Formula: see text] mapping techniques and electromagnetic simulations. Receiver signal-to-noise ratio (SNR), temporal SNR (tSNR) across EPI time series, g-factors for accelerated imaging and noise correlations were evaluated and compared with a commercial 32 channel whole head coil. The performance of the coil was further evaluated with human subjects through functional MRI (fMRI) studies at standard and submillimeter resolutions of upto 0.8mm isotropic. The transmit and receive sections were characterized using bench tests and showed good interelement decoupling, preamplifier decoupling and sample loading. SNR for the 16 channel coil was ∼ 1.5 times that of the commercial coil in the human occipital lobe, and showed better g-factor values for accelerated imaging. fMRI tests conducted showed better response to Blood Oxygen Level Dependent (BOLD) activation, at resolutions of 1.2mm and 0.8mm isotropic. The 4 channel phased array transmit coil provides homogeneous excitation across the visual cortex, which, in combination with the dual row 16 channel receive array, makes for a valuable research tool for high resolution anatomical and functional imaging of the visual cortex at 7T.

Compact and high resolution virtual mouse using lens array and light sensor

NASA Astrophysics Data System (ADS)

Qin, Zong; Chang, Yu-Cheng; Su, Yu-Jie; Huang, Yi-Pai; Shieh, Han-Ping David

2016-06-01

Virtual mouse based on IR source, lens array and light sensor was designed and implemented. Optical architecture including lens amount, lens pitch, baseline length, sensor length, lens-sensor gap, focal length etc. was carefully designed to achieve low detective error, high resolution, and simultaneously, compact system volume. System volume is 3.1mm (thickness) × 4.5mm (length) × 2, which is much smaller than that of camera-based device. Relative detective error of 0.41mm and minimum resolution of 26ppi were verified in experiments, so that it can replace conventional touchpad/touchscreen. If system thickness is eased to 20mm, resolution higher than 200ppi can be achieved to replace real mouse.

Small pixel pitch MCT IR-modules

NASA Astrophysics Data System (ADS)

Lutz, H.; Breiter, R.; Eich, D.; Figgemeier, H.; Fries, P.; Rutzinger, S.; Wendler, J.

2016-05-01

It is only some years ago, since VGA format detectors in 15μm pitch, manufactured with AIM's MCT n-on-p LPE standard technology, have been introduced to replace TV/4 format detector arrays as a system upgrade. In recent years a rapid increase in the demand for higher resolution, while preserving high thermal resolution, compactness and low power budget is observed. To satisfy these needs AIM has realized first prototypes of MWIR XGA format (1024x768) detector arrays in 10μm pitch. They fit in the same compact dewar as 640x512, 15μm pitch detector arrays. Therefore, they are best suited for system upgrade purposes to benefit from higher spatial resolution and keep cost on system level low. By combining pitch size reduction with recent development progress in the fields of miniature cryocoolers, short dewars and high operating temperatures the way ahead to ultra-compact high performance MWIR-modules is prepared. For cost reduction MBE grown MCT on commercially available GaAs substrates is introduced at AIM. Recently, 640x512, 15μm pitch FPAs, grown with MBE have successfully passed long-term high temperature storage tests as a crucial step towards serial production readiness level for use in future products. Pitch size reduction is not limited to arrays sensitive in the MWIR, but is of great interest for high performance LWIR or 3rd Gen solutions. Some applications such as rotorcraft pilotage require superior spatial resolution in a compact design to master severe weather conditions or degraded visual environment such as brown-out. For these applications AIM is developing both LWIR as well as dual band detector arrays in HD-format (1280x720) with 12μm pitch. This paper will present latest results in the development of detector arrays with small pitch sizes of 10μm and 12μm at AIM, together with their usage to realize compact cooled IR-modules.

The Space Infrared Interferometric Telescope (SPIRIT)

NASA Technical Reports Server (NTRS)

Rinehart, Stephen

2007-01-01

The Space Infrared Interferometric Telescope (SPIRIT) is a candidate NASA Origins Probe Mission. SPIRIT is a two-telescope Michelson interferometer covering wavelengths from 25-400 microns, providing simultaneously high spectral resolution and high angular resolution. With comparable sensitivity to Spitzer, but two orders of magnitude improvement in angular resolution, SPIRIT will enable us to address a wide array of compelling scientific questions, including how planetary systems form in disks and how new planets interact with the disk. Further, SPIRIT will lay the technological groundwork for an array of future interferometry missions with ambitious scientific goals, including the Terrestrial Planet Finder Interferometer / Darwin, and the Submillimeter Probe of the Evolution of Cosmic Structure.

The Space Infrared Interferometric Telescope (SPIRIT)

NASA Technical Reports Server (NTRS)

Rinehart, Stephen

2007-01-01

The Space Infrared Interferometric Telescope (SPIRIT) is a candidate NASA Origins Probe Mission. SPIRIT is a two-telescope Michelson interferometer covering wavelengths from 25-400 microns, providing simultaneously high spectral resolution and high angular resolution. With comparable sensitivity to Spitzer, but two orders of magnitude improvement in angular resolution, SPIRIT will enable us to address a wide array of compelling scientific questions, including how planetary systems form in disks and how new planets interact with the disk. Further, SPIRIT will lay the technological groundwork for an array of future interferometry missions with ambitious scientific goals, including the Terrestrial Planet Finder Interferometer/Darwin, and the Submillimeter Probe of the Evolution of Cosmic Structure.

Feasibility study of an optically coherent telescope array in space

NASA Technical Reports Server (NTRS)

Traub, W. A.

1983-01-01

Numerical methods of image construction which can be used to produce very high angular resolution images at optical wavelengths of astronomical objects from an orbiting array of telescopes are discussed and a concept is presented for a phase-coherent optical telescope array which may be deployed by space shuttle in the 1990's. The system would start as a four-element linear array with a 12 m baseline. The initial module is a minimum redundant array with a photon-counting collecting area three times larger than space telescope and a one dimensional resolution of better than 0.01 arc seconds in the visible range. Later additions to the array would build up facility capability. The advantages of a VLBI observatory in space are considered as well as apertures for the telescopes.

Improvement of resolution in full-view linear-array photoacoustic computed tomography using a novel adaptive weighting method

NASA Astrophysics Data System (ADS)

Omidi, Parsa; Diop, Mamadou; Carson, Jeffrey; Nasiriavanaki, Mohammadreza

2017-03-01

Linear-array-based photoacoustic computed tomography is a popular methodology for deep and high resolution imaging. However, issues such as phase aberration, side-lobe effects, and propagation limitations deteriorate the resolution. The effect of phase aberration due to acoustic attenuation and constant assumption of the speed of sound (SoS) can be reduced by applying an adaptive weighting method such as the coherence factor (CF). Utilizing an adaptive beamforming algorithm such as the minimum variance (MV) can improve the resolution at the focal point by eliminating the side-lobes. Moreover, invisibility of directional objects emitting parallel to the detection plane, such as vessels and other absorbing structures stretched in the direction perpendicular to the detection plane can degrade resolution. In this study, we propose a full-view array level weighting algorithm in which different weighs are assigned to different positions of the linear array based on an orientation algorithm which uses the histogram of oriented gradient (HOG). Simulation results obtained from a synthetic phantom show the superior performance of the proposed method over the existing reconstruction methods.

Oligonucleotide and Parylene Surface Coating of Polystyrene and ePTFE for Improved Endothelial Cell Attachment and Hemocompatibility

PubMed Central

Schleicher, Martina; Hansmann, Jan; Elkin, Bentsian; Kluger, Petra J.; Liebscher, Simone; Huber, Agnes J. T.; Fritze, Olaf; Schille, Christine; Müller, Michaela; Schenke-Layland, Katja; Seifert, Martina; Walles, Heike; Wendel, Hans-Peter; Stock, Ulrich A.

2012-01-01

In vivo self-endothelialization by endothelial cell adhesion on cardiovascular implants is highly desirable. DNA-oligonucleotides are an intriguing coating material with nonimmunogenic characteristics and the feasibility of easy and rapid chemical fabrication. The objective of this study was the creation of cell adhesive DNA-oligonucleotide coatings on vascular implant surfaces. DNA-oligonucleotides immobilized by adsorption on parylene (poly(monoaminomethyl-para-xylene)) coated polystyrene and ePTFE were resistant to high shear stress (9.5 N/m2) and human blood serum for up to 96 h. Adhesion of murine endothelial progenitor cells, HUVECs and endothelial cells from human adult saphenous veins as well as viability over a period of 14 days of HUVECs on oligonucleotide coated samples under dynamic culture conditions was significantly enhanced (P < 0.05). Oligonucleotide-coated surfaces revealed low thrombogenicity and excellent hemocompatibility after incubation with human blood. These properties suggest the suitability of immobilization of DNA-oligonucleotides for biofunctionalization of blood vessel substitutes for improved in vivo endothelialization. PMID:22481939

Wide-bandwidth high-resolution search for extraterrestrial intelligence

NASA Technical Reports Server (NTRS)

Horowitz, Paul

1992-01-01

Research accomplished in the following areas is discussed: the antenna configuration; HEMT low-noise amplifiers; the downconverter; the Fast Fourier Transform Array; the backend array; and the backend and workstation.

Indium antimonide large-format detector arrays

NASA Astrophysics Data System (ADS)

Davis, Mike; Greiner, Mark

2011-06-01

Large format infrared imaging sensors are required to achieve simultaneously high resolution and wide field of view image data. Infrared sensors are generally required to be cooled from room temperature to cryogenic temperatures in less than 10 min thousands of times during their lifetime. The challenge is to remove mechanical stress, which is due to different materials with different coefficients of expansion, over a very wide temperature range and at the same time, provide a high sensitivity and high resolution image data. These challenges are met by developing a hybrid where the indium antimonide detector elements (pixels) are unconnected islands that essentially float on a silicon substrate and form a near perfect match to the silicon read-out circuit. Since the pixels are unconnected and isolated from each other, the array is reticulated. This paper shows that the front side illuminated and reticulated element indium antimonide focal plane developed at L-3 Cincinnati Electronics are robust, approach background limited sensitivity limit, and provide the resolution expected of the reticulated pixel array.

High resolution scintillation detector with semiconductor readout

DOEpatents

Levin, Craig S.; Hoffman, Edward J.

2000-01-01

A novel high resolution scintillation detector array for use in radiation imaging such as high resolution Positron Emission Tomography (PET) which comprises one or more parallelepiped crystals with at least one long surface of each crystal being in intimate contact with a semiconductor photodetector such that photons generated within each crystal by gamma radiation passing therethrough is detected by the photodetector paired therewith.

Chromosomal microarray in clinical diagnosis: a study of 337 patients with congenital anomalies and developmental delays or intellectual disability.

PubMed

Sansović, Ivona; Ivankov, Ana-Maria; Bobinec, Adriana; Kero, Mijana; Barišić, Ingeborg

2017-06-14

To determine the diagnostic yield and criteria that could help to classify and interpret the copy number variations (CNVs) detected by chromosomal microarray (CMA) technique in patients with congenital and developmental abnormalities including dysmorphia, developmental delay (DD) or intellectual disability (ID), autism spectrum disorders (ASD) and congenital anomalies (CA). CMA analysis was performed in 337 patients with DD/ID with or without dysmorphism, ASD, and/or CA. In 30 of 337 patients, chromosomal imbalances had previously been detected by classical cytogenetic and molecular cytogenetic methods. In 73 of 337 patients, clinically relevant variants were detected and better characterized. Most of them were >1 Mb. Variants of unknown clinical significance (VOUS) were discovered in 35 patients. The most common VOUS size category was <300 kb (40.5%). Deletions and de novo imbalances were more frequent in pathogenic CNV than in VOUS category. CMA had a high diagnostic yield of 43/307, excluding patients previously detected by other methods. CMA was valuable in establishing the diagnosis in a high proportion of patients. Criteria for classification and interpretation of CNVs include CNV size and type, mode of inheritance, and genotype-phenotype correlation. Agilent ISCA v2 Human Genome 8x60 K oligonucleotide microarray format proved to be reasonable resolution for clinical use, particularly in the regions that are recommended by the International Standard Cytogenomic Array (ISCA) Consortium and associated with well-established syndromes.

Electric crosstalk impairs spatial resolution of multi-electrode arrays in retinal implants

NASA Astrophysics Data System (ADS)

Wilke, R. G. H.; Khalili Moghadam, G.; Lovell, N. H.; Suaning, G. J.; Dokos, S.

2011-08-01

Active multi-electrode arrays are used in vision prostheses, including optic nerve cuffs and cortical and retinal implants for stimulation of neural tissue. For retinal implants, arrays with up to 1500 electrodes are used in clinical trials. The ability to convey information with high spatial resolution is critical for these applications. To assess the extent to which spatial resolution is impaired by electric crosstalk, finite-element simulation of electric field distribution in a simplified passive tissue model of the retina is performed. The effects of electrode size, electrode spacing, distance to target cells, and electrode return configuration (monopolar, tripolar, hexagonal) on spatial resolution is investigated in the form of a mathematical model of electric field distribution. Results show that spatial resolution is impaired with increased distance from the electrode array to the target cells. This effect can be partly compensated by non-monopolar electrode configurations and larger electrode diameters, albeit at the expense of lower pixel densities due to larger covering areas by each stimulation electrode. In applications where multi-electrode arrays can be brought into close proximity to target cells, as presumably with epiretinal implants, smaller electrodes in monopolar configuration can provide the highest spatial resolution. However, if the implantation site is further from the target cells, as is the case in suprachoroidal approaches, hexagonally guarded electrode return configurations can convey higher spatial resolution. This paper was originally submitted for the special issue containing contributions from the Sixth Biennial Research Congress of The Eye and the Chip.

A polychromator-type near-infrared spectrometer with a high-sensitivity and high-resolution photodiode array detector for pharmaceutical process monitoring on the millisecond time scale.

PubMed

Murayama, Kodai; Genkawa, Takuma; Ishikawa, Daitaro; Komiyama, Makoto; Ozaki, Yukihiro

2013-02-01

In the fine chemicals industry, particularly in the pharmaceutical industry, advanced sensing technologies have recently begun being incorporated into the process line in order to improve safety and quality in accordance with process analytical technology. For estimating the quality of powders without preparation during drug formulation, near-infrared (NIR) spectroscopy has been considered the most promising sensing approach. In this study, we have developed a compact polychromator-type NIR spectrometer equipped with a photodiode (PD) array detector. This detector is consisting of 640 InGaAs-PD elements with 20-μm pitch. Some high-specification spectrometers, which use InGaAs-PD with 512 elements, have a wavelength resolution of about 1.56 nm when covering 900-1700 nm range. On the other hand, the newly developed detector, having the PD with one of the world's highest density, enables wavelength resolution of below 1.25 nm. Moreover, thanks to the combination with a highly integrated charge amplifier array circuit, measurement speed of the detector is higher by two orders than that of existing PD array detectors. The developed spectrometer is small (120 mm × 220 mm × 200 mm) and light (6 kg), and it contains various key devices including the high-density and high-sensitivity PD array detector, NIR technology, and spectroscopy technology for a spectroscopic analyzer that has the required detection mechanism and high sensitivity for powder measurement, as well as a high-speed measuring function for blenders. Moreover, we have evaluated the characteristics of the developed NIR spectrometer, and the measurement of powder samples confirmed that it has high functionality.

Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

NASA Astrophysics Data System (ADS)

Tripathy, Sushant

Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing oligonucleotides conjugated HDL NPs in regulating the expression and function of VEGFR2 in cultured endothelial cells. Finally, the efficacy of the conjugates in two animal models of angiogenesis is presented.

A novel 4p16.3 microduplication distal to WHSC1 and WHSC2 characterized by oligonucleotide array with new phenotypic features.

PubMed

Cyr, Andrew B; Nimmakayalu, Manjunath; Longmuir, Susannah Q; Patil, Shivanand R; Keppler-Noreuil, Kim M; Shchelochkov, Oleg A

2011-09-01

Larger imbalances on chromosome 4p in the form of deletions associated with Wolf-Hirschhorn syndrome (WHS) and duplications of chromosome 4p have a defined clinical phenotype. The critical region for both these clinical disorders has been narrowed based on the genotype-phenotype correlations. However, cryptic rearrangements in this region have been reported infrequently. We report on a male patient with a microduplication of chromosome 4p, who presents with findings of macrocephaly, irregular iris pigmentation-heterochromia, and preserved linear growth in addition to overlapping features of trisomy 4p such as seizures, delayed psychomotor development, and dysmorphic features including prominent glabella, low-set ears, and short neck. Using a high-density oligonucleotide microarray, we have identified a novel submicroscopic duplication involving dosage sensitive genes TACC3, FGFR3, and LETM1. The microduplication did not involve WHSC1 and WHSC2 which are considered in the critical region for WHS and trisomy 4p. This patient's presentation and genomic findings help further delineate clinical significance of re-arrangements in the 4p16 region without the involvement of WHS critical region. Copyright © 2011 Wiley-Liss, Inc.

Identification of differentially regulated transcripts in mouse striatum following methamphetamine treatment--an oligonucleotide microarray approach.

PubMed

Thomas, David M; Francescutti-Verbeem, Dina M; Liu, Xiuli; Kuhn, Donald M

2004-01-01

Methamphetamine is an addictive drug of abuse that can produce neurotoxic effects in dopamine nerve endings of the striatum. The purpose of this study was to identify new genes that may play a role in the highly complex cascade of events associated with methamphetamine intoxication. Using Affymetrix oligonucleotide arrays, 12 488 genes were simultaneously interrogated and there were 152 whose expression levels were changed following methamphetamine treatment. The genes are grouped into broad functional categories with inflammatory/immune response elements, receptor/signal transduction components and ion channel/transport proteins among the most populated. Many genes within these categories can be linked to ion regulation and apoptosis, both of which have been implicated in methamphetamine toxicity, and numerous factors associated with microglial activation emerged with significant changes in expression. For example, brain-derived neurotrophic factor (BDNF), chemokine (C-C) receptor 6 (CCr6) and numerous chemokine transcripts were increased or decreased in expression more than 2.8-fold. These results point to activated microglia as a potential source of the reactive oxygen/nitrogen species and cytokines that have been previously associated with methamphetamine toxicity and other neurotoxic conditions.

Sensitive detection of unlabeled oligonucleotides using a paired surface plasma waves biosensor.

PubMed

Li, Ying-Chang; Chiou, Chiuan-Chian; Luo, Ji-Dung; Chen, Wei-Ju; Su, Li-Chen; Chang, Ying-Feng; Chang, Yu-Sun; Lai, Chao-Sung; Lee, Cheng-Chung; Chou, Chien

2012-05-15

Detection of unlabeled oligonucleotides using surface plasmon resonance (SPR) is difficult because of the oligonucleotides' relatively lower molecular weight compared with proteins. In this paper, we describe a method for detecting unlabeled oligonucleotides at low concentration using a paired surface plasma waves biosensor (PSPWB). The biosensor uses a sensor chip with an immobilized probe to detect a target oligonucleotide via sequence-specific hybridization. PSPWB measures the demodulated amplitude of the heterodyne signal in real time. In the meantime, the ratio of the amplitudes between the detected output signal and reference can reduce the excess noise from the laser intensity fluctuation. Also, the common-path propagation of p and s waves cancels the common phase noise induced by temperature variation. Thus, a high signal-to-noise ratio (SNR) of the heterodyne signal is detected. The sequence specificity of oligonucleotide hybridization ensures that the platform is precisely discriminating between target and non-target oligonucleotides. Under optimized experimental conditions, the detected heterodyne signal increases linearly with the logarithm of the concentration of target oligonucleotide over the range 0.5-500 pM. The detection limit is 0.5 pM in this experiment. In addition, the non-target oligonucleotide at concentrations of 10 pM and 10nM generated signals only slightly higher than background, indicating the high selectivity and specificity of this method. Different length of perfectly matched oligonucleotide targets at 10-mer, 15-mer and 20-mer were identified at the concentration of 150 pM. Copyright © 2012 Elsevier B.V. All rights reserved.

Recent progress on DNA based walkers.

PubMed

Pan, Jing; Li, Feiran; Cha, Tae-Gon; Chen, Haorong; Choi, Jong Hyun

2015-08-01

DNA based synthetic molecular walkers are reminiscent of biological protein motors. They are powered by hybridization with fuel strands, environment induced conformational transitions, and covalent chemistry of oligonucleotides. Recent developments in experimental techniques enable direct observation of individual walkers with high temporal and spatial resolution. The functionalities of state-of-the-art DNA walker systems can thus be analyzed for various applications. Herein we review recent progress on DNA walker principles and characterization methods, and evaluate various aspects of their functions for future applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

Near-field electromagnetic holography for high-resolution analysis of network interactions in neuronal tissue

PubMed Central

Kjeldsen, Henrik D.; Kaiser, Marcus; Whittington, Miles A.

2015-01-01

Background Brain function is dependent upon the concerted, dynamical interactions between a great many neurons distributed over many cortical subregions. Current methods of quantifying such interactions are limited by consideration only of single direct or indirect measures of a subsample of all neuronal population activity. New method Here we present a new derivation of the electromagnetic analogy to near-field acoustic holography allowing high-resolution, vectored estimates of interactions between sources of electromagnetic activity that significantly improves this situation. In vitro voltage potential recordings were used to estimate pseudo-electromagnetic energy flow vector fields, current and energy source densities and energy dissipation in reconstruction planes at depth into the neural tissue parallel to the recording plane of the microelectrode array. Results The properties of the reconstructed near-field estimate allowed both the utilization of super-resolution techniques to increase the imaging resolution beyond that of the microelectrode array, and facilitated a novel approach to estimating causal relationships between activity in neocortical subregions. Comparison with existing methods The holographic nature of the reconstruction method allowed significantly better estimation of the fine spatiotemporal detail of neuronal population activity, compared with interpolation alone, beyond the spatial resolution of the electrode arrays used. Pseudo-energy flow vector mapping was possible with high temporal precision, allowing a near-realtime estimate of causal interaction dynamics. Conclusions Basic near-field electromagnetic holography provides a powerful means to increase spatial resolution from electrode array data with careful choice of spatial filters and distance to reconstruction plane. More detailed approaches may provide the ability to volumetrically reconstruct activity patterns on neuronal tissue, but the ability to extract vectored data with the method presented already permits the study of dynamic causal interactions without bias from any prior assumptions on anatomical connectivity. PMID:26026581

Near-field electromagnetic holography for high-resolution analysis of network interactions in neuronal tissue.

PubMed

Kjeldsen, Henrik D; Kaiser, Marcus; Whittington, Miles A

2015-09-30

Brain function is dependent upon the concerted, dynamical interactions between a great many neurons distributed over many cortical subregions. Current methods of quantifying such interactions are limited by consideration only of single direct or indirect measures of a subsample of all neuronal population activity. Here we present a new derivation of the electromagnetic analogy to near-field acoustic holography allowing high-resolution, vectored estimates of interactions between sources of electromagnetic activity that significantly improves this situation. In vitro voltage potential recordings were used to estimate pseudo-electromagnetic energy flow vector fields, current and energy source densities and energy dissipation in reconstruction planes at depth into the neural tissue parallel to the recording plane of the microelectrode array. The properties of the reconstructed near-field estimate allowed both the utilization of super-resolution techniques to increase the imaging resolution beyond that of the microelectrode array, and facilitated a novel approach to estimating causal relationships between activity in neocortical subregions. The holographic nature of the reconstruction method allowed significantly better estimation of the fine spatiotemporal detail of neuronal population activity, compared with interpolation alone, beyond the spatial resolution of the electrode arrays used. Pseudo-energy flow vector mapping was possible with high temporal precision, allowing a near-realtime estimate of causal interaction dynamics. Basic near-field electromagnetic holography provides a powerful means to increase spatial resolution from electrode array data with careful choice of spatial filters and distance to reconstruction plane. More detailed approaches may provide the ability to volumetrically reconstruct activity patterns on neuronal tissue, but the ability to extract vectored data with the method presented already permits the study of dynamic causal interactions without bias from any prior assumptions on anatomical connectivity. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Milliarcsecond Astronomy with the CHARA Array

NASA Astrophysics Data System (ADS)

Schaefer, Gail; ten Brummelaar, Theo; Gies, Douglas; Jones, Jeremy; Farrington, Christopher

2018-01-01

The Center for High Angular Resolution Astronomy offers 50 nights per year of open access time at the CHARA Array. The Array consists of six telescopes linked together as an interferometer, providing sub-milliarcsecond resolution in the optical and near-infrared. The Array enables a variety of scientific studies, including measuring stellar angular diameters, imaging stellar shapes and surface features, mapping the orbits of close binary companions, and resolving circumstellar environments. The open access time is part of an NSF/MSIP funded program to open the CHARA Array to the broader astronomical community. As part of the program, we will build a searchable database for the CHARA data archive and run a series of one-day community workshops at different locations across the country to expand the user base for stellar interferometry and encourage new scientific investigations with the CHARA Array.

High resolution telescope

DOEpatents

Massie, Norbert A.; Oster, Yale

1992-01-01

A large effective-aperture, low-cost optical telescope with diffraction-limited resolution enables ground-based observation of near-earth space objects. The telescope has a non-redundant, thinned-aperture array in a center-mount, single-structure space frame. It employs speckle interferometric imaging to achieve diffraction-limited resolution. The signal-to-noise ratio problem is mitigated by moving the wavelength of operation to the near-IR, and the image is sensed by a Silicon CCD. The steerable, single-structure array presents a constant pupil. The center-mount, radar-like mount enables low-earth orbit space objects to be tracked as well as increases stiffness of the space frame. In the preferred embodiment, the array has elemental telescopes with subaperture of 2.1 m in a circle-of-nine configuration. The telescope array has an effective aperture of 12 m which provides a diffraction-limited resolution of 0.02 arc seconds. Pathlength matching of the telescope array is maintained by an electro-optical system employing laser metrology. Speckle imaging relaxes pathlength matching tolerance by one order of magnitude as compared to phased arrays. Many features of the telescope contribute to substantial reduction in costs. These include eliminating the conventional protective dome and reducing on-site construction activites. The cost of the telescope scales with the first power of the aperture rather than its third power as in conventional telescopes.

Time and space integrating acousto-optic folded spectrum processing for SETI

NASA Technical Reports Server (NTRS)

Wagner, K.; Psaltis, D.

1986-01-01

Time and space integrating folded spectrum techniques utilizing acousto-optic devices (AOD) as 1-D input transducers are investigated for a potential application as wideband, high resolution, large processing gain spectrum analyzers in the search for extra-terrestrial intelligence (SETI) program. The space integrating Fourier transform performed by a lens channels the coarse spectral components diffracted from an AOD onto an array of time integrating narrowband fine resolution spectrum analyzers. The pulsing action of a laser diode samples the interferometrically detected output, aliasing the fine resolution components to baseband, as required for the subsequent charge coupled devices (CCD) processing. The raster scan mechanism incorporated into the readout of the CCD detector array is used to unfold the 2-D transform, reproducing the desired high resolution Fourier transform of the input signal.

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

NASA Astrophysics Data System (ADS)

Liu, Qinghua

The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

A Specialized Multi-Transmit Head Coil for High Resolution fMRI of the Human Visual Cortex at 7T

PubMed Central

Sengupta, Shubharthi; Roebroeck, Alard; Kemper, Valentin G.; Poser, Benedikt A.; Zimmermann, Jan; Goebel, Rainer; Adriany, Gregor

2016-01-01

Purpose To design, construct and validate radiofrequency (RF) transmit and receive phased array coils for high-resolution visual cortex imaging at 7 Tesla. Methods A 4 channel transmit and 16 channel receive array was constructed on a conformal polycarbonate former. Transmit field efficiency and homogeneity were simulated and validated, along with the Specific Absorption Rate, using B1+ mapping techniques and electromagnetic simulations. Receiver signal-to-noise ratio (SNR), temporal SNR (tSNR) across EPI time series, g-factors for accelerated imaging and noise correlations were evaluated and compared with a commercial 32 channel whole head coil. The performance of the coil was further evaluated with human subjects through functional MRI (fMRI) studies at standard and submillimeter resolutions of upto 0.8mm isotropic. Results The transmit and receive sections were characterized using bench tests and showed good interelement decoupling, preamplifier decoupling and sample loading. SNR for the 16 channel coil was ∼ 1.5 times that of the commercial coil in the human occipital lobe, and showed better g-factor values for accelerated imaging. fMRI tests conducted showed better response to Blood Oxygen Level Dependent (BOLD) activation, at resolutions of 1.2mm and 0.8mm isotropic. Conclusion The 4 channel phased array transmit coil provides homogeneous excitation across the visual cortex, which, in combination with the dual row 16 channel receive array, makes for a valuable research tool for high resolution anatomical and functional imaging of the visual cortex at 7T. PMID:27911950

A High-throughput Assay for mRNA Silencing in Primary Cortical Neurons in vitro with Oligonucleotide Therapeutics.

PubMed

Alterman, Julia F; Coles, Andrew H; Hall, Lauren M; Aronin, Neil; Khvorova, Anastasia; Didiot, Marie-Cécile

2017-08-20

Primary neurons represent an ideal cellular system for the identification of therapeutic oligonucleotides for the treatment of neurodegenerative diseases. However, due to the sensitive nature of primary cells, the transfection of small interfering RNAs (siRNA) using classical methods is laborious and often shows low efficiency. Recent progress in oligonucleotide chemistry has enabled the development of stabilized and hydrophobically modified small interfering RNAs (hsiRNAs). This new class of oligonucleotide therapeutics shows extremely efficient self-delivery properties and supports potent and durable effects in vitro and in vivo . We have developed a high-throughput in vitro assay to identify and test hsiRNAs in primary neuronal cultures. To simply, rapidly, and accurately quantify the mRNA silencing of hundreds of hsiRNAs, we use the QuantiGene 2.0 quantitative gene expression assay. This high-throughput, 96-well plate-based assay can quantify mRNA levels directly from sample lysate. Here, we describe a method to prepare short-term cultures of mouse primary cortical neurons in a 96-well plate format for high-throughput testing of oligonucleotide therapeutics. This method supports the testing of hsiRNA libraries and the identification of potential therapeutics within just two weeks. We detail methodologies of our high throughput assay workflow from primary neuron preparation to data analysis. This method can help identify oligonucleotide therapeutics for treatment of various neurological diseases.

Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

PubMed

Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

2016-02-01

One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

Nucleic acid sequence detection using multiplexed oligonucleotide PCR

DOEpatents

Nolan, John P [Santa Fe, NM; White, P Scott [Los Alamos, NM

2006-12-26

Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

Impact of Improved Heat Sinking of an X-Ray Calorimeter Array on Crosstalk, Noise, and Background Events

NASA Technical Reports Server (NTRS)

Kilbourne, C. A.; Adams, J. S.; Brekosky, R. P.; Chervenak, J. A.; Chiao, M. P.; Kelley, R. L.; Kelly, D. P.; Porter, F. S.

2011-01-01

The x-ray calorimeter array of the Soft X-ray Spectrometer (SXS) of the Astro-H satellite will incorporate a silicon thermistor array produced during the development of the X-Ray Spectrometer (XRS) of the Suzaku satellite. On XRS, inadequate heat sinking of the array led to several non-ideal effects. The thermal crosstalk, while too small to be confused with x-ray signals, nonetheless contributed a noise term that could be seen as a degradation in energy resolution at high flux. When energy was deposited in the silicon frame around the active elements of the array, such as by a cosmic ray, the resulting pulse in the temperature of the frame resulted in coincident signal pulses on most of the pixels. In orbit, the resolution was found to depend on the particle background rate. In order to minimize these effects on SXS, heat-sinking gold was applied to areas on the front and back of the array die, which was thermally anchored to the gold of its fanout board via gold wire bonds. The thermal conductance from the silicon chip to the fanout board was improved over that of XRS by an order of magnitude. This change was sufficient for essentially eliminating frame events and allowing high-resolution to be attained at much higher counting rates. We will present the improved performance, the measured crosstalk, and the results of the thermal characterization of such arrays.

High Spatiotemporal Resolution ECoG Recording of Somatosensory Evoked Potentials with Flexible Micro-Electrode Arrays.

PubMed

Kaiju, Taro; Doi, Keiichi; Yokota, Masashi; Watanabe, Kei; Inoue, Masato; Ando, Hiroshi; Takahashi, Kazutaka; Yoshida, Fumiaki; Hirata, Masayuki; Suzuki, Takafumi

2017-01-01

Electrocorticogram (ECoG) has great potential as a source signal, especially for clinical BMI. Until recently, ECoG electrodes were commonly used for identifying epileptogenic foci in clinical situations, and such electrodes were low-density and large. Increasing the number and density of recording channels could enable the collection of richer motor/sensory information, and may enhance the precision of decoding and increase opportunities for controlling external devices. Several reports have aimed to increase the number and density of channels. However, few studies have discussed the actual validity of high-density ECoG arrays. In this study, we developed novel high-density flexible ECoG arrays and conducted decoding analyses with monkey somatosensory evoked potentials (SEPs). Using MEMS technology, we made 96-channel Parylene electrode arrays with an inter-electrode distance of 700 μm and recording site area of 350 μm 2 . The arrays were mainly placed onto the finger representation area in the somatosensory cortex of the macaque, and partially inserted into the central sulcus. With electrical finger stimulation, we successfully recorded and visualized finger SEPs with a high spatiotemporal resolution. We conducted offline analyses in which the stimulated fingers and intensity were predicted from recorded SEPs using a support vector machine. We obtained the following results: (1) Very high accuracy (~98%) was achieved with just a short segment of data (~15 ms from stimulus onset). (2) High accuracy (~96%) was achieved even when only a single channel was used. This result indicated placement optimality for decoding. (3) Higher channel counts generally improved prediction accuracy, but the efficacy was small for predictions with feature vectors that included time-series information. These results suggest that ECoG signals with high spatiotemporal resolution could enable greater decoding precision or external device control.

High Spatiotemporal Resolution ECoG Recording of Somatosensory Evoked Potentials with Flexible Micro-Electrode Arrays

PubMed Central

Kaiju, Taro; Doi, Keiichi; Yokota, Masashi; Watanabe, Kei; Inoue, Masato; Ando, Hiroshi; Takahashi, Kazutaka; Yoshida, Fumiaki; Hirata, Masayuki; Suzuki, Takafumi

2017-01-01

Electrocorticogram (ECoG) has great potential as a source signal, especially for clinical BMI. Until recently, ECoG electrodes were commonly used for identifying epileptogenic foci in clinical situations, and such electrodes were low-density and large. Increasing the number and density of recording channels could enable the collection of richer motor/sensory information, and may enhance the precision of decoding and increase opportunities for controlling external devices. Several reports have aimed to increase the number and density of channels. However, few studies have discussed the actual validity of high-density ECoG arrays. In this study, we developed novel high-density flexible ECoG arrays and conducted decoding analyses with monkey somatosensory evoked potentials (SEPs). Using MEMS technology, we made 96-channel Parylene electrode arrays with an inter-electrode distance of 700 μm and recording site area of 350 μm2. The arrays were mainly placed onto the finger representation area in the somatosensory cortex of the macaque, and partially inserted into the central sulcus. With electrical finger stimulation, we successfully recorded and visualized finger SEPs with a high spatiotemporal resolution. We conducted offline analyses in which the stimulated fingers and intensity were predicted from recorded SEPs using a support vector machine. We obtained the following results: (1) Very high accuracy (~98%) was achieved with just a short segment of data (~15 ms from stimulus onset). (2) High accuracy (~96%) was achieved even when only a single channel was used. This result indicated placement optimality for decoding. (3) Higher channel counts generally improved prediction accuracy, but the efficacy was small for predictions with feature vectors that included time-series information. These results suggest that ECoG signals with high spatiotemporal resolution could enable greater decoding precision or external device control. PMID:28442997

Global gene expression profiles of Phytophthora ramorum strain pr102 in response to plant host and tissue differentiation

Treesearch

Caroline M. Press; Niklaus J. Grunwald

2008-01-01

The release of the draft genome sequence of P. ramorum strain Pr102, enabled the construction of an oligonucleotide microarray of the entire genome of Pr102. The array contains 344,680 features (oligos) that represent the transcriptome of Pr102. P. ramorum RNA was extracted from mycelium and sporangia and used to compare gene...

Plasmodium Genus Assay Transition to the Joint Biological Agent Identification and Diagnostic System (JBAIDS)

DTIC Science & Technology

2012-07-12

readily transferable to diverse real-time PCR instrumentation. These assays are used regularly for vector surveillance and are the primary...instrumentation ( FilmArray ) is under assessment. Assay oligonucleotide sequences and formulations are available for use in future joint projects...Plasmodium real-time PCR detection capability has been challenging. During 2006, the Division of Entomology, WRAIR designed and developed a

Research on Geometric Calibration of Spaceborne Linear Array Whiskbroom Camera

PubMed Central

Sheng, Qinghong; Wang, Qi; Xiao, Hui; Wang, Qing

2018-01-01

The geometric calibration of a spaceborne thermal-infrared camera with a high spatial resolution and wide coverage can set benchmarks for providing an accurate geographical coordinate for the retrieval of land surface temperature. The practice of using linear array whiskbroom Charge-Coupled Device (CCD) arrays to image the Earth can help get thermal-infrared images of a large breadth with high spatial resolutions. Focusing on the whiskbroom characteristics of equal time intervals and unequal angles, the present study proposes a spaceborne linear-array-scanning imaging geometric model, whilst calibrating temporal system parameters and whiskbroom angle parameters. With the help of the YG-14—China’s first satellite equipped with thermal-infrared cameras of high spatial resolution—China’s Anyang Imaging and Taiyuan Imaging are used to conduct an experiment of geometric calibration and a verification test, respectively. Results have shown that the plane positioning accuracy without ground control points (GCPs) is better than 30 pixels and the plane positioning accuracy with GCPs is better than 1 pixel. PMID:29337885

Large depth high-precision FMCW tomography using a distributed feedback laser array

NASA Astrophysics Data System (ADS)

DiLazaro, Thomas; Nehmetallah, George

2018-02-01

Swept-source optical coherence tomography (SS-OCT) has been widely employed in the medical industry for the high resolution imaging of subsurface biological structures. SS-OCT typically exhibits axial resolutions on the order of tens of microns at speeds of hundreds of kilohertz. Using the same coherent heterodyne detection technique, frequency modulated continuous wave (FMCW) ladar has been used for highly precise ranging for distances up to kilometers. Distributed feedback lasers (DFBs) have been used as a simple and inexpensive source for FMCW ranging. Here, we use a bandwidth-combined DFB array for sub-surface volume imaging at a 27 μm axial resolution over meters of distance. 2D and 3D tomographic images of several semi-transparent and diffuse objects at distances up to 10 m will be presented.

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Flexible Organic Electronics for Use in Neural Sensing

PubMed Central

Bink, Hank; Lai, Yuming; Saudari, Sangameshwar R.; Helfer, Brian; Viventi, Jonathan; Van der Spiegel, Jan; Litt, Brian; Kagan, Cherie

2016-01-01

Recent research in brain-machine interfaces and devices to treat neurological disease indicate that important network activity exists at temporal and spatial scales beyond the resolution of existing implantable devices. High density, active electrode arrays hold great promise in enabling high-resolution interface with the brain to access and influence this network activity. Integrating flexible electronic devices directly at the neural interface can enable thousands of multiplexed electrodes to be connected using many fewer wires. Active electrode arrays have been demonstrated using flexible, inorganic silicon transistors. However, these approaches may be limited in their ability to be cost-effectively scaled to large array sizes (8×8 cm). Here we show amplifiers built using flexible organic transistors with sufficient performance for neural signal recording. We also demonstrate a pathway for a fully integrated, amplified and multiplexed electrode array built from these devices. PMID:22255558

A 30-MHz piezo-composite ultrasound array for medical imaging applications.

PubMed

Ritter, Timothy A; Shrout, Thomas R; Tutwiler, Rick; Shung, K Kirk

2002-02-01

Ultrasound imaging at frequencies above 20 MHz is capable of achieving improved resolution in clinical applications requiring limited penetration depth. High frequency arrays that allow real-time imaging are desired for these applications but are not yet currently available. In this work, a method for fabricating fine-scale 2-2 composites suitable for 30-MHz linear array transducers was successfully demonstrated. High thickness coupling, low mechanical loss, and moderate electrical loss were achieved. This piezo-composite was incorporated into a 30-MHz array that included acoustic matching, an elevation focusing lens, electrical matching, and an air-filled kerf between elements. Bandwidths near 60%, 15-dB insertion loss, and crosstalk less than -30 dB were measured. Images of both a phantom and an ex vivo human eye were acquired using a synthetic aperture reconstruction method, resulting in measured lateral and axial resolutions of approximately 100 microm.

Method and apparatus for combinatorial chemistry

DOEpatents

Foote, Robert S.

2007-02-20

A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

Method and apparatus for combinatorial chemistry

DOEpatents

Foote, Robert S [Oak Ridge, TN

2012-06-05

A method and apparatus are provided for performing light-directed reactions in spatially addressable channels within a plurality of channels. One aspect of the invention employs photoactivatable reagents in solutions disposed into spatially addressable flow streams to control the parallel synthesis of molecules immobilized within the channels. The reagents may be photoactivated within a subset of channels at the site of immobilized substrate molecules or at a light-addressable site upstream from the substrate molecules. The method and apparatus of the invention find particularly utility in the synthesis of biopolymer arrays, e.g., oligonucleotides, peptides and carbohydrates, and in the combinatorial synthesis of small molecule arrays for drug discovery.

Patterning pallet arrays for cell selection based on high-resolution measurements of fluorescent biosensors

PubMed Central

Shadpour, Hamed; Zawistowski, Jon S.; Herman, Annadele; Hahn, Klaus; Allbritton, Nancy L.

2011-01-01

Pallet arrays enable cells to be separated while they remain adherent to a surface and provide a much greater range of cell selection criteria relative to that of current technologies. However there remains a need to further broaden cell selection criteria to include dynamic intracellular signaling events. To demonstrate the feasibility of measuring cellular protein behavior on the arrays using high resolution microscopy, the surfaces of individual pallets were modified to minimize the impact of scattered light at the pallet edges. The surfaces of the three-dimensional pallets on an array were patterned with a coating such as fibronectin using a customized stamping tool. Micropatterns of varying shape and size were printed in designated regions on the pallets in single or multiple steps to demonstrate the reliability and precision of patterning molecules on the pallet surface. Use of a fibronectin matrix stamped at the center of each pallet permitted the localization of H1299 and mouse embryonic fibroblast (MEF) cells to the pallet centers and away from the edges. Compared to pallet arrays with fibronection coating the entire top surface, arrays with a central fibronectin pattern increased the percentage of cells localized to the pallet center by 3-4 fold. Localization of cells to the pallet center also enabled the physical separation of cells from optical artifacts created by the rough pallet side walls. To demonstrate the measurement of dynamic intracellular signaling on the arrays, fluorescence measurements of high spatial resolution were performed using a RhoA GTPase biosensor. This biosensor utilized fluorescence resonance energy transfer (FRET) between cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) to measure localized RhoA activity in cellular ruffles at the cell periphery. These results demonstrated the ability to perform spatially resolved measurements of fluorescence-based sensors on the pallet arrays. Thus, the patterned pallet arrays should enable novel cell separations in which cell selection is based on complex cellular signaling properties. PMID:21621038

A dynamic bead-based microarray for parallel DNA detection

NASA Astrophysics Data System (ADS)

Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

2011-05-01

A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

A 2D/3D hybrid integral imaging display by using fast switchable hexagonal liquid crystal lens array

NASA Astrophysics Data System (ADS)

Lee, Hsin-Hsueh; Huang, Ping-Ju; Wu, Jui-Yi; Hsieh, Po-Yuan; Huang, Yi-Pai

2017-05-01

The paper proposes a new display which could switch 2D and 3D images on a monitor, and we call it as Hybrid Display. In 3D display technologies, the reduction of image resolution is still an important issue. The more angle information offer to the observer, the less spatial resolution would offer to image resolution because of the fixed panel resolution. Take it for example, in the integral photography system, the part of image without depth, like background, will reduce its resolution by transform from 2D to 3D image. Therefore, we proposed a method by using liquid crystal component to quickly switch the 2D image and 3D image. Meanwhile, the 2D image is set as a background to compensate the resolution.. In the experiment, hexagonal liquid crystal lens array would be used to take the place of fixed lens array. Moreover, in order to increase lens power of the hexagonal LC lens array, we applied high resistance (Hi-R) layer structure on the electrode. Hi-R layer would make the gradient electric field and affect the lens profile. Also, we use panel with 801 PPI to display the integral image in our system. Hence, the consequence of full resolution 2D background with the 3D depth object forms the Hybrid Display.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Ultrasound Imaging Using Diffraction Tomography in a Cylindrical Geometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chambers, D H; Littrup, P

2002-01-24

Tomographic images of tissue phantoms and a sample of breast tissue have been produced from an acoustic synthetic array system for frequencies near 500 kHz. The images for sound speed and attenuation show millimeter resolution and demonstrate the feasibility of obtaining high-resolution tomographic images with frequencies that can deeply penetrate tissue. The image reconstruction method is based on the Born approximation to acoustic scattering and is a simplified version of a method previously used by Andre (Andre, et. al., Int. J. Imaging Systems and Technology, Vol 8, No. 1, 1997) for a circular acoustic array system. The images have comparablemore » resolution to conventional ultrasound images at much higher frequencies (3-5 MHz) but with lower speckle noise. This shows the potential of low frequency, deeply penetrating, ultrasound for high-resolution quantitative imaging.« less

Ultrasensitive sliver nanorods array SERS sensor for mercury ions.

PubMed

Song, Chunyuan; Yang, Boyue; Zhu, Yu; Yang, Yanjun; Wang, Lianhui

2017-01-15

With years of outrageous mercury emissions, there is an urgent need to develop convenient and sensitive methods for detecting mercury ions in response to increasingly serious mercury pollution in water. In the present work, a portable, ultrasensitive SERS sensor is proposed and utilized for detecting trace mercury ions in water. The SERS sensor is prepared on an excellent sliver nanorods array SERS substrate by immobilizing T-component oligonucleotide probes labeled with dye on the 3'-end and -SH on the 5'-end. The SERS sensor responses to the specific chemical bonding between thymine and mercury ions, which causes the previous flexible single strand of oligonucleotide probe changing into rigid and upright double chain structure. Such change in the structure drives the dyes far away from the excellent SERS substrate and results in a SERS signal attenuation of the dye. Therefore, by monitoring the decay of SERS signal of the dye, mercury ions in water can be detected qualitatively and quantitatively. The experimental results indicate that the proposed optimal SERS sensor owns a linear response with wide detecting range from 1pM to 1μM, and a detection limit of 0.16pM is obtained. In addition, the SERS sensor demonstrates good specificity for Hg 2+ , which can accurately identify trace mercury ions from a mixture of ten kinds of other ions. The SERS sensor has been further executed to analyze the trace mercury ions in tap water and lake water respectively, and good recovery rates are obtained for sensing both kinds of water. With its high selectivity and good portability, the ultrasensitive SERS sensor is expected to be a promising candidate for discriminating mercury ions in the fields of environmental monitoring and food safety. Copyright © 2016 Elsevier B.V. All rights reserved.

High-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor array

NASA Astrophysics Data System (ADS)

Guss, Paul; Rabin, Michael; Croce, Mark; Hoteling, Nathan; Schwellenbach, David; Kruschwitz, Craig; Mocko, Veronika; Mukhopadhyay, Sanjoy

2017-09-01

We demonstrate very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor (TES) array. The readout circuit consists of superconducting microwave resonators coupled to radio frequency superconducting-quantum-interference devices (RF-SQUIDs) and transduces changes in input current to changes in phase of a microwave signal. We used a flux-ramp modulation to linearize the response and avoid low-frequency noise. The result is a very high-resolution photon spectroscopy with a microwave-multiplexed 4-pixel transition edge sensor array. We performed and validated a small-scale demonstration and test of all the components of our concept system, which encompassed microcalorimetry, microwave multiplexing, RF-SQUIDs, and software-defined radio (SDR). We shall display data we acquired in the first simultaneous combination of all key innovations in a 4-pixel demonstration, including microcalorimetry, microwave multiplexing, RF-SQUIDs, and SDR. We present the energy spectrum of a gadolinium-153 (153Gd) source we measured using our 4-pixel TES array and the RF-SQUID multiplexer. For each pixel, one can observe the two 97.4 and 103.2 keV photopeaks. We measured the 153Gd photon source with an achieved energy resolution of 70 eV, full width half maximum (FWHM) at 100 keV, and an equivalent readout system noise of 90 pA/pHz at the TES. This demonstration establishes a path for the readout of cryogenic x-ray and gamma ray sensor arrays with more elements and spectral resolving powers. We believe this project has improved capabilities and substantively advanced the science useful for missions such as nuclear forensics, emergency response, and treaty verification through the explored TES developments.

MALDI MS analysis of oligonucleotides: desalting by functional magnetite beads using microwave-assisted extraction.

PubMed

Chen, Wei-Yu; Chen, Yu-Chie

2007-11-01

The presence of alkali cation adductions of oligonucleotides commonly deteriorates matrix-assisted laser desorption/ionization (MALDI) mass spectra. Thus, desalting is required for oligonucleotide samples prior to MALDI MS analysis in order to prevent the mass spectra from developing poor quality. In this paper, we demonstrate a new approach to extract traces of oligonucleotides from aqueous solutions containing high concentrations of salts using microwave-assisted extraction. The C18-presenting magnetite beads, capable of absorbing microwave irradiation, are used as affinity probes for oligonucleotides with the addition of triethylammonium acetate as the counterions. This new microwave-assisted extraction approach using magnetite beads as the trapping agents and as microwave-absorbers has been demonstrated to be very effective in the selective binding of oligonucleotides from aqueous solutions. The extraction of oligonucleotides from solutions onto the C18-presenting magnetite beads takes only 30 s to enrich oligonucleotides in sufficient quantities for MALDI MS analysis. After using this desalting approach, alkali cation adductions of oligonucleotides are dramatically reduced in the MALDI mass spectra. The presence of saturated NaCl (approximately 6 M) in the oligonucleotide sample is tolerated without degrading the mass spectra. The detection limit for d(A)6 is approximately 2.8 fmol.

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Programmable DNA scaffolds for spatially-ordered protein assembly

NASA Astrophysics Data System (ADS)

Chandrasekaran, Arun Richard

2016-02-01

Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed.Ever since the notion of using DNA as a material was realized, it has been employed in the construction of complex structures that facilitate the assembly of nanoparticles or macromolecules with nanometer-scale precision. Specifically, tiles fashioned from DNA strands and DNA origami sheets have been shown to be suitable as scaffolds for immobilizing proteins with excellent control over their spatial positioning. Supramolecular assembly of proteins into periodic arrays in one or more dimensions is one of the most challenging aspects in the design of scaffolds for biomolecular investigations and macromolecular crystallization. This review provides a brief overview of how various biomolecular interactions with high degree of specificity such as streptavidin-biotin, antigen-antibody, and aptamer-protein interactions have been used to fabricate linear and multidimensional assemblies of structurally intact and functional proteins. The use of DNA-binding proteins as adaptors, polyamide recognition on DNA scaffolds and oligonucleotide linkers for protein assembly are also discussed. Dedicated to my advisor Ned Seeman on the occasion of his 70th birthday.

Effects of 1-MeV gamma radiation on a multi-anode microchannel array detector tube

NASA Technical Reports Server (NTRS)

Timothy, J. G.; Bybee, R. L.

1979-01-01

A multianode microchannel array (MAMA) detector tube without a photocathode was exposed to a total dose of 1,000,000 rads of 1-MeV gamma radiation from a Co-60 source. The high-voltage characteristic of the microchannel array plate, average dark count, gain, and resolution of pulse height distribution characteristics showed no degradation after this total dose. In fact, the degassing of the microchannels induced by the high radiation flux had the effect of cleaning up the array plate and improving its characteristics.

High resolution telescope including an array of elemental telescopes aligned along a common axis and supported on a space frame with a pivot at its geometric center

DOEpatents

Norbert, M.A.; Yale, O.

1992-04-28

A large effective-aperture, low-cost optical telescope with diffraction-limited resolution enables ground-based observation of near-earth space objects. The telescope has a non-redundant, thinned-aperture array in a center-mount, single-structure space frame. It employes speckle interferometric imaging to achieve diffraction-limited resolution. The signal-to-noise ratio problem is mitigated by moving the wavelength of operation to the near-IR, and the image is sensed by a Silicon CCD. The steerable, single-structure array presents a constant pupil. The center-mount, radar-like mount enables low-earth orbit space objects to be tracked as well as increases stiffness of the space frame. In the preferred embodiment, the array has elemental telescopes with subaperture of 2.1 m in a circle-of-nine configuration. The telescope array has an effective aperture of 12 m which provides a diffraction-limited resolution of 0.02 arc seconds. Pathlength matching of the telescope array is maintained by a electro-optical system employing laser metrology. Speckle imaging relaxes pathlength matching tolerance by one order of magnitude as compared to phased arrays. Many features of the telescope contribute to substantial reduction in costs. These include eliminating the conventional protective dome and reducing on-site construction activities. The cost of the telescope scales with the first power of the aperture rather than its third power as in conventional telescopes. 15 figs.

High resolution telescope including an array of elemental telescopes aligned along a common axis and supported on a space frame with a pivot at its geometric center

DOEpatents

Norbert, Massie A.; Yale, Oster

1992-01-01

A large effective-aperture, low-cost optical telescope with diffraction-limited resolution enables ground-based observation of near-earth space objects. The telescope has a non-redundant, thinned-aperture array in a center-mount, single-structure space frame. It employes speckle interferometric imaging to achieve diffraction-limited resolution. The signal-to-noise ratio problem is mitigated by moving the wavelength of operation to the near-IR, and the image is sensed by a Silicon CCD. The steerable, single-structure array presents a constant pupil. The center-mount, radar-like mount enables low-earth orbit space objects to be tracked as well as increases stiffness of the space frame. In the preferred embodiment, the array has elemental telescopes with subaperture of 2.1 m in a circle-of-nine configuration. The telescope array has an effective aperture of 12 m which provides a diffraction-limited resolution of 0.02 arc seconds. Pathlength matching of the telescope array is maintained by a electro-optical system employing laser metrology. Speckle imaging relaxes pathlength matching tolerance by one order of magnitude as compared to phased arrays. Many features of the telescope contribute to substantial reduction in costs. These include eliminating the conventional protective dome and reducing on-site construction activities. The cost of the telescope scales with the first power of the aperture rather than its third power as in conventional telescopes.

NaI(Tl) scintillator read out with SiPM array for gamma spectrometer

NASA Astrophysics Data System (ADS)

Huang, Tuchen; Fu, Qibin; Lin, Shaopeng; Wang, Biao

2017-04-01

The NaI(Tl) scintillator is widely used in gamma spectrometer with photomultiplier tube (PMT) readout. Recently developed silicon photomultiplier (SiPM) offers gain and efficiency similar to those of PMT, but with merits such as low bias voltage, compact volume, low cost, high ruggedness and magnetic resonance compatibility. In this study, 2-in. and 1-in. NaI(Tl) scintillators were readout with SiPM arrays, which were made by tiling multiple SiPMs each with an active area of 6×6 mm2 on a printed circuit board. The energy resolutions for 661.6 keV gamma rays, obtained with Φ2×2 in. scintillator coupled to 6×6 ch SiPM array and Φ1×1 in. scintillator coupled to 4×4 ch SiPM array were 7.6% and 7.8%, respectively, and were very close to the results obtained with traditional bialkali PMT (7.3% and 7.6%, respectively). Scintillator coupled to photodetector with smaller area was also studied by adding a light guide or using scintillator with tapered head. The latter showed better performance than using light guide. The 1-in. NaI(Tl) scintillator with tapered head coupled to 2×2 ch SiPM array achieved 7.7% energy resolution at 661.6 keV, the same as that obtained with standard Φ1×1 in. scintillator coupled to 4×4 ch SiPM array. While the 2-in. scintillator with similar geometry showed degraded energy resolution, 10.2% at 661.6 keV, but could still be used when high efficiency is preferred over energy resolution.

Flexible Neural Electrode Array Based-on Porous Graphene for Cortical Microstimulation and Sensing

NASA Astrophysics Data System (ADS)

Lu, Yichen; Lyu, Hongming; Richardson, Andrew G.; Lucas, Timothy H.; Kuzum, Duygu

2016-09-01

Neural sensing and stimulation have been the backbone of neuroscience research, brain-machine interfaces and clinical neuromodulation therapies for decades. To-date, most of the neural stimulation systems have relied on sharp metal microelectrodes with poor electrochemical properties that induce extensive damage to the tissue and significantly degrade the long-term stability of implantable systems. Here, we demonstrate a flexible cortical microelectrode array based on porous graphene, which is capable of efficient electrophysiological sensing and stimulation from the brain surface, without penetrating into the tissue. Porous graphene electrodes show superior impedance and charge injection characteristics making them ideal for high efficiency cortical sensing and stimulation. They exhibit no physical delamination or degradation even after 1 million biphasic stimulation cycles, confirming high endurance. In in vivo experiments with rodents, same array is used to sense brain activity patterns with high spatio-temporal resolution and to control leg muscles with high-precision electrical stimulation from the cortical surface. Flexible porous graphene array offers a minimally invasive but high efficiency neuromodulation scheme with potential applications in cortical mapping, brain-computer interfaces, treatment of neurological disorders, where high resolution and simultaneous recording and stimulation of neural activity are crucial.

"Phoswich Wall": A charged-particle detector array for inverse-kinematic reactions with the Gretina/GRETA γ-ray arrays

NASA Astrophysics Data System (ADS)

Sarantites, D. G.; Reviol, W.; Elson, J. M.; Kinnison, J. E.; Izzo, C. J.; Manfredi, J.; Liu, J.; Jung, H. S.; Goerres, J.

2015-08-01

A high-efficiency, forward-hemisphere detector system for light charged particles and low-Z heavy ions, as obtained in an accelerator experiment, is described. It consists of four 8×8 pixel multianode photomultiplier tubes with 2.2-mm thick CsI(Tl) and 12 -μm thick fast-plastic scintillation detectors. Its phoswich structure allows individual Z resolution for 1H, 4He, 7Li, 4He+4He, 9Be, 11B, 12C, and 14N ions, which are target-like fragments detected in strongly inverse kinematics. The device design has been optimized for use with a 4π γ-ray array, and the main applications are transfer reactions and Coulomb excitation. A high-angular resolution for the detection of the target-like fragments is achieved which permits angular distributions to be measured in the rest frame of the projectile-like fragment with a resolution of ~ 2 °.

High resolution photolithography using arrays of polystyrene and SiO2 micro- and nano-sized spherical lenses

NASA Astrophysics Data System (ADS)

Dvoretckaia, L. N.; Mozharov, A. M.; Mukhin, I. S.

2017-11-01

Photolithography mask made of close-packed array of micro- and nano-sized spherical lenses allows to obtain the ordered structures and provides highest “optical resolution/cost” ratio between all existing photolithography and laser direct writing methods. In this letter, we present results of modeling the propagation of a plane wave falling on the array of quartz (SiO2) microspherical lenses and focusing in the image reverse photoresist layer. We present here experimental results on fabrication of ordered arrays of submicron wells and columns and substrate preparation for growth of monocrystalline nanowires on metal surface using photolithography with mask of SiO2 microspheres. Such ordered nano-sized arrays of wells and columns can be used in fabrication of further growth of monocrystalline nanowires, quantum dots and production of plasmon structures.

arrayCGHbase: an analysis platform for comparative genomic hybridization microarrays

PubMed Central

Menten, Björn; Pattyn, Filip; De Preter, Katleen; Robbrecht, Piet; Michels, Evi; Buysse, Karen; Mortier, Geert; De Paepe, Anne; van Vooren, Steven; Vermeesch, Joris; Moreau, Yves; De Moor, Bart; Vermeulen, Stefan; Speleman, Frank; Vandesompele, Jo

2005-01-01

Background The availability of the human genome sequence as well as the large number of physically accessible oligonucleotides, cDNA, and BAC clones across the entire genome has triggered and accelerated the use of several platforms for analysis of DNA copy number changes, amongst others microarray comparative genomic hybridization (arrayCGH). One of the challenges inherent to this new technology is the management and analysis of large numbers of data points generated in each individual experiment. Results We have developed arrayCGHbase, a comprehensive analysis platform for arrayCGH experiments consisting of a MIAME (Minimal Information About a Microarray Experiment) supportive database using MySQL underlying a data mining web tool, to store, analyze, interpret, compare, and visualize arrayCGH results in a uniform and user-friendly format. Following its flexible design, arrayCGHbase is compatible with all existing and forthcoming arrayCGH platforms. Data can be exported in a multitude of formats, including BED files to map copy number information on the genome using the Ensembl or UCSC genome browser. Conclusion ArrayCGHbase is a web based and platform independent arrayCGH data analysis tool, that allows users to access the analysis suite through the internet or a local intranet after installation on a private server. ArrayCGHbase is available at . PMID:15910681

Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

PubMed

Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

2000-06-01

Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

Performance evaluation of a novel high performance pinhole array detector module using NEMA NU-4 image quality phantom for four head SPECT Imaging

NASA Astrophysics Data System (ADS)

Rahman, Tasneem; Tahtali, Murat; Pickering, Mark R.

2015-03-01

Radiolabeled tracer distribution imaging of gamma rays using pinhole collimation is considered promising for small animal imaging. The recent availability of various radiolabeled tracers has enhanced the field of diagnostic study and is simultaneously creating demand for high resolution imaging devices. This paper presents analyses to represent the optimized parameters of a high performance pinhole array detector module using two different characteristics phantoms. Monte Carlo simulations using the Geant4 application for tomographic emission (GATE) were executed to assess the performance of a four head SPECT system incorporated with pinhole array collimators. The system is based on a pixelated array of NaI(Tl) crystals coupled to an array of position sensitive photomultiplier tubes (PSPMTs). The detector module was simulated to have 48 mm by 48 mm active area along with different pinhole apertures on a tungsten plate. The performance of this system has been evaluated using a uniform shape cylindrical water phantom along with NEMA NU-4 image quality (IQ) phantom filled with 99mTc labeled radiotracers. SPECT images were reconstructed where activity distribution is expected to be well visualized. This system offers the combination of an excellent intrinsic spatial resolution, good sensitivity and signal-to-noise ratio along with high detection efficiency over an energy range between 20-160 keV. Increasing number of heads in a stationary system configuration offers increased sensitivity at a spatial resolution similar to that obtained with the current SPECT system design with four heads.

The Atacama Cosmology Telescope: The Polarization-Sensitive ACTPol Instrument

NASA Technical Reports Server (NTRS)

Thornton, R. J.; Ade, P. A. R.; Aiola, S.; Angile, F. E.; Amiri, M.; Beall, J. A.; Becker, D. T.; Cho, H.-M.; Choi, S. K.; Corlies, P.;

The Atacama Cosmology Telescope: The Polarization-sensitive ACTPol Instrument

NASA Astrophysics Data System (ADS)

Thornton, R. J.; Ade, P. A. R.; Aiola, S.; Angilè, F. E.; Amiri, M.; Beall, J. A.; Becker, D. T.; Cho, H.-M.; Choi, S. K.; Corlies, P.; Coughlin, K. P.; Datta, R.; Devlin, M. J.; Dicker, S. R.; Dünner, R.; Fowler, J. W.; Fox, A. E.; Gallardo, P. A.; Gao, J.; Grace, E.; Halpern, M.; Hasselfield, M.; Henderson, S. W.; Hilton, G. C.; Hincks, A. D.; Ho, S. P.; Hubmayr, J.; Irwin, K. D.; Klein, J.; Koopman, B.; Li, Dale; Louis, T.; Lungu, M.; Maurin, L.; McMahon, J.; Munson, C. D.; Naess, S.; Nati, F.; Newburgh, L.; Nibarger, J.; Niemack, M. D.; Niraula, P.; Nolta, M. R.; Page, L. A.; Pappas, C. G.; Schillaci, A.; Schmitt, B. L.; Sehgal, N.; Sievers, J. L.; Simon, S. M.; Staggs, S. T.; Tucker, C.; Uehara, M.; van Lanen, J.; Ward, J. T.; Wollack, E. J.

2016-12-01

The Atacama Cosmology Telescope (ACT) makes high angular resolution measurements of anisotropies in the Cosmic Microwave Background (CMB) at millimeter wavelengths. We describe ACTPol, an upgraded receiver for ACT, which uses feedhorn-coupled, polarization-sensitive detector arrays, a 3° field of view, 100 mK cryogenics with continuous cooling, and meta material antireflection coatings. ACTPol comprises three arrays with separate cryogenic optics: two arrays at a central frequency of 148 GHz and one array operating simultaneously at both 97 GHz and 148 GHz. The combined instrument sensitivity, angular resolution, and sky coverage are optimized for measuring angular power spectra, clusters via the thermal Sunyaev–Zel’dovich (SZ) and kinetic SZ signals, and CMB lensing due to large-scale structure. The receiver was commissioned with its first 148 GHz array in 2013, observed with both 148 GHz arrays in 2014, and has recently completed its first full season of operations with the full suite of three arrays. This paper provides an overview of the design and initial performance of the receiver and related systems.

The Astronomical Low Frequency Array: A Proposed Explorer Mission for Radio Astronomy

NASA Technical Reports Server (NTRS)

Jones, D.; Allen, R.; Basart, J.; Bastian, T.; Bougeret, J. L.; Dennison, B.; Desch, M.; Dwarakanath, K.; Erickson, W.; Finley, D.;

A Two-dimensional Sixteen Channel Transmit/Receive Coil Array for Cardiac MRI at 7.0 Tesla: Design, Evaluation and Application

PubMed Central

Thalhammer, Christof; Renz, Wolfgang; Winter, Lukas; Hezel, Fabian; Rieger, Jan; Pfeiffer, Harald; Graessl, Andreas; Seifert, Frank; Hoffmann, Werner; von Knobelsdorff-Brenkenhoff, Florian; Tkachenko, Valeriy; Schulz-Menger, Jeanette; Kellman, Peter; Niendorf, Thoralf

2012-01-01

Purpose To design, evaluate and apply a two-dimensional 16 channel transmit/receive coil array tailored for cardiac MRI at 7.0 Tesla. Material and Methods The cardiac coil array consists of 2 sections each using 8 elements arranged in a 2 × 4 array. RF safety was validated by SAR simulations. Cardiac imaging was performed using 2D CINE FLASH imaging, T2* mapping and fat-water separation imaging. The characteristics of the coil array were analyzed including parallel imaging performance, left ventricular chamber quantification and overall image quality. Results RF characteristics were found to be appropriate for all subjects included in the study. The SAR values derived from the simulations fall well in the limits of legal guidelines. The baseline SNR advantage at 7.0 T was put to use to acquire 2D CINE images of the heart with a very high spatial resolution of (1 × 1 × 4) mm3. The proposed coil array supports 1D acceleration factors of up to R=4 without impairing image quality significantly. Conclusions The 16 channel TX/RX coil has the capability to acquire high contrast and high spatial resolution images of the heart at 7.0 Tesla. PMID:22706727

Research relative to high energy astrophysics. [large area modular array of reflectors, X-ray spectroscopy, and thermal control

NASA Technical Reports Server (NTRS)

Gorenstein, P.

1984-01-01

Various parameters which affect the design of the proposed large area modular array of reflectors (LAMAR) are considered, including thermal control, high resolution X-ray spectroscopy, pointing control, and mirror performance. The LAMAR instrument is to be a shuttle-launched X-ray observatory to carry out cosmic X-ray investigations. The capabilities of LAMAR are enumerated. Angular resolution performance of the mirror module prototype was measured to be 30 sec of ARC for 50% of the power. The LAMAR thermal pre-collimator design concepts and test configurations are discussed in detail.

A monocrystal graphene domain biosensor array with differential output for real-time monitoring of glucose and normal saline.

PubMed

Shi, Junjie; Li, Xin; Chen, Qian; Gao, Kun; Song, Hui; Guo, Shixi; Li, Quanfu; Fang, Ming; Liu, Weihua; Liu, Hongzhong; Wang, Xiaoli

2015-05-07

A biosensor array with differential output based on a monocrystal graphene domain is proposed to realize high resolution measurements. The differential output structure can eliminate the noise that comes from graphene crystal orientation and grain boundary, as well as the fluctuation that comes from the contact resistance and experiment process, so as to improve resolution in the lower concentration. We have fabricated a high quality monocrystal graphene domain that has millimeter size by the chemical vapor deposition method. Two identical graphene ribbons that are cut from the same domain are used as field effect transistor source-to-drain channels for the reference and the test of differential output, respectively. The experimental results show that the source-to-drain current has a fast response shorter than 0.5 second in glucose, normal saline and pH buffer solutions of different concentrations. Sensitivity increases exponentially with the increase of concentration of the tested liquid and the high resolution range is 0.01-2 wt% in glucose and 0.0009-0.018 wt% in saline, and the highest resolutions of glucose and saline are 0.01 wt% and 0.0009 wt%, respectively. We have fabricated a 1 × 4 array structure with differential outputs that pave the way for rapidly detecting ultra-low concentration of analytes.

A Compressed Sensing Based Method for Reducing the Sampling Time of A High Resolution Pressure Sensor Array System

PubMed Central

Sun, Chenglu; Li, Wei; Chen, Wei

2017-01-01

For extracting the pressure distribution image and respiratory waveform unobtrusively and comfortably, we proposed a smart mat which utilized a flexible pressure sensor array, printed electrodes and novel soft seven-layer structure to monitor those physiological information. However, in order to obtain high-resolution pressure distribution and more accurate respiratory waveform, it needs more time to acquire the pressure signal of all the pressure sensors embedded in the smart mat. In order to reduce the sampling time while keeping the same resolution and accuracy, a novel method based on compressed sensing (CS) theory was proposed. By utilizing the CS based method, 40% of the sampling time can be decreased by means of acquiring nearly one-third of original sampling points. Then several experiments were carried out to validate the performance of the CS based method. While less than one-third of original sampling points were measured, the correlation degree coefficient between reconstructed respiratory waveform and original waveform can achieve 0.9078, and the accuracy of the respiratory rate (RR) extracted from the reconstructed respiratory waveform can reach 95.54%. The experimental results demonstrated that the novel method can fit the high resolution smart mat system and be a viable option for reducing the sampling time of the pressure sensor array. PMID:28796188

High spectral resolution studies of gamma ray bursts on new missions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desai, U. D.; Acuna, M. H.; Cline, T. L.

1996-08-01

Two new missions will be launched in 1996 and 1997, each carrying X-ray and gamma ray detectors capable of high spectral resolution at room temperature. The Argentine Satelite de Aplicaciones Cientificas (SAC-B) and the Small Spacecraft Technology Initiative (SSTI) Clark missions will each carry several arrays of X-ray detectors primarily intended for the study of solar flares and gamma-ray bursts. Arrays of small (1 cm{sup 2}) cadmium zinc telluride (CZT) units will provide x-ray measurements in the 10 to 80 keV range with an energy resolution of {approx_equal}6 keV. Arrays of both silicon avalanche photodiodes (APD) and P-intrinsic-N (PIN) photodiodesmore » (for the SAC-B mission only) will provide energy coverage from 2-25 keV with {approx_equal}1 keV resolution. For SAC-B, higher energy spectral data covering the 30-300 keV energy range will be provided by CsI(Tl) scintillators coupled to silicon APDs, resulting in similar resolution but greater simplicity relative to conventional CsI/PMT systems. Because of problems with the Pegasus launch vehicle, the launch of SAC-B has been delayed until 1997. The launch of the SSTI Clark mission is scheduled for June 1996.« less

Context dependent anti-aliasing image reconstruction

NASA Technical Reports Server (NTRS)

Beaudet, Paul R.; Hunt, A.; Arlia, N.

1989-01-01

Image Reconstruction has been mostly confined to context free linear processes; the traditional continuum interpretation of digital array data uses a linear interpolator with or without an enhancement filter. Here, anti-aliasing context dependent interpretation techniques are investigated for image reconstruction. Pattern classification is applied to each neighborhood to assign it a context class; a different interpolation/filter is applied to neighborhoods of differing context. It is shown how the context dependent interpolation is computed through ensemble average statistics using high resolution training imagery from which the lower resolution image array data is obtained (simulation). A quadratic least squares (LS) context-free image quality model is described from which the context dependent interpolation coefficients are derived. It is shown how ensembles of high-resolution images can be used to capture the a priori special character of different context classes. As a consequence, a priori information such as the translational invariance of edges along the edge direction, edge discontinuity, and the character of corners is captured and can be used to interpret image array data with greater spatial resolution than would be expected by the Nyquist limit. A Gibb-like artifact associated with this super-resolution is discussed. More realistic context dependent image quality models are needed and a suggestion is made for using a quality model which now is finding application in data compression.

Improved 2-D resistivity imaging of features in covered karst terrain with arrays of implanted electrodes

NASA Astrophysics Data System (ADS)

Kiflu, H. G.; Kruse, S. E.; Harro, D.; Loke, M. H.; Wilkinson, P. B.

2013-12-01

Electrical resistivity tomography is commonly used to identify geologic features associated with sinkhole formation. In covered karst terrain, however, it can be difficult to resolve the depth to top of limestone with this method. This is due to the fact that array lengths, and hence depth of resolution, are often limited by residential or commercial lot dimensions in urban environments. Furthermore, the sediments mantling the limestone are often clay-rich and highly conductive. The resistivity method has limited sensitivity to resistive zones beneath conductive zones. This sensitivity can be improved significantly with electrodes implanted at depth in the cover sediments near the top of limestone. An array of deep electrodes is installed with direct push technology in the karst cover. When combined with a surface array in which each surface electrode is underlain by a deep electrode, the array geometry is similar to a borehole array turned on its side. This method, called the Multi-Electrode Resistivity Implant Technique (MERIT), offers the promise of significantly improved resolution of epikarst and cover collapse development zones in the overlying sediment, the limestone or at the sediment-bedrock interface in heterogeneous karst environments. With a non-traditional array design, the question of optimal array geometries arises. Optimizing array geometries is complicated by the fact that many plausible 4-electrode readings will produce negative apparent resistivity values, even in homogeneous terrain. Negative apparent resistivities cannot be used in inversions based on the logarithm of the apparent resistivity. New algorithms for seeking optimal array geometries have been developed by modifying the 'Compare R' method of Wilkinson and Loke. The optimized arrays show significantly improved resolution over basic arrays adapted from traditional 2D surface geometries. Several MERIT case study surveys have been conducted in covered karst in west-central Florida, with 28-electrode arrays with electrodes 2-5 meters apart, and the deep arrays buried at 4-8 meters depth. Ground penetrating radar surveys, SPT borings and coring data provide selected 'ground truthing'. The case studies show that inclusion of the deep electrode array permits karst features such as undulations at the top of limestone and raveling zones within surficial sediments to be imaged. These features are not accessible from surface arrays with equivalent surface footprints. The method also has better resolution at depth at the ends of the lines, where surface arrays are typically plotted with a trapezoidal truncation due to poor resolution at the lower corners of the profile.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

PubMed

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-10-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

A High-Frequency Linear Ultrasonic Array Utilizing an Interdigitally Bonded 2-2 Piezo-Composite

PubMed Central

Cannata, Jonathan M.; Williams, Jay A.; Zhang, Lequan; Hu, Chang-Hong; Shung, K. Kirk

2011-01-01

This paper describes the development of a high-frequency 256-element linear ultrasonic array utilizing an interdigitally bonded (IB) piezo-composite. Several IB composites were fabricated with different commercial and experimental piezoelectric ceramics and evaluated to determine a suitable formulation for use in high-frequency linear arrays. It was found that the fabricated fine-scale 2–2 IB composites outperformed 1–3 IB composites with identical pillar- and kerf-widths. This result was not expected and lead to the conclusion that dicing damage was likely the cause of the discrepancy. Ultimately, a 2–2 composite fabricated using a fine-grain piezoelectric ceramic was chosen for the array. The composite was manufactured using one IB operation in the azimuth direction to produce approximately 19-μm-wide pillars separated by 6-μm-wide kerfs. The array had a 50 μm (one wavelength in water) azimuth pitch, two matching layers, and 2 mm elevation length focused to 7.3 mm using a polymethylpentene (TPX) lens. The measured pulse-echo center frequency for a representative array element was 28 MHz and −6-dB band-width was 61%. The measured single-element transmit −6-dB directivity was estimated to be 50°. The measured insertion loss was 19 dB after compensating for the effects of attenuation and diffraction in the water bath. A fine-wire phantom was used to assess the lateral and axial resolution of the array when paired with a prototype system utilizing a 64-channel analog beamformer. The −6-dB lateral and axial resolutions were estimated to be 125 and 68 μm, respectively. An anechoic cyst phantom was also imaged to determine the minimum detectable spherical inclusion, and thus the 3-D resolution of the array and beamformer. The minimum anechoic cyst detected was approximately 300 μm in diameter. PMID:21989884

The System Design, Engineering Architecture, and Preliminary Results of a Lower-Cost High-Sensitivity High-Resolution Positron Emission Mammography Camera.

PubMed

Zhang, Yuxuan; Ramirez, Rocio A; Li, Hongdi; Liu, Shitao; An, Shaohui; Wang, Chao; Baghaei, Hossain; Wong, Wai-Hoi

2010-02-01

A lower-cost high-sensitivity high-resolution positron emission mammography (PEM) camera is developed. It consists of two detector modules with the planar detector bank of 20 × 12 cm(2). Each bank has 60 low-cost PMT-Quadrant-Sharing (PQS) LYSO blocks arranged in a 10 × 6 array with two types of geometries. One is the symmetric 19.36 × 19.36 mm(2) block made of 1.5 × 1.5 × 10 mm(3) crystals in a 12 × 12 array. The other is the 19.36 × 26.05 mm(2) asymmetric block made of 1.5 × 1.9 × 10 mm(3) crystals in 12 × 13 array. One row (10) of the elongated blocks are used along one side of the bank to reclaim the half empty PMT photocathode in the regular PQS design to reduce the dead area at the edge of the module. The bank has a high overall crystal packing fraction of 88%, which results in a very high sensitivity. Mechanical design and electronics have been developed for low-cost, compactness, and stability purposes. Each module has four Anger-HYPER decoding electronics that can handle a count-rate of 3 Mcps for single events. A simple two-module coincidence board with a hardware delay window for random coincidences has been developed with an adjustable window of 6 to 15 ns. Some of the performance parameters have been studied by preliminary tests and Monte Carlo simulations, including the crystal decoding map and the 17% energy resolution of the detectors, the point source sensitivity of 11.5% with 50 mm bank-to-bank distance, the 1.2 mm-spatial resolutions, 42 kcps peak Noise Equivalent Count Rate at 7.0-mCi total activity in human body, and the resolution phantom images. Those results show that the design goal of building a lower-cost, high-sensitivity, high-resolution PEM detector is achieved.

A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.

PubMed Central

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776

A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

PubMed

Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

2014-01-01

Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

Fabrication and characterization of a 0.5-mm lutetium oxyorthosilicate detector array for high-resolution PET applications.

PubMed

Stickel, Jennifer R; Qi, Jinyi; Cherry, Simon R

2007-01-01

With the increasing use of in vivo imaging in mouse models of disease, there are many interesting applications that demand imaging of organs and tissues with submillimeter resolution. Though there are other contributing factors, the spatial resolution in small-animal PET is still largely determined by the detector pixel dimensions. In this work, a pair of lutetium oxyorthosilicate (LSO) arrays with 0.5-mm pixels was coupled to multichannel photomultiplier tubes and evaluated for use as high-resolution PET detectors. Flood histograms demonstrated that most crystals were clearly identifiable. Energy resolution varied from 22% to 38%. The coincidence timing resolution was 1.42-ns full width at half maximum (FWHM). The intrinsic spatial resolution was 0.68-mm FWHM as measured with a 30-gauge needle filled with (18)F. The improvement in spatial resolution in a tomographic setting is demonstrated using images of a line source phantom reconstructed with filtered backprojection and compared with images obtained from 2 dedicated small-animal PET scanners. Finally, a projection image of the mouse foot is shown to demonstrate the application of these 0.5-mm LSO detectors to a biologic task. A pair of highly pixelated LSO detections has been constructed and characterized for use as high-spatial-resolution PET detectors. It appears that small-animal PET systems capable of a FWHM spatial resolution of 600 microm or less are feasible and should be pursued.

Broadband high resolution X-ray spectral analyzer

DOEpatents

Silver, Eric H.; Legros, Mark; Madden, Norm W.; Goulding, Fred; Landis, Don

1998-01-01

A broad bandwidth high resolution x-ray fluorescence spectrometer has a performance that is superior in many ways to those currently available. It consists of an array of 4 large area microcalorimeters with 95% quantum efficiency at 6 keV and it produces x-ray spectra between 0.2 keV and 7 keV with an energy resolution of 7 to 10 eV. The resolution is obtained at input count rates per array element of 10 to 50 Hz in real-time, with analog pulse processing and thermal pile-up rejection. This performance cannot be matched by currently available x-ray spectrometers. The detectors are incorporated into a compact and portable cryogenic refrigerator system that is ready for use in many analytical spectroscopy applications as a tool for x-ray microanalysis or in research applications such as laboratory and astrophysical x-ray and particle spectroscopy.

Broadband high resolution X-ray spectral analyzer

DOEpatents

Silver, E.H.; Legros, M.; Madden, N.W.; Goulding, F.; Landis, D.

1998-07-07

A broad bandwidth high resolution X-ray fluorescence spectrometer has a performance that is superior in many ways to those currently available. It consists of an array of 4 large area microcalorimeters with 95% quantum efficiency at 6 keV and it produces X-ray spectra between 0.2 keV and 7 keV with an energy resolution of 7 to 10 eV. The resolution is obtained at input count rates per array element of 10 to 50 Hz in real-time, with analog pulse processing and thermal pile-up rejection. This performance cannot be matched by currently available X-ray spectrometers. The detectors are incorporated into a compact and portable cryogenic refrigerator system that is ready for use in many analytical spectroscopy applications as a tool for X-ray microanalysis or in research applications such as laboratory and astrophysical X-ray and particle spectroscopy. 6 figs.

Fabrication of a Kilopixel Array of Superconducting Microcalorimeters with Microstripline Wiring

NASA Technical Reports Server (NTRS)

Chervenak, James

2012-01-01

A document describes the fabrication of a two-dimensional microcalorimeter array that uses microstrip wiring and integrated heat sinking to enable use of high-performance pixel designs at kilopixel scales (32 X 32). Each pixel is the high-resolution design employed in small-array test devices, which consist of a Mo/Au TES (transition edge sensor) on a silicon nitride membrane and an electroplated Bi/Au absorber. The pixel pitch within the array is 300 microns, where absorbers 290 microns on a side are cantilevered over a silicon support grid with 100-micron-wide beams. The high-density wiring and heat sinking are both carried by the silicon beams to the edge of the array. All pixels are wired out to the array edge. ECR (electron cyclotron resonance) oxide underlayer is deposited underneath the sensor layer. The sensor (TES) layer consists of a superconducting underlayer and a normal metal top layer. If the sensor is deposited at high temperature, the ECR oxide can be vacuum annealed to improve film smoothness and etch characteristics. This process is designed to recover high-resolution, single-pixel x-ray microcalorimeter performance within arrays of arbitrarily large format. The critical current limiting parts of the circuit are designed to have simple interfaces that can be independently verified. The lead-to-TES interface is entirely determined in a single layer that has multiple points of interface to maximize critical current. The lead rails that overlap the TES sensor element contact both the superconducting underlayer and the TES normal metal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lecomte, Roger; Arpin, Louis; Beaudoin, Jean-Franç

Purpose: LabPET II is a new generation APD-based PET scanner designed to achieve sub-mm spatial resolution using truly pixelated detectors and highly integrated parallel front-end processing electronics. Methods: The basic element uses a 4×8 array of 1.12×1.12 mm{sup 2} Lu{sub 1.9}Y{sub 0.1}SiO{sub 5}:Ce (LYSO) scintillator pixels with one-to-one coupling to a 4×8 pixelated monolithic APD array mounted on a ceramic carrier. Four detector arrays are mounted on a daughter board carrying two flip-chip, 64-channel, mixed-signal, application-specific integrated circuits (ASIC) on the backside interfacing to two detector arrays each. Fully parallel signal processing was implemented in silico by encoding time andmore » energy information using a dual-threshold Time-over-Threshold (ToT) scheme. The self-contained 128-channel detector module was designed as a generic component for ultra-high resolution PET imaging of small to medium-size animals. Results: Energy and timing performance were optimized by carefully setting ToT thresholds to minimize the noise/slope ratio. ToT spectra clearly show resolved 511 keV photopeak and Compton edge with ToT resolution well below 10%. After correction for nonlinear ToT response, energy resolution is typically 24±2% FWHM. Coincidence time resolution between opposing 128-channel modules is below 4 ns FWHM. Initial imaging results demonstrate that 0.8 mm hot spots of a Derenzo phantom can be resolved. Conclusion: A new generation PET scanner featuring truly pixelated detectors was developed and shown to achieve a spatial resolution approaching the physical limit of PET. Future plans are to integrate a small-bore dedicated mouse version of the scanner within a PET/CT platform.« less

Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters.

PubMed

Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L

2003-01-01

Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.

Active phase correction of high resolution silicon photonic arrayed waveguide gratings

DOE PAGES

Gehl, M.; Trotter, D.; Starbuck, A.; ...

2017-03-10

Arrayed waveguide gratings provide flexible spectral filtering functionality for integrated photonic applications. Achieving narrow channel spacing requires long optical path lengths which can greatly increase the footprint of devices. High index contrast waveguides, such as those fabricated in silicon-on-insulator wafers, allow tight waveguide bends which can be used to create much more compact designs. Both the long optical path lengths and the high index contrast contribute to significant optical phase error as light propagates through the device. Thus, silicon photonic arrayed waveguide gratings require active or passive phase correction following fabrication. We present the design and fabrication of compact siliconmore » photonic arrayed waveguide gratings with channel spacings of 50, 10 and 1 GHz. The largest device, with 11 channels of 1 GHz spacing, has a footprint of only 1.1 cm 2. Using integrated thermo-optic phase shifters, the phase error is actively corrected. We present two methods of phase error correction and demonstrate state-of-the-art cross-talk performance for high index contrast arrayed waveguide gratings. As a demonstration of possible applications, we perform RF channelization with 1 GHz resolution. In addition, we generate unique spectral filters by applying non-zero phase offsets calculated by the Gerchberg Saxton algorithm.« less

Active phase correction of high resolution silicon photonic arrayed waveguide gratings.

PubMed

Gehl, M; Trotter, D; Starbuck, A; Pomerene, A; Lentine, A L; DeRose, C

2017-03-20

Arrayed waveguide gratings provide flexible spectral filtering functionality for integrated photonic applications. Achieving narrow channel spacing requires long optical path lengths which can greatly increase the footprint of devices. High index contrast waveguides, such as those fabricated in silicon-on-insulator wafers, allow tight waveguide bends which can be used to create much more compact designs. Both the long optical path lengths and the high index contrast contribute to significant optical phase error as light propagates through the device. Therefore, silicon photonic arrayed waveguide gratings require active or passive phase correction following fabrication. Here we present the design and fabrication of compact silicon photonic arrayed waveguide gratings with channel spacings of 50, 10 and 1 GHz. The largest device, with 11 channels of 1 GHz spacing, has a footprint of only 1.1 cm². Using integrated thermo-optic phase shifters, the phase error is actively corrected. We present two methods of phase error correction and demonstrate state-of-the-art cross-talk performance for high index contrast arrayed waveguide gratings. As a demonstration of possible applications, we perform RF channelization with 1 GHz resolution. Additionally, we generate unique spectral filters by applying non-zero phase offsets calculated by the Gerchberg Saxton algorithm.

Eukaryotic RNA polymerase subunit RPB8 is a new relative of the OB family.

PubMed

Krapp, S; Kelly, G; Reischl, J; Weinzierl, R O; Matthews, S

1998-02-01

RNA polymerase II subunit RPB8 is an essential subunit that is highly conserved throughout eukaryotic evolution and is present in all three types of nuclear RNA polymerases. We report the first high resolution structural insight into eukaryotic RNA polymerase architecture with the solution structure of RPB8 from Saccharomyces cerevisiae. It consists of an eight stranded, antiparallel beta-barrel, four short helical regions and a large, unstructured omega-loop. The strands are connected in classic Greek-key fashion. The overall topology is unusual and contains a striking C2 rotational symmetry. Furthermore, it is most likely a novel associate of the oligonucleotide/oligosaccharide (OB) binding protein class.

The Transition-Edge-Sensor Array for the Micro-X Sounding Rocket

NASA Technical Reports Server (NTRS)

Eckart, M. E.; Adams, J. S.; Bailey, C. N.; Bandler, S. R.; Busch, Sarah Elizabeth; Chervenak J. A.; Finkbeiner, F. M.; Kelley, R. L.; Kilbourne, C. A.; Porst, J. P.;

Methods Of Using Chemical Libraries To Search For New Kinase Inhibitors

DOEpatents

Gray, Nathanael S. , Schultz, Peter , Wodicka, Lisa , Meijer, Laurent , Lockhart, David J.

2003-06-03

The generation of selective inhibitors for specific protein kinases would provide new tools for analyzing signal transduction pathways and possibly new therapeutic agents. We have invented an approach to the development of selective protein kinase inhibitors based on the unexpected binding mode of 2,6,9-trisubstituted purines to the ATP binding site of human CDK2. The most potent inhibitor, purvalanol B (IC.sub.50 =6 nM), binds with a 30-fold greater affinity than the known CDK2 inhibitor, flavopiridol. The cellular effects of this class of compounds were examined and compared to those of flavopiridol by monitoring changes in mRNA expression levels for all genes in treated cells of Saccharomyces cerevisiae using high-density oligonucleotide probe arrays.

Investigation of anodic TiO2 nanotube composition with high spatial resolution AES and ToF SIMS

NASA Astrophysics Data System (ADS)

Dronov, Alexey; Gavrilin, Ilya; Kirilenko, Elena; Dronova, Daria; Gavrilov, Sergey

2018-03-01

High resolution Scanning Auger Electron Spectroscopy (AES) and Time-of-Flight Secondary Ion Mass-Spectrometry (ToF SIMS) were used to investigate structure and elemental composition variation of both across an array of TiO2 nanotubes (NTs) and single tube of an array. The TiO2 NT array was grown by anodic oxidation of Ti foil in fluorine-containing ethylene glycol electrolyte. It was found that the studied anodic TiO2 nanotubes have a layered structure with rather sharp interfaces. The differences in AES depth profiling results of a single tube with the focused primary electron beam (point analysis) and over an area of 75 μm in diameter of a nanotube array with the defocused primary electron beam are discussed. Depth profiling by ToF SIMS was carried out over approximately the same size of a nanotube array to determine possible ionic fragments in the structure. The analysis results show that the combination of both mentioned methods is useful for a detailed analysis of nanostructures with complex morphology and multi-layered nature.

Waveform digitization for high resolution timing detectors with silicon photomultipliers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ronzhin, A.; Albrow, M. G.; Los, S.

2012-03-01

The results of time resolution studies with silicon photomultipliers (SiPMs) read out with high bandwidth constant fraction discrimination electronics were presented earlier [1-3]. Here we describe the application of fast waveform digitization readout based on the DRS4 chip [4], a switched capacitor array (SCA) produced by the Paul Scherrer Institute, to further our goal of developing high time resolution detectors based on SiPMs. The influence of the SiPM signal shape on the time resolution was investigated. Different algorithms to obtain the best time resolution are described, and test beam results are presented.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Colloidal silica films for high-capacity DNA arrays

NASA Astrophysics Data System (ADS)

Glazer, Marc Irving

The human genome project has greatly expanded the amount of genetic information available to researchers, but before this vast new source of data can be fully utilized, techniques for rapid, large-scale analysis of DNA and RNA must continue to develop. DNA arrays have emerged as a powerful new technology for analyzing genomic samples in a highly parallel format. The detection sensitivity of these arrays is dependent on the quantity and density of immobilized probe molecules. We have investigated substrates with a porous, "three-dimensional" surface layer as a means of increasing the surface area available for the synthesis of oligonucleotide probes, thereby increasing the number of available probes and the amount of detectable bound target. Porous colloidal silica films were created by two techniques. In the first approach, films were deposited by spin-coating silica colloid suspensions onto flat glass substrates, with the pores being formed by the natural voids between the solid particles (typically 23nm pores, 35% porosity). In the second approach, latex particles were co-deposited with the silica and then pyrolyzed, creating films with larger pores (36 nm), higher porosity (65%), and higher surface area. For 0.3 mum films, enhancements of eight to ten-fold and 12- to 14-fold were achieved with the pure silica films and the films "templated" with polymer latex, respectively. In gene expression assays for up to 7,000 genes using complex biological samples, the high-capacity films provided enhanced signals and performed equivalently or better than planar glass on all other functional measures, confirming that colloidal silica films are a promising platform for high-capacity DNA arrays. We have also investigated the kinetics of hybridization on planar glass and high-capacity substrates. Adsorption on planar arrays is similar to ideal Langmuir-type adsorption, although with an "overshoot" at high solution concentration. Hybridization on high-capacity films is controlled by traditional adsorption (ka) and desorption (kd) coefficients, as well as morphology factors and transient binding interactions between the target and probes. The strength of the transient probe/target binding interactions are on the order of 5--7 DNA base pairs, which suggests the formation of nucleation or other metastable complexes, rather than fully-zippered duplexes.

Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

PubMed

Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

2005-08-01

Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

A compact high resolution flat panel PET detector based on the new 4-side buttable MPPC for biomedical applications.

PubMed

Wang, Qiang; Wen, Jie; Ravindranath, Bosky; O'Sullivan, Andrew W; Catherall, David; Li, Ke; Wei, Shouyi; Komarov, Sergey; Tai, Yuan-Chuan

2015-09-11

Compact high-resolution panel detectors using virtual pinhole (VP) PET geometry can be inserted into existing clinical or pre-clinical PET systems to improve regional spatial resolution and sensitivity. Here we describe a compact panel PET detector built using the new Though Silicon Via (TSV) multi-pixel photon counters (MPPC) detector. This insert provides high spatial resolution and good timing performance for multiple bio-medical applications. Because the TSV MPPC design eliminates wire bonding and has a package dimension which is very close to the MPPC's active area, it is 4-side buttable. The custom designed MPPC array (based on Hamamatsu S12641-PA-50(x)) used in the prototype is composed of 4 × 4 TSV-MPPC cells with a 4.46 mm pitch in both directions. The detector module has 16 × 16 lutetium yttrium oxyorthosilicate (LYSO) crystal array, with each crystal measuring 0.92 × 0.92 × 3 mm 3 with 1.0 mm pitch. The outer diameter of the detector block is 16.8 × 16.8 mm 2 . Thirty-two such blocks will be arranged in a 4 × 8 array with 1 mm gaps to form a panel detector with detection area around 7 cm × 14 cm in the full-size detector. The flood histogram acquired with Ge-68 source showed excellent crystal separation capability with all 256 crystals clearly resolved. The detector module's mean, standard deviation, minimum (best) and maximum (worst) energy resolution were 10.19%, +/-0.68%, 8.36% and 13.45% FWHM, respectively. The measured coincidence time resolution between the block detector and a fast reference detector (around 200 ps single photon timing resolution) was 0.95 ns. When tested with Siemens Cardinal electronics the performance of the detector blocks remain consistent. These results demonstrate that the TSV-MPPC is a promising photon sensor for use in a flat panel PET insert composed of many high resolution compact detector modules.

Chirp-coded excitation imaging with a high-frequency ultrasound annular array.

PubMed

Mamou, Jonathan; Ketterling, Jeffrey A; Silverman, Ronald H

2008-02-01

High-frequency ultrasound (HFU, > 15 MHz) is an effective means of obtaining fine-resolution images of biological tissues for applications such as opthalmologic, dermatologic, and small animal imaging. HFU has two inherent drawbacks. First, HFU images have a limited depth of field (DOF) because of the short wavelength and the low fixed F-number of conventional HFU transducers. Second, HFU can be used to image only a few millimeters deep into a tissue because attenuation increases with frequency. In this study, a five-element annular array was used in conjunction with a synthetic-focusing algorithm to extend the DOF. The annular array had an aperture of 10 mm, a focal length of 31 mm, and a center frequency of 17 MHz. To increase penetration depth, 8-micros, chirp-coded signals were designed, input into an arbitrary waveform generator, and used to excite each array element. After data acquisition, the received signals were linearly filtered to restore axial resolution and increase the SNR. To compare the chirpcoded imaging method with conventional impulse imaging in terms of resolution, a 25-microm diameter wire was scanned and the -6-dB axial and lateral resolutions were computed at depths ranging from 20.5 to 40.5 mm. The results demonstrated that chirp-coded excitation did not degrade axial or lateral resolution. A tissue-mimicking phantom containing 10-microm glass beads was scanned, and backscattered signals were analyzed to evaluate SNR and penetration depth. Finally, ex vivo ophthalmic images were formed and chirpcoded images showed features that were not visible in conventional impulse images.

Virtual electrodes for high-density electrode arrays

DOEpatents

Cela, Carlos J.; Lazzi, Gianluca

2015-10-13

The present embodiments are directed to implantable electrode arrays having virtual electrodes. The virtual electrodes may improve the resolution of the implantable electrode array without the burden of corresponding complexity of electronic circuitry and wiring. In a particular embodiment, a virtual electrode may include one or more passive elements to help steer current to a specific location between the active electrodes. For example, a passive element may be a metalized layer on a substrate that is adjacent to, but not directly connected to an active electrode. In certain embodiments, an active electrode may be directly coupled to a power source via a conductive connection. Beneficially, the passive elements may help to increase the overall resolution of the implantable array by providing additional stimulation points without requiring additional wiring or driver circuitry for the passive elements.

Development of optical micro resonance based sensor for detection and identification of microparticles and biological agents

NASA Astrophysics Data System (ADS)

Saetchnikov, Vladimir A.; Tcherniavskaia, Elina A.; Schweiger, Gustav

2009-05-01

A novel emerging technique for the label-free analysis of nanoparticles including biomolecules using optical micro cavity resonance of whispering-gallery-type modes is being developed. Schemes of such a method based on microsphere melted by laser on the tip of a standard single mode fiber optical cable with a laser and free microsphere matrix have been developed. Using a calibration principal of ultra high resolution spectroscopy based on such a scheme the method is being transformed to make further development for microbial application. The sensitivity of developed schemes has been tested to refractive index changes by monitoring the magnitude of the whispering gallery modes spectral shift. Water solutions of ethanol, glucose, vitamin C and biotin have been used. Some other schemes using similar principals: stand-alone, array and matrix microsphere resonators, liquid core optical ring resonators are also being under development. The influences of the gap in whispering-gallery modes on energy coupling, resonance quality and frequency have been investigated. An optimum gap for sensing applications has been defined at the half maximum energy coupling where both the Q factor and coupling efficiency are high and the resonance frequency is little affected by the gap variation. Developed schemes have been demonstrated to be a promising technology platform for sensitive, lab-on-chip type sensor which can be used for development of diagnostic tools for different biological molecules, e.g. proteins, oligonucleotides, oligosaccharides, lipids, small molecules, viral particles, cells as well as in different experimental contexts e.g. proteomics, genomics, drug discovery, and membrane studies.

TIA-1 RRM23 binding and recognition of target oligonucleotides

PubMed Central

Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

2017-01-01

Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

TIA-1 RRM23 binding and recognition of target oligonucleotides.

PubMed

Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

2017-05-05

TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Accurately determining direction of arrival by seismic array based on compressive sensing

NASA Astrophysics Data System (ADS)

Hu, J.; Zhang, H.; Yu, H.

2016-12-01

Seismic array analysis method plays an important role in detecting weak signals and determining their locations and rupturing process. In these applications, reliably estimating direction of arrival (DOA) for the seismic wave is very important. DOA is generally determined by the conventional beamforming method (CBM) [Rost et al, 2000]. However, for a fixed seismic array generally the resolution of CBM is poor in the case of low-frequency seismic signals, and in the case of high frequency seismic signals the CBM may produce many local peaks, making it difficult to pick the one corresponding to true DOA. In this study, we develop a new seismic array method based on compressive sensing (CS) to determine the DOA with high resolution for both low- and high-frequency seismic signals. The new method takes advantage of the space sparsity of the incoming wavefronts. The CS method has been successfully used to determine spatial and temporal earthquake rupturing distributions with seismic array [Yao et al, 2011;Yao et al, 2013;Yin 2016]. In this method, we first form the problem of solving the DOA as a L1-norm minimization problem. The measurement matrix for CS is constructed by dividing the slowness-angle domain into many grid nodes, which needs to satisfy restricted isometry property (RIP) for optimized reconstruction of the image. The L1-norm minimization is solved by the interior point method. We first test the CS-based DOA array determination method on synthetic data constructed based on Shanghai seismic array. Compared to the CBM, synthetic test for data without noise shows that the new method can determine the true DOA with a super-high resolution. In the case of multiple sources, the new method can easily separate multiple DOAs. When data are contaminated by noise at various levels, the CS method is stable when the noise amplitude is lower than the signal amplitude. We also test the CS method for the Wenchuan earthquake. For different arrays with different apertures, we are able to obtain reliable DOAs with uncertainties lower than 10 degrees.

Recent advances in a linear micromirror array for high-resolution projection

NASA Astrophysics Data System (ADS)

Picard, Francis; Doucet, Michel; Niall, Keith K.; Larouche, Carl; Savard, Maxime; Crisan, Silviu; Thibault, Simon; Jerominek, Hubert

2004-05-01

The visual displays of contemporary military flight simulators lack adequate definition to represent scenes in basic fast-jet fighter tasks. For example, air-to-air and air-to-ground targets are not projected with sufficient contrast and resolution for a pilot to perceive aspect, aspect rate and object detail at real world slant ranges. Simulator display geometries require the development of ultra-high resolution projectors with greater than 20 megapixel resolution at 60 Hz frame rate. A new micromirror device has been developed to address this requirement; it is able to modulate light intensity in an analog fashion with switching times shorter than 5 μs. When combined with a scanner, a laser and Schlieren optics, a linear array of these flexible micromirrors can display images composed of thousands of lines at a frame rate of 60 Hz. Recent results related to evaluation of this technology for high resolution projection are presented. Alternate operation modes for light modulation with flexible micromirrors are proposed. The related importance of controlling the residual micromirror curvature is discussed and results of experiments investigating the use of the deposition pressure to achieve such control are reported. Moreover, activities aiming at minimizing the micromirror response time and, so doing, maximizing the number of image columns per image frame are discussed. Finally, contrast measurement and estimate of the contrast limit achievable with the flexible micromirror technology are presented. All reported activities support the development of a fully addressable 2000-element micromirror array.

Method to determine thermal profiles of nanoscale circuitry

DOEpatents

Zettl, Alexander K; Begtrup, Gavi E

2013-04-30

A platform that can measure the thermal profiles of devices with nanoscale resolution has been developed. The system measures the local temperature by using an array of nanoscale thermometers. This process can be observed in real time using a high resolution imagining technique such as electron microscopy. The platform can operate at extremely high temperatures.

High-resolution microcontact printing and transfer of massive arrays of microorganisms on planar and compartmentalized nanoporous aluminium oxide.

PubMed

Ingham, Colin; Bomer, Johan; Sprenkels, Ad; van den Berg, Albert; de Vos, Willem; van Hylckama Vlieg, Johan

2010-06-07

Handling microorganisms in high throughput and their deployment into miniaturized platforms presents significant challenges. Contact printing can be used to create dense arrays of viable microorganisms. Such "living arrays", potentially with multiple identical replicates, are useful in the selection of improved industrial microorganisms, screening antimicrobials, clinical diagnostics, strain storage, and for research into microbial genetics. A high throughput method to print microorganisms at high density was devised, employing a microscope and a stamp with a massive array of PDMS pins. Viable bacteria (Lactobacillus plantarum, Esherichia coli), yeast (Candida albicans) and fungal spores (Aspergillus fumigatus) were deposited onto porous aluminium oxide (PAO) using arrays of pins with areas from 5 x 5 to 20 x 20 microm. Printing onto PAO with up to 8100 pins of 20 x 20 microm area with 3 replicates was achieved. Printing with up to 200 pins onto PAO culture chips (divided into 40 x 40 microm culture areas) allowed inoculation followed by effective segregation of microcolonies during outgrowth. Additionally, it was possible to print mixtures of C. albicans and spores of A. fumigatus with a degree of selectivity by capture onto a chemically modified PAO surface. High resolution printing of microorganisms within segregated compartments and on functionalized PAO surfaces has significant advantages over what is possible on semi-solid surfaces such as agar.

High-resolution extraction of particle size via Fourier Ptychography

NASA Astrophysics Data System (ADS)

Li, Shengfu; Zhao, Yu; Chen, Guanghua; Luo, Zhenxiong; Ye, Yan

2017-11-01

This paper proposes a method which can extract the particle size information with a resolution beyond λ/NA. This is achieved by applying Fourier Ptychographic (FP) ideas to the present problem. In a typical FP imaging platform, a 2D LED array is used as light sources for angle-varied illuminations, a series of low-resolution images was taken by a full sequential scan of the array of LEDs. Here, we demonstrate the particle size information is extracted by turning on each single LED on a circle. The simulated results show that the proposed method can reduce the total number of images, without loss of reliability in the results.

SU-F-T-559: High-Resolution Scintillating Fiber Array for In-Vivo Real-Time SRS and SBRT Patient QA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knewtson, T; Pokhrel, S; University of Tennessee Health Science Center, Memphis, TN

2016-06-15

Purpose: A high-resolution scintillating fiber detector was built for in-vivo real-time patient specific quality assurance (QA). The detector is designed for stereotactic body radiotherapy (SBRT) and stereotactic radiosurgery (SRS) to monitor treatment delivery and detect real-time deviations from planned dose to increase patient safety and treatment accuracy. Methods: The detector consists of two high-density scintillating fiber arrays layered to form an X-Y grid which can be attached to the accessory tray of a medical linac for SBRT and cone SRS treatment QA. Fiber arrays consist of 128 scintillating fibers embedded within a precision-machined, high-transmission polymer substrate with 0.8mm pitch. Themore » fibers are coupled on both ends to high-sensitivity photodetectors and the output is recorded through a high-speed analog-to-digital converter to capture the linac pulse sequence as treatment delivery progresses. The detector has a software controlled 360 degree rotational system to capture angular beam projections for high-resolution beam profile reconstruction. Results: The detector was validated using SRS cone sizes from 6mm to 34mm and MLC defined field sizes from 5×5mm2 to 100×100mm2. The detector output response is linear with dose and is dose rate independent. Each field can be reconstructed accurately with a spatial resolution of 0.8mm and the current beam output is displayed every 50msec. Dosimetric errors of 1% with respect to the treatment plan can be identified and clinically significant deviations from the expected treatment can be displayed in real-time to alert the therapists. Conclusion: The high resolution detector is capable of reconstructing beam profiles in real-time with submillimeter resolution and 1% dose resolution. This system has the ability to project in-vivo both spatial and dosimetric errors during SBRT and SRS treatments when only a non-clinically significant fraction of the intended dose was delivered. The device has the potential to establish new standards for in-vivo patient specific QA.« less

New Optimizations of Microcalorimeter Arrays for High-Resolution Imaging X-ray Spectroscopy

NASA Astrophysics Data System (ADS)

Kilbourne, Caroline

We propose to continue our successful research program in developing arrays of superconducting transition-edge sensors (TES) for x-ray astrophysics. Our standard 0.3 mm TES pixel achieves better than 2.5-eV resolution, and we now make 32x32 arrays of such pixels. We have also achieved better than 1-eV resolution in smaller pixels, and promising performance in a range of position-sensitive designs. We propose to continue to advance the designs of both the single-pixel and position-sensitive microcalorimeters so that we can produce arrays suitable for several x-ray spectroscopy observatories presently in formulation. We will also investigate various array and pixel optimizations such as would be needed for large arrays for surveys, large- pixel arrays for diffuse soft x-ray measurements, or sub-arrays of fast pixels optimized for neutron-star burst spectroscopy. In addition, we will develop fabrication processes for integrating sub-arrays with very different pixel designs into a monolithic focal-plane array to simplify the design of the focal-plane assembly and make feasible new detector configurations such as the one currently baselined for AXSIO. Through a series of measurements on test devices, we have improved our understanding of the weak-link physics governing the observed resistive transitions in TES detectors. We propose to build on that work and ultimately use the results to improve the immunity of the detector to environmental magnetic fields, as well as its fundamental performance, in each of the targeted optimizations we are developing.

Performance of Backshort-Under-Grid Kilopixel TES Arrays for HAWC+

NASA Technical Reports Server (NTRS)

Staguhn, J. G.; Benford, D. J.; Dowell, C. D.; Fixsen, D. J.; Hilton, G. C.; Irwin, K. D.; Jhabvala, C. A.; Maher, S. F.; Miller, T. M.; Moseley, S. H.;

Ultra high spatial and temporal resolution breast imaging at 7T.

PubMed

van de Bank, B L; Voogt, I J; Italiaander, M; Stehouwer, B L; Boer, V O; Luijten, P R; Klomp, D W J

2013-04-01

There is a need to obtain higher specificity in the detection of breast lesions using MRI. To address this need, Dynamic Contrast-Enhanced (DCE) MRI has been combined with other structural and functional MRI techniques. Unfortunately, owing to time constraints structural images at ultra-high spatial resolution can generally not be obtained during contrast uptake, whereas the relatively low spatial resolution of functional imaging (e.g. diffusion and perfusion) limits the detection of small lesions. To be able to increase spatial as well as temporal resolution simultaneously, the sensitivity of MR detection needs to increase as well as the ability to effectively accelerate the acquisition. The required gain in signal-to-noise ratio (SNR) can be obtained at 7T, whereas acceleration can be obtained with high-density receiver coil arrays. In this case, morphological imaging can be merged with DCE-MRI, and other functional techniques can be obtained at higher spatial resolution, and with less distortion [e.g. Diffusion Weighted Imaging (DWI)]. To test the feasibility of this concept, we developed a unilateral breast coil for 7T. It comprises a volume optimized dual-channel transmit coil combined with a 30-channel receive array coil. The high density of small coil elements enabled efficient acceleration in any direction to acquire ultra high spatial resolution MRI of close to 0.6 mm isotropic detail within a temporal resolution of 69 s, high spatial resolution MRI of 1.5 mm isotropic within an ultra high temporal resolution of 6.7 s and low distortion DWI at 7T, all validated in phantoms, healthy volunteers and a patient with a lesion in the right breast classified as Breast Imaging Reporting and Data System (BI-RADS) IV. Copyright © 2012 John Wiley & Sons, Ltd.

Design and simulation of a novel method for determining depth-of-interaction in a PET scintillation crystal array using a single-ended readout by a multi-anode PMT

NASA Astrophysics Data System (ADS)

Ito, Mikiko; Lee, Jae Sung; Park, Min-Jae; Sim, Kwang-Souk; Jong Hong, Seong

2010-07-01

PET detectors with depth-of-interaction (DOI) encoding capability allow high spatial resolution and high sensitivity to be achieved simultaneously. To obtain DOI information from a mono-layer array of scintillation crystals using a single-ended readout, the authors devised a method based on light spreading within a crystal array and performed Monte Carlo simulations with individual scintillation photon tracking to prove the concept. A scintillation crystal array model was constructed using a grid method. Conventional grids are constructed using comb-shaped reflector strips with rectangular teeth to isolate scintillation crystals optically. However, the authors propose the use of triangularly shaped teeth, such that scintillation photons spread only in the x-direction in the upper halves of crystals and in the y-direction in lower halves. DOI positions can be estimated by considering the extent of two-dimensional light dispersion, which can be determined from the multiple anode outputs of a position-sensitive PMT placed under the crystal array. In the main simulation, a crystal block consisting of a 29 × 29 array of 1.5 mm × 1.5 mm × 20 mm crystals and a multi-anode PMT with 16 × 16 pixels were used. The effects of crystal size and non-uniform PMT output gain were also explored by simulation. The DOI resolution estimated for 1.5 × 1.5 × 20 mm3 crystals was 2.16 mm on average. Although the flood map was depth dependent, each crystal was well identified at all depths when a corner of the crystal array was irradiated with 511 keV gamma rays (peak-to-valley ratio ~9:1). DOI resolution was better than 3 mm up to a crystal length of 28 mm with a 1.5 × 1.5 mm2 or 2.0 × 2.0 mm2 crystal surface area. The devised light-sharing method allowed excellent DOI resolutions to be obtained without the use of dual-ended readout or multiple crystal arrays.

TandemPET-A High Resolution, Small Animal, Virtual Pinhole-Based PET Scanner: Initial Design Study

NASA Astrophysics Data System (ADS)

Raylman, Raymond R.; Stolin, Alexander V.; Martone, Peter F.; Smith, Mark F.

2016-02-01

Mice are the perhaps the most common species of rodents used in biomedical research, but many of the current generation of small animal PET scanners are non-optimal for imaging these small rodents due to their relatively low resolution. Consequently, a number of researchers have investigated the development of high-resolution scanners to address this need. In this investigation, the design of a novel, high-resolution system based on the dual-detector, virtual-pinhole PET concept was explored via Monte Carlo simulations. Specifically, this system, called TandemPET, consists of a 5 cm × 5 cm high-resolution detector made-up of a 90 × 90 array of 0.5 mm × 0.5 × 10 mm (pitch = 0.55 mm) LYSO detector elements in coincidence with a lower resolution detector consisting of a 68 × 68 array of 1.5 mm × 1.5 mm × 10 mm LYSO detector elements (total size = 10.5 cm × 10.5 cm). Analyses indicated that TandemPET's optimal geometry is to position the high-resolution detector 3 cm from the center-of-rotation, with the lower resolution detector positioned 9 cm from center. Measurements using modified NEMA NU4-2008-based protocols revealed that the spatial resolution of the system is 0.5 mm FWHM, after correction of positron range effects. Peak sensitivity is 2.1%, which is comparable to current small animal PET scanners. Images from a digital mouse brain phantom demonstrated the potential of the system for identifying important neurological structures.

Graphical user interface for a dual-module EMCCD x-ray detector array

NASA Astrophysics Data System (ADS)

Wang, Weiyuan; Ionita, Ciprian; Kuhls-Gilcrist, Andrew; Huang, Ying; Qu, Bin; Gupta, Sandesh K.; Bednarek, Daniel R.; Rudin, Stephen

2011-03-01

A new Graphical User Interface (GUI) was developed using Laboratory Virtual Instrumentation Engineering Workbench (LabVIEW) for a high-resolution, high-sensitivity Solid State X-ray Image Intensifier (SSXII), which is a new x-ray detector for radiographic and fluoroscopic imaging, consisting of an array of Electron-Multiplying CCDs (EMCCDs) each having a variable on-chip electron-multiplication gain of up to 2000x to reduce the effect of readout noise. To enlarge the field-of-view (FOV), each EMCCD sensor is coupled to an x-ray phosphor through a fiberoptic taper. Two EMCCD camera modules are used in our prototype to form a computer-controlled array; however, larger arrays are under development. The new GUI provides patient registration, EMCCD module control, image acquisition, and patient image review. Images from the array are stitched into a 2kx1k pixel image that can be acquired and saved at a rate of 17 Hz (faster with pixel binning). When reviewing the patient's data, the operator can select images from the patient's directory tree listed by the GUI and cycle through the images using a slider bar. Commonly used camera parameters including exposure time, trigger mode, and individual EMCCD gain can be easily adjusted using the GUI. The GUI is designed to accommodate expansion of the EMCCD array to even larger FOVs with more modules. The high-resolution, high-sensitivity EMCCD modular-array SSXII imager with the new user-friendly GUI should enable angiographers and interventionalists to visualize smaller vessels and endovascular devices, helping them to make more accurate diagnoses and to perform more precise image-guided interventions.

Low-redundancy linear arrays in mirrored interferometric aperture synthesis.

PubMed

Zhu, Dong; Hu, Fei; Wu, Liang; Li, Jun; Lang, Liang

2016-01-15

Mirrored interferometric aperture synthesis (MIAS) is a novel interferometry that can improve spatial resolution compared with that of conventional IAS. In one-dimensional (1-D) MIAS, antenna array with low redundancy has the potential to achieve a high spatial resolution. This Letter presents a technique for the direct construction of low-redundancy linear arrays (LRLAs) in MIAS and derives two regular analytical patterns that can yield various LRLAs in short computation time. Moreover, for a better estimation of the observed scene, a bi-measurement method is proposed to handle the rank defect associated with the transmatrix of those LRLAs. The results of imaging simulation demonstrate the effectiveness of the proposed method.

High-Performance Flexible Force and Temperature Sensing Array with a Robust Structure

NASA Astrophysics Data System (ADS)

Kim, Min-Seok; Song, Han-Wook; Park, Yon-Kyu

We have developed a flexible tactile sensor array capable of sensing physical quantities, e.g. force and temperature with high-performances and high spatial resolution. The fabricated tactile sensor consists of 8 × 8 force measuring array with 1 mm spacing and a thin metal (copper) temperature sensor. The flexible force sensing array consists of sub-millimetre-size bar-shaped semi-conductor strain gage array attached to a thin and flexible printed circuit board covered by stretchable elastomeric material on both sides. This design incorporates benefits of both materials; the semi-conductor's high performance and the polymer's mechanical flexibility and robustness, while overcoming their drawbacks of those two materials. Special fabrication processes, so called “dry-transfer technique” have been used to fabricate the tactile sensor along with standard micro-fabrication processes.

Sensitivity encoded silicon photomultiplier--a new sensor for high-resolution PET-MRI.

PubMed

Schulz, Volkmar; Berker, Yannick; Berneking, Arne; Omidvari, Negar; Kiessling, Fabian; Gola, Alberto; Piemonte, Claudio

2013-07-21

Detectors for simultaneous positron emission tomography and magnetic resonance imaging in particular with sub-mm spatial resolution are commonly composed of scintillator crystal arrays, readout via arrays of solid state sensors, such as avalanche photo diodes (APDs) or silicon photomultipliers (SiPMs). Usually a light guide between the crystals and the sensor is used to enable the identification of crystals which are smaller than the sensor elements. However, this complicates crystal identification at the gaps and edges of the sensor arrays. A solution is to use as many sensors as crystals with a direct coupling, which unfortunately increases the complexity and power consumption of the readout electronics. Since 1997, position-sensitive APDs have been successfully used to identify sub-mm crystals. Unfortunately, these devices show a limitation in their time resolution and a degradation of spatial resolution when placed in higher magnetic fields. To overcome these limitations, this paper presents a new sensor concept that extends conventional SiPMs by adding position information via the spatial encoding of the channel sensitivity. The concept allows a direct coupling of high-resolution crystal arrays to the sensor with a reduced amount of readout channels. The theory of sensitivity encoding is detailed and linked to compressed sensing to compute unique sparse solutions. Two devices have been designed using one- and two-dimensional linear sensitivity encoding with eight and four readout channels, respectively. Flood histograms of both devices show the capability to precisely identify all 4 × 4 LYSO crystals with dimensions of 0.93 × 0.93 × 10 mm(3). For these crystals, the energy and time resolution (MV ± SD) of the devices with one (two)-dimensional encoding have been measured to be 12.3 · (1 ± 0.047)% (13.7 · (1 ± 0.047)%) around 511 keV with a paired coincidence time resolution (full width at half maximum) of 462 · (1 ± 0.054) ps (452 · (1 ± 0.078) ps).

Sensitivity encoded silicon photomultiplier—a new sensor for high-resolution PET-MRI

NASA Astrophysics Data System (ADS)

Schulz, Volkmar; Berker, Yannick; Berneking, Arne; Omidvari, Negar; Kiessling, Fabian; Gola, Alberto; Piemonte, Claudio

2013-07-01

Detectors for simultaneous positron emission tomography and magnetic resonance imaging in particular with sub-mm spatial resolution are commonly composed of scintillator crystal arrays, readout via arrays of solid state sensors, such as avalanche photo diodes (APDs) or silicon photomultipliers (SiPMs). Usually a light guide between the crystals and the sensor is used to enable the identification of crystals which are smaller than the sensor elements. However, this complicates crystal identification at the gaps and edges of the sensor arrays. A solution is to use as many sensors as crystals with a direct coupling, which unfortunately increases the complexity and power consumption of the readout electronics. Since 1997, position-sensitive APDs have been successfully used to identify sub-mm crystals. Unfortunately, these devices show a limitation in their time resolution and a degradation of spatial resolution when placed in higher magnetic fields. To overcome these limitations, this paper presents a new sensor concept that extends conventional SiPMs by adding position information via the spatial encoding of the channel sensitivity. The concept allows a direct coupling of high-resolution crystal arrays to the sensor with a reduced amount of readout channels. The theory of sensitivity encoding is detailed and linked to compressed sensing to compute unique sparse solutions. Two devices have been designed using one- and two-dimensional linear sensitivity encoding with eight and four readout channels, respectively. Flood histograms of both devices show the capability to precisely identify all 4 × 4 LYSO crystals with dimensions of 0.93 × 0.93 × 10 mm3. For these crystals, the energy and time resolution (MV ± SD) of the devices with one (two)-dimensional encoding have been measured to be 12.3 · (1 ± 0.047)% (13.7 · (1 ± 0.047)%) around 511 keV with a paired coincidence time resolution (full width at half maximum) of 462 · (1 ± 0.054) ps (452 · (1 ± 0.078) ps).

The Atacama Cosmology Telescope: The Polarization-Sensitive ACTPol Instrument

DOE PAGES

Thornton, R. J.; Ade, P. A. R.; Aiola, S.; ...

2016-12-09

The Atacama Cosmology Telescope (ACT) makes high angular resolution measurements of anisotropies in the Cosmic Microwave Background (CMB) at millimeter wavelengths. We describe ACTPol, an upgraded receiver for ACT, which uses feedhorn-coupled, polarization-sensitive detector arrays, a 3° field of view, 100 mK cryogenics with continuous cooling, and meta material antireflection coatings. ACTPol comprises three arrays with separate cryogenic optics: two arrays at a central frequency of 148 GHz and one array operating simultaneously at both 97 GHz and 148 GHz. The combined instrument sensitivity, angular resolution, and sky coverage are optimized for measuring angular power spectra, clusters via the thermalmore » Sunyaev–Zel'dovich (SZ) and kinetic SZ signals, and CMB lensing due to large-scale structure. The receiver was commissioned with its first 148 GHz array in 2013, observed with both 148 GHz arrays in 2014, and has recently completed its first full season of operations with the full suite of three arrays. This paper provides an overview of the design and initial performance of the receiver and related systems.« less

THE ATACAMA COSMOLOGY TELESCOPE: THE POLARIZATION-SENSITIVE ACTPol INSTRUMENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thornton, R. J.; Ade, P. A. R.; Aiola, S.

The Atacama Cosmology Telescope (ACT) makes high angular resolution measurements of anisotropies in the Cosmic Microwave Background (CMB) at millimeter wavelengths. We describe ACTPol, an upgraded receiver for ACT, which uses feedhorn-coupled, polarization-sensitive detector arrays, a 3° field of view, 100 mK cryogenics with continuous cooling, and meta material antireflection coatings. ACTPol comprises three arrays with separate cryogenic optics: two arrays at a central frequency of 148 GHz and one array operating simultaneously at both 97 GHz and 148 GHz. The combined instrument sensitivity, angular resolution, and sky coverage are optimized for measuring angular power spectra, clusters via the thermalmore » Sunyaev–Zel’dovich (SZ) and kinetic SZ signals, and CMB lensing due to large-scale structure. The receiver was commissioned with its first 148 GHz array in 2013, observed with both 148 GHz arrays in 2014, and has recently completed its first full season of operations with the full suite of three arrays. This paper provides an overview of the design and initial performance of the receiver and related systems.« less

The Atacama Cosmology Telescope: The Polarization-Sensitive ACTPol Instrument

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thornton, R. J.; Ade, P. A. R.; Aiola, S.

The Atacama Cosmology Telescope (ACT) makes high angular resolution measurements of anisotropies in the Cosmic Microwave Background (CMB) at millimeter wavelengths. We describe ACTPol, an upgraded receiver for ACT, which uses feedhorn-coupled, polarization-sensitive detector arrays, a 3° field of view, 100 mK cryogenics with continuous cooling, and meta material antireflection coatings. ACTPol comprises three arrays with separate cryogenic optics: two arrays at a central frequency of 148 GHz and one array operating simultaneously at both 97 GHz and 148 GHz. The combined instrument sensitivity, angular resolution, and sky coverage are optimized for measuring angular power spectra, clusters via the thermalmore » Sunyaev–Zel'dovich (SZ) and kinetic SZ signals, and CMB lensing due to large-scale structure. The receiver was commissioned with its first 148 GHz array in 2013, observed with both 148 GHz arrays in 2014, and has recently completed its first full season of operations with the full suite of three arrays. This paper provides an overview of the design and initial performance of the receiver and related systems.« less

USGS aerial resolution targets.

USGS Publications Warehouse

Salamonowicz, P.H.

1982-01-01

It is necessary to measure the achievable resolution of any airborne sensor that is to be used for metric purposes. Laboratory calibration facilities may be inadequate or inappropriate for determining the resolution of non-photographic sensors such as optical-mechanical scanners, television imaging tubes, and linear arrays. However, large target arrays imaged in the field can be used in testing such systems. The USGS has constructed an array of resolution targets in order to permit field testing of a variety of airborne sensing systems. The target array permits any interested organization with an airborne sensing system to accurately determine the operational resolution of its system. -from Author

A high-resolution 3D ultrasonic system for rapid evaluation of the anterior and posterior segment.

PubMed

Peyman, Gholam A; Ingram, Charles P; Montilla, Leonardo G; Witte, Russell S

2012-01-01

Traditional ultrasound imaging systems for ophthalmology employ slow, mechanical scanning of a single-element ultrasound transducer. The goal was to demonstrate rapid examination of the anterior and posterior segment with a three-dimensional (3D) commercial ultrasound system incorporating high-resolution linear probe arrays. The 3D images of the porcine eye were generated in approximately 10 seconds by scanning one of two commercial linear arrays (25- and 50-MHz). Healthy enucleated pig eyes were compared with those with induced injury or placement of a foreign material (eg, metal). Rapid, volumetric imaging was also demonstrated in one human eye in vivo. The 50-MHz probe provided exquisite volumetric images of the anterior segment at a depth up to 15 mm and axial resolution of 30 μm. The 25-MHz probe provided a larger field of view (lateral X depth: 20 × 30 mm), sufficient for capturing the entire anterior and posterior segments of the pig eye, at a resolution of 60 μm. A 50-MHz scan through the human eyelid illustrated detailed structures of the Meibomian glands, cilia, cornea, and anterior segment back to the posterior capsule. The 3D system with its high-frequency ultrasound arrays, fast data acquisition, and volume rendering capability shows promise for investigating anterior and posterior structures of the eye. Copyright 2012, SLACK Incorporated.

Field testing of a convergent array of acoustic Doppler profilers for high-resolution velocimetry in energetic tidal currents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harding, Samuel F.; Sellar, Brian; Richmond, Marshall C.

An array of single-beam acoustic Doppler profilers has been developed for the high resolution measurement of three-dimensional tidal flow velocities and subsequently tested in an energetic tidal site. This configuration has been developed to increase spatial resolution of velocity measurements in comparison to conventional acoustic Doppler profilers (ADPs) which characteristically use divergent acoustic beams emanating from a single instrument. This is achieved using geometrically convergent acoustic beams creating a sample volume at the focal point of 0.03 m3. Away from the focal point, the array is also able to simultaneously reconstruct three-dimensional velocity components in a profile throughout the watermore » column, and is referred to herein as a convergent-beam acoustic Doppler profiler (C-ADP). Mid-depth profiling is achieved through integration of the sensor platform with the operational commercial-scale Alstom 1MW DeepGen-IV Tidal Turbine deployed at the European Marine Energy Center, Orkney Isles, UK. This proof-of-concept paper outlines the C-ADP system configuration and comparison to measurements provided by co-installed reference instrumentation.« less

High-resolution X-ray emission spectroscopy with transition-edge sensors: present performance and future potential

DOE Office of Scientific and Technical Information (OSTI.GOV)

Uhlig, J.; Doriese, W. B.; Fowler, J. W.

2015-04-21

X-ray emission spectroscopy (XES) is a powerful element-selective tool to analyze the oxidation states of atoms in complex compounds, determine their electronic configuration, and identify unknown compounds in challenging environments. Until now the low efficiency of wavelength-dispersive X-ray spectrometer technology has limited the use of XES, especially in combination with weaker laboratory X-ray sources. More efficient energy-dispersive detectors have either insufficient energy resolution because of the statistical limits described by Fano or too low counting rates to be of practical use. This paper updates an approach to high-resolution X-ray emission spectroscopy that uses a microcalorimeter detector array of superconducting transition-edgemore » sensors (TESs). TES arrays are discussed and compared with conventional methods, and shown under which circumstances they are superior. It is also shown that a TES array can be integrated into a table-top time-resolved X-ray source and a soft X-ray synchrotron beamline to perform emission spectroscopy with good chemical sensitivity over a very wide range of energies.« less

Replica amplification of nucleic acid arrays

DOEpatents

Church, George M.; Mitra, Robi D.

2010-08-31

Disclosed are improved methods of making and using immobilized arrays of nucleic acids, particularly methods for producing replicas of such arrays. Included are methods for producing high density arrays of nucleic acids and replicas of such arrays, as well as methods for preserving the resolution of arrays through rounds of replication. Also included are methods which take advantage of the availability of replicas of arrays for increased sensitivity in detection of sequences on arrays. Improved methods of sequencing nucleic acids immobilized on arrays utilizing single copies of arrays and methods taking further advantage of the availability of replicas of arrays are disclosed. The improvements lead to higher fidelity and longer read lengths of sequences immobilized on arrays. Methods are also disclosed which improve the efficiency of multiplex PCR using arrays of immobilized nucleic acids.

Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

PubMed

Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

2016-04-01

Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

An Investigation of G-Quadruplex Structural Polymorphism in the Human Telomere Using a Combined Approach of Hydrodynamic Bead Modeling and Molecular Dynamics Simulation

PubMed Central

2015-01-01

Guanine-rich oligonucleotides can adopt noncanonical tertiary structures known as G-quadruplexes, which can exist in different forms depending on experimental conditions. High-resolution structural methods, such as X-ray crystallography and NMR spectroscopy, have been of limited usefulness in resolving the inherent structural polymorphism associated with G-quadruplex formation. The lack of, or the ambiguous nature of, currently available high-resolution structural data, in turn, has severely hindered investigations into the nature of these structures and their interactions with small-molecule inhibitors. We have used molecular dynamics in conjunction with hydrodynamic bead modeling to study the structures of the human telomeric G-quadruplex-forming sequences at the atomic level. We demonstrated that molecular dynamics can reproduce experimental hydrodynamic measurements and thus can be a powerful tool in the structural study of existing G-quadruplex sequences or in the prediction of new G-quadruplex structures. PMID:24779348

Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

PubMed

Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

2005-05-01

A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

High resolution phoswich gamma-ray imager utilizing monolithic MPPC arrays with submillimeter pixelized crystals

NASA Astrophysics Data System (ADS)

Kato, T.; Kataoka, J.; Nakamori, T.; Kishimoto, A.; Yamamoto, S.; Sato, K.; Ishikawa, Y.; Yamamura, K.; Kawabata, N.; Ikeda, H.; Kamada, K.

2013-05-01

We report the development of a high spatial resolution tweezers-type coincidence gamma-ray camera for medical imaging. This application consists of large-area monolithic Multi-Pixel Photon Counters (MPPCs) and submillimeter pixelized scintillator matrices. The MPPC array has 4 × 4 channels with a three-side buttable, very compact package. For typical operational gain of 7.5 × 105 at + 20 °C, gain fluctuation over the entire MPPC device is only ± 5.6%, and dark count rates (as measured at the 1 p.e. level) amount to <= 400 kcps per channel. We selected Ce-doped (Lu,Y)2(SiO4)O (Ce:LYSO) and a brand-new scintillator, Ce-doped Gd3Al2Ga3O12 (Ce:GAGG) due to their high light yield and density. To improve the spatial resolution, these scintillators were fabricated into 15 × 15 matrices of 0.5 × 0.5 mm2 pixels. The Ce:LYSO and Ce:GAGG scintillator matrices were assembled into phosphor sandwich (phoswich) detectors, and then coupled to the MPPC array along with an acrylic light guide measuring 1 mm thick, and with summing operational amplifiers that compile the signals into four position-encoded analog outputs being used for signal readout. Spatial resolution of 1.1 mm was achieved with the coincidence imaging system using a 22Na point source. These results suggest that the gamma-ray imagers offer excellent potential for applications in high spatial medical imaging.

Transcription factor mutations in myelodysplastic/myeloproliferative neoplasms

PubMed Central

Ernst, Thomas; Chase, Andrew; Zoi, Katerina; Waghorn, Katherine; Hidalgo-Curtis, Claire; Score, Joannah; Jones, Amy; Grand, Francis; Reiter, Andreas; Hochhaus, Andreas; Cross, Nicholas C.P.

2010-01-01

Background Aberrant activation of tyrosine kinases, caused by either mutation or gene fusion, is of major importance for the development of many hematologic malignancies, particularly myeloproliferative neoplasms. We hypothesized that hitherto unrecognized, cytogenetically cryptic tyrosine kinase fusions may be common in non-classical or atypical myeloproliferative neoplasms and related myelodysplastic/myeloproliferative neoplasms. Design and Methods To detect genomic copy number changes associated with such fusions, we performed a systematic search in 68 patients using custom designed, targeted, high-resolution array comparative genomic hybridization. Arrays contained 44,000 oligonucleotide probes that targeted 500 genes including all 90 tyrosine kinases plus downstream tyrosine kinase signaling components, other translocation targets, transcription factors, and other factors known to be important for myelopoiesis. Results No abnormalities involving tyrosine kinases were detected; however, nine cytogenetically cryptic copy number imbalances were detected in seven patients, including hemizygous deletions of RUNX1 or CEBPA in two cases with atypical chronic myeloid leukemia. Mutation analysis of the remaining alleles revealed non-mutated RUNX1 and a frameshift insertion within CEBPA. A further mutation screen of 187 patients with myelodysplastic/myeloproliferative neoplasms identified RUNX1 mutations in 27 (14%) and CEBPA mutations in seven (4%) patients. Analysis of other transcription factors known to be frequently mutated in acute myeloid leukemia revealed NPM1 mutations in six (3%) and WT1 mutations in two (1%) patients with myelodysplastic/myeloproliferative neoplasms. Univariate analysis indicated that patients with mutations had a shorter overall survival (28 versus 44 months, P=0.019) compared with patients without mutations, with the prognosis for cases with CEBPA, NPM1 or WT1 mutations being particularly poor. Conclusions We conclude that mutations of transcription and other nuclear factors are frequent in myelodysplastic/myeloproliferative neoplasms and are generally mutually exclusive. CEBPA, NPM1 or WT1 mutations may be associated with a poor prognosis, an observation that will need to be confirmed by detailed prospective studies. PMID:20421268

On Super-Resolution and the MUSIC Algorithm,

DTIC Science & Technology

1985-05-01

SUPER-RESOLUTION AND THE MUSIC ALGORITHM AUTHOR: G D de Villiers DATE: May 1985 SUMMARY Simulation results for phased array signal processing using...the MUSIC algorithm are presented. The model used is more realistic than previous ones and it gives an indication as to how the algorithm would perform...resolution ON SUPER-RESOLUTION AND THE MUSIC ALGORITHM 1. INTRODUCTION At present there is a considerable amount of interest in "high-resolution" b

Highlighting the history of Japanese radio astronomy. 5: The 1950 Osaka solar grating array proposal

NASA Astrophysics Data System (ADS)

Wendt, Harry; Orchiston, Wayne; Ishiguro, Masato; Nakamura, Tsuko

2017-04-01

In November 1950, a paper was presented at the 5th Annual Assembly of the Physical Society of Japan that outlined the plan for a radio frequency grating array, designed to provide high-resolution observations of solar radio emission at 3.3 GHz. This short paper provides details of the invention of this array, which occurred independently of W.N. Christiansen's invention of the solar grating array in Australia at almost the same time.

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

Camera array based light field microscopy

PubMed Central

Lin, Xing; Wu, Jiamin; Zheng, Guoan; Dai, Qionghai

2015-01-01

This paper proposes a novel approach for high-resolution light field microscopy imaging by using a camera array. In this approach, we apply a two-stage relay system for expanding the aperture plane of the microscope into the size of an imaging lens array, and utilize a sensor array for acquiring different sub-apertures images formed by corresponding imaging lenses. By combining the rectified and synchronized images from 5 × 5 viewpoints with our prototype system, we successfully recovered color light field videos for various fast-moving microscopic specimens with a spatial resolution of 0.79 megapixels at 30 frames per second, corresponding to an unprecedented data throughput of 562.5 MB/s for light field microscopy. We also demonstrated the use of the reported platform for different applications, including post-capture refocusing, phase reconstruction, 3D imaging, and optical metrology. PMID:26417490

Wide-bandwidth high-resolution search for extraterrestrial intelligence

NASA Technical Reports Server (NTRS)

Horowitz, Paul

1992-01-01

This interim report summarizes the research accomplished during the initial 6-month period of the grant. Activities associated with antenna configurations, the channelizing downconverter, the fast Fourier transform array, the DSP (digital signal processing) array, and the backend and UNIX workstation are discussed. Publications submitted during the reporting period are listed.

Wavelength scanning achieves pixel super-resolution in holographic on-chip microscopy

NASA Astrophysics Data System (ADS)

Luo, Wei; Göröcs, Zoltan; Zhang, Yibo; Feizi, Alborz; Greenbaum, Alon; Ozcan, Aydogan

2016-03-01

Lensfree holographic on-chip imaging is a potent solution for high-resolution and field-portable bright-field imaging over a wide field-of-view. Previous lensfree imaging approaches utilize a pixel super-resolution technique, which relies on sub-pixel lateral displacements between the lensfree diffraction patterns and the image sensor's pixel-array, to achieve sub-micron resolution under unit magnification using state-of-the-art CMOS imager chips, commonly used in e.g., mobile-phones. Here we report, for the first time, a wavelength scanning based pixel super-resolution technique in lensfree holographic imaging. We developed an iterative super-resolution algorithm, which generates high-resolution reconstructions of the specimen from low-resolution (i.e., under-sampled) diffraction patterns recorded at multiple wavelengths within a narrow spectral range (e.g., 10-30 nm). Compared with lateral shift-based pixel super-resolution, this wavelength scanning approach does not require any physical shifts in the imaging setup, and the resolution improvement is uniform in all directions across the sensor-array. Our wavelength scanning super-resolution approach can also be integrated with multi-height and/or multi-angle on-chip imaging techniques to obtain even higher resolution reconstructions. For example, using wavelength scanning together with multi-angle illumination, we achieved a halfpitch resolution of 250 nm, corresponding to a numerical aperture of 1. In addition to pixel super-resolution, the small scanning steps in wavelength also enable us to robustly unwrap phase, revealing the specimen's optical path length in our reconstructed images. We believe that this new wavelength scanning based pixel super-resolution approach can provide competitive microscopy solutions for high-resolution and field-portable imaging needs, potentially impacting tele-pathology applications in resource-limited-settings.

Spectrum of SMARCB1/INI1 Mutations in Familial and Sporadic Rhabdoid Tumors

PubMed Central

Eaton, Katherine W.; Tooke, Laura S.; Wainwright, Luanne M.; Judkins, Alexander R.; Biegel, Jaclyn A.

2011-01-01

Background Germline mutations and deletions of SMARCB1/INI1 in chromosome band 22q11.2 predispose patients to rhabdoid tumor and schwannomatosis. Previous estimates suggested that 15–20% of rhabdoid tumors were caused by an underlying germline abnormality of SMARCB1. However, these studies were limited by case selection and an inability to detect intragenic deletions and duplications. Procedure One hundred matched tumor and blood samples from patients with rhabdoid tumors of the brain, kidney, or soft tissues were analyzed for mutations and deletions of SMARCB1 by FISH, multiplex ligation-dependent probe amplification (MLPA), sequence analysis and high resolution Illumina 610K SNP based oligonucleotide array studies. Results Thirty-five of 100 patients were found to have a germline SMARCB1 abnormality. These abnormalities included point and frameshift mutations, intragenic deletions and duplications, and larger deletions including regions both proximal and distal to SMARCB1. There were 9 cases that demonstrated parent to child transmission of a mutated copy of SMARCB1. In 8 of the 9 cases, one or more family members were also diagnosed with rhabdoid tumor or schwannoma, and 2 of the 8 families presented with multiple affected children in a manner consistent with gonadal mosaicism. Conclusions Approximately one third of newly diagnosed patients with rhabdoid tumor have an underlying genetic predisposition to tumors due to a germline SMARCB1 alteration. Families may demonstrate incomplete penetrance and gonadal mosaicism, which must be considered when counseling families of patients with rhabdoid tumor. PMID:21108436

Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

PubMed

Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

2015-12-01

Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

LOFAR facet callibration

DOE PAGES

Weeren, R. J. van; Williams, W. L.; Hardcastle, M. J.; ...

2016-03-07

LOFAR, the Low-Frequency Array, is a powerful new radio telescope operating between 10 and 240 MHz. LOFAR allows detailed sensitive high-resolution studies of the low-frequency radio sky. At the same time LOFAR also provides excellent short baseline coverage to map di use extended emission. However, producing high-quality deep images is challenging due to the presence of direction dependent calibration errors, caused by imperfect knowledge of the station beam shapes and the ionosphere. Furthermore, the large data volume and presence of station clock errors present additional di culties. In this paper we present a new calibration scheme, which we name facetmore » calibration, to obtain deep high-resolution LOFAR High Band Antenna images using the Dutch part of the array. This scheme solves and corrects the direction dependent errors in a number of facets that cover the observed eld of view. Facet calibration provides close to thermal noise limited images for a typical 8 hr observing run at ~5'' resolution, meeting the speci cations of the LOFAR Tier-1 northern survey.« less

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Polystyrene negative resist for high-resolution electron beam lithography

PubMed Central

2011-01-01

We studied the exposure behavior of low molecular weight polystyrene as a negative tone electron beam lithography (EBL) resist, with the goal of finding the ultimate achievable resolution. It demonstrated fairly well-defined patterning of a 20-nm period line array and a 15-nm period dot array, which are the densest patterns ever achieved using organic EBL resists. Such dense patterns can be achieved both at 20 and 5 keV beam energies using different developers. In addition to its ultra-high resolution capability, polystyrene is a simple and low-cost resist with easy process control and practically unlimited shelf life. It is also considerably more resistant to dry etching than PMMA. With a low sensitivity, it would find applications where negative resist is desired and throughput is not a major concern. PMID:21749679

Molecular understanding of mutagenicity using potential energy methods. Progress report, July 1, 1992--September 30, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Broyde, S.; Shapiro, R.

1993-09-01

Our objective has been to elucidate on a molecular level, at atomic resolution, the structures of DNAs modified by highly mutagenic aromatic amines and hydrocarbons. The underlying hypothesis is that DNA replicates with reduced fidelity when its normal right-handed B-structure is altered, and one result is a higher mutation rate. This change in structure may occur normally at a low incidence but it may be enhanced greatly after covalent modification by a mutagenic substance. The methods that we use to elucidate structures are computational, but we keep in close contact with experimental developments, and we incorporate data from NMR studiesmore » in our calculations when they are available. X-ray and low resolution spectroscopic studies have not succeeded in producing atomic resolution views of mutagen and carcinogen-oligonucleotide adducts. Even the high resolution NMR method cannot alone yield molecular views, though it does so in combination with our computations. The specific methods that we employ are minimized potential energy calculations using the torsion angle space molecular mechanics program DUPLEX to yield static views. Molecular dynamics simulations of static structures with solvent and salt can be carried out with the program AMBER; this yields mobile views in a medium that mimics aspects of the natural aqueous environment of the cell.« less

High-throughput ultraviolet photoacoustic microscopy with multifocal excitation

NASA Astrophysics Data System (ADS)

Imai, Toru; Shi, Junhui; Wong, Terence T. W.; Li, Lei; Zhu, Liren; Wang, Lihong V.

2018-03-01

Ultraviolet photoacoustic microscopy (UV-PAM) is a promising intraoperative tool for surgical margin assessment (SMA), one that can provide label-free histology-like images with high resolution. In this study, using a microlens array and a one-dimensional (1-D) array ultrasonic transducer, we developed a high-throughput multifocal UV-PAM (MF-UV-PAM). Our new system achieved a 1.6 ± 0.2 μm lateral resolution and produced images 40 times faster than the previously developed point-by-point scanning UV-PAM. MF-UV-PAM provided a readily comprehensible photoacoustic image of a mouse brain slice with specific absorption contrast in ˜16 min, highlighting cell nuclei. Individual cell nuclei could be clearly resolved, showing its practical potential for intraoperative SMA.

Etalon Array Reconstructive Spectrometry

NASA Astrophysics Data System (ADS)

Huang, Eric; Ma, Qian; Liu, Zhaowei

2017-01-01

Compact spectrometers are crucial in areas where size and weight may need to be minimized. These types of spectrometers often contain no moving parts, which makes for an instrument that can be highly durable. With the recent proliferation in low-cost and high-resolution cameras, camera-based spectrometry methods have the potential to make portable spectrometers small, ubiquitous, and cheap. Here, we demonstrate a novel method for compact spectrometry that uses an array of etalons to perform spectral encoding, and uses a reconstruction algorithm to recover the incident spectrum. This spectrometer has the unique capability for both high resolution and a large working bandwidth without sacrificing sensitivity, and we anticipate that its simplicity makes it an excellent candidate whenever a compact, robust, and flexible spectrometry solution is needed.

Spatial resolution limitation of liquid crystal spatial light modulator

NASA Astrophysics Data System (ADS)

Wang, Xinghua; Wang, Bin; McManamon, Paul F., III; Pouch, John J.; Miranda, Felix A.; Anderson, James E.; Bos, Philip J.

2004-10-01

The effect of fringing electric fields in a liquid crystal (LC) Optical Phased Array (OPA), also referred to as a spatial light modulator (SLM), is a governing factor that determines the diffraction efficiency (DE) of the LC OPA for high resolution spatial phase modulation. In this article, the fringing field effect in a high resolution LC OPA is studied by accurate modeling the DE of the LC blazed gratings by LC director simulation and Finite Difference Time Domain (FDTD) simulation. Influence factors that contribute significantly to the DE are discussed. Such results provide fundamental understanding for high resolution LC devices.

Detecting novel genes with sparse arrays

PubMed Central

Haiminen, Niina; Smit, Bart; Rautio, Jari; Vitikainen, Marika; Wiebe, Marilyn; Martinez, Diego; Chee, Christine; Kunkel, Joe; Sanchez, Charles; Nelson, Mary Anne; Pakula, Tiina; Saloheimo, Markku; Penttilä, Merja; Kivioja, Teemu

2014-01-01

Species-specific genes play an important role in defining the phenotype of an organism. However, current gene prediction methods can only efficiently find genes that share features such as sequence similarity or general sequence characteristics with previously known genes. Novel sequencing methods and tiling arrays can be used to find genes without prior information and they have demonstrated that novel genes can still be found from extensively studied model organisms. Unfortunately, these methods are expensive and thus are not easily applicable, e.g., to finding genes that are expressed only in very specific conditions. We demonstrate a method for finding novel genes with sparse arrays, applying it on the 33.9 Mb genome of the filamentous fungus Trichoderma reesei. Our computational method does not require normalisations between arrays and it takes into account the multiple-testing problem typical for analysis of microarray data. In contrast to tiling arrays, that use overlapping probes, only one 25mer microarray oligonucleotide probe was used for every 100 b. Thus, only relatively little space on a microarray slide was required to cover the intergenic regions of a genome. The analysis was done as a by-product of a conventional microarray experiment with no additional costs. We found at least 23 good candidates for novel transcripts that could code for proteins and all of which were expressed at high levels. Candidate genes were found to neighbour ire1 and cre1 and many other regulatory genes. Our simple, low-cost method can easily be applied to finding novel species-specific genes without prior knowledge of their sequence properties. PMID:20691772

ALMA Observations of Dust Polarization and Molecular Line Emission from the Class 0 Protostellar Source Serpens SMM1

NASA Astrophysics Data System (ADS)

Hull, Charles L. H.; Girart, Josep M.; Tychoniec, Łukasz; Rao, Ramprasad; Cortés, Paulo C.; Pokhrel, Riwaj; Zhang, Qizhou; Houde, Martin; Dunham, Michael M.; Kristensen, Lars E.; Lai, Shih-Ping; Li, Zhi-Yun; Plambeck, Richard L.

2017-10-01

We present high angular resolution dust polarization and molecular line observations carried out with the Atacama Large Millimeter/submillimeter Array (ALMA) toward the Class 0 protostar Serpens SMM1. By complementing these observations with new polarization observations from the Submillimeter Array (SMA) and archival data from the Combined Array for Research in Millimeter-wave Astronomy (CARMA) and the James Clerk Maxwell Telescopes (JCMT), we can compare the magnetic field orientations at different spatial scales. We find major changes in the magnetic field orientation between large (˜0.1 pc) scales—where the magnetic field is oriented E-W, perpendicular to the major axis of the dusty filament where SMM1 is embedded—and the intermediate and small scales probed by CARMA (˜1000 au resolution), the SMA (˜350 au resolution), and ALMA (˜140 au resolution). The ALMA maps reveal that the redshifted lobe of the bipolar outflow is shaping the magnetic field in SMM1 on the southeast side of the source; however, on the northwestern side and elsewhere in the source, low-velocity shocks may be causing the observed chaotic magnetic field pattern. High-spatial-resolution continuum and spectral-line observations also reveal a tight (˜130 au) protobinary system in SMM1-b, the eastern component of which is launching an extremely high-velocity, one-sided jet visible in both {CO}(J=2\\to 1) and {SiO}(J=5\\to 4); however, that jet does not appear to be shaping the magnetic field. These observations show that with the sensitivity and resolution of ALMA, we can now begin to understand the role that feedback (e.g., from protostellar outflows) plays in shaping the magnetic field in very young, star-forming sources like SMM1.

Development of a novel depth of interaction PET detector using highly multiplexed G-APD cross-strip encoding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolb, A., E-mail: armin.kolb@med.uni-tuebingen.de; Parl, C.; Liu, C. C.

Purpose: The aim of this study was to develop a prototype PET detector module for a combined small animal positron emission tomography and magnetic resonance imaging (PET/MRI) system. The most important factor for small animal imaging applications is the detection sensitivity of the PET camera, which can be optimized by utilizing longer scintillation crystals. At the same time, small animal PET systems must yield a high spatial resolution. The measured object is very close to the PET detector because the bore diameter of a high field animal MR scanner is limited. When used in combination with long scintillation crystals, thesemore » small-bore PET systems generate parallax errors that ultimately lead to a decreased spatial resolution. Thus, we developed a depth of interaction (DoI) encoding PET detector module that has a uniform spatial resolution across the whole field of view (FOV), high detection sensitivity, compactness, and insensitivity to magnetic fields. Methods: The approach was based on Geiger mode avalanche photodiode (G-APD) detectors with cross-strip encoding. The number of readout channels was reduced by a factor of 36 for the chosen block elements. Two 12 × 2 G-APD strip arrays (25μm cells) were placed perpendicular on each face of a 12 × 12 lutetium oxyorthosilicate crystal block with a crystal size of 1.55 × 1.55 × 20 mm. The strip arrays were multiplexed into two channels and used to calculate the x, y coordinates for each array and the deposited energy. The DoI was measured in step sizes of 1.8 mm by a collimated {sup 18}F source. The coincident resolved time (CRT) was analyzed at all DoI positions by acquiring the waveform for each event and applying a digital leading edge discriminator. Results: All 144 crystals were well resolved in the crystal flood map. The average full width half maximum (FWHM) energy resolution of the detector was 12.8% ± 1.5% with a FWHM CRT of 1.14 ± 0.02 ns. The average FWHM DoI resolution over 12 crystals was 2.90 ± 0.15 mm. Conclusions: The novel DoI PET detector, which is based on strip G-APD arrays, yielded a DoI resolution of 2.9 mm and excellent timing and energy resolution. Its high multiplexing factor reduces the number of electronic channels. Thus, this cross-strip approach enables low-cost, high-performance PET detectors for dedicated small animal PET and PET/MRI and potentially clinical PET/MRI systems.« less

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

PubMed Central

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-01-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Nuclear resonant scattering measurements on (57)Fe by multichannel scaling with a 64-pixel silicon avalanche photodiode linear-array detector.

PubMed

Kishimoto, S; Mitsui, T; Haruki, R; Yoda, Y; Taniguchi, T; Shimazaki, S; Ikeno, M; Saito, M; Tanaka, M

2014-11-01

We developed a silicon avalanche photodiode (Si-APD) linear-array detector for use in nuclear resonant scattering experiments using synchrotron X-rays. The Si-APD linear array consists of 64 pixels (pixel size: 100 × 200 μm(2)) with a pixel pitch of 150 μm and depletion depth of 10 μm. An ultrafast frontend circuit allows the X-ray detector to obtain a high output rate of >10(7) cps per pixel. High-performance integrated circuits achieve multichannel scaling over 1024 continuous time bins with a 1 ns resolution for each pixel without dead time. The multichannel scaling method enabled us to record a time spectrum of the 14.4 keV nuclear radiation at each pixel with a time resolution of 1.4 ns (FWHM). This method was successfully applied to nuclear forward scattering and nuclear small-angle scattering on (57)Fe.

Challenges, constraints, and results of lens design for 17 micron-bolometer focal plane arrays in 8-12 micron waveband

NASA Astrophysics Data System (ADS)

Schuster, Norbert; Franks, John

2011-06-01

In the 8-12 micron waveband Focal Plane Arrays (FPA) are available with a 17 micron pixel pitch in different arrays sizes (e.g. 512 x 480 pixels and 320 x 240 pixels) and with excellent electrical properties. Many applications become possible using this new type of IR-detector which will become the future standard in uncooled technology. Lenses with an f-number faster than f/1.5 minimize the diffraction impact on the spatial resolution and guarantee a high thermal resolution for uncooled cameras. Both effects will be quantified. The distinction between Traditional f-number (TF) and Radiometric f-number (RF) is discussed. Lenses with different focal lengths are required for applications in a variety of markets. They are classified by their Horizontal field of view (HFOV). Respecting the requirements for high volume markets, several two lens solutions will be discussed. A commonly accepted parameter of spatial resolution is the Modulation Transfer Function (MTF)-value at the Nyquist frequency of the detector (here 30cy/mm). This parameter of resolution will be presented versus field of view. Wide Angle and Super Wide Angle lenses are susceptible to low relative illumination in the corner of the detector. Measures to reduce this drop to an acceptable value are presented.

Engineering Improvements in a Bacterial Therapeutic Delivery System for Breast Cancer

DTIC Science & Technology

2009-09-01

curve is observed on the other platform (Supplementary Figure 2H). Although it is not the object of this article to explore a physical explanation for...light-directed oligonucleotide microarrays using a digital micromirror array.. Nat Biotechnol, 17(10), 974–978. [12] Matveeva, O. V., Shabalina, S. A...Rouillard, J. M., Whittam, T. S., Gulari, E., Tiedje, J. M., and Hashsham, S. A. (2006) On- chip non-equilibrium dissociation curves and dissociation

Crystal-Structure-Guided Design of Self-Assembling RNA Nanotriangles.

PubMed

Boerneke, Mark A; Dibrov, Sergey M; Hermann, Thomas

2016-03-14

RNA nanotechnology uses RNA structural motifs to build nanosized architectures that assemble through selective base-pair interactions. Herein, we report the crystal-structure-guided design of highly stable RNA nanotriangles that self-assemble cooperatively from short oligonucleotides. The crystal structure of an 81 nucleotide nanotriangle determined at 2.6 Å resolution reveals the so-far smallest circularly closed nanoobject made entirely of double-stranded RNA. The assembly of the nanotriangle architecture involved RNA corner motifs that were derived from ligand-responsive RNA switches, which offer the opportunity to control self-assembly and dissociation. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Improving resistivity survey resolution at sites with limited spatial extent using buried electrode arrays

NASA Astrophysics Data System (ADS)

Kiflu, H.; Kruse, S.; Loke, M. H.; Wilkinson, P. B.; Harro, D.

2016-12-01

Electrical resistivity tomography (ERT) surveys are widely used in geological, environmental and engineering studies. However, the effectiveness of surface ERT surveys is limited by decreasing resolution with depth and near the ends of the survey line. Increasing the array length will increase depth of investigation, but may not be possible at urban sites where access is limited. One novel method of addressing these limitations while maintaining lateral coverage is to install an array of deep electrodes. Referred to here as the Multi-Electrode Resistivity Implant Technique (MERIT), self-driving pointed electrodes are implanted at depth below each surface electrode in an array, using direct-push technology. Optimal sequences of readings have been identified with the "Compare R" method of Wilkinson. Numerical, laboratory, and field case studies are applied to examine the effectiveness of the MERIT method, particularly for use in covered karst terrain. In the field case studies, resistivity images are compared against subsurface structure defined from borings, GPR surveys, and knowledge of prior land use. In karst terrain where limestone has a clay overburden, traditional surface resistivity methods suffer from lack of current penetration through the shallow clay layer. In these settings, the MERIT method is found to improve resolution of features between the surface and buried array, as well as increasing depth of penetration and enhancing imaging capabilities at the array ends. The method functions similar to a cross-borehole array between horizontal boreholes, and suffers from limitations common to borehole arrays. Inversion artifacts are common at depths close to the buried array, and because some readings involve high geometric factors, inversions are more susceptible to noise than traditional surface arrays. Results are improved by using errors from reciprocal measurements to weight the data during the inversion.

Long-range speckle imaging theory, simulation, and brassboard results

NASA Astrophysics Data System (ADS)

Riker, Jim F.; Tyler, Glenn A.; Vaughn, Jeff L.

2017-09-01

In the SPIE 2016 Unconventional Imaging session, the authors laid out a breakthrough new theory for active array imaging that exploits the speckle return to generate a high-resolution picture of the target. Since then, we have pursued that theory even in long-range (<1000-km) engagement scenarios and shown how we can obtain that high-resolution image of the target using only a few illuminators, or by using many illuminators. There is a trade of illuminators versus receivers, but many combinations provide the same synthetic aperture resolution. We will discuss that trade, along with the corresponding radiometric and speckle-imaging Signal-to-Noise Ratios (SNR) for geometries that can fit on relatively small aircraft, such as an Unmanned Aerial Vehicle (UAV). Furthermore, we have simulated the performance of the technique, and we have created a laboratory version of the approach that is able to obtain high-resolution speckle imagery. The principal results presented in this paper are the Signal to Noise Ratios (SNR) for both the radiometric and the speckle imaging portions of the problem, and the simulated results obtained for representative arrays.

Filling the gap: adding super-resolution to array tomography for correlated ultrastructural and molecular identification of electrical synapses at the C. elegans connectome.

PubMed

Markert, Sebastian Matthias; Britz, Sebastian; Proppert, Sven; Lang, Marietta; Witvliet, Daniel; Mulcahy, Ben; Sauer, Markus; Zhen, Mei; Bessereau, Jean-Louis; Stigloher, Christian

2016-10-01

Correlating molecular labeling at the ultrastructural level with high confidence remains challenging. Array tomography (AT) allows for a combination of fluorescence and electron microscopy (EM) to visualize subcellular protein localization on serial EM sections. Here, we describe an application for AT that combines near-native tissue preservation via high-pressure freezing and freeze substitution with super-resolution light microscopy and high-resolution scanning electron microscopy (SEM) analysis on the same section. We established protocols that combine SEM with structured illumination microscopy (SIM) and direct stochastic optical reconstruction microscopy (dSTORM). We devised a method for easy, precise, and unbiased correlation of EM images and super-resolution imaging data using endogenous cellular landmarks and freely available image processing software. We demonstrate that these methods allow us to identify and label gap junctions in Caenorhabditis elegans with precision and confidence, and imaging of even smaller structures is feasible. With the emergence of connectomics, these methods will allow us to fill in the gap-acquiring the correlated ultrastructural and molecular identity of electrical synapses.

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

Synthetic aperture radar images with composite azimuth resolution

DOEpatents

Bielek, Timothy P; Bickel, Douglas L

2015-03-31

A synthetic aperture radar (SAR) image is produced by using all phase histories of a set of phase histories to produce a first pixel array having a first azimuth resolution, and using less than all phase histories of the set to produce a second pixel array having a second azimuth resolution that is coarser than the first azimuth resolution. The first and second pixel arrays are combined to produce a third pixel array defining a desired SAR image that shows distinct shadows of moving objects while preserving detail in stationary background clutter.

Human telomeres that contain (CTAGGG)n repeats show replication dependent instability in somatic cells and the male germline

PubMed Central

Mendez-Bermudez, Aaron; Hills, Mark; Pickett, Hilda A.; Phan, Anh Tuân; Mergny, Jean-Louis; Riou, Jean-François; Royle, Nicola J.

2009-01-01

A number of different processes that impact on telomere length dynamics have been identified but factors that affect the turnover of repeats located proximally within the telomeric DNA are poorly defined. We have identified a particular repeat type (CTAGGG) that is associated with an extraordinarily high mutation rate (20% per gamete) in the male germline. The mutation rate is affected by the length and sequence homogeneity of the (CTAGGG)n array. This level of instability was not seen with other sequence-variant repeats, including the TCAGGG repeat type that has the same composition. Telomeres carrying a (CTAGGG)n array are also highly unstable in somatic cells with the mutation process resulting in small gains or losses of repeats that also occasionally result in the deletion of the whole (CTAGGG)n array. These sequences are prone to quadruplex formation in vitro but adopt a different topology from (TTAGGG)n (see accompanying article). Interestingly, short (CTAGGG)2 oligonucleotides induce a DNA damage response (γH2AX foci) as efficiently as (TTAGGG)2 oligos in normal fibroblast cells, suggesting they recruit POT1 from the telomere. Moreover, in vitro assays show that (CTAGGG)n repeats bind POT1 more efficiently than (TTAGGG)n or (TCAGGG)n. We estimate that 7% of human telomeres contain (CTAGGG)n repeats and when present, they create additional problems that probably arise during telomere replication. PMID:19656953

Microsphere-assisted super-resolution imaging with enlarged numerical aperture by semi-immersion

NASA Astrophysics Data System (ADS)

Wang, Fengge; Yang, Songlin; Ma, Huifeng; Shen, Ping; Wei, Nan; Wang, Meng; Xia, Yang; Deng, Yun; Ye, Yong-Hong

2018-01-01

Microsphere-assisted imaging is an extraordinary simple technology that can obtain optical super-resolution under white-light illumination. Here, we introduce a method to improve the resolution of a microsphere lens by increasing its numerical aperture. In our proposed structure, BaTiO3 glass (BTG) microsphere lenses are semi-immersed in a S1805 layer with a refractive index of 1.65, and then, the semi-immersed microspheres are fully embedded in an elastomer with an index of 1.4. We experimentally demonstrate that this structure, in combination with a conventional optical microscope, can clearly resolve a two-dimensional 200-nm-diameter hexagonally close-packed (hcp) silica microsphere array. On the contrary, the widely used structure where BTG microsphere lenses are fully immersed in a liquid or elastomer cannot even resolve a 250-nm-diameter hcp silica microsphere array. The improvement in resolution through the proposed structure is due to an increase in the effective numerical aperture by semi-immersing BTG microsphere lenses in a high-refractive-index S1805 layer. Our results will inform on the design of microsphere-based high-resolution imaging systems.

Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

PubMed

Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

1993-02-01

Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

In situ oligonucleotide synthesis on poly(dimethylsiloxane): a flexible substrate for microarray fabrication

PubMed Central

Moorcroft, Matthew J.; Meuleman, Wouter R. A.; Latham, Steven G.; Nicholls, Thomas J.; Egeland, Ryan D.; Southern, Edwin M.

2005-01-01

In this paper, we demonstrate in situ synthesis of oligonucleotide probes on poly(dimethylsiloxane) (PDMS) microchannels through use of conventional phosphoramidite chemistry. PDMS polymer was moulded into a series of microchannels using standard soft lithography (micro-moulding), with dimensions <100 μm. The surface of the PDMS was derivatized by exposure to ultraviolet/ozone followed by vapour phase deposition of glycidoxypropyltrimethoxysilane and reaction with poly(ethylene glycol) spacer, resulting in a reactive surface for oligonucleotide coupling. High, reproducible yields were achieved for both 6mer and 21mer probes as assessed by hybridization to fluorescent oligonucleotides. Oligonucleotide surface density was comparable with that obtained on glass substrates. These results suggest PDMS as a stable and flexible alternative to glass as a suitable substrate in the fabrication and synthesis of DNA microarrays. PMID:15870385

Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

PubMed Central

Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

1993-01-01

We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

Alternative Optimizations of X-ray TES Arrays: Soft X-rays, High Count Rates, and Mixed-Pixel Arrays

NASA Technical Reports Server (NTRS)

Kilbourne, C. A.; Bandler, S. R.; Brown, A.-D.; Chervenak, J. A.; Figueroa-Feliciano, E.; Finkbeiner, F. M.; Iyomoto, N.; Kelley, R. L.; Porter, F. S.; Smith, S. J.

2007-01-01

We are developing arrays of superconducting transition-edge sensors (TES) for imaging spectroscopy telescopes such as the XMS on Constellation-X. While our primary focus has been on arrays that meet the XMS requirements (of which, foremost, is an energy resolution of 2.5 eV at 6 keV and a bandpass from approx. 0.3 keV to 12 keV), we have also investigated other optimizations that might be used to extend the XMS capabilities. In one of these optimizations, improved resolution below 1 keV is achieved by reducing the heat capacity. Such pixels can be based on our XMS-style TES's with the separate absorbers omitted. These pixels can added to an array with broadband response either as a separate array or interspersed, depending on other factors that include telescope design and science requirements. In one version of this approach, we have designed and fabricated a composite array of low-energy and broad-band pixels to provide high spectral resolving power over a broader energy bandpass than could be obtained with a single TES design. The array consists of alternating pixels with and without overhanging absorbers. To explore optimizations for higher count rates, we are also optimizing the design and operating temperature of pixels that are coupled to a solid substrate. We will present the performance of these variations and discuss other optimizations that could be used to enhance the XMS or enable other astrophysics experiments.

Alteration in oligonucleotide fingerprint patterns of the viral genome in poliovirus type 2 isolated from paralytic patients.

PubMed Central

Yoneyama, T; Hagiwara, A; Hara, M; Shimojo, H

1982-01-01

A close relationship was demonstrated by oligonucleotide fingerprinting between genomes of the poliovirus type 2 Sabin vaccine strain and recent isolates from paralytic cases associated with vaccination in Japan. The oligonucleotide maps of isolates from an agammaglobulinemic patient, who continued to excrete poliovirus type 2 for 3.5 years after the administration of oral vaccine, showed that the genomic alteration proceeded gradually, retaining the majority of the oligonucleotides characteristic of the vaccine strain for a long period, indicating vaccine origin for the isolates. The final isolate at month 41, however, lost the majority of these oligonucleotides. The heterologous antigenic relationship between the final isolate and the previous isolates was also observed. The serial alteration in electrophoretic mobility of the major structural proteins (VP1, VP2, and VP3) was observed throughout the excreting period. These results indicate that the population of the virus in this individual changed markedly during the last short period (about 3 months), in which the treatment with secretory immunoglobulin A was carried out. Genome comparisons in oligonucleotide maps show that some oligonucleotides in the genome of the vaccine strain are highly mutable after passage in humans. Images PMID:6179881

Close-packed Arrays of Transition-edge X-ray Microcalorimeters with High Spectral Resolution at 5.9 keV

NASA Technical Reports Server (NTRS)

Iyomoto, N.; Bandler, S. R.; Brekosky, R. P.; Brown, A.-D.; Chervenak, J. A.; Finkbeiner, F. M.; Kelley, R. L.; Kilbourne, C. A.; Porter, F. S.; Sadleir, J. E.;

Micromachined array tip for multifocus fiber-based optical coherence tomography.

PubMed

Yang, Victor X D; Munce, Nigel; Pekar, Julius; Gordon, Maggie L; Lo, Stewart; Marcon, Norman E; Wilson, Brian C; Vitkin, I Alex

2004-08-01

High-resolution optical coherence tomography demands a large detector bandwidth and a high numerical aperture for real-time imaging, which is difficult to achieve over a large imaging depth. To resolve these conflicting requirements we propose a novel multifocus fiber-based optical coherence tomography system with a micromachined array tip. We demonstrate the fabrication of a prototype four-channel tip that maintains a 9-14-microm spot diameter with more than 500 microm of imaging depth. Images of a resolution target and a human tooth were obtained with this tip by use of a four-channel cascaded Michelson fiber-optic interferometer, scanned simultaneously at 8 kHz with geometric power distribution across the four channels.

Pulse-encoded ultrasound imaging of the vitreous with an annular array.

PubMed

Silverman, Ronald H; Ketterling, Jeffrey A; Mamou, Jonathan; Lloyd, Harriet O; Filoux, Erwan; Coleman, D Jackson

2012-01-01

The vitreous body is nearly transparent both optically and ultrasonically. Conventional 10- to 12-MHz diagnostic ultrasound can detect vitreous inhomogeneities at high gain settings, but has limited resolution and sensitivity, especially outside the fixed focal zone near the retina. To improve visualization of faint intravitreal fluid/gel interfaces, the authors fabricated a spherically curved 20-MHz five-element annular array ultrasound transducer, implemented a synthetic-focusing algorithm to extend the depth-of-field, and used a pulse-encoding strategy to increase sensitivity. The authors evaluated a human subject with a recent posterior vitreous detachment and compared the annular array with conventional 10-MHz ultrasound and spectral-domain optical coherence tomography. With synthetic focusing and chirp pulse-encoding, the array allowed visualization of the formed and fluid components of the vitreous with improved sensitivity and resolution compared with the conventional B-scan. Although optical coherence tomography allowed assessment of the posterior vitreoretinal interface, the ultrasound array allowed evaluation of the entire vitreous body. Copyright 2012, SLACK Incorporated.

Graphical User Interface for a Dual-Module EMCCD X-ray Detector Array.

PubMed

Wang, Weiyuan; Ionita, Ciprian; Kuhls-Gilcrist, Andrew; Huang, Ying; Qu, Bin; Gupta, Sandesh K; Bednarek, Daniel R; Rudin, Stephen

2011-03-16

A new Graphical User Interface (GUI) was developed using Laboratory Virtual Instrumentation Engineering Workbench (LabVIEW) for a high-resolution, high-sensitivity Solid State X-ray Image Intensifier (SSXII), which is a new x-ray detector for radiographic and fluoroscopic imaging, consisting of an array of Electron-Multiplying CCDs (EMCCDs) each having a variable on-chip electron-multiplication gain of up to 2000× to reduce the effect of readout noise. To enlarge the field-of-view (FOV), each EMCCD sensor is coupled to an x-ray phosphor through a fiberoptic taper. Two EMCCD camera modules are used in our prototype to form a computer-controlled array; however, larger arrays are under development. The new GUI provides patient registration, EMCCD module control, image acquisition, and patient image review. Images from the array are stitched into a 2k×1k pixel image that can be acquired and saved at a rate of 17 Hz (faster with pixel binning). When reviewing the patient's data, the operator can select images from the patient's directory tree listed by the GUI and cycle through the images using a slider bar. Commonly used camera parameters including exposure time, trigger mode, and individual EMCCD gain can be easily adjusted using the GUI. The GUI is designed to accommodate expansion of the EMCCD array to even larger FOVs with more modules. The high-resolution, high-sensitivity EMCCD modular-array SSXII imager with the new user-friendly GUI should enable angiographers and interventionalists to visualize smaller vessels and endovascular devices, helping them to make more accurate diagnoses and to perform more precise image-guided interventions.

Fabrication of X-ray Microcalorimeter Focal Planes Composed of Two Distinct Pixel Types.

PubMed

Wassell, E J; Adams, J S; Bandler, S R; Betancourt-Martinez, G L; Chiao, M P; Chang, M P; Chervenak, J A; Datesman, A M; Eckart, M E; Ewin, A J; Finkbeiner, F M; Ha, J Y; Kelley, R; Kilbourne, C A; Miniussi, A R; Sakai, K; Porter, F; Sadleir, J E; Smith, S J; Wakeham, N A; Yoon, W

2017-06-01

We are developing superconducting transition-edge sensor (TES) microcalorimeter focal planes for versatility in meeting specifications of X-ray imaging spectrometers including high count-rate, high energy resolution, and large field-of-view. In particular, a focal plane composed of two sub-arrays: one of fine-pitch, high count-rate devices and the other of slower, larger pixels with similar energy resolution, offers promise for the next generation of astrophysics instruments, such as the X-ray Integral Field Unit (X-IFU) instrument on the European Space Agency's Athena mission. We have based the sub-arrays of our current design on successful pixel designs that have been demonstrated separately. Pixels with an all gold X-ray absorber on 50 and 75 micron scales where the Mo/Au TES sits atop a thick metal heatsinking layer have shown high resolution and can accommodate high count-rates. The demonstrated larger pixels use a silicon nitride membrane for thermal isolation, thinner Au and an added bismuth layer in a 250 micron square absorber. To tune the parameters of each sub-array requires merging the fabrication processes of the two detector types. We present the fabrication process for dual production of different X-ray absorbers on the same substrate, thick Au on the small pixels and thinner Au with a Bi capping layer on the larger pixels to tune their heat capacities. The process requires multiple electroplating and etching steps, but the absorbers are defined in a single ion milling step. We demonstrate methods for integrating heatsinking of the two types of pixel into the same focal plane consistent with the requirements for each sub-array, including the limiting of thermal crosstalk. We also discuss fabrication process modifications for tuning the intrinsic transition temperature (T c ) of the bilayers for the different device types through variation of the bilayer thicknesses. The latest results on these "hybrid" arrays will be presented.

Fabrication of X-ray Microcalorimeter Focal Planes Composed of Two Distinct Pixel Types

PubMed Central

Wassell, E. J.; Adams, J. S.; Bandler, S. R.; Betancourt-Martinez, G. L.; Chiao, M. P.; Chang, M. P.; Chervenak, J. A.; Datesman, A. M.; Eckart, M. E.; Ewin, A. J.; Finkbeiner, F. M.; Ha, J. Y.; Kelley, R.; Kilbourne, C. A.; Miniussi, A. R.; Sakai, K.; Porter, F.; Sadleir, J. E.; Smith, S. J.; Wakeham, N. A.; Yoon, W.

2017-01-01

We are developing superconducting transition-edge sensor (TES) microcalorimeter focal planes for versatility in meeting specifications of X-ray imaging spectrometers including high count-rate, high energy resolution, and large field-of-view. In particular, a focal plane composed of two sub-arrays: one of fine-pitch, high count-rate devices and the other of slower, larger pixels with similar energy resolution, offers promise for the next generation of astrophysics instruments, such as the X-ray Integral Field Unit (X-IFU) instrument on the European Space Agency’s Athena mission. We have based the sub-arrays of our current design on successful pixel designs that have been demonstrated separately. Pixels with an all gold X-ray absorber on 50 and 75 micron scales where the Mo/Au TES sits atop a thick metal heatsinking layer have shown high resolution and can accommodate high count-rates. The demonstrated larger pixels use a silicon nitride membrane for thermal isolation, thinner Au and an added bismuth layer in a 250 micron square absorber. To tune the parameters of each sub-array requires merging the fabrication processes of the two detector types. We present the fabrication process for dual production of different X-ray absorbers on the same substrate, thick Au on the small pixels and thinner Au with a Bi capping layer on the larger pixels to tune their heat capacities. The process requires multiple electroplating and etching steps, but the absorbers are defined in a single ion milling step. We demonstrate methods for integrating heatsinking of the two types of pixel into the same focal plane consistent with the requirements for each sub-array, including the limiting of thermal crosstalk. We also discuss fabrication process modifications for tuning the intrinsic transition temperature (Tc) of the bilayers for the different device types through variation of the bilayer thicknesses. The latest results on these “hybrid” arrays will be presented. PMID:28804229

Ratiometric fluorescent sensing of pH values in living cells by dual-fluorophore-labeled i-motif nanoprobes.

PubMed

Huang, Jin; Ying, Le; Yang, Xiaohai; Yang, Yanjing; Quan, Ke; Wang, He; Xie, Nuli; Ou, Min; Zhou, Qifeng; Wang, Kemin

2015-09-01

We designed a new ratiometric fluorescent nanoprobe for sensing pH values in living cells. Briefly, the nanoprobe consists of a gold nanoparticle (AuNP), short single-stranded oligonucleotides, and dual-fluorophore-labeled i-motif sequences. The short oligonucleotides are designed to bind with the i-motif sequences and immobilized on the AuNP surface via Au-S bond. At neutral pH, the dual fluorophores are separated, resulting in very low fluorescence resonance energy transfer (FRET) efficiency. At acidic pH, the i-motif strands fold into a quadruplex structure and leave the AuNP, bringing the dual fluorophores into close proximity, resulting in high FRET efficiency, which could be used as a signal for pH sensing. The nanoprobe possesses abilities of cellular transfection, enzymatic protection, fast response and quantitative pH detection. The in vitro and intracellular applications of the nanoprobe were demonstrated, which showed excellent response in the physiological pH range. Furthermore, our experimental results suggested that the nanoprobe showed excellent spatial and temporal resolution in living cells. We think that the ratiometric sensing strategy could potentially be applied to create a variety of new multicolor sensors for intracellular detection.

Array Design: Literature Survey For A High-Resolution Imaging Sonal System. Part 1

DTIC Science & Technology

1993-12-01

radioastronomy or microwave arrays, or it may be elastic or acoustic (same as elastic but .-estricted to fields specified by a scalar quantity). There is...these are direction cosines (or sines) (see Ziomek 1985, or a radioastronomy book such as Perley et al. 1989). This 0 is because the Fourier

Performance of a scintillation detector array operated with LHAASO-KM2A electronics

NASA Astrophysics Data System (ADS)

Wang, Zhen; Guo, Yiqing; Cai, Hui; Chang, Jinfan; Chen, Tianlu; Danzengluobu; Feng, Youliang; Gao, Qi; Gou, Quanbu; Guo, Yingying; Hou, Chao; Hu, Hongbo; Labaciren; Liu, Cheng; Li, Haijin; Liu, Jia; Liu, Maoyuan; Qiao, Bingqiang; Qian, Xiangli; Sheng, Xiangdong; Tian, Zhen; Wang, Qun; Xue, Liang; Yao, Yuhua; Zhang, Shaoru; Zhang, Xueyao; Zhang, Yi

2018-04-01

A scintillation detector array composed of 115 detectors and covering an area of about 20000 m2 was installed at the end of 2016 at the Yangbajing international cosmic ray observatory and has been taking data since then. The array is equipped with electronics from Large High Altitude Air Shower Observatory Square Kilometer Complex Array (LHAASO-KM2A) and, in turn, currently serves as the largest debugging and testing platform for the LHAASO-KM2A. Furthermore, the array was used to study the performance of a wide field-of-view air Cherenkov telescope by providing accurate information on the shower core, direction and energy, etc. This work is mainly dealing with the scintillation detector array. The experimental setup and the offline calibration are described in detail. Then, a thorough comparison between the data and Monte Carlo (MC) simulations is presented and a good agreement is obtained. With the even-odd method, the resolutions of the shower direction and core are measured. Finally, successful observations of the expected Moon's and Sun's shadows of cosmic rays (CRs) verify the measured angular resolution.

Multifrequency Ultra-High Resolution Miniature Scanning Microscope Using Microchannel And Solid-State Sensor Technologies And Method For Scanning Samples

NASA Technical Reports Server (NTRS)

Wang, Yu (Inventor)

2006-01-01

A miniature, ultra-high resolution, and color scanning microscope using microchannel and solid-state technology that does not require focus adjustment. One embodiment includes a source of collimated radiant energy for illuminating a sample, a plurality of narrow angle filters comprising a microchannel structure to permit the passage of only unscattered radiant energy through the microchannels with some portion of the radiant energy entering the microchannels from the sample, a solid-state sensor array attached to the microchannel structure, the microchannels being aligned with an element of the solid-state sensor array, that portion of the radiant energy entering the microchannels parallel to the microchannel walls travels to the sensor element generating an electrical signal from which an image is reconstructed by an external device, and a moving element for movement of the microchannel structure relative to the sample. Discloses a method for scanning samples whereby the sensor array elements trace parallel paths that are arbitrarily close to the parallel paths traced by other elements of the array.

A LYSO crystal array readout by silicon photomultipliers as compact detector for space applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kryemadhi, A.; Barner, L.; Grove, A.

Precise measurements of GeV range gamma rays help narrow down among var- ious gamma emission models and increase sensitivity for dark matter searches. Construction of precise as well as compact instruments requires detectors with high efficiency, high stopping power, excellent energy resolution, and excellent angular resolution. Fast and bright crystal scintillators coupled with small foot- print photo-detectors are suitable candidates. We prototyped a detector array consisting of four LYSO crystals where each crystal is read out by a 2x2 SensL ArrayJ60035 silicon photomultipliers. The LYSO crystals were chosen because of their good light yield, fast decay time, demonstrated radiation hardness,more » and small radiation length. Here, we used the silicon photomultiplier arrays as photo- detectors because of their small size, simple readout, low voltage operation, and immunity to magnetic elds. We also studied the detector performance in the energy range of interest by exposing it to 2-16 GeV particles produced at the Test Beam Facility of Fermi National Accelerator Laboratory.« less

A LYSO crystal array readout by silicon photomultipliers as compact detector for space applications

DOE PAGES

Kryemadhi, A.; Barner, L.; Grove, A.; ...

2017-10-31

Precise measurements of GeV range gamma rays help narrow down among var- ious gamma emission models and increase sensitivity for dark matter searches. Construction of precise as well as compact instruments requires detectors with high efficiency, high stopping power, excellent energy resolution, and excellent angular resolution. Fast and bright crystal scintillators coupled with small foot- print photo-detectors are suitable candidates. We prototyped a detector array consisting of four LYSO crystals where each crystal is read out by a 2x2 SensL ArrayJ60035 silicon photomultipliers. The LYSO crystals were chosen because of their good light yield, fast decay time, demonstrated radiation hardness,more » and small radiation length. Here, we used the silicon photomultiplier arrays as photo- detectors because of their small size, simple readout, low voltage operation, and immunity to magnetic elds. We also studied the detector performance in the energy range of interest by exposing it to 2-16 GeV particles produced at the Test Beam Facility of Fermi National Accelerator Laboratory.« less

A sub-millimeter resolution PET detector module using a multi-pixel photon counter array

NASA Astrophysics Data System (ADS)

Song, Tae Yong; Wu, Heyu; Komarov, Sergey; Siegel, Stefan B.; Tai, Yuan-Chuan

2010-05-01

A PET block detector module using an array of sub-millimeter lutetium oxyorthosilicate (LSO) crystals read out by an array of surface-mount, semiconductor photosensors has been developed. The detector consists of a LSO array, a custom acrylic light guide, a 3 × 3 multi-pixel photon counter (MPPC) array (S10362-11-050P, Hamamatsu Photonics, Japan) and a readout board with a charge division resistor network. The LSO array consists of 100 crystals, each measuring 0.8 × 0.8 × 3 mm3 and arranged in 0.86 mm pitches. A Monte Carlo simulation was used to aid the design and fabrication of a custom light guide to control distribution of scintillation light over the surface of the MPPC array. The output signals of the nine MPPC are multiplexed by a charge division resistor network to generate four position-encoded analog outputs. Flood image, energy resolution and timing resolution measurements were performed using standard NIM electronics. The linearity of the detector response was investigated using gamma-ray sources of different energies. The 10 × 10 array of 0.8 mm LSO crystals was clearly resolved in the flood image. The average energy resolution and standard deviation were 20.0% full-width at half-maximum (FWHM) and ±5.0%, respectively, at 511 keV. The timing resolution of a single MPPC coupled to a LSO crystal was found to be 857 ps FWHM, and the value for the central region of detector module was 1182 ps FWHM when ±10% energy window was applied. The nonlinear response of a single MPPC when used to read out a single LSO was observed among the corner crystals of the proposed detector module. However, the central region of the detector module exhibits significantly less nonlinearity (6.5% for 511 keV). These results demonstrate that (1) a charge-sharing resistor network can effectively multiplex MPPC signals and reduce the number of output signals without significantly degrading the performance of a PET detector and (2) a custom light guide to permit light sharing among multiple MPPC and to diffuse and direct scintillation light can reduce the nonlinearity of the detector response within the limited dynamic range of a typical MPPC. As a result, the proposed PET detector module has the potential to be refined for use in high-resolution PET insert applications.

A sub-millimeter resolution PET detector module using a multi-pixel photon counter array.

PubMed

Song, Tae Yong; Wu, Heyu; Komarov, Sergey; Siegel, Stefan B; Tai, Yuan-Chuan

2010-05-07

A PET block detector module using an array of sub-millimeter lutetium oxyorthosilicate (LSO) crystals read out by an array of surface-mount, semiconductor photosensors has been developed. The detector consists of a LSO array, a custom acrylic light guide, a 3 x 3 multi-pixel photon counter (MPPC) array (S10362-11-050P, Hamamatsu Photonics, Japan) and a readout board with a charge division resistor network. The LSO array consists of 100 crystals, each measuring 0.8 x 0.8 x 3 mm(3) and arranged in 0.86 mm pitches. A Monte Carlo simulation was used to aid the design and fabrication of a custom light guide to control distribution of scintillation light over the surface of the MPPC array. The output signals of the nine MPPC are multiplexed by a charge division resistor network to generate four position-encoded analog outputs. Flood image, energy resolution and timing resolution measurements were performed using standard NIM electronics. The linearity of the detector response was investigated using gamma-ray sources of different energies. The 10 x 10 array of 0.8 mm LSO crystals was clearly resolved in the flood image. The average energy resolution and standard deviation were 20.0% full-width at half-maximum (FWHM) and +/-5.0%, respectively, at 511 keV. The timing resolution of a single MPPC coupled to a LSO crystal was found to be 857 ps FWHM, and the value for the central region of detector module was 1182 ps FWHM when +/-10% energy window was applied. The nonlinear response of a single MPPC when used to read out a single LSO was observed among the corner crystals of the proposed detector module. However, the central region of the detector module exhibits significantly less nonlinearity (6.5% for 511 keV). These results demonstrate that (1) a charge-sharing resistor network can effectively multiplex MPPC signals and reduce the number of output signals without significantly degrading the performance of a PET detector and (2) a custom light guide to permit light sharing among multiple MPPC and to diffuse and direct scintillation light can reduce the nonlinearity of the detector response within the limited dynamic range of a typical MPPC. As a result, the proposed PET detector module has the potential to be refined for use in high-resolution PET insert applications.

A sub-millimeter resolution PET detector module using a multi-pixel photon counter array

PubMed Central

Song, Tae Yong; Wu, Heyu; Komarov, Sergey; Siegel, Stefan B; Tai, Yuan-Chuan

2010-01-01

A PET block detector module using an array of sub-millimeter lutetium oxyorthosilicate (LSO) crystals read out by an array of surface-mount, semiconductor photosensors has been developed. The detector consists of a LSO array, a custom acrylic light guide, a 3 × 3 multi-pixel photon counter (MPPC) array (S10362-11-050P, Hamamatsu Photonics, Japan) and a readout board with a charge division resistor network. The LSO array consists of 100 crystals, each measuring 0.8 × 0.8 × 3 mm3 and arranged in 0.86 mm pitches. A Monte Carlo simulation was used to aid the design and fabrication of a custom light guide to control distribution of scintillation light over the surface of the MPPC array. The output signals of the nine MPPC are multiplexed by a charge division resistor network to generate four position-encoded analog outputs. Flood image, energy resolution and timing resolution measurements were performed using standard NIM electronics. The linearity of the detector response was investigated using gamma-ray sources of different energies. The 10 × 10 array of 0.8 mm LSO crystals was clearly resolved in the flood image. The average energy resolution and standard deviation were 20.0% full-width at half-maximum (FWHM) and ±5.0%, respectively, at 511 keV. The timing resolution of a single MPPC coupled to a LSO crystal was found to be 857 ps FWHM, and the value for the central region of detector module was 1182 ps FWHM when ±10% energy window was applied. The nonlinear response of a single MPPC when used to read out a single LSO was observed among the corner crystals of the proposed detector module. However, the central region of the detector module exhibits significantly less nonlinearity (6.5% for 511 keV). These results demonstrate that (1) a charge-sharing resistor network can effectively multiplex MPPC signals and reduce the number of output signals without significantly degrading the performance of a PET detector and (2) a custom light guide to permit light sharing among multiple MPPC and to diffuse and direct scintillation light can reduce the nonlinearity of the detector response within the limited dynamic range of a typical MPPC. As a result, the proposed PET detector module has the potential to be refined for use in high-resolution PET insert applications. PMID:20393236

Performance of the Fully Digital FPGA-Based Front-End Electronics for the GALILEO Array

NASA Astrophysics Data System (ADS)

Barrientos, D.; Bellato, M.; Bazzacco, D.; Bortolato, D.; Cocconi, P.; Gadea, A.; González, V.; Gulmini, M.; Isocrate, R.; Mengoni, D.; Pullia, A.; Recchia, F.; Rosso, D.; Sanchis, E.; Toniolo, N.; Ur, C. A.; Valiente-Dobón, J. J.

2015-12-01

In this work we present the architecture and results of a fully digital Front End Electronics (FEE) read out system developed for the GALILEO array. The FEE system, developed in collaboration with the Advanced Gamma Tracking Array (AGATA) collaboration, is composed of three main blocks: preamplifiers, digitizers and preprocessing electronics. The slow control system contains a custom Linux driver, a dynamic library and a server implementing network services. This work presents the first results of the digital FEE system coupled with a GALILEO germanium detector, which has demonstrated the capability to achieve an energy resolution of 1.530/00 at an energy of 1.33 MeV, similar to the one obtained with a conventional analog system. While keeping a good performance in terms of energy resolution, digital electronics will allow to instrument the full GALILEO array with a versatile system with high integration and low power consumption and costs.

Application of Array Comparative Genomic Hybridization in Newborns with Multiple Congenital Anomalies.

PubMed

Szczałuba, Krzysztof; Nowakowska, Beata; Sobecka, Katarzyna; Smyk, Marta; Castaneda, Jennifer; Klapecki, Jakub; Kutkowska-Kaźmierczak, Anna; Śmigiel, Robert; Bocian, Ewa; Radkowski, Marek; Demkow, Urszula

2016-01-01

Major congenital anomalies are detectable in 2-3 % of the newborn population. Some of their genetic causes are attributable to copy number variations identified by array comparative genomic hybridization (aCGH). The value of aCGH screening as a first-tier test in children with multiple congenital anomalies has been studied and consensus adopted. However, array resolution has not been agreed upon, specifically in the newborn or infant population. Moreover, most array studies have been focused on mixed populations of intellectual disability/developmental delay with or without multiple congenital anomalies, making it difficult to assess the value of microarrays in newborns. The aim of the study was to determine the optimal quality and clinical sensitivity of high-resolution array comparative genomic hybridization in neonates with multiple congenital anomalies. We investigated a group of 54 newborns with multiple congenital anomalies defined as two or more birth defects from more than one organ system. Cytogenetic studies were performed using OGT CytoSure 8 × 60 K microarray. We found ten rearrangements in ten newborns. Of these, one recurrent syndromic microduplication was observed, whereas all other changes were unique. Six rearrangements were definitely pathogenic, including one submicroscopic and five that could be seen on routine karyotype analysis. Four other copy number variants were likely pathogenic. The candidate genes that may explain the phenotype were discussed. In conclusion, high-resolution array comparative hybridization can be applied successfully in newborns with multiple congenital anomalies as the method detects a significant number of pathogenic changes, resulting in early diagnoses. We hypothesize that small changes previously considered benign or even inherited rearrangements should be classified as potentially pathogenic at least until a subsequent clinical assessment would exclude a developmental delay or dysmorphism.

High signal-to-noise-ratio electro-optical terahertz imaging system based on an optical demodulating detector array.

PubMed

Spickermann, Gunnar; Friederich, Fabian; Roskos, Hartmut G; Bolívar, Peter Haring

2009-11-01

We present a 64x48 pixel 2D electro-optical terahertz (THz) imaging system using a photonic mixing device time-of-flight camera as an optical demodulating detector array. The combination of electro-optic detection with a time-of-flight camera increases sensitivity drastically, enabling the use of a nonamplified laser source for high-resolution real-time THz electro-optic imaging.

Multiplexed Elimination of Wild-Type DNA and High-Resolution Melting Prior to Targeted Resequencing of Liquid Biopsies.

PubMed

Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Song, Chen; Adalsteinsson, Viktor A; Parsons, Heather A; Lin, Nancy U; Wagle, Nikhil; Makrigiorgos, G Mike

2017-10-01

The use of clinical samples and circulating cell-free DNA (cfDNA) collected from liquid biopsies for diagnostic and prognostic applications in cancer is burgeoning, and improved methods that reduce the influence of excess wild-type (WT) portion of the sample are desirable. Here we present enrichment of mutation-containing sequences using enzymatic degradation of WT DNA. Mutation enrichment is combined with high-resolution melting (HRM) performed in multiplexed closed-tube reactions as a rapid, cost-effective screening tool before targeted resequencing. We developed a homogeneous, closed-tube approach to use a double-stranded DNA-specific nuclease for degradation of WT DNA at multiple targets simultaneously. The No Denaturation Nuclease-assisted Minor Allele Enrichment with Probe Overlap (ND-NaME-PrO) uses WT oligonucleotides overlapping both strands on putative DNA targets. Under conditions of partial denaturation (DNA breathing), the oligonucleotide probes enhance double-stranded DNA-specific nuclease digestion at the selected targets, with high preference toward WT over mutant DNA. To validate ND-NaME-PrO, we used multiplexed HRM, digital PCR, and MiSeq targeted resequencing of mutated genomic DNA and cfDNA. Serial dilution of KRAS mutation-containing DNA shows mutation enrichment by 10- to 120-fold and detection of allelic fractions down to 0.01%. Multiplexed ND-NaME-PrO combined with multiplexed PCR-HRM showed mutation scanning of 10-20 DNA amplicons simultaneously. ND-NaME-PrO applied on cfDNA from clinical samples enables mutation enrichment and HRM scanning over 10 DNA targets. cfDNA mutations were enriched up to approximately 100-fold (average approximately 25-fold) and identified via targeted resequencing. Closed-tube homogeneous ND-NaME-PrO combined with multiplexed HRM is a convenient approach to efficiently enrich for mutations on multiple DNA targets and to enable prescreening before targeted resequencing. © 2017 American Association for Clinical Chemistry.

Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

NASA Astrophysics Data System (ADS)

Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

2017-08-01

Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

A High-Speed, Event-Driven, Active Pixel Sensor Readout for Photon-Counting Microchannel Plate Detectors

NASA Technical Reports Server (NTRS)

Kimble, Randy A.; Pain, Bedabrata; Norton, Timothy J.; Haas, J. Patrick; Oegerle, William R. (Technical Monitor)

2002-01-01

Silicon array readouts for microchannel plate intensifiers offer several attractive features. In this class of detector, the electron cloud output of the MCP intensifier is converted to visible light by a phosphor; that light is then fiber-optically coupled to the silicon array. In photon-counting mode, the resulting light splashes on the silicon array are recognized and centroided to fractional pixel accuracy by off-chip electronics. This process can result in very high (MCP-limited) spatial resolution while operating at a modest MCP gain (desirable for dynamic range and long term stability). The principal limitation of intensified CCD systems of this type is their severely limited local dynamic range, as accurate photon counting is achieved only if there are not overlapping event splashes within the frame time of the device. This problem can be ameliorated somewhat by processing events only in pre-selected windows of interest of by using an addressable charge injection device (CID) for the readout array. We are currently pursuing the development of an intriguing alternative readout concept based on using an event-driven CMOS Active Pixel Sensor. APS technology permits the incorporation of discriminator circuitry within each pixel. When coupled with suitable CMOS logic outside the array area, the discriminator circuitry can be used to trigger the readout of small sub-array windows only when and where an event splash has been detected, completely eliminating the local dynamic range problem, while achieving a high global count rate capability and maintaining high spatial resolution. We elaborate on this concept and present our progress toward implementing an event-driven APS readout.

Two-dimensional array of cold-electron bolometers for high-sensitivity polarization measurements

NASA Astrophysics Data System (ADS)

Kuzmin, L. S.

2012-01-01

A new concept of a two-dimensional array of cold-electron bolometers with distributed dipole antennas in the focal plane for high-sensitivity polarization measurements is proposed. The concept gives a unique combination of high polarization resolution due to a large uniforms array of cold-electron bolometers and optimal matching with junction field effect transistor (JFET) amplifiers because of flexibility in direct-current connections. The noise characteristics are improved due to arriving-signal power distribution among numerous cold-electron bolometers and an increase in their response. This should lead to a significant increase in the sensitivity and dynamic range compared with competing alternative bolometer technologies. The reliability of the twodimensional array significantly increases due to a series-parallel connection of a large number of cold-electron bolometers. High polarization resolution should be ensured due to uniform covering of a substrate by a two-dimensional array over a large area and the absence of the beam compression to small lumped elements. The fundamental sensitivity limit of the cold-electron bolometer array is smaller than photon noise which is considered to be the ultimate level restricted by the background radiation. Estimates of noise of bolometers with the JFET reading system show the possibility of realizing the ultimate sensitivity below the photon-noise level 5 ・10-17 W/Hz1/2 at a frequency of 350 GHz for an optical load with a power of 5 pW. These parameters correspond to the requirements to the receiving system of a BOOMERanG balloon telescope.

High-resolution x-ray imaging using a structured scintillator.

PubMed

Hormozan, Yashar; Sychugov, Ilya; Linnros, Jan

2016-02-01

In this study, the authors introduce a new generation of finely structured scintillators with a very high spatial resolution (a few micrometers) compared to conventional scintillators, yet maintaining a thick absorbing layer for improved detectivity. Their concept is based on a 2D array of high aspect ratio pores which are fabricated by ICP etching, with spacings (pitches) of a few micrometers, on silicon and oxidation of the pore walls. The pores were subsequently filled by melting of powdered CsI(Tl), as the scintillating agent. In order to couple the secondary emitted photons of the back of the scintillator array to a CCD device, having a larger pixel size than the pore pitch, an open optical microscope with adjustable magnification was designed and implemented. By imaging a sharp edge, the authors were able to calculate the modulation transfer function (MTF) of this finely structured scintillator. The x-ray images of individually resolved pores suggest that they have been almost uniformly filled, and the MTF measurements show the feasibility of a few microns spatial resolution imaging, as set by the scintillator pore size. Compared to existing techniques utilizing CsI needles as a structured scintillator, their results imply an almost sevenfold improvement in resolution. Finally, high resolution images, taken by their detector, are presented. The presented work successfully shows the functionality of their detector concept for high resolution imaging and further fabrication developments are most likely to result in higher quantum efficiencies.

Conception and realization of a semiconductor based 240 GHz full 3D MIMO imaging system

NASA Astrophysics Data System (ADS)

Weisenstein, Christian; Kahl, Matthias; Friederich, Fabian; Haring Bolívar, Peter

2017-02-01

Multiple-input multiple-output (MIMO) imaging systems in the terahertz frequency range have a high potential in the field of non-destructive testing (NDT). With such systems it is possible to detect defects in composite materials, for example cracks or delaminations in fiber composites. To investigate mass-produced products it is necessary to study the objects in close to real-time on a conveyor without affecting the production cycle time. In this work we present the conception and realization of a 3D MIMO imaging system for in-line investigation of composite materials and structures. To achieve a lateral resolution of 1 mm, in order to detect such small defects in composite materials with a moderate number of elements, precise sensor design is crucial. In our approach we use the effective aperture concept. The designed sparse array consists of 32 transmitters and 30 receivers based on planar semiconductor components. High range resolution is achieved by an operating frequency between 220 GHz and 260 GHz in a stepped frequency continuous wave (SFCW) setup. A matched filter approach is used to simulate the reconstructed 3D image through the array. This allows the evaluation of the designed array geometry in regard of resolution and side lobe level. In contrast to earlier demonstrations, in which synthetic reconstruction is only performed in a 2D plane, an optics-free full 3D recon- struction has been implemented in our concept. Based on this simulation we designed an array geometry that enables to resolve objects with a resolution smaller than 1mm and moderate side lobe level.

A compact high resolution flat panel PET detector based on the new 4-side buttable MPPC for biomedical applications

PubMed Central

Wang, Qiang; Wen, Jie; Ravindranath, Bosky; O’Sullivan, Andrew W.; Catherall, David; Li, Ke; Wei, Shouyi; Komarov, Sergey; Tai, Yuan-Chuan

2015-01-01

Compact high-resolution panel detectors using virtual pinhole (VP) PET geometry can be inserted into existing clinical or pre-clinical PET systems to improve regional spatial resolution and sensitivity. Here we describe a compact panel PET detector built using the new Though Silicon Via (TSV) multi-pixel photon counters (MPPC) detector. This insert provides high spatial resolution and good timing performance for multiple bio-medical applications. Because the TSV MPPC design eliminates wire bonding and has a package dimension which is very close to the MPPC’s active area, it is 4-side buttable. The custom designed MPPC array (based on Hamamatsu S12641-PA-50(x)) used in the prototype is composed of 4 × 4 TSV-MPPC cells with a 4.46 mm pitch in both directions. The detector module has 16 × 16 lutetium yttrium oxyorthosilicate (LYSO) crystal array, with each crystal measuring 0.92 × 0.92 × 3 mm3 with 1.0 mm pitch. The outer diameter of the detector block is 16.8 × 16.8 mm2. Thirty-two such blocks will be arranged in a 4 × 8 array with 1 mm gaps to form a panel detector with detection area around 7 cm × 14 cm in the full-size detector. The flood histogram acquired with Ge-68 source showed excellent crystal separation capability with all 256 crystals clearly resolved. The detector module’s mean, standard deviation, minimum (best) and maximum (worst) energy resolution were 10.19%, +/−0.68%, 8.36% and 13.45% FWHM, respectively. The measured coincidence time resolution between the block detector and a fast reference detector (around 200 ps single photon timing resolution) was 0.95 ns. When tested with Siemens Cardinal electronics the performance of the detector blocks remain consistent. These results demonstrate that the TSV-MPPC is a promising photon sensor for use in a flat panel PET insert composed of many high resolution compact detector modules. PMID:26085702

Tactile surface classification for limbed robots using a pressure sensitive robot skin.

PubMed

Shill, Jacob J; Collins, Emmanuel G; Coyle, Eric; Clark, Jonathan

2015-02-02

This paper describes an approach to terrain identification based on pressure images generated through direct surface contact using a robot skin constructed around a high-resolution pressure sensing array. Terrain signatures for classification are formulated from the magnitude frequency responses of the pressure images. The initial experimental results for statically obtained images show that the approach yields classification accuracies [Formula: see text]. The methodology is extended to accommodate the dynamic pressure images anticipated when a robot is walking or running. Experiments with a one-legged hopping robot yield similar identification accuracies [Formula: see text]. In addition, the accuracies are independent with respect to changing robot dynamics (i.e., when using different leg gaits). The paper further shows that the high-resolution capabilities of the sensor enables similarly textured surfaces to be distinguished. A correcting filter is developed to accommodate for failures or faults that inevitably occur within the sensing array with continued use. Experimental results show using the correcting filter can extend the effective operational lifespan of a high-resolution sensing array over 6x in the presence of sensor damage. The results presented suggest this methodology can be extended to autonomous field robots, providing a robot with crucial information about the environment that can be used to aid stable and efficient mobility over rough and varying terrains.

Monovalent Streptavidin that Senses Oligonucleotides**

PubMed Central

Wang, Jingxian; Kostic, Natasa; Stojanovic, Milan N.

2013-01-01

We report a straightforward chemical route to monovalent streptavidin, a valuable reagent for imaging. The one-step process is based on a (tris)biotinylated-oligonucleotide blocking three of streptavidin’s four biotin binding sites. Further, the complex is highly sensitive to single-base differences - whereby perfectly matched oligonucleotides trigger dissociation of the biotin-streptavidin interaction at higher rates than single-base mismatches. Unique properties and ease of synthesis open wide opportunities for practical applications in imaging and biosensing. PMID:23606329

Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

PubMed Central

Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

2016-01-01

The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

Taking the Measure of Massive Stars and their Environments with the CHARA Array Long-baseline Interferometer

NASA Astrophysics Data System (ADS)

Gies, Douglas R.

2017-11-01

Most massive stars are so distant that their angular diameters are too small for direct resolution. However, the observational situation is now much more favorable, thanks to new opportunities available with optical/IR long-baseline interferometry. The Georgia State University Center for High Angular Resolution Astronomy Array at Mount Wilson Observatory is a six-telescope instrument with a maximum baseline of 330 meters, which is capable of resolving stellar disks with diameters as small as 0.2 milliarcsec. The distant stars are no longer out of range, and many kinds of investigations are possible. Here we summarize a number of studies involving angular diameter measurements and effective temperature estimates for OB stars, binary and multiple stars (including the σ Orionis system), and outflows in Luminous Blue Variables. An enlarged visitors program will begin in 2017 that will open many opportunities for new programs in high angular resolution astronomy.

The silicon drift detector for the IXO high-time resolution spectrometer

NASA Astrophysics Data System (ADS)

Lechner, Peter; Amoros, Carine; Barret, Didier; Bodin, Pierre; Boutelier, Martin; Eckhardt, Rouven; Fiorini, Carlo; Kendziorra, Eckhard; Lacombe, Karine; Niculae, Adrian; Pouilloux, Benjamin; Pons, Roger; Rambaud, Damien; Ravera, Laurent; Schmid, Christian; Soltau, Heike; Strüder, Lothar; Tenzer, Christoph; Wilms, Jörn

2010-07-01

The High Time Resolution Spectrometer (HTRS) is one of six scientific payload instruments of the International X-ray Observatory (IXO). HTRS is dedicated to the physics of matter at extreme density and gravity and will observe the X-rays generated in the inner accretion flows around the most compact massive objects, i.e. black holes and neutron stars. The study of their timing signature and in addition the simultaneous spectroscopy of the gravitationally shifted and broadened iron line allows for probing general relativity in the strong field regime and understanding the inner structure of neutron stars. As the sources to be observed by HTRS are the brightest in the X-ray sky and the studies require good photon statistics the instrument design is driven by the capability to operate at extremely high count rates. The HTRS instrument is based on a monolithic array of Silicon Drift Detectors (SDDs) with 31 cells in a circular envelope and a sensitive volume of 4.5 cm2 × 450 μm. The SDD principle uses fast signal charge collection on an integrated amplifier by a focusing internal electrical field. It combines a large sensitive area and a small capacitance, thus facilitating good energy resolution and high count rate capability. The HTRS is specified to provide energy spectra with a resolution of 150 eV (FWHM at 6 keV) at high time resolution of 10 μsec and with high count rate capability up to a goal of 2.106 counts per second, corresponding to a 12 Crab equivalent source. As the HTRS is a non-imaging instrument and will target only point sources it is placed on axis but out of focus so that the spot is spread over the array of 31 SDD cells. The SDD array is logically organized in four independent 'quadrants', a dedicated 8-channel quadrant readout chip is in development.

Magnetic Resonance Imaging of Phosphocreatine and Determination of BOLD Kinetics in Lower Extremity Muscles using a Dual-Frequency Coil Array

NASA Astrophysics Data System (ADS)

Brown, Ryan; Khegai, Oleksandr; Parasoglou, Prodromos

2016-07-01

Magnetic resonance imaging (MRI) provides the unique ability to study metabolic and microvasculature functions in skeletal muscle using phosphorus and proton measurements. However, the low sensitivity of these techniques can make it difficult to capture dynamic muscle activity due to the temporal resolution required for kinetic measurements during and after exercise tasks. Here, we report the design of a dual-nuclei coil array that enables proton and phosphorus MRI of the human lower extremities with high spatial and temporal resolution. We developed an array with whole-volume coverage of the calf and a phosphorus signal-to-noise ratio of more than double that of a birdcage coil in the gastrocnemius muscles. This enabled the local assessment of phosphocreatine recovery kinetics following a plantar flexion exercise using an efficient sampling scheme with a 6 s temporal resolution. The integrated proton array demonstrated image quality approximately equal to that of a clinical state-of-the-art knee coil, which enabled fat quantification and dynamic blood oxygen level-dependent measurements that reflect microvasculature function. The developed array and time-efficient pulse sequences were combined to create a localized assessment of calf metabolism using phosphorus measurements and vasculature function using proton measurements, which could provide new insights into muscle function.

Three-Dimensional Application of DAMAS Methodology for Aeroacoustic Noise Source Definition

NASA Technical Reports Server (NTRS)

Brooks, Thomas F.; Humphreys, William M., Jr.

2005-01-01

At the 2004 AIAA/CEAS Aeroacoustic Conference, a breakthrough in acoustic microphone array technology was reported by the authors. A Deconvolution Approach for the Mapping of Acoustic Sources (DAMAS) was developed which decouples the array design and processing influence from the noise being measured, using a simple and robust algorithm. For several prior airframe noise studies, it was shown to permit an unambiguous and accurate determination of acoustic source position and strength. As a follow-on effort, this paper examines the technique for three-dimensional (3D) applications. First, the beamforming ability for arrays, of different size and design, to focus longitudinally and laterally is examined for a range of source positions and frequency. Advantage is found for larger array designs with higher density microphone distributions towards the center. After defining a 3D grid generalized with respect to the array s beamforming characteristics, DAMAS is employed in simulated and experimental noise test cases. It is found that spatial resolution is much less sharp in the longitudinal direction in front of the array compared to side-to-side lateral resolution. 3D DAMAS becomes useful for sufficiently large arrays at sufficiently high frequency. But, such can be a challenge to computational capabilities, with regard to the required expanse and number of grid points. Also, larger arrays can strain basic physical modeling assumptions that DAMAS and all traditional array methodologies use. An important experimental result is that turbulent shear layers can negatively impact attainable beamforming resolution. Still, the usefulness of 3D DAMAS is demonstrated by the measurement of landing gear noise source distributions in a difficult hard-wall wind tunnel environment.

Coarse-to-fine construction for high-resolution representation in visual working memory.

PubMed

Gao, Zaifeng; Ding, Xiaowei; Yang, Tong; Liang, Junying; Shui, Rende

2013-01-01

This study explored whether the high-resolution representations created by visual working memory (VWM) are constructed in a coarse-to-fine or all-or-none manner. The coarse-to-fine hypothesis suggests that coarse information precedes detailed information in entering VWM and that its resolution increases along with the processing time of the memory array, whereas the all-or-none hypothesis claims that either both enter into VWM simultaneously, or neither does. We tested the two hypotheses by asking participants to remember two or four complex objects. An ERP component, contralateral delay activity (CDA), was used as the neural marker. CDA is higher for four objects than for two objects when coarse information is primarily extracted; yet, this CDA difference vanishes when detailed information is encoded. Experiment 1 manipulated the comparison difficulty of the task under a 500-ms exposure time to determine a condition in which the detailed information was maintained. No CDA difference was found between two and four objects, even in an easy-comparison condition. Thus, Experiment 2 manipulated the memory array's exposure time under the easy-comparison condition and found a significant CDA difference at 100 ms while replicating Experiment 1's results at 500 ms. In Experiment 3, the 500-ms memory array was blurred to block the detailed information; this manipulation reestablished a significant CDA difference. These findings suggest that the creation of high-resolution representations in VWM is a coarse-to-fine process.

Adding polarimetric imaging to depth map using improved light field camera 2.0 structure

NASA Astrophysics Data System (ADS)

Zhang, Xuanzhe; Yang, Yi; Du, Shaojun; Cao, Yu

2017-06-01

Polarization imaging plays an important role in various fields, especially for skylight navigation and target identification, whose imaging system is always required to be designed with high resolution, broad band, and single-lens structure. This paper describe such a imaging system based on light field 2.0 camera structure, which can calculate the polarization state and depth distance from reference plane for every objet point within a single shot. This structure, including a modified main lens, a multi-quadrants Polaroid, a honeycomb-liked micro lens array, and a high resolution CCD, is equal to an "eyes array", with 3 or more polarization imaging "glasses" in front of each "eye". Therefore, depth can be calculated by matching the relative offset of corresponding patch on neighboring "eyes", while polarization state by its relative intensity difference, and their resolution will be approximately equal to each other. An application on navigation under clear sky shows that this method has a high accuracy and strong robustness.

Crystal structure of an Okazaki fragment at 2-A resolution

NASA Technical Reports Server (NTRS)

Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

1992-01-01

In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

Ready to clone: CNV detection and breakpoint fine-mapping in breast and ovarian cancer susceptibility genes by high-resolution array CGH.

PubMed

Hackmann, Karl; Kuhlee, Franziska; Betcheva-Krajcir, Elitza; Kahlert, Anne-Karin; Mackenroth, Luisa; Klink, Barbara; Di Donato, Nataliya; Tzschach, Andreas; Kast, Karin; Wimberger, Pauline; Schrock, Evelin; Rump, Andreas

2016-10-01

Detection of predisposing copy number variants (CNV) in 330 families affected with hereditary breast and ovarian cancer (HBOC). In order to complement mutation detection with Illumina's TruSight Cancer panel, we designed a customized high-resolution 8 × 60k array for CGH (aCGH) that covers all 94 genes from the panel. Copy number variants with immediate clinical relevance were detected in 12 families (3.6%). Besides 3 known CNVs in CHEK2, RAD51C, and BRCA1, we identified 3 novel pathogenic CNVs in BRCA1 (deletion of exons 4-13, deletion of exons 12-18) and ATM (deletion exons 57-63) plus an intragenic duplication of BRCA2 (exons 3-11) and an intronic BRCA1 variant with unknown pathogenicity. The precision of high-resolution aCGH enabled straight forward breakpoint amplification of a BRCA1 deletion which subsequently allowed for fast and economic CNV verification in family members of the index patient. Furthermore, we used our aCGH data to validate an algorithm that was able to detect all identified copy number changes from next-generation sequencing (NGS) data. Copy number detection is a mandatory analysis in HBOC families at least if no predisposing mutations were found by sequencing. Currently, high-resolution array CGH is our first choice of method of analysis due to unmatched detection precision. Although it seems possible to detect CNV from sequencing data, there currently is no satisfying tool to do so in a routine diagnostic setting.

Genome-wide high-resolution screening in Dupuytren's disease reveals common regions of DNA copy number alterations.

PubMed

Shih, Barbara B; Tassabehji, May; Watson, James S; McGrouther, Angus D; Bayat, Ardeshir

2010-07-01

Dupuytren's disease (DD) is a familial disorder with a high genetic susceptibility in white people; however, its etiopathogenesis remains unknown. Previous comparative genomic hybridization studies using lower-resolution, 44-k oligonucleotide-based arrays revealed no copy number variation (CNV) changes in DD. In this study, we used a higher-resolution genome-wide screening (next-generation microarrays) comprising 963,331 human sequences (3 kb spacing between probes) for whole genome DNA variation analysis. The objective was to detect cryptic chromosomal imbalances in DD. Agilent SurePrint G3 microarrays, one million format (Agilent Technologies, Santa Clara, CA), were used to detect CNV regions (CNVRs) in DNA extracted from nodules of 4 white men with DD (age, 69 +/- 4 y). Reference samples were from the DNA of 10 men who served as control patients. Copy number variations that were common to greater than 3 assessed DD individuals (p < .05) were selected as candidate loci for DD etiology. In addition, quantitative polymerase chain reactions (qPCR) assays were designed for selected CNVRs on DNA from 13 DD patients and 11 control patients. Independent t-tests and Fisher's exact tests were carried out for statistical analysis. Three novel CNVs previously unreported in the phenotypically normal population were detected in 3 DD cases, located at 10q22, 16p12.1, and 17p12. Nine polymorphic CNVRs potentially associated with DD were determined using our strategic selection criteria, locating to chromosomes 1q31, 6p21, 7p14, 8p11, 12p13, 14q11, 17q21 and 20p13. More than 3 of the DD cases tested had a CNVR located to a small region on 6p21 and 4 CNVRs within 6p21-22 of the human leukocyte antigen (HLA) genes. Three novel copy number alterations were observed in 3 unrelated patients with sporadic (no known family history) DD. Nine polymorphic CNVRs were found to be common among the DD cases. These variants might contain genes involved in DD formation, indicating that important gene networks expressed within the palmar fascia might contribute to genetic susceptibility of DD. Copyright 2010. Published by Elsevier Inc.

Solar XUV Imaging and Non-dispersive Spectroscopy for Solar-C Enabled by Scientific CMOS APS Arrays

NASA Astrophysics Data System (ADS)

Stern, Robert A.; Lemen, J. R.; Shing, L.; Janesick, J.; Tower, J.

2009-05-01

Monolithic CMOS Advanced Pixel Sensor (APS) arrays are showing great promise as eventual replacements for the current workhorse of solar physics focal planes, the scientific CCD. CMOS APS devices have individually addressable pixels, increased radiation tolerance compared to CCDs, and require lower clock voltages, and thus lower power. However, commercially available CMOS chips, while suitable for use with intensifiers or fluorescent coatings, are generally not optimized for direct detection of EUV and X-ray photons. A high performance scientific CMOS array designed for these wavelengths will have significant new capabilities compared to CCDs, including the ability to read out small regions of the solar disk at high (sub sec) cadence, count single X-ray photons with Fano-limited energy resolution, and even operate at room temperature with good noise performance. Such capabilities will be crucial for future solar X-ray and EUV missions such as Solar-C. Sarnoff Corporation has developed scientific grade, monolithic CMOS arrays for X-ray imaging and photon counting. One prototype device, the "minimal" array, has 8 um pixels, is 15 to 25 um thick, is fabricated on high-resistivity ( 10 to 20 kohm-cm) Si wafers, and can be back-illuminated. These characteristics yield high quantum efficiency and high spatial resolution with minimal charge sharing among pixels, making it ideal for the detection of keV X-rays. When used with digital correlated double sampling, the array has demonstrated noise performance as low as 2 e, allowing single photon counting of X-rays over a range of temperatures. We report test results for this device in X-rays, and discuss the implications for future solar space missions.

Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer

PubMed Central

Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

2007-01-01

DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO® PrimeSurface® with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3′ end of the immobilized DNA primers on the S-Bio® by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

Multiplex Detection of Bacteria Associated with Normal Microbiota and with Bacterial Vaginosis in Vaginal Swabs by Use of Oligonucleotide-Coupled Fluorescent Microspheres▿ †

PubMed Central

Dumonceaux, Tim J.; Schellenberg, John; Goleski, Vanessa; Hill, Janet E.; Jaoko, Walter; Kimani, Joshua; Money, Deborah; Ball, T. Blake; Plummer, Francis A.; Severini, Alberto

2009-01-01

Bacterial vaginosis (BV) is a recurrent condition that is associated with a range of negative outcomes, including the acquisition of human immunodeficiency virus and other sexually transmitted diseases, preterm births, and pelvic inflammatory disease. In contrast to the Lactobacillus-dominated normal vaginal microbiota, BV is characterized by a lack of lactobacilli and an abundance of anaerobic and gram-negative organisms, including Gardnerella vaginalis and Atopobium vaginae. To date, the laboratory diagnosis of BV has relied upon the fulfillment of criteria determined by microscopic observation of Gram-stained vaginal swabs. We describe a molecular-based method for the easy determination of the species profile within the vaginal microbiota based on the amplification of the chaperonin-60 genes of all bacteria present in the swab and hybridization of the amplicon to species-specific oligonucleotide-coupled fluorescent beads that are identified by flow cytometry with a Luminex instrument. We designed a nineplex Luminex array for characterization of the vaginal microbiota and applied it to the analysis of vaginal swabs from individuals from Africa and North America. Using the presence of A. vaginae or G. vaginalis, or both, as the defining criterion for BV, we found that the method was highly specific and sensitive for the diagnosis of BV using microscopy as a gold standard. PMID:19794034

Large-Scale Interaction Profiling of Protein Domains Through Proteomic Peptide-Phage Display Using Custom Peptidomes.

PubMed

Seo, Moon-Hyeong; Nim, Satra; Jeon, Jouhyun; Kim, Philip M

2017-01-01

Protein-protein interactions are essential to cellular functions and signaling pathways. We recently combined bioinformatics and custom oligonucleotide arrays to construct custom-made peptide-phage libraries for screening peptide-protein interactions, an approach we call proteomic peptide-phage display (ProP-PD). In this chapter, we describe protocols for phage display for the identification of natural peptide binders for a given protein. We finally describe deep sequencing for the analysis of the proteomic peptide-phage display.

A Multi-Functional Microelectrode Array Featuring 59760 Electrodes, 2048 Electrophysiology Channels, Stimulation, Impedance Measurement and Neurotransmitter Detection Channels.

PubMed

Dragas, Jelena; Viswam, Vijay; Shadmani, Amir; Chen, Yihui; Bounik, Raziyeh; Stettler, Alexander; Radivojevic, Milos; Geissler, Sydney; Obien, Marie; Müller, Jan; Hierlemann, Andreas

2017-06-01

Biological cells are characterized by highly complex phenomena and processes that are, to a great extent, interdependent. To gain detailed insights, devices designed to study cellular phenomena need to enable tracking and manipulation of multiple cell parameters in parallel; they have to provide high signal quality and high spatiotemporal resolution. To this end, we have developed a CMOS-based microelectrode array system that integrates six measurement and stimulation functions, the largest number to date. Moreover, the system features the largest active electrode array area to date (4.48×2.43 mm 2 ) to accommodate 59,760 electrodes, while its power consumption, noise characteristics, and spatial resolution (13.5 μm electrode pitch) are comparable to the best state-of-the-art devices. The system includes: 2,048 action-potential (AP, bandwidth: 300 Hz to 10 kHz) recording units, 32 local-field-potential (LFP, bandwidth: 1 Hz to 300 Hz) recording units, 32 current recording units, 32 impedance measurement units, and 28 neurotransmitter detection units, in addition to the 16 dual-mode voltage-only or current/voltage-controlled stimulation units. The electrode array architecture is based on a switch matrix, which allows for connecting any measurement/stimulation unit to any electrode in the array and for performing different measurement/stimulation functions in parallel.

SCINTILLATION ARCS IN LOW-FREQUENCY OBSERVATIONS OF THE TIMING-ARRAY MILLISECOND PULSAR PSR J0437–4715

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhat, N. D. R.; Ord, S. M.; Tremblay, S. E.

2016-02-10

Low-frequency observations of pulsars provide a powerful means for probing the microstructure in the turbulent interstellar medium (ISM). Here we report on high-resolution dynamic spectral analysis of our observations of the timing-array millisecond pulsar PSR J0437–4715 with the Murchison Widefield Array (MWA), enabled by our recently commissioned tied-array beam processing pipeline for voltage data recorded from the high time resolution mode of the MWA. A secondary spectral analysis reveals faint parabolic arcs akin to those seen in high-frequency observations of pulsars with the Green Bank and Arecibo telescopes. Data from Parkes observations at a higher frequency of 732 MHz revealmore » a similar parabolic feature with a curvature that scales approximately as the square of the observing wavelength (λ{sup 2}) to the MWA's frequency of 192 MHz. Our analysis suggests that scattering toward PSR J0437–4715 predominantly arises from a compact region about 115 pc from the Earth, which matches well with the expected location of the edge of the Local Bubble that envelopes the local Solar neighborhood. As well as demonstrating new and improved pulsar science capabilities of the MWA, our analysis underscores the potential of low-frequency pulsar observations for gaining valuable insights into the local ISM and for characterizing the ISM toward timing-array pulsars.« less

Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

PubMed Central

Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

2009-01-01

Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

PubMed

Yang, Haozhe; Seela, Frank

2016-01-22

A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Antenna Electronics Concept for the Next-Generation Very Large Array

NASA Astrophysics Data System (ADS)

Shillue, Bill; Jackson, James; Selina, Rob

2018-01-01

The National Radio Astronomy Observatory (NRAO) is considering the scientific potential and technical feasibility of a next-generation VLA (ngVLA) with an emphasis on thermal imaging at milliarcsecond resolution. The preliminary goals for the ngVLA are to increase both the system sensitivity and angular resolution of the VLA tenfold and to cover a frequency range of 1.2-116 GHz.The design of the antenna electronics, reference signal distribution, and data transmission systems will be construction and operations cost drivers for the facility. The electronics must achieve a high level of performance, while maintaining low operation and maintenance costs and a high level of reliability. With the size of the array, design effort on manufacturability and integration of components can lead to reduced lifecycle costs. With current uncertainty in the feasibility of wideband receivers, and advancements in digitizer technology, the architecture should be scalable to the number of receiver bands and the speed and resolution of available digitizer ICs. The focus of the presentation will be a proposed architecture for the electronics system, parameter tradeoffs within the system specification, and areas where technical advances are required when compared to existing array designs.

High-frequency Pulse-compression Ultrasound Imaging with an Annular Array

NASA Astrophysics Data System (ADS)

Mamou, J.; Ketterling, J. A.; Silverman, R. H.

High-frequency ultrasound (HFU) allows fine-resolution imaging at the expense of limited depth-of-field (DOF) and shallow acoustic penetration depth. Coded-excitation imaging permits a significant increase in the signal-to-noise ratio (SNR) and therefore, the acoustic penetration depth. A 17-MHz, five-element annular array with a focal length of 31 mm and a total aperture of 10 mm was fabricated using a 25-μm thick piezopolymer membrane. An optimized 8-μs linear chirp spanning 6.5-32 MHz was used to excite the transducer. After data acquisition, the received signals were linearly filtered by a compression filter and synthetically focused. To compare the chirp-array imaging method with conventional impulse imaging in terms of resolution, a 25-μm wire was scanned and the -6-dB axial and lateral resolutions were computed at depths ranging from 20.5 to 40.5 mm. A tissue-mimicking phantom containing 10-μm glass beads was scanned, and backscattered signals were analyzed to evaluate SNR and penetration depth. Finally, ex-vivo ophthalmic images were formed and chirp-coded images showed features that were not visible in conventional impulse images.

Dynamically re-configurable CMOS imagers for an active vision system

NASA Technical Reports Server (NTRS)

Yang, Guang (Inventor); Pain, Bedabrata (Inventor)

2005-01-01

A vision system is disclosed. The system includes a pixel array, at least one multi-resolution window operation circuit, and a pixel averaging circuit. The pixel array has an array of pixels configured to receive light signals from an image having at least one tracking target. The multi-resolution window operation circuits are configured to process the image. Each of the multi-resolution window operation circuits processes each tracking target within a particular multi-resolution window. The pixel averaging circuit is configured to sample and average pixels within the particular multi-resolution window.

Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

PubMed

Sheehan, J P; Lan, H C

1998-09-01

Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

Integration of Organic Electrochemical and Field-Effect Transistors for Ultraflexible, High Temporal Resolution Electrophysiology Arrays.

PubMed

Lee, Wonryung; Kim, Dongmin; Rivnay, Jonathan; Matsuhisa, Naoji; Lonjaret, Thomas; Yokota, Tomoyuki; Yawo, Hiromu; Sekino, Masaki; Malliaras, George G; Someya, Takao

2016-11-01

Integration of organic electrochemical transistors and organic field-effect transistors is successfully realized on a 600 nm thick parylene film toward an electrophysiology array. A single cell of an integrated device and a 2 × 2 electrophysiology array succeed in detecting electromyogram with local stimulation of the motor nerve bundle of a transgenic rat by a laser pulse. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Imaging 2015 Mw 7.8 Gorkha Earthquake and Its Aftershock Sequence Combining Multiple Calibrated Global Seismic Arrays

NASA Astrophysics Data System (ADS)

LI, B.; Ghosh, A.

2016-12-01

The 2015 Mw 7.8 Gorkha earthquake provides a good opportunity to study the tectonics and earthquake hazards in the Himalayas, one of the most seismically active plate boundaries. Details of the seismicity patterns and associated structures in the Himalayas are poorly understood mainly due to limited instrumentation. Here, we apply a back-projection method to study the mainshock rupture and the following aftershock sequence using four large aperture global seismic arrays. All the arrays show eastward rupture propagation of about 130 km and reveal similar evolution of seismic energy radiation, with strong high-frequency energy burst about 50 km north of Kathmandu. Each single array, however, is typically limited by large azimuthal gap, low resolution, and artifacts due to unmodeled velocity structures. Therefore, we use a self-consistent empirical calibration method to combine four different arrays to image the Gorkha event. It greatly improves the resolution, can better track rupture and reveal details that cannot be resolved by any individual array. In addition, we also use the same arrays at teleseismic distances and apply a back-projection technique to detect and locate the aftershocks immediately following the Gorkha earthquake. We detect about 2.5 times the aftershocks recorded by the Advance National Seismic System comprehensive earthquake catalog during the 19 days following the mainshock. The aftershocks detected by the arrays show an east-west trend in general, with majority of the aftershocks located at the eastern part of the rupture patch and surrounding the rupture zone of the largest Mw 7.3 aftershock. Overall spatiotemporal aftershock pattern agrees well with global catalog, with our catalog showing more details relative to the standard global catalog. The improved aftershock catalog enables us to better study the aftershock dynamics, stress evolution in this region. Moreover, rapid and better imaging of aftershock distribution may aid rapid response and hazard assessment after destructive large earthquakes. Existing multiple global seismic arrays, when properly calibrated and used in combinations, provide a high resolution image of rupture of large earthquakes and spatiotemporal distribution of aftershocks.

Continuous Beam Steering From a Segmented Liquid Crystal Optical Phased Array

NASA Technical Reports Server (NTRS)

Titus, Charles M.; Pouch, John; Nguyen, Hung; Miranda, Felix; Bos, Philip J.

2002-01-01

Optical communications to and from deep space probes will require beams possessing divergence on the order of a microradian, and must be steered with sub-microradian precision. Segmented liquid crystal spatial phase modulators, a type of optical phased array, are considered for this ultra-high resolution beam steering. It is shown here that in an ideal device of this type, there are ultimately no restrictions on the angular resolution. Computer simulations are used to obtain that result, and to analyze the influence of beam truncation and substrate flatness on the performance of this type of device.

Continuous Beam Steering From A Segmented Liquid Crystal Optical Phased Array

NASA Technical Reports Server (NTRS)

Pouch, John; Nguyen, Hung; Miranda, Felix; Titus, Charles M.; Bos, Philip J.

2002-01-01

Optical communications to and from deep space probes will require beams possessing divergence on the order of a microradian, and must be steered with sub-microradian precision. Segmented liquid crystal spatial phase modulators, a type of optical phased array, are considered for this ultra-high resolution beam steering. It is shown here that in an ideal device of this type, there are ultimately no restrictions on the angular resolution. Computer simulations are used to obtain that result, and to analyze the influence of beam truncation and substrate flatness on the performance of this type of device.

Kilopixel X-Ray Microcalorimeter Arrays for Astrophysics: Device Performance and Uniformity

NASA Technical Reports Server (NTRS)

Eckart, M. E.; Adams, J. S.; Bailey, C. N.; Bandler, S. R.; Busch, S. E.; Chervenak, J. A.; Finkbeiner, F. M.; Kelley, R. L.; Kilbourne, C. A.; Porter, F. S.;

Kilopixel X-Ray Microcalorimeter Arrays for Astrophysics: Device Performance and Uniformity

NASA Technical Reports Server (NTRS)

Eckart, M. E.; Adams, J. S.; Bailey, C. N.; Bandler, S. R.; Chervenak, F. M.

2011-01-01

We are developing kilo-pixel arrays of TES microcalorimeters to enable high-resolution X-ray imaging spectrometers for future X-ray observatories and laboratory astrophysics experiments. Our current array design was targeted as a prototype for the X-ray Microcalorimeter Spectrometer proposed for the International X-ray Observatory, which calls for a 40x40-pixel core array of 300 micron devices with 2.5 e V energy resolution (at 6 keV). Here we present device characterization of our 32x32 arrays, including X-ray spectral performance of individual pixels within the array. We present our results in light of the understanding that our Mo/Au TESs act as weak superconducting links, causing the TES critical current (Ic) and transition shape to oscillate with applied magnetic field (B). We show Ic(B) measurements and discuss the uniformity of these measurements across the array, as well as implications regarding the uniformity of device noise and response. In addition, we are working to reduce pixel-to-pixel electrical and thermal crosstalk; we present recent test results from an array that has microstrip wiring and an angle-evaporated Cu backside heatsinking layer, which provides Cu coverage on the four sidewalls of the silicon wells beneath each pixel.

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Hard-tip, soft-spring lithography.

PubMed

Shim, Wooyoung; Braunschweig, Adam B; Liao, Xing; Chai, Jinan; Lim, Jong Kuk; Zheng, Gengfeng; Mirkin, Chad A

2011-01-27

Nanofabrication strategies are becoming increasingly expensive and equipment-intensive, and consequently less accessible to researchers. As an alternative, scanning probe lithography has become a popular means of preparing nanoscale structures, in part owing to its relatively low cost and high resolution, and a registration accuracy that exceeds most existing technologies. However, increasing the throughput of cantilever-based scanning probe systems while maintaining their resolution and registration advantages has from the outset been a significant challenge. Even with impressive recent advances in cantilever array design, such arrays tend to be highly specialized for a given application, expensive, and often difficult to implement. It is therefore difficult to imagine commercially viable production methods based on scanning probe systems that rely on conventional cantilevers. Here we describe a low-cost and scalable cantilever-free tip-based nanopatterning method that uses an array of hard silicon tips mounted onto an elastomeric backing. This method-which we term hard-tip, soft-spring lithography-overcomes the throughput problems of cantilever-based scanning probe systems and the resolution limits imposed by the use of elastomeric stamps and tips: it is capable of delivering materials or energy to a surface to create arbitrary patterns of features with sub-50-nm resolution over centimetre-scale areas. We argue that hard-tip, soft-spring lithography is a versatile nanolithography strategy that should be widely adopted by academic and industrial researchers for rapid prototyping applications.

Leaf-FISH: Microscale Imaging of Bacterial Taxa on Phyllosphere

PubMed Central

Peredo, Elena L.; Simmons, Sheri L.

2018-01-01

Molecular methods for microbial community characterization have uncovered environmental and plant-associated factors shaping phyllosphere communities. Variables undetectable using bulk methods can play an important role in shaping plant-microbe interactions. Microscale analysis of bacterial dynamics in the phyllosphere requires imaging techniques specially adapted to the high autoflouresence and 3-D structure of the leaf surface. We present an easily-transferable method (Leaf-FISH) to generate high-resolution tridimensional images of leaf surfaces that allows simultaneous visualization of multiple bacterial taxa in a structurally informed context, using taxon-specific fluorescently labeled oligonucleotide probes. Using a combination of leaf pretreatments coupled with spectral imaging confocal microscopy, we demonstrate the successful imaging bacterial taxa at the genus level on cuticular and subcuticular leaf areas. Our results confirm that different bacterial species, including closely related isolates, colonize distinct microhabitats in the leaf. We demonstrate that highly related Methylobacterium species have distinct colonization patterns that could not be predicted by shared physiological traits, such as carbon source requirements or phytohormone production. High-resolution characterization of microbial colonization patterns is critical for an accurate understanding of microbe-microbe and microbe-plant interactions, and for the development of foliar bacteria as plant-protective agents. PMID:29375531

2D-crystallization of Rhodococcus 20S proteasome at the liquid-liquid interface

NASA Astrophysics Data System (ADS)

Aoyama, Kazuhiro

1996-10-01

The 2D-crystallization method using the liquid-liquid interface between a aqueous phase (protein solution) and a thin organic liquid (dehydroabietylamine) layer has been applied to the Rhodococcus 20S proteasome. The 20S proteasome is known to be the core complex of the 26S proteasome, which is the central protease of the ubiquitin-dependent pathway. Two types of ordered arrays were obtained, both large enough for high resolution analysis by electron crystallography. The first one had a four-fold symmetry, whereas the second one was found out to be a hexagonally close-packed array. By image analysis based on a real space correlation averaging (CAV) technique, the close-packed array was found to be hexagonally packed, but the molecules had presumably rotational freedom. The four-fold array was found to be a true crystal with p4 symmetry. Lattice constants were a = b = 20.0 nm and α = 90°. The unit cell of this crystal contained two molecules. The diffraction pattern computed from the original picture showed spots up to (4, 5) that corresponds to 3.1 nm resolution. After applying an unbending procedure, the diffraction pattern showed spots extending to 1.8 nm resolution.

Ultrafast Ultrasound Imaging of Ocular Anatomy and Blood Flow

PubMed Central

Urs, Raksha; Ketterling, Jeffrey A.; Silverman, Ronald H.

2016-01-01

Purpose Ophthalmic ultrasound imaging is currently performed with mechanically scanned single-element probes. These probes have limited capabilities overall and lack the ability to image blood flow. Linear-array systems are able to detect blood flow, but these systems exceed ophthalmic acoustic intensity safety guidelines. Our aim was to implement and evaluate a new linear-array–based technology, compound coherent plane-wave ultrasound, which offers ultrafast imaging and depiction of blood flow at safe acoustic intensity levels. Methods We compared acoustic intensity generated by a 128-element, 18-MHz linear array operated in conventionally focused and plane-wave modes and characterized signal-to-noise ratio (SNR) and lateral resolution. We developed plane-wave B-mode, real-time color-flow, and high-resolution depiction of slow flow in postprocessed data collected continuously at a rate of 20,000 frames/s. We acquired in vivo images of the posterior pole of the eye by compounding plane-wave images acquired over ±10° and produced images depicting orbital and choroidal blood flow. Results With the array operated conventionally, Doppler modes exceeded Food and Drug Administration safety guidelines, but plane-wave modalities were well within guidelines. Plane-wave data allowed generation of high-quality compound B-mode images, with SNR increasing with the number of compounded frames. Real-time color-flow Doppler readily visualized orbital blood flow. Postprocessing of continuously acquired data blocks of 1.6-second duration allowed high-resolution depiction of orbital and choroidal flow over the cardiac cycle. Conclusions Newly developed high-frequency linear arrays in combination with plane-wave techniques present opportunities for the evaluation of ocular anatomy and blood flow, as well as visualization and analysis of other transient phenomena such as vessel wall motion over the cardiac cycle and saccade-induced vitreous motion. PMID:27428169

Azimuthal resolution degradation due to ocean surface motion in focused arrays and SARS

NASA Astrophysics Data System (ADS)

1990-06-01

During the meeting at WHOI (5-18-90), a discussion arose of the ability of the focused array to simulate the R/v ratios typical of airborne and/or spaceborne SARs. In particular, the ability was questioned of the focused array to yield the same azimuthal resolution, rho, as the SAR. Although the focused array can be sampled to yield the same azimuthal resolution as the SAR, it is likely that the images generated by the focused array will not be identical to those produced by a SAR with the same azimuth resolution. For a true SAR, biases in the Doppler history of azimuthally traveling waves due to their along-track motion will cause shifts in their apparent position. This will cause waves which are physically at one location to shift over several pixel widths in the image. The limited swath width of the focused array will prevent if from observing scattered power from waves falling outside the swath, thus such waves will not affect the image formed within the swath, as would happen in the SAR. Thus, it is likely that the focused array will not yield the same image as a SAR having the same resolution.

Towards on-chip time-resolved thermal mapping with micro-/nanosensor arrays

PubMed Central

2012-01-01

In recent years, thin-film thermocouple (TFTC) array emerged as a versatile candidate in micro-/nanoscale local temperature sensing for its high resolution, passive working mode, and easy fabrication. However, some key issues need to be taken into consideration before real instrumentation and industrial applications of TFTC array. In this work, we will demonstrate that TFTC array can be highly scalable from micrometers to nanometers and that there are potential applications of TFTC array in integrated circuits, including time-resolvable two-dimensional thermal mapping and tracing the heat source of a device. Some potential problems and relevant solutions from a view of industrial applications will be discussed in terms of material selection, multiplexer reading, pattern designing, and cold-junction compensation. We show that the TFTC array is a powerful tool for research fields such as chip thermal management, lab-on-a-chip, and other novel electrical, optical, or thermal devices. PMID:22931306

New light-amplifier-based detector designs for high spatial resolution and high sensitivity CBCT mammography and fluoroscopy

PubMed Central

Rudin, Stephen; Kuhls, Andrew T.; Yadava, Girijesh K.; Josan, Gaurav C.; Wu, Ye; Chityala, Ravishankar N.; Rangwala, Hussain S.; Ciprian Ionita, N.; Hoffmann, Kenneth R.; Bednarek, Daniel R.

2011-01-01

New cone-beam computed tomographic (CBCT) mammography system designs are presented where the detectors provide high spatial resolution, high sensitivity, low noise, wide dynamic range, negligible lag and high frame rates similar to features required for high performance fluoroscopy detectors. The x-ray detectors consist of a phosphor coupled by a fiber-optic taper to either a high gain image light amplifier (LA) then CCD camera or to an electron multiplying CCD. When a square-array of such detectors is used, a field-of-view (FOV) to 20 × 20 cm can be obtained where the images have pixel-resolution of 100 µm or better. To achieve practical CBCT mammography scan-times, 30 fps may be acquired with quantum limited (noise free) performance below 0.2 µR detector exposure per frame. Because of the flexible voltage controlled gain of the LA’s and EMCCDs, large detector dynamic range is also achievable. Features of such detector systems with arrays of either generation 2 (Gen 2) or 3 (Gen 3) LAs optically coupled to CCD cameras or arrays of EMCCDs coupled directly are compared. Quantum accounting analysis is done for a variety of such designs where either the lowest number of information carriers off the LA photo-cathode or electrons released in the EMCCDs per x-ray absorbed in the phosphor are large enough to imply no quantum sink for the design. These new LA- or EMCCD-based systems could lead to vastly improved CBCT mammography, ROI-CT, or fluoroscopy performance compared to systems using flat panels. PMID:21297904

New light-amplifier-based detector designs for high spatial resolution and high sensitivity CBCT mammography and fluoroscopy

NASA Astrophysics Data System (ADS)

Rudin, Stephen; Kuhls, Andrew T.; Yadava, Girijesh K.; Josan, Gaurav C.; Wu, Ye; Chityala, Ravishankar N.; Rangwala, Hussain S.; Ionita, N. Ciprian; Hoffmann, Kenneth R.; Bednarek, Daniel R.

2006-03-01

New cone-beam computed tomographic (CBCT) mammography system designs are presented where the detectors provide high spatial resolution, high sensitivity, low noise, wide dynamic range, negligible lag and high frame rates similar to features required for high performance fluoroscopy detectors. The x-ray detectors consist of a phosphor coupled by a fiber-optic taper to either a high gain image light amplifier (LA) then CCD camera or to an electron multiplying CCD. When a square-array of such detectors is used, a field-of-view (FOV) to 20 x 20 cm can be obtained where the images have pixel-resolution of 100 μm or better. To achieve practical CBCT mammography scan-times, 30 fps may be acquired with quantum limited (noise free) performance below 0.2 μR detector exposure per frame. Because of the flexible voltage controlled gain of the LA's and EMCCDs, large detector dynamic range is also achievable. Features of such detector systems with arrays of either generation 2 (Gen 2) or 3 (Gen 3) LAs optically coupled to CCD cameras or arrays of EMCCDs coupled directly are compared. Quantum accounting analysis is done for a variety of such designs where either the lowest number of information carriers off the LA photo-cathode or electrons released in the EMCCDs per x-ray absorbed in the phosphor are large enough to imply no quantum sink for the design. These new LA- or EMCCD-based systems could lead to vastly improved CBCT mammography, ROI-CT, or fluoroscopy performance compared to systems using flat panels.

Time-resolved optical spectrometer based on a monolithic array of high-precision TDCs and SPADs

NASA Astrophysics Data System (ADS)

Tamborini, Davide; Markovic, Bojan; Di Sieno, Laura; Contini, Davide; Bassi, Andrea; Tisa, Simone; Tosi, Alberto; Zappa, Franco

2013-12-01

We present a compact time-resolved spectrometer suitable for optical spectroscopy from 400 nm to 1 μm wavelengths. The detector consists of a monolithic array of 16 high-precision Time-to-Digital Converters (TDC) and Single-Photon Avalanche Diodes (SPAD). The instrument has 10 ps resolution and reaches 70 ps (FWHM) timing precision over a 160 ns full-scale range with a Differential Non-Linearity (DNL) better than 1.5 % LSB. The core of the spectrometer is the application-specific integrated chip composed of 16 pixels with 250 μm pitch, containing a 20 μm diameter SPAD and an independent TDC each, fabricated in a 0.35 μm CMOS technology. In front of this array a monochromator is used to focus different wavelengths into different pixels. The spectrometer has been used for fluorescence lifetime spectroscopy: 5 nm spectral resolution over an 80 nm bandwidth is achieved. Lifetime spectroscopy of Nile blue is demonstrated.

A High-Speed, Event-Driven, Active Pixel Sensor Readout for Photon-Counting Microchannel Plate Detectors

NASA Technical Reports Server (NTRS)

Kimble, Randy A.; Pain, B.; Norton, T. J.; Haas, P.; Fisher, Richard R. (Technical Monitor)

2001-01-01

Silicon array readouts for microchannel plate intensifiers offer several attractive features. In this class of detector, the electron cloud output of the MCP intensifier is converted to visible light by a phosphor; that light is then fiber-optically coupled to the silicon array. In photon-counting mode, the resulting light splashes on the silicon array are recognized and centroided to fractional pixel accuracy by off-chip electronics. This process can result in very high (MCP-limited) spatial resolution for the readout while operating at a modest MCP gain (desirable for dynamic range and long term stability). The principal limitation of intensified CCD systems of this type is their severely limited local dynamic range, as accurate photon counting is achieved only if there are not overlapping event splashes within the frame time of the device. This problem can be ameliorated somewhat by processing events only in pre-selected windows of interest or by using an addressable charge injection device (CID) for the readout array. We are currently pursuing the development of an intriguing alternative readout concept based on using an event-driven CMOS Active Pixel Sensor. APS technology permits the incorporation of discriminator circuitry within each pixel. When coupled with suitable CMOS logic outside the array area, the discriminator circuitry can be used to trigger the readout of small sub-array windows only when and where an event splash has been detected, completely eliminating the local dynamic range problem, while achieving a high global count rate capability and maintaining high spatial resolution. We elaborate on this concept and present our progress toward implementing an event-driven APS readout.

Spaced-antenna wind estimation using an X-band active phased-array weather radar

NASA Astrophysics Data System (ADS)

Venkatesh, Vijay

Over the past few decades, several single radar methods have been developed to probe the kinematic structure of storms. All these methods trade angular-resolution to retrieve the wind-field. To date, the spaced-antenna method has been employed for profiling the ionosphere and the precipitation free lower atmosphere. This work focuses on applying the spaced-antenna method on an X-band active phased-array radar for high resolution horizontal wind-field retrieval from precipitation echoes. The ability to segment the array face into multiple displaced apertures allows for flexible spaced-antenna implementations. The methodology employed herein comprises of Monte-Carlo simulations to optimize the spaced-antenna system design and analysis of real data collected with the designed phased-array system. The contribution that underpins this dissertation is the demonstration of qualitative agreement between spaced-antenna and Doppler beam swinging retrievals based on real data. First, simulations of backscattered electric fields at the antenna array elements are validated using theoretical expressions. Based on the simulations, the degrees of freedom in the spaced-antenna system design are optimized for retrieval of mean baseline wind. We show that the designed X-band spaced-antenna system has lower retrieval uncertainty than the existing S-band spaced-antenna implementation on the NWRT. This is because of the flexibility to synthesize small overlapping apertures and the ability to obtain statistically independent samples at a faster rate at X-band. We then demonstrate a technique to make relative phase-center displacement measurements based on simulations and real data from the phased-array spaced-antenna system. This simple method uses statistics of precipitation echoes and apriori beamwidth measurements to make field repeatable phase-center displacement measurements. Finally, we test the hypothesis that wind-field curvature effects are common to both the spaced-antenna and Doppler beam swinging methods. Based on a close-range winter storm data set, we find that the spaced-antenna and fine-resolution Doppler beam swinging retrievals are in qualitative agreement. The correlation between the spaced-antenna and fine-resolution Doppler beam swinging retrievals was 0.57. The lowered correlation coefficient was, in part, due to the high standard deviation of the DBS retrievals. At high wind-speeds, the spaced-antenna retrievals significantly departed from variational retrievals of mean baseline wind.

Flat field concave holographic grating with broad spectral region and moderately high resolution.

PubMed

Wu, Jian Fen; Chen, Yong Yan; Wang, Tai Sheng

2012-02-01

In order to deal with the conflicts between broad spectral region and high resolution in compact spectrometers based on a flat field concave holographic grating and line array CCD, we present a simple and practical method to design a flat field concave holographic grating that is capable of imaging a broad spectral region at a moderately high resolution. First, we discuss the principle of realizing a broad spectral region and moderately high resolution. Second, we provide the practical method to realize our ideas, in which Namioka grating theory, a genetic algorithm, and ZEMAX are used to reach this purpose. Finally, a near-normal-incidence example modeled in ZEMAX is shown to verify our ideas. The results show that our work probably has a general applicability in compact spectrometers with a broad spectral region and moderately high resolution.

A novel method for size uniform 200nm particles: multimetallic particles and in vitro gene delivery

NASA Astrophysics Data System (ADS)

Mair, Lamar; Ford, Kris; Superfine, Richard

2008-10-01

We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts. Metal particles evaporated on cylindrical structures 0.20μm in diameter and 0.33μm tall are released via photoresist dissolution, resulting in freely suspended, shape defined particles. These Post-Particles have highly tunable composition, as demonstrated by our deposition of five different multimetallic particle blends. We calculate the susceptibility and magnetization of 200nm Fe particles in an applied 0.081T magnetic field. In order to evaluate their usefulness as magnetofection agents an antisense oligonucleotide designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA was successfully attached to Fe Post-Particles via a polyethyleneimine linker and transfected into a modified HeLa cell line.

Performance of the Broadband Golay 3x6 Array Associated with the 2016 IRIS Community Wavefields Experiment

NASA Astrophysics Data System (ADS)

Bolarinwa, O. J.; Langston, C. A.; Sweet, J. R.; Anderson, K. R.; Woodward, R.

2017-12-01

A 6 km aperture regional array in the Golay 3x6 configuration was fielded as part of the IRIS Community Wavefields Experiment near Enid, Oklahoma from June 26 through November 12, 2016. The array consisted of 18 broadband CMG-3T seismometers deployed using a PASSCAL insulated vault design and RT130 data recorders. The Golay geometry is unusual in that it features 6 tripartite arrays in an open arrangement. Spacing and orientation of each tripartite array is such that the array uniformly samples the wavefield in space as determined from the co-array diagram even though the interior of the array configuration contains no seismic stations. The short wavelength performance of this array requires a high degree of phase correlation across its entire aperture, a characteristic that has been difficult to achieve for other regional array designs because of velocity heterogeneity in the earth. Located within an area of high regional seismicity, the IRIS experiment offered an opportunity to examine the slowness-frequency performance of a real-world Golay 3x6 array that was subject to constraints on land usage during deployment. Individual tripartite arrays fit well within a land survey quarter section but it proved difficult to match the ideal spacing between each subarray because of permitting problems. Nevertheless, these unavoidable geometry perturbations caused only minor changes to the theoretical array response. More surprisingly, observations of high frequency regional P and S phases show very high correlation over the array aperture that gives rise to precise array responses that are close to theoretical. Both the array geometry and relatively homogeneous structure under the array produces an exceptional facility that can be used for high-resolution studies of regional seismic waves.

Microwell Array Method for Rapid Generation of Uniform Agarose Droplets and Beads for Single Molecule Analysis.

PubMed

Li, Xingrui; Zhang, Dongfeng; Zhang, Huimin; Guan, Zhichao; Song, Yanling; Liu, Ruochen; Zhu, Zhi; Yang, Chaoyong

2018-02-20

Compartmentalization of aqueous samples in uniform emulsion droplets has proven to be a useful tool for many chemical, biological, and biomedical applications. Herein, we introduce an array-based emulsification method for rapid and easy generation of monodisperse agarose-in-oil droplets in a PDMS microwell array. The microwells are filled with agarose solution, and subsequent addition of hot oil results in immediate formation of agarose droplets due to the surface-tension of the liquid solution. Because droplet size is determined solely by the array unit dimensions, uniform droplets with preselectable diameters ranging from 20 to 100 μm can be produced with relative standard deviations less than 3.5%. The array-based droplet generation method was used to perform digital PCR for absolute DNA quantitation. The array-based droplet isolation and sol-gel switching property of agarose enable formation of stable beads by chilling the droplet array at -20 °C, thus, maintaining the monoclonality of each droplet and facilitating the selective retrieval of desired droplets. The monoclonality of droplets was demonstrated by DNA sequencing and FACS analysis, suggesting the robustness and flexibility of the approach for single molecule amplification and analysis. We believe our approach will lead to new possibilities for a great variety of applications, such as single-cell gene expression studies, aptamer selection, and oligonucleotide analysis.

Characterization of a 2-mm thick, 16x16 Cadmium-Zinc-Telluride Pixel Array

NASA Technical Reports Server (NTRS)

Gaskin, Jessica; Richardson, Georgia; Mitchell, Shannon; Ramsey, Brian; Seller, Paul; Sharma, Dharma

2003-01-01

The detector under study is a 2-mm-thick, 16x16 Cadmium-Zinc-Telluride pixel array with a pixel pitch of 300 microns and inter-pixel gap of 50 microns. This detector is a precursor to that which will be used at the focal plane of the High Energy Replicated Optics (HERO) telescope currently being developed at Marshall Space Flight Center. With a telescope focal length of 6 meters, the detector needs to have a spatial resolution of around 200 microns in order to take full advantage of the HERO angular resolution. We discuss to what degree charge sharing will degrade energy resolution but will improve our spatial resolution through position interpolation. In addition, we discuss electric field modeling for this specific detector geometry and the role this mapping will play in terms of charge sharing and charge loss in the detector.

High resolution collimator system for X-ray detector

DOEpatents

Eberhard, Jeffrey W.; Cain, Dallas E.

1987-01-01

High resolution in an X-ray computerized tomography (CT) inspection system is achieved by using a collimator/detector combination to limit the beam width of the X-ray beam incident on a detector element to the desired resolution width. In a detector such as a high pressure Xenon detector array, a narrow tapered collimator is provided above a wide detector element. The collimator slits have any desired width, as small as a few mils at the top, the slit width is easily controlled, and they are fabricated on standard machines. The slit length determines the slice thickness of the CT image.

Progress Towards High-Sensitivity Arrays of Detectors of Sub-mm Radiation using Superconducting Tunnel Junctions with Radio-Frequency Single-Electron Transistors

NASA Technical Reports Server (NTRS)

Stevenson, T. R.; Hsieh, W.-T.; Li, M. J.; Stahle, C. M.; Wollack, E. J.; Schoelkopf, R. J.; Krebs, Carolyn (Technical Monitor)

2002-01-01

The science drivers for the SPIRIT/SPECS missions demand sensitive, fast, compact, low-power, large-format detector arrays for high resolution imaging and spectroscopy in the far infrared and submillimeter. Detector arrays with 10,000 pixels and sensitivity less than 10(exp 20)-20 W/Hz(exp 20)0.5 are needed. Antenna-coupled superconducting tunnel junction detectors with integrated rf single-electron transistor readout amplifiers have the potential for achieving this high level of sensitivity, and can take advantage of an rf multiplexing technique when forming arrays. The device consists of an antenna structure to couple radiation into a small superconducting volume and cause quasiparticle excitations, and a single-electron transistor to measure currents through tunnel junction contacts to the absorber volume. We will describe optimization of device parameters, and recent results on fabrication techniques for producing devices with high yield for detector arrays. We will also present modeling of expected saturation power levels, antenna coupling, and rf multiplexing schemes.

Nitride micro-LEDs and beyond--a decade progress review.

PubMed

Jiang, H X; Lin, J Y

2013-05-06

Since their inception, micro-size light emitting diode (µLED) arrays based on III-nitride semiconductors have emerged as a promising technology for a range of applications. This paper provides an overview on a decade progresses on realizing III-nitride µLED based high voltage single-chip AC/DC-LEDs without power converters to address the key compatibility issue between LEDs and AC power grid infrastructure; and high-resolution solid-state self-emissive microdisplays operating in an active driving scheme to address the need of high brightness, efficiency and robustness of microdisplays. These devices utilize the photonic integration approach by integrating µLED arrays on-chip. Other applications of nitride µLED arrays are also discussed.

Recent Developments in Transition-Edge Strip Detectors for Solar X-Rays

NASA Technical Reports Server (NTRS)

Rausch, Adam J.; Deiker, Steven W.; Hilton, Gene; Irwin, Kent D.; Martinez-Galarce, Dennis S.; Shing, Lawrence; Stern, Robert A.; Ullom, Joel N.; Vale, Leila R.

2008-01-01

LMSAL and NIST are developing position-sensitive x-ray strip detectors based on Transition Edge Sensor (TES) microcalorimeters optimized for solar physics. By combining high spectral (E/ delta E approximately equals 1600) and temporal (single photon delta t approximately equals 10 micro s) resolutions with imaging capabilities, these devices will be able to study high-temperature (>l0 MK) x-ray lines as never before. Diagnostics from these lines should provide significant new insight into the physics of both microflares and the early stages of flares. Previously, the large size of traditional TESs, along with the heat loads associated with wiring large arrays, presented obstacles to using these cryogenic detectors for solar missions. Implementing strip detector technology at small scales, however, addresses both issues: here, a line of substantially smaller effective pixels requires only two TESs, decreasing both the total array size and the wiring requirements for the same spatial resolution. Early results show energy resolutions of delta E(sub fwhm) approximately equals 30 eV and spatial resolutions of approximately 10-15 micron, suggesting the strip-detector concept is viable.

DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

PubMed Central

Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

2015-01-01

Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

The drift chamber array at the external target facility in HIRFL-CSR

NASA Astrophysics Data System (ADS)

Sun, Y. Z.; Sun, Z. Y.; Wang, S. T.; Duan, L. M.; Sun, Y.; Yan, D.; Tang, S. W.; Yang, H. R.; Lu, C. G.; Ma, P.; Yu, Y. H.; Zhang, X. H.; Yue, K.; Fang, F.; Su, H.

2018-06-01

A drift chamber array at the External Target Facility in HIRFL-CSR has been constructed for three-dimensional particle tracking in high-energy radioactive ion beam experiments. The design, readout, track reconstruction program and calibration procedures for the detector are described. The drift chamber array was tested in a 311 AMeV 40Ar beam experiment. The detector performance based on the measurements of the beam test is presented. A spatial resolution of 230 μm is achieved.

Jammed-array wideband sawtooth filter.

PubMed

Tan, Zhongwei; Wang, Chao; Goda, Keisuke; Malik, Omer; Jalali, Bahram

2011-11-21

We present an all-optical passive low-cost spectral filter that exhibits a high-resolution periodic sawtooth spectral pattern without the need for active optoelectronic components. The principle of the filter is the partial masking of a phased array of virtual light sources with multiply jammed diffraction orders. We utilize the filter's periodic linear map between frequency and intensity to demonstrate fast sensitive interrogation of fiber Bragg grating sensor arrays and ultrahigh-frequency electrical sawtooth waveform generation. © 2011 Optical Society of America

High-resolution hard x-ray spectroscopy of high-temperature plasmas using an array of quantum microcalorimeters.

PubMed

Thorn, Daniel B; Gu, Ming F; Brown, Greg V; Beiersdorfer, Peter; Porter, F Scott; Kilbourne, Caroline A; Kelley, Richard L

2008-10-01

Quantum microcalorimeters show promise in being able to fully resolve x-ray spectra from heavy highly charged ions, such as would be found in hot plasmas with temperatures in excess of 50 keV. Quantum microcalorimeter arrays are able to achieve this as they have a high-resolving power and good effective quantum efficiency for hard x-ray photons up to 60 keV. To demonstrate this, we present a measurement using an array of thin HgTe quantum microcalorimeters to measure the K-shell spectrum of hydrogenlike through carbonlike praseodymium (Z=57). With this device we are able to attain a resolving power, E/DeltaE, of 1000 at a photon energy of 37 keV.

Spatiotemporal Pixelization to Increase the Recognition Score of Characters for Retinal Prostheses

PubMed Central

Kim, Hyun Seok; Park, Kwang Suk

2017-01-01

Most of the retinal prostheses use a head-fixed camera and a video processing unit. Some studies proposed various image processing methods to improve visual perception for patients. However, previous studies only focused on using spatial information. The present study proposes a spatiotemporal pixelization method mimicking fixational eye movements to generate stimulation images for artificial retina arrays by combining spatial and temporal information. Input images were sampled with a resolution that was four times higher than the number of pixel arrays. We subsampled this image and generated four different phosphene images. We then evaluated the recognition scores of characters by sequentially presenting phosphene images with varying pixel array sizes (6 × 6, 8 × 8 and 10 × 10) and stimulus frame rates (10 Hz, 15 Hz, 20 Hz, 30 Hz, and 60 Hz). The proposed method showed the highest recognition score at a stimulus frame rate of approximately 20 Hz. The method also significantly improved the recognition score for complex characters. This method provides a new way to increase practical resolution over restricted spatial resolution by merging the higher resolution image into high-frame time slots. PMID:29073735

MTF measurements with high-resolution a-Si:H imaging arrays

NASA Astrophysics Data System (ADS)

Yorkston, John; Antonuk, Larry E.; Seraji, N.; Huang, Weidong; Siewerdsen, Jeffrey H.; El-Mohri, Youcef

1995-05-01

Recent advances in a-Si:H fabrication technology have opened the way for the application of flat panel imaging arrays in a number of areas in medical imaging. Their large area (up to approximately 26 X 26 cm), thin profile (< 1 mm) and real time readout capability make them strong candidates for the replacement of more traditional x-ray imaging technologies such as film and image intensifier systems. As a first step towards a device suitable for clinical use we have created a 24.4 X 19.4 cm array with 127 micrometers pitch pixels. This device serves as a testbed for investigating the effects of design changes on array imaging performance. This paper reports on initial measurements of the spatial resolution of this device used in conjunction with an overlaying Lanex Regular screen and 90 kVp x rays. The measured pre-sampled modulation transfer function (p.s. MTF) is found to fall below the predicted value by up to approximately 8%. At least part of this reduction seems to be due to scattering of light photons between the array and the surface of the phosphor screen contacting the array.