Science.gov

Sample records for highly functional virus-specific

  1. Reducing persistent polyomavirus infection increases functionality of virus-specific memory CD8 T cells.

    PubMed

    Qin, Qingsong; Lauver, Matthew; Maru, Saumya; Lin, Eugene; Lukacher, Aron E

    2017-02-01

    Mouse polyomavirus (MuPyV) causes a smoldering persistent infection in immunocompetent mice. To lower MuPyV infection in acutely and persistently infected mice, and study the impact of a temporal reduction in viral loads on the memory CD8 T cell response, we created a recombinant MuPyV in which a loxP sequence was inserted into the A2 strain genome upstream of the early promoter and another loxP sequence was inserted in cis into the intron shared by all three T antigens. Using mice transgenic for tamoxifen-inducible Cre recombinase, we demonstrated that reduction in MuPyV load during persistent infection was associated with differentiation of virus-specific CD8 T cells having a superior recall response. Evidence presented here supports the concept that reduction in viral load during persistent infection can promote differentiation of protective virus-specific memory CD8 T cells in patients at risk for diseases caused by human polyomaviruses.

  2. Functional profile of human influenza virus-specific cytotoxic T lymphocyte activity is influenced by interleukin-2 concentration and epitope specificity

    PubMed Central

    Boon, ACM; de Mutsert, G; Fouchier, RAM; Osterhaus, ADME; Rimmelzwaan, GF

    2005-01-01

    The ability of influenza A virus-specific cytotoxic T lymphocytes (CTL) to degranulate and produce cytokines upon antigenic restimulation was studied in four HLA-A*0101 and HLA-A*0201 positive subjects. Peripheral blood mononuclear cells of these subjects were stimulated with influenza A virus in the presence of high or low interleukin (IL)-2 concentrations. CD8+ T cell populations specific for the HLA-A*0101 restricted epitope NP44–52 and the HLA-A*0201 restricted epitope M158–66 were identified by positive staining with tetramers of peptide major histocompatibility complexes (MHC) (NP-Tm and M1-Tm, respectively). Within these populations, the proportion of cells mobilizing CD107a, or expressing interferon (IFN)-γ and tumour necrosis factor-(TNF)-α upon short-term peptide restimulation was determined by flow cytometry. Independent of IL-2 concentrations, large subject-dependent differences in the mobilization of CD107a and expression of IFN-γ and TNF-α by both NP- and M1-specific T cells were observed. In two of the four subjects, the functional profile of NP-Tm+ and M1-Tm+ cells differed considerably. Overall, no difference in the proportion of NP-Tm+ or M1-Tm+ cells expressing CD107a was observed. The proportion of M1-Tm+ cells that produced IFN-γ (P < 0·05) was larger than for NP-Tm+ cells, independent of IL-2 concentration. When cultured under IL-2hi concentrations higher TNF-α expression was also observed in M1-Tm+ cells (P < 0·05). The IL-2 concentration during expansion of virus-specific cells had a profound effect on the functionality of both M1-Tm+ and NP-Tm+ cells. PMID:16178855

  3. Peripheral blood-derived virus-specific memory stem T cells mature to functional effector memory subsets with self-renewal potency.

    PubMed

    Schmueck-Henneresse, Michael; Sharaf, Radwa; Vogt, Katrin; Weist, Benjamin J D; Landwehr-Kenzel, Sybille; Fuehrer, Henrike; Jurisch, Anke; Babel, Nina; Rooney, Cliona M; Reinke, Petra; Volk, Hans-Dieter

    2015-06-01

    Memory T cells expressing stem cell-like properties have been described recently. The capacity of self-renewal and differentiation into various memory/effector subsets make them attractive for adoptive T cell therapy to combat severe virus infections and tumors. The very few reports on human memory stem T cells (T(SCM)) are restricted to analyses on polyclonal T cells, but extensive data on Ag-specific T(SCM )are missing. This might be due to their very low frequency limiting their enrichment and characterization. In this article, we provide functional and phenotypic data on human viral-specific T(SCM), defined as CD8(+)CD45RA(+)CCR7(+)CD127(+)CD95(+). Whereas <1% of total T cells express the T(SCM) phenotype, human CMV-specific T(SCM) can be detected at frequencies similar to those seen in other subsets, resulting in ∼ 1 /10,000 human CMV-specific T(SCM). A new virus-specific expansion protocol of sort-purified T(SCM) reveals both upregulation of various T cell subset markers and preservation of their stem cell phenotype in a significant proportion, indicating both self-renewal and differentiation potency of virus-specific T cells sharing their TCR repertoire. Furthermore, we describe a simplified culture protocol that allows fast expansion of virus-specific T(SCM) starting from a mixed naive T/T(SCM) pool of PBLs. Due to the clinical-grade compatibility, this might be the basis for novel cell therapeutic options in life-threatening courses of viral and tumor disease.

  4. Different Levels of T-Cell Receptor Triggering Induce Distinct Functions in Hepatitis B and Hepatitis C Virus-Specific Human CD4+ T-Cell Clones

    PubMed Central

    Diepolder, Helmut M.; Gruener, Norbert H.; Gerlach, J. Tilman; Jung, Maria-Christina; Wierenga, Eddy A.; Pape, Gerd R.

    2001-01-01

    CD4+ T cells play a major role in the host defense against viruses and intracellular microbes. During the natural course of such an infection, specific CD4+ T cells are exposed to a wide range of antigen concentrations depending on the body compartment and the stage of disease. While epitope variants trigger only subsets of T-cell effector functions, the response of virus-specific CD4+ T cells to various concentrations of the wild-type antigen has not been systematically studied. We stimulated hepatitis B virus core- and hepatitis C virus NS3-specific CD4+ T-cell clones which had been isolated from patients with acute hepatitis during viral clearance with a wide range of specific antigen concentrations and determined the phenotypic changes and the induction of T-cell effector functions in relation to T-cell receptor internalization. A low antigen concentration induced the expression of T-cell activation markers and adhesion molecules in CD4+ T-cell clones in the absence of cytokine secretion and proliferation. The expression of CD25, HLA-DR, CD69, and intercellular cell adhesion molecule 1 increased as soon as T-cell receptor internalization became detectable. A 30- to 100-fold-higher antigen concentration, corresponding to the internalization of 20 to 30% of T-cell receptor molecules, however, was required for the induction of proliferation as well as for gamma interferon and interleukin-4 secretion. These data indicate that virus-specific CD4+ T cells can respond to specific antigen in a graded manner depending on the antigen concentration, which may have implications for a coordinate regulation of specific CD4+ T-cell responses. PMID:11483723

  5. Differential functional avidity of dengue virus-specific T-cell clones for variant peptides representing heterologous and previously encountered serotypes.

    PubMed

    Imrie, Allison; Meeks, Janet; Gurary, Alexandra; Sukhbataar, Munkhzul; Kitsutani, Paul; Effler, Paul; Zhao, Zhengshan

    2007-09-01

    Proinflammatory cytokines secreted by memory CD8+ and CD4+ T cells are thought to play a direct role in the pathogenesis of dengue virus infection by increasing vascular permeability and thereby inducing the pathophysiologic events associated with dengue hemorrhagic fever and dengue shock syndrome. Severe disease is frequently observed in the setting of secondary infection with heterologous dengue virus serotypes, suggesting a role for cross-reactive memory T cells in the immunopathogenesis of severe disease. We used a large panel of well-characterized dengue virus-specific CD8+ T-cell clones isolated from Pacific Islanders previously infected with dengue virus 1 to examine effector memory function, focusing on a novel dominant HLA-B*5502-restricted NS5(329-337) epitope, and assessed T-cell responses to stimulation with variant peptides representing heterologous serotypes. Variant peptides were differentially recognized by dengue virus 1-specific effector CD8+ cytotoxic T lymphocytes (CTL) in a heterogeneous and clone-specific manner, in which cytolytic function and cytokine secretion could be enhanced, diminished, or abrogated compared with cognate peptide stimulation. Dengue virus-specific CTL stimulated with cognate and variant peptides demonstrated a cytokine response hierarchy of gamma IFN (IFN-gamma) > tumor necrosis factor alpha (TNF-alpha) > interleukin-2 (IL-2), and a subset of clones also produced IL-4 and IL-6. Individual clones demonstrated greater avidity for variant peptides representing heterologous serotypes, including serotypes previously encountered by the subject, and IFN-gamma and TNF-alpha secretion was enhanced by stimulation with these heterologous peptides. Altered antiviral T-cell responses in response to stimulation with heterologous dengue virus serotypes have implications for control of virus replication and for disease pathogenesis.

  6. Distinct Metabolic Requirements of Exhausted and Functional Virus-Specific CD8 T Cells in the Same Host.

    PubMed

    Schurich, Anna; Pallett, Laura J; Jajbhay, Danyal; Wijngaarden, Jessica; Otano, Itziar; Gill, Upkar S; Hansi, Navjyot; Kennedy, Patrick T; Nastouli, Eleni; Gilson, Richard; Frezza, Christian; Henson, Sian M; Maini, Mala K

    2016-08-02

    T cells undergo profound metabolic changes to meet the increased energy demands of maintaining an antiviral response. We postulated that differences in metabolic reprogramming would shape the efficacy of CD8 T cells mounted against persistent viral infections. We found that the poorly functional PD-1(hi) T cell response against hepatitis B virus (HBV) had upregulated the glucose transporter, Glut1, an effect recapitulated by oxygen deprivation to mimic the intrahepatic environment. Glut1(hi) HBV-specific T cells were dependent on glucose supplies, unlike the more functional cytomegalovirus (CMV)-specific T cells that could utilize oxidative phosphorylation in the absence of glucose. The inability of HBV-specific T cells to switch to oxidative phosphorylation was accompanied by increased mitochondrial size and lower mitochondrial potential, indicative of mitochondrial dysfunction. Interleukin (IL)-12, which recovers HBV-specific T cell effector function, increased their mitochondrial potential and reduced their dependence on glycolysis. Our findings suggest that mitochondrial defects limit the metabolic plasticity of exhausted HBV-specific T cells.

  7. A viral resistance gene from common bean functions across plant families and is up-regulated in a non-virus-specific manner

    PubMed Central

    Seo, Young-Su; Rojas, Maria R.; Lee, Jung-Youn; Lee, Sang-Won; Jeon, Jong-Seong; Ronald, Pamela; Lucas, William J.; Gilbertson, Robert L.

    2006-01-01

    Genes involved in a viral resistance response in common bean (Phaseolus vulgaris cv. Othello) were identified by inoculating a geminivirus reporter (Bean dwarf mosaic virus expressing the green fluorescent protein), extracting RNA from tissue undergoing the defense response, and amplifying sequences with degenerate R gene primers. One such gene (a TIR-NBS-LRR gene, RT4-4) was selected for functional analysis in which transgenic Nicotiana benthamiana were generated and screened for resistance to a range of viruses. This analysis revealed that RT4-4 did not confer resistance to the reporter geminivirus; however, it did activate a resistance-related response (systemic necrosis) to seven strains of Cucumber mosaic virus (CMV) from pepper or tomato, but not to a CMV strain from common bean. Of these eight CMV strains, only the strain from common bean systemically infected common bean cv. Othello. Additional evidence that RT4-4 is a CMV R gene came from the detection of resistance response markers in CMV-challenged leaves of RT4-4 transgenic plants, and the identification of the CMV 2a gene product as the elicitor of the necrosis response. These findings indicate that RT4-4 functions across two plant families and is up-regulated in a non-virus-specific manner. This experimental approach holds promise for providing insights into the mechanisms by which plants activate resistance responses against pathogens. PMID:16880399

  8. Cytomegalovirus Infection Leads to Development of High Frequencies of Cytotoxic Virus-Specific CD4+ T Cells Targeted to Vascular Endothelium

    PubMed Central

    Begum, Jusnara; Lal, Neeraj; Zuo, Jianmin; Beggs, Andrew; Moss, Paul

    2016-01-01

    Cytomegalovirus (CMV) infection elicits a very strong and sustained intravascular T cell immune response which may contribute towards development of accelerated immune senescence and vascular disease in older people. Virus-specific CD8+ T cell responses have been investigated extensively through the use of HLA-peptide tetramers but much less is known regarding CMV-specific CD4+ T cells. We used a range of HLA class II-peptide tetramers to investigate the phenotypic and transcriptional profile of CMV-specific CD4+ T cells within healthy donors. We show that such cells comprise an average of 0.45% of the CD4+ T cell pool and can reach up to 24% in some individuals (range 0.01–24%). CMV-specific CD4+ T cells display a highly differentiated effector memory phenotype and express a range of cytokines, dominated by dual TNF-α and IFN-γ expression, although substantial populations which express IL-4 were seen in some donors. Microarray analysis and phenotypic expression revealed a profile of unique features. These include the expression of CX3CR1, which would direct cells towards fractalkine on activated endothelium, and the β2-adrenergic receptor, which could permit rapid response to stress. CMV-specific CD4+ T cells display an intense cytotoxic profile with high level expression of granzyme B and perforin, a pattern which increases further during aging. In addition CMV-specific CD4+ T cells demonstrate strong cytotoxic activity against antigen-loaded target cells when isolated directly ex vivo. PD-1 expression is present on 47% of cells but both the intensity and distribution of the inhibitory receptor is reduced in older people. These findings reveal the marked accumulation and unique phenotype of CMV-specific CD4+ T cells and indicate how such T cells may contribute to the vascular complications associated with CMV in older people. PMID:27606804

  9. Functionality of Dengue Virus Specific Memory T Cell Responses in Individuals Who Were Hospitalized or Who Had Mild or Subclinical Dengue Infection

    PubMed Central

    Jeewandara, Chandima; Adikari, Thiruni N.; Gomes, Laksiri; Fernando, Samitha; Fernando, R. H.; Perera, M. K. T.; Ariyaratne, Dinuka; Kamaladasa, Achala; Salimi, Maryam; Prathapan, Shamini

    2015-01-01

    Background Although antibody responses to dengue virus (DENV) in naturally infected individuals have been extensively studied, the functionality of DENV specific memory T cell responses in relation to clinical disease severity is incompletely understood. Methodology/Principal findings Using ex vivo IFNγ ELISpot assays, and by determining cytokines produced in ELISpot supernatants, we investigated the functionality of DENV-specific memory T cell responses in a large cohort of individuals from Sri Lanka (n=338), who were naturally infected and were either hospitalized due to dengue or had mild or sub clinical dengue infection. We found that T cells of individuals with both past mild or sub clinical dengue infection and who were hospitalized produced multiple cytokines when stimulated with DENV-NS3 peptides. However, while DENV-NS3 specific T cells of those with mild/sub clinical dengue infection were more likely to produce only granzyme B (p=0.02), those who were hospitalized were more likely to produce both TNFα and IFNγ (p=0.03) or TNFα alone. We have also investigated the usefulness of a novel T cell based assay, which can be used to determine the past infecting DENV serotype. 92.4% of DENV seropositive individuals responded to at least one DENV serotype of this assay and none of the seronegatives responded. Individuals who were seronegative, but had received the Japanese encephalitis vaccine too made no responses, suggesting that the peptides used in this assay did not cross react with the Japanese encephalitis virus. Conclusions/significance The types of cytokines produced by DENV-specific memory T cells appear to influence the outcome of clinical disease severity. The novel T cell based assay, is likely to be useful in determining the past infecting DENV serotype in immune-epidemiological studies and also in dengue vaccine trials. PMID:25875020

  10. Variola virus-specific diagnostic assays: characterization, sensitivity, and specificity.

    PubMed

    Kondas, Ashley V; Olson, Victoria A; Li, Yu; Abel, Jason; Laker, Miriam; Rose, Laura; Wilkins, Kimberly; Turner, Jonathan; Kline, Richard; Damon, Inger K

    2015-04-01

    A public health response relies upon rapid and reliable confirmation of disease by diagnostic assays. Here, we detail the design and validation of two variola virus-specific real-time PCR assays, since previous assays cross-reacted with newly identified cowpox viruses. The assay specificity must continually be reassessed as other closely related viruses are identified.

  11. High Functioning Autism.

    ERIC Educational Resources Information Center

    Reed, Vicki

    This paper reviews the characteristics and needs of students with high functioning autism. First, it lists 18 common characteristics of autism, then it stresses that autism is defined by the general pattern of characteristics. Next, it discusses how people with high functioning autism differ from those with autism. These differences include higher…

  12. Tracking Virus-Specific CD4+ T Cells during and after Acute Hepatitis C Virus Infection

    PubMed Central

    Pfafferot, Katja; Heeg, Malte H.J.; Gaudieri, Silvana; Grüner, Norbert; Rauch, Andri; Gerlach, J. Tilman; Jung, Maria-Christina; Zachoval, Reinhart; Pape, Gerd R.; Schraut, Winfried; Santantonio, Teresa; Nitschko, Hans; Obermeier, Martin; Phillips, Rodney; Scriba, Thomas J.; Semmo, Nasser; Day, Cheryl; Weber, Jonathan N.; Fidler, Sarah; Thimme, Robert; Haberstroh, Anita; Baumert, Thomas F.; Klenerman, Paul; Diepolder, Helmut M.

    2007-01-01

    Background CD4+ T cell help is critical in maintaining antiviral immune responses and such help has been shown to be sustained in acute resolving hepatitis C. In contrast, in evolving chronic hepatitis C CD4+ T cell helper responses appear to be absent or short-lived, using functional assays. Methodology/Principal Findings Here we used a novel HLA-DR1 tetramer containing a highly targeted CD4+ T cell epitope from the hepatitis C virus non-structural protein 4 to track number and phenotype of hepatitis C virus specific CD4+ T cells in a cohort of seven HLA-DR1 positive patients with acute hepatitis C in comparison to patients with chronic or resolved hepatitis C. We observed peptide-specific T cells in all seven patients with acute hepatitis C regardless of outcome at frequencies up to 0.65% of CD4+ T cells. Among patients who transiently controlled virus replication we observed loss of function, and/or physical deletion of tetramer+ CD4+ T cells before viral recrudescence. In some patients with chronic hepatitis C very low numbers of tetramer+ cells were detectable in peripheral blood, compared to robust responses detected in spontaneous resolvers. Importantly we did not observe escape mutations in this key CD4+ T cell epitope in patients with evolving chronic hepatitis C. Conclusions/Significance During acute hepatitis C a CD4+ T cell response against this epitope is readily induced in most, if not all, HLA-DR1+ patients. This antiviral T cell population becomes functionally impaired or is deleted early in the course of disease in those where viremia persists. PMID:17653276

  13. Measles and Other Virus-specific Immunoglobulins in Multiple Sclerosis

    PubMed Central

    Haire, Margaret; Fraser, K. B.; Millar, J. H. D.

    1973-01-01

    Immunoglobulins M and G specific for meales, herpes simplex, and rubella viruses were assayed by the fluorescent antibody method in sera and cerebrospinal fluids (C.S.F.) obtained simultaneously from 30 patients with multiple sclerosis, 30 patients with other neurological diseases, and 30 “normal” control subjects. Sera of 11 out of 30 patients with multiple sclerosis had IgM which reacted specifically with measles virus-infected cells, compared with 2 out of 30 of the patients with other neurological diseases and none of the 30 normal controls. Virus-specific IgM was not found in C.S.F. by this method. The geometric mean titre of measles virus-specific IgG in serum was significantly higher in the multiple sclerosis group than in either control group, and while IgG specific for all three viruses was found in C.S.F., suggesting transfer across the blood-brain barrier, measles IgG predominated. ImagesFIG. 1FIG. 2 PMID:4356870

  14. Measles and other virus-specific immunoglobulins in multiple sclerosis.

    PubMed

    Haire, M; Fraser, K B; Millar, J H

    1973-09-22

    Immunoglobulins M and G specific for meales, herpes simplex, and rubella viruses were assayed by the fluorescent antibody method in sera and cerebrospinal fluids (C.S.F.) obtained simultaneously from 30 patients with multiple sclerosis, 30 patients with other neurological diseases, and 30 "normal" control subjects. Sera of 11 out of 30 patients with multiple sclerosis had IgM which reacted specifically with measles virus-infected cells, compared with 2 out of 30 of the patients with other neurological diseases and none of the 30 normal controls. Virus-specific IgM was not found in C.S.F. by this method.The geometric mean titre of measles virus-specific IgG in serum was significantly higher in the multiple sclerosis group than in either control group, and while IgG specific for all three viruses was found in C.S.F., suggesting transfer across the blood-brain barrier, measles IgG predominated.

  15. Id3 Controls Cell Death of 2B4+ Virus-Specific CD8+ T Cells in Chronic Viral Infection.

    PubMed

    Menner, Alexandra J; Rauch, Katharina S; Aichele, Peter; Pircher, Hanspeter; Schachtrup, Christian; Schachtrup, Kristina

    2015-09-01

    Sustained Ag persistence in chronic infection results in a deregulated CD8(+) T cell response that is characterized by T cell exhaustion and cell death of Ag-specific CD8(+) T cells. Yet, the underlying transcriptional mechanisms regulating CD8(+) T cell exhaustion and cell death are poorly defined. Using the experimental mouse model of lymphocytic choriomeningitis virus infection, we demonstrate that the transcriptional regulator Id3 controls cell death of virus-specific CD8(+) T cells in chronic infection. By comparing acute and chronic infection, we showed that Id3 (-) virus-specific CD8(+) T cells were less abundant, whereas the absolute numbers of Id3 (+) virus-specific CD8(+) T cells were equal in chronic and acute infection. Phenotypically, Id3 (-) and Id3 (+) cells most prominently differed with regard to expression of the surface receptor 2B4; although Id3 (-) cells were 2B4(+), almost all Id3 (+) cells lacked expression of 2B4. Lineage-tracing experiments showed that cells initially expressing Id3 differentiated into Id3 (-)2B4(+) cells; in turn, these cells were terminally differentiated and highly susceptible to cell death under conditions of persisting Ag. Enforced Id3 expression specifically increased the persistence of 2B4(+) virus-specific CD8(+) T cells by decreasing susceptibility to Fas/Fas ligand-mediated cell death. Thus, our findings reveal that the transcriptional regulator Id3 promotes the survival of virus-specific CD8(+) T cells in chronic infection and suggest that targeting Id3 might be beneficial for preventing cell death of CD8(+) T cells in chronic infection or for promoting cell death of uncontrolled, hyperactive CD8(+) T cells to prevent immunopathology.

  16. Virus-specific polymeric immunoglobulin A antibodies in serum from patients with rubella, measles, varicella, and herpes zoster virus infections.

    PubMed Central

    Negro Ponzi, A; Merlino, C; Angeretti, A; Penna, R

    1985-01-01

    More than 85% of the immunoglobulin A (IgA) antibodies in normal adult serum are monomeric (m-IgA). By contrast, virus-specific IgA is mainly polymeric (p-IgA) in sera from patients with rubella, measles, and varicella. Specific m-IgA antibodies only reach quantitative significance in late convalescence. In patients with herpes zoster, on the other hand, a varying response was observed: in three of six sera, specific IgA was absent or at a very low titer, whereas in the remaining three cases, a high titer of both p-IgA and m-IgA was noted. These results suggest that in the initial response to rubella, measles, and varicella-zoster viruses, specific IgA first appears as p-IgA and only later becomes, or is replaced by, m-IgA. PMID:3001129

  17. Detection of Bovine viral diarrhea virus-specific neutralizing antibodies in fresh colostrum: a modification of the virus neutralization test.

    PubMed

    Bedekovic, Tomislav; Mihaljevic, Zeljko; Jungic, Andreja; Lemo, Nina; Lojkic, Ivana; Cvetnic, Zeljko; Cac, Zeljko

    2013-03-01

    To eliminate cytotoxic effects of colostrum on cells, a modified virus neutralization test (VNT) for the detection of Bovine viral diarrhea virus-specific neutralizing antibodies in colostrum was developed. The new test was compared to the World Organization for Animal Health-recommended VNT and the results evaluated. The agreement of the new test compared to the standard VNT was determined to be 98%, whereas sensitivity and specificity of the modified VNT compared to the standard VNT were 100%. Bovine viral diarrhea virus-specific antibodies were detected in 42 sera samples and 38 colostrum samples. The antibody titers in serum and colostrum showed a high correlation (n = 56, r = 0.9719, P < 0.001). The modified virus neutralization technique described herein succeeds in eliminating cytotoxic effects and can be readily applied for the detection of specific antibodies against other infectious agents in colostrum.

  18. Cell-based antiviral screening against coronaviruses: Developing virus-specific and broad-spectrum inhibitors

    PubMed Central

    Kilianski, Andy; Baker, Susan C.

    2014-01-01

    To combat the public health threat from emerging coronaviruses (CoV), the development of antiviral therapies with either virus-specific or pan-CoV activities is necessary. An important step in antiviral drug development is the screening of potential inhibitors in cell-based systems. The recent emergence of the Middle East respiratory syndrome (MERS)-CoV necessitates adapting methods that have been used to identify antivirals against the severe, acute respiratory syndrome (SARS)-CoV and developing new approaches to more efficiently screen antiviral drugs. In this article we review cell-based assays using infectious virus (BSL-3) and surrogate assays (BSL-2) that can be implemented to accelerate antiviral development against MERS-CoV and future emergent coronaviruses. This paper forms part of a series of invited articles in Antiviral Research on “From SARS to MERS: 10 years of research on highly pathogenic human coronaviruses.” PMID:24269477

  19. CXCL10 and trafficking of virus-specific T cells during coronavirus-induced demyelination

    PubMed Central

    Stiles, Linda N.; Liu, Michael T.; Kane, Joy A. C.; Lane, Thomas E.

    2009-01-01

    Chronic expression of CXC chemokine ligand 10 (CXCL10) in the central nervous system (CNS) following infection with the neurotropic JHM strain of mouse hepatitis virus (JHMV) is associated with an immune-mediated demyelinating disease. Treatment of mice with anti-CXCL10 neutralizing antibody results in limited CD4+ T cell infiltration into the CNS accompanied by a reduction in white matter damage. The current study determines the antigen-specificity of the T lymphocytes present during chronic disease and evaluates how blocking CXCL10 signaling affects retention of virus-specific T cells within the CNS. CXCL10 neutralization selectively reduced accumulation and/or retention of virus-specific CD4+ T cells, yet exhibited limited effect on virus-specific CD8+ T cells. The response of CXCL10 neutralization on virus-specific T cell subsets is not due to differential expression of the CXCL10 receptor CXCR3 on T cells as there was no appreciable difference in receptor expression on virus-specific T cells during either acute or chronic disease. These findings emphasize the importance of virus-specific CD4+ T cells in amplifying demyelination in JHMV-infected mice. In addition, differential signals are required for trafficking and retention of virus-specific CD4+ and CD8+ T cells during chronic demyelination in JHMV-infected mice. PMID:19626487

  20. Measuring the diaspora for virus-specific CD8+ T cells.

    PubMed

    Marshall, D R; Turner, S J; Belz, G T; Wingo, S; Andreansky, S; Sangster, M Y; Riberdy, J M; Liu, T; Tan, M; Doherty, P C

    2001-05-22

    The CD8(+) T cell diaspora has been analyzed after secondary challenge with an influenza A virus that replicates only in the respiratory tract. Numbers of D(b)NP(366)- and D(b)PA(224)-specific CD8(+) T cells were measured by tetramer staining at the end of the recall response, then followed sequentially in the lung, lymph nodes, spleen, blood, and other organs. The extent of clonal expansion did not reflect the sizes of the preexisting memory T cell pools. Although the high-frequency CD8(+) tetramer(+) populations in the pneumonic lung and mediastinal lymph nodes fell rapidly from peak values, the "whole mouse" virus-specific CD8(+) T cell counts decreased only 2-fold over the 4 weeks after infection, then subsided at a fairly steady rate to reach a plateau at about 2 months. The largest numbers were found throughout in the spleen, then the bone marrow. The CD8(+)D(b)NP(366)+ and CD8(+)D(b)PA(224)+ sets remained significantly enlarged for at least 4 months, declining at equivalent rates while retaining the nucleoprotein > acid polymerase immunodominance hierarchy characteristic of the earlier antigen-driven phase. Lowest levels of the CD69 "activation marker" were detected consistently on virus-specific CD8(+) T cells in the blood, then the spleen. Those in the bone marrow and liver were intermediate, and CD69(hi) T cells were very prominent in the regional lymph nodes and the nasal-associated lymphoid tissue. Any population of "resting" CD8(+) memory T cells is thus phenotypically heterogeneous, widely dispersed, and subject to broad homeostatic and local environmental effects irrespective of epitope specificity or magnitude.

  1. The possible role of virus-specific CD8(+) memory T cells in decidual tissue.

    PubMed

    van Egmond, A; van der Keur, C; Swings, G M J S; Scherjon, S A; Claas, F H J

    2016-02-01

    The most abundant lymphocyte present in decidual tissue is the CD8(+) T cell. It has been shown that most decidual CD8(+) T cells have an effector-memory phenotype, but expressed reduced levels of perforin and granzyme B compared with the peripheral CD8(+) effector-memory T cells. The specificity of these CD8(+) memory T cells has yet to be determined. One hypothesis is that the decidual memory T cells are virus-specific T cells that should protect the fetus against incoming pathogens. As virus-specific CD8(+) memory T cells can cross-react with human leukocyte alloantigens, an alternative, but not mutually exclusive, hypothesis is that these CD8(+) T cells are fetus-specific. Using virus-specific tetramers, we found increased percentages of virus-specific CD8(+) T cells in decidual tissue compared with peripheral blood after uncomplicated pregnancy. So far, no evidence has been obtained for a cross-reactive response of these virus-specific T cells to fetal human leukocyte antigens. These results suggest that the virus-specific memory T cells accumulate in the placenta to protect the fetus from a harmful infection.

  2. Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

  3. Human Leukocyte Antigen (HLA) A*1101-Restricted Epstein-Barr Virus-Specific T-cell Receptor Gene Transfer to Target Nasopharyngeal Carcinoma.

    PubMed

    Zheng, Yong; Parsonage, Greg; Zhuang, Xiaodong; Machado, Lee R; James, Christine H; Salman, Asmaa; Searle, Peter F; Hui, Edwin P; Chan, Anthony T C; Lee, Steven P

    2015-10-01

    Infusing virus-specific T cells is effective treatment for rare Epstein-Barr virus (EBV)-associated posttransplant lymphomas, and more limited success has been reported using this approach to treat a far more common EBV-associated malignancy, nasopharyngeal carcinoma (NPC). However, current approaches using EBV-transformed lymphoblastoid cell lines to reactivate EBV-specific T cells for infusion take 2 to 3 months of in vitro culture and favor outgrowth of T cells targeting viral antigens expressed within EBV(+) lymphomas, but not in NPC. Here, we explore T-cell receptor (TCR) gene transfer to rapidly and reliably generate T cells specific for the NPC-associated viral protein LMP2. We cloned a human leukocyte antigen (HLA) A*1101-restricted TCR, which would be widely applicable because 40% of NPC patients carry this HLA allele. Studying both the wild-type and modified forms, we have optimized expression of the TCR and demonstrated high-avidity antigen-specific function (proliferation, cytotoxicity, and cytokine release) in both CD8(+) and CD4(+) T cells. The engineered T cells also inhibited LMP2(+) epithelial tumor growth in a mouse model. Furthermore, transduced T cells from patients with advanced NPC lysed LMP2-expressing NPC cell lines. Using this approach, within a few days large numbers of high-avidity LMP2-specific T cells can be generated reliably to treat NPC, thus providing an ideal clinical setting to test TCR gene transfer without the risk of autoimmunity through targeting self-antigens.

  4. Human Leukocyte Antigen (HLA) A*1101-restricted Epstein-Barr Virus-specific T-cell Receptor Gene Transfer to Target Nasopharyngeal Carcinoma

    PubMed Central

    Zheng, Yong; Parsonage, Greg; Zhuang, Xiaodong; Machado, Lee R; James, Christine H.; Salman, Asmaa; Searle, Peter F.; Hui, Edwin P.; Chan, Anthony T.C.; Lee, Steven P.

    2015-01-01

    Infusing virus-specific T cells is effective treatment for rare Epstein-Barr virus (EBV)-associated post-transplant lymphomas and more limited success has been reported using this approach to treat a far more common EBV-associated malignancy, nasopharyngeal carcinoma (NPC). However, current approaches using EBV-transformed lymphoblastoid cell lines to reactivate EBV-specific T cells for infusion take 2 to 3 months of in vitro culture and favour outgrowth of T cells targeting viral antigens expressed within EBV+ lymphomas but not in NPC. Here we explore T-cell receptor (TCR) gene transfer to rapidly and reliably generate T cells specific for the NPC-associated viral protein LMP2. We cloned a HLA A*1101-restricted TCR, which would be widely applicable since 40% of NPC patients carry this HLA allele. Studying both the wild-type and modified forms we have optimised expression of the TCR and demonstrated high avidity antigen-specific function (proliferation, cytotoxicity, cytokine release) in both CD8+ and CD4+ T cells. The engineered T cells also inhibited LMP2+ epithelial tumour growth in a mouse model. Furthermore, transduced T cells from patients with advanced NPC lysed LMP2-expressing NPC cell lines. Using this approach, within a few days large numbers of high avidity LMP2-specific T cells can be generated reliably to treat NPC, thus providing an ideal clinical setting to test TCR gene transfer without the risk of autoimmunity through targeting self-antigens. PMID:25711537

  5. Plasmablasts During Acute Dengue Infection Represent a Small Subset of a Broader Virus-specific Memory B Cell Pool.

    PubMed

    Appanna, Ramapraba; Kg, Srinivasan; Xu, Mei Hui; Toh, Ying-Xiu; Velumani, Sumathy; Carbajo, Daniel; Lee, Chia Yin; Zuest, Roland; Balakrishnan, Thavamalar; Xu, Weili; Lee, Bernett; Poidinger, Michael; Zolezzi, Francesca; Leo, Yee Sin; Thein, Tun Linn; Wang, Cheng-I; Fink, Katja

    2016-10-01

    Dengue is endemic in tropical countries worldwide and the four dengue virus serotypes often co-circulate. Infection with one serotype results in high titers of cross-reactive antibodies produced by plasmablasts, protecting temporarily against all serotypes, but impairing protective immunity in subsequent infections. To understand the development of these plasmablasts, we analyzed virus-specific B cell properties in patients during acute disease and at convalescence. Plasmablasts were unrelated to classical memory cells expanding in the blood during early recovery. We propose that only a small subset of memory B cells is activated as plasmablasts during repeat infection and that plasmablast responses are not representative of the memory B cell repertoire after dengue infection.

  6. The transcription factor Zbtb32 controls the proliferative burst of virus-specific natural killer cells responding to infection

    PubMed Central

    Beaulieu, Aimee M.; Zawislak, Carolyn L.; Nakayama, Toshinori; Sun, Joseph C.

    2015-01-01

    Natural Killer (NK) cells are innate lymphocytes that exhibit many features of adaptive immunity including clonal proliferation and long-lived memory. Here we demonstrate that the BTB-ZF transcription factor Zbtb32 (also known as ROG, FAZF, TZFP, and PLZP) is essential for the proliferative burst and protective capacity of virus-specific NK cells. Signals from proinflammatory cytokines are both necessary and sufficient to induce high Zbtb32 expression in NK cells. Mechanistically, we show that Zbtb32 facilitates NK cell proliferation during infection by antagonizing the anti-proliferative factor Blimp-1 (Prdm1). Taken together, our data support a model in which Zbtb32 acts as a cellular “hub” through which pro-inflammatory signals instruct a “proliferation-permissive” state in NK cells, thereby allowing their prolific expansion in response to viral infection. PMID:24747678

  7. New procedure for isolation of Rous sarcoma virus-specific RNA from infected cells.

    PubMed Central

    Bromley, P A; Spahr, P F; Darlix, J L

    1979-01-01

    The use of mercurated "strong stop" complementary DNA (complementary to the 5'-terminal 101 nucleotides of Rous sarcoma virus RNA) in the isolation of virus-specific RNA from infected chicken embryo fibroblasts is described. Strong stop Rous sarcoma virus complementary DNA was mercurated chemically, and, as a result of the low complexity of this DNA, short hybridization times (up to 15 min) and heating in the absence of formamide were found to be adequate conditions for the isolation of virus-specific RNA. The purity of the isolated RNA was demonstrated by analysis of labeled RNase T1-resistant oligonucleotides by two-dimensional polyacrylamide gel electrophoresis. The isolated RNA could be translated in the in vitro protein synthesis system derived from rabbit reticulocytes, and an analysis of polypeptides programmed by isolated RNA before and after immunoprecipitation further demonstrated both the purity of the isolated mRNA and the quantitative nature of the isolation procedure. Images PMID:228062

  8. Dengue virus protein recognition by virus-specific murine CD8+ cytotoxic T lymphocytes.

    PubMed Central

    Rothman, A L; Kurane, I; Lai, C J; Bray, M; Falgout, B; Men, R; Ennis, F A

    1993-01-01

    The identification of the protein targets for dengue virus-specific T lymphocytes may be useful for planning the development of subunit vaccines against dengue. We studied the recognition by murine dengue virus-specific major histocompatibility complex class I-restricted, CD8+ cytotoxic T lymphocytes (CTL) of dengue virus proteins using recombinant vaccinia viruses containing segments of the dengue virus genome. CTL from H-2k mice recognized a single serotype-cross-reactive epitope on the nonstructural (NS) protein NS3. CTL from H-2b mice recognized a serotype-cross-reactive epitope that was localized to NS4a or NS4b. CTL from H-2d mice recognized at least three epitopes: a serotype-specific epitope on one of the structural proteins, a serotype-cross-reactive epitope on NS3, and a serotype-cross-reactive epitope on NS1 or NS2a. Our findings demonstrate the limited recognition of dengue virus proteins by CTL from three inbred mouse strains and the predominance of CTL epitopes on dengue virus nonstructural proteins, particularly NS3. Since human dengue virus-specific CTL show similar patterns of recognition, these findings suggest that nonstructural proteins should be considered in designing vaccines against dengue. PMID:7678307

  9. Comparable polyfunctionality of ectromelia virus- and vaccinia virus-specific murine T cells despite markedly different in vivo replication and pathogenicity.

    PubMed

    Hersperger, Adam R; Siciliano, Nicholas A; Eisenlohr, Laurence C

    2012-07-01

    Vaccinia virus (VACV) stimulates long-term immunity against highly pathogenic orthopoxvirus infection of humans (smallpox) and mice (mousepox [ectromelia virus {ECTV}]) despite the lack of a natural host-pathogen relationship with either of these species. Previous research revealed that VACV is able to induce polyfunctional CD8(+) T-cell responses after immunization of humans. However, the degree to which the functional profile of T cells induced by VACV is similar to that generated during natural poxvirus infection remains unknown. In this study, we monitored virus-specific T-cell responses following the dermal infection of C57BL/6 mice with ECTV or VACV. Using polychromatic flow cytometry, we measured levels of degranulation, cytokine expression (gamma interferon [IFN-γ], tumor necrosis factor alpha [TNF-α], and interleukin-2 [IL-2]), and the cytolytic mediator granzyme B. We observed that the functional capacities of T cells induced by VACV and ECTV were of a similar quality in spite of the markedly different replication abilities and pathogenic outcomes of these viruses. In general, a significant fraction (≥50%) of all T-cell responses were positive for at least three functions both during acute infection and into the memory phase. In vivo killing assays revealed that CD8(+) T cells specific for both viruses were equally cytolytic (∼80% target cell lysis after 4 h), consistent with the similar levels of granzyme B and degranulation detected among these cells. Collectively, these data provide a mechanism to explain the ability of VACV to induce protective T-cell responses against pathogenic poxviruses in their natural hosts and provide further support for the use of VACV as a vaccine platform able to induce polyfunctional T cells.

  10. Host-virus specificity of morbilliviruses predicted by structural modeling of the marine mammal SLAM, a receptor.

    PubMed

    Ohishi, Kazue; Ando, Akiko; Suzuki, Rintaro; Takishita, Kiyotaka; Kawato, Masaru; Katsumata, Etsuko; Ohtsu, Dai; Okutsu, Kenji; Tokutake, Koji; Miyahara, Hirokazu; Nakamura, Hirotaka; Murayama, Tsukasa; Maruyama, Tadashi

    2010-05-01

    Signaling lymphocyte activation molecule (SLAM) is thought to be a major cellular receptor for high-host specificity morbilliviruses, which cause devastating and highly infectious diseases in mammals. We determined the sequences of SLAM cDNA from five species of marine mammal, including two cetaceans, two pinnipeds and one sirenian, and generated three-dimensional models to understand the receptor-virus interaction. Twenty-one amino acid residues in the immunoglobulin-like V domains of the SLAMs were shown to bind the viral protein. Notably, the sequences from pinnipeds and dogs were highly homologous, which is consistent with the fact that canine distemper virus was previously shown to cause a mass die-off of seals. Among these twenty-one residues, eight (63, 66, 68, 72, 84, 119, 121 and 130) were shared by animal groups susceptible to a particular morbillivirus species. This set of residues appears to determine host-virus specificity and may be useful for risk estimation for morbilliviruses.

  11. In Vitro Synthesis of Rous Sarcoma Virus-Specific RNA is Catalyzed by a DNA-Dependent RNA Polymerase

    PubMed Central

    Rymo, L.; Parsons, J. T.; Coffin, J. M.; Weissmann, C.

    1974-01-01

    Synthesis of Rous sarcoma virus RNA was examined in vitro with a new assay for radioactive virus-specific RNA. Nuclei from infected and uninfected cells were incubated with ribonucleoside [α-32P]triphosphates, Mn++, Mg++ and (NH4)2SO4. Incorporation into total and viral RNA proceeded with similar kinetics for up to 25 min at 37°. About 0.5% of the RNA synthesized by the infected system was scored as virus-specific, compared to 0.03% of the RNA from the uninfected system and 0.005% of the RNA synthesized by monkey kidney cell nuclei. Preincubation with DNase or actinomycin D completely suppressed total and virus-specific RNA synthesis. α-Amanitin, a specific inhibitor of eukaryotic RNA polymerase II, completely inhibited virus-specific RNA synthesis, while reducing total RNA synthesis by only 50%. We conclude that tumor virus-specific RNA is synthesized on a DNA template, most probably by the host's RNA polymerase II. PMID:4368801

  12. High throughput reproducible cantilever functionalization

    SciTech Connect

    Evans, Barbara R; Lee, Ida

    2014-01-21

    A method for functionalizing cantilevers is provided that includes providing a holder having a plurality of channels each having a width for accepting a cantilever probe and a plurality of probes. A plurality of cantilever probes are fastened to the plurality of channels of the holder by the spring clips. The wells of a well plate are filled with a functionalization solution, wherein adjacent wells in the well plate are separated by a dimension that is substantially equal to a dimension separating adjacent channels of the plurality of channels. Each cantilever probe that is fastened within the plurality of channels of the holder is applied to the functionalization solution that is contained in the wells of the well plate.

  13. High throughout reproducible cantilever functionalization

    SciTech Connect

    Evans, Barbara R; Lee, Ida

    2014-11-25

    A method for functionalizing cantilevers is provided that includes providing a holder having a plurality of channels each having a width for accepting a cantilever probe and a plurality of probes. A plurality of cantilever probes are fastened to the plurality of channels of the holder by the spring clips. The wells of a well plate are filled with a functionalization solution, wherein adjacent wells in the well plate are separated by a dimension that is substantially equal to a dimension separating adjacent channels of the plurality of channels. Each cantilever probe that is fastened within the plurality of channels of the holder is applied to the functionalization solution that is contained in the wells of the well plate.

  14. Intracellular cytokine production by dengue virus-specific T cells correlates with subclinical secondary infection.

    PubMed

    Hatch, Steven; Endy, Tim P; Thomas, Stephen; Mathew, Anuja; Potts, James; Pazoles, Pamela; Libraty, Daniel H; Gibbons, Robert; Rothman, Alan L

    2011-05-01

    The pathophysiology of dengue virus infection remains poorly understood, although secondary infection is strongly associated with more severe disease. In the present study, we performed a nested, case-control study comparing the responses of pre-illness peripheral blood mononuclear cells between children who would subsequently develop either subclinical or symptomatic secondary infection 6-11 months after the baseline blood samples were obtained and frozen. We analyzed intracellular cytokine production by CD4(+) and CD8(+) cells in response to stimulation with dengue antigen. We found higher frequencies of dengue virus-specific TNFα, IFNγ-, and IL-2-producing T cells among schoolchildren who subsequently developed subclinical infection, compared with those who developed symptomatic secondary dengue virus infection. Although other studies have correlated immune responses during secondary infection with severity of disease, to our knowledge this is the first study to demonstrate a pre-infection dengue-specific immune response that correlates specifically with a subclinical secondary infection.

  15. Magnetic protein microbead-aided indirect fluoroimmunoassay for the determination of canine virus specific antibodies.

    PubMed

    Wang, Xueqin; Ren, Li; Tu, Qin; Wang, Jianchun; Zhang, Yanrong; Li, Manlin; Liu, Rui; Wang, Jinyi

    2011-03-15

    Rabies, canine distemper, and canine parvovirus are common contagious viral diseases of dogs and many other carnivores, and pose a severe threat to the population dynamics of wild carnivores, as well as endangering carnivore conservation. However, clinical diagnosis of these diseases, especially canine distemper and canine parvovirus, is difficult because of the broad spectrum of symptoms that may be confused with other respiratory and enteric diseases of dogs. The most frequently used and proven techniques for diagnosing viral diseases include the conventional enzyme-linked immunosorbent assay (ELISA), rapid fluorescent focus inhibition test (RFFIT), mouse neutralisation test (MNT), and fluorescent antibody virus neutralization (FAVN) test. However, these methods still have some inherent limitations. In this study, a magnetic protein microbead-aided indirect fluoroimmunoassay was developed to detect canine virus specific antibodies, human rabies immunoglobulin, CDV McAbs, and CPV McAbs. In this assay, an avidin-biotin system was employed to combine magnetic microbeads and virus antigens (rabies virus, canine distemper virus, and canine parvovirus). Quantification of the targeted virus antibodies was analyzed through indirect fluoroimmunoassay using the specific antigen-antibody reaction, as well as their corresponding FITC-labeled detection antibodies (mouse anti-human IgG/FITC conjugate or rabbit anti-dog IgG/FITC conjugate). The results indicated that the fluorescence intensity increased when a higher concentration of the targeted analyte was used, but the control had almost no fluorescence, much like the conventional ELISA. For human rabies immunoglobulin, CDV McAbs, and CPV McAbs, the minimum detectable concentrations were 0.2 IU/mL, 0.3 ng/mL, and 0.5 ng/mL, respectively. All of these results indicate that this assay can be employed to determine the presence of canine virus specific antibodies. In addition, the method devised here can be utilized as a general

  16. Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

    PubMed

    Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

    2015-03-15

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work.

  17. Virus-specific antibodies interfere with avian influenza infection in peripheral blood mononuclear leukocytes from young or aged chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Avian influenza virus (AIV) infection was examined in peripheral blood mononuclear leukocyte cultures (PBMC) that were collected from 1-day-old chicks or from 52-week-old chickens. Virus-specific antibodies were incubated with AIV to model maternal antibody interference in vitro. Interferon-alpha (I...

  18. Success and failure of virus-specific T cell responses in hepatitis C virus infection.

    PubMed

    Neumann-Haefelin, Christoph; Thimme, Robert

    2011-01-01

    Hepatitis C virus (HCV) infection is only cleared in a minority of infected individuals, the majority of patients develop chronic infection. Chronic HCV infection potentially leads to liver fibrosis, cirrhosis and finally hepatocellular carcinoma. The host immune response is an important determinant in the outcome of HCV infection. Innate as well as adaptive cellular and humoral immune responses mediate important antiviral actions; however, virus-specific T cell responses appear to be most critical. Indeed, strong and multispecific CD4+ as well as CD8+ T cell responses are required for viral clearance. Interestingly, individuals who express certain HLA alleles (which are important for antigen presentation to CD4+ and CD8+ T cells) have a higher chance to clear the virus. The mechanisms of protection by HLA class I alleles such as HLA-B27 have been characterized recently. In most individuals, however, the HCV-specific immune response fails to clear the virus. Several mechanisms underlying this HCV-specific T cell failure have been identified. These include viral factors such as viral escape mutations and immunological factors such as the expression of inhibitory receptors, which lead to CD8+ T cell dysfunction. An in-depth understanding of the determinants of success or failure of the HCV-specific T cell response is critical for the development of prophylactic as well as therapeutic vaccination regimes against HCV. Here, we will discuss the virological and immunological determinants of HCV clearance and persistence.

  19. Broad RNA interference-mediated antiviral immunity and virus-specific inducible responses in Drosophila1

    PubMed Central

    Kemp, Cordula; Mueller, Stefanie; Goto, Akira; Barbier, Vincent; Paro, Simona; Bonnay, François; Dostert, Catherine; Troxler, Laurent; Hetru, Charles; Meignin, Carine; Pfeffer, Sébastien; Hoffmann, Jules A.; Imler, Jean-Luc

    2012-01-01

    The fruit fly Drosophila melanogaster is a good model to unravel the molecular mechanisms of innate immunity, and has led to some important discoveries on the sensing and signaling of microbial infections. The response of Drosophila to virus infections remains poorly characterized, and appears to involve two facets. On one hand RNA interference (RNAi) involves the recognition and processing of double stranded (ds) RNA into small interfering (si) RNAs by the host ribonuclease Dicer-2 (Dcr-2), whereas on the other hand an inducible response controlled by the evolutionarily conserved JAK-STAT pathway contributes to the antiviral host defense. In order to clarify the contribution of the siRNA and JAK-STAT pathways to the control of viral infections, we have compared the resistance of flies wild-type and mutant for Dcr-2 or the JAK kinase Hopscotch (Hop) to infections by seven RNA or DNA viruses belonging to different families. Our results reveal a unique susceptibility of hop mutant flies to infection by DCV and CrPV, two members of the Dicistroviridae family, which contrasts with the susceptibility of Dcr-2 mutant flies to many viruses, including the DNA virus IIV-6. Genome-wide microarray analysis confirmed that different sets of genes were induced following infection by DCV or by two unrelated RNA viruses, FHV and SINV. Overall, our data reveal that RNAi is an efficient antiviral mechanism, operating against a large range of viruses, including a DNA virus. By contrast, the antiviral contribution of the JAK-STAT pathway appears to be virus-specific. PMID:23255357

  20. Adoptive immunotherapy with the use of regulatory T cells and virus-specific T cells derived from cord blood.

    PubMed

    Hanley, Patrick J; Bollard, Catherine M; Brunstein, Claudio G

    2015-06-01

    Cord blood transplantation, an alternative to traditional stem cell transplants (bone marrow or peripheral blood stem cell transplantation), is an attractive option for patients lacking suitable stem cell transplant donors. Cord blood units have also proven to be a valuable donor source for the development of cellular therapeutics. Virus-specific T cells and regulatory T cells are two cord blood-derived products that have shown promise in early-phase clinical trials to prevent and/or treat viral infections and graft-versus-host disease, respectively. We describe how current strategies that use cord blood-derived regulatory T cells and virus-specific T cells have been developed to improve outcomes for cord blood transplant recipients.

  1. Developmental functional adaptation to high altitude: review.

    PubMed

    Frisancho, A Roberto

    2013-01-01

    Various approaches have been used to understand the origins of the functional traits that characterize the Andean high-altitude native. Based on the conceptual framework of developmental functional adaptation which postulates that environmental influences during the period of growth and development have long lasting effects that may be expressed during adulthood, we initiated a series of studies addressed at determining the pattern of physical growth and the contribution of growth and development to the attainment of full functional adaptation to high-altitude of low and high altitude natives living under rural and urban conditions. Current research indicate that: (a) the pattern of growth at high altitude due to limited nutritional resources, physical growth in body size is delayed but growth in lung volumes is accelerated because of hypoxic stress); (b) low-altitude male and female urban natives can attain a full functional adaptation to high altitude by exposure to high-altitude hypoxia during the period of growth and development; (c) both experimental studies on animals and comparative human studies indicate that exposure to high altitude during the period of growth and development results in the attainment of a large residual lung volume; (d) this developmentally acquired enlarged residual lung volume and its associated increase in alveolar area when combined with the increased tissue capillarization and moderate increase in red blood cells and hemoglobin concentration contributes to the successful functional adaptation of the Andean high-altitude native to hypoxia; and (e) any specific genetic traits that are related to the successful functional adaptation of Andean high-altitude natives have yet to be identified.

  2. Human Memory Cytotoxic T-Lymphocyte (CTL) Responses to Hantaan Virus Infection: Identification of Virus-Specific and Cross-Reactive CD8+ CTL Epitopes on Nucleocapsid Protein

    PubMed Central

    Van Epps, Heather L.; Schmaljohn, Connie S.; Ennis, Francis A.

    1999-01-01

    Hantaan virus, the prototypic member of the Hantavirus genus, causes hemorrhagic fever with renal syndrome in humans. We examined the human memory T-lymphocyte responses of three donors who had previous laboratory-acquired infections with Hantaan virus. We demonstrated virus-specific responses in bulk cultures of peripheral blood mononuclear cells (PBMC) from all donors. Bulk T-cell responses were directed against either Hantaan virus nucleocapsid (N) or G1 protein, and these responses varied between donors. We established both CD4+ and CD8+ N-specific cell lines from two donors and CD4+ G1-specific cell lines from a third donor. All CD8+ cytotoxic T-lymphocyte (CTL) lines recognized one of two epitopes on the nucleocapsid protein: one epitope spanning amino acids 12 to 20 and the other spanning amino acids 421 to 429. The CTL lines specific for amino acids 12 to 20 were restricted by HLA B51, and those specific for amino acids 421 to 429 were restricted by HLA A1. The N-specific CTL lines isolated from these two donors included both Hantaan virus-specific CTLs and hantavirus cross-reactive CTLs. Responses to both epitopes are detectable in short-term bulk cultures of PBMC from one donor, and precursor frequency analysis confirms that CTLs specific for these epitopes are present at relatively high precursor frequencies in the peripheral T-cell pool. These data suggest that infection with Hantaan virus results in the generation of CTL to limited epitopes on the nucleocapsid protein and that infection also results in the generation of cross-reactive T-cell responses to distantly related hantaviruses which cause the distinct hantavirus pulmonary syndrome. This is the first demonstration of human T-lymphocyte responses to Hantaan virus. PMID:10364276

  3. Water Production Functions for High Plains Crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Water Production Functions for High Plains Crops Water consumptive use by a crop can be reduced through limited (deficit) irrigation. If the reduced consumptive use (CU) can be quantified, the saved water can be transferred to other users. If the value of the transferred water is greater than the fa...

  4. Selective expansion of high functional avidity memory CD8 T cell clonotypes during hepatitis C virus reinfection and clearance.

    PubMed

    Abdel-Hakeem, Mohamed S; Boisvert, Maude; Bruneau, Julie; Soudeyns, Hugo; Shoukry, Naglaa H

    2017-02-01

    The dynamics of the memory CD8 T cell receptor (TCR) repertoire upon virus re-exposure and factors governing the selection of TCR clonotypes conferring protective immunity in real life settings are poorly understood. Here, we examined the dynamics and functionality of the virus-specific memory CD8 TCR repertoire before, during and after hepatitis C virus (HCV) reinfection in patients who spontaneously resolved two consecutive infections (SR/SR) and patients who resolved a primary but failed to clear a subsequent infection (SR/CI). The TCR repertoire was narrower prior to reinfection in the SR/SR group as compared to the SR/CI group and became more focused upon reinfection. CD8 T cell clonotypes expanding upon re-exposure and associated with protection from viral persistence were recruited from the memory T cell pool. Individual CD8 T cell lines generated from the SR/SR group exhibited higher functional avidity and polyfunctionality as compared to cell lines from the SR/CI group. Our results suggest that protection from viral persistence upon HCV reinfection is associated with focusing of the HCV-specific CD8 memory T cell repertoire from which established cell lines showed high functional avidity. These findings are applicable to vaccination strategies aiming at shaping the protective human T cell repertoire.

  5. Selective expansion of high functional avidity memory CD8 T cell clonotypes during hepatitis C virus reinfection and clearance

    PubMed Central

    Bruneau, Julie

    2017-01-01

    The dynamics of the memory CD8 T cell receptor (TCR) repertoire upon virus re-exposure and factors governing the selection of TCR clonotypes conferring protective immunity in real life settings are poorly understood. Here, we examined the dynamics and functionality of the virus-specific memory CD8 TCR repertoire before, during and after hepatitis C virus (HCV) reinfection in patients who spontaneously resolved two consecutive infections (SR/SR) and patients who resolved a primary but failed to clear a subsequent infection (SR/CI). The TCR repertoire was narrower prior to reinfection in the SR/SR group as compared to the SR/CI group and became more focused upon reinfection. CD8 T cell clonotypes expanding upon re-exposure and associated with protection from viral persistence were recruited from the memory T cell pool. Individual CD8 T cell lines generated from the SR/SR group exhibited higher functional avidity and polyfunctionality as compared to cell lines from the SR/CI group. Our results suggest that protection from viral persistence upon HCV reinfection is associated with focusing of the HCV-specific CD8 memory T cell repertoire from which established cell lines showed high functional avidity. These findings are applicable to vaccination strategies aiming at shaping the protective human T cell repertoire. PMID:28146579

  6. Executive functioning in highly talented soccer players.

    PubMed

    Verburgh, Lot; Scherder, Erik J A; van Lange, Paul A M; Oosterlaan, Jaap

    2014-01-01

    Executive functions might be important for successful performance in sports, particularly in team sports requiring quick anticipation and adaptation to continuously changing situations in the field. The executive functions motor inhibition, attention and visuospatial working memory were examined in highly talented soccer players. Eighty-four highly talented youth soccer players (mean age 11.9), and forty-two age-matched amateur soccer players (mean age 11.8) in the age range 8 to 16 years performed a Stop Signal task (motor inhibition), the Attention Network Test (alerting, orienting, and executive attention) and a visuospatial working memory task. The highly talented soccer players followed the talent development program of the youth academy of a professional soccer club and played at the highest national soccer competition for their age. The amateur soccer players played at a regular soccer club in the same geographical region as the highly talented soccer players and play in a regular regional soccer competition. Group differences were tested using analyses of variance. The highly talented group showed superior motor inhibition as measured by stop signal reaction time (SSRT) on the Stop Signal task and a larger alerting effect on the Attention Network Test, indicating an enhanced ability to attain and maintain an alert state. No group differences were found for orienting and executive attention and visuospatial working memory. A logistic regression model with group (highly talented or amateur) as dependent variable and executive function measures that significantly distinguished between groups as predictors showed that these measures differentiated highly talented soccer players from amateur soccer players with 89% accuracy. Highly talented youth soccer players outperform youth amateur players on suppressing ongoing motor responses and on the ability to attain and maintain an alert state; both may be essential for success in soccer.

  7. Executive Functioning in Highly Talented Soccer Players

    PubMed Central

    Verburgh, Lot; Scherder, Erik J. A.; van Lange, Paul A.M.; Oosterlaan, Jaap

    2014-01-01

    Executive functions might be important for successful performance in sports, particularly in team sports requiring quick anticipation and adaptation to continuously changing situations in the field. The executive functions motor inhibition, attention and visuospatial working memory were examined in highly talented soccer players. Eighty-four highly talented youth soccer players (mean age 11.9), and forty-two age-matched amateur soccer players (mean age 11.8) in the age range 8 to 16 years performed a Stop Signal task (motor inhibition), the Attention Network Test (alerting, orienting, and executive attention) and a visuospatial working memory task. The highly talented soccer players followed the talent development program of the youth academy of a professional soccer club and played at the highest national soccer competition for their age. The amateur soccer players played at a regular soccer club in the same geographical region as the highly talented soccer players and play in a regular regional soccer competition. Group differences were tested using analyses of variance. The highly talented group showed superior motor inhibition as measured by stop signal reaction time (SSRT) on the Stop Signal task and a larger alerting effect on the Attention Network Test, indicating an enhanced ability to attain and maintain an alert state. No group differences were found for orienting and executive attention and visuospatial working memory. A logistic regression model with group (highly talented or amateur) as dependent variable and executive function measures that significantly distinguished between groups as predictors showed that these measures differentiated highly talented soccer players from amateur soccer players with 89% accuracy. Highly talented youth soccer players outperform youth amateur players on suppressing ongoing motor responses and on the ability to attain and maintain an alert state; both may be essential for success in soccer. PMID:24632735

  8. Virus-specific T lymphocytes home to the skin during natural dengue infection.

    PubMed

    Rivino, Laura; Kumaran, Emmanuelle A; Thein, Tun-Linn; Too, Chien Tei; Gan, Victor Chih Hao; Hanson, Brendon J; Wilder-Smith, Annelies; Bertoletti, Antonio; Gascoigne, Nicholas R J; Lye, David Chien; Leo, Yee Sin; Akbar, Arne N; Kemeny, David M; MacAry, Paul A

    2015-03-11

    Dengue, which is the most prevalent mosquito-borne viral disease afflicting human populations, causes a spectrum of clinical symptoms that include fever, muscle and joint pain, maculopapular skin rash, and hemorrhagic manifestations. Patients infected with dengue develop a broad antigen-specific T lymphocyte response, but the phenotype and functional properties of these cells are only partially understood. We show that natural infection induces dengue-specific CD8(+) T lymphocytes that are highly activated and proliferating, exhibit antiviral effector functions, and express CXCR3, CCR5, and the skin-homing marker cutaneous lymphocyte-associated antigen (CLA). In the same patients, bystander human cytomegalovirus -specific CD8(+) T cells are also activated during acute dengue infection but do not express the same tissue-homing phenotype. We show that CLA expression by circulating dengue-specific CD4(+) and CD8(+) T cells correlates with their in vivo ability to traffic to the skin during dengue infection. The juxtaposition of dengue-specific T cells with virus-permissive cell types at sites of possible dengue exposure represents a previously uncharacterized form of immune surveillance for this virus. These findings suggest that vaccination strategies may need to induce dengue-specific T cells with similar homing properties to provide durable protection against dengue viruses.

  9. Western blot analysis of virus-specific antibody responses for capripox and contagious pustular dermatitis viral infections in sheep.

    PubMed

    Chand, P; Kitching, R P; Black, D N

    1994-10-01

    This paper reports the development and evaluation of serological tests for the differentiation of antibodies in animals infected with capripox and parapox viruses. Agar-gel immunodiffusion tests using sera from sheep with naturally-acquired infections and from sheep experimentally inoculated with orf or capripox viruses showed cross reactions. Virus-specific antibody responses to structural proteins of the viruses were analysed by Western-blot analysis. This analysis readily differentiated the infections as either capripox or contagious pustular dermatitis. The antibody responses to the 32 kDa and 26 kDa proteins of capripoxvirus provided a firm basis for differentiation.

  10. Grafting functional antioxidants on highly crosslinked polyethylene

    NASA Astrophysics Data System (ADS)

    Al-Malaika, S.; Riasat, S.; Lewucha, C.

    2016-05-01

    The problem of interference of antioxidants, such as hindered phenols, with peroxide-initiated crosslinking of polyethylene was addressed through the use of functional (reactive) graftable antioxidants (g-AO). Reactive derivatives of hindered phenol and hindered amine antioxidants were synthesised, characterised and used to investigate their grafting reactions in high density polyethylene; both non-crosslinked (PE) and highly peroxide-crosslinked (PEXa). Assessment of the extent of in-situ grafting of the antioxidants, their retention after exhaustive solvent extraction in PE and PEXa, and the stabilising performance of the grafted antioxidants (g-AO) in the polymer were examined and benchmarked against conventionally stabilised crosslinked & non-crosslinked polyethylene. It was shown that the functional antioxidants graft to a high extent in PEXa, and that the level of interference of the g-AOs with the polymer crosslinking process was minimal compared to that of conventional antioxidants which bear the same antioxidant function. The much higher level of retention of the g-AOs in PEXa after exhaustive solvent extraction, compared to that of the corresponding conventional antioxidants, accounts for their superior long-term thermal stabilising performance under severe extractive conditions.

  11. Building and optimizing a virus-specific T cell receptor library for targeted immunotherapy in viral infections.

    PubMed

    Banu, Nasirah; Chia, Adeline; Ho, Zi Zong; Garcia, Alfonso Tan; Paravasivam, Komathi; Grotenbreg, Gijsbert M; Bertoletti, Antonio; Gehring, Adam J

    2014-02-25

    Restoration of antigen-specific T cell immunity has the potential to clear persistent viral infection. T cell receptor (TCR) gene therapy can reconstitute CD8 T cell immunity in chronic patients. We cloned 10 virus-specific TCRs targeting 5 different viruses, causing chronic and acute infection. All 10 TCR genetic constructs were optimized for expression using a P2A sequence, codon optimization and the addition of a non-native disulfide bond. However, maximum TCR expression was only achieved after establishing the optimal orientation of the alpha and beta chains in the expression cassette; 9/10 TCRs favored the beta-P2A-alpha orientation over alpha-P2A-beta. Optimal TCR expression was associated with a significant increase in the frequency of IFN-gamma+ T cells. In addition, activating cells for transduction in the presence of Toll-like receptor ligands further enhanced IFN-gamma production. Thus, we have built a virus-specific TCR library that has potential for therapeutic intervention in chronic viral infection or virus-related cancers.

  12. Dengue virus-specific murine T-lymphocyte proliferation: serotype specificity and response to recombinant viral proteins.

    PubMed Central

    Rothman, A L; Kurane, I; Zhang, Y M; Lai, C J; Ennis, F A

    1989-01-01

    Definition of the T-lymphocyte responses to dengue viruses should aid in the development of safe and effective vaccines and help to explain the pathophysiology of dengue hemorrhagic fever and dengue shock syndrome. In this study, we demonstrated that dengue virus-specific T lymphocytes were detected in spleen cells from dengue virus-immune mice using an in vitro proliferation assay. Following immunization with a single dose of infectious dengue virus, murine lymphocytes showed increased proliferation when incubated in the presence of viral antigens of the same serotype but not in the presence of control antigens. Depletion experiments with antibody and complement showed that the population of responding cells expressed the Thy1+ L3T4+ Lyt2- phenotype. This indicates that the predominant proliferating cells are T lymphocytes of the helper-inducer phenotype. Dengue virus-specific memory lymphocyte responses were detectable for at least 22 weeks after immunization. The response to primary infection was primarily serotype specific, with some serotype cross-reactivity present at a low level. We demonstrated that lymphocytes from mice immunized with dengue 4 virus proliferate in response to a combination of dengue 4 virus C, pre-M, E, NS1, and NS2a proteins expressed in Sf9 cells with a recombinant baculovirus, and, to a lesser extent, to the dengue 4 virus E protein alone. PMID:2786087

  13. High Speed SPM of Functional Materials

    SciTech Connect

    Huey, Bryan D.

    2015-08-14

    The development and optimization of applications comprising functional materials necessitates a thorough understanding of their static and dynamic properties and performance at the nanoscale. Leveraging High Speed SPM and concepts enabled by it, efficient measurements and maps with nanoscale and nanosecond temporal resolution are uniquely feasible. This includes recent enhancements for topographic, conductivity, ferroelectric, and piezoelectric properties as originally proposed, as well as newly developed methods or improvements to AFM-based mechanical, friction, thermal, and photoconductivity measurements. The results of this work reveal fundamental mechanisms of operation, and suggest new approaches for improving the ultimate speed and/or efficiency, of data storage systems, magnetic-electric sensors, and solar cells.

  14. T-cell depleted allogeneic hematopoietic cell transplants as a platform for adoptive therapy with leukemia selective or virus-specific T-cells.

    PubMed

    O'Reilly, R J; Koehne, G; Hasan, A N; Doubrovina, E; Prockop, S

    2015-06-01

    Allogeneic hematopoietic cell transplants adequately depleted of T-cells can reduce or prevent acute and chronic GVHD in both HLA-matched and haplotype-disparate hosts, without post-transplant prophylaxis with immunosuppressive drugs. Recent trials indicate that high doses of CD34+ progenitors from G-CSF mobilized peripheral blood leukocytes isolated and T-cell depleted by immunoadsorption to paramagnetic beads, when administered after myeloablative conditioning with TBI and chemotherapy or chemotherapy alone can secure consistent engraftment and abrogate GVHD in patients with acute leukemia without incurring an increased risk of a recurrent leukemia. Early clinical trials also indicate that high doses of in vitro generated leukemia-reactive donor T-cells can be adoptively transferred and can induce remissions of leukemia relapse without GVHD. Similarly, virus-specific T-cells generated from the transplant donor or an HLA partially matched third party, have induced remissions of Rituxan-refractory EBV lymphomas and can clear CMV disease or viremia persisting despite antiviral therapy in a high proportion of cases. Analyses of treatment responses and failures illustrate both the advantages and limitations of donor or banked, third party-derived T-cells, but underscore the potential of adoptive T-cell therapy in the absence of ongoing immunosuppression.

  15. Functional enrichment analyses and construction of functional similarity networks with high confidence function prediction by PFP

    PubMed Central

    2010-01-01

    Background A new paradigm of biological investigation takes advantage of technologies that produce large high throughput datasets, including genome sequences, interactions of proteins, and gene expression. The ability of biologists to analyze and interpret such data relies on functional annotation of the included proteins, but even in highly characterized organisms many proteins can lack the functional evidence necessary to infer their biological relevance. Results Here we have applied high confidence function predictions from our automated prediction system, PFP, to three genome sequences, Escherichia coli, Saccharomyces cerevisiae, and Plasmodium falciparum (malaria). The number of annotated genes is increased by PFP to over 90% for all of the genomes. Using the large coverage of the function annotation, we introduced the functional similarity networks which represent the functional space of the proteomes. Four different functional similarity networks are constructed for each proteome, one each by considering similarity in a single Gene Ontology (GO) category, i.e. Biological Process, Cellular Component, and Molecular Function, and another one by considering overall similarity with the funSim score. The functional similarity networks are shown to have higher modularity than the protein-protein interaction network. Moreover, the funSim score network is distinct from the single GO-score networks by showing a higher clustering degree exponent value and thus has a higher tendency to be hierarchical. In addition, examining function assignments to the protein-protein interaction network and local regions of genomes has identified numerous cases where subnetworks or local regions have functionally coherent proteins. These results will help interpreting interactions of proteins and gene orders in a genome. Several examples of both analyses are highlighted. Conclusion The analyses demonstrate that applying high confidence predictions from PFP can have a significant impact

  16. Comparison of measles virus-specific antibody titres as measured by enzyme-linked immunosorbent assay and virus neutralisation assay.

    PubMed

    van den Hof, Susan; van Gageldonk-Lafeber, Arianne B; van Binnendijk, Robert S; van Gageldonk, Pieter G M; Berbers, Guy A M

    2003-10-01

    We assessed whether measles virus-specific antibody levels in the Dutch population as estimated by an enzyme-linked immunosorbent assay (ELISA) were comparable with estimates by virus neutralisation assay (NT), prompted by a relatively low ELISA seroprevalence in the 10-21-year-old group. We tested 791 sera from individuals aged 2-49 years both in ELISA and NT. Seroprevalence in the 10-21-year-old group was 93.4% (95% confidence interval (CI) 89.5-97.2%) in ELISA versus 97.2% (CI 94.7-99.6%) in NT. There was good agreement between NT and ELISA seroprevalences in the vaccinated 2-9-year-olds and the unvaccinated 22-49-year-olds.

  17. Varicella-zoster virus-specific antibody responses in 50-59-year-old recipients of zoster vaccine.

    PubMed

    Levin, Myron J; Schmader, Kenneth E; Gnann, John W; McNeil, Shelly A; Vesikari, Timo; Betts, Robert F; Keay, Susan; Stek, Jon E; Bundick, Nickoya D; Su, Shu-Chih; Zhao, Yanli; Li, Xiaoming; Chan, Ivan S F; Annunziato, Paula W; Parrino, Janie

    2013-11-01

    Prevaccination and 6-week postvaccination samples from the immunogenicity substudy (n = 2269) of the zoster vaccine (ZV) efficacy trial (N = 22 439) in 50-59-year-old subjects were examined for varicella-zoster virus-specific antibody responses to vaccination. The varicella-zoster virus geometric mean titer (GMT) and geometric mean fold rise were higher in ZV recipients than in placebo recipients (GMT, 660.0 vs 293.1 glycoprotein enzyme-linked immunosorbent assay units/mL [P < .001], respectively; geometric mean fold rise, 2.31 vs 1.00 [P < .025]). In each group there was a strong inverse correlation between postvaccination GMT and risk of subsequent herpes zoster. Although these data provide strong evidence that relates ZV-induced antibody and the risk of herpes zoster, a protective threshold was not determined. Clinical Trials Registration. NCT00534248.

  18. Western blot analysis of virus-specific antibody responses for capripox and contagious pustular dermatitis viral infections in sheep.

    PubMed Central

    Chand, P.; Kitching, R. P.; Black, D. N.

    1994-01-01

    This paper reports the development and evaluation of serological tests for the differentiation of antibodies in animals infected with capripox and parapox viruses. Agar-gel immunodiffusion tests using sera from sheep with naturally-acquired infections and from sheep experimentally inoculated with orf or capripox viruses showed cross reactions. Virus-specific antibody responses to structural proteins of the viruses were analysed by Western-blot analysis. This analysis readily differentiated the infections as either capripox or contagious pustular dermatitis. The antibody responses to the 32 kDa and 26 kDa proteins of capripoxvirus provided a firm basis for differentiation. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7925674

  19. Type I interferon suppresses virus-specific B cell responses by modulating CD8+ T cell differentiation

    PubMed Central

    Moseman, E. Ashley; Wu, Tuoqi; de la Torre, Juan Carlos; Schwartzberg, Pamela L.; McGavern, Dorian B.

    2016-01-01

    Studies have established a role for T cells in resolving persistent viral infections, yet emerging evidence indicates that both T and B cells are required to control some viruses. During persistent infection, a marked lag or failure to generate neutralizing antibodies is commonly observed and likely contributes to an inability to control certain pathogens. Using lymphocytic choriomeningitis virus (LCMV) as a model, we have examined how a persistent viral infection can suppress neutralizing humoral immunity. By tracking the fate of virus-specific B cells in vivo, we report that LCMV-specific B cells were rapidly deleted within a few days of persistent infection, and this deletion was completely reversed by blockade of type I interferon (IFN-I) signaling. Early interference with IFN-I signaling promoted survival and differentiation of LCMV-specific B cells, which accelerated the generation of neutralizing antibodies. This marked improvement in antiviral humoral immunity did not rely on the cessation of IFN-I signaling in B cells but on alterations in the virus-specific CD8+ T cell response. Using two-photon microscopy and in vivo calcium imaging, we observed that cytotoxic T lymphocytes (CTLs) productively engaged and killed LCMV-specific B cells in a perforin-dependent manner within the first few days of infection. Blockade of IFN-I signaling protected LCMV-specific B cells by promoting CTL dysfunction. Therapeutic manipulation of this pathway may facilitate efforts to promote humoral immunity during persistent viral infection in humans. Our findings illustrate how events that occur early after infection can disturb the resultant adaptive response and contribute to viral persistence. PMID:27812556

  20. Influenza B virus-specific CD8+ T-lymphocytes strongly cross-react with viruses of the opposing influenza B lineage.

    PubMed

    van de Sandt, Carolien E; Dou, YingYing; Vogelzang-van Trierum, Stella E; Westgeest, Kim B; Pronk, Mark R; Osterhaus, Albert D M E; Fouchier, Ron A M; Rimmelzwaan, Guus F; Hillaire, Marine L B

    2015-08-01

    Influenza B viruses fall in two antigenically distinct lineages (B/Victoria/2/1987 and B/Yamagata/16/1988 lineage) that co-circulate with influenza A viruses of the H3N2 and H1N1 subtypes during seasonal epidemics. Infections with influenza B viruses contribute considerably to morbidity and mortality in the human population. Influenza B virus neutralizing antibodies, elicited by natural infections or vaccination, poorly cross-react with viruses of the opposing influenza B lineage. Therefore, there is an increased interest in identifying other correlates of protection which could aid the development of broadly protective vaccines. blast analysis revealed high sequence identity of all viral proteins. With two online epitope prediction algorithms, putative conserved epitopes relevant for study subjects used in the present study were predicted. The cross-reactivity of influenza B virus-specific polyclonal CD8+ cytotoxic T-lymphocyte (CTL) populations obtained from HLA-typed healthy study subjects, with intra-lineage drift variants and viruses of the opposing lineage, was determined by assessing their in vitro IFN-γ response and lytic activity. Here, we show for the first time, to the best of our knowledge, that CTLs directed to viruses of the B/Victoria/2/1987 lineage cross-react with viruses of the B/Yamagata/16/1988 lineage and vice versa.

  1. The RNA-binding domain of influenzavirus non-structural protein-1 cooperatively binds to virus-specific RNA sequences in a structure-dependent manner

    PubMed Central

    Marc, Daniel; Barbachou, Sosthène; Soubieux, Denis

    2013-01-01

    Influenzavirus non-structural protein NS1 is involved in several steps of the virus replication cycle. It counteracts the interferon response, and also exhibits other activities towards viral and cellular RNAs. NS1 is known to bind non-specifically to double-stranded RNA (dsRNA) as well as to viral and cellular RNAs. We set out to search whether NS1 could preferentially bind sequence-specific RNA patterns, and performed an in vitro selection (SELEX) to isolate NS1-specific aptamers from a pool of 80-nucleotide(nt)-long RNAs. Among the 63 aptamers characterized, two families were found to harbour a sequence that is strictly conserved at the 5′ terminus of all positive-strand RNAs of influenzaviruses A. We found a second virus-specific motif, a 9 nucleotide sequence located 15 nucleotides downstream from NS1’s stop codon. In addition, a majority of aptamers had one or two symmetrically positioned copies of the 5′-GUAAC / 3′-CUUAG double-stranded motif, which closely resembles the canonical 5′-splice site. Through an in-depth analysis of the interaction combining fluorimetry and gel-shift assays, we showed that NS1’s RNA-binding domain (RBD) specifically recognizes sequence patterns in a structure-dependent manner, resulting in an intimate interaction with high affinity (low nanomolar to subnanomolar KD values) that leads to oligomerization of the RBD on its RNA ligands. PMID:23093596

  2. Age-associated Epstein–Barr virus-specific T cell responses in seropositive healthy adults

    PubMed Central

    Cárdenas Sierra, D; Vélez Colmenares, G; Orfao de Matos, A; Fiorentino Gómez, S; Quijano Gómez, S M

    2014-01-01

    Epstein–Barr virus (EBV) is present in 95% of the world's adult population. The immune response participates in immune vigilance and persistent infection control, and this condition is maintained by both a good quality (functionality) and quantity of specific T cells throughout life. In the present study, we evaluated EBV-specific CD4+ and CD8+ T lymphocyte responses in seropositive healthy individuals younger and older than 50 years of age. The assessment comprised the frequency, phenotype, functionality and clonotypic distribution of T lymphocytes. We found that in both age groups a similar EBV-specific T cell response was found, with overlapping numbers of tumour necrosis factor (TNF)-α+ T lymphocytes (CD4+ and CD8+) within the memory and effector cell compartments, in addition to monofunctional and multi-functional T cells producing interleukin (IL)-2 and/or interferon (IFN)-γ. However, individuals aged more than 50 years showed significantly higher frequencies of IL-2-producing CD4+ T lymphocytes in association with greater production of soluble IFN-γ, TNF-α and IL-6 than subjects younger than 50 years. A polyclonal T cell receptor (TCR)-variable beta region (Vβ) repertoire exists in both age groups under basal conditions and in response to EBV; the major TCR families found in TNF-α+/CD4+ T lymphocytes were Vβ1, Vβ2, Vβ17 and Vβ22 in both age groups, and the major TCR family in TNF-α+/CD8+ T cells was Vβ13·1 for individuals younger than 50 years and Vβ9 for individuals aged more than 50 years. Our findings suggest that the EBV-specific T cell response (using a polyclonal stimulation model) is distributed throughout several T cell differentiation compartments in an age-independent manner and includes both monofunctional and multi-functional T lymphocytes. PMID:24666437

  3. Induction of foot-and-mouth disease virus specific cytotoxic T cell killing by vaccination

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Foot-and-mouth disease (FMD) continues to be a significant threat to the health and economic value of livestock species. This acute infection is caused by the highly contagious FMD virus which infects cloven-hoofed animals including large and small ruminants and swine. Current vaccine strategies are...

  4. Highly excited strings I: Generating function

    NASA Astrophysics Data System (ADS)

    Skliros, Dimitri P.; Copeland, Edmund J.; Saffin, Paul M.

    2017-03-01

    This is the first of a series of detailed papers on string amplitudes with highly excited strings (HES). In the present paper we construct a generating function for string amplitudes with generic HES vertex operators using a fixed-loop momentum formalism. We generalise the proof of the chiral splitting theorem of D'Hoker and Phong to string amplitudes with arbitrary HES vertex operators (with generic KK and winding charges, polarisation tensors and oscillators) in general toroidal compactifications E =R D - 1 , 1 ×T Dcr - D (with generic constant Kähler and complex structure target space moduli, background Kaluza-Klein (KK) gauge fields and torsion). We adopt a novel approach that does not rely on a ;reverse engineering; method to make explicit the loop momenta, thus avoiding a certain ambiguity pointed out in a recent paper by Sen, while also keeping the genus of the worldsheet generic. This approach will also be useful in discussions of quantum gravity and in particular in relation to black holes in string theory, non-locality and breakdown of local effective field theory, as well as in discussions of cosmic superstrings and their phenomenological relevance. We also discuss the manifestation of wave/particle (or rather wave/string) duality in string theory.

  5. Transient CD86 expression on hepatitis C virus-specific CD8+ T cells in acute infection is linked to sufficient IL-2 signaling.

    PubMed

    Radziewicz, Henry; Ibegbu, Chris C; Hon, Huiming; Bédard, Nathalie; Bruneau, Julie; Workowski, Kimberly A; Knechtle, Stuart J; Kirk, Allan D; Larsen, Christian P; Shoukry, Naglaa H; Grakoui, Arash

    2010-03-01

    Costimulatory signals via B7/CD28 family molecules (signal 2) are critical for effective adaptive CD8(+) T cell immune responses. In addition to costimulatory signals, B7/CD28 family coinhibitory receptor/ligands that modulate immune responses have been identified. In acute hepatitis C virus (HCV) infection, programmed death receptor 1, an inhibitory receptor in the CD28 family, is highly expressed on virus-specific CD8(+) T cells, yet vigorous immune responses often develop. We hypothesized that other costimulatory signals present during the acute phase of HCV infection would be important to counter this negative signaling. In this study, we found that CD86 was highly expressed on HCV-specific CD8(+) T cells early in acute HCV infection and was lost on transition to chronic HCV infection; the expression of CD86 was different from other activation markers, because expression was delayed after in vitro TCR stimulation and required sufficient IL-2 signaling; and HCV-specific CD8(+) T cells in the liver of patients with chronic HCV infection were highly activated (CD69, CD38, and HLA-DR expression), but only a minority expressed CD86 or showed evidence of recent IL-2 signaling (low basal phosphorylated STAT5), despite persistent viremia. Our study identified B7 ligand expression on HCV-specific CD8(+) T cells as a distinct marker of effective T cell stimulation with IL-2 signaling in acute HCV infection. Expression of costimulatory molecules, such as CD86, early in HCV infection may be essential in overcoming inhibitory signals from the high level of programmed death receptor 1 expression also seen at this phase of infection.

  6. Selective retention of herpes simplex virus-specific T cells in latently infected human trigeminal ganglia

    PubMed Central

    Verjans, Georges M. G. M.; Hintzen, Rogier Q.; van Dun, Jessica M.; Poot, Angelique; Milikan, Johannes C.; Laman, Jon D.; Langerak, Anton W.; Kinchington, Paul R.; Osterhaus, Albert D. M. E.

    2007-01-01

    Primary infection with herpes simplex virus 1 (HSV-1) and varicella zoster virus (VZV) results in lifelong latent infections of neurons in sensory ganglia such as the trigeminal ganglia (TG). It has been postulated that T cells retained in TG inhibit reactivation of latent virus. The acquisition of TG specimens of individuals within hours after death offered the unique opportunity to characterize the phenotype and specificity of TG-resident T cells in humans. High numbers of activated CD8+ T cells expressing a late effector memory phenotype were found to reside in latently infected TG. The T cell infiltrate was oligoclonal, and T cells selectively clustered around HSV-1 but not VZV latently infected neurons. Neuronal damage was not observed despite granzyme B expression by the neuron-interacting CD8+ T cells. The TG-resident T cells, mainly CD8+ T cells, were directed against HSV-1 and not to VZV, despite neuronal expression of VZV proteins. The results implicate that herpesvirus latency in human TG is associated with a local, persistent T cell response, comprising activated late effector memory CD8+ T cells that appear to control HSV-1 latency by noncytolytic pathways. In contrast, T cells do not seem to be directly involved in controlling VZV latency in human TG. PMID:17360672

  7. High-efficiency thermoelectrics with functionalized graphene.

    PubMed

    Kim, Jeong Yun; Grossman, Jeffrey C

    2015-05-13

    Graphene superlattices made with chemical functionalization offer the possibility of tuning both the thermal and electronic properties via nanopatterning of the graphene surface. Using classical and quantum mechanical calculations, we predict that suitable chemical functionalization of graphene can introduce peaks in the density of states at the band edge that result in a large enhancement in the Seebeck coefficient, leading to an increase in the room-temperature power factor of a factor of 2 compared to pristine graphene, despite the degraded electrical conductivity. Furthermore, the presence of patterns on graphene reduces the thermal conductivity, which when taken together leads to an increase in the figure of merit for functionalized graphene by up to 2 orders of magnitude over that of pristine graphene, reaching its maximum ZT ∼ 3 at room temperature according to our calculations. These results suggest that appropriate chemical functionalization could lead to efficient graphene-based thermoelectric materials.

  8. Plasmid DNA Initiates Replication of Yellow Fever Vaccine In Vitro and Elicits Virus-Specific Immune Response in Mice

    PubMed Central

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-01-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20µg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. PMID:25129436

  9. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

    PubMed

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

    2014-11-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF.

  10. MESON CORRELATION FUNCTIONS AT HIGH TEMPERATURES.

    SciTech Connect

    WISSEL, S.; DATTA, S.; KARSCH, F.; LAERMANN, E.; SHCHEREDIN, S.

    2005-07-25

    We present preliminary results for the correlation- and spectral functions of different meson channels on the lattice. The main focus lies on gaining control over cut-off as well as on the finite-volume effects. Extrapolations of screening masses above the deconfining temperature are guided by the result of the free (T = {infinity}) case on the lattice and in the continuum. We study the quenched non-perturbatively improved Wilson-clover fermion as well as the hypercube fermion action which might show less cut-off effects.

  11. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    SciTech Connect

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-11-15

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

  12. Compartmentalization of Total and Virus-Specific Tissue-Resident Memory CD8+ T Cells in Human Lymphoid Organs.

    PubMed

    Woon, Heng Giap; Braun, Asolina; Li, Jane; Smith, Corey; Edwards, Jarem; Sierro, Frederic; Feng, Carl G; Khanna, Rajiv; Elliot, Michael; Bell, Andrew; Hislop, Andrew D; Tangye, Stuart G; Rickinson, Alan B; Gebhardt, Thomas; Britton, Warwick J; Palendira, Umaimainthan

    2016-08-01

    Disruption of T cell memory during severe immune suppression results in reactivation of chronic viral infections, such as Epstein Barr virus (EBV) and Cytomegalovirus (CMV). How different subsets of memory T cells contribute to the protective immunity against these viruses remains poorly defined. In this study we examined the compartmentalization of virus-specific, tissue resident memory CD8+ T cells in human lymphoid organs. This revealed two distinct populations of memory CD8+ T cells, that were CD69+CD103+ and CD69+CD103-, and were retained within the spleen and tonsils in the absence of recent T cell stimulation. These two types of memory cells were distinct not only in their phenotype and transcriptional profile, but also in their anatomical localization within tonsils and spleen. The EBV-specific, but not CMV-specific, CD8+ memory T cells preferentially accumulated in the tonsils and acquired a phenotype that ensured their retention at the epithelial sites where EBV replicates. In vitro studies revealed that the cytokine IL-15 can potentiate the retention of circulating effector memory CD8+ T cells by down-regulating the expression of sphingosine-1-phosphate receptor, required for T cell exit from tissues, and its transcriptional activator, Kruppel-like factor 2 (KLF2). Within the tonsils the expression of IL-15 was detected in regions where CD8+ T cells localized, further supporting a role for this cytokine in T cell retention. Together this study provides evidence for the compartmentalization of distinct types of resident memory T cells that could contribute to the long-term protection against persisting viral infections.

  13. Compartmentalization of Total and Virus-Specific Tissue-Resident Memory CD8+ T Cells in Human Lymphoid Organs

    PubMed Central

    Li, Jane; Smith, Corey; Edwards, Jarem; Sierro, Frederic; Feng, Carl G.; Khanna, Rajiv; Bell, Andrew; Hislop, Andrew D.; Tangye, Stuart G.; Rickinson, Alan B.; Gebhardt, Thomas; Britton, Warwick J.

    2016-01-01

    Disruption of T cell memory during severe immune suppression results in reactivation of chronic viral infections, such as Epstein Barr virus (EBV) and Cytomegalovirus (CMV). How different subsets of memory T cells contribute to the protective immunity against these viruses remains poorly defined. In this study we examined the compartmentalization of virus-specific, tissue resident memory CD8+ T cells in human lymphoid organs. This revealed two distinct populations of memory CD8+ T cells, that were CD69+CD103+ and CD69+CD103—, and were retained within the spleen and tonsils in the absence of recent T cell stimulation. These two types of memory cells were distinct not only in their phenotype and transcriptional profile, but also in their anatomical localization within tonsils and spleen. The EBV-specific, but not CMV-specific, CD8+ memory T cells preferentially accumulated in the tonsils and acquired a phenotype that ensured their retention at the epithelial sites where EBV replicates. In vitro studies revealed that the cytokine IL-15 can potentiate the retention of circulating effector memory CD8+ T cells by down-regulating the expression of sphingosine-1-phosphate receptor, required for T cell exit from tissues, and its transcriptional activator, Kruppel-like factor 2 (KLF2). Within the tonsils the expression of IL-15 was detected in regions where CD8+ T cells localized, further supporting a role for this cytokine in T cell retention. Together this study provides evidence for the compartmentalization of distinct types of resident memory T cells that could contribute to the long-term protection against persisting viral infections. PMID:27540722

  14. Water Production Functions For High Plains Crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Declining water supplies is the critical resource issue for irrigated agriculture in the High Plains and much of the western U.S. Farmers need to maximize production per unit water consumed to remain economically viable and sustain irrigated agriculture. The Agricultural Research Service (ARS) Wat...

  15. High-throughput TILLING for functional genomics.

    PubMed

    Till, Bradley J; Colbert, Trenton; Tompa, Rachel; Enns, Linda C; Codomo, Christine A; Johnson, Jessica E; Reynolds, Steven H; Henikoff, Jorja G; Greene, Elizabeth A; Steine, Michael N; Comai, Luca; Henikoff, Steven

    2003-01-01

    Targeting-induced local lesions in genomes (TILLING) is a general strategy for identifying induced point mutations that can be applied to almost any organism. Here, we describe the basic methodology for high-throughput TILLING. Gene segments are amplified using fluorescently tagged primers, and products are denatured and reannealed to form heteroduplexes between the mutated sequence and its wild-type counterpart. These heteroduplexes are substrates for cleavage by the endonuclease CEL I. Following cleavage, products are analyzed on denaturing polyacrylamide gels using the LI-COR DNA analyzer system. High-throughput TILLING has been adopted by the Arabidopsis TILLING Project (ATP) to provide allelic series of point mutations for the general Arabidopsis community.

  16. Challenging Stereotypes: Sexual Functioning of Single Adults with High Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Byers, E. Sandra; Nichols, Shana; Voyer, Susan D.

    2013-01-01

    This study examined the sexual functioning of single adults (61 men, 68 women) with high functioning autism and Asperger syndrome living in the community with and without prior relationship experience. Participants completed an on-line questionnaire assessing autism symptoms, psychological functioning, and various aspects of sexual functioning. In…

  17. Language, Social, and Executive Functions in High Functioning Autism: A Continuum of Performance

    ERIC Educational Resources Information Center

    Landa, Rebecca J.; Goldberg, Melissa C.

    2005-01-01

    This study examined language and executive functions (EF) in high-functioning school-aged individuals with autism and individually matched controls. Relationships between executive, language, and social functioning were also examined. Participants with autism exhibited difficulty on measures of expressive grammar, figurative language, planning,…

  18. Virus-specific HLA-restricted lysis of herpes simplex virus-infected human monocytes and macrophages mediated by cytotoxic T lymphocytes

    SciTech Connect

    Torpey, D.J. III

    1987-01-01

    Freshly-isolated peripheral blood human monocytes and 5 day in vitro cultured macrophages were infected with herpes simplex virus type 1 (HSV-1), labeled with /sup 51/Cr, and used as target cells in a 12-14 hour cell-mediated cytotoxicity assay. Mononuclear leukocytes (MNL) from HSV-1 non-immune individuals, whether unstimulated or stimulated with HSV-1 antigen, did not mediate significant lysis of either target cell. HSV-immune MNL, both freshly-isolated and cultured for 5 days without antigen, demonstrated only low levels of natural killer (NK) cell-mediate lysis. MNL from HSV-immune individuals incubated for 5 days in vitro with HSV-1 antigen mediated significant virus-specific lysis of both target cells. Mean virus-specific lysis of autologous monocytes was 8.5(/+-/2.0)% compared to a three-fold greater virus-specific lysis of autologous macrophages. Greater than 70% of this lytic activity was mediated by Leu-11-negative, T3-positive cytotoxic T lymphocytes (CTL). Allogeneic target cells lacking a common HLA determinant were not significantly lysed while T8-positive CTL mediated infrequent lysis of target cells sharing a common HLA-A and/or HLA-B determinant. T4-positive lymphocytes were demonstrated to be the predominant cell mediating lysis of autologous target cells and allogeneic target cells sharing both HLA-A and/or HLA-B plus HLA-DR determinants with the CTL; the T4-positive cell was the sole CTL mediator of lysis of allogeneic target cells having a common HLA-DR determinant.

  19. Alterations to functional analysis methodology to clarify the functions of low rate, high intensity problem behavior.

    PubMed

    Davis, Barbara J; Kahng, Sungwoo; Schmidt, Jonathan; Bowman, Lynn G; Boelter, Eric W

    2012-01-01

    Current research provides few suggestions for modifications to functional analysis procedures to accommodate low rate, high intensity problem behavior. This study examined the results of the extended duration functional analysis procedures of Kahng, Abt, and Schonbachler (2001) with six children admitted to an inpatient hospital for the treatment of severe problem behavior. Results of initial functional analyses (Iwata, Dorsey, Slifer, Bauman, & Richman, 1982/1994) were inconclusive for all children because of low levels of responding. The altered functional analyses, which changed multiple variables including the duration of the functional analysis (i.e., 6 or 7 hrs), yielded clear behavioral functions for all six participants. These results add additional support for the utility of an altered analysis of low rate, high intensity problem behavior when standard functional analyses do not yield differentiated results.

  20. Alterations to Functional Analysis Methodology to Clarify the Functions of Low Rate, High Intensity Problem Behavior

    PubMed Central

    Davis, Barbara J; Kahng, SungWoo; Schmidt, Jonathan; Bowman, Lynn G; Boelter, Eric W

    2012-01-01

    Current research provides few suggestions for modifications to functional analysis procedures to accommodate low rate, high intensity problem behavior. This study examined the results of the extended duration functional analysis procedures of Kahng, Abt, and Schonbachler (2001) with six children admitted to an inpatient hospital for the treatment of severe problem behavior. Results of initial functional analyses (Iwata, Dorsey, Slifer, Bauman, & Richman, 1982/1994) were inconclusive for all children because of low levels of responding. The altered functional analyses, which changed multiple variables including the duration of the functional analysis (i.e., 6 or 7 hrs), yielded clear behavioral functions for all six participants. These results add additional support for the utility of an altered analysis of low rate, high intensity problem behavior when standard functional analyses do not yield differentiated results. PMID:23326628

  1. A System for Performing High Throughput Assays of Synaptic Function

    PubMed Central

    Hempel, Chris M.; Sivula, Michael; Levenson, Jonathan M.; Rose, David M.; Li, Bing; Sirianni, Ana C.; Xia, Eva; Ryan, Timothy A.; Gerber, David J.; Cottrell, Jeffrey R.

    2011-01-01

    Unbiased, high-throughput screening has proven invaluable for dissecting complex biological processes. Application of this general approach to synaptic function would have a major impact on neuroscience research and drug discovery. However, existing techniques for studying synaptic physiology are labor intensive and low-throughput. Here, we describe a new high-throughput technology for performing assays of synaptic function in primary neurons cultured in microtiter plates. We show that this system can perform 96 synaptic vesicle cycling assays in parallel with high sensitivity, precision, uniformity, and reproducibility and can detect modulators of presynaptic function. By screening libraries of pharmacologically defined compounds on rat forebrain cultures, we have used this system to identify novel effects of compounds on specific aspects of presynaptic function. As a system for unbiased compound as well as genomic screening, this technology has significant applications for basic neuroscience research and for the discovery of novel, mechanism-based treatments for central nervous system disorders. PMID:21998743

  2. Rare species support vulnerable functions in high-diversity ecosystems.

    PubMed

    Mouillot, David; Bellwood, David R; Baraloto, Christopher; Chave, Jerome; Galzin, Rene; Harmelin-Vivien, Mireille; Kulbicki, Michel; Lavergne, Sebastien; Lavorel, Sandra; Mouquet, Nicolas; Paine, C E Timothy; Renaud, Julien; Thuiller, Wilfried

    2013-01-01

    Around the world, the human-induced collapses of populations and species have triggered a sixth mass extinction crisis, with rare species often being the first to disappear. Although the role of species diversity in the maintenance of ecosystem processes has been widely investigated, the role of rare species remains controversial. A critical issue is whether common species insure against the loss of functions supported by rare species. This issue is even more critical in species-rich ecosystems where high functional redundancy among species is likely and where it is thus often assumed that ecosystem functioning is buffered against species loss. Here, using extensive datasets of species occurrences and functional traits from three highly diverse ecosystems (846 coral reef fishes, 2,979 alpine plants, and 662 tropical trees), we demonstrate that the most distinct combinations of traits are supported predominantly by rare species both in terms of local abundance and regional occupancy. Moreover, species that have low functional redundancy and are likely to support the most vulnerable functions, with no other species carrying similar combinations of traits, are rarer than expected by chance in all three ecosystems. For instance, 63% and 98% of fish species that are likely to support highly vulnerable functions in coral reef ecosystems are locally and regionally rare, respectively. For alpine plants, 32% and 89% of such species are locally and regionally rare, respectively. Remarkably, 47% of fish species and 55% of tropical tree species that are likely to support highly vulnerable functions have only one individual per sample on average. Our results emphasize the importance of rare species conservation, even in highly diverse ecosystems, which are thought to exhibit high functional redundancy. Rare species offer more than aesthetic, cultural, or taxonomic diversity value; they disproportionately increase the potential breadth of functions provided by ecosystems across

  3. Preferential expansion of human virus-specific multifunctional central memory T cells by partial targeting of the IL-2 receptor signaling pathway: the key role of CD4+ T cells.

    PubMed

    Schmueck, Michael; Fischer, Annika M; Hammoud, Ben; Brestrich, Gordon; Fuehrer, Henrike; Luu, Si-Hong; Mueller, Karin; Babel, Nina; Volk, Hans-Dieter; Reinke, Petra

    2012-05-15

    Effector memory T cells are effective in controlling acute infections, but central memory T cells play a key role in long-lasting protection against viruses and tumors. In vivo/in vitro challenge by Ag commonly supports the generation of effector memory T cells with limited longevity. To our knowledge, this study demonstrates for the first time in the human system and under rechallenge conditions that targeting IL-2R by partial mammalian target of rapamycin inhibition or blocking IL-2Rα enriches human CD4(+)/CD8(+) central memory T cells within the virus-specific T cell product associated with enhanced functionality (i.e., multicytokine secretors, including IL-2; enhanced CD137 and CD107a expression on CD8(+) and CD4(+) T cells, respectively; and killing infected target cells). Remarkably, the effects on CD8(+) T cells are mainly mediated via the enhancement of CD4(+) T cell function. The data reveal new insights into the role of CD4(+) T cell support for the quality of CD8(+) T cell memory, even under rechallenge conditions. Moreover, our method offers a new approach to improve the long-lasting efficacy of adoptive T cell therapy in patients.

  4. Vaccination of rhesus monkeys with synthetic peptide in a fusogenic proteoliposome elicits simian immunodeficiency virus-specific CD8+ cytotoxic T lymphocytes

    PubMed Central

    1992-01-01

    An effective vaccine against the human immunodeficiency virus should be capable of eliciting both an antibody and a cytotoxic T lymphocyte (CTL) response. However, when viral proteins and peptides are formulated with traditional immunological adjuvants and inoculated via a route acceptable for use in humans, they have not been successful at eliciting virus-specific, major histocompatibility complex (MHC) class I-restricted CTL. We have designed a novel viral subunit vaccine by encapsulating a previously defined synthetic peptide CTL epitope of the simian immunodeficiency virus (SIV) gag protein within a proteoliposome capable of attaching to and fusing with plasma membranes. Upon fusing, the encapsulated contents of this proteoliposome can enter the MHC class I processing pathway through the cytoplasm. In this report, we show that after a single intramuscular vaccination, rhesus monkeys develop a CD8+ cell-mediated, MHC class I-restricted CTL response that recognizes the synthetic peptide immunogen. The induced CTL also demonstrate antiviral immunity by recognizing SIV gag protein endogenously processed by target cells infected with SIV/vaccinia recombinant virus. These results demonstrate that virus-specific, MHC class I-restricted, CD8+ CTL can be elicited by a safe, nonreplicating viral subunit vaccine in a primate model for acquired immune deficiency syndrome. Moreover, the proteoliposome vaccine formation described can include multiple synthetic peptide epitopes, and, thus, offers a simple means of generating antiviral cell-mediated immunity in a genetically heterogeneous population. PMID:1460429

  5. The effect of high altitude on olfactory functions.

    PubMed

    Altundağ, Aytuğ; Salihoglu, Murat; Çayönü, Melih; Cingi, Cemal; Tekeli, Hakan; Hummel, Thomas

    2014-03-01

    It is known that high-altitude trips cause nasal congestion, impaired nasal mucociliary transport rate, and increased nasal resistance, due to decreased partial oxygen pressure and dry air. It is also known that olfactory perception is affected by barometric pressure and humidity. The aim of the present study was to investigate whether olfactory function changes in relation to high altitude in a natural setting. The present study included 41 volunteers with no history of chronic rhinosinusitis or nasal polyposis. The study group consisted of 31 men (76 %) and 10 women (24 %); the mean age of the study population was 38 ± 10 years. Olfactory testing was conducted using "Sniffin' Sticks" at a high altitude (2,200 ms) and at sea level. Odor test scores for threshold and identification were significantly better at sea level than at high altitude (p < 0.001). The major finding of this investigation was that olfactory functions are decreased at high altitudes.

  6. High-throughput screening of chemicals as functional ...

    EPA Pesticide Factsheets

    Identifying chemicals that provide a specific function within a product, yet have minimal impact on the human body or environment, is the goal of most formulation chemists and engineers practicing green chemistry. We present a methodology to identify potential chemical functional substitutes from large libraries of chemicals using machine learning based models. We collect and analyze publicly available information on the function of chemicals in consumer products or industrial processes to identify a suite of harmonized function categories suitable for modeling. We use structural and physicochemical descriptors for these chemicals to build 41 quantitative structure–use relationship (QSUR) models for harmonized function categories using random forest classification. We apply these models to screen a library of nearly 6400 chemicals with available structure information for potential functional substitutes. Using our Functional Use database (FUse), we could identify uses for 3121 chemicals; 4412 predicted functional uses had a probability of 80% or greater. We demonstrate the potential application of the models to high-throughput (HT) screening for “candidate alternatives” by merging the valid functional substitute classifications with hazard metrics developed from HT screening assays for bioactivity. A descriptor set could be obtained for 6356 Tox21 chemicals that have undergone a battery of HT in vitro bioactivity screening assays. By applying QSURs, we wer

  7. Electroretinographic assessment of retinal function at high altitude.

    PubMed

    Schatz, Andreas; Willmann, Gabriel; Fischer, M Dominik; Schommer, Kai; Messias, André; Zrenner, Eberhart; Bartz-Schmidt, Karl-Ulrich; Gekeler, Florian

    2013-08-01

    Although hypoxia plays a key role in the pathophysiology of many common and well studied retinal diseases, little is known about the effects of high-altitude hypoxia on retinal function. The aim of the present study was to assess retinal function during exposure to high-altitude hypoxia using electroretinography (ERG). This work is related to the Tübingen High Altitude Ophthalmology (THAO) study. Electroretinography was performed in 14 subjects in Tübingen, Germany (341 m) and at high altitude at La Capanna Regina Margherita, Italy (4,559 m) using an extended protocol to assess functional integrity of various retinal layers. To place findings in the context of acute mountain sickness, correlations between ERG measurements and oxygen saturation, heart rate, and scores of acute mountain sickness (AMS) were calculated. At high altitude, the maximum response of the scotopic sensitivity function, the implicit times of the a- and b-wave of the combined rod-cone responses, and the implicit times of the photopic negative responses (PhNR) were significantly altered. A-wave slopes and i-waves were significantly decreased at high altitude. The strongest correlation was found for PhNR and O2 saturation (r = 0.68; P < 0.05). Of all tested correlations, only the photopic b-wave implicit time (10 cd·s/m(2)) was significantly correlated with severity of AMS (r = 0.57; P < 0.05). ERG data show that retinal function of inner, outer, and ganglion cell layer is altered at high-altitude hypoxia. Interestingly, the most affected ERG parameters are related to combined rod-cone responses, which indicate that phototransduction and visual processing, especially under conditions of rod-cone interaction, are primarily affected at high altitude.

  8. Functional over-redundancy and high functional vulnerability in global fish faunas on tropical reefs

    PubMed Central

    Mouillot, David; Villéger, Sébastien; Parravicini, Valeriano; Kulbicki, Michel; Arias-González, Jesus Ernesto; Bender, Mariana; Chabanet, Pascale; Floeter, Sergio R.; Friedlander, Alan; Vigliola, Laurent; Bellwood, David R.

    2014-01-01

    When tropical systems lose species, they are often assumed to be buffered against declines in functional diversity by the ability of the species-rich biota to display high functional redundancy: i.e., a high number of species performing similar functions. We tested this hypothesis using a ninefold richness gradient in global fish faunas on tropical reefs encompassing 6,316 species distributed among 646 functional entities (FEs): i.e., unique combinations of functional traits. We found that the highest functional redundancy is located in the Central Indo-Pacific with a mean of 7.9 species per FE. However, this overall level of redundancy is disproportionately packed into few FEs, a pattern termed functional over-redundancy (FOR). For instance, the most speciose FE in the Central Indo-Pacific contains 222 species (out of 3,689) whereas 38% of FEs (180 out of 468) have no functional insurance with only one species. Surprisingly, the level of FOR is consistent across the six fish faunas, meaning that, whatever the richness, over a third of the species may still be in overrepresented FEs whereas more than one third of the FEs are left without insurance, these levels all being significantly higher than expected by chance. Thus, our study shows that, even in high-diversity systems, such as tropical reefs, functional diversity remains highly vulnerable to species loss. Although further investigations are needed to specifically address the influence of redundant vs. vulnerable FEs on ecosystem functioning, our results suggest that the promised benefits from tropical biodiversity may not be as strong as previously thought. PMID:25225388

  9. Functional over-redundancy and high functional vulnerability in global fish faunas on tropical reefs.

    PubMed

    Mouillot, David; Villéger, Sébastien; Parravicini, Valeriano; Kulbicki, Michel; Arias-González, Jesus Ernesto; Bender, Mariana; Chabanet, Pascale; Floeter, Sergio R; Friedlander, Alan; Vigliola, Laurent; Bellwood, David R

    2014-09-23

    When tropical systems lose species, they are often assumed to be buffered against declines in functional diversity by the ability of the species-rich biota to display high functional redundancy: i.e., a high number of species performing similar functions. We tested this hypothesis using a ninefold richness gradient in global fish faunas on tropical reefs encompassing 6,316 species distributed among 646 functional entities (FEs): i.e., unique combinations of functional traits. We found that the highest functional redundancy is located in the Central Indo-Pacific with a mean of 7.9 species per FE. However, this overall level of redundancy is disproportionately packed into few FEs, a pattern termed functional over-redundancy (FOR). For instance, the most speciose FE in the Central Indo-Pacific contains 222 species (out of 3,689) whereas 38% of FEs (180 out of 468) have no functional insurance with only one species. Surprisingly, the level of FOR is consistent across the six fish faunas, meaning that, whatever the richness, over a third of the species may still be in overrepresented FEs whereas more than one third of the FEs are left without insurance, these levels all being significantly higher than expected by chance. Thus, our study shows that, even in high-diversity systems, such as tropical reefs, functional diversity remains highly vulnerable to species loss. Although further investigations are needed to specifically address the influence of redundant vs. vulnerable FEs on ecosystem functioning, our results suggest that the promised benefits from tropical biodiversity may not be as strong as previously thought.

  10. Immunodominant Dengue Virus-Specific CD8+ T Cell Responses Are Associated with a Memory PD-1+ Phenotype

    PubMed Central

    de Alwis, Ruklanthi; Bangs, Derek J.; Angelo, Michael A.; Cerpas, Cristhiam; Fernando, Anira; Sidney, John; Peters, Bjoern; Gresh, Lionel; Balmaseda, Angel; de Silva, Aruna D.; Harris, Eva; Sette, Alessandro

    2016-01-01

    cells express high levels of the receptor programmed death 1 protein (PD-1), while those from disease-susceptible alleles do not. Not only does this represent a possible correlate of immunodominance, but it raises the hypothesis that PD-1 might be a regulator that prevents excessive damage while preserving antiviral function. Further, as this study employs distinct populations (Nicaraguan and Sri Lankan donors), we also confirmed that this pattern holds despite geographic and ethnic differences. This finding indicates that HLA type is the major determinant in shaping T cell responses. PMID:26912627

  11. Executive Function Impairments in High IQ Adults with ADHD

    ERIC Educational Resources Information Center

    Brown, Thomas E.; Reichel, Philipp C.; Quinlan, Donald M.

    2009-01-01

    Objectives: To demonstrate that high IQ adults diagnosed with ADHD suffer from executive function (EF) impairments that: a) can be identified with a combination of standardized measures and self-report data; and b) occur more commonly in this group than in the general population. Method: 157 ADHD adults with IQ greater than or equal to 120 were…

  12. Bioinspired, Mobile Robots With High Stability, Functionality and Low Cost

    DTIC Science & Technology

    2014-02-19

    MOBILE ROBOTS WITH HIGH STABILITY, FUNCTIONALITY AND LOW COST W911NF-11-1-0094 FINAL REPORT 2/15/11 – 9/30/13 THE HARVARD TEAM DARPA /DSO...ATTN: BAA 10-65 Dr. Gill Pratt 3701 North Fairfax Drive Arlington VA 22203-1714 Technical POC: Dr. Gill Pratt, DARPA /DSO Submission

  13. Cognitive Styles in High-Functioning Adolescents with Autistic Disorder.

    ERIC Educational Resources Information Center

    Teunisse, Jan-Pieter; Cools, Alexander R.; van Spaendonck, Karel P. M.; Aerts, Francisca H. T. M.; Berger, Hans J. C.

    2001-01-01

    A study investigated the operationalization, the identification, and the prevalence of weak central coherence and poor cognitive shifting in 35 high-functioning adolescents with autism. Weak central coherence and poor cognitive shifting did not appear to be related to measures of symptom severity, social understanding, and social competence.…

  14. Memory Illusion in High-Functioning Autism and Asperger's Disorder

    ERIC Educational Resources Information Center

    Kamio, Yoko; Toichi, Motomi

    2007-01-01

    In this study, 13 individuals with high-functioning autism (HFA), 15 individuals with Asperger's disorder (AD), and age-, and IQ-matched controls were presented a list of sentences auditorily. Participants then evaluated semantically related but new sentences and reported whether they were old or new. The total rates of false recognition for…

  15. Did Michelangelo (1475-1564) have high-functioning autism?

    PubMed

    Arshad, Muhammad; Fitzgerald, Michael

    2004-05-01

    In this paper evidence is presented that Michelangelo met the criteria for Asperger's disorder, or high-functioning autism. The evidence relates to his single-minded work routine, unusual lifestyle, limited interests, poor social and communication skills, and issues of life control. Depression and various medical conditions, including gout, renal colic and renal stones, did not stop his obsessive working habits.

  16. Differentiating High-Functioning Autism and Social Phobia

    ERIC Educational Resources Information Center

    Tyson, Katherine E.; Cruess, Dean G.

    2012-01-01

    Both high-functioning autism (HFA) and social phobia (SP) involve profound social interaction deficits. Although these disorders share some similar symptoms, they are conceptualized as distinct. Because both HFA and SP are defined behaviorally, the degree of overlap between the two disorders may result in misinterpretation of symptoms. However,…

  17. Highly functionalized 7-azaindoles as selective PPAR gamma modulators.

    PubMed

    Debenham, Sheryl D; Chan, Audrey; Lau, Fiona Waiyu; Liu, Weiguo; Wood, Harold B; Lemme, Karen; Colwell, Lawrence; Habulihaz, Bahanu; Akiyama, Taro E; Einstein, Monica; Doebber, Thomas W; Sharma, Neelam; Wang, Chaunlin F; Wu, Margaret; Berger, Joel P; Meinke, Peter T

    2008-09-01

    A series of highly functionalized 3-aroyl and 3-phenoxy-2-methyl-7-azaindoles have been identified, which are potent selective PPARgamma modulators (SPPARgammaMs). Addition of substituents at the 6-position of the 7-azaindoles improves in vitro potency and pharmacokinetics. 7-Azaindoles have significantly improved off-target profiles compared to the parent indole series.

  18. Speech-and-Gesture Integration in High Functioning Autism

    ERIC Educational Resources Information Center

    Silverman, Laura B.; Bennetto, Loisa; Campana, Ellen; Tanenhaus, Michael K.

    2010-01-01

    This study examined iconic gesture comprehension in autism, with the goal of assessing whether cross-modal processing difficulties impede speech-and-gesture integration. Participants were 19 adolescents with high functioning autism (HFA) and 20 typical controls matched on age, gender, verbal IQ, and socio-economic status (SES). Gesture…

  19. Recreational Participation of Children with High Functioning Autism

    ERIC Educational Resources Information Center

    Potvin, Marie-Christine; Snider, Laurie; Prelock, Patricia; Kehayia, Eva; Wood-Dauphinee, Sharon

    2013-01-01

    The recreation of children with High Functioning Autism (HFA) is not well understood. The objective of this cross-sectional study was to compare the recreational engagement of children with HFA and their typically developing peers. Children with HFA (n = 30) and peers (n = 31) were similar on key characteristics that may impact recreation except…

  20. Neuropsychological Profile in High Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Narzisi, Antonio; Muratori, Filippo; Calderoni, Sara; Fabbro, Franco; Urgesi, Cosimo

    2013-01-01

    A comprehensive investigation of the neuropsychological strengths and weaknesses of children with autism may help to better describe their cognitive abilities and to design appropriate interventions. To this end we compared the NEPSY-II profiles of 22 children with high-functioning autism spectrum disorders (HFASD) with those of 44 healthy control…

  1. Construction of hyperelliptic function fields of high three-rank

    NASA Astrophysics Data System (ADS)

    Bauer, M.; Jacobson, M. J., Jr.; Lee, Y.; Scheidler, R.

    2008-03-01

    We present several explicit constructions of hyperelliptic function fields whose Jacobian or ideal class group has large 3 -rank. Our focus is on finding examples for which the genus and the base field are as small as possible. Most of our methods are adapted from analogous techniques used for generating quadratic number fields whose ideal class groups have high 3 -rank, but one method, applicable to finding large l -ranks for odd primes l geq 3, is new and unique to function fields. Algorithms, examples, and numerical data are included.

  2. Pancreatic functions in high salt fed female rats

    PubMed Central

    Lasheen, Noha N

    2015-01-01

    Salt consumption has been increased worldwide and the association of high salt diets with enhanced inflammation and target organ damage was reported. Little data were available about the effect of high salt diet on exocrine function of pancreas, while the relation between high salt intake and insulin sensitivity was controversial. This study was designed to investigate the effect of high salt diet on exocrine and endocrine pancreatic functions, and to elucidate the possible underlying mechanism(s). Twenty adult female Wistar rats were randomly divided into two groups; control group; fed standard rodent diet containing 0.3% NaCl, and high salt fed group; fed 8% NaCl for 8 weeks. On the day of sacrifice, rats were anesthized by i.p. pentobarbitone (40 μg/kg B.W.). Nasoanal length was measured and fasting blood glucose was determined from rat tail. Blood samples were obtained from abdominal aorta for determination of plasma sodium, potassium, amylase, lipase, aldosterone, insulin, transforming growth factor-β (TGF-β1), and interleukin 6 (IL6). Pancreata of both groups were histologically studied. Compared to control group, 8-week high salt fed group showed: significant elevation in body weight, body mass index, Lee index, plasma sodium, TGF-β1 and IL6, however, plasma aldosterone, amylase, lipase, and insulin levels were significantly decreased. A nonsignificant increase in plasma potassium and nonsignificant changes in fasting blood glucose and HOMA-IR were detected between groups. Pancreatic fibrosis was observed in test group. High salt diet for 8 weeks caused pancreatic fibrosis evidenced by decline of both exocrine and endocrine functions of pancreas in Wistar rats. PMID:26216433

  3. Protection against lethal Sendai virus infection by in vivo priming of virus-specific cytotoxic T lymphocytes with a free synthetic peptide.

    PubMed Central

    Kast, W M; Roux, L; Curren, J; Blom, H J; Voordouw, A C; Meloen, R H; Kolakofsky, D; Melief, C J

    1991-01-01

    The only peptide of Sendai virus that is recognized by cytotoxic T lymphocytes (CTL) in B6 mice was found with (i) the use of recombinant vaccinia virus constructs containing separate genes of Sendai virus and (ii) a set of overlapping peptides completely spanning the identified nucleoprotein (NP) gene product. This immunodominant NP peptide is recognized by Sendai virus-specific CTL that are known to have therapeutic effects in vivo. By subcutaneous immunization, this peptide induced Sendai virus and NP peptide-specific CTL memory responses in vivo. Most importantly, mice that had been immunized with this peptide were protected against a lethal virus dose, indicating that viral peptides can be used as antiviral T-cell vaccines. The induction of T-cell memory by free peptide immunization potentially has wide applicability in biology and medicine, including protection against infectious disease. PMID:1848698

  4. Protection Against Lethal Sendai Virus Infection by in vivo Priming of Virus-Specific Cytotoxic T Lymphocytes with a Free Synthetic Peptide

    NASA Astrophysics Data System (ADS)

    Kast, W. Martin; Roux, Laurent; Curren, Joseph; Blom, Hendrika J. J.; Voordouw, Arie C.; Meloen, Rob H.; Kolakofsky, Daniel; Melief, Cornelis J. M.

    1991-03-01

    The only peptide of Sendai virus that is recognized by cytotoxic T lymphocytes (CTL) in B6 mice was found with (i) the use of recombinant vaccinia virus constructs containing separate genes of Sendai virus and (ii) a set of overlapping peptides completely spanning the identified nucleoprotein (NP) gene product. This immunodominant NP peptide is recognized by Sendai virus-specific CTL that are known to have therapeutic effects in vivo. By subcutaneous immunization, this peptide induced Sendai virus and NP peptide-specific CTL memory responses in vivo. Most importantly, mice that had been immunized with this peptide were protected against a lethal virus dose, indicating that viral peptides can be used as antiviral T-cell vaccines. The induction of T-cell memory by free peptide immunization potentially has wide applicability in biology and medicine, including protection against infectious disease.

  5. Repeated vaginal SHIV challenges in macaques receiving oral or topical Pre-Exposure Prophylaxis induce virus-specific T cell responses

    PubMed Central

    Tsegaye, Theodros Solomon; Butler, Katherine; Luo, Wei; Radzio, Jessica; Srinivasan, Priya; Sharma, Sunita; Aubert, Rachael D.; Hanson, Debra L.; Dobard, Charles; Garcia-Lerma, J. Gerardo; Heneine, Walid; McNicholl, Janet M.; Kersh, Ellen N.

    2015-01-01

    Background Pre-Exposure Prophylaxis (PrEP) for HIV prevention is a novel biomedical prevention method. We have previously modeled PrEP during rectal SHIV exposures in macaques and identified that SHIV-specific T cell responses were induced in the presence of antiretroviral drugs, an observation previously termed T cell chemo-vaccination. This report expands those initial findings by examining a larger group of macaques that were given oral or topical PrEP during repeated vaginal virus exposure. Methods Thirty-six female pigtail macaques received up to 20 repeat low-dose vaginal inoculations with wild type (WT) SHIVSF162P3 (n=24) or a clonal derivative with the tenofovir K65R drug resistant mutation (n=12). PrEP consisted of oral Truvada (n=6, WT), tenofovir vaginal gel (n=6, K65R), or tenofovir intra-vaginal ring (n=6, WT). The remaining animals were PrEP-inexperienced controls (n=12, WT; n=6, K65R). SHIV-specific T cells were identified and characterized using IFNγ ELISPOT and multi-parameter flow cytometry. Results Of nine animals that were on PrEP and remained uninfected during WT SHIV vaginal challenges, eight (88.9%) developed virus-specific T cell responses. T cells were in CD4 and CD8 compartments, reached up to 4,900 IFNγ producing cells per million PBMCs, and primarily pol directed. In contrast, the replication impaired K65R virus did not induce detectable T cell responses, likely reflecting the need for adequate replication. Conclusion Virus-specific T cell responses occur frequently in oral or topical PrEP-protected pigtail macaques after vaginal exposure to WT SHIV virus. The contribution of such immune responses to protection from infection during and following PrEP warrants further investigation. PMID:25886925

  6. High functional load inhibits phonological contrast loss: a corpus study.

    PubMed

    Wedel, Andrew; Kaplan, Abby; Jackson, Scott

    2013-08-01

    For nearly a century, linguists have suggested that diachronic merger is less likely between phonemes with a high functional load--that is, phonemes that distinguish many words in the language in question. However, limitations in data and computational power have made assessing this hypothesis difficult. Here we present the first larger-scale study of the functional load hypothesis, using data from sound changes in a diverse set of languages. Our results support the functional load hypothesis: phoneme pairs undergoing merger distinguish significantly fewer minimal pairs in the lexicon than unmerged phoneme pairs. Furthermore, we show that higher phoneme probability is positively correlated with merger, but that this effect is stronger for phonemes that distinguish no minimal pairs. Finally, within our dataset we find that minimal pair count and phoneme probability better predict merger than change in system entropy at the lexical or phoneme level.

  7. Functionalized Materials From Elastomers to High Performance Thermoplastics

    SciTech Connect

    Salazar, Laura Ann

    2003-01-01

    Synthesis and incorporation of functionalized materials continues to generate significant research interest in academia and in industry. If chosen correctly, a functional group when incorporated into a polymer can deliver enhanced properties, such as adhesion, water solubility, thermal stability, etc. The utility of these new materials has been demonstrated in drug-delivery systems, coatings, membranes and compatibilizers. Two approaches exist to functionalize a material. The desired moiety can be added to the monomer either before or after polymerization. The polymers used range from low glass transition temperature elastomers to high glass transition temperature, high performance materials. One industrial example of the first approach is the synthesis of Teflon(reg. sign). Poly(tetrafluoroethylene) (PTFE or Teflon(reg. sign)) is synthesized from tetrafluoroethylene, a functionalized monomer. The resulting material has significant property differences from the parent, poly(ethylene). Due to the fluorine in the polymer, PTFE has excellent solvent and heat resistance, a low surface energy and a low coefficient of friction. This allows the material to be used in high temperature applications where the surface needs to be nonabrasive and nonstick. This material has a wide spread use in the cooking industry because it allows for ease of cooking and cleaning as a nonstick coating on cookware. One of the best examples of the second approach, functionalization after polymerization, is the vulcanization process used to make tires. Natural rubber (from the Hevea brasiliensis) has a very low glass transition temperature, is very tacky and would not be useful to make tires without synthetic alteration. Goodyear's invention was the vulcanization of polyisoprene by crosslinking the material with sulfur to create a rubber that was tough enough to withstand the elements of weather and road conditions. Due to the development of polymerization techniques to make cis

  8. The high-functioning autistic experience: birth to preteen years.

    PubMed

    Church, C C; Coplan, J

    1995-01-01

    A retrospective chart review of 15 children with high-functioning autism was conducted for the years 1981 through 1992. The purpose of the study was to describe the experience of children with high-functioning autism from infancy through preadolescence. Chart data included clinic staff records, parent letters, academic program records, service records, and comments from the children themselves. The findings of this study support the proposition that children with autism who have an IQ above 70 follow a varied but improving course over time. All 15 children met the DSM-III-R criteria for autism when first evaluated. By middle elementary school, however, none of the children in this study met the DSM-III-R criteria for autism, although they continued to have various language disturbances, social skill deficits, and unique behavioral qualities.

  9. High functional diversity stimulates diversification in experimental microbial communities.

    PubMed

    Jousset, Alexandre; Eisenhauer, Nico; Merker, Monika; Mouquet, Nicolas; Scheu, Stefan

    2016-06-01

    There is a growing awareness that biodiversity not only drives ecosystem services but also affects evolutionary dynamics. However, different theories predict contrasting outcomes on when do evolutionary processes occur within a context of competition. We tested whether functional diversity can explain diversification patterns. We tracked the survival and diversification of a focal bacterial species (Pseudomonas fluorescens) growing in bacterial communities of variable diversity and composition. We found that high functional diversity reduced the fitness of the focal species and, at the same time, fostered its diversification. This pattern was linked to resource competition: High diversity increased competition on a portion of the resources while leaving most underexploited. The evolved phenotypes of the focal species showed a better use of underexploited resources, albeit at a cost of lower overall growth rates. As a result, diversification alleviated the impact of competition on the fitness of the focal species. We conclude that biodiversity can stimulate evolutionary diversification, provided that sufficient alternative niches are available.

  10. Density Functional Theory Investigation of Sodium Azide at High Pressure

    NASA Astrophysics Data System (ADS)

    Steele, Brad; Landerville, Aaron; Oleynik, Ivan

    2013-06-01

    Sodium azide is being investigated as a potential precursor to a high-nitrogen content energetic material. Changes in the experimentally measured raman spectra under compression and high temperature indicate that a structural change may have taken place. Accurate mode assignments of new peaks arising in the raman spectra have been inconclusive. In this work, the first order raman spectra of sodium azide's alpha and beta phases are calculated using Density Function Pertubation Theory (DFPT) under compression and expansion. Normal mode assignments are made and compared to experiment. In addition, the equation of state of both phases is obtained up to 90 GPa.

  11. Learning disability subtypes: classification of high functioning hyperlexia.

    PubMed

    Richman, Lynn C; Wood, Kevin M

    2002-07-01

    This study examined 30 children with hyperlexic reading patterns and average intelligence to determine if established learning disability subtypes could be applied to these children with hyperlexia. Two groups emerged. One type showed language learning disorder patterns with good visual memory. This group also showed a high percentage of phonetic word errors. A second hyperlexic group showed signs of nonverbal learning disorder with visual spatial deficits and impaired visual memory. This latter subgroup showed few phonetic errors with more sight word errors. These findings suggest subtypes of high functioning hyperlexia, one showing language deficits characteristic of dysphasia and one showing patterns similar to visual spatial dyslexia.

  12. Highly Stable Sodium Batteries Enabled by Functional Ionic Polymer Membranes.

    PubMed

    Wei, Shuya; Choudhury, Snehashis; Xu, Jun; Nath, Pooja; Tu, Zhengyuan; Archer, Lynden A

    2017-01-23

    A sodium metal anode protected by an ion-rich polymeric membrane exhibits enhanced stability and high-Columbic efficiency cycling. Formed in situ via electropolymerization of functional imidazolium-type ionic liquid monomers, the polymer membrane protects the metal against parasitic reactions with electrolyte and, for fundamental reasons, inhibits dendrite formation and growth. The effectiveness of the membrane is demonstrated using direct visualization of sodium electrodeposition.

  13. Temperament as a Predictor of Symptomotology and Adaptive Functioning in Adolescents with High-Functioning Autism

    ERIC Educational Resources Information Center

    Schwartz, Caley B.; Henderson, Heather A.; Inge, Anne P.; Zahka, Nicole E.; Coman, Drew C.; Kojkowski, Nicole M.; Hileman, Camilla M.; Mundy, Peter C.

    2009-01-01

    Variation in temperament is characteristic of all people but is rarely studied as a predictor of individual differences among individuals with autism. Relative to a matched comparison sample, adolescents with High-Functioning Autism (HFA) reported lower levels of Surgency and higher levels of Negative Affectivity. Variability in temperament…

  14. Relationships among Repetitive Behaviors, Sensory Features, and Executive Functions in High Functioning Autism

    ERIC Educational Resources Information Center

    Boyd, Brian A.; McBee, Matthew; Holtzclaw, Tia; Baranek, Grace T.; Bodfish, James W.

    2009-01-01

    This study examined the relationship between repetitive behaviors and sensory processing issues in school-aged children with high functioning autism (HFA). Children with HFA (N = 61) were compared to healthy, typical controls (N = 64) to determine the relationship between these behavioral classes and to examine whether executive dysfunction…

  15. Quantitative Assessment of Neuromotor Function in Adolescents with High Functioning Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Freitag, Christine M.; Kleser, Christina; Schneider, Marc; von Gontard, Alexander

    2007-01-01

    Background: Motor impairment in children with Asperger Syndrome (AS) or High functioning autism (HFA) has been reported previously. This study presents results of a quantitative assessment of neuromotor skills in 14-22 year old HFA/AS. Methods: 16 HFA/AS and 16 IQ-matched controls were assessed by the Zurich Neuromotor Assessment (ZNA). Results:…

  16. High-temperature asymptotics of supersymmetric partition functions

    SciTech Connect

    Ardehali, Arash Arabi

    2016-07-05

    We study the supersymmetric partition function of 4d supersymmetric gauge theories with a U(1) R-symmetry on Euclidean S3 × Sβ1, with S3 the unit-radius squashed three-sphere, and β the circumference of the circle. For superconformal theories, this partition function coincides (up to a Casimir energy factor) with the 4d superconformal index. The partition function can be computed exactly using the supersymmetric localization of the gauge theory path-integral. It takes the form of an elliptic hypergeometric integral, which may be viewed as a matrix-integral over the moduli space of the holonomies of the gauge fields around Sβ1. At high temperatures (β → 0, corresponding to the hyperbolic limit of the elliptic hypergeometric integral) we obtain from the matrix-integral a quantum effective potential for the holonomies. The effective potential is proportional to the temperature. Therefore the high-temperature limit further localizes the matrix-integral to the locus of the minima of the potential. If the effective potential is positive semi-definite, the leading high-temperature asymptotics of the partition function is given by the formula of Di Pietro and Komargodski, and the subleading asymptotics is connected to the Coulomb branch dynamics on R3 × S1. In theories where the effective potential is not positive semi-definite, the Di Pietro-Komargodski formula needs to be modified. In particular, this modification occurs in the SU(2) theory of Intriligator-Seiberg-Shenker, and the SO(N) theory of Brodie-Cho-Intriligator, both believed to exhibit “misleading” anomaly matchings, and both believed to yield interacting superconformal field theories with c < a. Lastly, two new simple tests for dualities between 4d supersymmetric gauge theories emerge as byproducts of our analysis.

  17. High-temperature asymptotics of supersymmetric partition functions

    DOE PAGES

    Ardehali, Arash Arabi

    2016-07-05

    We study the supersymmetric partition function of 4d supersymmetric gauge theories with a U(1) R-symmetry on Euclidean S3 × Sβ1, with S3 the unit-radius squashed three-sphere, and β the circumference of the circle. For superconformal theories, this partition function coincides (up to a Casimir energy factor) with the 4d superconformal index. The partition function can be computed exactly using the supersymmetric localization of the gauge theory path-integral. It takes the form of an elliptic hypergeometric integral, which may be viewed as a matrix-integral over the moduli space of the holonomies of the gauge fields around Sβ1. At high temperatures (βmore » → 0, corresponding to the hyperbolic limit of the elliptic hypergeometric integral) we obtain from the matrix-integral a quantum effective potential for the holonomies. The effective potential is proportional to the temperature. Therefore the high-temperature limit further localizes the matrix-integral to the locus of the minima of the potential. If the effective potential is positive semi-definite, the leading high-temperature asymptotics of the partition function is given by the formula of Di Pietro and Komargodski, and the subleading asymptotics is connected to the Coulomb branch dynamics on R3 × S1. In theories where the effective potential is not positive semi-definite, the Di Pietro-Komargodski formula needs to be modified. In particular, this modification occurs in the SU(2) theory of Intriligator-Seiberg-Shenker, and the SO(N) theory of Brodie-Cho-Intriligator, both believed to exhibit “misleading” anomaly matchings, and both believed to yield interacting superconformal field theories with c < a. Lastly, two new simple tests for dualities between 4d supersymmetric gauge theories emerge as byproducts of our analysis.« less

  18. Fast Covariance Estimation for High-dimensional Functional Data.

    PubMed

    Xiao, Luo; Zipunnikov, Vadim; Ruppert, David; Crainiceanu, Ciprian

    2016-01-01

    We propose two fast covariance smoothing methods and associated software that scale up linearly with the number of observations per function. Most available methods and software cannot smooth covariance matrices of dimension J > 500; a recently introduced sandwich smoother is an exception but is not adapted to smooth covariance matrices of large dimensions, such as J = 10, 000. We introduce two new methods that circumvent those problems: 1) a fast implementation of the sandwich smoother for covariance smoothing; and 2) a two-step procedure that first obtains the singular value decomposition of the data matrix and then smoothes the eigenvectors. These new approaches are at least an order of magnitude faster in high dimensions and drastically reduce computer memory requirements. The new approaches provide instantaneous (a few seconds) smoothing for matrices of dimension J = 10,000 and very fast (< 10 minutes) smoothing for J = 100, 000. R functions, simulations, and data analysis provide ready to use, reproducible, and scalable tools for practical data analysis of noisy high-dimensional functional data.

  19. Structural Stability and Functional Remodeling of High-Density Lipoproteins

    PubMed Central

    Gursky, Olga

    2015-01-01

    Lipoproteins are protein-lipid nanoparticles that transport lipids in circulation and are central in atherosclerosis and other disorders of lipid metabolism. Apolipoproteins form flexible structural scaffolds and important functional ligands on the particle surface and direct lipoprotein metabolism. Lipoproteins undergo multiple rounds of metabolic remodeling that is crucial to lipid transport. Important aspects of this remodeling, including apolipoprotein dissociation and particle fusion, are mimicked in thermal or chemical denaturation and are modulated by free energy barriers. Here we review our biophysical studies that revealed kinetic mechanism of lipoprotein stabilization and unraveled its structural basis. The main focus is on high-density lipoprotein (HDL). An inverse correlation between stability and functions of various HDLs in cholesterol transport suggests functional role of structural disorder. A mechanism for conformational adaptation of the major HDL proteins, apoA-I and apoA-II, to the increasing lipid load is proposed. Together, these studies help understand why HDL form discrete subclasses separated by kinetic barriers, which have distinct composition, conformation and functional properties. Understanding these properties may help improve HDL quality and develop novel therapies for cardiovascular disease. PMID:25749369

  20. A synthetic multi-epitope antigen enhances hepatitis C virus-specific B- and T-cell responses.

    PubMed

    Yang, Guimei; Chen, Shuwen; Zhu, Xiangying; Liang, Shenghua; Liu, Longding; Ren, Daming

    2011-04-01

    Combining results from previous studies, a multi-epitope antigen PCXZ against the hepatitis C virus was synthesized in this study. The antigenic specificity of PCXZ was determined by recognizing antibodies in serum samples from hepatitis C virus patients, but not from healthy subjects or subjects who had the hepatitis B virus. The characteristics of PCXZ immunogenicity were evaluated in BALB/c mice. Strong antibody responses were generated in mice immunized with either naked PCXZ or PCXZ in Freund's adjuvant. As for the T-cell responses, Freund's adjuvant significantly increased interferon-γ secretion and enhanced the lytic activity of cytotoxic T lymphocytes. The epitope Pa, one component of PCXZ, made the most significant contribution to specific CTL lysis; this epitope was also a B-cell epitope and was able to induce high IgG titers. In summary, PCXZ was found to be highly immunogenic, and elicited both humoral and cellular immune responses in mice.

  1. Acrolein impairs the cholesterol transport functions of high density lipoproteins.

    PubMed

    Chadwick, Alexandra C; Holme, Rebecca L; Chen, Yiliang; Thomas, Michael J; Sorci-Thomas, Mary G; Silverstein, Roy L; Pritchard, Kirkwood A; Sahoo, Daisy

    2015-01-01

    High density lipoproteins (HDL) are considered athero-protective, primarily due to their role in reverse cholesterol transport, where they transport cholesterol from peripheral tissues to the liver for excretion. The current study was designed to determine the impact of HDL modification by acrolein, a highly reactive aldehyde found in high abundance in cigarette smoke, on the cholesterol transport functions of HDL. HDL was chemically-modified with acrolein and immunoblot and mass spectrometry analyses confirmed apolipoprotein crosslinking, as well as acrolein adducts on apolipoproteins A-I and A-II. The ability of acrolein-modified HDL (acro-HDL) to serve as an acceptor of free cholesterol (FC) from COS-7 cells transiently expressing SR-BI was significantly decreased. Further, in contrast to native HDL, acro-HDL promotes higher neutral lipid accumulation in murine macrophages as judged by Oil Red O staining. The ability of acro-HDL to mediate efficient selective uptake of HDL-cholesteryl esters (CE) into SR-BI-expressing cells was reduced compared to native HDL. Together, the findings from our studies suggest that acrolein modification of HDL produces a dysfunctional particle that may ultimately promote atherogenesis by impairing functions that are critical in the reverse cholesterol transport pathway.

  2. Density functional theory investigation of sodium azide at high pressure

    NASA Astrophysics Data System (ADS)

    Steele, B. A.; Landerville, A. C.; Oleynik, I. I.

    2014-05-01

    High pressure experiments utilizing Raman spectroscopy indicate that the a phase of sodium azide undergoes a polymeric phase transition at high pressure. In this work, the structural and vibrational properties, including the first order Raman and infrared spectra, of the a phase of sodium azide are calculated using first-principles density functional theory up to 92 GPa. The equation of state of α NaN3 is obtained within the quasi-harmonic approximation at various temperatures. Each Raman-active mode blue shifts under compression whereas the doubly degenerate IR-active azide bending mode red-shifts under compression. However, at 70 GPa, the intensity of the Bu IR-active bending mode decreases substantially, and a new distorted azide bending lattice mode appears in the IR spectrum. In contrast to the bending mode, this new mode blue-shifts under compression. No new modes appear in the Raman spectra at high pressure, indicating that the changes in the Raman spectrum seen in experiment at high pressure are signs of new high nitrogen content structures, but not due to sodium azide.

  3. [Psychoeducational intervention in high ability: intellectual functioning and extracurricular enrichment].

    PubMed

    Sastre-Riba, Sylvia

    2014-02-24

    The 'new paradigm' defines the high intellectual ability as a potential that should crystallize progressively throughout development. Its main feature is a high intellectual initial multidimensional potential, which is transformed so that, being a person with high intellectual ability is the result of a developmental process from a neurobiological substrate and the incidence of variables (psychosocial and education) which determines its manifestation more or less stable and optimal to excellence. It is interesting to know the effectiveness of psychoeducational intervention of the extracurricular enrichment programs and their effects on the expression of differential functioning and the optimization of the management of cognitive resources that lead to excellence. An extracurricular enrichment program is described and evaluated through: 1) the stability of the intellectual measures; 2) the satisfaction level of participants and families. Participants are 58 high ability students on the enrichment program and 25 parents. Intellectual profiles are obtained on T1-T2 and calculated their stability by regression analysis, the CSA and CSA-P questionnaires were applied in order to know the participants and families' satisfaction measure. Results show the basic stability of intellectual profiles with five cases of instability among the 58 profiles obtained, and a high satisfaction with the results obtained in the domain of cognitive and personal management among the participants.

  4. Partial reconstitution of virus-specific memory CD8{sup +} T cells following whole body {gamma}-irradiation

    SciTech Connect

    Grayson, Jason M. . E-mail: jgrayson@wfubmc.edu; Laniewski, Nathan G.; Holbrook, Beth C.

    2006-04-25

    CD8{sup +} memory T cells are critical in providing immunity to viral infection. Previous studies documented that antigen-specific CD8{sup +} memory T cells are more resistant to radiation-induced apoptosis than naive T cells. Here, we determined the number and in vivo function of memory CD8{sup +} T cells as immune reconstitution progressed following irradiation. Immediately following irradiation, the number of memory CD8{sup +} T cells declined 80%. As reconstitution progressed, the number of memory cells reached a zenith at 33% of pre-irradiation levels, and was maintained for 120 days post-irradiation. In vitro, memory CD8{sup +} T cells were able to produce cytokines at all times post-irradiation, but when adoptively transferred, they were not able to expand upon rechallenge immediately following irradiation, but regained this ability as reconstitution progressed. When proliferation was examined in vitro, irradiated memory CD8{sup +} T cells were able to respond to mitogenic growth but were unable to divide.

  5. Density Functional Theory Investigation of Sodium Azide at High Pressure

    NASA Astrophysics Data System (ADS)

    Steele, Brad; Landerville, Aaron; Oleynik, Ivan

    2013-03-01

    Sodium azide is intriguing because it could potentially be used as a precursor to a high-nitrogen energetic material. Furthermore, recent absorption and Raman spectroscopic results have shown that novel nitrogen structures may indeed be attainable from sodium azide. First-principles density functional theory calculations were performed to characterize possible novel crystalline structures of sodium azide including their atomic structure, vibrational properties, Raman spectra, and equation of state up to 90 GPa. Calculated Raman peaks and intensities show good agreement with experiment.

  6. Startle and blink reflex in high functioning autism.

    PubMed

    Erturk, Ozdem; Korkmaz, Baris; Alev, Gulce; Demirbilek, Veysi; Kiziltan, Meral

    2016-06-01

    An important clinical feature of autism is the presence of atypical responses to sensory stimuli. In this study, we investigated if high functioning autistic patients had abnormalities in the blink reflex and the startle reaction to auditory or somatosensory stimuli. Fourteen patients aged between 7 and 16 years were included in the study. We found a longer latency of the blink reflex, an increased duration and amplitude of the auditory startle reaction and a lower presence rate of the somatosensorial startle reaction in autistic patients. To better define the sensorial characteristics of the disease could improve the therapeutic management of children with autism spectrum disorder.

  7. Identification of a dengue virus-specific HLA-A*0201-restricted CD8+ T cell epitope.

    PubMed

    Wen, Jinsheng; Duan, Zhiliang; Jiang, Lifang

    2010-04-01

    In this study, a combination of epitope-prediction programs and in vitro assays was used to identify dengue virus (DENV)-specific CD8(+) T cell epitopes. Peripheral blood mononuclear cells (PBMCs) isolated from patients who recovered from dengue fever were stimulated with candidate epitope peptides derived from DENV, which were predicted by using SYFPEITHI and RANKpep epitope-prediction programs. The IFN-gamma ELISpot results and the results of intracellular staining of IFN-gamma showed that peptides NS4b_40 (TLYAVATTI), E_256 (QEGAMHTAL), NS3_205 (LPAIVREAI), NS5_210 (SRNSTHEMY), and NS3_207 (AIVREAIKR) could induce the recall response of CD8(+) T cells. Furthermore, the results of the MHC-peptide complex stabilization assay revealed that peptide NS4b_40 (TLYAVATTI) has a high affinity for HLA-A*0201 molecules. The IFN-gamma ELISpot results and staining of intracellular IFN-gamma confirmed that this peptide could induce high-level CD8(+) T cell response in HLA-A*0201 positive PBMCs. Peptide NS4b_40 (TLYAVATTI) was identified as a novel DENV-specific HLA-A*0201-restricted CD8(+) T cell epitope.

  8. Reorganization of functionally connected brain subnetworks in high-functioning autism.

    PubMed

    Glerean, Enrico; Pan, Raj K; Salmi, Juha; Kujala, Rainer; Lahnakoski, Juha M; Roine, Ulrika; Nummenmaa, Lauri; Leppämäki, Sami; Nieminen-von Wendt, Taina; Tani, Pekka; Saramäki, Jari; Sams, Mikko; Jääskeläinen, Iiro P

    2016-03-01

    Previous functional connectivity studies have found both hypo- and hyper-connectivity in brains of individuals having autism spectrum disorder (ASD). Here we studied abnormalities in functional brain subnetworks in high-functioning individuals with ASD during free viewing of a movie containing social cues and interactions. Twenty-six subjects (13 with ASD) watched a 68-min movie during functional magnetic resonance imaging. For each subject, we computed Pearson's correlation between haemodynamic time-courses of each pair of 6-mm isotropic voxels. From the whole-brain functional networks, we derived individual and group-level subnetworks using graph theory. Scaled inclusivity was then calculated between all subject pairs to estimate intersubject similarity of connectivity structure of each subnetwork. Additional 54 individuals (27 with ASD) from the ABIDE resting-state database were included to test the reproducibility of the results. Between-group differences were observed in the composition of default-mode and ventro-temporal-limbic (VTL) subnetworks. The VTL subnetwork included amygdala, striatum, thalamus, parahippocampal, fusiform, and inferior temporal gyri. Further, VTL subnetwork similarity between subject pairs correlated significantly with similarity of symptom gravity measured with autism quotient. This correlation was observed also within the controls, and in the reproducibility dataset with ADI-R and ADOS scores. Our results highlight how the reorganization of functional subnetworks in individuals with ASD clarifies the mixture of hypo- and hyper-connectivity findings. Importantly, only the functional organization of the VTL subnetwork emerges as a marker of inter-individual similarities that co-vary with behavioral measures across all participants. These findings suggest a pivotal role of ventro-temporal and limbic systems in autism.

  9. Intrahepatic virus-specific IL-10-producing CD8 T cells prevent liver damage during chronic hepatitis C virus infection.

    PubMed

    Abel, Michal; Sène, Damien; Pol, Stanislas; Bourlière, Marc; Poynard, Thierry; Charlotte, Frédéric; Cacoub, Patrice; Caillat-Zucman, Sophie

    2006-12-01

    CD8 T cell killing of hepatitis C virus (HCV)-infected hepatocytes is thought to contribute to liver damage during chronic HCV infection, whereas the participation of HCV-nonspecific immune cells is unclear. To visualize the spatial relationship of HCV-specific CD8 T cells with parenchymal target cells, and to examine their local functional activity in relation to hepatocellular necrosis and fibrosis, we used HLA tetramers and confocal microscopy in biopsies from 23 HLA-A2 or HLA-B7 patients with chronic HCV infection. Intrahepatic tetramer+ (HCV-specific) CD8 T cells protected from hepatic necroinflammatory disease activity, independently of age, gender, viral load, and viral genotype. Indeed, tetramer+ cells were scattered in the liver within regions of weak fibrosis (low laminin expression) and low hepatocellular apoptosis (TUNEL method), and expressed IL-10 but not IFNgamma. By contrast, tetramer-negative CD8 T cells were associated with active necroinflammatory liver disease, colocalized with strong laminin expression and hepatocellular apoptosis, and expressed more frequently IFNgamma than IL-10. Overall, liver regions harboring HCV-specific CD8 T cells tended to be healthier than areas containing only inflammatory cells of undefined specificity. In conclusion, HCV-specific IL-10-producing CD8 T cells, although not cytotoxic and unable to control viral replication, can attenuate hepatocellular necrosis, liver fibrosis, and inflammation mediated by bystander T cells, and may thus represent antigen-induced regulatory CD8 T cells. Therapeutic modulation of the intrahepatic balance between specific and bystander CD8 T cells might be beneficial in patients with chronic hepatitis C.

  10. Dengue virus specific dual HLA binding T cell epitopes induce CD8+ T cell responses in seropositive individuals

    PubMed Central

    Comber, Joseph D; Karabudak, Aykan; Huang, Xiaofang; Piazza, Paolo A; Marques, Ernesto T A; Philip, Ramila

    2015-01-01

    Dengue virus infects an estimated 300 million people each year and even more are at risk of becoming infected as the virus continues to spread into new areas. Despite the increase in viral prevalence, no anti-viral medications or vaccines are approved for treating or preventing infection. CD8+ T cell responses play a major role in viral clearance. Therefore, effective vaccines that induce a broad, multi-functional T cell response with substantial cross-reactivity between all virus serotypes can have major impacts on reducing infection rates and infection related complications. Here, we took an immunoproteomic approach to identify novel MHC class I restricted T cell epitopes presented by dengue virus infected cells, representing the natural and authentic targets of the T cell response. Using this approach we identified 4 novel MHC-I restricted epitopes: 2 with the binding motif for HLA-A24 molecules and 2 with both HLA-A2 and HLA-A24 binding motifs. These peptides were able to activate CD8+ T cell responses in both healthy, seronegative individuals and in seropositive individuals who have previously been infected with dengue virus. Importantly, the dual binding epitopes activated pre-existing T cell precursors in PBMCs obtained from both HLA-A2+ and HLA-A24+ seropositive individuals. Together, the data indicate that these epitopes are immunologically relevant T cell activating peptides presented on infected cells during a natural infection and therefore may serve as candidate antigens for the development of effective multi-serotype specific dengue virus vaccines. PMID:25668665

  11. Dengue virus specific dual HLA binding T cell epitopes induce CD8+ T cell responses in seropositive individuals.

    PubMed

    Comber, Joseph D; Karabudak, Aykan; Huang, Xiaofang; Piazza, Paolo A; Marques, Ernesto T A; Philip, Ramila

    2014-01-01

    Dengue virus infects an estimated 300 million people each year and even more are at risk of becoming infected as the virus continues to spread into new areas. Despite the increase in viral prevalence, no anti-viral medications or vaccines are approved for treating or preventing infection. CD8+ T cell responses play a major role in viral clearance. Therefore, effective vaccines that induce a broad, multi-functional T cell response with substantial cross-reactivity between all virus serotypes can have major impacts on reducing infection rates and infection related complications. Here, we took an immunoproteomic approach to identify novel MHC class I restricted T cell epitopes presented by dengue virus infected cells, representing the natural and authentic targets of the T cell response. Using this approach we identified 4 novel MHC-I restricted epitopes: 2 with the binding motif for HLA-A24 molecules and 2 with both HLA-A2 and HLA-A24 binding motifs. These peptides were able to activate CD8+ T cell responses in both healthy, seronegative individuals and in seropositive individuals who have previously been infected with dengue virus. Importantly, the dual binding epitopes activated pre-existing T cell precursors in PBMCs obtained from both HLA-A2+ and HLA-A24+ seropositive individuals. Together, the data indicate that these epitopes are immunologically relevant T cell activating peptides presented on infected cells during a natural infection and therefore may serve as candidate antigens for the development of effective multi-serotype specific dengue virus vaccines.

  12. Age-related and regional differences in the prevalence of hepatitis E virus-specific antibodies in pigs in Germany.

    PubMed

    Krumbholz, Andi; Joel, Sebastian; Neubert, Anne; Dremsek, Paul; Dürrwald, Ralf; Johne, Reimar; Hlinak, Andreas; Walther, Mario; Lange, Jeannette; Wutzler, Peter; Sauerbrei, Andreas; Ulrich, Rainer G; Zell, Roland

    2013-12-27

    An increasing number of acute autochthonous human hepatitis E virus (HEV)-infections was noticed in Germany and other developed countries, most likely the result of a zoonotic virus transmission from pig, wild boar and deer. Currently there is still a lack of profound data concerning the actual prevalence of HEV-specific antibodies in domestic pig herds in Germany, in particular for regions with high pig density, and its age-dependency. 2273 domestic pig sera were collected in 2011 mainly from Bavaria, North Rhine-Westphalia and Lower Saxony from areas having a high pig density. Initially, 420 randomly selected pig sera were tested in three commercially available and in two in-house HEV-antibody ELISAs. 43.6% (183/420) to 65.5% (275/420) of the sera were demonstrated to be reactive against human pathogenic HEV genotypes 1 and/or 3. The majority of sera reacted only weakly or not at all with the rat HEV antigen with very few sera showing a stronger reactivity to this antigen compared to the genotype 3 antigen. The results of all three HEV-IgG tests, i.e. the PrioCHECK(®) HEV Ab porcine ELISA kit, the ID Screen(®) Hepatitis E Indirect Multi-species ELISA kit and the genotype 3 in-house ELISA were in good accordance. Therefore, the remaining sera were tested using the PrioCHECK(®) HEV Ab porcine ELISA kit. Samples with a borderline result were finally determined by application of the conjugate-modified recomLine HEV IgG assay. A total of 1065 of the 2273 sera (46.9%) were found to be anti-HEV IgG-positive. While 38.4% (306/796) of fatteners (age between 3 and 9 months) exhibited HEV-specific antibodies, 51.4% (759/1477) of sows (age older than 9 months) exhibited anti-HEV antibodies (P<0.001). Fatteners kept in Southern Germany had a significantly higher HEV IgG prevalence compared to fatteners kept in the high pig density federal states North Rhine-Westphalia and Lower Saxony but also in German federal states with a low pig density. In conclusion, the present

  13. Noncovalent functionalization of carbon nanotubes for highly specific electronic biosensors

    NASA Astrophysics Data System (ADS)

    Chen, Robert J.; Bangsaruntip, Sarunya; Drouvalakis, Katerina A.; Wong Shi Kam, Nadine; Shim, Moonsub; Li, Yiming; Kim, Woong; Utz, Paul J.; Dai, Hongjie

    2003-04-01

    Novel nanomaterials for bioassay applications represent a rapidly progressing field of nanotechnology and nanobiotechnology. Here, we present an exploration of single-walled carbon nanotubes as a platform for investigating surface-protein and protein-protein binding and developing highly specific electronic biomolecule detectors. Nonspecific binding on nanotubes, a phenomenon found with a wide range of proteins, is overcome by immobilization of polyethylene oxide chains. A general approach is then advanced to enable the selective recognition and binding of target proteins by conjugation of their specific receptors to polyethylene oxide-functionalized nanotubes. This scheme, combined with the sensitivity of nanotube electronic devices, enables highly specific electronic sensors for detecting clinically important biomolecules such as antibodies associated with human autoimmune diseases.

  14. High-frequency health data and spline functions.

    PubMed

    Martín-Rodríguez, Gloria; Murillo-Fort, Carlos

    2005-03-30

    Seasonal variations are highly relevant for health service organization. In general, short run movements of medical magnitudes are important features for managers in this field to make adequate decisions. Thus, the analysis of the seasonal pattern in high-frequency health data is an appealing task. The aim of this paper is to propose procedures that allow the analysis of the seasonal component in this kind of data by means of spline functions embedded into a structural model. In the proposed method, useful adaptions of the traditional spline formulation are developed, and the resulting procedures are capable of capturing periodic variations, whether deterministic or stochastic, in a parsimonious way. Finally, these methodological tools are applied to a series of daily emergency service demand in order to capture simultaneous seasonal variations in which periods are different.

  15. Vestibular contributions to high-level sensorimotor functions.

    PubMed

    Medendorp, W Pieter; Selen, Luc J P

    2017-02-02

    The vestibular system, which detects motion and orientation of the head in space, is known to be important in controlling gaze to stabilize vision, to ensure postural stability and to provide our sense of self-motion. While the brain's computations underlying these functions are extensively studied, the role of the vestibular system in higher level sensorimotor functions is less clear. This review covers new research on the vestibular influence on perceptual judgments, motor decisions, and the ability to learn multiple motor actions. Guided by concepts such as optimization, inference, estimation and control, we focus on how the brain determines causal relationships between memorized and visual representations in the updating of visual space, and how vestibular, visual and efferent motor information are integrated in the estimation of body motion. We also discuss evidence that these computations involve multiple coordinate representations, some of which can be probed in parietal cortex using neuronal oscillations derived from EEG. In addition, we describe work on decision making during self-motion, showing a clear modulation of bottom-up acceleration signals on decisions in the saccadic system. Finally, we consider the importance of vestibular signals as contextual cues in motor learning and recall. Taken together, these results emphasize the impact of vestibular information on high-level sensorimotor functions, and identify future directions for theoretical, behavioral, and neurophysiological investigations.

  16. Virus-Specific Immune Memory at Peripheral Sites of Herpes Simplex Virus Type 2 (HSV-2) Infection in Guinea Pigs

    PubMed Central

    Xia, Jingya; Veselenak, Ronald L.; Gorder, Summer R.; Bourne, Nigel; Milligan, Gregg N.

    2014-01-01

    Despite its importance in modulating HSV-2 pathogenesis, the nature of tissue-resident immune memory to HSV-2 is not completely understood. We used genital HSV-2 infection of guinea pigs to assess the type and location of HSV-specific memory cells at peripheral sites of HSV-2 infection. HSV-specific antibody-secreting cells were readily detected in the spleen, bone marrow, vagina/cervix, lumbosacral sensory ganglia, and spinal cord of previously-infected animals. Memory B cells were detected primarily in the spleen and to a lesser extent in bone marrow but not in the genital tract or neural tissues suggesting that the HSV-specific antibody-secreting cells present at peripheral sites of HSV-2 infection represented persisting populations of plasma cells. The antibody produced by these cells isolated from neural tissues of infected animals was functionally relevant and included antibodies specific for HSV-2 glycoproteins and HSV-2 neutralizing antibodies. A vigorous IFN-γ-secreting T cell response developed in the spleen as well as the sites of HSV-2 infection in the genital tract, lumbosacral ganglia and spinal cord following acute HSV-2 infection. Additionally, populations of HSV-specific tissue-resident memory T cells were maintained at these sites and were readily detected up to 150 days post HSV-2 infection. Unlike the persisting plasma cells, HSV-specific memory T cells were also detected in uterine tissue and cervicothoracic region of the spinal cord and at low levels in the cervicothoracic ganglia. Both HSV-specific CD4+ and CD8+ resident memory cell subsets were maintained long-term in the genital tract and sensory ganglia/spinal cord following HSV-2 infection. Together these data demonstrate the long-term maintenance of both humoral and cellular arms of the adaptive immune response at the sites of HSV-2 latency and virus shedding and highlight the utility of the guinea pig infection model to investigate tissue-resident memory in the setting of HSV-2 latency

  17. Measles Virus-Specific Antibody Levels in Individuals in Argentina Who Received a One-Dose Vaccine

    PubMed Central

    Argüelles, Marcelo H.; Orellana, Mariana L.; Castello, Alejandro A.; Villegas, Guillermo A.; Masini, Matilde; Belizan, Alejandra L.; González Ayala, Silvia; Vera, Osmar D.; Glikmann, Graciela

    2006-01-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease. PMID:16891485

  18. Measles virus-specific antibody levels in individuals in Argentina who received a one-dose vaccine.

    PubMed

    Argüelles, Marcelo H; Orellana, Mariana L; Castello, Alejandro A; Villegas, Guillermo A; Masini, Matilde; Belizan, Alejandra L; González Ayala, Silvia; Vera, Osmar D; Glikmann, Graciela

    2006-08-01

    In spite of active measles virus (MV) vaccination strategies, reemergence continues to occur, impairing global eradication programs. The immune status against measles was evaluated in 350 vaccinated healthy Argentine children and teenagers who received a single dose of the MV Schwarz strain Lirugen vaccine (Aventis Pasteur). Sera were assessed for immunoglobulin G (IgG) antibodies by a commercial enzyme immunoassay (EIA) (Enzygnost; Behring), an in-house EIA, and neutralization EIA. Results obtained with these methods showed a marked decline in IgG level with increasing age. At 1 to 4 years of age, 84% of children had IgG antibodies above 200 mIU/ml, conventionally accepted as protective levels, whereas only 32% of older children and teenagers had antibody levels exceeding 200 mIU/ml. Moreover, the MV IgG content in the teenage group was significantly lower than the IgG antibody level of the group of younger children (P < 0.0001). In contrast, screening for IgG antibody levels to inactivated tetanus vaccine showed that, on average, 80% of this population was fully protected and that this high level of protection remained through the teenage years. This study suggests that within this population a considerable proportion of individuals had low measles antibody levels that may be insufficient to protect against reinfections or clinical disease.

  19. Immunogenicity of recombinant HBsAg/HCV particles in mice pre-immunised with hepatitis B virus-specific vaccine.

    PubMed

    Netter, Hans J; Woo, Wai-Ping; Tindle, Robert; Macfarlan, Roderick I; Gowans, Eric J

    2003-06-20

    Due to their spatial structure virus-like particles (VLPs) generally induce effective immune responses. VLPs derived from the small envelope protein (HBsAg-S) of hepatitis B virus (HBV) comprise the HBV vaccine. Modified HBsAs-S VLPs, carrying the immunodominant hypervariable region (HVR1) of the hepatitis C virus (HCV) envelope protein E2 within the exposed 'a'-determinant region (HBsAg/HVR1-VLPs), elicited HVR1-specific antibodies in mice. A high percentage of the human population is positive for anti-HBsAg antibodies (anti-HBs), either through vaccination or natural infection. We, therefore, determined if pre-existing anti-HBs could influence immunisation with modified VLPs. Mice were immunised with a commercial HBV vaccine, monitored to ensure an anti-HBs response, then immunised with HBsAg/HVR1-VLPs. The resulting anti-HVR1 antibody titre was similar in mice with or without pre-existing anti-HBs. This suggests that HBsAg/HVR1-VLPs induce a primary immune response to HVR1 in anti-HBs positive mice and, hence, they may be used successfully in individuals already immunised with the HBV vaccine.

  20. Tribocorrosion behavior of bio-functionalized highly porous titanium.

    PubMed

    Toptan, F; Alves, A C; Pinto, A M P; Ponthiaux, P

    2017-05-01

    Titanium and its alloys are widely used in orthopedic and dental implants, however, some major clinical concerns such as poor wear resistance, lack of bioactivity, and bone resorption due to stress shielding are yet to be overcome. In order to improve these drawbacks, highly porous Ti samples having functionalized surfaces were developed by powder metallurgy with space holder technique followed by anodic treatment. Tribocorrosion tests were performed in 9g/L NaCl solution using a unidirectional pin-on-disc tribometer under 3N normal load, 1Hz frequency and 4mm track diameter. Open circuit potential (OCP) was measured before, during and after sliding. Worn surfaces investigated by field emission gun scanning electron microscope (FEG-SEM) equipped with energy dispersive X-ray spectroscopy (EDS). Results suggested bio-functionalized highly porous samples presented lower tendency to corrosion under sliding against zirconia pin, mainly due to the load carrying effect given by the hard protruded oxide surfaces formed by the anodic treatment.

  1. Phonological and orthographic spelling in high-functioning adult dyslexics.

    PubMed

    Kemp, Nenagh; Parrila, Rauno K; Kirby, John R

    2009-05-01

    Despite a history of reading or spelling difficulties, some adults attain age-appropriate spelling skills and succeed at university. We compared the spelling of 29 such high-functioning dyslexics with that of 28 typical students, matched on general spelling ability, and controlling for vocabulary and non-verbal intelligence. Participants wrote derived real and pseudo words, whose spelling relationship to their base forms was categorized as phonologically simple (apt-aptly), orthographically simple (deceit-deceitful), phonologically complex (ash-ashen), or orthographically complex (plenty-plentiful). Dyslexic participants spelled all word and pseudoword categories more poorly than controls. Both groups spelled simple phonological words best. Dyslexics were particularly poor at spelling simple orthographic words, whose letter patterns and rules must likely be memorized. In contrast, dyslexics wrote more plausible spellings of orthographic than phonological pseudowords, but this might be an artefact of their more variable spelling attempts. These results suggest that high-functioning dyslexics make some use of phonological skills to spell familiar words, but they have difficulty in memorizing orthographic patterns, which makes it difficult to spell unfamiliar words consistently in the absence of sufficient phonological cues or orthographic rules.

  2. Development of Norwalk Virus-Specific Monoclonal Antibodies with Therapeutic Potential for the Treatment of Norwalk Virus Gastroenteritis

    PubMed Central

    Sosnovtsev, Stanislav V.; Bok, Karin; Parra, Gabriel I.; Makiya, Michelle; Agulto, Liane; Purcell, Robert H.

    2013-01-01

    Passive immunoprophylaxis or immunotherapy with norovirus-neutralizing monoclonal antibodies (MAbs) could be a useful treatment for high-risk populations, including infants and young children, the elderly, and certain patients who are debilitated or immunocompromised. In order to obtain antinorovirus MAbs with therapeutic potential, we stimulated a strong adaptive immune response in chimpanzees to the prototype norovirus strain Norwalk virus (NV) (genogroup I.1). A combinatorial phage Fab display library derived from mRNA of the chimpanzees' bone marrow was prepared, and four distinct Fabs reactive with Norwalk recombinant virus-like particles (rVLPs) were recovered, with estimated binding affinities in the subnanomolar range. Mapping studies showed that the four Fabs recognized three different conformational epitopes in the protruding (P) domain of NV VP1, the major capsid protein. The epitope of one of the Fabs, G4, was further mapped to a specific site involving a key amino acid residue, Gly365. One additional specific Fab (F11) was recovered months later from immortalized memory B cells and partially characterized. The anti-NV Fabs were converted into full-length IgG (MAbs) with human γ1 heavy chain constant regions. The anti-NV MAbs were tested in the two available surrogate assays for Norwalk virus neutralization, which showed that the MAbs could block carbohydrate binding and inhibit hemagglutination by NV rVLP. By mixing a single MAb with live Norwalk virus prior to challenge, MAbs D8 and B7 neutralized the virus and prevented infection in a chimpanzee. Because chimpanzee immunoglobulins are virtually identical to human immunoglobulins, these chimpanzee anticapsid MAbs may have a clinical application. PMID:23785216

  3. Priming Cross-Protective Bovine Viral Diarrhea Virus-Specific Immunity Using Live-Vectored Mosaic Antigens

    PubMed Central

    Fang, Xin; Waghela, Suryakant D.; Bray, Jocelyn; Njongmeta, Leo M.; Herring, Andy; Abdelsalam, Karim W.; Chase, Christopher; Mwangi, Waithaka

    2017-01-01

    Bovine viral diarrhea virus (BVDV) plays a key role in bovine respiratory disease complex, which can lead to pneumonia, diarrhea and death of calves. Current vaccines are not very effective due, in part, to immunosuppressive traits and failure to induce broad protection. There are diverse BVDV strains and thus, current vaccines contain representative genotype 1 and 2 viruses (BVDV-1 & 2) to broaden coverage. BVDV modified live virus (MLV) vaccines are superior to killed virus vaccines, but they are susceptible to neutralization and complement-mediated destruction triggered by passively acquired antibodies, thus limiting their efficacy. We generated three novel mosaic polypeptide chimeras, designated NproE2123; NS231; and NS232, which incorporate protective determinants that are highly conserved among BVDV-1a, 1b, and BVDV-2 genotypes. In addition, strain-specific protective antigens from disparate BVDV strains were included to broaden coverage. We confirmed that adenovirus constructs expressing these antigens were strongly recognized by monoclonal antibodies, polyclonal sera, and IFN-γ-secreting T cells generated against diverse BVDV strains. In a proof-of-concept efficacy study, the multi-antigen proto-type vaccine induced higher, but not significantly different, IFN-γ spot forming cells and T-cell proliferation compared to a commercial MLV vaccine. In regards to the humoral response, the prototype vaccine induced higher BVDV-1 specific neutralizing antibody titers, whereas the MLV vaccine induced higher BVDV-2 specific neutralizing antibody titers. Following BVDV type 2a (1373) challenge, calves immunized with the proto-type or the MLV vaccine had lower clinical scores compared to naïve controls. These results support the hypothesis that a broadly protective subunit vaccine can be generated using mosaic polypeptides that incorporate rationally selected and validated protective determinants from diverse BVDV strains. Furthermore, regarding biosafety of using a

  4. Developing high-performance cross-functional teams: Understanding motivations, functional loyalties, and teaming fundamentals

    SciTech Connect

    Miller, M.A.

    1996-08-01

    Teamwork is the key to the future of effective technology management. Today`s technologies and markets have become too complex for individuals to work alone. Global competition, limited resources, cost consciousness, and time pressures have forced organizations and project managers to encourage teamwork. Many of these teams will be cross-functional teams that can draw on a multitude of talents and knowledge. To develop high-performing cross-functional teams, managers must understand motivations, functional loyalties, and the different backgrounds of the individual team members. To develop a better understanding of these issues, managers can learn from experience and from literature on teams and teaming concepts. When studying the literature to learn about cross-functional teaming, managers will find many good theoretical concepts, but when put into practice, these concepts have varying effects. This issue of varying effectiveness is what drives the research for this paper. The teaming concepts were studied to confirm or modify current understanding. The literature was compared with a {open_quotes}ground truth{close_quotes}, a survey of the reality of teaming practices, to examine the teaming concepts that the literature finds to be critical to the success of teams. These results are compared to existing teams to determine if such techniques apply in real-world cases.

  5. Largely typical patterns of resting-state functional connectivity in high-functioning adults with autism.

    PubMed

    Tyszka, J Michael; Kennedy, Daniel P; Paul, Lynn K; Adolphs, Ralph

    2014-07-01

    A leading hypothesis for the neural basis of autism postulates globally abnormal brain connectivity, yet the majority of studies report effects that are either very weak, inconsistent across studies, or explain results incompletely. Here we apply multiple analytical approaches to resting-state BOLD-fMRI data at the whole-brain level. Neurotypical and high-functioning adults with autism displayed very similar patterns and strengths of resting-state connectivity. We found only limited evidence in autism for abnormal resting-state connectivity at the regional level and no evidence for altered connectivity at the whole-brain level. Regional abnormalities in functional connectivity in autism spectrum disorder were primarily in the frontal and temporal cortices. Within these regions, functional connectivity with other brain regions was almost exclusively lower in the autism group. Further examination showed that even small amounts of head motion during scanning have large effects on functional connectivity measures and must be controlled carefully. Consequently, we suggest caution in the interpretation of apparent positive findings until all possible confounding effects can be ruled out. Additionally, we do not rule out the possibility that abnormal connectivity in autism is evident at the microstructural synaptic level, which may not be reflected sensitively in hemodynamic changes measured with BOLD-fMRI.

  6. Highly adaptive tests for group differences in brain functional connectivity.

    PubMed

    Kim, Junghi; Pan, Wei

    2015-01-01

    Resting-state functional magnetic resonance imaging (rs-fMRI) and other technologies have been offering evidence and insights showing that altered brain functional networks are associated with neurological illnesses such as Alzheimer's disease. Exploring brain networks of clinical populations compared to those of controls would be a key inquiry to reveal underlying neurological processes related to such illnesses. For such a purpose, group-level inference is a necessary first step in order to establish whether there are any genuinely disrupted brain subnetworks. Such an analysis is also challenging due to the high dimensionality of the parameters in a network model and high noise levels in neuroimaging data. We are still in the early stage of method development as highlighted by Varoquaux and Craddock (2013) that "there is currently no unique solution, but a spectrum of related methods and analytical strategies" to learn and compare brain connectivity. In practice the important issue of how to choose several critical parameters in estimating a network, such as what association measure to use and what is the sparsity of the estimated network, has not been carefully addressed, largely because the answers are unknown yet. For example, even though the choice of tuning parameters in model estimation has been extensively discussed in the literature, as to be shown here, an optimal choice of a parameter for network estimation may not be optimal in the current context of hypothesis testing. Arbitrarily choosing or mis-specifying such parameters may lead to extremely low-powered tests. Here we develop highly adaptive tests to detect group differences in brain connectivity while accounting for unknown optimal choices of some tuning parameters. The proposed tests combine statistical evidence against a null hypothesis from multiple sources across a range of plausible tuning parameter values reflecting uncertainty with the unknown truth. These highly adaptive tests are not only

  7. Highly adaptive tests for group differences in brain functional connectivity

    PubMed Central

    Kim, Junghi; Pan, Wei

    2015-01-01

    Resting-state functional magnetic resonance imaging (rs-fMRI) and other technologies have been offering evidence and insights showing that altered brain functional networks are associated with neurological illnesses such as Alzheimer's disease. Exploring brain networks of clinical populations compared to those of controls would be a key inquiry to reveal underlying neurological processes related to such illnesses. For such a purpose, group-level inference is a necessary first step in order to establish whether there are any genuinely disrupted brain subnetworks. Such an analysis is also challenging due to the high dimensionality of the parameters in a network model and high noise levels in neuroimaging data. We are still in the early stage of method development as highlighted by Varoquaux and Craddock (2013) that “there is currently no unique solution, but a spectrum of related methods and analytical strategies” to learn and compare brain connectivity. In practice the important issue of how to choose several critical parameters in estimating a network, such as what association measure to use and what is the sparsity of the estimated network, has not been carefully addressed, largely because the answers are unknown yet. For example, even though the choice of tuning parameters in model estimation has been extensively discussed in the literature, as to be shown here, an optimal choice of a parameter for network estimation may not be optimal in the current context of hypothesis testing. Arbitrarily choosing or mis-specifying such parameters may lead to extremely low-powered tests. Here we develop highly adaptive tests to detect group differences in brain connectivity while accounting for unknown optimal choices of some tuning parameters. The proposed tests combine statistical evidence against a null hypothesis from multiple sources across a range of plausible tuning parameter values reflecting uncertainty with the unknown truth. These highly adaptive tests are not

  8. Proteomic profiling of high risk medulloblastoma reveals functional biology.

    PubMed

    Staal, Jerome A; Lau, Ling San; Zhang, Huizhen; Ingram, Wendy J; Hallahan, Andrew R; Northcott, Paul A; Pfister, Stefan M; Wechsler-Reya, Robert J; Rusert, Jessica M; Taylor, Michael D; Cho, Yoon-Jae; Packer, Roger J; Brown, Kristy J; Rood, Brian R

    2015-06-10

    Genomic characterization of medulloblastoma has improved molecular risk classification but struggles to define functional biological processes, particularly for the most aggressive subgroups. We present here a novel proteomic approach to this problem using a reference library of stable isotope labeled medulloblastoma-specific proteins as a spike-in standard for accurate quantification of the tumor proteome. Utilizing high-resolution mass spectrometry, we quantified the tumor proteome of group 3 medulloblastoma cells and demonstrate that high-risk MYC amplified tumors can be segregated based on protein expression patterns. We cross-validated the differentially expressed protein candidates using an independent transcriptomic data set and further confirmed them in a separate cohort of medulloblastoma tissue samples to identify the most robust proteogenomic differences. Interestingly, highly expressed proteins associated with MYC-amplified tumors were significantly related to glycolytic metabolic pathways via alternative splicing of pyruvate kinase (PKM) by heterogeneous ribonucleoproteins (HNRNPs). Furthermore, when maintained under hypoxic conditions, these MYC-amplified tumors demonstrated increased viability compared to non-amplified tumors within the same subgroup. Taken together, these findings highlight the power of proteomics as an integrative platform to help prioritize genetic and molecular drivers of cancer biology and behavior.

  9. NCBI GEO: archive for high-throughput functional genomic data.

    PubMed

    Barrett, Tanya; Troup, Dennis B; Wilhite, Stephen E; Ledoux, Pierre; Rudnev, Dmitry; Evangelista, Carlos; Kim, Irene F; Soboleva, Alexandra; Tomashevsky, Maxim; Marshall, Kimberly A; Phillippy, Katherine H; Sherman, Patti M; Muertter, Rolf N; Edgar, Ron

    2009-01-01

    The Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) is the largest public repository for high-throughput gene expression data. Additionally, GEO hosts other categories of high-throughput functional genomic data, including those that examine genome copy number variations, chromatin structure, methylation status and transcription factor binding. These data are generated by the research community using high-throughput technologies like microarrays and, more recently, next-generation sequencing. The database has a flexible infrastructure that can capture fully annotated raw and processed data, enabling compliance with major community-derived scientific reporting standards such as 'Minimum Information About a Microarray Experiment' (MIAME). In addition to serving as a centralized data storage hub, GEO offers many tools and features that allow users to effectively explore, analyze and download expression data from both gene-centric and experiment-centric perspectives. This article summarizes the GEO repository structure, content and operating procedures, as well as recently introduced data mining features. GEO is freely accessible at http://www.ncbi.nlm.nih.gov/geo/.

  10. Numerical methods for high-dimensional probability density function equations

    NASA Astrophysics Data System (ADS)

    Cho, H.; Venturi, D.; Karniadakis, G. E.

    2016-01-01

    In this paper we address the problem of computing the numerical solution to kinetic partial differential equations involving many phase variables. These types of equations arise naturally in many different areas of mathematical physics, e.g., in particle systems (Liouville and Boltzmann equations), stochastic dynamical systems (Fokker-Planck and Dostupov-Pugachev equations), random wave theory (Malakhov-Saichev equations) and coarse-grained stochastic systems (Mori-Zwanzig equations). We propose three different classes of new algorithms addressing high-dimensionality: The first one is based on separated series expansions resulting in a sequence of low-dimensional problems that can be solved recursively and in parallel by using alternating direction methods. The second class of algorithms relies on truncation of interaction in low-orders that resembles the Bogoliubov-Born-Green-Kirkwood-Yvon (BBGKY) framework of kinetic gas theory and it yields a hierarchy of coupled probability density function equations. The third class of algorithms is based on high-dimensional model representations, e.g., the ANOVA method and probabilistic collocation methods. A common feature of all these approaches is that they are reducible to the problem of computing the solution to high-dimensional equations via a sequence of low-dimensional problems. The effectiveness of the new algorithms is demonstrated in numerical examples involving nonlinear stochastic dynamical systems and partial differential equations, with up to 120 variables.

  11. Numerical methods for high-dimensional probability density function equations

    SciTech Connect

    Cho, H.; Venturi, D.; Karniadakis, G.E.

    2016-01-15

    In this paper we address the problem of computing the numerical solution to kinetic partial differential equations involving many phase variables. These types of equations arise naturally in many different areas of mathematical physics, e.g., in particle systems (Liouville and Boltzmann equations), stochastic dynamical systems (Fokker–Planck and Dostupov–Pugachev equations), random wave theory (Malakhov–Saichev equations) and coarse-grained stochastic systems (Mori–Zwanzig equations). We propose three different classes of new algorithms addressing high-dimensionality: The first one is based on separated series expansions resulting in a sequence of low-dimensional problems that can be solved recursively and in parallel by using alternating direction methods. The second class of algorithms relies on truncation of interaction in low-orders that resembles the Bogoliubov–Born–Green–Kirkwood–Yvon (BBGKY) framework of kinetic gas theory and it yields a hierarchy of coupled probability density function equations. The third class of algorithms is based on high-dimensional model representations, e.g., the ANOVA method and probabilistic collocation methods. A common feature of all these approaches is that they are reducible to the problem of computing the solution to high-dimensional equations via a sequence of low-dimensional problems. The effectiveness of the new algorithms is demonstrated in numerical examples involving nonlinear stochastic dynamical systems and partial differential equations, with up to 120 variables.

  12. Optimizing high performance computing workflow for protein functional annotation.

    PubMed

    Stanberry, Larissa; Rekepalli, Bhanu; Liu, Yuan; Giblock, Paul; Higdon, Roger; Montague, Elizabeth; Broomall, William; Kolker, Natali; Kolker, Eugene

    2014-09-10

    Functional annotation of newly sequenced genomes is one of the major challenges in modern biology. With modern sequencing technologies, the protein sequence universe is rapidly expanding. Newly sequenced bacterial genomes alone contain over 7.5 million proteins. The rate of data generation has far surpassed that of protein annotation. The volume of protein data makes manual curation infeasible, whereas a high compute cost limits the utility of existing automated approaches. In this work, we present an improved and optmized automated workflow to enable large-scale protein annotation. The workflow uses high performance computing architectures and a low complexity classification algorithm to assign proteins into existing clusters of orthologous groups of proteins. On the basis of the Position-Specific Iterative Basic Local Alignment Search Tool the algorithm ensures at least 80% specificity and sensitivity of the resulting classifications. The workflow utilizes highly scalable parallel applications for classification and sequence alignment. Using Extreme Science and Engineering Discovery Environment supercomputers, the workflow processed 1,200,000 newly sequenced bacterial proteins. With the rapid expansion of the protein sequence universe, the proposed workflow will enable scientists to annotate big genome data.

  13. Private Speech and executive functioning among high-functioning children with autistic spectrum disorders.

    PubMed

    Winsler, Adam; Abar, Beau; Feder, Michael A; Schunn, Christian D; Rubio, David Alarcón

    2007-10-01

    Private speech used by high-functioning children with autistic spectrum disorders (ASD) (n = 33) during two executive functioning tasks was compared to that of typically developing children (n = 28), and children with ADHD (n = 21). Children with ASD were as likely as others to talk to themselves and their speech was similarly relevant and likely to appear in moments of task difficulty. Unlike others, children with ASD were more likely to get items correct when they were talking than when they were silent. Group differences in performance were observed when children were silent but not when children were talking. Findings suggest that autistic children talk to themselves in relevant ways during problem-solving and that such speech is helpful in normalizing their executive performance relative to controls.

  14. Ocular infection with herpes simplex virus type 1: prevention of acute herpetic encephalitis by systemic administration of virus-specific antibody.

    PubMed

    Davis, W B; Taylor, J A; Oakes, J E

    1979-10-01

    The effects of virus-specific antibody on the pathogenesis of infection due to herpes simplex virus type 1 (HSV-1) following corneal inoculation of young adult mice were studied. HSV-1 was inoculated onto the corneal surface immediately after trephination with a capillary pipette. After inoculation, virus spread to the trigeminal ganglion and brain within two days and caused acute herpetic encephalitis, which killed infected animals eight to 10 days after infection. Rabbit hyperimmune antisera to HSV-1 were prepared, diluted to contain antibody at a titer of 1:150, and administered intraperitoneally to mice 8 hr after corneal infection. Administration of antisera did not interfere with the spread of HSV-1 from the site of infection to the trigeminal ganglion and brain but did reduce the multiplication of virus within the central nervous system. Reduction in viral replication resulted in complete recovery of the animals that were given antibody to HSV-1. however, the animals were not protected if they were irradiated with 390 rad 24 hr prior to administration of antibody. This observation suggested that antibody-mediated protection was not the result of in vivo neutralization of virus but instead required the presence of antibody as well as one or more radiation-sensitive components.

  15. Inter-laboratory evaluation of the performance parameters of a Lateral Flow Test device for the detection of Bluetongue virus-specific antibodies.

    PubMed

    Hanon, Jean-Baptiste; Vandenberge, Valerie; Deruelle, Matthias; De Leeuw, Ilse; De Clercq, Kris; Van Borm, Steven; Koenen, Frank; Liu, Lihong; Hoffmann, Bernd; Batten, Carrie Anne; Zientara, Stéphan; Breard, Emmanuel; Van der Stede, Yves

    2016-02-01

    Bluetongue (BT) is a viral vector-borne disease affecting domestic and wild ruminants worldwide. In this study, a commercial rapid immuno-chromatographic method or Lateral Flow Test (LFT) device, for the detection of BT virus-specific antibodies in animal serum, was evaluated in an international inter-laboratory proficiency test. The evaluation was done with sera samples of variable background (ruminant species, serotype, field samples, experimental infections, vaccinated animals). The diagnostic sensitivity was 100% (95% C.I. [90.5-100]) and the diagnostic specificity was 95.2% (95% C.I. [76.2-99.9]). The repeatability (accordance) and reproducibility (concordance) were 100% for seropositive samples but were lower for two of the seronegative samples (45% and 89% respectively). The analytical sensitivity, evaluated by testing positive sera at increasing dilutions was better for the BT LFT compared to some commercial ELISAs. Seroconversion of an infected sheep was detected at 4 days post infection. Analytical specificity was impaired by cross-reactions observed with some of the samples seropositive for Epizootic Haemorrhagic Disease Virus (EHDV). The agreement (Cohen's kappa) between the LFT and a commercial BT competitive ELISA was 0.79 (95% CI [0.62-0.95]). Based on these results, it can be concluded that the BT LFT device is a rapid and sensitive first-line serological test that can be used in the field, especially in areas endemic for the disease where there is a lack of diagnostic facilities.

  16. Retinol binding protein and vitamin D associations with serum antibody isotypes, serum influenza virus-specific neutralizing activities and airway cytokine profiles.

    PubMed

    Jones, B G; Oshansky, C M; Bajracharya, R; Tang, L; Sun, Y; Wong, S S; Webby, R; Thomas, P G; Hurwitz, J L

    2016-02-01

    Vitamin A supports the induction of immunoglobulin (Ig)A responses at mucosal surfaces in mice, but much less is known about the influence of vitamins on antibody isotype expression in humans. To address this knowledge gap, we examined 46 residual blood samples from adults and children, some of whom were experiencing influenza virus infections of the respiratory tract. Assays were performed for retinol binding protein (RBP, a surrogate for vitamin A), vitamin D (a related vitamin) and antibody isotypes. Results showed that all but two tested samples exhibited RBP and/or vitamin D insufficiencies or deficiencies. Vitamin D correlated with blood IgM and IgG3, while RBP correlated with IgG4 and IgA. RBP also correlated positively with age and with influenza virus-specific antibody neutralization titres. Individuals with low blood RBP levels exhibited the highest frequencies of over-expressed cytokines and growth factors in nasal wash samples, an indication of inflamed mucosal tissues. While cause-effect relationships were not discerned, results support a hypothesis that vitamins directly influence B cell isotype expression in humans, and by so doing may help protect mucosal surfaces from respiratory viral disease.

  17. Neuroimaging of the Functional and Structural Networks Underlying Visuospatial vs. Linguistic Reasoning in High-Functioning Autism

    ERIC Educational Resources Information Center

    Sahyoun, Cherif P.; Belliveau, John W.; Soulieres, Isabelle; Schwartz, Shira; Mody, Maria

    2010-01-01

    High-functioning individuals with autism have been found to favor visuospatial processing in the face of typically poor language abilities. We aimed to examine the neurobiological basis of this difference using functional magnetic resonance imaging and diffusion tensor imaging. We compared 12 children with high functioning autism (HFA) to 12 age-…

  18. High resolution functional photoacoustic tomography of breast cancer

    SciTech Connect

    Li, Xiaoqi; Yao, Lei; Xi, Lei; Jiang, Huabei; Heldermon, Coy D.

    2015-09-15

    Purpose: To evaluate the feasibility of functional photoacoustic tomography (fPAT) for high resolution detection and characterization of breast cancer and to demonstrate for the first time quantitative hemoglobin concentration and oxygen saturation images of breasts that were formed with model-based reconstruction of tomographic photoacoustic data. Methods: The study was HIPAA compliant and was approved by the university institutional review board. Written informed consents were obtained from all the participants. Ten cases, including six cancer and four healthy (mean age = 50 yr; age range = 41–66 yr), were examined. Functional images of breast tissue including absolute total hemoglobin concentration (Hb{sub T}) and oxygen saturation (StO{sub 2}%) were obtained by fPAT and cross validated with magnetic resonance imaging (MRI) readings and/or histopathology. Results: Hb{sub T} and StO{sub 2}% maps from all six pathology-confirmed cancer cases (60%) show clear detection of tumor, while MR images indicate clear detection of tumor for five of six cancer cases; one small tumor was read as near-complete-resolution by MRI. The average Hb{sub T} and StO{sub 2}% value of suspicious lesion area for the cancer cases was 61.6 ± 18.9 μM/l and 67.5% ± 5.2% compared to 25.6 ± 7.4 μM/l and 65.2% ± 3.8% for background normal tissue. Conclusions: fPAT has the potential to be a significant add-on in breast cancer detection and characterization as it provides submillimeter resolution functional images of breast lesions.

  19. A high precision semi-analytic mass function

    NASA Astrophysics Data System (ADS)

    Del Popolo, Antonino; Pace, Francesco; Le Delliou, Morgan

    2017-03-01

    In this paper, extending past works of Del Popolo, we show how a high precision mass function (MF) can be obtained using the excursion set approach and an improved barrier taking implicitly into account a non-zero cosmological constant, the angular momentum acquired by tidal interaction of proto-structures and dynamical friction. In the case of the ΛCDM paradigm, we find that our MF is in agreement at the 3% level to Klypin's Bolshoi simulation, in the mass range Mvir = 5 × 109 h‑1Msolar–‑5 × 1014 h‑1Msolar and redshift range 0 lesssim z lesssim 10. For z = 0 we also compared our MF to several fitting formulae, and found in particular agreement with Bhattacharya's within 3% in the mass range 1012–1016 h‑1Msolar. Moreover, we discuss our MF validity for different cosmologies.

  20. Highly efficient electroosmotic flow through functionalized carbon nanotube membranes

    NASA Astrophysics Data System (ADS)

    Wu, Ji; Gerstandt, Karen; Majumder, Mainak; Zhan, Xin; Hinds, Bruce J.

    2011-08-01

    Carbon nanotube membranes with inner diameter ranging from 1.5-7 nm were examined for enhanced electroosmotic flow. After functionalization via electrochemical diazonium grafting and carbodiimide coupling reaction, it was found that neutral caffeine molecules can be efficiently pumped via electroosmosis. An electroosmotic velocity as high as 0.16 cm s-1 V-1 has been observed. Power efficiencies were 25-110 fold improved compared to related nanoporous materials, which has important applications in chemical separations and compact medical devices. Nearly ideal electroosmotic flow was seen in the case where the mobile cation diameter nearly matched the inner diameter of the single-walled carbon nanotube resulting in a condition of using one ion is to pump one neutral molecule at equivalent concentrations.

  1. Emotion regulation in Asperger's syndrome and high-functioning autism.

    PubMed

    Samson, Andrea C; Huber, Oswald; Gross, James J

    2012-08-01

    It is generally thought that individuals with Asperger's syndrome and high-functioning autism (AS/HFA) have deficits in theory of mind. These deficits have been previously linked to problems with social cognition. However, we reasoned that AS/HFA individuals' Theory of Mind deficits also might lead to problems with emotion regulation. To assess emotional functioning in AS/HFA, 27 AS/HFA adults (16 women) and 27 age-, gender-, and education-matched typically developing (TD) participants completed a battery of measures of emotion experience, labeling, and regulation. With respect to emotion experience, individuals with AS/HFA reported higher levels of negative emotions, but similar levels of positive emotions, compared with TD individuals. With respect to emotion labeling, individuals with AS/HFA had greater difficulties identifying and describing their emotions, with approximately two-thirds exceeding the cutoff for alexithymia. With respect to emotion regulation, individuals with AS/HFA used reappraisal less frequently than TD individuals and reported lower levels of reappraisal self-efficacy. Although AS/HFA individuals used suppression more frequently than TD individuals, no difference in suppression self-efficacy was found. It is important to note that these differences in emotion regulation were evident even when controlling for emotion experience and labeling. Implications of these deficits are discussed, and future research directions are proposed.

  2. Functional approach to high-throughput plant growth analysis

    PubMed Central

    2013-01-01

    Method Taking advantage of the current rapid development in imaging systems and computer vision algorithms, we present HPGA, a high-throughput phenotyping platform for plant growth modeling and functional analysis, which produces better understanding of energy distribution in regards of the balance between growth and defense. HPGA has two components, PAE (Plant Area Estimation) and GMA (Growth Modeling and Analysis). In PAE, by taking the complex leaf overlap problem into consideration, the area of every plant is measured from top-view images in four steps. Given the abundant measurements obtained with PAE, in the second module GMA, a nonlinear growth model is applied to generate growth curves, followed by functional data analysis. Results Experimental results on model plant Arabidopsis thaliana show that, compared to an existing approach, HPGA reduces the error rate of measuring plant area by half. The application of HPGA on the cfq mutant plants under fluctuating light reveals the correlation between low photosynthetic rates and small plant area (compared to wild type), which raises a hypothesis that knocking out cfq changes the sensitivity of the energy distribution under fluctuating light conditions to repress leaf growth. Availability HPGA is available at http://www.msu.edu/~jinchen/HPGA. PMID:24565437

  3. Impact of high dose vitamin C on platelet function

    PubMed Central

    Mohammed, Bassem M; Sanford, Kimberly W; Fisher, Bernard J; Martin, Erika J; Contaifer Jr, Daniel; Warncke, Urszula Osinska; Wijesinghe, Dayanjan S; Chalfant, Charles E; Brophy, Donald F; Fowler III, Alpha A; Natarajan, Ramesh

    2017-01-01

    AIM To examine the effect of high doses of vitamin C (VitC) on ex vivo human platelets (PLTs). METHODS Platelet concentrates collected for therapeutic or prophylactic transfusions were exposed to: (1) normal saline (control); (2) 0.3 mmol/L VitC (Lo VitC); or (3) 3 mmol/L VitC (Hi VitC, final concentrations) and stored appropriately. The VitC additive was preservative-free buffered ascorbic acid in water, pH 5.5 to 7.0, adjusted with sodium bicarbonate and sodium hydroxide. The doses of VitC used here correspond to plasma VitC levels reported in recently completed clinical trials. Prior to supplementation, a baseline sample was collected for analysis. PLTs were sampled again on days 2, 5 and 8 and assayed for changes in PLT function by: Thromboelastography (TEG), for changes in viscoelastic properties; aggregometry, for PLT aggregation and adenosine triphosphate (ATP) secretion in response to collagen or adenosine diphosphate (ADP); and flow cytometry, for changes in expression of CD-31, CD41a, CD62p and CD63. In addition, PLT intracellular VitC content was measured using a fluorimetric assay for ascorbic acid and PLT poor plasma was used for plasma coagulation tests [prothrombin time (PT), partial thrombplastin time (PTT), functional fibrinogen] and Lipidomics analysis (UPLC ESI-MS/MS). RESULTS VitC supplementation significantly increased PLTs intracellular ascorbic acid levels from 1.2 mmol/L at baseline to 3.2 mmol/L (Lo VitC) and 15.7 mmol/L (Hi VitC, P < 0.05). VitC supplementation did not significantly change PT and PTT values, or functional fibrinogen levels over the 8 d exposure period (P > 0.05). PLT function assayed by TEG, aggregometry and flow cytometry was not significantly altered by Lo or Hi VitC for up to 5 d. However, PLTs exposed to 3 mmol/L VitC for 8 d demonstrated significantly increased R and K times by TEG and a decrease in the α-angle (P < 0.05). There was also a fall of 20 mm in maximum amplitude associated with the Hi VitC compared to

  4. Alternative Effector-Function Profiling Identifies Broad HIV-Specific T-Cell Responses in Highly HIV-Exposed Individuals Who Remain Uninfected

    PubMed Central

    Ruiz-Riol, Marta; Llano, Anuska; Ibarrondo, Javier; Zamarreño, Jennifer; Yusim, Karina; Bach, Vanessa; Mothe, Beatriz; Perez-Alvarez, Susana; Fernandez, Marco A.; Requena, Gerard; Meulbroek, Michael; Pujol, Ferran; Leon, Agathe; Cobarsi, Patricia; Korber, Bette T.; Clotet, Bonaventura; Ganoza, Carmela; Sanchez, Jorge; Coll, Josep; Brander, Christian

    2015-01-01

    The characterization of host immune responses to human immunodeficiency virus (HIV) in HIV controllers and individuals with high exposure but seronegativity to HIV (HESN) is needed to guide the development of effective preventive and therapeutic vaccine candidates. However, several technical hurdles severely limit the definition of an effective virus-specific T-cell response. By using a toggle-peptide approach, which takes HIV sequence diversity into account, and a novel, boosted cytokine staining/flow cytometry strategy, we here describe new patterns of T-cell responses to HIV that would be missed by standard assays. Importantly, this approach also allows detection of broad and strong virus-specific T-cell responses in HESN individuals that are characterized by a T-helper type 1 cytokine–like effector profile and produce cytokines that have been associated with potential control of HIV infection, including interleukin 10, interleukin 13, and interleukin 22. These results establish a novel approach to improve the current understanding of HIV-specific T-cell immunity and identify cellular immune responses and individual cytokines as potential markers of relative HIV resistance. As such, the findings also help develop similar strategies for more-comprehensive assessments of host immune responses to other human infections and immune-mediated disorders. PMID:25249264

  5. Alternative effector-function profiling identifies broad HIV-specific T-cell responses in highly HIV-exposed individuals who remain uninfected.

    PubMed

    Ruiz-Riol, Marta; Llano, Anuska; Ibarrondo, Javier; Zamarreño, Jennifer; Yusim, Karina; Bach, Vanessa; Mothe, Beatriz; Perez-Alvarez, Susana; Fernandez, Marco A; Requena, Gerard; Meulbroek, Michael; Pujol, Ferran; Leon, Agathe; Cobarsi, Patricia; Korber, Bette T; Clotet, Bonaventura; Ganoza, Carmela; Sanchez, Jorge; Coll, Josep; Brander, Christian

    2015-03-15

    The characterization of host immune responses to human immunodeficiency virus (HIV) in HIV controllers and individuals with high exposure but seronegativity to HIV (HESN) is needed to guide the development of effective preventive and therapeutic vaccine candidates. However, several technical hurdles severely limit the definition of an effective virus-specific T-cell response. By using a toggle-peptide approach, which takes HIV sequence diversity into account, and a novel, boosted cytokine staining/flow cytometry strategy, we here describe new patterns of T-cell responses to HIV that would be missed by standard assays. Importantly, this approach also allows detection of broad and strong virus-specific T-cell responses in HESN individuals that are characterized by a T-helper type 1 cytokine-like effector profile and produce cytokines that have been associated with potential control of HIV infection, including interleukin 10, interleukin 13, and interleukin 22. These results establish a novel approach to improve the current understanding of HIV-specific T-cell immunity and identify cellular immune responses and individual cytokines as potential markers of relative HIV resistance. As such, the findings also help develop similar strategies for more-comprehensive assessments of host immune responses to other human infections and immune-mediated disorders.

  6. Impact of structure and functionality of core polyol in highly functional biobased epoxy resins.

    PubMed

    Pan, Xiao; Webster, Dean C

    2011-09-01

    Highly functional biobased epoxy resins were prepared using dipentaerythritol (DPE), tripentaerythritol (TPE), and sucrose as core polyols that were substituted with epoxidized soybean oil fatty acids, and the impact of structure and functionality of the core polyol on the properties of the macromolecular resins and their epoxy-anhydride thermosets was explored. The chemical structures, functional groups, molecular weights, and compositions of epoxies were characterized using nuclear magnetic resonance (NMR) spectroscopy, Fourier-transform infrared (FTIR) spectroscopy, gel permeation chromatography (GPC), and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI MS). The epoxies were also studied for their bulk viscosity, intrinsic viscosity, and density. Crosslinked with dodecenyl succinic anhydride (DDSA), epoxy-anhydride thermosets were evaluated using differential scanning calorimetry (DSC), dynamic mechanical analysis (DMA), tensile tests, and tests of coating properties. Epoxidized soybean oil (ESO) was used as a control. Overall, the sucrose-based thermosets exhibited the highest moduli, having the most rigid and ductile performance while maintaining the highest biobased content. DPE/TPE-based thermosets showed modestly better thermosetting performance than the control ESO thermoset.

  7. Vestibulo-ocular reflex function in children with high-functioning autism spectrum disorders.

    PubMed

    Carson, Tana B; Wilkes, Bradley J; Patel, Kunal; Pineda, Jill L; Ko, Ji H; Newell, Karl M; Bodfish, James W; Schubert, Michael C; Radonovich, Krestin; White, Keith D; Lewis, Mark H

    2017-02-01

    Sensorimotor processing alterations are a growing focus in the assessment and treatment of Autism Spectrum Disorders (ASD). The rotational vestibulo-ocular reflex (rVOR), which functions to maintain stable vision during head movements, is a sensorimotor system that may be useful in understanding such alterations and their underlying neurobiology. In this study, we assessed post-rotary nystagmus elicited by continuous whole body rotation among children with high-functioning ASD and typically developing children. Children with ASD exhibited increased rVOR gain, the ratio of eye velocity to head velocity, indicating a possible lack of cerebellar inhibitory input to brainstem vestibular nuclei in this population. The ASD group also showed less regular or periodic horizontal eye movements as indexed by greater variance accounted for by multiple higher frequency bandwidths as well as greater entropy scores compared to typically developing children. The decreased regularity or dysrhythmia in the temporal structure of nystagmus beats in children with ASD may be due to alterations in cerebellum and brainstem circuitry. These findings could potentially serve as a model to better understand the functional effects of differences in these brain structures in ASD. Autism Res 2017, 10: 251-266. © 2016 International Society for Autism Research, Wiley Periodicals, Inc.

  8. Lift outs: how to acquire a high-functioning team.

    PubMed

    Groysberg, Boris; Abrahams, Robin

    2006-12-01

    More and more, expanding companies are hiring high-functioning groups of people who have been working together effectively within one company and can rapidly come up to speed in a new environment. These lifted-out teams don't need to get acquainted with one another or to establish shared values, mutual accountability, or group norms; their long-standing relationships and trust help them make an impact very quickly. Of course, the process is not without risks: A failed lift out can lead to loss of money, opportunity, credibility, and even native talent. Boris Groysberg and Robin Abrahams studied more than 40 high-profile moves and interviewed team leaders in multiple industries and countries to examine the risks and opportunities that lift outs present. They concluded that, regardless of industry, nationality, or size of the team, a successful lift out unfolds over four consecutive, interdependent stages that must be meticulously managed. In the courtship stage, the hiring company and the leader of the targeted team determine whether the proposed move is, in fact, a good idea, and then define their business goals and discuss strategies. At the same time, the team leader discusses the potential move with the other members of his or her group to assess their level of interest and prepare them for the change. The second stage involves the integration of the team leader with the new company's top leadership. This part of the process ensures the team's access to senior executives-the most important factor in a lift out's success. Operational integration is the focus of the third stage. Ideally, teams will start out working with the same or similar clients, vendors, and industry standards. The fourth stage entails full cultural integration. To succeed, the lifted-out team members must be willing to re-earn credibility by proving their value and winning their new colleagues' trust.

  9. Filariae-Retrovirus Co-infection in Mice is Associated with Suppressed Virus-Specific IgG Immune Response and Higher Viral Loads

    PubMed Central

    Dietze, Kirsten Katrin; Dittmer, Ulf; Koudaimi, Daniel Karim; Schimmer, Simone; Reitz, Martina

    2016-01-01

    Worldwide more than 2 billion people are infected with helminths, predominantly in developing countries. Co-infections with viruses such as human immunodeficiency virus (HIV) are common due to the geographical overlap of these pathogens. Helminth and viral infections induce antagonistic cytokine responses in their hosts. Helminths shift the immune system to a type 2-dominated immune response, while viral infections skew the cytokine response towards a type 1 immune response. Moreover, chronic helminth infections are often associated with a generalized suppression of the immune system leading to prolonged parasite survival, and also to a reduced defence against unrelated pathogens. To test whether helminths affect the outcome of a viral infection we set up a filarial/retrovirus co-infection model in C57BL/6 mice. Although Friend virus (FV) infection altered the L. sigmodontis-specific immunoglobulin response towards a type I associated IgG2 isotype in co-infected mice, control of L. sigmodontis infection was not affected by a FV-superinfection. However, reciprocal control of FV infection was clearly impaired by concurrent L. sigmodontis infection. Spleen weight as an indicator of pathology and viral loads in spleen, lymph nodes (LN) and bone marrow (BM) were increased in L. sigmodontis/FV-co-infected mice compared to only FV-infected mice. Numbers of FV-specific CD8+ T cells as well as cytokine production by CD4+ and CD8+ cells were alike in co-infected and FV-infected mice. Increased viral loads in co-infected mice were associated with reduced titres of neutralising FV-specific IgG2b and IgG2c antibodies. In summary our findings suggest that helminth infection interfered with the control of retroviral infection by dampening the virus-specific neutralising antibody response. PMID:27923052

  10. The functionality and cost advantages of high-performance polymers.

    PubMed

    Young, Mark

    2003-09-01

    Acetals remain extremely important for medical devices, particularly in gears, springs and other mechanisms, although going forward with progressively lower emission targets is likely to require a combination of low-emission grades and tighter processing controls. Nylon and PBT materials have a continued importance in achieving the combination of mechanical performance, biocompatibility (a range of grades are available that have been tested successfully against USP 23 Class VI) and sterilisation performance (dependent on grade and type of sterilisation). Materials such as liquid crystal polymer are progressively more important for their barrier properties, high temperature performance and all-round sterilisation performance. Polycarbonates and cyclic olefin copolymers continue to find new applications, often where clarity is important; transparent Nylons and other olefinic materials are also valuable in this area. With the continuing advances in raw materials and polymer processes, careful choices can produce some worthy advances in device technology, although utilising the technologies effectively still depends on working forwards from the user/patient need and desired functionality. Whether considering developing a new device using plastics, or reconsidering further development of an existing device, engineering polymers can provide the key to something better.

  11. Lexical and Affective Prosody in Children with High Functioning Autism

    PubMed Central

    Grossman, Ruth B.; Bemis, Rhyannon H.; Skwerer, Daniela Plesa; Tager-Flusberg, Helen

    2012-01-01

    Purpose We investigated perception and production of lexical stress and processing of affective prosody in adolescents with high functioning autism (HFA). We hypothesized preserved processing of lexical and affective prosody, but atypical lexical prosody production. Method 16 children with HFA and 15 typically developing (TD) peers participated in three experiments: 1. Perception of affective prosody, 2. Lexical stress perception, 3. Lexical stress production. In Experiment 1, participants labeled sad, happy, and neutral spoken sentences that were low-pass filtered, to eliminate verbal content. In Experiment 2 participants disambiguated word meanings based on lexical stress (HOTdog, vs. hotDOG). In Experiment 3 participants produced these words in a sentence completion task. Productions were analyzed using acoustic measures. Results Accuracy levels showed no group differences. Participants with HFA could determine affect from filtered sentences and disambiguate words based on lexical stress. They produced appropriately differentiated lexical stress patterns but demonstrated atypically long productions indicating reduced ability in natural prosody production. Conclusions Children with HFA were as capable as their TD peers in receptive tasks of lexical stress and affective prosody. Prosody productions were atypically long, despite accurate differentiation of lexical stress patterns. Future research should use larger samples and spontaneous vs. elicited productions. PMID:20530388

  12. Speech-and-gesture integration in high functioning autism.

    PubMed

    Silverman, Laura B; Bennetto, Loisa; Campana, Ellen; Tanenhaus, Michael K

    2010-06-01

    This study examined iconic gesture comprehension in autism, with the goal of assessing whether cross-modal processing difficulties impede speech-and-gesture integration. Participants were 19 adolescents with high functioning autism (HFA) and 20 typical controls matched on age, gender, verbal IQ, and socio-economic status (SES). Gesture comprehension was assessed via quantitative analyses of visual fixations during a video-based task, using the visual world paradigm. Participants' eye movements were recorded while they watched videos of a person describing one of four shapes shown on a computer screen, using speech-and-gesture or speech-only descriptions. Participants clicked on the shape that the speaker described. Since gesture naturally precedes speech, earlier visual fixations to the target shape during speech-and-gesture compared to speech-only trials, would suggest immediate integration of auditory and visual information. Analyses of eye movements supported this pattern in control participants but not in individuals with autism: iconic gestures facilitated comprehension in typical individuals, while it hindered comprehension in those with autism. Cross-modal processing difficulties in autism were not accounted for by impaired unimodal speech or gesture processing. The results have important implications for the treatment of children and adults with this disorder.

  13. UVUDF: UV Luminosity Functions at the Cosmic High Noon

    NASA Astrophysics Data System (ADS)

    Mehta, Vihang; Scarlata, Claudia; Rafelski, Marc; Gburek, Timothy; Teplitz, Harry I.; Alavi, Anahita; Boylan-Kolchin, Michael; Finkelstein, Steven; Gardner, Jonathan P.; Grogin, Norman; Koekemoer, Anton; Kurczynski, Peter; Siana, Brian; Codoreanu, Alex; de Mello, Duilia F.; Lee, Kyoung-Soo; Soto, Emmaris

    2017-03-01

    We present the rest-1500 Å UV luminosity functions (LF) for star-forming galaxies during the cosmic high noon—the peak of cosmic star formation rate at 1.5< z< 3. We use deep NUV imaging data obtained as part of the Hubble Ultra-Violet Ultra Deep Field (UVUDF) program, along with existing deep optical and NIR coverage on the HUDF. We select F225W, F275W, and F336W dropout samples using the Lyman break technique, along with samples in the corresponding redshift ranges selected using photometric redshifts, and measure the rest-frame UV LF at z∼ 1.7,2.2,3.0, respectively, using the modified maximum likelihood estimator. We perform simulations to quantify the survey and sample incompleteness for the UVUDF samples to correct the effective volume calculations for the LF. We select galaxies down to {M}{UV}=-15.9,-16.3,-16.8 and fit a faint-end slope of α =-{1.20}-0.13+0.10,-{1.32}-0.14+0.10,-{1.39}-0.12+0.08 at 1.4< z< 1.9, 1.8< z< 2.6, and 2.4< z< 3.6, respectively. We compare the star formation properties of z∼ 2 galaxies from these UV observations with results from Hα and UV+IR observations. We find a lack of high-SFR sources in the UV LF compared to the Hα and UV+IR, likely due to dusty SFGs not being properly accounted for by the generic {IRX}{--}β relation used to correct for dust. We compute a volume-averaged UV-to-Hα ratio by abundance matching the rest-frame UV LF and Hα LF. We find an increasing UV-to-Hα ratio toward low-mass galaxies ({M}\\star ≲ 5× {10}9 {M}ȯ ). We conclude that this could be due to a larger contribution from starbursting galaxies compared to the high-mass end.

  14. New Generation Nuclear Plant -- High Level Functions and Requirements

    SciTech Connect

    J. M. Ryskamp; E. J. Gorski; E. A. Harvego; S. T. Khericha; G. A. Beitel

    2003-09-01

    This functions and requirements (F&R) document was prepared for the Next Generation Nuclear Plant (NGNP) Project. The highest-level functions and requirements for the NGNP preconceptual design are identified in this document, which establishes performance definitions for what the NGNP will achieve. NGNP designs will be developed based on these requirements by commercial vendor(s).

  15. Functionalized graphene hydrogel-based high-performance supercapacitors.

    PubMed

    Xu, Yuxi; Lin, Zhaoyang; Huang, Xiaoqing; Wang, Yang; Huang, Yu; Duan, Xiangfeng

    2013-10-25

    Functionalized graphene hydrogels are prepared by a one-step low-temperature reduction process and exhibit ultrahigh specific capacitances and excellent cycling stability in the aqueous electrolyte. Flexible solid-state supercapacitors based on functionalized graphene hydrogels are demonstrated with superior capacitive performances and extraordinary mechanical flexibility.

  16. A Multi-Agent Alphavirus DNA Vaccine Delivered by Intramuscular Electroporation Elicits Robust and Durable Virus Specific Immune Responses in Mice and Rabbits and Completely Protects Mice against Lethal Venezuelan, Western, and Eastern Equine Encephalitis Virus Aerosol Challenges

    DTIC Science & Technology

    2016-07-26

    A Multi-Agent Alphavirus DNA Vaccine Delivered by Intramuscular Electroporation Elicits 1 Robust and Durable Virus-Specific Immune Responses in Mice...Agent Alphavirus DNA Vaccine Protects Mice 12 13 #Address correspondence to Lesley C. Dupuy, lesley.c.dupuy.ctr@mail.mil. 14 *Present address...virus (VEEV) DNA vaccine 21 that was optimized for increased antigen expression and delivered by intramuscular (IM) 22 electroporation (EP) elicits

  17. Japanese encephalitis protein vaccine candidates expressing neutralizing epitope and M.T hsp70 induce virus-specific memory B cells and long-lasting antibodies in swine.

    PubMed

    Fei-fei, Ge; Jian, Wang; Feng, Xu; Li-ping, Sheng; Quan-yun, Sun; Jin-ping, Zhou; Pu-yan, Chen; Pei-hong, Liu

    2008-10-16

    Swine are an important amplifier of Japanese encephalitis (JE) virus in the paradomestic environment. In this study, two JE protein vaccine candidates were evaluated for immunogenicity in swine. Both vaccine plasmids are based on a prokaryotic vector pET-32a(+). One plasmid, designated pET-32a(+)-epitope, encode a cassette consisting of a neutralizing epitope on envelope (E) protein of JE virus, whereas the other plasmid, designated pET-32a(+)-epitope-hsp70, express the fusion protein of the epitope and M.T hsp70. Some differences were detected in the immunogenicity of these two proteins in swine. Swine immunized twice with 2000pmol of the neutralizing epitope or the fusion protein developed neutralizing antibody titers of respectively, 154 and 300, and anti-neutralizing epitope antibody titers of 10(4.25) and 10(6.0) by 3 weeks after the second immunization. In addition, swine immunized with the neutralizing epitope emulsified with adjuvant S206 or with imported mineral oil and Tween-80 induced neutralizing antibody titers of 196 and 244, and anti-neutralizing epitope antibody titers of 10(5.25) or 10(5.6) at the same time point. However, swine administered two doses of a commercial JE vaccine (attenuated virus preparation; JEV SA14-14-2 strain) developed less favorable antibody responses with neutralizing antibody titer 40 and anti-neutralizing epitope antibody titers 10(3.7). The anamnestic response was followed by monitoring titers 1 week after boosting with a viral antigen; swine immunized twice with the fusion protein showed a 177-fold increase in anti-neutralizing epitope titer, indicating a strong recall of the antibody response. The animals maintained detectable levels of anti-neutralizing epitope antibody for at least 105 days after two immunizations, indicating that these four protein antigens are able to stimulate virus-specific memory B cells and long-lasting antibodies at higher levels than is achieved using a current commercial attenuated JEV vaccine

  18. High Precision Prediction of Functional Sites in Protein Structures

    PubMed Central

    Buturovic, Ljubomir; Wong, Mike; Tang, Grace W.; Altman, Russ B.; Petkovic, Dragutin

    2014-01-01

    We address the problem of assigning biological function to solved protein structures. Computational tools play a critical role in identifying potential active sites and informing screening decisions for further lab analysis. A critical parameter in the practical application of computational methods is the precision, or positive predictive value. Precision measures the level of confidence the user should have in a particular computed functional assignment. Low precision annotations lead to futile laboratory investigations and waste scarce research resources. In this paper we describe an advanced version of the protein function annotation system FEATURE, which achieved 99% precision and average recall of 95% across 20 representative functional sites. The system uses a Support Vector Machine classifier operating on the microenvironment of physicochemical features around an amino acid. We also compared performance of our method with state-of-the-art sequence-level annotator Pfam in terms of precision, recall and localization. To our knowledge, no other functional site annotator has been rigorously evaluated against these key criteria. The software and predictive models are incorporated into the WebFEATURE service at http://feature.stanford.edu/wf4.0-beta. PMID:24632601

  19. Peak functions for modeling high resolution soil profile data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Parametric and non-parametric depth functions have been used to estimate continuous soil profile properties. However, some soil properties, such as those seen in weathered loess, have complex peaked and anisotropic depth distributions. These distributions are poorly handled by common parametric func...

  20. Highly energetic compositions based on functionalized carbon nanomaterials.

    PubMed

    Yan, Qi-Long; Gozin, Michael; Zhao, Feng-Qi; Cohen, Adva; Pang, Si-Ping

    2016-03-07

    In recent years, research in the field of carbon nanomaterials (CNMs), such as fullerenes, expanded graphite (EG), carbon nanotubes (CNTs), graphene, and graphene oxide (GO), has been widely used in energy storage, electronics, catalysts, and biomaterials, as well as medical applications. Regarding energy storage, one of the most important research directions is the development of CNMs as carriers of energetic components by coating or encapsulation, thus forming safer advanced nanostructures with better performances. Moreover, some CNMs can also be functionalized to become energetic additives. This review article covers updated preparation methods for the aforementioned CNMs, with a more specific orientation towards the use of these nanomaterials in energetic compositions. The effects of these functionalized CNMs on thermal decomposition, ignition, combustion and the reactivity properties of energetic compositions are significant and are discussed in detail. It has been shown that the use of functionalized CNMs in energetic compositions greatly improves their combustion performances, thermal stability and sensitivity. In particular, functionalized fullerenes, CNTs and GO are the most appropriate candidate components in nanothermites, solid propellants and gas generators, due to their superior catalytic properties as well as facile preparation methods.

  1. Highly energetic compositions based on functionalized carbon nanomaterials

    NASA Astrophysics Data System (ADS)

    Yan, Qi-Long; Gozin, Michael; Zhao, Feng-Qi; Cohen, Adva; Pang, Si-Ping

    2016-02-01

    In recent years, research in the field of carbon nanomaterials (CNMs), such as fullerenes, expanded graphite (EG), carbon nanotubes (CNTs), graphene, and graphene oxide (GO), has been widely used in energy storage, electronics, catalysts, and biomaterials, as well as medical applications. Regarding energy storage, one of the most important research directions is the development of CNMs as carriers of energetic components by coating or encapsulation, thus forming safer advanced nanostructures with better performances. Moreover, some CNMs can also be functionalized to become energetic additives. This review article covers updated preparation methods for the aforementioned CNMs, with a more specific orientation towards the use of these nanomaterials in energetic compositions. The effects of these functionalized CNMs on thermal decomposition, ignition, combustion and the reactivity properties of energetic compositions are significant and are discussed in detail. It has been shown that the use of functionalized CNMs in energetic compositions greatly improves their combustion performances, thermal stability and sensitivity. In particular, functionalized fullerenes, CNTs and GO are the most appropriate candidate components in nanothermites, solid propellants and gas generators, due to their superior catalytic properties as well as facile preparation methods.

  2. Maternal Recurrent Mood Disorders and High-Functioning Autism

    ERIC Educational Resources Information Center

    Cohen, Ira L.; Tsiouris, John A.

    2006-01-01

    A quantitative examination was made of the association of parental mood and anxiety disorders with severity of disability within a large sample of young children with Pervasive Developmental Disorder (PDD). Maternal recurrent mood disorders were associated with elevated cognitive and adaptive functioning in their affected children, parent reports…

  3. Impact of IQ Discrepancy on Executive Function in High-Functioning Autism: Insight into Twice Exceptionality

    ERIC Educational Resources Information Center

    Kalbfleisch, M. Layne; Loughan, Ashlee R.

    2012-01-01

    We examined the impact of IQ discrepancy (IQD) within (1) and above (1+) one standard deviation on executive function in HFA using the BRIEF. We hypothesized that IQD would benefit executive function. IQD 1 is hallmarked by deficits in BRIEF indices and subscales inhibit, shift, initiate, working memory, planning and organization, and monitor…

  4. Signed-Digit High Speed Transcendental Function Processor Architecture

    DTIC Science & Technology

    1989-06-01

    carry - select adder . A carry - select adder is used to...maximum value of their sum is Tmax + Xm,. = 9 + 1 = 10. The addition is accomplished by using the same carry - select adder described in the preceding...8217 from A by using the functions Ko = (A, xor A 4) and (73 or A4) 5-4 SIGNED-DIGIT INPUT A DIGIT B DIGIT 5-BIT CARRY - SELECT ADDER CARRY OUT 2 BIT

  5. A correction to a highly accurate voight function algorithm

    NASA Technical Reports Server (NTRS)

    Shippony, Z.; Read, W. G.

    2002-01-01

    An algorithm for rapidly computing the complex Voigt function was published by Shippony and Read. Its claimed accuracy was 1 part in 10^8. It was brought to our attention by Wells that Shippony and Read was not meeting its claimed accuracy for extremely small but non zero y values. Although true, the fix to the code is so trivial to warrant this note for those who use this algorithm.

  6. Highly Conductive Aromatic Functionalized Multi-Walled Carbon Nanotube for Inkjet Printable High Performance Supercapacitor Electrodes

    PubMed Central

    Attri, Pankaj

    2015-01-01

    We report the functionalization of multiwalled carbon nanotubes (MWCNT) via the 1,3-dipolar [3+2] cycloaddition of aromatic azides, which resulted in a detangled CNT as shown by transmission electron microscopy (TEM). Carboxylic moieties (-COOH) on aromatic azide result in highly stable aqueous dispersion (max. conc. ~ 10 mg/mL H2O), making the suitable for inkjet printing. Printed patterns on polyethylene terephthalate (PET) flexible substrate exhibit low sheet resistivity ~65 Ω. cm, which is attributed to enhanced conductivity. Fabricated Supercapacitors (SC) assembled using these printed substrates exhibit good electrochemical performance in organic as well as aqueous electrolytes. High energy and power density (57.8 Wh/kg and 0.85 kW/kg) in 1M H2SO4 aqueous electrolyte demonstrate the excellent performance of the proposed supercapacitor. Capacitive retention varies from ~85–94% with columbic efficiency ~95% after 1000 charge/discharge cycles in different electrolytes, demonstrating the excellent potential of the device for futuristic power applications. PMID:26153688

  7. High-performance functional ecopolymers based on flora and fauna.

    PubMed

    Kaneko, Tatsuo

    2007-01-01

    Liquid crystalline (LC) polymers of rigid monomers based on flora and fauna were prepared by in-bulk polymerization. Para-coumaric (p-coumaric) acid [4-hydroxycinnamic acid (4HCA)] and its derivatives were selected as phytomonomers and bile acids were selected as biomonomers. The 4HCA homopolymer showed a thermotropic LC phase only in a state of low molecular weight. The copolymers of 4HCA with bile acids such as lithocholic acid (LCA) and cholic acid (CA) showed excellent cell compatibilities but low molecular weights. However, P(4HCA-co-CA)s allowed LC spinning to create molecularly oriented biofibers, presumably due to the chain entanglement that occurs during in-bulk chain propagation into hyperbranching architecture. P[4HCA-co-3,4-dihydroxycinnamic acid (DHCA)]s showed high molecular weight, high mechanical strength, high Young's modulus, and high softening temperature, which may be achieved through the entanglement by in-bulk formation of hyperbranching, rigid structures. P(4HCA-co-DHCA)s showed a smooth hydrolysis, in-soil degradation, and photo-tunable hydrolysis. Thus, P(4HCA-co-DHCA)s might be applied as an environmentally degradable plastic with extremely high performance.

  8. Highly deoxynivalenol contaminated oats and immune function in horses.

    PubMed

    Khol-Parisini, Annabella; Hellweg, Petra; Razzazi-Fazeli, Ebrahim; Saalmüller, Armin; Strasser, Alois; Tichy, Alexander; Zenteke, Jürgen

    2012-04-01

    The aim of the present study was to investigate the impact of deoxynivalenol (DON) on cellular and humoral immune parameters in horses. A feeding trial using naturally contaminated oats with high (20.2 mg/kg) and low (0.49 mg/kg) levels of DON was conducted. Two groups of five mares were fed 2 kg oats daily with high or low DON levels for two weeks, using a crossover design with a three-week wash-out period. No adverse effects on general health were observed. Only minor diet-related changes in differential blood counts and serum biochemistry were noted. Serum haptoglobin concentration was significantly elevated after feeding DON (p = 0.04). Lymphocyte subsets (CD4+ CD8+, CD2+, CD21+, MHCII+) and lymphocyte proliferation data (concanavalin A, phytohemagglutinin, pokeweed mitogen) were not different between feeding-groups. It can be concluded that daily DON intakes as high as 6.9 to 9.5 mg/100 kg BW appear to have no major impact on the measured immune response of horses, indicating that this species has a high tolerance for DON.

  9. Impact of IQ discrepancy on executive function in high-functioning autism: insight into twice exceptionality.

    PubMed

    Kalbfleisch, M Layne; Loughan, Ashlee R

    2012-03-01

    We examined the impact of IQ discrepancy (IQD) within (1) and above (1+) one standard deviation on executive function in HFA using the BRIEF. We hypothesized that IQD would benefit executive function. IQD 1 is hallmarked by deficits in BRIEF indices and subscales inhibit, shift, initiate, working memory, planning and organization, and monitor (MANCOVA, p < .003, corrected). As IQD increases to 1+, deficits are fewer, corresponding to subscales inhibit, shift, and initiate. Pearson correlations (p < .004, corrected) identify significant relationships for FSIQ and BRIEF Global Composite (r = -.66, p = .002) and Metacognition subscales plan/organize (r = -.64, p = .003) and monitor (r = -.63, p = .004). Results suggest IQD 1+ favoring verbal IQ may support these aspects of executive function in HFA.

  10. Highly reflective polymeric substrates functionalized utilizing atomic layer deposition

    NASA Astrophysics Data System (ADS)

    Zuzuarregui, Ana; Coto, Borja; Rodríguez, Jorge; Gregorczyk, Keith E.; Ruiz de Gopegui, Unai; Barriga, Javier; Knez, Mato

    2015-08-01

    Reflective surfaces are one of the key elements of solar plants to concentrate energy in the receivers of solar thermal electricity plants. Polymeric substrates are being considered as an alternative to the widely used glass mirrors due to their intrinsic and processing advantages, but optimizing both the reflectance and the physical stability of polymeric mirrors still poses technological difficulties. In this work, polymeric surfaces have been functionalized with ceramic thin-films by atomic layer deposition. The characterization and optimization of the parameters involved in the process resulted in surfaces with a reflection index of 97%, turning polymers into a real alternative to glass substrates. The solution we present here can be easily applied in further technological areas where seemingly incompatible combinations of polymeric substrates and ceramic coatings occur.

  11. Highly reflective polymeric substrates functionalized utilizing atomic layer deposition

    SciTech Connect

    Zuzuarregui, Ana Gregorczyk, Keith E.; Coto, Borja; Ruiz de Gopegui, Unai; Barriga, Javier; Rodríguez, Jorge; Knez, Mato

    2015-08-10

    Reflective surfaces are one of the key elements of solar plants to concentrate energy in the receivers of solar thermal electricity plants. Polymeric substrates are being considered as an alternative to the widely used glass mirrors due to their intrinsic and processing advantages, but optimizing both the reflectance and the physical stability of polymeric mirrors still poses technological difficulties. In this work, polymeric surfaces have been functionalized with ceramic thin-films by atomic layer deposition. The characterization and optimization of the parameters involved in the process resulted in surfaces with a reflection index of 97%, turning polymers into a real alternative to glass substrates. The solution we present here can be easily applied in further technological areas where seemingly incompatible combinations of polymeric substrates and ceramic coatings occur.

  12. A Functional High-Throughput Assay of Myelination in Vitro

    DTIC Science & Technology

    2014-07-01

    Human induced pluripotent stem cells , hydrogels, 3D culture, electrophysiology, high-throughput assay 16. SECURITY CLASSIFICATION OF: 17...clear that four of the seven human astrocyte cell lines (HA #1, 2, 3, and 7) show very large amounts of neuronal differentiation when using epigenetic...derived.   5    Fig. 1: Spontaneous differentiation toward neuronal lineage of iPS cells derived from human astrocytes. Left: phase contrast

  13. Social functioning using direct and indirect measures with children with High Functioning Autism, nonverbal learning disability, and typically developing children.

    PubMed

    Semrud-Clikeman, Margaret; Fine, Jodene Goldenring; Bledsoe, Jesse

    2016-01-01

    Social perception is an important underlying foundation for emotional development and overall adaptation. The majority of studies with children with High Functioning Autism (HFA) or nonverbal learning disabilities (NLD) evaluating social functioning have used measures of parent and/or teacher ratings. The present study utilized parent and teacher ratings of behavior as well as executive functioning in addition to direct measures of social perception. Three groups participated in this study (control [n = 38] HFA [n = 36], NLD [n = 31]). Results indicated that the HFA group experienced the most difficulty understanding emotional cues on the direct measure while both the HFA and NLD groups experienced difficulty with nonverbal cues. Significant difficulties were reported on the parent rating scale for sadness and social withdrawal for both clinical groups. Executive functioning was found to be particularly problematic for the clinical groups. The direct social perception measure was highly correlated with the measures of executive functioning and reflects the contribution that executive functions have on social functioning. These findings suggest that the clinical presentation on behavior rating scales may be very similar for children with HFA and NLD. Moreover, it appears that measures of executive functioning are sensitive to the clinical difficulties these groups experience. The findings also suggest there is a commonality in these disorders that warrants further investigation.

  14. A functional protein retention and release multilayer with high stability

    NASA Astrophysics Data System (ADS)

    Nie, Kun; An, Qi; Zhang, Yihe

    2016-04-01

    Effective and robust interfacial protein retention lies at the heart of the fabrication of protein-based functional interfaces, which is potentially applicable in catalysis, medical therapy, antifouling, and smart devices, but remains challenging due to the sensitive nature of proteins. This study reports a general protein retention strategy to spatial-temporally confine various types of proteins at interfacial regions. The proteins were preserved in mesoporous silica nanoparticles embedded in covalently woven multilayers. It is worth noting that the protein retention strategy effectively preserves the catalytic capabilities of the proteins, and the multilayer structure is robust enough to withstand the bubbling catalytic reactions and could be repeatedly used due to conservation of proteins. The spatiotemporal retention of proteins could be adjusted by varying the number of capping layers. Furthermore, we demonstrate that the protein-loaded interfacial layers could not only be used to construct catalytic-active interfaces, but also be integrated as the power-generating unit to propel a macroscopic floating device.Effective and robust interfacial protein retention lies at the heart of the fabrication of protein-based functional interfaces, which is potentially applicable in catalysis, medical therapy, antifouling, and smart devices, but remains challenging due to the sensitive nature of proteins. This study reports a general protein retention strategy to spatial-temporally confine various types of proteins at interfacial regions. The proteins were preserved in mesoporous silica nanoparticles embedded in covalently woven multilayers. It is worth noting that the protein retention strategy effectively preserves the catalytic capabilities of the proteins, and the multilayer structure is robust enough to withstand the bubbling catalytic reactions and could be repeatedly used due to conservation of proteins. The spatiotemporal retention of proteins could be adjusted by

  15. [Some aspects of functional diagnostics in sportsmen of high qualification].

    PubMed

    Chistiakova, Iu S

    2005-01-01

    The article presents characteristics and prevalence of EKG changes among sportsmen of high qualification. A new interpretation of such changes is given in the article. EKG data had been compared with the dynamics of sports results. It was established that ECG carried out in a group of professionals was not of sufficient diagnostic value. Differential diagnostics of ECG changes may be practiced with a wide use of current stress pharmacological testing, modern methods of ECG monitoring, echocardiography with Doppler analysis, stress-echocardiography under physical activity, assessment of variability of the cardiac rate.

  16. Independence of Hot and Cold Executive Function Deficits in High-Functioning Adults with Autism Spectrum Disorder

    PubMed Central

    Zimmerman, David L.; Ownsworth, Tamara; O'Donovan, Analise; Roberts, Jacqueline; Gullo, Matthew J.

    2016-01-01

    Individuals with autistic spectrum disorder (ASD) display diverse deficits in social, cognitive and behavioral functioning. To date, there has been mixed findings on the profile of executive function deficits for high-functioning adults (IQ > 70) with ASD. A conceptual distinction is commonly made between “cold” and “hot” executive functions. Cold executive functions refer to mechanistic higher-order cognitive operations (e.g., working memory), whereas hot executive functions entail cognitive abilities supported by emotional awareness and social perception (e.g., social cognition). This study aimed to determine the independence of deficits in hot and cold executive functions for high-functioning adults with ASD. Forty-two adults with ASD (64% male, aged 18–66 years) and 40 age and gender matched controls were administered The Awareness of Social Inference Test (TASIT; emotion recognition and social inference), Letter Number Sequencing (working memory) and Hayling Sentence Completion Test (response initiation and suppression). Between-group analyses identified that the ASD group performed significantly worse than matched controls on all measures of cold and hot executive functions (d = 0.54 − 1.5). Hierarchical multiple regression analyses revealed that the ASD sample performed more poorly on emotion recognition and social inference tasks than matched controls after controlling for cold executive functions and employment status. The findings also indicated that the ability to recognize emotions and make social inferences was supported by working memory and response initiation and suppression processes. Overall, this study supports the distinction between hot and cold executive function impairments for adults with ASD. Moreover, it advances understanding of higher-order impairments underlying social interaction difficulties for this population which, in turn, may assist with diagnosis and inform intervention programs. PMID:26903836

  17. Memristive crypto primitive for building highly secure physical unclonable functions.

    PubMed

    Gao, Yansong; Ranasinghe, Damith C; Al-Sarawi, Said F; Kavehei, Omid; Abbott, Derek

    2015-08-04

    Physical unclonable functions (PUFs) exploit the intrinsic complexity and irreproducibility of physical systems to generate secret information. The advantage is that PUFs have the potential to provide fundamentally higher security than traditional cryptographic methods by preventing the cloning of devices and the extraction of secret keys. Most PUF designs focus on exploiting process variations in Complementary Metal Oxide Semiconductor (CMOS) technology. In recent years, progress in nanoelectronic devices such as memristors has demonstrated the prevalence of process variations in scaling electronics down to the nano region. In this paper, we exploit the extremely large information density available in nanocrossbar architectures and the significant resistance variations of memristors to develop an on-chip memristive device based strong PUF (mrSPUF). Our novel architecture demonstrates desirable characteristics of PUFs, including uniqueness, reliability, and large number of challenge-response pairs (CRPs) and desirable characteristics of strong PUFs. More significantly, in contrast to most existing PUFs, our PUF can act as a reconfigurable PUF (rPUF) without additional hardware and is of benefit to applications needing revocation or update of secure key information.

  18. High-performance functional Renormalization Group calculations for interacting fermions

    NASA Astrophysics Data System (ADS)

    Lichtenstein, J.; Sánchez de la Peña, D.; Rohe, D.; Di Napoli, E.; Honerkamp, C.; Maier, S. A.

    2017-04-01

    We derive a novel computational scheme for functional Renormalization Group (fRG) calculations for interacting fermions on 2D lattices. The scheme is based on the exchange parametrization fRG for the two-fermion interaction, with additional insertions of truncated partitions of unity. These insertions decouple the fermionic propagators from the exchange propagators and lead to a separation of the underlying equations. We demonstrate that this separation is numerically advantageous and may pave the way for refined, large-scale computational investigations even in the case of complex multiband systems. Furthermore, on the basis of speedup data gained from our implementation, it is shown that this new variant facilitates efficient calculations on a large number of multi-core CPUs. We apply the scheme to the t ,t‧ Hubbard model on a square lattice to analyze the convergence of the results with the bond length of the truncation of the partition of unity. In most parameter areas, a fast convergence can be observed. Finally, we compare to previous results in order to relate our approach to other fRG studies.

  19. Memristive crypto primitive for building highly secure physical unclonable functions

    NASA Astrophysics Data System (ADS)

    Gao, Yansong; Ranasinghe, Damith C.; Al-Sarawi, Said F.; Kavehei, Omid; Abbott, Derek

    2015-08-01

    Physical unclonable functions (PUFs) exploit the intrinsic complexity and irreproducibility of physical systems to generate secret information. The advantage is that PUFs have the potential to provide fundamentally higher security than traditional cryptographic methods by preventing the cloning of devices and the extraction of secret keys. Most PUF designs focus on exploiting process variations in Complementary Metal Oxide Semiconductor (CMOS) technology. In recent years, progress in nanoelectronic devices such as memristors has demonstrated the prevalence of process variations in scaling electronics down to the nano region. In this paper, we exploit the extremely large information density available in nanocrossbar architectures and the significant resistance variations of memristors to develop an on-chip memristive device based strong PUF (mrSPUF). Our novel architecture demonstrates desirable characteristics of PUFs, including uniqueness, reliability, and large number of challenge-response pairs (CRPs) and desirable characteristics of strong PUFs. More significantly, in contrast to most existing PUFs, our PUF can act as a reconfigurable PUF (rPUF) without additional hardware and is of benefit to applications needing revocation or update of secure key information.

  20. Memristive crypto primitive for building highly secure physical unclonable functions

    PubMed Central

    Gao, Yansong; Ranasinghe, Damith C.; Al-Sarawi, Said F.; Kavehei, Omid; Abbott, Derek

    2015-01-01

    Physical unclonable functions (PUFs) exploit the intrinsic complexity and irreproducibility of physical systems to generate secret information. The advantage is that PUFs have the potential to provide fundamentally higher security than traditional cryptographic methods by preventing the cloning of devices and the extraction of secret keys. Most PUF designs focus on exploiting process variations in Complementary Metal Oxide Semiconductor (CMOS) technology. In recent years, progress in nanoelectronic devices such as memristors has demonstrated the prevalence of process variations in scaling electronics down to the nano region. In this paper, we exploit the extremely large information density available in nanocrossbar architectures and the significant resistance variations of memristors to develop an on-chip memristive device based strong PUF (mrSPUF). Our novel architecture demonstrates desirable characteristics of PUFs, including uniqueness, reliability, and large number of challenge-response pairs (CRPs) and desirable characteristics of strong PUFs. More significantly, in contrast to most existing PUFs, our PUF can act as a reconfigurable PUF (rPUF) without additional hardware and is of benefit to applications needing revocation or update of secure key information. PMID:26239669

  1. High resolution multiplexed functional imaging in live embyros (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Xu, Dongli; Peng, Leilei

    2016-03-01

    Optical projection tomography (OPT) creates isotropic 3D imaging of tissue. Two approaches exist today: Wide-field OPT illuminates the entire sample and acquires projection images with a camera; Scanning-laser optical tomography (SLOT) generates the projection with a moving laser beam and point detector. SLOT has superior light collecting efficiency than wide-field optical tomography, making it ideal for tissue fluorescence imaging. Regardless the approach, traditional OPT has to compromise between the resolution and the depth of view. In traditional SLOT, the focused Gaussian beam diverges quickly from the focused plane, making it impossible to achieve high resolution imaging through a large volume specimen. We report using Bessel beam instead of Gaussian beam to perform SLOT. By illuminating samples with a narrow Bessel beam throughout an extended depth, high-resolution projection images can be measured in large volume. Under Bessel illumination, the projection image contains signal from annular-rings of the Bessel beam. Traditional inverse Radon transform of these projections will result in ringing artifacts in reconstructed imaging. Thus a modified 3D filtered back projection algorithm is developed to perform tomography reconstructing of Bessel-illuminated projection images. The resulting 3D imaging is free of artifact and achieved cellular resolution in extended sample volume. The system is applied to in-vivo imaging of transgenic Zebrafish embryos. Results prove Bessel SLOT a promising imaging method in development biology research.

  2. [Functional respiratory evaluation in patients with high traumatic spinal injury].

    PubMed

    Andrada, L; De Vito, E L

    2001-01-01

    The restrictive defect was quantified (Forced vital capacity, FVC) and their postural dependence and the respiratory muscle weakness (Maximal inspiratory and expiratory pressures, MIP and MEP) in 29 patients (12 to 46 years) with spinal injury from cervical (C) 4 to thoracic (T) 7 (30 days to 48 months post injury period). The FVC in C (seated) was 2200 +/- 560 ml (47.2%), and in T was 2940 +/- 750 ml (66.6%), p < 0.008. The postural dependence of the FVC was higher in C with an increase of 25% and only of 10% in the T (p < 0.03). This postural dependence was a function of the FVC according to the regression equation: FVC % (supine) = 24.73+ 0.7341* FVC % seated (r 0.8771, p < 0.001). The MIP in C was 61.59 (53.82%) +/- 17.26 cm H2O and in T was 87.25 (77.85%) +/- 24.27 cmH2O (p < 0.05). The MEP in C was 48.53 (24.97%) +/- 18.09 cm H2O, and in T was 58.75 (30.74%) +/- 27.67 cmH2O (p NS). No correlation was found between FVC and maximal statics respiratory pressures. In conclusion, the C showed more significant restrictive defect and a great postural dependence of the FVC. In both, the expiratory muscle weakness was more severe than the inspiratory group. Inspiratory muscle weakness was higher in C.

  3. Structure–Function Relationships in Highly Modified Shoots of Cactaceae

    PubMed Central

    MAUSETH, JAMES D.

    2006-01-01

    • Background and Aims Cacti are extremely diverse structurally and ecologically, and so modified as to be intimidating to many biologists. Yet all have the same organization as most dicots, none differs fundamentally from Arabidopsis or other model plants. This review explains cactus shoot structure, discusses relationships between structure, ecology, development and evolution, and indicates areas where research on cacti is necessary to test general theories of morphogenesis. • Scope Cactus leaves are diverse; all cacti have foliage leaves; many intermediate stages in evolutionary reduction of leaves are still present; floral shoots often have large, complex leaves whereas vegetative shoots have microscopic leaves. Spines are modified bud scales, some secrete sugar as extra-floral nectaries. Many cacti have juvenile/adult phases in which the flowering adult phase (a cephalium) differs greatly from the juvenile; in some, one side of a shoot becomes adult, all other sides continue to grow as the juvenile phase. Flowers are inverted: the exterior of a cactus ‘flower’ is a hollow vegetative shoot with internodes, nodes, leaves and spines, whereas floral organs occur inside, with petals physically above stamens. Many cacti have cortical bundles vascularizing the cortex, however broad it evolves to be, thus keeping surface tissues alive. Great width results in great weight of weak parenchymatous shoots, correlated with reduced branching. Reduced numbers of shoot apices is compensated by great increases in number of meristematic cells within individual SAMs. Ribs and tubercles allow shoots to swell without tearing during wet seasons. Shoot epidermis and cortex cells live and function for decades then convert to cork cambium. Many modifications permit water storage within cactus wood itself, adjacent to vessels. PMID:16820405

  4. Measurement of the nucleon structure function using high energy muons

    SciTech Connect

    Meyers, P.D.

    1983-12-01

    We have measured the inclusive deep inelastic scattering of muons on nucleons in iron using beams of 93 and 215 GeV muons. To perform this measurement, we have built and operated the Multimuon Spectrometer (MMS) in the muon beam at Fermilab. The MMS is a magnetized iron target/spectrometer/calorimeter which provides 5.61 kg/cm/sup 2/ of target, 9% momentum resolution on scattered muons, and a direct measure of total hadronic energy with resolution sigma/sub nu/ = 1.4..sqrt..nu(GeV). In the distributed target, the average beam energies at the interaction are 88.0 and 209 GeV. Using the known form of the radiatively-corrected electromagnetic cross section, we extract the structure function F/sub 2/(x,Q/sup 2/) with a typical precision of 2% over the range 5 < Q/sup 2/ < 200 GeV/sup 2//c/sup 2/. We compare our measurements to the predictions of lowest order quantum chromodynamics (QCD) and find a best fit value of the QCD scale parameter ..lambda../sub LO/ = 230 +- 40/sup stat/ +- 80/sup syst/ MeV/c, assuming R = 0 and without applying Fermi motion corrections. Comparing the cross sections at the two beam energies, we measure R = -0.06 +- 0.06/sup stat/ +- 0.11/sup syst/. Our measurements show qualitative agreement with QCD, but quantitative comparison is hampered by phenomenological uncertainties. The experimental situation is quite good, with substantial agreement between our measurements and those of others. 86 references.

  5. Use of Gilliam Asperger's disorder scale in differentiating high and low functioning autism and ADHD.

    PubMed

    Mayes, Susan Dickerson; Calhoun, Susan L; Murray, Michael J; Morrow, Jill D; Yurich, Kirsten K L; Cothren, Shiyoko; Purichia, Heather; Bouder, James N

    2011-02-01

    Little is known about the validity of Gilliam Asperger's Disorder Scale (GADS), although it is widely used. This study of 199 children with high functioning autism or Asperger's disorder, 195 with low functioning autism, and 83 with attention deficit hyperactivity disorder (ADHD) showed high classification accuracy (autism vs. ADHD) for clinicians' GADS Quotients (92%), and somewhat lower accuracy (77%) for parents' Quotients. Both children with high and low functioning autism had clinicians' Quotients (M=99 and 101, respectively) similar to the Asperger's Disorder mean of 100 for the GADS normative sample. Children with high functioning autism scored significantly higher on the cognitive patterns subscale than children with low functioning autism, and the latter had higher scores on the remaining subscales: social interaction, restricted patterns of behavior, and pragmatic skills. Using the clinicians' Quotient and Cognitive Patterns score, 70% of children were correctly identified as having high or low functioning autism or ADHD.

  6. Unexpected high vulnerability of functions in wilderness areas: evidence from coral reef fishes

    PubMed Central

    Vigliola, Laurent; Graham, Nicholas A. J.; Wantiez, Laurent; Parravicini, Valeriano; Villéger, Sébastien; Mou-Tham, Gerard; Frolla, Philippe; Friedlander, Alan M.; Kulbicki, Michel; Mouillot, David

    2016-01-01

    High species richness is thought to support the delivery of multiple ecosystem functions and services under changing environments. Yet, some species might perform unique functional roles while others are redundant. Thus, the benefits of high species richness in maintaining ecosystem functioning are uncertain if functions have little redundancy, potentially leading to high vulnerability of functions. We studied the natural propensity of assemblages to be functionally buffered against loss prior to fishing activities, using functional trait combinations, in coral reef fish assemblages across unfished wilderness areas of the Indo-Pacific: Chagos Archipelago, New Caledonia and French Polynesia. Fish functional diversity in these wilderness areas is highly vulnerable to fishing, explained by species- and abundance-based redundancy packed into a small combination of traits, leaving most other trait combinations (60%) sensitive to fishing, with no redundancy. Functional vulnerability peaks for mobile and sedentary top predators, and large species in general. Functional vulnerability decreases for certain functional entities in New Caledonia, where overall functional redundancy was higher. Uncovering these baseline patterns of functional vulnerability can offer early warning signals of the damaging effects from fishing, and may serve as baselines to guide precautionary and even proactive conservation actions. PMID:27928042

  7. Unexpected high vulnerability of functions in wilderness areas: evidence from coral reef fishes.

    PubMed

    D'agata, Stéphanie; Vigliola, Laurent; Graham, Nicholas A J; Wantiez, Laurent; Parravicini, Valeriano; Villéger, Sébastien; Mou-Tham, Gerard; Frolla, Philippe; Friedlander, Alan M; Kulbicki, Michel; Mouillot, David

    2016-12-14

    High species richness is thought to support the delivery of multiple ecosystem functions and services under changing environments. Yet, some species might perform unique functional roles while others are redundant. Thus, the benefits of high species richness in maintaining ecosystem functioning are uncertain if functions have little redundancy, potentially leading to high vulnerability of functions. We studied the natural propensity of assemblages to be functionally buffered against loss prior to fishing activities, using functional trait combinations, in coral reef fish assemblages across unfished wilderness areas of the Indo-Pacific: Chagos Archipelago, New Caledonia and French Polynesia. Fish functional diversity in these wilderness areas is highly vulnerable to fishing, explained by species- and abundance-based redundancy packed into a small combination of traits, leaving most other trait combinations (60%) sensitive to fishing, with no redundancy. Functional vulnerability peaks for mobile and sedentary top predators, and large species in general. Functional vulnerability decreases for certain functional entities in New Caledonia, where overall functional redundancy was higher. Uncovering these baseline patterns of functional vulnerability can offer early warning signals of the damaging effects from fishing, and may serve as baselines to guide precautionary and even proactive conservation actions.

  8. High tibial osteotomy: factors influencing the duration of satisfactory function.

    PubMed

    Giagounidis, E M; Sell, S

    1999-01-01

    In 94 patients 112 knees were examined after high tibial osteotomy for varus and valgus gonarthrosis. Preoperatively, there were 71 varus and 23 valgus deformities. The mean follow-up period was 9.0 years (range 2-21 years). Concerning the pain on walking and the pain at rest, we noted good and excellent results in 73% and 65%, respectively. The radiological evaluation showed an improvement or a persistence of the stage of arthrosis in 69.5% of the reviewed cases. The results according to the HSS score as an objective parameter showed in over 50% an improvement of the patients' situation. The data were subjected to multivariate statistical analysis in which three of four evaluated risk factors were found to be associated with the duration of pain-free survival: certain preoperative injuries, preoperative meniscopathies and a deterioration of the stage of arthrosis (P < 0.05). There was no significance for weight in excess of 10% above the normal body mass index (BMI) limits. However, in a Kaplan-Meier survival analysis this parameter could be determined as a significant factor for a reduced pain-free survival interval (P < 0.05): patients with a BMI of more than 10% above normal limits had a pain-free period of 5.07 years, whereas those with a BMI of less than 10% had a pain-free period of 7.80 years.

  9. Decreasing Disruptive Vocalizations of a Student with High-Functioning Autism across Three General Education Classrooms

    ERIC Educational Resources Information Center

    Banda, Devender R.; Hart, Stephanie L.; Kercood, Suneeta

    2012-01-01

    The authors conducted this study to decrease disruptive vocalizations in a 3rd-grade student with high-functioning autism across 3 general education classrooms. They used direct and indirect approaches of functional behavior assessment to determine the function of the disruptive behavior. Results indicated that the behavior was maintained by…

  10. Advanced Inverter Functions to Support High Levels of Distributed Solar: Policy and Regulatory Considerations (Brochure)

    SciTech Connect

    Not Available

    2014-11-01

    This paper explains how advanced inverter functions (sometimes called 'smart inverters') contribute to the integration of high levels of solar PV generation onto the electrical grid and covers the contributions of advanced functions to maintaining grid stability. Policy and regulatory considerations associated with the deployment of advanced inverter functions are also introduced.

  11. Children with High-Functioning Autism and Asperger's Syndrome: Can We Differentiate Their Cognitive Profiles?

    ERIC Educational Resources Information Center

    Planche, Pascale; Lemonnier, Eric

    2012-01-01

    The aim of this study was to investigate whether children with high-functioning autism (HFA) and Asperger's syndrome (AS) can be differentiated from each other and from typically developing children on their cognitive profiles. The present study included a total of 45 participants: children with autism (high-functioning autism or Asperger's…

  12. Anxiety in High-Functioning Autism: A Pilot Study of Experience Sampling Using a Mobile Platform

    ERIC Educational Resources Information Center

    Hare, Dougal Julian; Gracey, Carolyn; Wood, Christopher

    2016-01-01

    Anxiety and stress are everyday issues for many people with high-functioning autism, and while cognitive-behavioural therapy is the treatment of choice for the management of anxiety, there are challenges in using it with people with high-functioning autism. This study used modified experience sampling techniques to examine everyday anxiety and…

  13. The Role of High Level Play as a Predictor Social Functioning in Autism

    ERIC Educational Resources Information Center

    Manning, Margaret M.; Wainwright, Laurel D.

    2010-01-01

    Play and social abilities of a group of children diagnosed with high functioning autism were compared to a second group diagnosed with a variety of developmental language disorders (DLD). The children with autism engaged in fewer acts of high level play. The children with autism also had significantly lower social functioning than the DLD group…

  14. Relationship between Social Competence and Sensory Processing in Children with High Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Hilton, Claudia; Graver, Kathleen; LaVesser, Patricia

    2007-01-01

    Purpose: This study examines the relationship between social competence and sensory processing in children with high functioning autism spectrum disorders. Methodology: Children, ages 6-10 (N = 36), with high functioning autism spectrum disorders were assessed using the Social Responsiveness Scale (SRS) and the Sensory Profile (SP). A bivariate…

  15. A mutation in X-linked inhibitor of apoptosis (G466X) leads to memory inflation of Epstein-Barr virus-specific T cells.

    PubMed

    Lopez-Granados, E; Stacey, M; Kienzler, A-K; Sierro, S; Willberg, C B; Fox, C P; Rigaud, S; Long, H M; Hislop, A D; Rickinson, A B; Patel, S; Latour, S; Klenerman, P; Chapel, H

    2014-12-01

    Mutations in the X-linked inhibitor of apoptosis (XIAP) gene have been associated with XLP-like disease, including recurrent Epstein-Barr virus (EBV)-related haemophagocytic lymphohystiocytosis (HLH), but the immunopathogenic bases of EBV-related disease in XIAP deficiency is unknown. We present the first analysis of EBV-specific T cell responses in functional XIAP deficiency. In a family of patients with a novel mutation in XIAP (G466X) leading to a late-truncated protein and varying clinical features, we identified gradual hypogammaglobulinaemia and large expansions of T cell subsets, including a prominent CD4(+) CD8(+) population. Extensive ex-vivo analyses showed that the expanded T cell subsets were dominated by EBV-specific cells with conserved cytotoxic, proliferative and interferon (IFN)-γ secretion capacity. The EBV load in blood fluctuated and was occasionally very high, indicating that the XIAP(G466X) mutation could impact upon EBV latency. XIAP deficiency may unravel a new immunopathogenic mechanism in EBV-associated disease.

  16. Differential in vivo clearance and response to secondary heterologous infections by H2(b)-restricted dengue virus-specific CD8+ T cells.

    PubMed

    Beaumier, Coreen M; Jaiswal, Smita; West, Kim Y; Friberg, Heather; Mathew, Anuja; Rothman, Alan L

    2010-10-01

    Cytotoxic T lymphocytes (CTL) are hypothesized to play a role in clearance during primary dengue virus (DENV) infections, and contribute to immunopathology during secondary heterologous infections in humans. We previously reported skewed T-cell responses to secondary DENV infection in BALB/c (H-2(d)) mice, reproducing characteristics of human DENV infection. To set the stage for using widely available transgenic and knockout mice, we extended these studies to identify DENV-specific T-cell responses in C57BL/6 (H-2(b)) mice. We identified dominant CD8+ T-cell responses to H-2D(b)-restricted epitopes on the DENV NS4a (aa 249-265) and NS5 (aa 521-537) proteins. High frequencies of IFN-γ- and TNF-α-producing T cells directed at both epitopes were detected following primary infection with all four DENV serotypes, and were augmented by secondary DENV infections. In vivo cytotoxicity assays demonstrated rapid clearance of target cells pulsed with the NS4a peptide; in contrast, NS5 peptide-pulsed target cells were poorly cleared in vivo. These data characterize two H-2(b)-restricted T-cell epitopes displaying divergent in vivo function. These results should facilitate further studies of the in vivo effects of DENV-specific T cells, including the use of genetically modified mouse strains.

  17. An Investigation of Upper Limb Motor Function in High Functioning Autism and Asperger's Disorder Using a Repetitive Fitts' Aiming Task

    ERIC Educational Resources Information Center

    Papadopoulos, Nicole; McGinley, Jennifer; Tonge, Bruce J.; Bradshaw, John L.; Saunders, Kerryn; Rinehart, Nicole J.

    2012-01-01

    There is now a growing body of research examining movement difficulties in children diagnosed with high functioning autism (HFA) and Asperger's disorder (AD). Despite this, few studies have investigated the kinematic components of movement that may be disrupted in children diagnosed with these disorders. The current study investigated rapid aiming…

  18. Abnormal Functional Specialization within Medial Prefrontal Cortex in High-Functioning Autism: A Multi-Voxel Similarity Analysis

    ERIC Educational Resources Information Center

    Gilbert, Sam J.; Meuwese, Julia D. I.; Towgood, Karren J.; Frith, Christopher D.; Burgess, Paul W.

    2009-01-01

    Multi-voxel pattern analyses have proved successful in "decoding" mental states from fMRI data, but have not been used to examine brain differences associated with atypical populations. We investigated a group of 16 (14 males) high-functioning participants with autism spectrum disorder (ASD) and 16 non-autistic control participants (12 males)…

  19. Heightened self-reactivity associated with selective survival, but not expansion, of naïve virus-specific CD8+ T cells in aged mice

    PubMed Central

    Quinn, Kylie M.; Zaloumis, Sophie G.; Cukalac, Tania; Kan, Wan-Ting; Sng, Xavier Y. X.; Mirams, Michiko; Watson, Katherine A.; Doherty, Peter C.; Thomas, Paul G.; Handel, Andreas; La Gruta, Nicole L.

    2016-01-01

    In advanced age, decreased CD8+ cytotoxic T-lymphocyte (CTL) responses to novel pathogens and cancer is paralleled by a decline in the number and function of naïve CTL precursors (CTLp). Although the age-related fall in CD8+ T-cell numbers is well established, neither the underlying mechanisms nor the extent of variation for different epitope specificities have been defined. Furthermore, naïve CD8+ T cells expressing high levels of CD44 accumulate with age, but it is unknown whether this accumulation reflects their preferential survival or an age-dependent driver of CD8+ T-cell proliferation. Here, we track the number and phenotype of four influenza A virus (IAV)-specific CTLp populations in naïve C57BL/6 (B6) mice during aging, and compare T-cell receptor (TCR) clonal diversity for the CD44hi and CD44lo subsets of one such population. We show differential onset of decline for several IAV-specific CD8+ T-cell populations with advanced age that parallel age-associated changes in the B6 immunodominance hierarchy, suggestive of distinct impacts of aging on different epitope-specific populations. Despite finding no evidence of clonal expansions in an aged, epitope-specific TCR repertoire, nonrandom alterations in TCR usage were observed, along with elevated CD5 and CD8 coreceptor expression. Collectively, these data demonstrate that naïve CD8+ T cells expressing markers of heightened self-recognition are selectively retained, but not clonally expanded, during aging. PMID:26787864

  20. Structure-function studies of nerve growth factor: functional importance of highly conserved amino acid residues.

    PubMed Central

    Ibáñez, C F; Hallböök, F; Ebendal, T; Persson, H

    1990-01-01

    Selected amino acid residues in chicken nerve growth factor (NGF) were replaced by site-directed mutagenesis. Mutated NGF sequences were transiently expressed in COS cells and the yield of NGF protein in conditioned medium was quantified by Western blotting. Binding of each mutant to NGF receptors on PC12 cells was evaluated in a competition assay. The biological activity was determined by measuring stimulation of neurite outgrowth from chick sympathetic ganglia. The residues homologous to the proposed receptor binding site of insulin (Ser18, Met19, Val21, Asp23) were substituted by Ala. Replacement of Ser18, Met19 and Asp23 did not affect NGF activity. Modification of Val21 notably reduced both receptor binding and biological activity, suggesting that this residue is important to retain a fully active NGF. The highly conserved Tyr51 and Arg99 were converted into Phe and Lys respectively, without changing the biological properties of the molecule. However, binding and biological activity were greatly impaired after the simultaneous replacement of both Arg99 and Arg102 by Gly. The three conserved Trp residues at positions 20, 75 and 98 were substituted by Phe. The Trp mutated proteins retained 15-60% of receptor binding and 40-80% of biological activity, indicating that the Trp residues are not essential for NGF activity. However, replacement of Trp20 significantly reduced the amount of NGF in the medium, suggesting that this residue may be important for protein stability. Images Fig. 4. PMID:2328722

  1. QCD Precision Measurements and Structure Function Extraction at a High Statistics, High Energy Neutrino Scattering Experiment: NuSOnG

    SciTech Connect

    Adams, T.; Batra, P.; Bugel, Leonard G.; Camilleri, Leslie Loris; Conrad, Janet Marie; de Gouvea, A.; Fisher, Peter H.; Formaggio, Joseph Angelo; Jenkins, J.; Karagiorgi, Georgia S.; Kobilarcik, T.R.; /Fermilab /Texas U.

    2009-06-01

    We extend the physics case for a new high-energy, ultra-high statistics neutrino scattering experiment, NuSOnG (Neutrino Scattering On Glass) to address a variety of issues including precision QCD measurements, extraction of structure functions, and the derived Parton Distribution Functions (PDFs). This experiment uses a Tevatron-based neutrino beam to obtain a sample of Deep Inelastic Scattering (DIS) events which is over two orders of magnitude larger than past samples. We outline an innovative method for fitting the structure functions using a parameterized energy shift which yields reduced systematic uncertainties. High statistics measurements, in combination with improved systematics, will enable NuSOnG to perform discerning tests of fundamental Standard Model parameters as we search for deviations which may hint of 'Beyond the Standard Model' physics.

  2. Adiposity is increased among High-Functioning, Non-Ambulatory Patients with Spinal Muscular Atrophy

    PubMed Central

    Sproule, Douglas M.; Montes, Jacqueline; Dunaway, Sally; Montgomery, Megan; Battista, Vanessa; Koenigsberger, Dorcas; Martens, Bill; Shen, Wei; Punyanitya, Mark; Benton, Maryjane; Butler, Hailly; Caracciolo, Jayson; Mercuri, Eugenio; Finkel, Richard; Darras, Basil; De Vivo, Darryl C.; Kaufmann, Petra

    2010-01-01

    The relationship between body composition and function in spinal muscular atrophy (SMA) is poorly understood. 53 subjects with SMA were stratified by type and Hammersmith Functional Motor Scale, Expanded score into three cohorts: Low-Functioning Non-Ambulatory (type 2 with Hammersmith score <12, n=19), High-Functioning Non-Ambulatory (type 2 with Hammersmith Score ≥ 12 or non-ambulatory type 3, n=17), and Ambulatory (n=17). Lean and fat mass was estimated using dual-energy x-ray absorptiometry. Anthropometric data was incorporated to measure fat-free (lean mass in kg /stature in m2) and fat (fat mass in kg /stature in m2) mass indices, the latter compared to published age and sex norms. Feeding dysfunction among type 2 subjects was assessed by questionnaire. Fat mass index was increased in the High-Functioning Non-Ambulatory cohort (10.4 ± 4.5) compared with both the ambulatory (7.2 ± 2.1, p = 0.013) and Low-Functioning Non-Ambulatory (7.6 ± 3.1, p = 0.040) cohorts. 12 of 17 subjects (71%) in the High-Functioning Non-Ambulatory cohort had fat mass index >85th percentile for age and gender (connoting “at risk of overweight”) versus 9 of 19 subjects (47%) in the Low-Functioning Non-Ambulatory cohort and 8 of 17 ambulatory subjects (47%). Despite differences in clinical function, a similar proportion of low functioning (7/18, 39%) and high functioning (2/7, 29%) type 2 subjects reported swallowing or feeding dysfunction. Non-ambulatory patients with relatively high clinical function may be at particular risk of excess adiposity, perhaps reflecting access to excess calories despite relative immobility, emphasizing the importance of individualized nutritional management in SMA. PMID:20610154

  3. Self-awareness of functional impairment in individuals at clinical high-risk for psychosis

    PubMed Central

    Olvet, Doreen M.; Carrión, Ricardo E.; Auther, Andrea M.; Cornblatt, Barbara A.

    2013-01-01

    Aims A major public health concern associated with schizophrenia is the long-term disability that involves an inability to function independently in the community. An individual’s self-awareness of functional impairment may be a significant factor contributing to long-term disability. In fact, subjective interpretation of one’s illness impacts treatment participation and adherence, and is linked to poor outcomes. However, it remains unclear how illness-related functional impairment is perceived by individuals prior to the onset of psychosis. This study aims to examine the relationship between clinician-based and self-report assessments of functioning, as well as the contribution of clinical symptoms to this relationship in individuals at clinical high-risk for psychosis. Methods The Sheehan Disability Scale, a self-rated instrument, was used to measure disruption in daily functioning in social and role functioning due to symptoms in a sample of 73 treatment-seeking patients at clinical high-risk for psychosis and 50 healthy controls. Results Relative to healthy controls, clinical high-risk patients self-reported significant disruptions in social and role functioning. In addition, a specific relationship emerged in that clinician-rated measures of functioning and depression were related to disability scores. Conclusions These findings suggest that clinical high-risk patients are significantly disturbed by their illness. Self-reported disruption of daily functioning was associated with clinician-rated functioning and depressive symptoms, further highlighting the impact of functional impairments on the level of distress experienced by patients in the early phases of the illness. Intervention strategies that repair functional impairment before the onset of psychosis may prevent long-term disability. PMID:23968457

  4. Social Competence Intervention for Youth with Asperger Syndrome and High-Functioning Autism: An Initial Investigation

    ERIC Educational Resources Information Center

    Stichter, Janine P.; Herzog, Melissa J.; Visovsky, Karen; Schmidt, Carla; Randolph, Jena; Schultz, Tia; Gage, Nicholas

    2010-01-01

    Individuals with high functioning autism (HFA) or Asperger Syndrome (AS) exhibit difficulties in the knowledge or correct performance of social skills. This subgroup's social difficulties appear to be associated with deficits in three social cognition processes: theory of mind, emotion recognition and executive functioning. The current study…

  5. Brain Structure and Resting-State Functional Connectivity in University Professors with High Academic Achievement

    ERIC Educational Resources Information Center

    Li, Weiwei; Yang, Wenjing; Li, Wenfu; Li, Yadan; Wei, Dongtao; Li, Huimin; Qiu, Jiang; Zhang, Qinglin

    2015-01-01

    Creative persons play an important role in technical innovation and social progress. There is little research on the neural correlates with researchers with high academic achievement. We used a combined structural (regional gray matter volume, rGMV) and functional (resting-state functional connectivity analysis, rsFC) approach to examine the…

  6. Associations between Conceptual Reasoning, Problem Solving, and Adaptive Ability in High-Functioning Autism

    ERIC Educational Resources Information Center

    Williams, Diane L.; Mazefsky, Carla A.; Walker, Jon D.; Minshew, Nancy J.; Goldstein, Gerald

    2014-01-01

    Abstract thinking is generally highly correlated with problem-solving ability which is predictive of better adaptive functioning. Measures of conceptual reasoning, an ecologically-valid laboratory measure of problem-solving, and a report measure of adaptive functioning in the natural environment, were administered to children and adults with and…

  7. Effects of Observing Eye Contact on Gaze Following in High-Functioning Autism

    ERIC Educational Resources Information Center

    Böckler, Anne; Timmermans, Bert; Sebanz, Natalie; Vogeley, Kai; Schilbach, Leonhard

    2014-01-01

    Observing eye contact between others enhances the tendency to subsequently follow their gaze and has been suggested to function as a social signal that adds meaning to an upcoming action or event. The present study investigated effects of observed eye contact in high-functioning autism (HFA). Two faces on a screen either looked at or away from…

  8. Facial Emotion Recognition in Children with High Functioning Autism and Children with Social Phobia

    ERIC Educational Resources Information Center

    Wong, Nina; Beidel, Deborah C.; Sarver, Dustin E.; Sims, Valerie

    2012-01-01

    Recognizing facial affect is essential for effective social functioning. This study examines emotion recognition abilities in children aged 7-13 years with High Functioning Autism (HFA = 19), Social Phobia (SP = 17), or typical development (TD = 21). Findings indicate that all children identified certain emotions more quickly (e.g., happy [less…

  9. Rhetorical Functions of Citations in High- and Low-Rated Master's Theses

    ERIC Educational Resources Information Center

    Petric, Bojana

    2007-01-01

    This study compares rhetorical citation functions in eight high- and eight low-graded master's theses in the field of gender studies, written in English as a second language. The following rhetorical functions of citations are identified: attribution, exemplification, further reference, statement of use, application, evaluation, establishing links…

  10. Verbal Memory Deficits in Relation to Organization Strategy in High- and Low-Functioning Autistic Children

    ERIC Educational Resources Information Center

    Cheung, Mei-chun; Chan, Agnes S.; Sze, Sophia L.; Leung, Winnie W.; To, Cho Yee

    2010-01-01

    The present study examined the verbal memory profile and its relation to organizational strategies in high-functioning (Hi-AUT) and low-functioning (Lo-AUT) children with autism. Twenty-two Hi-AUT and 16 Lo-AUT, and 22 age-, gender- and handedness-matched normal children (NC) were required to remember a list of semantically related words for…

  11. Perception of Dialect Variation by Young Adults with High-Functioning Autism

    ERIC Educational Resources Information Center

    Clopper, Cynthia G.; Rohrbeck, Kristin L.; Wagner, Laura

    2012-01-01

    The linguistic profile of people with Autism spectrum disorders typically involves intact perceptual processing, accompanied by deficits in the social functions of language. In a series of three experiments, the impact of this profile on the perception of regional dialect was examined. Young adults with High-Functioning Autism exhibited similar…

  12. Highly water-soluble multi-walled carbon nanotubes amine-functionalized by supercritical water oxidation.

    PubMed

    Chun, Kyoung-Yong; Moon, In-Kyu; Han, Joo-Hee; Do, Seung-Hoe; Lee, Jin-Seo; Jeon, Seong-Yun

    2013-11-07

    Multi-walled carbon nanotubes (MWNTs) have been amine-functionalized by eco-friendly supercritical water oxidation. The facilely functionalized MWNTs have high solubility (~84 mg L(-1)) in water and 78% transmittance at 30-fold dilution. The Tyndall effect is also shown for several liquids.

  13. Health-Related Quality of Life in Children with High-Functioning Autism

    ERIC Educational Resources Information Center

    Potvin, Marie-Christine; Snider, Laurie; Prelock, Patricia A.; Wood-Dauphinee, Sharon; Kehayia, Eva

    2015-01-01

    The health-related quality of life of school-aged children with high-functioning autism is poorly understood. The objectives of this study were to compare the health-related quality of life of children with high-functioning autism to that of typically developing peers and to compare child-self and parent-proxy reports of health-related quality of…

  14. An organic surface modifier to produce a high work function transparent electrode for high performance polymer solar cells.

    PubMed

    Choi, Hyosung; Kim, Hak-Beom; Ko, Seo-Jin; Kim, Jin Young; Heeger, Alan J

    2015-02-04

    Modification of an ITO electrode with small-molecule organic surface modifier, 4-chloro-benzoic acid (CBA), via a simple spin-coating method produces a high-work-function electrode with high transparency and a hydrophobic surface. As an alternative to PEDOT:PSS, CBA modification achieves efficiency enhancement up to 8.5%, which is attributed to enhanced light absorption within the active layer and smooth hole transport from the active layer to the anode.

  15. Cardiovascular function in male and female JCR:LA-cp rats: Effect of high fat/high sucrose diet.

    PubMed

    Hunter, Ian; Soler, Amanda; Joseph, Gregory; Hutcheson, Brenda; Bradford, Chastity; Zhang, Frank; Potter, Barry J; Proctor, Spencer D; Rocic, Petra

    2017-01-13

    30% of the world population is diagnosed with metabolic syndrome. High fat/high sucrose diet (HF/HS, Western diet) correlates with metabolic syndrome prevalence. We characterized effects of the HF/HS diet on vascular (arterial stiffness, vasoreactivity, coronary collateral development) and cardiac (echocardiography) function, oxidative stress and inflammation in a rat model of metabolic syndrome (JCR). Furthermore, we determined whether male vs. female animals were affected differentially by the Western diet. Cardiovascular function in JCR male rats was impaired vs. normal rats (SD). HF/HS diet compromised cardiovascular (dys)function in JCR but not in SD male rats. In contrast, cardiovascular function was minimally impaired in JCR females on normal chow. However, cardiovascular function in JCR females on the HF/HS diet deteriorated to levels comparable to JCR males on the HF/HS diet. Similarly, oxidative stress was markedly increased in male but not female JCR rats on normal chow, but was equally exacerbated by the HF/HS diet in male and female JCR rats. These results indicate that the Western diet enhances oxidative stress and cardiovascular dysfunction in metabolic syndrome and eliminates the protective effect of female sex on cardiovascular function, implying that both males and females with metabolic syndrome are at equal risk for cardiovascular disease.

  16. Health-related quality of life in children with high-functioning autism.

    PubMed

    Potvin, Marie-Christine; Snider, Laurie; Prelock, Patricia A; Wood-Dauphinee, Sharon; Kehayia, Eva

    2015-01-01

    The health-related quality of life of school-aged children with high-functioning autism is poorly understood. The objectives of this study were to compare the health-related quality of life of children with high-functioning autism to that of typically developing peers and to compare child-self and parent-proxy reports of health-related quality of life of children. A cross-sectional study of children with high-functioning autism (n = 30) and peers (n = 31) was conducted using the Pediatric Quality of Life Inventory 4.0 Generic Core Scales. Children with high-functioning autism had significantly poorer health-related quality of life than peers whether reported by themselves (p < .001) or their parents (p < .001), although disagreement (intra-class coefficient = -.075) between children and parental scores suggested variance in points of view. This study specifically investigated health-related quality of life in children with high-functioning autism as compared to a sample of peers, from the child's perspective. It strengthens earlier findings that children with high-functioning autism experience poorer health-related quality of life than those without this disorder and points to the importance of clinicians working with families to identify areas in a child's life that promote or hinder their sense of well-being.

  17. Calculation of the vacuum Green's function valid for high toroidal mode number in tokamaks.

    NASA Astrophysics Data System (ADS)

    Chance, Morrell; Turnbull, Alan

    2005-10-01

    The present evaluation of the Green's function used for the magmetic scalar potential in vacuum calculations for axisymmetric geometry in the vacuum segments of gato, pest and other mhd stability codes has been found to be deficient for moderately high toroidal mode numbers. This was due to the loss of numerical precision arising from the upward recursion relation used for generating the functions to high mode numbers. The recursion is initiated from the complete elliptic integrals of the first and second kinds. To ameliorate this, a direct integration of the integral representation of the function was crafted to achieve the necessary high accuracy for moderately high mode numbers. At very high mode numbers the loss of numerical precision due to the oscillatory behavior of the integrand is further avoided by judiciously deforming the integration contour in the complex plane. Machine precision, roughly 14 -- 16 digits, accuracy can be achieved by using a combination of both these techniques.

  18. Advancing biodiversity-ecosystem functioning science using high-density tree-based experiments over functional diversity gradients.

    PubMed

    Tobner, Cornelia M; Paquette, Alain; Reich, Peter B; Gravel, Dominique; Messier, Christian

    2014-03-01

    Increasing concern about loss of biodiversity and its effects on ecosystem functioning has triggered a series of manipulative experiments worldwide, which have demonstrated a general trend for ecosystem functioning to increase with diversity. General mechanisms proposed to explain diversity effects include complementary resource use and invoke a key role for species' functional traits. The actual mechanisms by which complementary resource use occurs remain, however, poorly understood, as well as whether they apply to tree-dominated ecosystems. Here we present an experimental approach offering multiple innovative aspects to the field of biodiversity-ecosystem functioning (BEF) research. The International Diversity Experiment Network with Trees (IDENT) allows research to be conducted at several hierarchical levels within individuals, neighborhoods, and communities. The network investigates questions related to intraspecific trait variation, complementarity, and environmental stress. The goal of IDENT is to identify some of the mechanisms through which individuals and species interact to promote coexistence and the complementary use of resources. IDENT includes several implemented and planned sites in North America and Europe, and uses a replicated design of high-density tree plots of fixed species-richness levels varying in functional diversity (FD). The design reduces the space and time needed for trees to interact allowing a thorough set of mixtures varying over different diversity gradients (specific, functional, phylogenetic) and environmental conditions (e.g., water stress) to be tested in the field. The intention of this paper is to share the experience in designing FD-focused BEF experiments with trees, to favor collaborations and expand the network to different conditions.

  19. Virtual reality social cognition training for young adults with high-functioning autism.

    PubMed

    Kandalaft, Michelle R; Didehbani, Nyaz; Krawczyk, Daniel C; Allen, Tandra T; Chapman, Sandra B

    2013-01-01

    Few evidence-based social interventions exist for young adults with high-functioning autism, many of whom encounter significant challenges during the transition into adulthood. The current study investigated the feasibility of an engaging Virtual Reality Social Cognition Training intervention focused on enhancing social skills, social cognition, and social functioning. Eight young adults diagnosed with high-functioning autism completed 10 sessions across 5 weeks. Significant increases on social cognitive measures of theory of mind and emotion recognition, as well as in real life social and occupational functioning were found post-training. These findings suggest that the virtual reality platform is a promising tool for improving social skills, cognition, and functioning in autism.

  20. Next-Generation High-Throughput Functional Annotation of Microbial Genomes

    PubMed Central

    Baric, Ralph S.; Damania, Blossom; Miller, Samuel I.; Rubin, Eric J.

    2016-01-01

    ABSTRACT Host infection by microbial pathogens cues global changes in microbial and host cell biology that facilitate microbial replication and disease. The complete maps of thousands of bacterial and viral genomes have recently been defined; however, the rate at which physiological or biochemical functions have been assigned to genes has greatly lagged. The National Institute of Allergy and Infectious Diseases (NIAID) addressed this gap by creating functional genomics centers dedicated to developing high-throughput approaches to assign gene function. These centers require broad-based and collaborative research programs to generate and integrate diverse data to achieve a comprehensive understanding of microbial pathogenesis. High-throughput functional genomics can lead to new therapeutics and better understanding of the next generation of emerging pathogens by rapidly defining new general mechanisms by which organisms cause disease and replicate in host tissues and by facilitating the rate at which functional data reach the scientific community. PMID:27703071

  1. The relationship between executive functioning, central coherence, and repetitive behaviors in the high-functioning autism spectrum.

    PubMed

    South, Mikle; Ozonoff, Sally; McMahon, William M

    2007-09-01

    This study examined the relationship between everyday repetitive behavior (primary symptoms of autism) and performance on neuropsychological tests of executive function and central coherence (secondary symptoms). It was hypothesized that the frequency and intensity of repetitive behavior would be positively correlated with laboratory measures of cognitive rigidity and weak central coherence. Participants included 19 individuals (ages 10-19) with high-functioning autism spectrum disorders (ASD group) and 18 age- and IQ-matched typically developing controls (TD group). There was partial support in the ASD group for the link between repetitive behavior and executive performance (the Wisconsin Card Sorting Task). There was no support for a link between repetitive behavior and measures of central coherence (a Gestalt Closure test and the Embedded Figures Test). Further research on repetitive behaviors in autism may benefit from a focus on narrow behavioral and cognitive constructs rather than general categories.

  2. Responses to Nonverbal Behaviour of Dynamic Virtual Characters in High-Functioning Autism

    ERIC Educational Resources Information Center

    Schwartz, Caroline; Bente, Gary; Gawronski, Astrid; Schilbach, Leonhard; Vogeley, Kai

    2010-01-01

    We investigated feelings of involvement evoked by nonverbal behaviour of dynamic virtual characters in 20 adults with high-functioning autism (HFA) and high IQ as well as 20 IQ-matched control subjects. The effects of diagnostic group showed that subjects with autism experienced less "contact" and "urge" to establish contact across conditions and…

  3. Psychosocial Functioning in Youths at High Risk to Develop Major Depressive Disorder.

    ERIC Educational Resources Information Center

    Birmaher, Boris; Bridge, Jeffrey A.; Williamson, Douglas E.; Brent, David A.; Dahl, Ronald E.; Axelson, David A.; Dorn, Lorah D.; Ryan, Neal D.

    2004-01-01

    Objective: To compare the psychosocial functioning of children and adolescents at high risk of major depressive disorder with youths with acute major depressive disorder and healthy controls. Method: High-risk (n = 57), major depressive disorder (n = 71), and healthy control (n = 48) youths and their families were recruited from 1987 to 1996 and…

  4. Do Individuals with High Functioning Autism Have the IQ Profile Associated with Nonverbal Learning Disability?

    ERIC Educational Resources Information Center

    Williams, Diane L.; Goldstein, Gerald; Kojkowski, Nicole; Minshew, Nancy J.

    2008-01-01

    Previously researchers have noted a high level of occurrence of the IQ profile associated with nonverbal learning disability (NLD) in Asperger syndrome (ASP) but not in high functioning autism (HFA). We examined the IQ profile scores of a large sample of children (n=69) and adults (n=77) with HFA, stringently diagnosed according to ADOS, ADI-R,…

  5. Emulation and Mimicry in School Students with Typical Development and with High Functioning Autism

    ERIC Educational Resources Information Center

    Jiménez, Luis; Lorda, María José; Méndez, Cástor

    2014-01-01

    Two samples of participants with typical development (TD) and high functioning autism performed an imitation task where the goal was of high or low salience, and where the modeled action complied with or was contrary to the end-state comfort (ESC) effect. Imitation was affected by the ESC effect in both groups, and participants with autism…

  6. Transition to College and Students with High Functioning Autism Spectrum Disorder: Strategy Considerations for School Counselors

    ERIC Educational Resources Information Center

    Dipeolu, Abiola O.; Storlie, Cassandra; Johnson, Carol

    2014-01-01

    There are limited school counseling resources that address the unique post high school transition issues faced by students with High-functioning Autism Spectrum Disorder (HASD). While many school counselors have excellent skills in assessment, advising, and career planning, it is worthwhile to expand these to include working with students with…

  7. West Nile virus-specific CD4 T cells exhibit direct anti-viral cytokine secretion and cytotoxicity and are sufficient for antiviral protection

    PubMed Central

    Brien, James D.; Uhrlaub, Jennifer L.; Nikolich-Zugich, Janko

    2012-01-01

    CD4 T cells have been shown to be necessary for the prevention of encephalitis during West Nile virus infection. However, the mechanisms used by antigen-specific CD4 T cells to protect mice from West Nile virus encephalitis remain incompletely understood. Contrary to the belief that CD4 T cells are protective because they merely maintain the CD8 T cell response and improve antibody production, we here provide evidence for the direct anti-viral activity of CD4 T cells which functions to protect the host from WNV encephalitis. In adoptive transfers, naïve CD4 T cells protected a significant number of lethally infected RAG−/− mice, demonstrating the protective effect of CD4 T cells independent of B cells and CD8 T cells. To shed light on the mechanism of this protection, we defined the peptide specificities of the CD4 T cells responding to West Nile virus infection in C57BL/6 (H-2b) mice, and used these peptides to characterize the in vivo function of antiviral CD4 T cells. WNV-specific CD4 T cells produced IFN-γ and IL-2, but also showed potential for in vivo and ex vivo cytotoxicity. Furthermore, peptide vaccination using CD4 epitopes conferred protection against lethal West Nile virus infection in immunocompetent mice. These results demonstrate the role of direct effector function of antigen-specific CD4 T cell in preventing severe West Nile virus disease. PMID:19050276

  8. Functional second harmonic generation microscopy probes molecular dynamics with high temporal resolution

    PubMed Central

    Förderer, Moritz; Georgiev, Tihomir; Mosqueira, Matias; Fink, Rainer H. A.; Vogel, Martin

    2016-01-01

    Second harmonic generation (SHG) microscopy is a powerful tool for label free ex vivo or in vivo imaging, widely used to investigate structure and organization of endogenous SHG emitting proteins such as myosin or collagen. Polarization resolved SHG microscopy renders supplementary information and is used to probe different molecular states. This development towards functional SHG microscopy is calling for new methods for high speed functional imaging of dynamic processes. In this work we present two approaches with linear polarized light and demonstrate high speed line scan measurements of the molecular dynamics of the motor protein myosin with a time resolution of 1 ms in mammalian muscle cells. Such a high speed functional SHG microscopy has high potential to deliver new insights into structural and temporal molecular dynamics under ex vivo or in vivo conditions. PMID:26977360

  9. DPP4-inhibitor improves neuronal insulin receptor function, brain mitochondrial function and cognitive function in rats with insulin resistance induced by high-fat diet consumption.

    PubMed

    Pipatpiboon, Noppamas; Pintana, Hiranya; Pratchayasakul, Wasana; Chattipakorn, Nipon; Chattipakorn, Siriporn C

    2013-03-01

    High-fat diet (HFD) consumption has been demonstrated to cause peripheral and neuronal insulin resistance, and brain mitochondrial dysfunction in rats. Although the dipeptidyl peptidase-4 inhibitor, vildagliptin, is known to improve peripheral insulin sensitivity, its effects on neuronal insulin resistance and brain mitochondrial dysfunction caused by a HFD are unknown. We tested the hypothesis that vildagliptin prevents neuronal insulin resistance, brain mitochondrial dysfunction, learning and memory deficit caused by HFD. Male rats were divided into two groups to receive either a HFD or normal diet (ND) for 12 weeks, after which rats in each group were fed with either vildagliptin (3 mg/kg/day) or vehicle for 21 days. The cognitive function was tested by the Morris Water Maze prior to brain removal for studying neuronal insulin receptor (IR) and brain mitochondrial function. In HFD rats, neuronal insulin resistance and brain mitochondrial dysfunction were demonstrated, with impaired learning and memory. Vildagliptin prevented neuronal insulin resistance by restoring insulin-induced long-term depression and neuronal IR phosphorylation, IRS-1 phosphorylation and Akt/PKB-ser phosphorylation. It also improved brain mitochondrial dysfunction and cognitive function. Vildagliptin effectively restored neuronal IR function, increased glucagon-like-peptide 1 levels and prevented brain mitochondrial dysfunction, thus attenuating the impaired cognitive function caused by HFD.

  10. High-Dimensional Function Approximation With Neural Networks for Large Volumes of Data.

    PubMed

    Andras, Peter

    2017-01-25

    Approximation of high-dimensional functions is a challenge for neural networks due to the curse of dimensionality. Often the data for which the approximated function is defined resides on a low-dimensional manifold and in principle the approximation of the function over this manifold should improve the approximation performance. It has been show that projecting the data manifold into a lower dimensional space, followed by the neural network approximation of the function over this space, provides a more precise approximation of the function than the approximation of the function with neural networks in the original data space. However, if the data volume is very large, the projection into the low-dimensional space has to be based on a limited sample of the data. Here, we investigate the nature of the approximation error of neural networks trained over the projection space. We show that such neural networks should have better approximation performance than neural networks trained on high-dimensional data even if the projection is based on a relatively sparse sample of the data manifold. We also find that it is preferable to use a uniformly distributed sparse sample of the data for the purpose of the generation of the low-dimensional projection. We illustrate these results considering the practical neural network approximation of a set of functions defined on high-dimensional data including real world data as well.

  11. High-throughput functional annotation and data mining with the Blast2GO suite

    PubMed Central

    Götz, Stefan; García-Gómez, Juan Miguel; Terol, Javier; Williams, Tim D.; Nagaraj, Shivashankar H.; Nueda, María José; Robles, Montserrat; Talón, Manuel; Dopazo, Joaquín; Conesa, Ana

    2008-01-01

    Functional genomics technologies have been widely adopted in the biological research of both model and non-model species. An efficient functional annotation of DNA or protein sequences is a major requirement for the successful application of these approaches as functional information on gene products is often the key to the interpretation of experimental results. Therefore, there is an increasing need for bioinformatics resources which are able to cope with large amount of sequence data, produce valuable annotation results and are easily accessible to laboratories where functional genomics projects are being undertaken. We present the Blast2GO suite as an integrated and biologist-oriented solution for the high-throughput and automatic functional annotation of DNA or protein sequences based on the Gene Ontology vocabulary. The most outstanding Blast2GO features are: (i) the combination of various annotation strategies and tools controlling type and intensity of annotation, (ii) the numerous graphical features such as the interactive GO-graph visualization for gene-set function profiling or descriptive charts, (iii) the general sequence management features and (iv) high-throughput capabilities. We used the Blast2GO framework to carry out a detailed analysis of annotation behaviour through homology transfer and its impact in functional genomics research. Our aim is to offer biologists useful information to take into account when addressing the task of functionally characterizing their sequence data. PMID:18445632

  12. Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions

    SciTech Connect

    Kover, Karen; Yan, Yun; Tong, Pei Ying; Watkins, Dara; Li, Xiaoyu; Tasch, James; Hager, Melissa; Clements, Mark; Moore, Wayne V.

    2015-06-19

    Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up to 72 h. Oxidative stress and viability/mitochondrial function were measured by H{sub 2}O{sub 2} assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H{sub 2}O{sub 2} levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose

  13. Functional carbon nanotubes for high-quality charge transfer and moisture regulation through membranes: structural and functional insights.

    PubMed

    Gugliuzza, Annarosa; Pingitore, Valentino; Miriello, Domenico; Drioli, Enrico

    2015-05-21

    Functional single walled carbon nanotubes (SWCNTs) are assembled onto porous supports by using layer-by-layer (LBL) approaches. Directed nano-assembly of nanotubes is identified as a crucial factor for controlling the combined functions of hybrid-composite membranes, including charge and moisture transport. In both the cases, donor-acceptor interactions are indicated to be responsible for the rearrangement of nanotubes inside the LBL multilayer and their related properties. Aggregation and stratification of the carbon nanotubes along with the availability of selective-site interactions are complementarily investigated by using SEM, Raman and infrared spectroscopy, while high electrical charge and water vapor transfer are achievable, provided that a large number of connections and competitive interactions are allowed. Ohmic behavior is observed for all types of carbon nanotubes, even if better-quality charge transfer pathways are obtained with carboxylated conductive filaments. Likewise, assisted moisture regulation is succeeded when using functional filaments with the capability to establish competitive H-donor-acceptor interactions with water.

  14. Obesity and diabetes as accelerators of functional decline: can lifestyle interventions maintain functional status in high risk older adults?

    PubMed

    Anton, Stephen D; Karabetian, Christy; Naugle, Kelly; Buford, Thomas W

    2013-09-01

    Obesity and diabetes are known risk factors for the development of physical disability among older adults. With the number of seniors with these conditions rising worldwide, the prevention and treatment of physical disability in these persons have become a major public health challenge. Sarcopenia, the progressive loss of muscle mass and strength, has been identified as a common pathway associated with the initial onset and progression of physical disability among older adults. A growing body of evidence suggests that metabolic dysregulation associated with obesity and diabetes accelerates the progression of sarcopenia, and subsequently functional decline in older adults. The focus of this brief review is on the contributions of obesity and diabetes in accelerating sarcopenia and functional decline among older adults. We also briefly discuss the underexplored interaction between obesity and diabetes that may further accelerate sarcopenia and place obese older adults with diabetes at particularly high risk of disability. Finally, we review findings from studies that have specifically tested the efficacy of lifestyle-based interventions in maintaining the functional status of older persons with obesity and/or diabetes.

  15. An investigation into the relationship between age and physiological function in highly active older adults

    PubMed Central

    Pollock, Ross D; Carter, Scott; Velloso, Cristiana P; Duggal, Niharika A; Lord, Janet M; Lazarus, Norman R; Harridge, Stephen D R

    2015-01-01

    Despite extensive research, the relationship between age and physiological function remains poorly characterised and there are currently no reliable markers of human ageing. This is probably due to a number of confounding factors, particularly in studies of a cross-sectional nature. These include inter-subject genetic variation, as well as inter-generational differences in nutrition, healthcare and insufficient levels of physical activity as well as other environmental factors. We have studied a cohort of highly and homogeneously active older male (n = 84) and female (n = 41) cyclists aged 55–79 years who it is proposed represent a model for the study of human ageing free from the majority of confounding factors, especially inactivity. The aim of the study was to identify physiological markers of ageing by assessing the relationship between function and age across a wide range of indices. Each participant underwent a detailed physiological profiling which included measures of cardiovascular, respiratory, neuromuscular, metabolic, endocrine and cognitive functions, bone strength, and health and well-being. Significant associations between age and function were observed for many functions. The maximal rate of oxygen consumption ( showed the closest association with age (r = −0.443 to −0.664; P < 0.001), but even here the variance in age for any given level was high, precluding the clear identification of the age of any individual. The results of this cross-sectional study suggest that even when many confounding variables are removed the relationship between function and healthy ageing is complex and likely to be highly individualistic and that physical activity levels must be taken into account in ageing studies. Key Points The relationship between age and physiological function remains poorly defined and there are no physiological markers that can be used to reliably predict the age of an individual. This could be due to a variety of confounding

  16. High-Resolution MRI of Cardiac Function With Projection Reconstruction and Steady-State Free Precession

    PubMed Central

    Peters, Dana C.; Ennis, Daniel B.; McVeigh, Elliot R.

    2007-01-01

    The purpose of this study was to investigate the trabecular structure of the endocardial wall of the living human heart, and the effect of that structure on the measurement of myocardial function using MRI. High-resolution MR images (0.8 × 0.8 × 8 mm voxels) of cardiac function were obtained in five volunteers using a combination of undersampled projection reconstruction (PR) and steady-state free precession (SSFP) contrast in ECG-gated breath-held scans. These images provide movies of cardiac function with new levels of endocardial detail. The trabecular-papillary muscle complex, consisting of a mixture of blood and endocardial structures, is measured to constitute as much as 50% of the myocardial wall in some sectors. Myocardial wall strain measurements derived from tagged MR images show correlation between regions of trabeculae and papillary muscles and regions of high strain, leading to an overestimation of function in the lateral wall. PMID:12111934

  17. Clinical and functional outcomes in people with schizophrenia with a high sense of well-being.

    PubMed

    Fervaha, Gagan; Agid, Ofer; Takeuchi, Hiroyoshi; Foussias, George; Lee, Jimmy; Remington, Gary

    2015-03-01

    Optimal outcome in schizophrenia is thought to include remission of symptoms, functional recovery, and improved subjective well-being. The present study examined the characteristics of individuals with schizophrenia who report being satisfied with their life in general. Individuals with schizophrenia who participated in the Clinical Antipsychotic Trial of Intervention Effectiveness study were included in the present analysis. Approximately half of the individuals evaluated reported a high level of life satisfaction, even while many concurrently described themselves as at least moderately ill and experiencing moderate-severe symptoms and manifested severe functional deficits. Of all individuals evaluated, only about 1% experienced what was considered to be optimal outcome. Individuals with schizophrenia are able to experience a high level of life satisfaction, despite experiencing severe illness and functional deficits. Those involved in care should be aware that life satisfaction as an outcome is not necessarily associated with symptom remission and superior functioning.

  18. Geochip: A high throughput genomic tool for linking community structure to functions

    SciTech Connect

    Van Nostrand, Joy D.; Liang, Yuting; He, Zhili; Li, Guanghe; Zhou, Jizhong

    2009-01-30

    GeoChip is a comprehensive functional gene array that targets key functional genes involved in the geochemical cycling of N, C, and P, sulfate reduction, metal resistance and reduction, and contaminant degradation. Studies have shown the GeoChip to be a sensitive, specific, and high-throughput tool for microbial community analysis that has the power to link geochemical processes with microbial community structure. However, several challenges remain regarding the development and applications of microarrays for microbial community analysis.

  19. Demonstration of the serum antibody to Epstein-Barr virus specific DNA polymerased (EBV-DP) from patients with nasopharyngeal carcinoma (NPC)

    SciTech Connect

    Tan, R.S.; Li, J.S.; Grill, S.; Nutter, L.M.; Cheng, Y.C.

    1986-03-05

    Raji cells, an EBV genome carrying and nonproducer cell line, treated with tetradecanoyl-phorbol-13-acetate (TPA) and n-butyrate could induce a special DNA polymerase which has properties that are similar to the EBV-DP induced by TPA in P/sub 3/HR-I cells, an EBV producer cell line. Since EBV was found to have a strong association with NPC, and antibodies against EBV proteins or enzymes were found in high levels in sera from these patients, the possible presence of serum antibody against EBV-DP was examined. The serum titer of antibody to EBV-DP was found to have 190 +/- 84 units/ml serum (mean +/- S.D.) in 48 sera from patients with NPC. The titer in 52 healthy donors was 31.4 +/- 28 unit/ml serum (p < 0.01). The antibody was found to be associated with the IgG but not the IgA fraction. The antibody titers against EBV-DP were not correlated with the titer against EBV-DNase or VCA-IgA. Whether the antibody observed is against an EBV-DP core protein or its stimulating protein, as demonstrated by this laboratory previously, is still being investigated. This study demonstrated the high frequency and high titer of antibody against EBV-DP in serum from patients with NPC, and suggested the potential of utilizing this antibody titer to compliment other methods for the early diagnosis or prognosis of NPC.

  20. High functioning individuals with schizophrenia have preserved social perception but not mentalizing abilities.

    PubMed

    Karpouzian, Tatiana M; Alden, Eva C; Reilly, James L; Smith, Matthew J

    2016-03-01

    Social perception and mentalizing are fundamental social cognitive abilities that are related to functioning and are impaired in schizophrenia. A novel approach to examine the relationship between social cognition and community functioning is to first functionally categorize individuals with schizophrenia and then evaluate social cognitive performance. We evaluated differences in social perception and mentalizing among controls (CON, n=45), high functioning individuals with schizophrenia (HF-SCZ, n=36), and individuals with low functioning schizophrenia (LF-SCZ, n=24). Analyses revealed that HF-SCZ had preserved social perceptual abilities compared to LF-SCZ. Both schizophrenia groups had impaired mentalizing abilities compared to CON, but did not differ from each other. These results suggest that HF-SCZ and LF-SCZ are characterized by differences in the perceptual aspects of social cognition and encourage future research to evaluate the neural basis underlying this preserved ability.

  1. Functional specificity for high-level linguistic processing in the human brain.

    PubMed

    Fedorenko, Evelina; Behr, Michael K; Kanwisher, Nancy

    2011-09-27

    Neuroscientists have debated for centuries whether some regions of the human brain are selectively engaged in specific high-level mental functions or whether, instead, cognition is implemented in multifunctional brain regions. For the critical case of language, conflicting answers arise from the neuropsychological literature, which features striking dissociations between deficits in linguistic and nonlinguistic abilities, vs. the neuroimaging literature, which has argued for overlap between activations for linguistic and nonlinguistic processes, including arithmetic, domain general abilities like cognitive control, and music. Here, we use functional MRI to define classic language regions functionally in each subject individually and then examine the response of these regions to the nonlinguistic functions most commonly argued to engage these regions: arithmetic, working memory, cognitive control, and music. We find little or no response in language regions to these nonlinguistic functions. These data support a clear distinction between language and other cognitive processes, resolving the prior conflict between the neuropsychological and neuroimaging literatures.

  2. Interpersonal sensitivity and functioning impairment in youth at ultra-high risk for psychosis.

    PubMed

    Masillo, A; Valmaggia, L R; Saba, R; Brandizzi, M; Lindau, J F; Solfanelli, A; Curto, M; Narilli, F; Telesforo, L; Kotzalidis, G D; Di Pietro, D; D'Alema, M; Girardi, P; Fiori Nastro, P

    2016-01-01

    A personality trait that often elicits poor and uneasy interpersonal relationships is interpersonal sensitivity. The aim of the present study was to explore the relationship between interpersonal sensitivity and psychosocial functioning in individuals at ultra-high risk for psychosis as compared to help-seeking individuals who screened negative for an ultra-high risk of psychosis. A total sample of 147 adolescents and young adult who were help seeking for emerging mental health problems participated in the study. The sample was divided into two groups: 39 individuals who met criteria for an ultra-high-risk mental state (UHR), and 108 (NS). The whole sample completed the Interpersonal Sensitivity Measure (IPSM) and the Global Functioning: Social and Role Scale (GF:SS; GF:RS). Mediation analysis was used to explore whether attenuated negative symptoms mediated the relationship between interpersonal sensitivity and social functioning. Individuals with UHR state showed higher IPSM scores and lower GF:SS and GF:RS scores than NS participants. A statistically negative significant correlation between two IPSM subscales (Interpersonal Awareness and Timidity) and GF:SS was found in both groups. Our results also suggest that the relationship between the aforementioned aspects of interpersonal sensitivity and social functioning was not mediated by negative prodromal symptoms. This study suggests that some aspects of interpersonal sensitivity were associated with low level of social functioning. Assessing and treating interpersonal sensitivity may be a promising therapeutic target to improve social functioning in young help-seeking individuals.

  3. Neuropsychological presentation and adaptive skills in high-functioning adolescents with visual impairment: A preliminary investigation.

    PubMed

    Greenaway, R; Pring, L; Schepers, A; Isaacs, D P; Dale, N J

    2017-01-01

    Studies in infants and young children with congenital visual impairment (VI) have indicated early developmental vulnerabilities, conversely research with older children and adults have highlighted areas of cognitive strength. A minimal amount is known, however, about the possible combination of strengths and weaknesses in adolescence, and this present study therefore aims to explore the neuropsychological presentation and adaptive behavior profile in high-functioning adolescents with congenital VI. Participants completed a battery of commonly used neuropsychological measures assessing memory, executive function, and attention. The measures utilized focused on auditory neuropsychological function, because only subtests that could be completed with auditory administration were suitable for this sample. Parents completed standardized measures of adaptive behavior, executive function, and social communication. Compared to aged-based norms for normal sight, adolescents with VI demonstrated strengths in aspects of working memory and verbal memory. Furthermore, performance across the neuropsychological battery was within or above the average range for the majority of the sample. In contrast, parent-report measures indicated areas of weakness in adaptive functioning, social communication, and behavioral executive functioning. Overall, this study provides preliminary evidence that relative to fully sighted peers, high-functioning adolescents with VI present with an uneven profile of cognitive and adaptive skills, which has important implications for assessment and intervention.

  4. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    PubMed Central

    Du, Yushen; Wu, Nicholas C.; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting

    2016-01-01

    ABSTRACT Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. PMID:27803181

  5. Prepulse Inhibition of the Acoustic Startle Reflex in High Functioning Autism

    PubMed Central

    Gruendler, Theo O. J.; Vogeley, Kai; Klosterkötter, Joachim; Kuhn, Jens

    2014-01-01

    Background High functioning autism is an autism spectrum disorder that is characterized by deficits in social interaction and communication as well as repetitive and restrictive behavior while intelligence and general cognitive functioning are preserved. According to the weak central coherence account, individuals with autism tend to process information detail-focused at the expense of global form. This processing bias might be reflected by deficits in sensorimotor gating, a mechanism that prevents overstimulation during the transformation of sensory input into motor action. Prepulse inhibition is an operational measure of sensorimotor gating, which indicates an extensive attenuation of the startle reflex that occurs when a startling pulse is preceded by a weaker stimulus, the prepulse. Methods In the present study, prepulse inhibition of acoustic startle was compared between 17 adults with high functioning autism and 17 sex-, age-, and intelligence-matched controls by means of electromyography. Results Results indicate that participants with high functioning autism exhibited significantly higher startle amplitudes than the control group. However, groups did not differ with regard to PPI or habituation of startle. Discussion These findings challenge the results of two previous studies that reported prepulse inhibition deficits in high-functioning autism and suggest that sensorimotor gating is only impaired in certain subgroups with autism spectrum disorder. PMID:24643088

  6. Evolution of metabolic disorder in rats fed high sucrose or high fat diet: Focus on redox state and mitochondrial function.

    PubMed

    Long, Zi; Zhang, Xuesi; Sun, Quangui; Liu, Ying; Liao, Nai; Wu, Hao; Wang, Xin; Hai, Chunxu

    2017-02-01

    Glucotoxicity and lipotoxicity are major hallmarks of metabolic disorder. High consumption of fat or carbohydrate rich food is a major risk of metabolic disorder. However, the evolution of high fat or high carbohydrate diet-induced metabolic disorder is not clear. In the study, we tried to find distinguished and common ways involved in the pathogenesis of insulin resistance induced by high fat (HF) and high sucrose (HS) diet. We found that HS diet induced mild glucose intolerance (2month), followed by a "temporary non-symptom phase" (3month), and then induced significant metabolic abnormality (4month). HF diet induced an early "responsive enhancement phase" (2month), and then gradually caused severe metabolic dysfunction (3-4month). After a mild induction of mitochondrial ROS generation (2month), HS diet resulted in a "temporary non-symptom phase" (3month), and then induced a more significant mitochondrial ROS production (4month). The impairment of mitochondrial function induced by HS diet was progressive (2-4month). HF diet induced gradual mitochondrial ROS generation and hyperpolarization. HF diet induced an early "responsive enhancement" of mitochondrial function (2month), and then gradually resulted in severe decrease of mitochondrial function (3-4month). Despite the patterns of HS and HF diet-induced insulin resistance were differential, final mitochondrial ROS generation combined with mitochondrial dysfunction may be the common pathway. These findings demonstrate a novel understanding of the mechanism of insulin resistance and highlight the pivotal role of mitochondrial ROS generation and mitochondrial dysfunction in the pathogenesis of metabolic disorder.

  7. Tunable catalytic properties of bi-functional mixed oxides in ethanol conversion to high value compounds

    SciTech Connect

    Ramasamy, Karthikeyan K.; Gray, Michel J.; Job, Heather M.; Smith, Colin D.; Wang, Yong

    2016-04-10

    tA highly versatile ethanol conversion process to selectively generate high value compounds is pre-sented here. By changing the reaction temperature, ethanol can be selectively converted to >C2alcohols/oxygenates or phenolic compounds over hydrotalcite derived bi-functional MgO–Al2O3cata-lyst via complex cascade mechanism. Reaction temperature plays a role in whether aldol condensationor the acetone formation is the path taken in changing the product composition. This article containsthe catalytic activity comparison between the mono-functional and physical mixture counterpart to thehydrotalcite derived mixed oxides and the detailed discussion on the reaction mechanisms.

  8. Tunable catalytic properties of bi-functional mixed oxides in ethanol conversion to high value compounds

    DOE PAGES

    Ramasamy, Karthikeyan K.; Gray, Michel; Job, Heather; ...

    2016-02-03

    Here, a highly versatile ethanol conversion process to selectively generate high value compounds is presented here. By changing the reaction temperature, ethanol can be selectively converted to >C2 alcohols/oxygenates or phenolic compounds over hydrotalcite derived bi-functional MgO–Al2O3 catalyst via complex cascade mechanism. Reaction temperature plays a role in whether aldol condensation or the acetone formation is the path taken in changing the product composition. This article contains the catalytic activity comparison between the mono-functional and physical mixture counterpart to the hydrotalcite derived mixed oxides and the detailed discussion on the reaction mechanisms.

  9. Tunable catalytic properties of bi-functional mixed oxides in ethanol conversion to high value compounds

    SciTech Connect

    Ramasamy, Karthikeyan K.; Gray, Michel; Job, Heather; Smith, Colin; Wang, Yong

    2016-02-03

    Here, a highly versatile ethanol conversion process to selectively generate high value compounds is presented here. By changing the reaction temperature, ethanol can be selectively converted to >C2 alcohols/oxygenates or phenolic compounds over hydrotalcite derived bi-functional MgO–Al2O3 catalyst via complex cascade mechanism. Reaction temperature plays a role in whether aldol condensation or the acetone formation is the path taken in changing the product composition. This article contains the catalytic activity comparison between the mono-functional and physical mixture counterpart to the hydrotalcite derived mixed oxides and the detailed discussion on the reaction mechanisms.

  10. Virus-specific CD4+ and CD8+ cytotoxic T-cell responses and long-term T-cell memory in individuals vaccinated against polio.

    PubMed

    Wahid, Rahnuma; Cannon, Martin J; Chow, Marie

    2005-05-01

    The presence of poliovirus (PV)-specific CD4(+) T cells in individuals vaccinated against polio has been shown, but CD8(+) T-cell responses have not been described. Here, we functionally characterize the CD4(+) T-cell response and show for the first time that dendritic cells and macrophages can stimulate PV-specific CD8(+) T-cell responses in vitro from vaccinees. Both CD4(+) T and CD8(+) T cells secrete gamma interferon in response to PV antigens and are cytotoxic via the perforin/granzyme B-mediated pathway. Furthermore, the T cells also recognize and kill Sabin 1 vaccine-infected targets. The macrophage-stimulated CD4(+) T and CD8(+) T cells most likely represent memory T cells that persist for long periods in vaccinated individuals. Thus, immunity to PV vaccination involves not only an effective neutralizing antibody titer but also long-term CD4(+) and CD8(+) cytotoxic T-cell responses.

  11. Attenuation of S-cone function at high altitude assessed by electroretinography.

    PubMed

    Schatz, Andreas; Dominik Fischer, M; Schommer, Kai; Zrenner, Eberhart; Bartz-Schmidt, Karl-Ulrich; Gekeler, Florian; Willmann, Gabriel

    2014-04-01

    As impaired S-cone function has been reported psychophysically this study assessed S-cone function during high altitude exposure using electroretinography (ERG) and investigated a possible association with severity of acute mountain sickness (AMS). This work is related to the Tübingen High Altitude Ophthalmology (THAO) study. Standard ERG equipment was used (Diagnosys LLC, Cambridge, UK) with special protocol settings to extract S-cone function. Twelve subjects were analyzed in the current study and examinations were performed in Tübingen, Germany (341m) as baseline and thereafter at the Capanna Margherita, Italy (4559m) at high altitude. Results were compared using a paired t-test. Correlations between ERG measurements and oxygen saturation (SpO2), heart rate (HR) and scores of acute mountain sickness (AMS-C and LL) were calculated using Pearson's correlation coefficients. Amplitudes of S-cone b-waves decreased significantly at high altitude (p=0.02). No significant changes were observed for implicit times of b-waves (p=0.63), a-waves (p=0.75) or for a-wave amplitudes (p=0.78). The incidence of AMS was 50% at high altitude according to AMS-C and LL scores (AMS-C⩾0.7 and LL⩾5). Heart rate increased to 84±10min(-1) and SpO2 decreased to 71.9±5.7% at high altitude. No significant correlation was found between S-cone ERG parameters and SpO2, HR, AMS-C and LL. For the first time our study defines a significant impairment of S-cone function at high altitude time using objective state of the art examination methods. No correlation between the functional impairment of S-cones and levels of AMS was detected.

  12. Anxiety in high-functioning autism: A pilot study of experience sampling using a mobile platform.

    PubMed

    Hare, Dougal Julian; Gracey, Carolyn; Wood, Christopher

    2016-08-01

    Anxiety and stress are everyday issues for many people with high-functioning autism, and while cognitive-behavioural therapy is the treatment of choice for the management of anxiety, there are challenges in using it with people with high-functioning autism. This study used modified experience sampling techniques to examine everyday anxiety and stress in adults with high-functioning autism and to explore the feasibility of delivering real-time stress management techniques using a mobile platform. High levels of anxiety were found to be characterised by worry, confusing thoughts and being alone but was not associated with internal focus, imagery or rumination. Participants reported improved mood and less worry and anxious thinking in the active phase of the study. These results support previous studies indicating that people with high-functioning autism differ in their experience of anxiety and provided preliminary data on the feasibility of real-time stress management. The limitations of this approach are discussed together with considerations for future work in the area of developing clinical interventions on mobile platforms.

  13. High-resolution optical imaging of functional brain architecture in the awake monkey.

    PubMed

    Grinvald, A; Frostig, R D; Siegel, R M; Bartfeld, E

    1991-12-15

    Optical imaging of the functional architecture of cortex, based on intrinsic signals, is a useful tool for the study of the development, organization, and function of the living mammalian brain. This relatively noninvasive technique is based on small activity-dependent changes of the optical properties of cortex. Thus far, functional imaging has been performed only on anesthetized animals. Here we establish that this technique is also suitable for exploring the brain of awake behaving primates. We designed a chronic sealed chamber and mounted it on the skull of a cynomolgus monkey (Macaca fascicularis) over the primary visual cortex to permit imaging through a transparent glass window. Restriction of head position alone was sufficient to eliminate movement noise in awake monkey imaging experiments. High-resolution imaging of the ocular dominance columns and the cytochrome oxidase blobs was achieved simply by taking pictures of the exposed cortex when the awake monkey was viewing video movies alternatively with each eye. Furthermore, the functional maps could be obtained without synchronization of the data acquisition to the animal's respiration and the electrocardiogram. The wavelength dependency and time course of the intrinsic signal were similar in anesthetized and awake monkeys, indicating that the signal sources were the same. We therefore conclude that optical imaging is well suited for exploring functional organization related to higher cognitive brain functions of the primate as well as providing a diagnostic tool for delineating functional cortical borders and assessing proper functions of human patients during neurosurgery.

  14. Heteroclitic Peptides Increase Proliferation and Reduce Evidence of Human Immunodeficiency Virus-Specific CD8⁺ T Cell Dysfunction.

    PubMed

    Adegoke, Adeolu; Gladney, Krista; Gallant, Maureen; Grant, Michael

    2015-10-01

    Human immunodeficiency virus (HIV)-specific CD8(+) T cell dysfunction parallels disease progression; therefore, restoring potent HIV-specific CD8(+) T cell responses is a key therapeutic goal. Certain CD8(+) T cell peptide epitope variants, termed heteroclitic, enhance cytokine production by the HIV-specific CD8(+) T cells of some individuals. In this study, we investigated whether heteroclitic peptides that enhance cytokine production by HIV-specific CD8(+) T cells also reduce functional and phenotypic evidence of HIV-specific CD8(+) T cell exhaustion in those instances. Twenty-four variant peptides of human histocompatibility-linked leukocyte antigen (HLA)-A2-restricted reference HIV peptide epitopes designated as A2-7; Nef 83→91, A2-8; Nef 135→143, A2-Gag; Gag 77→85 and A2-9; Gag 433→440 were synthesized with conservative and semiconservative amino acid substitutions at positions 3, 5, and 7 or 3, 5, and 8 of Gag 433→440. Variants that enhanced interferon-gamma (IFN-γ) and/or interleukin-2 (IL-2) production in enzyme-linked immunospot assays (29 cases overall) were subsequently tested by 7-day in vitro peptide stimulation for their effects on HIV-specific CD8(+) T cell proliferation and programmed death-1 (PD-1) expression. Heteroclitic variants enhanced HIV-specific CD8(+) T cell proliferation by >20% in 13/29 cases tested, reduced PD-1 expression on proliferating cells by 15-50% in 10 cases, and reduced PD-1 expression on proliferating cells by >50% in 3 cases. In five cases, the same heteroclitic peptide increased proliferation by >20% and reduced PD-1 expression by >15%. These data demonstrate that heteroclitic peptides can alter the magnitude and character of HIV-specific CD8(+) cell responses relative to reference peptides and may have a unique immunotherapeutic value in therapeutic vaccines.

  15. Compartmentalization of SIV Replication Within Secondary Lymphoid Tissues of Rhesus Macaques is Linked to Disease Stage and Inversely Related to Localization of Virus-Specific CTL1 2

    PubMed Central

    Connick, Elizabeth; Folkvord, Joy M.; Lind, Katherine T.; Rakasz, Eva G.; Miles, Brodie; Wilson, Nancy A.; Santiago, Mario L.; Schmitt, Kimberly; Stephens, Edward B.; Kim, Hyeon O.; Wagstaff, Reece; Li, Shengbin; Abdelaal, Hadia M.; Kemp, Nathan; Watkins, David I.; MaWhinney, Samantha; Skinner, Pamela J.

    2014-01-01

    We previously demonstrated that HIV replication is concentrated in lymph node B cell follicles during chronic infection and that HIV-specific CTL fail to accumulate in large numbers at those sites. It is unknown whether these observations can be generalized to other secondary lymphoid tissues, or whether virus compartmentalization occurs in the absence of CTL. We evaluated these questions in SIVmac239-infected rhesus macaques by quantifying SIV RNA+ cells and SIV-specific CTL in situ in spleen, lymph nodes and intestinal tissues obtained at several stages of infection. During chronic asymptomatic infection prior to simian AIDS (SAIDS), SIV-producing cells were more concentrated in follicular compared to extrafollicular regions of secondary lymphoid tissues. At day 14 of infection, when CTL have minimal impact on virus replication, there was no compartmentalization of SIV-producing cells. Virus compartmentalization was diminished in animals with SAIDS, which often have low frequency CTL responses. SIV-specific CTL were consistently more concentrated within extrafollicular regions of lymph node and spleen in chronically infected animals regardless of epitope specificity. Frequencies of SIV-specific CTL within follicular and extrafollicular compartments predicted SIV RNA+ cells within these compartments in a mixed model. Few SIV-specific CTL expressed the follicular homing molecule CXCR5 in the absence of the extrafollicular retention molecule CCR7, possibly accounting for the paucity of follicular CTL. These findings bolster the hypothesis that B cell follicles are immune privileged sites and suggest that strategies to augment CTL in B cell follicles could lead to improved viral control and possibly a functional cure for HIV infection. PMID:25362178

  16. Hypervariable Domains of nsP3 Proteins of New World and Old World Alphaviruses Mediate Formation of Distinct, Virus-Specific Protein Complexes

    PubMed Central

    Foy, Niall J.; Akhrymuk, Maryna; Akhrymuk, Ivan; Atasheva, Svetlana; Bopda-Waffo, Alain; Frolov, Ilya

    2013-01-01

    Alphaviruses are a group of single-stranded RNA viruses with genomes of positive polarity. They are divided into two geographically isolated groups: the Old World and the New World alphaviruses. Despite their similar genome organizations and virion structures, they differ in many aspects of pathogenesis and interaction with the host cell. Here we present new data highlighting previously unknown differences between these two groups. We found that nsP3 proteins of Sindbis virus (SINV) and Venezuelan equine encephalitis virus (VEEV) form cytoplasmic complexes with different morphologies and protein compositions. Unlike the amorphous aggregates formed by SINV nsP3 and other Old World alphavirus-specific nsP3s, VEEV nsP3 forms unique, large spherical structures with striking symmetry. Moreover, VEEV nsP3 does not interact with proteins previously identified as major components of SINV nsP3 complexes, such as G3BP1 and G3BP2. Importantly, the morphology of the complexes and the specificity of the interaction with cellular proteins are largely determined by the hypervariable domain (HVD) of nsP3. Replacement of the VEEV nsP3 HVD with the corresponding domain of SINV nsP3 rendered this protein capable of interaction with G3BPs. Conversely, replacement of the SINV nsP3 HVD with that of VEEV abolished SINV nsP3's interaction with G3BPs. The replacement of natural HVDs with those from heterologous viruses did not abrogate virus replication, despite these fragments demonstrating very low levels of sequence identity. Our data suggest that in spite of the differences in morphology and composition of the SINV- and VEEV-specific nsP3 complexes, it is likely that they have similar functions in virus replication and modification of the cellular environment. PMID:23221551

  17. Transport/magnetotransport of high-performance graphene transistors on organic molecule-functionalized substrates.

    PubMed

    Chen, Shao-Yu; Ho, Po-Hsun; Shiue, Ren-Jye; Chen, Chun-Wei; Wang, Wei-Hua

    2012-02-08

    In this article, we present the transport and magnetotransport of high-quality graphene transistors on conventional SiO(2)/Si substrates by modification with organic molecule octadecyltrichlorosilane (OTS) self-assembled monolayers (SAMs). Graphene devices on OTS SAM-functionalized substrates with high carrier mobility, low intrinsic doping, suppressed carrier scattering, and reduced thermal activation of resistivity at room temperature were observed. Most interestingly, the remarkable magnetotransport of graphene devices with pronounced quantum Hall effect, strong Shubnikov-de Haas oscillations, a nonzero Berry's phase, and a short carrier scattering time also confirms the high quality of graphene on this ultrasmooth organic SAM-modified platform. The high-performance graphene transistors on the solution-processable OTS SAM-functionalized SiO(2)/Si substrates are promising for the future development of large-area and low-cost fabrications of graphene-based nanoelectronics.

  18. Escape from neutralization by the respiratory syncytial virus-specific neutralizing monoclonal antibody palivizumab is driven by changes in on-rate of binding to the fusion protein.

    PubMed

    Bates, John T; Keefer, Christopher J; Slaughter, James C; Kulp, Daniel W; Schief, William R; Crowe, James E

    2014-04-01

    The role of binding kinetics in determining neutralizing potency for antiviral antibodies is poorly understood. While it is believed that increased steady-state affinity correlates positively with increased virus-neutralizing activity, the relationship between association or dissociation rate and neutralization potency is unclear. We investigated the effect of naturally-occurring antibody resistance mutations in the RSV F protein on the kinetics of binding to palivizumab. Escape from palivizumab-mediated neutralization of RSV occurred with reduced association rate (Kon) for binding to RSV F protein, while alteration of dissociation rate (Koff) did not significantly affect neutralizing activity. Interestingly, linkage of reduced Kon with reduced potency mirrored the effect of increased Kon found in a high-affinity enhanced potency palivizumab variant (motavizumab). These data suggest that association rate is the dominant factor driving neutralization potency for antibodies to RSV F protein antigenic site A and determines the potency of antibody somatic variants or efficiency of escape of viral glycoprotein variants.

  19. An attenuated Lassa vaccine in SIV-infected rhesus macaques does not persist or cause arenavirus disease but does elicit Lassa virus-specific immunity

    PubMed Central

    2013-01-01

    Background Lassa hemorrhagic fever (LHF) is a rodent-borne viral disease that can be fatal for human beings. In this study, an attenuated Lassa vaccine candidate, ML29, was tested in SIV-infected rhesus macaques for its ability to elicit immune responses without instigating signs pathognomonic for arenavirus disease. ML29 is a reassortant between Lassa and Mopeia viruses that causes a transient infection in non-human primates and confers sterilizing protection from lethal Lassa viral challenge. However, since the LHF endemic area of West Africa also has high HIV seroprevalence, it is important to determine whether vaccination could be safe in the context of HIV infection. Results SIV-infected and uninfected rhesus macaques were vaccinated with the ML29 virus and monitored for specific humoral and cellular immune responses, as well as for classical and non-classical signs of arenavirus disease. Classical disease signs included viremia, rash, respiratory distress, malaise, high liver enzyme levels, and virus invasion of the central nervous system. Non-classical signs, derived from profiling the blood transcriptome of virulent and non-virulent arenavirus infections, included increased expression of interferon-stimulated genes (ISG) and decreased expression of COX2, IL-1β, coagulation intermediates and nuclear receptors needed for stress signaling. All vaccinated monkeys showed ML29-specific antibody responses and ML29-specific cell-mediated immunity. Conclusion SIV-infected and uninfected rhesus macaques responded similarly to ML29 vaccination, and none developed chronic arenavirus infection. Importantly, none of the macaques developed signs, classical or non-classical, of arenavirus disease. PMID:23402317

  20. High capacity and high density functional conductive polymer and SiO anode for high-energy lithium-ion batteries.

    PubMed

    Zhao, Hui; Yuca, Neslihan; Zheng, Ziyan; Fu, Yanbao; Battaglia, Vincent S; Abdelbast, Guerfi; Zaghib, Karim; Liu, Gao

    2015-01-14

    High capacity and high density functional conductive polymer binder/SiO electrodes are fabricated and calendered to various porosities. The effect of calendering is investigated in the reduction of thickness and porosity, as well as the increase of density. SiO particle size remains unchanged after calendering. When compressed to an appropriate density, an improved cycling performance and increased energy density are shown compared to the uncalendered electrode and overcalendered electrode. The calendered electrode has a high-density of ∼1.2 g/cm(3). A high loading electrode with an areal capacity of ∼3.5 mAh/cm(2) at a C/10 rate is achieved using functional conductive polymer binder and simple and effective calendering method.

  1. Modified effective dielectric function for metallic granular composites with high percolation threshold.

    PubMed

    Su, Xiong-Rui; Zhang, Zong-Suo; Liu, Shao-Ding; Hao, Zhong-Hua

    2010-03-01

    We propose the effective dielectric function theory of metal granular composites modified with the metal particle size. The modified theory is used to explain the electrical conductivity, resonant plasmon absorption, and large nonlinear absorption of Au-TiO2 granular composite films with high-density metallic particles and a high electric percolation threshold. It is revealed that the decreasing metal particle size leads to an increasing percolation threshold and large enhancement of optical nonlinearity of the composites.

  2. Viruses as Modulators of Mitochondrial Functions

    PubMed Central

    Anand, Sanjeev K.; Tikoo, Suresh K.

    2013-01-01

    Mitochondria are multifunctional organelles with diverse roles including energy production and distribution, apoptosis, eliciting host immune response, and causing diseases and aging. Mitochondria-mediated immune responses might be an evolutionary adaptation by which mitochondria might have prevented the entry of invading microorganisms thus establishing them as an integral part of the cell. This makes them a target for all the invading pathogens including viruses. Viruses either induce or inhibit various mitochondrial processes in a highly specific manner so that they can replicate and produce progeny. Some viruses encode the Bcl2 homologues to counter the proapoptotic functions of the cellular and mitochondrial proteins. Others modulate the permeability transition pore and either prevent or induce the release of the apoptotic proteins from the mitochondria. Viruses like Herpes simplex virus 1 deplete the host mitochondrial DNA and some, like human immunodeficiency virus, hijack the host mitochondrial proteins to function fully inside the host cell. All these processes involve the participation of cellular proteins, mitochondrial proteins, and virus specific proteins. This review will summarize the strategies employed by viruses to utilize cellular mitochondria for successful multiplication and production of progeny virus. PMID:24260034

  3. Naringin Improves Neuronal Insulin Signaling, Brain Mitochondrial Function, and Cognitive Function in High-Fat Diet-Induced Obese Mice.

    PubMed

    Wang, Dongmei; Yan, Junqiang; Chen, Jing; Wu, Wenlan; Zhu, Xiaoying; Wang, Yong

    2015-10-01

    The epidemic and experimental studies have confirmed that the obesity induced by high-fat diet not only caused neuronal insulin resistance, but also induced brain mitochondrial dysfunction as well as learning impairment in mice. Naringin has been reported to posses biological functions which are beneficial to human cognitions, but its protective effects on HFD-induced cognitive deficits and underlying mechanisms have not been well characterized. In the present study Male C57BL/6 J mice were fed either a control or high-fat diet for 20 weeks and then randomized into four groups treated with their respective diets including control diet, control diet + naringin, high-fat diet (HFD), and high-fat diet + naringin (HFDN). The behavioral performance was assessed by using novel object recognition test and Morris water maze test. Hippocampal mitochondrial parameters were analyzed. Then the protein levels of insulin signaling pathway and the AMP-activated protein kinase (AMPK) in the hippocampus were detected by Western blot method. Our results showed that oral administration of naringin significantly improved the learning and memory abilities as evidenced by increasing recognition index by 52.5% in the novel object recognition test and inducing a 1.05-fold increase in the crossing-target number in the probe test, and ameliorated mitochondrial dysfunction in mice caused by HFD consumption. Moreover, naringin significantly enhanced insulin signaling pathway as indicated by a 34.5% increase in the expression levels of IRS-1, a 47.8% decrease in the p-IRS-1, a 1.43-fold increase in the p-Akt, and a 1.89-fold increase in the p-GSK-3β in the hippocampus of the HFDN mice versus HFD mice. Furthermore, the AMPK activity significantly increased in the naringin-treated (100 mg kg(-1) d(-1)) group. These findings suggest that an enhancement in insulin signaling and a decrease in mitochondrial dysfunction through the activation of AMPK may be one of the mechanisms that naringin

  4. Functional genomic and high-content screening for target discovery and deconvolution

    PubMed Central

    Heynen-Genel, Susanne; Pache, Lars; Chanda, Sumit K

    2014-01-01

    Introduction Functional genomic screens apply knowledge gained from the sequencing of the human genome toward rapid methods of identifying genes involved in cellular function based on a specific phenotype. This approach has been made possible through the use of advances in both molecular biology and automation. The utility of this approach has been further enhanced through the application of image-based high content screening, an automated microscopy and quantitative image analysis platform. These approaches can significantly enhance acquisition of novel targets for drug discovery. Areas covered Both the utility and potential issues associated with functional genomic screening approaches are discussed along with examples that illustrate both. The considerations for high content screening applied to functional genomics are also presented. Expert opinion Functional genomic and high content screening are extremely useful in the identification of new drug targets. However, the technical, experimental, and computational parameters have an enormous influence on the results. Thus, although new targets are identified, caution should be applied toward interpretation of screening data in isolation. Genomic screens should be viewed as an integral component of a target identification campaign that requires both the acquisition of orthogonal data, as well as a rigorous validation strategy. PMID:22860749

  5. High frame rate retrospectively triggered Cine MRI for assessment of murine diastolic function.

    PubMed

    Coolen, Bram F; Abdurrachim, Desiree; Motaal, Abdallah G; Nicolay, Klaas; Prompers, Jeanine J; Strijkers, Gustav J

    2013-03-01

    To assess left ventricular (LV) diastolic function in mice with Cine MRI, a high frame rate (>60 frames per cardiac cycle) is required. For conventional electrocardiography-triggered Cine MRI, the frame rate is inversely proportional to the pulse repetition time (TR). However, TR cannot be lowered at will to increase the frame rate because of gradient hardware, spatial resolution, and signal-to-noise limitations. To overcome these limitations associated with electrocardiography-triggered Cine MRI, in this paper, we introduce a retrospectively triggered Cine MRI protocol capable of producing high-resolution high frame rate Cine MRI of the mouse heart for addressing left ventricular diastolic function. Simulations were performed to investigate the influence of MRI sequence parameters and the k-space filling trajectory in relation to the desired number of frames per cardiac cycle. An optimized protocol was applied in vivo and compared with electrocardiography-triggered Cine for which a high-frame rate could only be achieved by several interleaved acquisitions. Retrospective high frame rate Cine MRI proved superior to the interleaved electrocardiography-triggered protocols. High spatial-resolution Cine movies with frames rates up to 80 frames per cardiac cycle were obtained in 25 min. Analysis of left ventricular filling rate curves allowed accurate determination of early and late filling rates and revealed subtle impairments in left ventricular diastolic function of diabetic mice in comparison with nondiabetic mice.

  6. High temperature partition functions and thermodynamic data for ammonia and phosphine

    NASA Astrophysics Data System (ADS)

    Sousa-Silva, Clara; Hesketh, Nicholas; Yurchenko, Sergei N.; Hill, Christian; Tennyson, Jonathan

    2014-07-01

    The total internal partition function of ammonia (14NH3) and phosphine (31PH3) are calculated as a function of temperature by explicit summation of 153 million (for PH3) and 7.5 million (for NH3) theoretical rotation-vibrational energy levels. High accuracy estimates are obtained for the specific heat capacity, Cp, the Gibbs enthalpy function, gef, the Helmholtz function, hcf, and the entropy, S, of gas phase molecules as a function of temperature. In order to reduce the computational costs associated with the high rotational excitations, only the A-symmetry energy levels are used above a certain threshold of the total angular momentum number J. With this approach levels are summed up to dissociation energy for values of Jmax=45 and 100 for ammonia (Emax=41 051 cm-1) and phosphine (Emax=28 839.7 cm-1), respectively. Estimates of the partition function are converged for all temperatures considered for phosphine and below 3000 K for ammonia. All other thermodynamic properties are converged to at least 2000 K for ammonia and fully converged for phosphine.

  7. Selective Loss of Early Differentiated, Highly Functional PD1high CD4 T Cells with HIV Progression

    PubMed Central

    Paris, Robert M.; Petrovas, Constantinos; Ferrando-Martinez, Sara; Moysi, Eirini; Boswell, Kristin L.; Archer, Eva; Yamamoto, Takuya; Ambrozak, David; Casazza, Joseph P.; Haubrich, Richard; Connors, Mark; Ake, Julie; Kim, Jerome H.; Koup, Richard A.

    2015-01-01

    The role of PD-1 expression on CD4 T cells during HIV infection is not well understood. Here, we describe the differential expression of PD-1 in CD127high CD4 T cells within the early/intermediate differentiated (EI) (CD27highCD45RAlow) T cell population among uninfected and HIV-infected subjects, with higher expression associated with decreased viral replication (HIV-1 viral load). A significant loss of circulating PD-1highCTLA-4low CD4 T cells was found specifically in the CD127highCD27highCD45RAlow compartment, while initiation of antiretroviral treatment, particularly in subjects with advanced disease, reversed these dynamics. Increased HIV-1 Gag DNA was also found in PD-1high compared to PD-1low ED CD4 T cells. In line with an increased susceptibility to HIV infection, PD-1 expression in this CD4 T cell subset was associated with increased activation and expression of the HIV co-receptor, CCR5. Rather than exhaustion, this population produced more IFN-g, MIP1-a, IL-4, IL-10, and IL-17a compared to PD-1low EI CD4 T cells. In line with our previous findings, PD-1high EI CD4 T cells were also characterized by a high expression of CCR7, CXCR5 and CCR6, a phenotype associated with increased in vitro B cell help. Our data show that expression of PD-1 on early-differentiated CD4 T cells may represent a population that is highly functional, more susceptible to HIV infection and selectively lost in chronic HIV infection. PMID:26678998

  8. Escape from neutralization by the respiratory syncytial virus-specific neutralizing monoclonal antibody palivizumab is driven by changes in on-rate of binding to the fusion protein

    SciTech Connect

    Bates, John T.; Keefer, Christopher J.; Slaughter, James C.; Kulp, Daniel W.; Schief, William R.

    2014-04-15

    The role of binding kinetics in determining neutralizing potency for antiviral antibodies is poorly understood. While it is believed that increased steady-state affinity correlates positively with increased virus-neutralizing activity, the relationship between association or dissociation rate and neutralization potency is unclear. We investigated the effect of naturally-occurring antibody resistance mutations in the RSV F protein on the kinetics of binding to palivizumab. Escape from palivizumab-mediated neutralization of RSV occurred with reduced association rate (K{sub on}) for binding to RSV F protein, while alteration of dissociation rate (K{sub off}) did not significantly affect neutralizing activity. Interestingly, linkage of reduced K{sub on} with reduced potency mirrored the effect of increased K{sub on} found in a high-affinity enhanced potency palivizumab variant (motavizumab). These data suggest that association rate is the dominant factor driving neutralization potency for antibodies to RSV F protein antigenic site A and determines the potency of antibody somatic variants or efficiency of escape of viral glycoprotein variants. - Highlights: • The relationship of affinity to neutralization for virus antibodies is uncertain. • Palivizumab binds to RSV escape mutant fusion proteins, but with reduced affinity. • Association rate (K{sub on}) correlated well with the potency of neutralization.

  9. Centralized PI control for high dimensional multivariable systems based on equivalent transfer function.

    PubMed

    Luan, Xiaoli; Chen, Qiang; Liu, Fei

    2014-09-01

    This article presents a new scheme to design full matrix controller for high dimensional multivariable processes based on equivalent transfer function (ETF). Differing from existing ETF method, the proposed ETF is derived directly by exploiting the relationship between the equivalent closed-loop transfer function and the inverse of open-loop transfer function. Based on the obtained ETF, the full matrix controller is designed utilizing the existing PI tuning rules. The new proposed ETF model can more accurately represent the original processes. Furthermore, the full matrix centralized controller design method proposed in this paper is applicable to high dimensional multivariable systems with satisfactory performance. Comparison with other multivariable controllers shows that the designed ETF based controller is superior with respect to design-complexity and obtained performance.

  10. Perception and Lateralization of Spoken Emotion by Youths with High-Functioning Forms of Autism

    ERIC Educational Resources Information Center

    Baker, Kimberly F.; Montgomery, Allen A.; Abramson, Ruth

    2010-01-01

    The perception and the cerebral lateralization of spoken emotions were investigated in children and adolescents with high-functioning forms of autism (HFFA), and age-matched typically developing controls (TDC). A dichotic listening task using nonsense passages was used to investigate the recognition of four emotions: happiness, sadness, anger, and…

  11. Examining the Effects of Functional Assessment-Based Interventions with High School Students

    ERIC Educational Resources Information Center

    Bruhn, Allison L.; Kaldenberg, Erica; Bappe, Kemlyn Tan; Brandsmeier, Brian; Rila, Ashley; Lanphier, Lindsay; Lewis, Megan; Slater, Alexandra

    2016-01-01

    In two studies, the systematic approach to designing functional assessment-based interventions (FABIs) created by Umbreit, Ferro, Liaupsin, and Lane (2007) was used with high school students receiving special education services in self-contained classrooms reserved for students with persistent behavior problems. In Study 1, an AB design was used…

  12. Supporting the Spectrum Hypothesis: Self-Reported Temperament in Children and Adolescents with High Functioning Autism

    ERIC Educational Resources Information Center

    Burrows, Catherine A.; Usher, Lauren V.; Schwartz, Caley B.; Mundy, Peter C.; Henderson, Heather A.

    2016-01-01

    This study tested the "spectrum hypothesis," which posits that children and adolescents with high functioning autism (HFA) differ "quantitatively" but not "qualitatively" from typically developing peers on self-reported temperament. Temperament refers to early-appearing, relatively stable behavioral and emotional…

  13. Sex Differences in WISC-III Profiles of Children with High-Functioning Pervasive Developmental Disorders

    ERIC Educational Resources Information Center

    Koyama, Tomonori; Kamio, Yoko; Inada, Naoko; Kurita, Hiroshi

    2009-01-01

    Using the Japanese version of the Wechsler Intelligence Scale for Children-Third Edition (WISC-III), 26 girls with high-functioning (IQ greater than or equal to 70) pervasive developmental disorders (HFPDD) (mean age, 8.2 years) were compared with 116 boys with HFPDD (mean age, 9.0 years). Compared with the boys, the girls scored significantly…

  14. The Experiences and Needs of Female Adults with High-Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Baldwin, Susanna; Costley, Debra

    2016-01-01

    There is limited large-scale research into the lived experiences of female adults who have an autism spectrum disorder with no co-occurring intellectual disability. Drawing on the findings of an Australia-wide survey, this report presents self-report data from n = 82 women with high-functioning autism spectrum disorder in the areas of health,…

  15. WISC-IV and WIAT-II Profiles in Children with High-Functioning Autism

    ERIC Educational Resources Information Center

    Mayes, Susan Dickerson; Calhoun, Susan L.

    2008-01-01

    Children with high-functioning autism earned above normal scores on the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) Perceptual Reasoning and Verbal Comprehension Indexes and below normal scores on the Working Memory and Processing Speed Indexes and Wechsler Individual Achievement Test-Second Edition (WIAT-II) Written…

  16. Metaphor Comprehension in Autistic Spectrum Disorders: Case Studies of Two High-Functioning Children

    ERIC Educational Resources Information Center

    Melogno, Sergio; D'Ardia, Caterina; Pinto, Maria Antonietta; Levi, Gabriel

    2012-01-01

    This article presents case studies on metaphor comprehension in two boys with high-functioning autistic spectrum disorder, aged 9;1 (9 years, 1 month) and 8;11. The participants were assessed twice, before and after an intervention program aimed at improving their social skills. The focus of the article is on the specific patterns exhibited by…

  17. Reading Comprehension Profiles of High-Functioning Students on the Autism Spectrum: A Grounded Theory

    ERIC Educational Resources Information Center

    Williamson, Pamela; Carnahan, Christina R.; Jacobs, Jennifer A.

    2012-01-01

    Using a constructivist grounded theory approach, this study sought to understand what influences reading comprehension and how meaning is made from text among high-functioning individuals with autism spectrum disorder (ASD). Using a think-aloud procedure, 13 individuals ages 7-13 with ASD read 16 passages at their instructional reading level.…

  18. How Stimulus and Task Complexity Affect Monitoring in High-Functioning Adults with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Koolen, Sophieke; Vissers, Constance Th. W. M.; Egger, Jos I. M.; Verhoeven, Ludo

    2014-01-01

    The present study examined whether individuals with autism spectrum disorder (ASD) are able to update and monitor working memory representations of visual input, and whether performance is influenced by stimulus and task complexity. 15 high-functioning adults with ASD and 15 controls were asked to allocate either elements of abstract figures or…

  19. Gestalt Perception and Local-Global Processing in High-Functioning Autism

    ERIC Educational Resources Information Center

    Bolte, Sven; Holtmann, Martin; Poustka, Fritz; Scheurich, Armin; Schmidt, Lutz

    2007-01-01

    This study examined gestalt perception in high-functioning autism (HFA) and its relation to tasks indicative of local visual processing. Data on of gestalt perception, visual illusions (VI), hierarchical letters (HL), Block Design (BD) and the Embedded Figures Test (EFT) were collected in adult males with HFA, schizophrenia, depression and…

  20. Key Components of Successful Sexuality Education for High Functioning Students with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Greiert, Brittany Sovran

    2016-01-01

    To date, there is very little existing research on the sexuality education of high functioning adolescents with Autism Spectrum Disorder (ASD) even though current research suggests that 1 in 68 children are diagnosed with ASD (CDC, 2014). Through group consensus of experts in ASD representing families, school-based professionals, and researchers,…

  1. Group Social Skills Instruction for Adolescents with High-Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    White, Susan W.; Koenig, Kathleen; Scahill, Lawrence

    2010-01-01

    Given the increased recognition of autism spectrum disorders (ASD) and the chronic and pervasive nature of associated deficits, there is a pressing need for effective treatments. The feasibility and preliminary efficacy of a structured, group social skills training program for high-functioning youth with ASD was examined in this study. Fifteen…

  2. Narrative Ability in High-Functioning Children with Autism or Asperger's Syndrome.

    ERIC Educational Resources Information Center

    Losh, Molly; Capps, Lisa

    2003-01-01

    A study examined the narrative abilities of 28 high-functioning children (ages 8-14) with autism or Asperger syndrome and 22 controls across two different discourse contexts. Compared to controls, the subjects performed relatively well in the storybook context but exhibited difficulty imbuing their narratives of personal experience with more…

  3. Superior Nonverbal Intelligence in Children with High-Functioning Autism or Asperger's Syndrome

    ERIC Educational Resources Information Center

    Chen, Fei; Planche, Pascale; Lemonnier, Eric

    2010-01-01

    Some early studies showed discordance in cognitive strengths and weaknesses in individuals with high-functioning autism (HFA) or Asperger's syndrome (AS). The present study administered the French version of Colored Raven's Progressive Matrices in 14 children with HFA/AS and in 26 chronological age matched peers with typical development. We found…

  4. Brief Report: Inhibitory Control of Socially Relevant Stimuli in Children with High Functioning Autism

    ERIC Educational Resources Information Center

    Geurts, Hilde M.; Begeer, Sander; Stockmann, Lex

    2009-01-01

    The current study explored whether inhibitory control deficits in high functioning autism (HFA) emerged when socially relevant stimuli were used and whether arousal level affected the performance. A Go/NoGo paradigm, with socially relevant stimuli and varying presentation rates, was applied in 18 children with HFA (including children with autism…

  5. Linguistic Characteristics of Individuals with High Functioning Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Seung, Hye Kyeung

    2007-01-01

    This study examined the linguistic characteristics of high functioning individuals with autism and Asperger syndrome. Each group consisted of 10 participants who were matched on sex, chronological age, and intelligence scores. Participants generated a narrative after watching a brief video segment of the Social Attribution Task video. Each…

  6. Becoming Social: Interventions with Youth Who Have High-Functioning Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Blacher, Jan; Howell, Erica

    2008-01-01

    Many adults come up short on social skills. Some of these may be co-workers, friends, or family members who make occasional blunders. Some of these individuals may experience marked social skills deficits throughout life, as is the case with young adults who are diagnosed with High Functioning Autism or Asperger Syndrome (HFA/AS). Following years…

  7. Disembedding Performance in Children and Adolescents with Asperger Syndrome or High-Functioning Autism

    ERIC Educational Resources Information Center

    Kaland, Nils; Mortensen, Erik Lykke; Smith, Lars

    2007-01-01

    The aim of the present study was to assess the findings, reported in earlier studies, that individuals with autism spectrum disorders process visuo-spatial tasks faster than typically developing control persons. The participants in the present study were children and adolescents with Asperger syndrome (AS) or high-functioning autism (HFA) (N =…

  8. Personal Perspectives about Sustaining Inclusion in School Environments for Children with High Functioning Autism

    ERIC Educational Resources Information Center

    Wiatr, Jeanne Malecki

    2016-01-01

    Students, at a partial hospital setting in Western Tennessee with high functioning autism spectrum disorders (HFASD) were being removed from general education classrooms. Researchers have indicated that restrictive settings preclude interaction with neurotypical peers and access to general education experiences. The purpose of this case study was…

  9. Pragmatic Inference Abilities in Individuals with Asperger Syndrome or High-Functioning Autism. A Review

    ERIC Educational Resources Information Center

    Loukusa, Soile; Moilanen, Irma

    2009-01-01

    This review summarizes studies involving pragmatic language comprehension and inference abilities in individuals with Asperger syndrome or high-functioning autism. Systematic searches of three electronic databases, selected journals, and reference lists identified 20 studies meeting the inclusion criteria. These studies were evaluated in terms of:…

  10. Theory of Mind and Central Coherence in Adults with High-Functioning Autism or Asperger Syndrome

    ERIC Educational Resources Information Center

    Beaumont, Renae; Newcombe, Peter

    2006-01-01

    The study investigated theory of mind and central coherence abilities in adults with high-functioning autism (HFA) or Asperger syndrome (AS) using naturalistic tasks. Twenty adults with HFA/AS correctly answered significantly fewer theory of mind questions than 20 controls on a forced-choice response task. On a narrative task, there were no…

  11. Psychological and Neurobehavioral Comparisons of Children with Asperger's Disorder versus High-Functioning Autism

    ERIC Educational Resources Information Center

    Thede, Linda L.; Coolidge, Frederick L.

    2007-01-01

    This study investigated personality and neurobehavioral differences between 16 children with Asperger's Disorder, 15 children with High-Functioning Autism (HFA), and 31 controls, all ranging in age from 5-17 years, M age = 10.7 years, SD = 3.0. Parents rated their children's behaviors on a 44-item autistic symptoms survey and on the 200-item…

  12. Brief Report: Biochemical Correlates of Clinical Impairment in High Functioning Autism and Asperger's Disorder

    ERIC Educational Resources Information Center

    Kleinhans, Natalia M.; Richards, Todd; Weaver, Kurt E.; Liang, Olivia; Dawson, Geraldine; Aylward, Elizabeth

    2009-01-01

    Amygdala dysfunction has been proposed as a critical contributor to social impairment in autism spectrum disorders (ASD). The current study investigated biochemical abnormalities in the amygdala in 20 high functioning adults with autistic disorder or Asperger's disorder and 19 typically developing adults matched on age and IQ. Magnetic resonance…

  13. Investigating Multitasking in High-Functioning Adolescents with Autism Spectrum Disorders Using the Virtual Errands Task

    ERIC Educational Resources Information Center

    Rajendran, Gnanathusharan; Law, Anna S.; Logie, Robert H.; van der Meulen, Marian; Fraser, Diane; Corley, Martin

    2011-01-01

    Using a modified version of the Virtual Errands Task (VET; McGeorge et al. in "Presence-Teleop Virtual Environ" 10(4):375-383, 2001), we investigated the executive ability of multitasking in 18 high-functioning adolescents with ASD and 18 typically developing adolescents. The VET requires multitasking (Law et al. in "Acta Psychol" 122(1):27-44,…

  14. Synthesis and characterization of highly functionalized symmetric aromatic hexa-ol intermediates from oleic acid.

    PubMed

    Song, Dong; Narine, Suresh S

    2008-09-01

    A novel highly functionalized aromatic hexa-ol was synthesized by palladium-catalyzed cyclotrimerization of an alkyne fatty acid ester followed by LAH reduction. This polyol product is a novel monomer made from a renewable lipid raw material for the production of polyurethanes, polyesters and polyamides.

  15. Story Recall and Narrative Coherence of High-Functioning Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Diehl, Joshua J.; Bennetto, Loisa; Young, Edna Carter

    2006-01-01

    Previous research has found few quantitative differences between children with high-functioning autism spectrum disorders (ASDs) and well-matched controls in the length, complexity, and structure of their narratives. Researchers have noted, however, that narratives of children with ASDs have an unusual and idiosyncratic nature. This study provides…

  16. Sensory Sensitivities and Performance on Sensory Perceptual Tasks in High-Functioning Individuals with Autism

    ERIC Educational Resources Information Center

    Minshew, Nancy J.; Hobson, Jessica A.

    2008-01-01

    Most reports of sensory symptoms in autism are second hand or observational, and there is little evidence of a neurological basis. Sixty individuals with high-functioning autism and 61 matched typical participants were administered a sensory questionnaire and neuropsychological tests of elementary and higher cortical sensory perception. Thirty-two…

  17. Brief Report: Imitation of Meaningless Gestures in Individuals with Asperger Syndrome and High-Functioning Autism

    ERIC Educational Resources Information Center

    Stieglitz Ham, Heidi; Corley, Martin; Rajendran, Gnanathusharan; Carletta, Jean; Swanson, Sara

    2008-01-01

    Nineteen people with Asperger syndrome (AS)/High-Functioning Autism (HFA) (ages 7-15) were tested on imitation of two types of meaningless gesture: hand postures and finger positions. The individuals with AS/HFA achieved lower scores in the imitation of both hand and finger positions relative to a matched neurotypical group. The between-group…

  18. Judgments of Social Awkwardness from Brief Exposure to Children with and without High-Functioning Autism

    ERIC Educational Resources Information Center

    Grossman, Ruth B

    2015-01-01

    We form first impressions of many traits based on very short interactions. This study examines whether typical adults judge children with high-functioning autism to be more socially awkward than their typically developing peers based on very brief exposure to still images, audio-visual, video-only, or audio-only information. We used video and…

  19. Social Skill Deficits and Anxiety in High-Functioning Adolescents with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Bellini, S.

    2004-01-01

    The present study examined the prevalence and types of anxiety exhibited by high-functioning adolescents with autism spectrum disorders and factors related to this anxiety. Results suggest that adolescents with autism spectrum disorders exhibit anxiety levels that are significantly higher than those of the general population. The study found a low…

  20. Brief Report: The Assessment of Anxiety in High-Functioning Adolescents with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    White, Susan W.; Schry, Amie R.; Maddox, Brenna B.

    2012-01-01

    Anxiety may exacerbate interpersonal difficulties and contribute to secondary behavioral problems in adolescents with High-Functioning Autism Spectrum Disorder (HFASD). This study was conducted to assess the psychometric properties and construct validity of measures of anxiety with a sample (n = 30) of adolescents with HFASD and comorbid anxiety…

  1. High-intensity knee extensor training restores skeletal muscle function in COPD patients.

    PubMed

    Brønstad, Eivind; Rognmo, Oivind; Tjonna, Arnt Erik; Dedichen, Hans Henrich; Kirkeby-Garstad, Idar; Håberg, Asta K; Bjørk Ingul, Charlotte; Wisløff, Ulrik; Steinshamn, Sigurd

    2012-11-01

    Improving reduced skeletal muscle function is important for optimising exercise tolerance and quality of life in chronic obstructive pulmonary disease (COPD) patients. By applying high-intensity training to a small muscle group, we hypothesised a normalisation of muscle function. Seven patients with COPD performed 6 weeks (3 days·week(-1)) of high-intensity interval aerobic knee extensor exercise training. Five age-matched healthy individuals served as a reference group. Muscle oxygen uptake and mitochondrial respiration of the vastus lateralis muscle were measured before and after the 6-week training programme. Initial peak work and maximal mitochondrial respiration were reduced in COPD patients and improved significantly after the training programme. Peak power and maximal mitochondrial respiration in vastus lateralis muscle increased to the level of the control subjects and were mainly mediated via improved complex I respiration. Furthermore, when normalised to citrate synthase activity, no difference in maximal respiration was found either after the intervention or compared to controls, suggesting normal functioning mitochondrial complexes. The present study shows that high-intensity training of a restricted muscle group is highly effective in restoring skeletal muscle function in COPD patients.

  2. Sleep Patterns of School-Age Children with Asperger Syndrome or High-Functioning Autism

    ERIC Educational Resources Information Center

    Allik, Hiie; Larsson, Jan-Olov; Smedje, Hans

    2006-01-01

    Sleep patterns of 32 school-age children with Asperger syndrome (AS) and high-functioning autism (HFA) were compared to those of 32 typically developing age- and gender-matched children, using parent survey and one week of diary and actigraphic monitoring. Parents of children with AS/HFA more commonly reported that their children had difficulty…

  3. Parents' Criticisms and Attributions about Their Adult Children with High Functioning Autism or Schizophrenia

    ERIC Educational Resources Information Center

    Wasserman, Stephanie; Weisman de Mamani, Amy; Mundy, Peter

    2010-01-01

    The current study examined the criticism component of expressed emotion (EE) and attributions in parents of adults diagnosed with schizophrenia/schizoaffective disorder (S/SA) or high functioning autism/Asperger's. Consistent with study hypotheses, parents of adults diagnosed with autism/Asperger's disorder exhibited lower levels of high…

  4. Reading Comprehension Intervention for High-Functioning Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Woolley, Gary

    2016-01-01

    The prevalence of children with autism spectrum disorders appears to be on the increase and educators are becoming more aware of their educational and social needs. In particular, many students with high-functioning autism have a deficit in reading comprehension. As a consequence, there is now a greater determination by educators to design the…

  5. High fat fed heart failure animals have enhanced mitochondrial function and acyl-coa dehydrogenase activities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have previously shown that administration of high fat in heart failure (HF) increased mitochondrial respiration and did not alter left ventricular (LV) function. PPARalpha is a nuclear transcription factor that activates expression of genes involved in fatty acid uptake and utilization. We hypoth...

  6. How High-Functioning Children with Autism Understand Real and Deceptive Emotion.

    ERIC Educational Resources Information Center

    Dennis, Maureen; Lockyer, Linda; Lazenby, Anne L.

    2000-01-01

    A study compared the ability of eight high-functioning children with autism and eight controls to understand the facial expressions of real and deceptive emotion. Children with autism were less able to indicate the real emotions that story characters felt, the deceptive emotions they expressed, or the social reasons prompting a deceptive facial…

  7. ASD, a Psychiatric Disorder, or Both? Psychiatric Diagnoses in Adolescents with High-Functioning ASD

    ERIC Educational Resources Information Center

    Mazefsky, Carla A.; Oswald, Donald P.; Day, Taylor N.; Eack, Shaun M.; Minshew, Nancy J.; Lainhart, Janet E.

    2012-01-01

    Varied presentations of emotion dysregulation in autism complicate diagnostic decision making and may lead to inaccurate psychiatric diagnoses or delayed autism diagnosis for high-functioning children. This pilot study aimed to determine the concordance between prior psychiatric diagnoses and the results of an autism-specific psychiatric interview…

  8. Social Development in Individuals with High Functioning Autism and Asperger Disorder

    ERIC Educational Resources Information Center

    Koegel, Robert L.

    2007-01-01

    Until recently, and even in many current research circles, social behavior in individuals with autism spectrum disorders (including those with high functioning autism or Asperger disorder) was considered to be unmodifiable. Mundy, Henderson, Inge, and Coman and McGee and Daly shed new light on this concept of intractability, suggesting that…

  9. Measuring Reciprocity in High Functioning Children and Adolescents with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    van Ommeren, Tineke Backer; Begeer, Sander; Scheeren, Anke M.; Koot, Hans M.

    2012-01-01

    Few instruments have been developed that measure impairments in reciprocity, a defining feature of autism. We introduce a new test assessing the quality of reciprocal behaviour: the interactive drawing test (IDT). Children and adolescents (n = 49) with and without high functioning autism spectrum disorders (HFASD) were invited to collaborate with…

  10. Effects of Social Skill Instruction for High-Functioning Adolescents with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Webb, B. J.; Miller, S. P.; Pierce, T. B.; Strawser, S.; Jones, W. P.

    2004-01-01

    The purpose of this study was to investigate the efficacy of using the SCORE Skills Strategy (Vernon, Schumaker, & Deshler, 1996) to teach high-functioning adolescents with autism spectrum disorders five important social skills. Ten male participants ranging in age from 12 to 17 took part in a 10-week program. Results obtained using a…

  11. High-Functioning Autism and Asperger's Disorder: Utility and Meaning for Families

    ERIC Educational Resources Information Center

    Ruiz Calzada, Luisa; Pistrang, Nancy; Mandy, William P. L.

    2012-01-01

    We used framework analysis to investigate the utility of pervasive developmental disorder diagnoses, interviewing young people (aged 9-16 years) with high-functioning autistic disorder (AD) and Asperger's disorder (AsD), and their parents. Twenty two participants from ten families described both gains and costs resulting from diagnosis. Perceived…

  12. Lexical Processing in Individuals with High-Functioning Autism and Asperger's Disorder

    ERIC Educational Resources Information Center

    Speirs, Samantha; Yelland, Greg; Rinehart, Nicole; Tonge, Bruce

    2011-01-01

    The presence or absence of clinically delayed language development prior to 3 years of age is a key, but contentious, clinical feature distinguishing autism from Asperger's disorder. The aim of this study was to examine language processing in children with high-functioning autism (HFA) and Asperger's disorder (AD) using a task which taps lexical…

  13. Social Competence Intervention for Elementary Students with Aspergers Syndrome and High Functioning Autism

    ERIC Educational Resources Information Center

    Stichter, Janine P.; O'Connor, Karen V.; Herzog, Melissa J.; Lierheimer, Kristin; McGhee, Stephanie D.

    2012-01-01

    Despite frequent reports of academic success, individuals with high functioning autism or Aspergers Syndrome (HFA/AS) often manifest deficits in social abilities. These deficits can lead to daily difficulties, and negative long-term outcomes. Deficits in social competency are evident in this population from an early age, as children with HFA/AS…

  14. Brief Report: Additive and Subtractive Counterfactual Reasoning of Children with High-Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Begeer, Sander; Terwogt, Mark Meerum; Lunenburg, Patty; Stegge, Hedy

    2009-01-01

    The development of additive ("If only I had done...") and subtractive ("If only I had not done....") counterfactual reasoning was examined in children with High Functioning Autism Spectrum Disorders (HFASD) (n = 72) and typically developing controls (n = 71), aged 6-12 years. Children were presented four stories where they could generate…

  15. High Functioning Children with Autism Spectrum Disorder: A Novel Test of Multitasking

    ERIC Educational Resources Information Center

    Mackinlay, Rachael; Charman, Tony; Karmiloff-Smith, Annette

    2006-01-01

    High functioning children with a diagnosis of autism or Asperger's syndrome (HF-ASD) often experience difficulties organising goal-directed actions in their day-to-day lives, requiring support to schedule daily activities. This study aimed to capture these everyday difficulties experimentally using multitasking, a methodology that taps into the…

  16. Participation in Daily Activities of Young Adults with High Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    McCollum, Mary; LaVesser, Patti; Berg, Christine

    2016-01-01

    Young adults with an autism spectrum disorder (ASD) struggle to assume adult roles. This research assessed the feasibility of using the Adolescent and Young Adult Activity Card Sort (AYA-ACS) with emerging adults with high functioning ASD. Two phases were utilized during this research: (1) comparing the activity participation reported by emerging…

  17. Emotion Perception in Music in High-Functioning Adolescents with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Quintin, Eve-Marie; Bhatara, Anjali; Poissant, Helene; Fombonne, Eric; Levitin, Daniel J.

    2011-01-01

    Individuals with Autism Spectrum Disorders (ASD) succeed at a range of musical tasks. The ability to recognize musical emotion as belonging to one of four categories (happy, sad, scared or peaceful) was assessed in high-functioning adolescents with ASD (N = 26) and adolescents with typical development (TD, N = 26) with comparable performance IQ,…

  18. Narrative Skills in Young Adults with High-Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Rollins, Pamela Rosenthal

    2014-01-01

    In this study, the author investigated narrative performances of 10 high-functioning young adults with Autism Spectrum Disorders (ASD) across personal and storybook narratives. Narratives were elicited with genre-specific procedures and then transcribed and scored using the narrative scoring scheme (NSS). One-tailed paired-sample t tests were…

  19. Enhancing Reading Comprehension among Students with High-Functioning Autism Spectrum Disorder: A Randomized Pilot Study

    ERIC Educational Resources Information Center

    Roux, Catherine; Dion, Eric; Barrette, Anne

    2015-01-01

    Reading with comprehension is a challenge for students with high-functioning autism spectrum disorder. Unfortunately, research has little to offer to teachers trying to help these students. The present study pilots a new intervention targeting vocabulary, main idea identification, anaphoric relations, and text structure. Students (N = 13, M…

  20. Sexual Attitudes and Knowledge of High-Functioning Adolescents and Adults with Autism.

    ERIC Educational Resources Information Center

    Ousley, Opal Y.; Mesibov, Gary B.

    1991-01-01

    Interviews with 21 high-functioning adults with autism and 20 mildly to moderately mentally retarded adults without autism indicated that the mentally retarded group had more sexual experiences, with no intergroup differences in sexual knowledge or interest. Intelligence quotient was positively correlated with knowledge scores and males had…

  1. Pragmatic Inferences in High-Functioning Adults with Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Pijnacker, Judith; Hagoort, Peter; Buitelaar, Jan; Teunisse, Jan-Pieter; Geurts, Bart

    2009-01-01

    Although people with autism spectrum disorders (ASD) often have severe problems with pragmatic aspects of language, little is known about their pragmatic reasoning. We carried out a behavioral study on high-functioning adults with autistic disorder (n = 11) and Asperger syndrome (n = 17) and matched controls (n = 28) to investigate whether they…

  2. Do Adults with High Functioning Autism or Asperger Syndrome Differ in Empathy and Emotion Recognition?

    ERIC Educational Resources Information Center

    Montgomery, Charlotte B.; Allison, Carrie; Lai, Meng-Chuan; Cassidy, Sarah; Langdon, Peter E.; Baron-Cohen, Simon

    2016-01-01

    The present study examined whether adults with high functioning autism (HFA) showed greater difficulties in (1) their self-reported ability to empathise with others and/or (2) their ability to read mental states in others' eyes than adults with Asperger syndrome (AS). The Empathy Quotient (EQ) and "Reading the Mind in the Eyes" Test…

  3. Monthly high dose vitamin D treatment for the prevention of functional decline: a randomized clinical trial

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Importance: Vitamin D deficiency has been associated with poor physical performance. Objective: To determine the effectiveness of high dose vitamin D in lowering the risk of functional decline. Design, Setting, and Participants: One-year double-blind, randomized clinical trial conducted in Zurich,...

  4. Lexical and Affective Prosody in Children with High-Functioning Autism

    ERIC Educational Resources Information Center

    Grossman, Ruth B.; Bemis, Rhyannon H.; Skwerer, Daniela Plesa; Tager-Flusberg, Helen

    2010-01-01

    Purpose: To investigate the perception and production of lexical stress and processing of affective prosody in adolescents with high-functioning autism (HFA). We hypothesized preserved processing of lexical and affective prosody but atypical lexical prosody production. Method: Sixteen children with HFA and 15 typically developing (TD) peers…

  5. Virtual-Reality-Based Social Interaction Training for Children with High-Functioning Autism

    ERIC Educational Resources Information Center

    Ke, Fengfeng; Im, Tami

    2013-01-01

    Employing the multiple-baseline across-subjects design, the authors examined the implementation and potential effect of a virtual-reality-based social interaction program on the interaction and communication performance of children with high functioning autism. The data were collected via behavior observation and analysis, questionnaires, and…

  6. Virtual Reality Social Cognition Training for Young Adults with High-Functioning Autism

    ERIC Educational Resources Information Center

    Kandalaft, Michelle R.; Didehbani, Nyaz; Krawczyk, Daniel C.; Allen, Tandra T.; Chapman, Sandra B.

    2013-01-01

    Few evidence-based social interventions exist for young adults with high-functioning autism, many of whom encounter significant challenges during the transition into adulthood. The current study investigated the feasibility of an engaging Virtual Reality Social Cognition Training intervention focused on enhancing social skills, social cognition,…

  7. Atypical Visual Orienting to Gaze- and Arrow-Cues in Adults with High Functioning Autism

    ERIC Educational Resources Information Center

    Vlamings, Petra H. J. M.; Stauder, Johannes E. A.; van Son, Ilona A. M.; Mottron, Laurent

    2005-01-01

    The present study investigates visual orienting to directional cues (arrow or eyes) in adults with high functioning autism (n = 19) and age matched controls (n = 19). A choice reaction time paradigm is used in which eye-or arrow direction correctly (congruent) or incorrectly (incongruent) cues target location. In typically developing participants,…

  8. Sexual Behavior in High-Functioning Male Adolescents and Young Adults with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Hellemans, Hans; Colson, Kathy; Verbraeken, Christine; Vermeiren, Robert; Deboutte, Dirk

    2007-01-01

    Group home caregivers of 24 institutionalized, male, high-functioning adolescents and young adults with Autism Spectrum Disorder, were interviewed with the Interview Sexuality Autism. Most subjects were reported to express sexual interest and to display some kind of sexual behavior. Knowledge of socio-sexual skills existed, but practical use was…

  9. Explaining Metaphors in High-Functioning Autism Spectrum Disorder Children: A Brief Report

    ERIC Educational Resources Information Center

    Melogno, Sergio; D'Ardia, Caterina; Pinto, Maria Antonietta; Levi, Gabriel

    2012-01-01

    This study investigated metaphor comprehension in a group of 24 Italian high-functioning ASD children (mean age: 8.5 y.). Children were administered a test that was composed of "sensorial metaphors", which are understood by normally developing preschoolers, that the children had to verbally explain. Two normally developing control…

  10. The Use of Grammatical Morphemes by Mandarin-Speaking Children with High Functioning Autism

    ERIC Educational Resources Information Center

    Zhou, Peng; Crain, Stephen; Gao, Liqun; Tang, Ye; Jia, Meixiang

    2015-01-01

    The present study investigated the production of grammatical morphemes by Mandarin-speaking children with high functioning autism. Previous research found that a subgroup of English-speaking children with autism exhibit deficits in the use of grammatical morphemes that mark tense. In order to see whether this impairment in grammatical morphology…

  11. Distinct Patterns of Grey Matter Abnormality in High-Functioning Autism and Asperger's Syndrome

    ERIC Educational Resources Information Center

    McAlonan, Grainne M.; Suckling, John; Wong, Naikei; Cheung, Vinci; Lienenkaemper, Nina; Cheung, Charlton; Chua, Siew E.

    2008-01-01

    Background: Autism exists across a wide spectrum and there is considerable debate as to whether children with Asperger's syndrome, who have normal language milestones, should be considered to comprise a subgroup distinct other from high-functioning children with autism (HFA), who have a history of delayed language development. Magnetic resonance…

  12. Investigating Commercially Available Technology for Language Learners in Higher Education within the High Functioning Disability Spectrum

    ERIC Educational Resources Information Center

    Savvidou, Georgia; Loizides, Fernando

    2016-01-01

    This work presents the assistive use of a combination of technologies in language learning to individuals with high functioning disabilities within a higher education environment. The primary aim of this research is to introduce the initial findings of a pilot exploratory user test which aims to facilitate a better understanding of the suitability…

  13. 'Here's the Weavery Looming Up': Verbal Humour in a Woman with High-Functioning Autism.

    ERIC Educational Resources Information Center

    Werth, Abigail; Perkins, Michael; Boucher, Jill

    2001-01-01

    A case study of a 29-year-old woman with high functioning autism is presented. Examples of her use of puns, jokes, neologisms, "portmanteau" words, irreverent humor, irony, sarcasm, and word play based on her obsessional interests are provided and discussed in relation to current theories of autism and of normal humor. (Contains references.)…

  14. Mathematics Interventions for Students with High Functioning Autism/Asperger's Syndrome

    ERIC Educational Resources Information Center

    Donaldson, Jeffrey B.; Zager, Dianne

    2010-01-01

    Teachers are often at a loss when considering how to address mathematics difficulties for students with high functioning autism/Asperger's syndrome (HFA/AS). Students may show difficulty remembering operations throughout an equation, organizing information on the page, and comprehending the language in instructions of word problems. These…

  15. Brief Report: Judicial Attitudes Regarding the Sentencing of Offenders with High Functioning Autism

    ERIC Educational Resources Information Center

    Berryessa, Colleen M.

    2016-01-01

    This brief report presents preliminary data on the attitudes of judges on the sentencing of offenders with High Functioning Autism (HFA). Semi-structured telephone interviews were conducted with twenty-one California Superior Court Judges. Interviews were qualitatively coded and constant comparative analysis was utilized. Findings revealed that…

  16. Assessing Motor Skills as a Differentiating Feature between High Functioning Autism and Asperger's Disorder

    ERIC Educational Resources Information Center

    Cid, Maria R.

    2011-01-01

    The purpose of this research was to investigate if motor skills could be used as a differentiating feature between Asperger's Disorder (AD) and High Functioning (HFA) in children under the age of 9 years, 0 months, in order to provide additional information regarding the usefulness and validity of distinguishing these two disorders. There is…

  17. White Matter Integrity and Pictorial Reasoning in High-Functioning Children with Autism

    ERIC Educational Resources Information Center

    Sahyoun, Cherif P.; Belliveau, John W.; Mody, Maria

    2010-01-01

    The current study investigated the neurobiological role of white matter in visuospatial versus linguistic processing abilities in autism using diffusion tensor imaging. We examined differences in white matter integrity between high-functioning children with autism (HFA) and typically developing controls (CTRL), in relation to the groups' response…

  18. Binding of Multiple Features in Memory by High-Functioning Adults with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Bowler, Dermot M.; Gaigg, Sebastian B.; Gardiner, John M.

    2014-01-01

    Diminished episodic memory and diminished use of semantic information to aid recall by individuals with autism spectrum disorder (ASD) are both thought to result from diminished relational binding of elements of complex stimuli. To test this hypothesis, we asked high-functioning adults with ASD and typical comparison participants to study grids in…

  19. Cognitive Differences in Pictorial Reasoning between High-Functioning Autism and Asperger's Syndrome

    ERIC Educational Resources Information Center

    Sahyoun, Cherif P.; Soulieres, Isabelle; Belliveau, John W.; Mottron, Laurent; Mody, Maria

    2009-01-01

    We investigated linguistic and visuospatial processing during pictorial reasoning in high-functioning autism (HFA), Asperger's syndrome (ASP), and age and IQ-matched typically developing participants (CTRL), using three conditions designed to differentially engage linguistic mediation or visuospatial processing (visuospatial, V; semantic, S;…

  20. A Comparison of Repetitive Behaviors in Aspergers Disorder and High Functioning Autism

    ERIC Educational Resources Information Center

    Cuccaro, Michael L.; Nations, Laura; Brinkley, Jason; Abramson, Ruth K.; Wright, Harry H.; Hall, Alicia; Gilbert, John; Pericak-Vance, Margaret A.

    2007-01-01

    In this study we compared 33 IQ and age matched pairs of individuals with Aspergers Disorder (ASP) and high functioning autism (HFA) on measures of repetitive behavior. On the Repetitive Behavior Scale-Revised (RBS-R), the ASP and HFA groups showed no differences in RBS-R Intensity score (severity) score or Frequency score (number of problems…

  1. Embarrassment, Theory of Mind, and Emotion Regulation in Adolescents with Asperger's Syndrome and High Functioning Autism

    ERIC Educational Resources Information Center

    Winter-Messiers, Mary Ann

    2013-01-01

    The purpose of the present study was to increase our understanding of the relations among embarrassment, Theory of Mind (ToM), and emotion dysregulation in adolescents with Asperger's Syndrome and High Functioning Autism (AS/HFA), topics that have not previously been the foci of research in this population. The research sample consisted of 42…

  2. Cultivation of Empathy in Individuals with High-Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jaarsma, Pier

    2013-01-01

    High-functioning individuals with autism spectrum disorder (HF-ASD) typically lack cognitive empathy, compromising their moral agency from both a Kantian and a Humean perspective. Nevertheless, they are capable of exhibiting moral behavior, and sometimes, they exhibit what may be deemed "super-moral" behavior. The empathy deficit poses,…

  3. Asymmetric synthesis of a highly functionalized enantioenriched system close to thapsigargin framework.

    PubMed

    Tap, Aurélien; Jouanneau, Morgan; Galvani, Gilles; Sorin, Geoffroy; Lannou, Marie-Isabelle; Férézou, Jean-Pierre; Ardisson, Janick

    2012-10-28

    A straightforward approach to a highly functionalized enantioenriched bicyclo[5.3.0]decadienone system close to the thapsigargin framework has been achieved. The developed synthetic route involves two main stages: installation of the chains on either side of the quaternary center at C7 starting from a central enantiopure epoxide and formation of the bicyclic octahydroazulene through subsequent Pauson-Khand annelation.

  4. Do Individuals with High-Functioning Autism Who Speak a Tone Language Show Intonation Deficits?

    ERIC Educational Resources Information Center

    Chan, Kary K. L.; To, Carol K. S.

    2016-01-01

    This study investigated whether intonation deficits were observed in 19 Cantonese-speaking adults with high-functioning autism (HFA) when compared to 19 matched neurotypical (NT) controls. This study also investigated the use of sentence-final particles (SFPs) and their relationship with intonation in both groups. Standard deviations…

  5. Preparing Transition-Age Students with High-Functioning Autism Spectrum Disorders for Meaningful Work

    ERIC Educational Resources Information Center

    Lee, Gloria K.; Carter, Erik W.

    2012-01-01

    This article provides an overview of promising essential elements for fostering vocational success among students with high-functioning autism spectrum disorders (HFASDs) by drawing literature from the fields of school-to-work transition for post-secondary students and vocational rehabilitation for individuals with disabilities. We highlight seven…

  6. Online Processing of Sentences Containing Noun Modification in Young Children with High-Functioning Autism

    ERIC Educational Resources Information Center

    Bavin, Edith L.; Prendergast, Luke A.; Kidd, Evan; Baker, Emma; Dissanayake, Cheryl

    2016-01-01

    Background: There is variability in the language of children with autism, even those who are high functioning. However, little is known about how they process language structures in real time, including how they handle potential ambiguity, and whether they follow referential constraints. Previous research with older autism spectrum disorder (ASD)…

  7. Inclusion for Students with High-Functioning Autism Spectrum Disorders: Definitions and Decision Making

    ERIC Educational Resources Information Center

    Sansosti, Jenine M.; Sansosti, Frank J.

    2012-01-01

    General education placements are believed to offer numerous benefits for students with high-functioning autism spectrum disorders (HFASDs), yet decisions about including students with HFASDs remain controversial. This article presents data from a qualitative analysis of definitions and decision making considerations for a school district with a…

  8. An Examination of Handedness and Footedness in Children with High Functioning Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Markoulakis, R.; Scharoun, S. M.; Bryden, P. J.; Fletcher, P. C.

    2012-01-01

    Motor control deficits have been documented in children with high functioning autism and Asperger syndrome (HFA/AS), but the extent to which these disorders affect the children's footedness must be delineated. Twelve typically developing (TD) children and 12 children with HFA/AS, ages 6-9 years, were recruited. Motor control skills were assessed…

  9. Perception of Talker Age by Young Adults with High-Functioning Autism

    ERIC Educational Resources Information Center

    Clopper, Cynthia G.; Rohrbeck, Kristin L.; Wagner, Laura

    2013-01-01

    People with high-functioning Autism (HFA) can accurately identify social categories from speech, but they have more difficulty connecting linguistic variation in the speech signal to social stereotypes associated with those categories. In the current study, the perception and evaluation of talker age by young adults with HFA was examined. The…

  10. Review of Social Skills Training Groups for Youth with Asperger Syndrome and High Functioning Autism

    ERIC Educational Resources Information Center

    Cappadocia, M. Catherine; Weiss, Jonathan A.

    2011-01-01

    Although social skills deficits represent core symptoms of Asperger Syndrome and High Functioning Autism, there is limited research investigating the empirical validity of social skills interventions currently being used with these populations. This literature review compares three types of social skills training groups: traditional, cognitive…

  11. The Modality Shift Experiment in Adults and Children with High Functioning Autism

    ERIC Educational Resources Information Center

    Williams, Diane L.; Goldstein, Gerald; Minshew, Nancy J.

    2013-01-01

    This study used the modality shift experiment, a relatively simple reaction time measure to visual and auditory stimuli, to examine attentional shifting within and across modalities in 33 children and 42 adults with high-functioning autism as compared to matched numbers of age- and ability-matched typical controls. An exaggerated "modality shift…

  12. Judgments of social awkwardness from brief exposure to children with and without high-functioning autism.

    PubMed

    Grossman, Ruth B

    2015-07-01

    We form first impressions of many traits based on very short interactions. This study examines whether typical adults judge children with high-functioning autism to be more socially awkward than their typically developing peers based on very brief exposure to still images, audio-visual, video-only, or audio-only information. We used video and audio recordings of children with and without high-functioning autism captured during a story-retelling task. Typically developing adults were presented with 1 s and 3 s clips of these children, as well as still images, and asked to judge whether the person in the clip was socially awkward. Our findings show that participants who are naïve to diagnostic differences between the children in the clips judged children with high-functioning autism to be socially awkward at a significantly higher rate than their typically developing peers. These results remain consistent for exposures as short as 1 s to visual and/or auditory information, as well as for still images. These data suggest that typical adults use subtle nonverbal and non-linguistic cues produced by children with high-functioning autism to form rapid judgments of social awkwardness with the potential for significant repercussions in social interactions.

  13. Social Skills Interventions for Children with High-Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Schreiber, Catherine

    2011-01-01

    While the number of children diagnosed with high-functioning autism spectrum disorders (HFASD) continues to rise, the number of research-based methods to meet the needs of this population lags behind. Social dysfunction is perhaps the most pervasive and debilitating deficit for those diagnosed with HFASD. This article presents a narrative review…

  14. What Is School Like? Perspectives of Singaporean Youth with High-Functioning Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Poon, Kenneth K.; Soon, Sijie; Wong, Meng-Ee; Kaur, Sarinajit; Khaw, Joanne; Ng, Zijia; Tan, Chee Soon

    2014-01-01

    This study sought to understand the perspectives of four youth with high-functioning autism spectrum disorders (HFA) regarding their experiences in Singapore secondary schools. Qualitative analyses of in-depth interviews revealed that youth with HFA actively construct their experience of being a person with HFA. The extent to which the youth were…

  15. The Role of Causal and Intentional Judgments in Moral Reasoning in Individuals with High Functioning Autism

    ERIC Educational Resources Information Center

    Buon, Marine; Dupoux, Emmanuel; Jacob, Pierre; Chaste, Pauline; Leboyer, Marion; Zalla, Tiziana

    2013-01-01

    In the present study, we investigated the ability to assign moral responsibility and punishment in adults with high functioning autism or Asperger Syndrome (HFA/AS), using non-verbal cartoons depicting an aggression, an accidental harm or a mere coincidence. Participants were asked to evaluate the agent's causal and intentional roles, his…

  16. Social Skills Training for Children with Asperger Syndrome and High-Functioning Autism

    ERIC Educational Resources Information Center

    White, Susan Williams

    2011-01-01

    This practical, research-based guide provides a wealth of tools and strategies for implementing social skills training in school or clinical settings. Numerous case examples illustrate common social difficulties experienced by children with Asperger syndrome and high-functioning autism; the impact on peer relationships, school performance, and…

  17. Adolescents with High-Functioning Autism: An Investigation of Comorbid Anxiety and Depression

    ERIC Educational Resources Information Center

    Hammond, Rachel K.; Hoffman, Jennifer M.

    2014-01-01

    Adolescents with high-functioning autism (HFA) possess core social and pragmatic deficits, which interfere with normal relationship development. At a time when friendships are increasingly important, many adolescents with HFA realize they are different from their peers. Initial research has indicated that adolescence is the time when symptoms of…

  18. Employment Activities and Experiences of Adults with High-Functioning Autism and Asperger's Disorder

    ERIC Educational Resources Information Center

    Baldwin, Susanna; Costley, Debra; Warren, Anthony

    2014-01-01

    There is limited large-scale empirical research into the working lives of adults who have an autism spectrum disorder with no co-occurring intellectual disability. Drawing on data from a national survey, this report describes the employment activities and experiences of 130 adults with Asperger's Disorder (AD) and high functioning autism (HFA) in…

  19. Summer Treatment Program Improves Behavior of Children with High-Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Mitchell, Elisabeth Sheridan; Mrug, Sylvie; Patterson, Cryshelle S.; Bailey, Kirstin J.; Bart Hodgens, J.

    2015-01-01

    This study evaluated the effects of a behavioral summer treatment program for children with high-functioning autism spectrum disorder (HFASD). Twenty boys (M = 9.2 years) diagnosed with HFASD participated in the 6-week program across 6 years. Detailed daily behavioral data were collected on a variety of positive and negative social behaviors.…

  20. Avoidant Attachment Style Indicates Job Adaptation of People with High Functional Autistic Spectrum Disorders

    ERIC Educational Resources Information Center

    Yokotani, Kenji

    2011-01-01

    The aim of the present study was to investigate whether or not the avoidant attachment style indicates job adaptation of people with High Functional Autistic Spectrum Disorders (HFASD). HFASD are groups of developmental disorders characterized by impairment of social interaction and normal level of intelligence. Twenty-two people with HFASD…

  1. Urinary Cortisol Circadian Rhythm in a Group of High-Functioning Children with Autism.

    ERIC Educational Resources Information Center

    Richdale, Amanda L.; Prior, Margot R.

    1992-01-01

    This study found no evidence for abnormal temporal placement of the basal urinary cortisol circadian rhythm in a group of 18 high-functioning children (ages 4-14) with autism. There was a tendency toward cortisol hypersecretion during the day, predominantly in autistic children who were integrated into the normal school system. (Author/JDD)

  2. Reduced Transplacental Transfer of a Subset of Epstein-Barr Virus-Specific Antibodies to Neonates of Mothers Infected with Plasmodium falciparum Malaria during Pregnancy.

    PubMed

    Ogolla, Sidney; Daud, Ibrahim I; Asito, Amolo S; Sumba, Odada P; Ouma, Collins; Vulule, John; Middeldorp, Jaap M; Dent, Arlene E; Mehta, Saurabh; Rochford, Rosemary

    2015-11-01

    Over 35% of children in a region of malaria endemicity are infected with Epstein-Barr virus (EBV) by 6 months of age. This susceptibility may be linked to impaired transplacental transfer of antibodies. In this study, we determined the effect of malaria exposure during pregnancy on the transfer of EBV-specific maternal antibodies in a region of western Kenya that experiences endemic malaria. Pregnant mothers were recruited and followed up until delivery to determine levels of neonatal malaria exposure. Levels of EBV lytic (viral capsid antigen [VCA], Z transcriptional activator [Zta], and early diffuse antigen complex [EAd]) and EBV latent (EBV nuclear antigen-1 (EBNA1]) and tetanus-specific IgG antibodies were measured in 70 paired maternal and cord blood samples using a Luminex-bead-based assay. A high proportion (63%) of the infants were exposed to malaria in utero. Levels of EBV- and tetanus-specific antibodies were similar in malaria-infected mothers and in mothers who had no detectable malaria infection. Malaria-exposed neonates had significantly lower levels of anti-EBNA1, anti-Zta, and anti-EAd antibodies than were seen in their mothers. In utero malaria exposure resulted in significant reductions in transplacental transfer of anti-VCA-p18 and anti-EBNA1 antibodies of 13% and 22%, respectively. Neonates received significantly low levels of anti-Zta and anti-EAd antibodies irrespective of malaria exposure levels. In multivariate analysis, in utero malaria exposure was associated with a significant reduction in the transfer of anti-VCA-p18 and anti-EBNA1 antibodies to the neonates (P = 0.0234 and P = 0.0017, respectively). Malaria during pregnancy results in differential levels of transfer of EBV-specific antibodies from the mother to the fetus. The impaired transplacental transfer of some antibodies may lead to the malaria-exposed neonates being susceptible to early EBV infection.

  3. Reduced Transplacental Transfer of a Subset of Epstein-Barr Virus-Specific Antibodies to Neonates of Mothers Infected with Plasmodium falciparum Malaria during Pregnancy

    PubMed Central

    Ogolla, Sidney; Daud, Ibrahim I.; Asito, Amolo S.; Sumba, Odada P.; Ouma, Collins; Vulule, John; Middeldorp, Jaap M.; Dent, Arlene E.; Mehta, Saurabh

    2015-01-01

    Over 35% of children in a region of malaria endemicity are infected with Epstein-Barr virus (EBV) by 6 months of age. This susceptibility may be linked to impaired transplacental transfer of antibodies. In this study, we determined the effect of malaria exposure during pregnancy on the transfer of EBV-specific maternal antibodies in a region of western Kenya that experiences endemic malaria. Pregnant mothers were recruited and followed up until delivery to determine levels of neonatal malaria exposure. Levels of EBV lytic (viral capsid antigen [VCA], Z transcriptional activator [Zta], and early diffuse antigen complex [EAd]) and EBV latent (EBV nuclear antigen-1 (EBNA1]) and tetanus-specific IgG antibodies were measured in 70 paired maternal and cord blood samples using a Luminex-bead-based assay. A high proportion (63%) of the infants were exposed to malaria in utero. Levels of EBV- and tetanus-specific antibodies were similar in malaria-infected mothers and in mothers who had no detectable malaria infection. Malaria-exposed neonates had significantly lower levels of anti-EBNA1, anti-Zta, and anti-EAd antibodies than were seen in their mothers. In utero malaria exposure resulted in significant reductions in transplacental transfer of anti-VCA-p18 and anti-EBNA1 antibodies of 13% and 22%, respectively. Neonates received significantly low levels of anti-Zta and anti-EAd antibodies irrespective of malaria exposure levels. In multivariate analysis, in utero malaria exposure was associated with a significant reduction in the transfer of anti-VCA-p18 and anti-EBNA1 antibodies to the neonates (P = 0.0234 and P = 0.0017, respectively). Malaria during pregnancy results in differential levels of transfer of EBV-specific antibodies from the mother to the fetus. The impaired transplacental transfer of some antibodies may lead to the malaria-exposed neonates being susceptible to early EBV infection. PMID:26376931

  4. Synthesis of human parainfluenza virus 4 nucleocapsid-like particles in yeast and their use for detection of virus-specific antibodies in human serum.

    PubMed

    Bulavaitė, Aistė; Lasickienė, Rita; Tamošiūnas, Paulius Lukas; Simanavičius, Martynas; Sasnauskas, Kęstutis; Žvirblienė, Aurelija

    2017-04-01

    The aim of this study was to produce human parainfluenza virus type 4 (HPIV4) nucleocapsid (N) protein in yeast Saccharomyces cerevisiae expression system, to explore its structural and antigenic properties and to evaluate its applicability in serology. The use of an optimized gene encoding HPIV4 N protein amino acid (aa) sequence GenBank AGU90031.1 allowed high yield of recombinant N protein forming nucleocapsid-like particles (NLPs) in yeast. A substitution L332D disrupted self-assembly of NLPs, confirming the role of this position in the N proteins of Paramyxovirinae. Three monoclonal antibodies (MAbs) were generated against the NLP-forming HPIV4 N protein. They recognised HPIV4-infected cells, demonstrating the antigenic similarity between the recombinant and virus-derived N proteins. HPIV4 N protein was used as a coating antigen in an indirect IgG ELISA with serum specimens of 154 patients with respiratory tract infection. The same serum specimens were tested with previously generated N protein of a closely related HPIV2, another representative of genus Rubulavirus. Competitive ELISA was developed using related yeast-produced viral antigens to deplete the cross-reactive serum antibodies. In the ELISA either without or with competition using heterologous HPIV (2 or 4) N or mumps virus N proteins, the seroprevalence of HPIV4 N-specific IgG was, respectively, 46.8, 39.6 and 40.3% and the seroprevalence of HPIV2 N-specific IgG-47.4, 39.0 and 37.7%. In conclusion, yeast-produced HPIV4 N protein shares structural and antigenic properties of the native virus nucleocapsids. Yeast-produced HPIV4 and HPIV2 NLPs are prospective tools in serology.

  5. Adoptive Transfer of Engineered Rhesus Simian Immunodeficiency Virus-Specific CD8+ T Cells Reduces the Number of Transmitted/Founder Viruses Established in Rhesus Macaques.

    PubMed

    Ayala, Victor I; Trivett, Matthew T; Barsov, Eugene V; Jain, Sumiti; Piatak, Michael; Trubey, Charles M; Alvord, W Gregory; Chertova, Elena; Roser, James D; Smedley, Jeremy; Komin, Alexander; Keele, Brandon F; Ohlen, Claes; Ott, David E

    2016-11-01

    AIDS virus infections are rarely controlled by cell-mediated immunity, in part due to viral immune evasion and immunodeficiency resulting from CD4(+) T-cell infection. One likely aspect of this failure is that antiviral cellular immune responses are either absent or present at low levels during the initial establishment of infection. To test whether an extensive, timely, and effective response could reduce the establishment of infection from a high-dose inoculum, we adoptively transferred large numbers of T cells that were molecularly engineered with anti-simian immunodeficiency virus (anti-SIV) activity into rhesus macaques 3 days following an intrarectal SIV inoculation. To measure in vivo antiviral activity, we assessed the number of viruses transmitted using SIVmac239X, a molecularly tagged viral stock containing 10 genotypic variants, at a dose calculated to transmit 12 founder viruses. Single-genome sequencing of plasma virus revealed that the two animals receiving T cells expressing SIV-specific T-cell receptors (TCRs) had significantly fewer viral genotypes than the two control animals receiving non-SIV-specific T cells (means of 4.0 versus 7.5 transmitted viral genotypes; P = 0.044). Accounting for the likelihood of transmission of multiple viruses of a particular genotype, the calculated means of the total number of founder viruses transmitted were 4.5 and 14.5 in the experimental and control groups, respectively (P = 0.021). Thus, a large antiviral T-cell response timed with virus exposure can limit viral transmission. The presence of strong, preexisting T-cell responses, including those induced by vaccines, might help prevent the establishment of infection at the lower-exposure doses in humans that typically transmit only a single virus.

  6. Examining the Characteristics of Visuospatial Information Processing in Individuals with High-Functioning Autism

    PubMed Central

    Kumar, Sandhya L.

    2013-01-01

    Information processing in individuals with autism is marked by a unique interplay of strengths and weaknesses that in concert distinguishes social cognition in autism from individuals with typical-functioning brains. In autism, difficulties with higher cognitive processing and enhancement of low-level visuospatial processing, such as in visual search tasks, may lead to diminished central coherence, which has the potential to hinder how an individual functions in social interactions where integration of components such as intention, emotion, and context paints the global picture necessary for social processing. A more thorough understanding of the cognitive and neural processes in autism is important for the advancement of intervention programs. The intention of this review is to discuss the implications of neuroimaging and behavioral studies that have analyzed the higher cognitive functions in individuals with high-functioning autism, with a particular emphasis on studies that have investigated visuospatial processing. PMID:23766736

  7. Masculinity, moral atmosphere, and moral functioning of high school football players.

    PubMed

    Steinfeldt, Jesse A; Rutkowski, Leslie A; Vaughan, Ellen L; Steinfeldt, Matthew C

    2011-04-01

    In order to identify factors associated with on-field moral functioning among student athletes within the unique context of football, we examined masculine gender role conflict, moral atmosphere, and athletic identity. Using structural equation modeling to assess survey data from 204 high school football players, results demonstrated that moral atmosphere (i.e., the influence of coaches and teammates) was significantly associated with participants' process of on-field moral functioning across the levels of judgment, intention, and behavior. Neither masculine gender role conflict nor athletic identity significantly predicted moral functioning, but the results indicated that participants' identification with the athlete role significantly predicted conflict with socialized gender roles. Results suggest that in the aggressive and violent sport of football, coaches can have a direct influence on players' moral functioning process. Coaches can also have an indirect effect by influencing all the players so that a culture of ethical play can be cultivated among teammates and spread from the top down.

  8. Numerical evaluation of the incomplete airy functions and their application to high frequency scattering and diffraction

    NASA Technical Reports Server (NTRS)

    Constantinides, E. D.; Marhefka, R. J.

    1992-01-01

    The incomplete Airy integrals serve as canonical functions for the uniform ray optical solutions to several high frequency scattering and diffraction problems that involve a class of integrals characterized by two stationary points that are arbitrarily close to one another or to an integration endpoint. Integrals of such analytical properties describe transition region phenomena associated with composite shadow boundaries. An efficient and accurate method for computing the incomplete Airy functions would make the solutions to such problems useful for engineering purposes. Here, a convergent series solution form for the incomplete Airy functions is derived. Asymptotic expansions involving several terms were also developed and serve as large argument approximations. The combination of the series solution form with the asymptotic formulae provides for an efficient and accurate computation of the incomplete Airy functions. Validation of accuracy is accomplished using direct numerical integration data.

  9. Examining the characteristics of visuospatial information processing in individuals with high-functioning autism.

    PubMed

    Kumar, Sandhya L

    2013-06-01

    Information processing in individuals with autism is marked by a unique interplay of strengths and weaknesses that in concert distinguishes social cognition in autism from individuals with typical-functioning brains. In autism, difficulties with higher cognitive processing and enhancement of low-level visuospatial processing, such as in visual search tasks, may lead to diminished central coherence, which has the potential to hinder how an individual functions in social interactions where integration of components such as intention, emotion, and context paints the global picture necessary for social processing. A more thorough understanding of the cognitive and neural processes in autism is important for the advancement of intervention programs. The intention of this review is to discuss the implications of neuroimaging and behavioral studies that have analyzed the higher cognitive functions in individuals with high-functioning autism, with a particular emphasis on studies that have investigated visuospatial processing.

  10. Executive functions and consumption of fruits/ vegetables and high saturated fat foods in young adults.

    PubMed

    Limbers, Christine A; Young, Danielle

    2015-05-01

    Executive functions play a critical role in regulating eating behaviors and have been shown to be associated with overeating which over time can result in overweight and obesity. There has been a paucity of research examining the associations among healthy dietary behaviors and executive functions utilizing behavioral rating scales of executive functioning. The objective of the present cross-sectional study was to evaluate the associations among fruit and vegetable consumption, intake of foods high in saturated fat, and executive functions using the Behavioral Rating Inventory of Executive Functioning-Adult Version. A total of 240 university students completed the Behavioral Rating Inventory of Executive Functioning-Adult Version, the 26-Item Eating Attitudes Test, and the Diet subscale of the Summary of Diabetes Self-Care Activities Questionnaire. Multiple linear regression analysis was conducted with two separate models in which fruit and vegetable consumption and saturated fat intake were the outcomes. Demographic variables, body mass index, and eating styles were controlled for in the analysis. Better initiation skills were associated with greater intake of fruits and vegetables in the last 7 days (standardized beta = -0.17; p < 0.05). Stronger inhibitory control was associated with less consumption of high fat foods in the last 7 days (standardized beta = 0.20; p < 0.05) in the multiple linear regression analysis. Executive functions that predict fruit and vegetable consumption are distinct from those that predict avoidance of foods high in saturated fat. Future research should investigate whether continued skill enhancement in initiation and inhibition following standard behavioral interventions improves long-term maintenance of weight loss.

  11. Highly efficient hyperbranched CNT surfactants: influence of molar mass and functionalization.

    PubMed

    Bertels, Ellen; Bruyninckx, Kevin; Kurttepeli, Mert; Smet, Mario; Bals, Sara; Goderis, Bart

    2014-10-21

    End-group-functionalized hyperbranched polymers were synthesized to act as a carbon nanotube (CNT) surfactant in aqueous solutions. Variation of the percentage of triphenylmethyl (trityl) functionalization and of the molar mass of the hyperbranched polyglycerol (PG) core resulted in the highest measured surfactant efficiency for a 5000 g/mol PG with 5.6% of the available hydroxyl end-groups replaced by trityl functions, as shown by UV-vis measurements. Semiempirical model calculations suggest an even higher efficiency for PG5000 with 2.5% functionalization and maximal molecule specific efficiency in general at low degrees of functionalization. Addition of trityl groups increases the surfactant-nanotube interactions in comparison to unfunctionalized PG because of π-π stacking interactions. However, at higher functionalization degrees mutual interactions between trityl groups come into play, decreasing the surfactant efficiency, while lack of water solubility becomes an issue at very high functionalization degrees. Low molar mass surfactants are less efficient compared to higher molar mass species most likely because the higher bulkiness of the latter allows for a better CNT separation and stabilization. The most efficient surfactant studied allowed dispersing 2.85 mg of CNT in 20 mL with as little as 1 mg of surfactant. These dispersions, remaining stable for at least 2 months, were mainly composed of individual CNTs as revealed by electron microscopy.

  12. Multiwalled Carbon Nanotube Functionalization with High Molecular Weight Hyaluronan Significantly Reduces Pulmonary Injury.

    PubMed

    Hussain, Salik; Ji, Zhaoxia; Taylor, Alexia J; DeGraff, Laura M; George, Margaret; Tucker, Charles J; Chang, Chong Hyun; Li, Ruibin; Bonner, James C; Garantziotis, Stavros

    2016-08-23

    Commercialization of multiwalled carbon nanotubes (MWCNT)-based applications has been hampered by concerns regarding their lung toxicity potential. Hyaluronic acid (HA) is a ubiquitously found polysaccharide, which is anti-inflammatory in its native high molecular weight form. HA-functionalized smart MWCNTs have shown promise as tumor-targeting drug delivery agents and can enhance bone repair and regeneration. However, it is unclear whether HA functionalization could reduce the pulmonary toxicity potential of MWCNTs. Using in vivo and in vitro approaches, we investigated the effectiveness of MWCNT functionalization with HA in increasing nanotube biocompatibility and reducing lung inflammatory and fibrotic effects. We utilized three-dimensional cultures of differentiated primary human bronchial epithelia to translate findings from rodent assays to humans. We found that HA functionalization increased stability and dispersion of MWCNTs and reduced postexposure lung inflammation, fibrosis, and mucus cell metaplasia compared with nonfunctionalized MWCNTs. Cocultures of fully differentiated bronchial epithelial cells (cultivated at air-liquid interface) and human lung fibroblasts (submerged) displayed significant reduction in injury, oxidative stress, as well as pro-inflammatory gene and protein expression after exposure to HA-functionalized MWCNTs compared with MWCNTs alone. In contrast, neither type of nanotubes stimulated cytokine production in primary human alveolar macrophages. In aggregate, our results demonstrate the effectiveness of HA functionalization as a safer design approach to eliminate MWCNT-induced lung injury and suggest that HA functionalization works by reducing MWCNT-induced epithelial injury.

  13. The neural basis of deictic shifting in linguistic perspective-taking in high-functioning autism

    PubMed Central

    Liu, Yanni; Williams, Diane L.; Keller, Timothy A.; Minshew, Nancy J.; Just, Marcel Adam

    2011-01-01

    Personal pronouns, such as ‘I’ and ‘you’, require a speaker/listener to continuously re-map their reciprocal relation to their referent, depending on who is saying the pronoun. This process, called ‘deictic shifting’, may underlie the incorrect production of these pronouns, or ‘pronoun reversals’, such as referring to oneself with the pronoun ‘you’, which has been reported in children with autism. The underlying neural basis of deictic shifting, however, is not understood, nor has the processing of pronouns been studied in adults with autism. The present study compared the brain activation pattern and functional connectivity (synchronization of activation across brain areas) of adults with high-functioning autism and control participants using functional magnetic resonance imaging in a linguistic perspective-taking task that required deictic shifting. The results revealed significantly diminished frontal (right anterior insula) to posterior (precuneus) functional connectivity during deictic shifting in the autism group, as well as reliably slower and less accurate behavioural responses. A comparison of two types of deictic shifting revealed that the functional connectivity between the right anterior insula and precuneus was lower in autism while answering a question that contained the pronoun ‘you’, querying something about the participant’s view, but not when answering a query about someone else’s view. In addition to the functional connectivity between the right anterior insula and precuneus being lower in autism, activation in each region was atypical, suggesting over reliance on individual regions as a potential compensation for the lower level of collaborative interregional processing. These findings indicate that deictic shifting constitutes a challenge for adults with high-functioning autism, particularly when reference to one’s self is involved, and that the functional collaboration of two critical nodes, right anterior insula

  14. The neural basis of deictic shifting in linguistic perspective-taking in high-functioning autism.

    PubMed

    Mizuno, Akiko; Liu, Yanni; Williams, Diane L; Keller, Timothy A; Minshew, Nancy J; Just, Marcel Adam

    2011-08-01

    Personal pronouns, such as 'I' and 'you', require a speaker/listener to continuously re-map their reciprocal relation to their referent, depending on who is saying the pronoun. This process, called 'deictic shifting', may underlie the incorrect production of these pronouns, or 'pronoun reversals', such as referring to oneself with the pronoun 'you', which has been reported in children with autism. The underlying neural basis of deictic shifting, however, is not understood, nor has the processing of pronouns been studied in adults with autism. The present study compared the brain activation pattern and functional connectivity (synchronization of activation across brain areas) of adults with high-functioning autism and control participants using functional magnetic resonance imaging in a linguistic perspective-taking task that required deictic shifting. The results revealed significantly diminished frontal (right anterior insula) to posterior (precuneus) functional connectivity during deictic shifting in the autism group, as well as reliably slower and less accurate behavioural responses. A comparison of two types of deictic shifting revealed that the functional connectivity between the right anterior insula and precuneus was lower in autism while answering a question that contained the pronoun 'you', querying something about the participant's view, but not when answering a query about someone else's view. In addition to the functional connectivity between the right anterior insula and precuneus being lower in autism, activation in each region was atypical, suggesting over reliance on individual regions as a potential compensation for the lower level of collaborative interregional processing. These findings indicate that deictic shifting constitutes a challenge for adults with high-functioning autism, particularly when reference to one's self is involved, and that the functional collaboration of two critical nodes, right anterior insula and precuneus, may play a

  15. Versatile On-Resin Synthesis of High Mannose Glycosylated Asparagine with Functional Handles

    PubMed Central

    Chen, Rui; Pawlicki, Mark A.; Tolbert, Thomas J.

    2013-01-01

    Here we present a synthetic route for solid phase synthesis of N-linked glycoconjugates containing high mannose oligosaccharides which allows the incorporation of useful functional handles on the N-terminus of asparagine. In this strategy, the C-terminus of an Fmoc protected aspartic acid residue is first attached to a solid phase support. The side chain of aspartic acid is protected by a 2-phenylisopropyl protecting group, which allows selective deprotection for the introduction of glycosylation. By using a convergent on-resin glycosylamine coupling strategy, an N-glycosidic linkage is successfully formed on the free side chain of the resin bound aspartic acid with a large high mannose oligosaccharide, Man8GlcNAc2, to yield N-linked high mannose glycosylated asparagine. The use of on-resin glycosylamine coupling provides excellent glycosylation yield, can be applied to couple other types of oligosaccharides, and also makes it possible to recover excess oligosaccharides conveniently after the on-resin coupling reaction. Useful functional handles including an alkene (p-vinylbenzoic acid), an alkyne (4-pentynoic acid), biotin, and 5-carboxyfluorescein are then conjugated onto the N-terminal amine of asparagine on-resin after the removal of the Fmoc protecting group. In this way, useful functional handles are introduced onto the glycosylated asparagine while maintaining the structural integrity of the reducing end of the oligosaccharide. The asparagine side chain also serves as a linker between the glycan and the functional group and preserves the native presentation of N-linked glycan which may aid in biochemical and structural studies. As an example of a biochemical study using functionalized high mannose glycosylated asparagine, a fluorescence polarization assay has been utilized to study the binding of the lectin Concanavalin A (ConA) using 5-carboxyfluorescein labeled high mannose glycosylated asparagine. PMID:24326091

  16. High quality factor silica microspheres functionalized with self-assembled nanomaterials.

    PubMed

    Kandas, Ishac; Zhang, Baigang; Daengngam, Chalongrat; Ashry, Islam; Jao, Chih-Yu; Peng, Bo; Ozdemir, Sahin K; Robinson, Hans D; Heflin, James R; Yang, Lan; Xu, Yong

    2013-09-09

    With extremely low material absorption and exceptional surface smoothness, silica-based optical resonators can achieve extremely high cavity quality (Q) factors. However, the intrinsic material limitations of silica (e.g., lack of second order nonlinearity) may limit the potential applications of silica-based high Q resonators. Here we report some results in utilizing layer-by-layer self-assembly to functionalize silica microspheres with nonlinear and plasmonic nanomaterials while maintaining Q factors as high as 10(7). We compare experimentally measured Q factors with theoretical estimates, and find good agreement.

  17. Continuous-flow synthesis of highly functionalized imidazo-oxadiazoles facilitated by microfluidic extraction

    PubMed Central

    Herath, Ananda

    2017-01-01

    A versatile continuous-flow synthesis of highly functionalized 1,2,4-oxadiazoles starting from carboxylic acids is reported. This process was applied to the multistep synthesis of imidazo[1,2-a]pyridin-2-yl-1,2,4-oxadiazoles, using a three reactor, multistep continuous-flow system without isolation of intermediates. This continuous-flow method was successfully combined with a single-step liquid–liquid microextraction unit to remove high boiling point polar solvents and impurities and provides the target compounds in high purity with excellent overall yields. PMID:28326132

  18. Impacts of High Serum Total Cholesterol Level on Brain Functional Connectivity in Non-Demented Elderly.

    PubMed

    Zhang, Ting; Li, He; Zhang, Junying; Li, Xin; Qi, Di; Wang, Nuo; Zhang, Zhanjun

    2016-01-01

    Epidemiological and clinical studies suggest that high serum cholesterol is a risk factor of dementia. However, the effects of cholesterol on cognition and brain remain largely unclear. This study aims to investigate the associations between serum total cholesterol (TC) and neuropsychological performance, and intrinsic functional networks in non-demented elderly. Among a cohort of 120 community-dwelling Beijing residents, 29 subjects in the high-TC group (1st quartile) and 31 in the low-TC group (4th quartile) were included in this study, and underwent a battery of neuropsychological tests and magnetic resonance imaging (MRI) scans, including T2- and T1-weighted imaging, and resting-state functional MRI. No significant group difference was found in any of the neuropsychological tests used. Stronger connectivity in the default mode network was observed in the high-TC group compared to that in the low-TC group (p <  0.001, uncorrected). While in the salience network (SN), the high-TC group showed lower connectivity in the anterior cingulate cortex and frontal regions, compared to the low-TC group (p <  0.05, FWE corrected). Our findings suggest that in non-demented elderly persons, high serum cholesterol is associated with disruption of functional connectivity in the SN. The results not only deepen our understanding of how cholesterol affects the brain, but are also significant for selecting sensitive indicators for monitoring the impairments of cholesterol on the neural system.

  19. A genome-wide analysis of putative functional and exonic variation associated with extremely high intelligence

    PubMed Central

    Spain, S L; Pedroso, I; Kadeva, N; Miller, M B; Iacono, W G; McGue, M; Stergiakouli, E; Smith, G D; Putallaz, M; Lubinski, D; Meaburn, E L; Plomin, R; Simpson, M A

    2016-01-01

    Although individual differences in intelligence (general cognitive ability) are highly heritable, molecular genetic analyses to date have had limited success in identifying specific loci responsible for its heritability. This study is the first to investigate exome variation in individuals of extremely high intelligence. Under the quantitative genetic model, sampling from the high extreme of the distribution should provide increased power to detect associations. We therefore performed a case–control association analysis with 1409 individuals drawn from the top 0.0003 (IQ >170) of the population distribution of intelligence and 3253 unselected population-based controls. Our analysis focused on putative functional exonic variants assayed on the Illumina HumanExome BeadChip. We did not observe any individual protein-altering variants that are reproducibly associated with extremely high intelligence and within the entire distribution of intelligence. Moreover, no significant associations were found for multiple rare alleles within individual genes. However, analyses using genome-wide similarity between unrelated individuals (genome-wide complex trait analysis) indicate that the genotyped functional protein-altering variation yields a heritability estimate of 17.4% (s.e. 1.7%) based on a liability model. In addition, investigation of nominally significant associations revealed fewer rare alleles associated with extremely high intelligence than would be expected under the null hypothesis. This observation is consistent with the hypothesis that rare functional alleles are more frequently detrimental than beneficial to intelligence. PMID:26239293

  20. Functional Knowledge Transfer for High-accuracy Prediction of Under-studied Biological Processes

    PubMed Central

    Rowland, Jessica; Guan, Yuanfang; Bongo, Lars A.; Burdine, Rebecca D.; Troyanskaya, Olga G.

    2013-01-01

    A key challenge in genetics is identifying the functional roles of genes in pathways. Numerous functional genomics techniques (e.g. machine learning) that predict protein function have been developed to address this question. These methods generally build from existing annotations of genes to pathways and thus are often unable to identify additional genes participating in processes that are not already well studied. Many of these processes are well studied in some organism, but not necessarily in an investigator's organism of interest. Sequence-based search methods (e.g. BLAST) have been used to transfer such annotation information between organisms. We demonstrate that functional genomics can complement traditional sequence similarity to improve the transfer of gene annotations between organisms. Our method transfers annotations only when functionally appropriate as determined by genomic data and can be used with any prediction algorithm to combine transferred gene function knowledge with organism-specific high-throughput data to enable accurate function prediction. We show that diverse state-of-art machine learning algorithms leveraging functional knowledge transfer (FKT) dramatically improve their accuracy in predicting gene-pathway membership, particularly for processes with little experimental knowledge in an organism. We also show that our method compares favorably to annotation transfer by sequence similarity. Next, we deploy FKT with state-of-the-art SVM classifier to predict novel genes to 11,000 biological processes across six diverse organisms and expand the coverage of accurate function predictions to processes that are often ignored because of a dearth of annotated genes in an organism. Finally, we perform in vivo experimental investigation in Danio rerio and confirm the regulatory role of our top predicted novel gene, wnt5b, in leftward cell migration during heart development. FKT is immediately applicable to many bioinformatics techniques and will

  1. Functional ultrasound imaging of intrinsic connectivity in the living rat brain with high spatiotemporal resolution

    PubMed Central

    Osmanski, Bruno-Félix; Pezet, Sophie; Ricobaraza, Ana; Lenkei, Zsolt; Tanter, Mickael

    2014-01-01

    Long-range coherences in spontaneous brain activity reflect functional connectivity. Here we propose a novel, highly resolved connectivity mapping approach, using ultrafast functional ultrasound (fUS), which enables imaging of cerebral microvascular haemodynamics deep in the anaesthetized rodent brain, through a large thinned-skull cranial window, with pixel dimensions of 100 μm × 100 μm in-plane. The millisecond-range temporal resolution allows unambiguous cancellation of low-frequency cardio-respiratory noise. Both seed-based and singular value decomposition analysis of spatial coherences in the low-frequency (<0.1 Hz) spontaneous fUS signal fluctuations reproducibly report, at different coronal planes, overlapping high-contrast, intrinsic functional connectivity patterns. These patterns are similar to major functional networks described in humans by resting-state fMRI, such as the lateral task-dependent network putatively anticorrelated with the midline default-mode network. These results introduce fUS as a powerful novel neuroimaging method, which could be extended to portable systems for three-dimensional functional connectivity imaging in awake and freely moving rodents. PMID:25277668

  2. Liver disease alters high-density lipoprotein composition, metabolism and function.

    PubMed

    Trieb, Markus; Horvath, Angela; Birner-Gruenberger, Ruth; Spindelboeck, Walter; Stadlbauer, Vanessa; Taschler, Ulrike; Curcic, Sanja; Stauber, Rudolf E; Holzer, Michael; Pasterk, Lisa; Heinemann, Akos; Marsche, Gunther

    2016-07-01

    High-density lipoproteins (HDL) are important endogenous inhibitors of inflammatory responses. Functional impairment of HDL might contribute to the excess mortality experienced by patients with liver disease, but the effect of cirrhosis on HDL metabolism and function remain elusive. To get an integrated measure of HDL quantity and quality, we assessed several metrics of HDL function using apolipoprotein (apo) B-depleted sera from patients with compensated cirrhosis, patients with acutely decompensated cirrhosis and healthy controls. We observed that sera of cirrhotic patients showed reduced levels of HDL-cholesterol and profoundly suppressed activities of several enzymes involved in HDL maturation and metabolism. Native gel electrophoresis analyses revealed that cirrhotic serum HDL shifts towards the larger HDL2 subclass. Proteomic assessment of isolated HDL identified several proteins, including apoA-I, apoC-III, apoE, paraoxonase 1 and acute phase serum amyloid A to be significantly altered in cirrhotic patients. With regard to function, these alterations in levels, composition and structure of HDL were strongly associated with metrics of function of apoB-depleted sera, including cholesterol efflux capability, paraoxonase activity, the ability to inhibit monocyte production of cytokines and endothelial regenerative activities. Of particular interest, cholesterol efflux capacity appeared to be strongly associated with liver disease mortality. Our findings may be clinically relevant and improve our ability to monitor cirrhotic patients at high risk.

  3. C-element: a new clustering algorithm to find high quality functional modules in PPI networks.

    PubMed

    Ghasemi, Mahdieh; Rahgozar, Maseud; Bidkhori, Gholamreza; Masoudi-Nejad, Ali

    2013-01-01

    Graph clustering algorithms are widely used in the analysis of biological networks. Extracting functional modules in protein-protein interaction (PPI) networks is one such use. Most clustering algorithms whose focuses are on finding functional modules try either to find a clique like sub networks or to grow clusters starting from vertices with high degrees as seeds. These algorithms do not make any difference between a biological network and any other networks. In the current research, we present a new procedure to find functional modules in PPI networks. Our main idea is to model a biological concept and to use this concept for finding good functional modules in PPI networks. In order to evaluate the quality of the obtained clusters, we compared the results of our algorithm with those of some other widely used clustering algorithms on three high throughput PPI networks from Sacchromyces Cerevisiae, Homo sapiens and Caenorhabditis elegans as well as on some tissue specific networks. Gene Ontology (GO) analyses were used to compare the results of different algorithms. Each algorithm's result was then compared with GO-term derived functional modules. We also analyzed the effect of using tissue specific networks on the quality of the obtained clusters. The experimental results indicate that the new algorithm outperforms most of the others, and this improvement is more significant when tissue specific networks are used.

  4. Structural and Functional Changes of the Human Macula during Acute Exposure to High Altitude

    PubMed Central

    Fischer, M. Dominik; Willmann, Gabriel; Schatz, Andreas; Schommer, Kai; Zhour, Ahmad; Zrenner, Eberhart; Bartz-Schmidt, Karl U.; Gekeler, Florian

    2012-01-01

    Background This study aimed to quantify structural and functional changes at the macula during acute exposure to high altitude and to assess their structure/function relationship. This work is related to the Tuebingen High Altitude Ophthalmology (THAO) study. Methodology/Principal Findings Spectral domain optical coherence tomography and microperimetry were used to quantify changes of central retinal structure and function in 14 healthy subjects during acute exposure to high altitude (4559 m). High-resolution volume scans and fundus-controlled microperimetry of the posterior pole were performed in addition to best-corrected visual acuity (BCVA) measurements and assessment of acute mountain sickness. Analysis of measurements at altitude vs. baseline revealed increased total retinal thickness (TRT) in all four outer ETDRS grid subfields during acute altitude exposure (TRTouter = 2.80±1.00 μm; mean change±95%CI). This change was inverted towards the inner four subfields (TRTinner = −1.89±0.97 μm) with significant reduction of TRT in the fovea (TRTfoveal = −6.62±0.90 μm) at altitude. BCVA revealed no significant difference compared to baseline (0.06±0.08 logMAR). Microperimetry showed stable mean sensitivity in all but the foveal subfield (MSfoveal = −1.12±0.68 dB). At baseline recordings before and >2 weeks after high altitude exposure, all subjects showed equal levels with no sign of persisting structural or functional sequels. Conclusions/Significance During acute exposure to high altitude central retinal thickness is subject to minor, yet statistically significant changes. These alterations describe a function of eccentricity with an increase in regions with relatively higher retinal nerve fiber content and vascular arcades. However, these changes did not correlate with measures of central retinal function or acute mountain sickness. For the first time a quantitative approach has been used to assess these changes during acute, non

  5. Effects of High Dietary HEME Iron and Radiation on Cardiovascular Function

    NASA Technical Reports Server (NTRS)

    Westby, Christian M.; Brown, A. K.; Platts, S. H.

    2012-01-01

    The radiation related health risks to astronauts is of particular concern to NASA. Data support that exposure to radiation is associated with a number of disorders including a heightened risk for cardiovascular diseases. Independent of radiation, altered nutrient status (e.g. high dietary iron) also increases ones risk for cardiovascular disease. However, it is unknown whether exposure to radiation in combination with high dietary iron further increases ones cardiovascular risk. The intent of our proposal is to generate compulsory data examining the combined effect of radiation exposure and iron overload on sensitivity to radiation injury to address HRP risks: 1) Risk Factor of Inadequate Nutrition; 2) Risk of Cardiac Rhythm Problems; and 3) Risk of Degenerative Tissue or other Health Effects from Space Radiation. Towards our goal we propose two distinct pilot studies using the following specific aims: Vascular Aim 1: To determine the short-term consequences of the independent and combined effects of exposure to gamma radiation and elevated body iron stores on measures of endothelial function and cell viability and integrity. We hypothesize that animals that have high body iron stores and are exposed to gamma radiation will show a greater reduction in endothelial dependent nitric oxid production and larger pathological changes in endothelial integrity than animals that have only 1 of those treatments (either high iron stores or exposure to gamma radiation). Vascular Aim 2: Identify and compare the effects of gamma radiation and elevated body iron stores on the genetic and epigenetic regulation of proteins associated with endothelial cell function. We hypothesize that modifications of epigenetic control and posttranslational expression of proteins associated with endothelial cell function will be differentially altered in rats with high body iron stores and exposed to gamma radiation compared to rats with only 1 type of treatment. Cardiac Aim 1: To determine the

  6. Cross-reactive and major virus-specific epitopes are located at the N-terminal halves of the cylindrical inclusion proteins of turnip mosaic and zucchini yellow mosaic potyviruses.

    PubMed

    Kundu, A K; Ohshima, K; Sako, N; Yaegashi, H

    2000-01-01

    To investigate the antigenic nature of cylindrical inclusion proteins (CIPs) of the potyviruses Turnip mosaic virus (TuMV) and Zucchini yellow mosaic virus (ZYMV), monoclonal antibodies (MAbs) against the two CIPs were produced and epitopes on the CIPs were localized using Escherichia coli-expressed CIP fragments in Western blot analysis. All 23 MAbs against ZYMV CIP reacted only with ZYMV CIP. In contrast out of the 18 MAbs produced against TuMV CIP, 14 MAbs were TuMV CIP-specific while the remaining four MAbs cross-reacted with both CIPs. The four cross-reactive MAbs recognized two distinct epitopes in the N-terminal half of TuMV CIP corresponding to amino acid residues 103-119 and 224-237. Thirteen out of 14 TuMV CIP-specific MAbs recognized two distinct epitopes within residues 1-102 and 120-214, while the other one recognized an epitope within residues 301-644. On the other hand, 21 out of 23 ZYMV CIP-specific MAbs recognized epitopes within residues 1-118, while the remaining two recognized epitopes within residues 301-522. These results suggest that cross-reactive and major virus-specific epitopes are located at the N-terminal half of the respective CIPs.

  7. Simultaneous virus-specific detection of the two cassava brown streak-associated viruses by RT-PCR reveals wide distribution in East Africa, mixed infections, and infections in Manihot glaziovii.

    PubMed

    Mbanzibwa, D R; Tian, Y P; Tugume, A K; Mukasa, S B; Tairo, F; Kyamanywa, S; Kullaya, A; Valkonen, J P T

    2011-02-01

    The expanding cassava brown streak disease (CBSD) epidemic in East Africa is caused by two ipomoviruses (genus Ipomovirus; Potyviridae), namely, Cassava brown streak virus (CBSV), and Ugandan cassava brown streak virus (UCBSV) that was described recently. A reverse transcription polymerase chain reaction (RT-PCR) based diagnostic method was developed in this study for simultaneous virus-specific detection of the two viruses. Results showed that CBSV and UCBSV are distributed widely in the highlands (> 1000 m above the sea level) of the Lake Victoria zone in Uganda and Tanzania and also in the Indian Ocean costal lowlands of Tanzania. Isolates of UCBSV from the Lake Victoria zone were placed to two phylogenetic clusters in accordance with their origin in Uganda or Tanzania, respectively. Mixed infections with CBSV and UCBSV were detected in many cassava plants in the areas surveyed. CBSV was also detected in the perennial species Manihot glaziovii (DNA-barcoded in this study) in Tanzania, which revealed the first virus reservoir other than cassava. The method for detection of CBSV and UCBSV described in this study has important applications for plant quarantine, resistance breeding of cassava, and studies on epidemiology and control of CBSD in East Africa.

  8. Highly surface functionalized carbon nano-onions for bright light bioimaging

    NASA Astrophysics Data System (ADS)

    Frasconi, Marco; Maffeis, Viviana; Bartelmess, Juergen; Echegoyen, Luis; Giordani, Silvia

    2015-12-01

    Carbon-based nanomaterials functionalized with fluorescent and water-soluble groups have emerged as platforms for biological imaging because of their low toxicity and ability to be internalized by cells. The development of imaging probes based on carbon nanomaterials for biomedical studies requires the understanding of their biological response as well as the efficient and safety exposition of the nanomaterial to the cell compartment where it is designed to operate. Here, we present a fluorescent probe based on surface functionalized carbon nano-onions (CNOs) for biological imaging. The modification of CNOs by chemical oxidation of the defects on the outer shell of these carbon nanoparticles results in an extensive surface functionalization with carboxyl groups. We have obtained fluorescently labelled CNOs by a reaction involving the amide bond formation between fluoresceinamine and the carboxylic acids groups on the surface of the CNOs. The functionalized CNOs display high emission properties and dispersability in water due to the presence of high surface coverage of carboxylic acid groups that translate in an efficient fluorescent probe for in vitro imaging of HeLa cells, without significant cytotoxicity. The resulting nanomaterial represents a promising platform for biological imaging applications due to the high dispersability in water, its efficient internalization by cancer cells and localization in specific cell compartments.

  9. In search of joy in practice: a report of 23 high-functioning primary care practices.

    PubMed

    Sinsky, Christine A; Willard-Grace, Rachel; Schutzbank, Andrew M; Sinsky, Thomas A; Margolius, David; Bodenheimer, Thomas

    2013-01-01

    We highlight primary care innovations gathered from high-functioning primary care practices, innovations we believe can facilitate joy in practice and mitigate physician burnout. To do so, we made site visits to 23 high-performing primary care practices and focused on how these practices distribute functions among the team, use technology to their advantage, improve outcomes with data, and make the job of primary care feasible and enjoyable as a life's vocation. Innovations identified include (1) proactive planned care, with previsit planning and previsit laboratory tests; (2) sharing clinical care among a team, with expanded rooming protocols, standing orders, and panel management; (3) sharing clerical tasks with collaborative documentation (scribing), nonphysician order entry, and streamlined prescription management; (4) improving communication by verbal messaging and in-box management; and (5) improving team functioning through co-location, team meetings, and work flow mapping. Our observations suggest that a shift from a physician-centric model of work distribution and responsibility to a shared-care model, with a higher level of clinical support staff per physician and frequent forums for communication, can result in high-functioning teams, improved professional satisfaction, and greater joy in practice.

  10. Sleep Patterns in Adults with a Diagnosis of High-Functioning Autism Spectrum Disorder

    PubMed Central

    Baker, Emma K.; Richdale, Amanda L.

    2015-01-01

    Study Objectives: To examine sleep patterns and sleep problems and their relationship with daytime functioning in adults with a diagnosis of an autism spectrum disorder and no comorbid intellectual disability (high-functioning autism spectrum disorder [HFASD]) compared to neurotypical (NT) adults. Design: Cross-sectional. Setting: Home-based study. Participants: 36 adults with HFASD and 36 age-, intelligence quotient- and sex-matched NT adults. Measurements: Participants completed an online questionnaire battery including the Pittsburgh Sleep Quality Index (PSQI), a 14-d sleep wake diary and 14-d actigraphy data collection. Results: Adults with HFASD had significantly more general sleep disturbances and higher scores on the PSQI, longer sleep onset latencies (actigraphy), and poorer sleep efficiency (diary) and these results remained significant after accounting for the False Discovery Rate. Those adults with HFASD who did not have a comorbid diagnosis of anxiety/depression had significantly shorter total sleep time (diary and actigraphy) compared to NT adults. Compared to NT adults, the HFASD group self-reported significantly poorer refreshment scores upon waking in the morning and higher scores on the daytime dysfunction due to sleepiness subscale of the PSQI. Conclusions: These findings support the notion that problems related to sleep, in particular insomnia, continue into adulthood in individuals with high-functioning autism spectrum disorder. Citation: Baker EK, Richdale AL. Sleep patterns in adults with a diagnosis of high-functioning autism spectrum disorder. SLEEP 2015;38(11):1765–1774. PMID:26237770

  11. High-Throughput Density Functional Theory Categorization of Ferroelectric Ternary Perovskite Oxides for Use as High-Performance Piezoelectrics

    NASA Astrophysics Data System (ADS)

    Armiento, Rickard; Kozinsky, Boris; Fornari, Marco; Ceder, Gerbrand

    2011-03-01

    We present a nearly exhaustive density functional theory (DFT) survey over the chemical space of perovskite compounds on ABO3 form, with the aim of identifying alloy end points for new piezoelectric materials. Our screening criteria on the DFT results selects 85 relevant compounds, among which all well known alloy end points for high performance piezoelectrics are present. We analyze the compounds with respect to macroscopic polarization, born effective charges, and energy differences between different structure distortions. We discuss the energy features that cause the high piezoelectric performance of the well known piezoelectric lead zirconate titanate (PZT), and to what extent these features are rare among the found compounds. The results are used to discuss relevant isovalent alloys of the selected compounds.

  12. Filtered Mass Density Function for Design Simulation of High Speed Airbreathing Propulsion Systems

    NASA Technical Reports Server (NTRS)

    Drozda, T. G.; Sheikhi, R. M. H.; Givi, P.; Drummond, J. Philip (Technical Monitor)

    2002-01-01

    The objective of this research is to develop and implement a new methodology for large eddy simulation of (LES) of high-speed reacting turbulent flows. We have just completed 2 1/2 years of Phase I of this research. The work within the past six months was concentrated on the following two subjects: (1) Development of the joint velocity-scalar filtered density function (VSFDF) scheme for LES. (2) Implementation of our previously developed scalar filtered density function (SFDF) for flame simulations.

  13. Large-Deformation Displacement Transfer Functions for Shape Predictions of Highly Flexible Slender Aerospace Structures

    NASA Technical Reports Server (NTRS)

    Ko, William L.; Fleischer, Van Tran

    2013-01-01

    Large deformation displacement transfer functions were formulated for deformed shape predictions of highly flexible slender structures like aircraft wings. In the formulation, the embedded beam (depth wise cross section of structure along the surface strain sensing line) was first evenly discretized into multiple small domains, with surface strain sensing stations located at the domain junctures. Thus, the surface strain (bending strains) variation within each domain could be expressed with linear of nonlinear function. Such piecewise approach enabled piecewise integrations of the embedded beam curvature equations [classical (Eulerian), physical (Lagrangian), and shifted curvature equations] to yield closed form slope and deflection equations in recursive forms.

  14. Particle-hole optical model and strength functions for high-energy giant resonances

    SciTech Connect

    Urin, M. H.

    2010-08-15

    A formulation of the particle-hole optical model is proposed for describing the contribution of the fragmentation effect to the formation of strength functions for high-energy giant resonances. The model is based on the Bethe-Goldstone equation for the energy-averaged particle-hole Green's function. In this equation, the particle-hole interaction that is induced by a virtual excitation of multiquasiparticle configurations and in which, upon averaging over energy, an imaginary part is contained is taken into account. An analogy with the single-quasiparticle optical model is discussed.

  15. Theory of melting at high pressures: Amending density functional theory with quantum Monte Carlo

    SciTech Connect

    Shulenburger, L.; Desjarlais, M. P.; Mattsson, T. R.

    2014-10-01

    We present an improved first-principles description of melting under pressure based on thermodynamic integration comparing Density Functional Theory (DFT) and quantum Monte Carlo (QMC) treatments of the system. The method is applied to address the longstanding discrepancy between density functional theory (DFT) calculations and diamond anvil cell (DAC) experiments on the melting curve of xenon, a noble gas solid where van der Waals binding is challenging for traditional DFT methods. The calculations show excellent agreement with data below 20 GPa and that the high-pressure melt curve is well described by a Lindemann behavior up to at least 80 GPa, a finding in stark contrast to DAC data.

  16. Correlation Function Approach for Estimating Thermal Conductivity in Highly Porous Fibrous Materials

    NASA Technical Reports Server (NTRS)

    Martinez-Garcia, Jorge; Braginsky, Leonid; Shklover, Valery; Lawson, John W.

    2011-01-01

    Heat transport in highly porous fiber networks is analyzed via two-point correlation functions. Fibers are assumed to be long and thin to allow a large number of crossing points per fiber. The network is characterized by three parameters: the fiber aspect ratio, the porosity and the anisotropy of the structure. We show that the effective thermal conductivity of the system can be estimated from knowledge of the porosity and the correlation lengths of the correlation functions obtained from a fiber structure image. As an application, the effects of the fiber aspect ratio and the network anisotropy on the thermal conductivity is studied.

  17. High Interleukin 17 Expression Is Correlated With Better Cardiac Function in Human Chagas Disease

    PubMed Central

    Magalhães, Luisa M. D.; Villani, Fernanda N. A.; Nunes, Maria do Carmo P.; Gollob, Kenneth J.; Rocha, Manoel O. C.; Dutra, Walderez O.

    2013-01-01

    This study was designed to investigate whether the expression of interleukin 17 (IL-17) is associated with the indeterminate or cardiac clinical forms of Chagas disease and whether IL-17 expression can be correlated with patients' cardiac function. Our results demonstrated that cardiac Chagas patients have a lower intensity of expression of IL-17 by total lymphocytes and lower frequency of circulating T helper 17 cells. Correlative analysis showed that high IL-17 expression was associated with better cardiac function, as determined by left ventricular ejection fraction and left ventricular diastolic diameter values. Therefore, IL-17 expression can be a protective factor to prevent myocardial damage in human Chagas disease. PMID:23204182

  18. More of the same: high functional redundancy in stream fish assemblages from tropical agroecosystems.

    PubMed

    Casatti, Lilian; Teresa, Fabrício Barreto; Zeni, Jaquelini de Oliveira; Ribeiro, Mariela Domiciano; Brejão, Gabriel Lourenço; Ceneviva-Bastos, Mônica

    2015-06-01

    In this study, we investigated the influence of environmental variables (predictor variables) on the species richness, species diversity, functional diversity, and functional redundancy (response variables) of stream fish assemblages in an agroecosystem that harbor a gradient of degradation. We hypothesized that, despite presenting high richness or diversity in some occasions, fish communities will be more functionally redundant with stream degradation. Species richness, species diversity, and functional redundancy were predicted by the percentage of grass on the banks, which is a characteristic that indicates degraded conditions, whereas the percentage of coarse substrate in the stream bottom was an important predictor of all response variables and indicates more preserved conditions. Despite being more numerous and diverse, the groups of species living in streams with an abundance of grass on the banks perform similar functions in the ecosystem. We found that riparian and watershed land use had low predictive power in comparison to the instream habitat. If there is any interest in promoting ecosystem functions and fish diversity, conservation strategies should seek to restore forests in watersheds and riparian buffers, protect instream habitats from siltation, provide wood debris, and mitigate the proliferation of grass on stream banks. Such actions will work better if they are planned together with good farming practices because these basins will continue to be used for agriculture and livestock in the future.

  19. The High-mass Truncation of the Star Cluster Mass Function: Limits on Massive Cluster Formation

    NASA Astrophysics Data System (ADS)

    Johnson, L. C.; PHAT Team

    2017-01-01

    Long-lived star clusters serve as useful tracers of star formation, and massive clusters in particular are often associated with vigorous star formation activity. We examine how massive cluster formation varies as a function of star formation surface density (ΣSFR) by comparing cluster populations from galaxies that span a wide range of characteristic ΣSFR values. The Panchromatic Hubble Andromeda Treasury (PHAT) survey yielded an unparalleled census of young star clusters in M31 and allows us to examine massive cluster formation in a low intensity star formation environment. We measure the cluster mass function for a sample of 840 young star clusters with ages between 10-300 Myr. The data show clear evidence of a high-mass truncation: only 15 clusters more massive than 104 M⊙ are observed, compared to ~100 expected for a canonical M-2 power-law mass function with the same total number of clusters above the catalog completeness limit. Adopting a Schechter function parameterization, we fit a characteristic truncation mass (Mc) of 8.5×103 M⊙ — the lowest truncation mass ever reported. When combined with previous mass function results, we find that the cluster mass function truncation correlates strongly with the star formation rate surface density, where Mc ∝ ΣSFR1.3. We also find evidence that suggests the observed Mc-ΣSFR relation also holds for globular clusters, linking the two populations via a common formation pathway.

  20. More of the Same: High Functional Redundancy in Stream Fish Assemblages from Tropical Agroecosystems

    NASA Astrophysics Data System (ADS)

    Casatti, Lilian; Teresa, Fabrício Barreto; Zeni, Jaquelini de Oliveira; Ribeiro, Mariela Domiciano; Brejão, Gabriel Lourenço; Ceneviva-Bastos, Mônica

    2015-06-01

    In this study, we investigated the influence of environmental variables (predictor variables) on the species richness, species diversity, functional diversity, and functional redundancy (response variables) of stream fish assemblages in an agroecosystem that harbor a gradient of degradation. We hypothesized that, despite presenting high richness or diversity in some occasions, fish communities will be more functionally redundant with stream degradation. Species richness, species diversity, and functional redundancy were predicted by the percentage of grass on the banks, which is a characteristic that indicates degraded conditions, whereas the percentage of coarse substrate in the stream bottom was an important predictor of all response variables and indicates more preserved conditions. Despite being more numerous and diverse, the groups of species living in streams with an abundance of grass on the banks perform similar functions in the ecosystem. We found that riparian and watershed land use had low predictive power in comparison to the instream habitat. If there is any interest in promoting ecosystem functions and fish diversity, conservation strategies should seek to restore forests in watersheds and riparian buffers, protect instream habitats from siltation, provide wood debris, and mitigate the proliferation of grass on stream banks. Such actions will work better if they are planned together with good farming practices because these basins will continue to be used for agriculture and livestock in the future.

  1. Synthesis, characterization, and in vitro biological evaluation of highly stable diversely functionalized superparamagnetic iron oxide nanoparticles

    NASA Astrophysics Data System (ADS)

    Bhattacharya, Dipsikha; Sahu, Sumanta K.; Banerjee, Indranil; Das, Manasmita; Mishra, Debashish; Maiti, Tapas K.; Pramanik, Panchanan

    2011-09-01

    In this article, we report the design and synthesis of a series of well-dispersed superparamagnetic iron oxide nanoparticles (SPIONs) using chitosan as a surface modifying agent to develop a potential T 2 contrast probe for magnetic resonance imaging (MRI). The amine, carboxyl, hydroxyl, and thiol functionalities were introduced on chitosan-coated magnetic probe via simple reactions with small reactive organic molecules to afford a series of biofunctionalized nanoparticles. Physico-chemical characterizations of these functionalized nanoparticles were performed by TEM, XRD, DLS, FTIR, and VSM. The colloidal stability of these functionalized iron oxide nanoparticles was investigated in presence of phosphate buffer saline, high salt concentrations and different cell media for 1 week. MRI analysis of human cervical carcinoma (HeLa) cell lines treated with nanoparticles elucidated that the amine-functionalized nanoparticles exhibited higher amount of signal darkening and lower T 2 relaxation in comparison to the others. The cellular internalization efficacy of these functionalized SPIONs was also investigated with HeLa cancer cell line by magnetically activated cell sorting (MACS) and fluorescence microscopy and results established selectively higher internalization efficacy of amine-functionalized nanoparticles to cancer cells. These positive attributes demonstrated that these nanoconjugates can be used as a promising platform for further in vitro and in vivo biological evaluations.

  2. Alcohol Mixed With Energy Drinks: Associations with Risky Drinking and Functioning in High School

    PubMed Central

    Tucker, Joan S.; Troxel, Wendy M.; Ewing, Brett A.; D’Amico, Elizabeth J.

    2016-01-01

    Background Mixing alcohol with energy drinks is associated with heavier drinking and related problems among college students. However, little is known about how high school drinkers who mix alcohol with energy drinks (AmED) compare to those who do not (AwoED). This study compares high school AmED and AwoED users on their alcohol use during middle and high school, as well as key domains of functioning in high school. Methods Two surveys were conducted three years apart in adolescents initially recruited from 16 middle schools in Southern California. The analytic sample consists of 696 past month drinkers. Multivariable models compared AmED and AwoED users on alcohol use, mental health, social functioning, academic orientation, delinquency and other substance use at age 17, and on their alcohol use and related cognitions at age 14. Results AmED was reported by 13% of past month drinkers. AmED and AwoED users did not differ on alcohol use or cognitions in middle school, but AmED users drank more often, more heavily, and reported more negative consequences in high school. AmED users were also more likely to report poor grades, delinquent behavior, substance use-related unsafe driving, public intoxication, and drug use than AwoED users in high school. Group differences were not found on mental health, social functioning, or academic aspirations. Conclusions AmED use is common among high school drinkers. The higher risk behavioral profile of these young AmED users, which includes drug use and substance use-related unsafe driving, is a significant cause for concern and warrants further attention. PMID:27522534

  3. Hydrazide functionalized core-shell magnetic nanocomposites for highly specific enrichment of N-glycopeptides.

    PubMed

    Liu, Liting; Yu, Meng; Zhang, Ying; Wang, Changchun; Lu, Haojie

    2014-05-28

    In view of the biological significance of glycosylation for human health, profiling of glycoproteome from complex biological samples is highly inclined toward the discovery of disease biomarkers and clinical diagnosis. Nevertheless, because of the existence of glycopeptides at relatively low abundances compared with nonglycosylated peptides and glycan microheterogeneity, glycopeptides need to be highly selectively enriched from complex biological samples for mass spectrometry analysis. Herein, a new type of hydrazide functionalized core-shell magnetic nanocomposite has been synthesized for highly specific enrichment of N-glycopeptides. The nanocomposites with both the magnetic core and the polymer shell hanging high density of hydrazide groups were prepared by first functionalization of the magnetic core with polymethacrylic acid by reflux precipitation polymerization to obtain the Fe3O4@poly(methacrylic acid) (Fe3O4@PMAA) and then modification of the surface of Fe3O4@PMAA with adipic acid dihydrazide (ADH) to obtain Fe3O4@poly(methacrylic hydrazide) (Fe3O4@PMAH). The abundant hydrazide groups toward highly specific enrichment of glycopeptides and the magnetic core make it suitable for large-scale, high-throughput, and automated sample processing. In addition, the hydrophilic polymer surface can provide low nonspecific adsorption of other peptides. Compared to commercially available hydrazide resin, Fe3O4@PMAH improved more than 5 times the signal-to-noise ratio of standard glycopeptides. Finally, this nanocomposite was applied in the profiling of N-glycoproteome from the colorectal cancer patient serum. In total, 175 unique glycopeptides and 181 glycosylation sites corresponding to 63 unique glycoproteins were identified in three repeated experiments, with the specificities of the enriched glycopeptides and corresponding glycoproteins of 69.6% and 80.9%, respectively. Because of all these attractive features, we believe that this novel hydrazide functionalized

  4. Acute Effect of High-Intensity Eccentric Exercise on Vascular Endothelial Function in Young Men.

    PubMed

    Choi, Youngju; Akazawa, Nobuhiko; Zempo-Miyaki, Asako; Ra, Song-Gyu; Shiraki, Hitoshi; Ajisaka, Ryuichi; Maeda, Seiji

    2016-08-01

    Choi, Y, Akazawa, N, Zempo-Miyaki, A, Ra, S-G, Shiraki, H, Ajisaka, R, and Maeda, S. Acute effect of high-intensity eccentric exercise on vascular endothelial function in young men. J Strength Cond Res 30(8): 2279-2285, 2016-Increased central arterial stiffness is as an independent risk factor for cardiovascular disease. Evidence regarding the effects of high-intensity resistance exercise on vascular endothelial function and central arterial stiffness is conflicting. The purpose of this study was to examine the effects of acute high-intensity eccentric exercise on vascular endothelial function and central arterial stiffness. We evaluated the acute changes in endothelium-dependent flow-mediated dilation (FMD), low-flow-mediated constriction (L-FMC), and arterial stiffness after high-intensity eccentric exercise. Seven healthy, sedentary men (age, 24 ± 1 year) performed maximal eccentric elbow flexor exercise using their nondominant arm. Before and 45 minutes after eccentric exercise, carotid arterial compliance and brachial artery FMD and L-FMC in the nonexercised arm were measured. Carotid arterial compliance was significantly decreased, and β-stiffness index significantly increased after eccentric exercise. Brachial FMD was significantly reduced after eccentric exercise, whereas there was no significant difference in brachial L-FMC before and after eccentric exercise. A positive correlation was detected between change in arterial compliance and change in FMD (r = 0.779; p ≤ 0.05), and a negative correlation was detected between change in β-stiffness index and change in FMD (r = -0.891; p < 0.01) with eccentric exercise. In this study, acute high-intensity eccentric exercise increased central arterial stiffness; this increase was accompanied by a decrease in endothelial function caused by reduced endothelium-dependent vasodilation but not by a change in endothelium-dependent vasoconstriction.

  5. High density lipoprotein and metabolic disease: Potential benefits of restoring its functional properties

    PubMed Central

    Klancic, Teja; Woodward, Lavinia; Hofmann, Susanna M.; Fisher, Edward A.

    2016-01-01

    Background High density lipoproteins (HDLs) are thought to be atheroprotective and to reduce the risk of cardiovascular disease (CVD). Besides their antioxidant, antithrombotic, anti-inflammatory, anti-apoptotic properties in the vasculature, HDLs also improve glucose metabolism in skeletal muscle. Scope of the review Herein, we review the functional role of HDLs to improve metabolic disorders, especially those involving insulin resistance and to induce regression of CVD with a particular focus on current pharmacological treatment options as well as lifestyle interventions, particularly exercise. Major conclusions Functional properties of HDLs continue to be considered important mediators to reverse metabolic dysfunction and to regress atherosclerotic cardiovascular disease. Lifestyle changes are often recommended to reduce the risk of CVD, with exercise being one of the most important of these. Understanding how exercise improves HDL function will likely lead to new approaches to battle the expanding burden of obesity and the metabolic syndrome. PMID:27110484

  6. Relationship between functional properties and aggregation changes of whey protein induced by high pressure microfluidization.

    PubMed

    Liu, Cheng-Mei; Zhong, Jun-Zhen; Liu, Wei; Tu, Zong-Cai; Wan, Jie; Cai, Xiao-Fei; Song, Xin-Yun

    2011-05-01

    Aggregation changes of whey protein induced by high-pressure microfluidization (HPM) treatment have been investigated in relation with their functional properties. Whey protein was treated with HPM under pressure from 40 to 160 MPa. Functional properties (solubility, foaming, and emulsifying properties) of whey protein concentrate (WPC) ultrafiltered from fluid whey were evaluated. The results showed significant modifications in the solubility (30% to 59%) and foaming properties (20% to 65%) of WPC with increasing pressure. However, emulsifying property of WPC treated at different pressures was significantly worse than untreated sample. To better understand the mechanism of the modification by HPM, the HPM-induced aggregation changes were examined using particle size distribution, scanning electron microscopy, and hydrophobicity. It was indicated that HPM induced 2 kinds of aggregation changes on WPC: deaggregation and reaggregation of WPC, which resulted in the changes of functional properties of WPC modified by HPM.

  7. Innate-like functions of natural killer T cell subsets result from highly divergent gene programs.

    PubMed

    Engel, Isaac; Seumois, Grégory; Chavez, Lukas; Samaniego-Castruita, Daniela; White, Brandie; Chawla, Ashu; Mock, Dennis; Vijayanand, Pandurangan; Kronenberg, Mitchell

    2016-06-01

    Natural killer T cells (NKT cells) have stimulatory or inhibitory effects on the immune response that can be attributed in part to the existence of functional subsets of NKT cells. These subsets have been characterized only on the basis of the differential expression of a few transcription factors and cell-surface molecules. Here we have analyzed purified populations of thymic NKT cell subsets at both the transcriptomic level and epigenomic level and by single-cell RNA sequencing. Our data indicated that despite their similar antigen specificity, the functional NKT cell subsets were highly divergent populations with many gene-expression and epigenetic differences. Therefore, the thymus 'imprints' distinct gene programs on subsets of innate-like NKT cells that probably impart differences in proliferative capacity, homing, and effector functions.

  8. Innate-like functions of natural killer T cell subsets result from highly divergent gene programs

    PubMed Central

    Engel, Isaac; Seumois, Grégory; Chavez, Lukas; Samaniego-Castruita, Daniela; White, Brandie; Chawla, Ashu; Mock, Dennis; Vijayanand, Pandurangan; Kronenberg, Mitchell

    2016-01-01

    Natural killer T cells (NKT cells) have stimulatory or inhibitory effects on the immune response that can be attributed in part to the existence of functional subsets of NKT cells. These subsets have been characterized only on the basis of the differential expression of a few transcription factors and cell-surface molecules. Here we have analyzed purified populations of thymic NKT cell subsets at both the transcriptomic level and epigenomic level and by single-cell RNA sequencing. Our data indicated that despite their similar antigen specificity, the functional NKT cell subsets were highly divergent populations with many gene-expression and epigenetic differences. Therefore, the thymus ‘imprints’ distinct gene programs on subsets of innate-like NKT cells that probably impart differences in proliferative capacity, homing, and effector functions. PMID:27089380

  9. Social competence intervention for youth with Asperger Syndrome and high-functioning autism: an initial investigation.

    PubMed

    Stichter, Janine P; Herzog, Melissa J; Visovsky, Karen; Schmidt, Carla; Randolph, Jena; Schultz, Tia; Gage, Nicholas

    2010-09-01

    Individuals with high functioning autism (HFA) or Asperger Syndrome (AS) exhibit difficulties in the knowledge or correct performance of social skills. This subgroup's social difficulties appear to be associated with deficits in three social cognition processes: theory of mind, emotion recognition and executive functioning. The current study outlines the development and initial administration of the group-based Social Competence Intervention (SCI), which targeted these deficits using cognitive behavioral principles. Across 27 students age 11-14 with a HFA/AS diagnosis, results indicated significant improvement on parent reports of social skills and executive functioning. Participants evidenced significant growth on direct assessments measuring facial expression recognition, theory of mind and problem solving. SCI appears promising, however, larger samples and application in naturalistic settings are warranted.

  10. Thioetherification of chloroheteroarenes: a binuclear catalyst promotes wide scope and high functional-group tolerance.

    PubMed

    Platon, Mélanie; Wijaya, Novi; Rampazzi, Vincent; Cui, Luchao; Rousselin, Yoann; Saeys, Mark; Hierso, Jean-Cyrille

    2014-09-22

    A constrained binuclear palladium catalyst system affords selective thioetherification of a wide range of functionalized arenethiols with chloroheteroaromatic partners with the highest turnover numbers (TONs) reported to date and tolerates a large variety of reactive functions. The scope of this system includes the coupling of thiophenols with six- and five-membered 2-chloroheteroarenes (i.e., functionalized pyridine, pyrazine, quinoline, pyrimidine, furane, and thiazole) and 3-bromoheteroarenes (i.e., pyridine and furane). Electron-rich congested thiophenols and fluorinated thiophenols are also suitable partners. The coupling of unprotected amino-2-chloropyridines with thiophenol and the successful employment of synthetically valuable chlorothiophenols are described with the same catalyst system. DFT studies attribute the high performance of this binuclear palladium catalyst to the decreased stability of thiolate-containing resting states. Palladium loading was as low as 0.2 mol %, which is important for industrial application and is a step forward in solving catalyst activation/deactivation problems.

  11. [Structural and functional changes in the of heart of high-performance (canoeing) athletes].

    PubMed

    Galván, O; Cherebetiu, G; Meléndez, H; Casanova, J M; Huerta, D; Guadalajara, J F

    1999-01-01

    We studied two groups of healthy subjects: Group I was integrated by 13 high-performance sportsmen (10 men and 3 women), devoted to the discipline of the rowing. Group II was integrated by 16 sedentary healthy subjects. All of them were studied with a two-dimensional echocardiogram, in order to study the anatomical and functional characteristics of the heart. Both groups had similar characteristics in regard of total body area, heart rate and blood pressure, the only difference was in age. The ventricular mass and the diastolic volume were greater in athletes in spite of the fact that the dimensions and transverse thicknesses were similar, this imply a longitudinal increase of the heart size. It is possible that this form of ventricular remodeling has functional advantages. On the other hand, it was demonstrated the existence of physiological hypertrophy without disorders in diastolic function.

  12. Executive functions and performance on high-stakes testing in children from urban schools.

    PubMed

    Waber, Deborah P; Gerber, Emily B; Turcios, Viana Y; Wagner, Erin R; Forbes, Peter W

    2006-01-01

    High-stakes achievement testing is a centerpiece of education reform. Children from socially disadvantaged backgrounds typically perform more poorly than their more advantaged peers. The authors evaluated 91 fifth-grade children from low-income urban schools using clinical neuropsychological tests and behavioral questionnaires and obtained fourth-grade scores on state mandated standards-based testing. Goals were to determine whether executive functions are selectively diminished in children from poor urban environments and to evaluate to what extent integrity of executive functions is associated with test scores. Neuropsychological variables (particularly executive functions) accounted for 40% of the variance in English scores and 30% in mathematics. Efforts to improve children's academic achievement should consider developmental factors as well as curricular content.

  13. High-Frequency Electron Paramagnetic Resonance Spectroscopy of Nitroxide-Functionalized Nanodiamonds in Aqueous Solution.

    PubMed

    Akiel, R D; Stepanov, V; Takahashi, S

    2016-06-21

    Nanodiamond (ND) is an attractive class of nanomaterial for fluorescent labeling, magnetic sensing of biological molecules, and targeted drug delivery. Many of those applications require tethering of target biological molecules on the ND surface. Even though many approaches have been developed to attach macromolecules to the ND surface, it remains challenging to characterize dynamics of tethered molecule. Here, we show high-frequency electron paramagnetic resonance (HF EPR) spectroscopy of nitroxide-functionalized NDs. Nitroxide radical is a commonly used spin label to investigate dynamics of biological molecules. In the investigation, we developed a sample holder to overcome water absorption of HF microwave. Then, we demonstrated HF EPR spectroscopy of nitroxide-functionalized NDs in aqueous solution and showed clear spectral distinction of ND and nitroxide EPR signals. Moreover, through EPR spectral analysis, we investigate dynamics of nitroxide radicals on the ND surface. The demonstration sheds light on the use of HF EPR spectroscopy to investigate biological molecule-functionalized nanoparticles.

  14. Risk Factors for Depression in Children and Adolescents with High Functioning Autism Spectrum Disorders

    PubMed Central

    De-la-Iglesia, Myriam; Olivar, José-Sixto

    2015-01-01

    The objective of our study was to examine, discuss, and provide proposals on diagnostic comorbidity of depression in children and adolescents with high functioning autism spectrum disorder (HFASD) in the following aspects. (1) Prevalence. It was concluded that there are an elevated depression rate and the need for longitudinal studies to determine prevalence and incidence based on functioning level, autistic symptoms, gender, age, type of depression, prognosis, duration, and treatment. (2) Explicative Hypotheses and Vulnerability. The factors that present the greatest specific risk are higher cognitive functioning, self-awareness of deficit, capacity for introspection, stressful life events, adolescence, quality of social relationships, and alexithymia. (3) Risk of Suicide. The need for control and detection of suicidal tendencies and bullying is emphasised. (4) Depressive Symptoms. Indicators for early detection are proposed and their overlap with HFASD is analysed, examining the assessment techniques used and arguing that specific adapted tests are needed. PMID:26413564

  15. Risk Factors for Depression in Children and Adolescents with High Functioning Autism Spectrum Disorders.

    PubMed

    De-la-Iglesia, Myriam; Olivar, José-Sixto

    2015-01-01

    The objective of our study was to examine, discuss, and provide proposals on diagnostic comorbidity of depression in children and adolescents with high functioning autism spectrum disorder (HFASD) in the following aspects. (1) Prevalence. It was concluded that there are an elevated depression rate and the need for longitudinal studies to determine prevalence and incidence based on functioning level, autistic symptoms, gender, age, type of depression, prognosis, duration, and treatment. (2) Explicative Hypotheses and Vulnerability. The factors that present the greatest specific risk are higher cognitive functioning, self-awareness of deficit, capacity for introspection, stressful life events, adolescence, quality of social relationships, and alexithymia. (3) Risk of Suicide. The need for control and detection of suicidal tendencies and bullying is emphasised. (4) Depressive Symptoms. Indicators for early detection are proposed and their overlap with HFASD is analysed, examining the assessment techniques used and arguing that specific adapted tests are needed.

  16. Non-covalent functionalization of high-surface area nanomaterials: a new class of sorbent materials

    SciTech Connect

    Nell, Kara M.; Fontenot, Sean A.; Carter, Timothy G.; Warner, Marvin G.; Warner, Cynthia L.; Addleman, R. Shane; Johnson, Darren W.

    2015-10-27

    non-covalent approach to functionalizing nanostructured materials with high-specificity ligands is described. In this work a variety of thiol ligands were non-covalently attached to self-assembled phenyl monolayers on nanostructured materials by taking advantage of favorable aromatic interactions. The resulting sorbent materials, both mesoporous silica and magnetic nanoparticles, were found to be very effective at scavenging soft heavy metal cations, Cd(II), Hg(II), Pb(II) and Ag(I), from aqueous matrices, performing better than commercial sorbents and comparably to the best covalently functionalized thiol sorbents available. This approach can be extended to a variety of surface chemistries and has application to chemical functionalization of a broad range of support structures used for chemical separations and processing.

  17. Associations between conceptual reasoning, problem solving, and adaptive ability in high-functioning autism.

    PubMed

    Williams, Diane L; Mazefsky, Carla A; Walker, Jon D; Minshew, Nancy J; Goldstein, Gerald

    2014-11-01

    Abstract thinking is generally highly correlated with problem-solving ability which is predictive of better adaptive functioning. Measures of conceptual reasoning, an ecologically-valid laboratory measure of problem-solving, and a report measure of adaptive functioning in the natural environment, were administered to children and adults with and without autism. The individuals with autism had weaker conceptual reasoning ability than individuals with typical development of similar age and cognitive ability. For the autism group, their flexible thinking scores were significantly correlated with laboratory measures of strategy formation and rule shifting and with reported overall adaptive behavior but not socialization scores. Therefore, in autism, flexibility of thought is potentially more important for adaptive functioning in the natural environment than conceptual reasoning or problem-solving.

  18. Increased premotor cortex activation in high functioning autism during action observation.

    PubMed

    Perkins, Tom J; Bittar, Richard G; McGillivray, Jane A; Cox, Ivanna I; Stokes, Mark A

    2015-04-01

    The mirror neuron (MN) hypothesis of autism has received considerable attention, but to date has produced inconsistent findings. Using functional MRI, participants with high functioning autism or Asperger's syndrome were compared to typically developing individuals (n=12 in each group). Participants passively observed hand gestures that included waving, pointing, and grasping. Concerning the MN network, both groups activated similar regions including prefrontal, inferior parietal and superior temporal regions, with the autism group demonstrating significantly greater activation in the dorsal premotor cortex. Concerning other regions, participants with autism demonstrated increased activity in the anterior cingulate and medial frontal gyrus, and reduced activation in calcarine, cuneus, and middle temporal gyrus. These results suggest that during observation of hand gestures, frontal cortex activation is affected in autism, which we suggest may be linked to abnormal functioning of the MN system.

  19. Mining high-throughput experimental data to link gene and function

    PubMed Central

    Blaby-Haas, Crysten E.; de Crécy-Lagard, Valérie

    2011-01-01

    Nearly 2200 genomes encoding some 6 million proteins have now been sequenced. Around 40% of these proteins are of unknown function even when function is loosely and minimally defined as “belonging to a superfamily”. In addition to in silico methods, the swelling stream of high-throughput experimental data can give valuable clues for linking these “unknowns” with precise biological roles. The goal is to develop integrative data-mining platforms that allow the scientific community at large to access and utilize this rich source of experimental knowledge. To this end, we review recent advances in generating whole-genome experimental datasets, where this data can be accessed, and how it can be used to drive prediction of gene function. PMID:21310501

  20. Functional connectivity classification of autism identifies highly predictive brain features but falls short of biomarker standards

    PubMed Central

    Plitt, Mark; Barnes, Kelly Anne; Martin, Alex

    2014-01-01

    Objectives Autism spectrum disorders (ASD) are diagnosed based on early-manifesting clinical symptoms, including markedly impaired social communication. We assessed the viability of resting-state functional MRI (rs-fMRI) connectivity measures as diagnostic biomarkers for ASD and investigated which connectivity features are predictive of a diagnosis. Methods Rs-fMRI scans from 59 high functioning males with ASD and 59 age- and IQ-matched typically developing (TD) males were used to build a series of machine learning classifiers. Classification features were obtained using 3 sets of brain regions. Another set of classifiers was built from participants' scores on behavioral metrics. An additional age and IQ-matched cohort of 178 individuals (89 ASD; 89 TD) from the Autism Brain Imaging Data Exchange (ABIDE) open-access dataset (http://fcon_1000.projects.nitrc.org/indi/abide/) were included for replication. Results High classification accuracy was achieved through several rs-fMRI methods (peak accuracy 76.67%). However, classification via behavioral measures consistently surpassed rs-fMRI classifiers (peak accuracy 95.19%). The class probability estimates, P(ASD|fMRI data), from brain-based classifiers significantly correlated with scores on a measure of social functioning, the Social Responsiveness Scale (SRS), as did the most informative features from 2 of the 3 sets of brain-based features. The most informative connections predominantly originated from regions strongly associated with social functioning. Conclusions While individuals can be classified as having ASD with statistically significant accuracy from their rs-fMRI scans alone, this method falls short of biomarker standards. Classification methods provided further evidence that ASD functional connectivity is characterized by dysfunction of large-scale functional networks, particularly those involved in social information processing. PMID:25685703

  1. Facile and green synthesis of highly stable L-cysteine functionalized copper nanoparticles

    NASA Astrophysics Data System (ADS)

    Kumar, Nikhil; Upadhyay, Lata Sheo Bachan

    2016-11-01

    A simple eco-friendly method for L-cysteine capped copper nanoparticles (CCNPs) synthesis in aqueous solution has been developed. Glucose and L-cysteine were used as reducing agent and capping/functionalizing agent, respectively. Different parameters such as capping agent concentration, pH, reaction temperature, and reducing agent concentration were optimized during the synthesis. The L-cysteine capped copper nanoparticle were characterized by ultraviolet-visible spectroscopy, Fourier-transform infrared spectroscopy, X-ray diffraction, Particle size and zeta potential analyser, and high resolution transmission electron microscopy. Spherical shaped cysteine functionalized/capped copper nanoparticles with an average size of 40 nm were found to be highly stable at room temperature (RT) for a period of 1 month

  2. WISC-IV and WIAT-II profiles in children with high-functioning autism.

    PubMed

    Mayes, Susan Dickerson; Calhoun, Susan L

    2008-03-01

    Children with high-functioning autism earned above normal scores on the Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) Perceptual Reasoning and Verbal Comprehension Indexes and below normal scores on the Working Memory and Processing Speed Indexes and Wechsler Individual Achievement Test-Second Edition (WIAT-II) Written Expression. Full Scale IQ (FSIQ) and reading and math scores were similar to the norm. Profiles were consistent with previous WISC-III research, except that the new WISC-IV motor-free visual reasoning subtests (Matrix Reasoning and Picture Concepts) were the highest of the nonverbal subtests. The WISC-IV may be an improvement over the WISC-III for children with high-functioning autism because it captures their visual reasoning strength, while identifying their attention, graphomotor, and processing speed weaknesses. FSIQ was the best single predictor of academic achievement.

  3. Catatonia in high-functioning autism spectrum disorders: case report and review of literature.

    PubMed

    Takaoka, Ken; Takata, Tomoji

    2007-12-01

    Although catatonia has been identified in individuals with autism spectrum disorders, little is known about this relationship. Studies on previous case reports dealing with the relationship between catatonia and autism spectrum disorders are reviewed, then the case of a 28-yr.-old Japanese woman with high-functioning autism spectrum disorder who exhibited mood disorder and catatonia is described. Her mood disorder was apparently induced by a crisis of her "inner world," constituted as a way of coping with a sense of alienation, related to her impaired development in reciprocal social interaction. Environmental change, a precipitating factor, induced alternation between catatonia and depression. Fluvoxamine ameliorated both features. The catatonia identified in this patient is considered to be symptom derived from depression. Given the limitation of this single case, such a conclusion is necessarily tentative. Closer investigation into cases in which patients with high-functioning autism spectrum disorders describe their own psychological experiences should be pursued.

  4. High throughput estimation of functional cell activities reveals disease mechanisms and predicts relevant clinical outcomes.

    PubMed

    Hidalgo, Marta R; Cubuk, Cankut; Amadoz, Alicia; Salavert, Francisco; Carbonell-Caballero, José; Dopazo, Joaquin

    2017-01-17

    Understanding the aspects of the cell functionality that account for disease or drug action mechanisms is a main challenge for precision medicine. Here we propose a new method that models cell signaling using biological knowledge on signal transduction. The method recodes individual gene expression values (and/or gene mutations) into accurate measurements of changes in the activity of signaling circuits, which ultimately constitute high-throughput estimations of cell functionalities caused by gene activity within the pathway. Moreover, such estimations can be obtained either at cohort-level, in case/control comparisons, or personalized for individual patients. The accuracy of the method is demonstrated in an extensive analysis involving 5640 patients from 12 different cancer types. Circuit activity measurements not only have a high diagnostic value but also can be related to relevant disease outcomes such as survival, and can be used to assess therapeutic interventions.

  5. The use of grammatical morphemes by Mandarin-speaking children with high functioning autism.

    PubMed

    Zhou, Peng; Crain, Stephen; Gao, Liqun; Tang, Ye; Jia, Meixiang

    2015-05-01

    The present study investigated the production of grammatical morphemes by Mandarin-speaking children with high functioning autism. Previous research found that a subgroup of English-speaking children with autism exhibit deficits in the use of grammatical morphemes that mark tense. In order to see whether this impairment in grammatical morphology can be generalised to children with autism from other languages, the present study examined whether or not high-functioning Mandarin-speaking children with autism also exhibit deficits in using grammatical morphemes that mark aspect. The results show that Mandarin-speaking children with autism produced grammatical morphemes significantly less often than age-matched and IQ-matched TD peers as well as MLU-matched TD peers. The implications of these findings for understanding the grammatical abilities of children with autism were discussed.

  6. High throughput in vivo functional validation of candidate congenital heart disease genes in Drosophila.

    PubMed

    Zhu, Jun-Yi; Fu, Yulong; Nettleton, Margaret; Richman, Adam; Han, Zhe

    2017-01-20

    Genomic sequencing has implicated large numbers of genes and de novo mutations as potential disease risk factors. A high throughput in vivo model system is needed to validate gene associations with pathology. We developed a Drosophila-based functional system to screen candidate disease genes identified from Congenital Heart Disease (CHD) patients. 134 genes were tested in the Drosophila heart using RNAi-based gene silencing. Quantitative analyses of multiple cardiac phenotypes demonstrated essential structural, functional, and developmental roles for more than 70 genes, including a subgroup encoding histone H3K4 modifying proteins. We also demonstrated the use of Drosophila to evaluate cardiac phenotypes resulting from specific, patient-derived alleles of candidate disease genes. We describe the first high throughput in vivo validation system to screen candidate disease genes identified from patients. This approach has the potential to facilitate development of precision medicine approaches for CHD and other diseases associated with genetic factors.

  7. Study and application of a high-pressure water jet multi-functional flow test system.

    PubMed

    Shi, Huaizhong; Li, Gensheng; Huang, Zhongwei; Li, Jingbin; Zhang, Yi

    2015-12-01

    As the exploration and development of oil and gas focus more and more on deeper formation, hydraulic issues such as high-pressure water jet rock breaking, wellbore multiphase flow law, cuttings carrying efficiency, and hydraulic fracturing technique during the drilling and completion process have become the key points. To accomplish related researches, a high-pressure water jet multi-functional flow test system was designed. The following novel researches are carried out: study of high-pressure water jet characteristics under confining pressure, wellbore multiphase flow regime, hydraulic pressure properties of down hole tools during jet fracturing and pulsed cavitation jet drilling, and deflector's friction in radial jet drilling. The validity and feasibility of the experimental results provided by the system with various test modules have proved its importance in the research of the high-pressure water jet and well completion technology.

  8. Ionic photoacid generators containing functionalized semifluorinated sulfonates for high-resolution lithography

    NASA Astrophysics Data System (ADS)

    Yi, Yi; Ayothi, Ramakrishnan; Ober, Christopher K.; Yueh, Wang; Cao, Heidi

    2008-03-01

    To meet the challenges for resist materials raised by high resolution lithography technologies, tailor-made photoacid generators (PAGs) with controlled acid diffusion and improved miscibility with polymers are very important. We have developed new ionic PAGs containing functionalized semifluorinated sulfonates. These PAGs have excellent solubility in polymer matrices and common organic solvents, high thermal stability, high acid strength and low volatility of the generated acids, and make them attractive PAGs for high resolution lithography. In this contribution, the preparation and characterization of several new ionic PAGs, the influence of the host matrix on PAG properties, and a comparison of their lithographic performance are presented. Specifically their lithographic performance at EUV wavelength is discussed.

  9. Study and application of a high-pressure water jet multi-functional flow test system

    NASA Astrophysics Data System (ADS)

    Shi, Huaizhong; Li, Gensheng; Huang, Zhongwei; Li, Jingbin; Zhang, Yi

    2015-12-01

    As the exploration and development of oil and gas focus more and more on deeper formation, hydraulic issues such as high-pressure water jet rock breaking, wellbore multiphase flow law, cuttings carrying efficiency, and hydraulic fracturing technique during the drilling and completion process have become the key points. To accomplish related researches, a high-pressure water jet multi-functional flow test system was designed. The following novel researches are carried out: study of high-pressure water jet characteristics under confining pressure, wellbore multiphase flow regime, hydraulic pressure properties of down hole tools during jet fracturing and pulsed cavitation jet drilling, and deflector's friction in radial jet drilling. The validity and feasibility of the experimental results provided by the system with various test modules have proved its importance in the research of the high-pressure water jet and well completion technology.

  10. High transition frequencies of dynamic functional connectivity states in the creative brain.

    PubMed

    Li, Junchao; Zhang, Delong; Liang, Aiying; Liang, Bishan; Wang, Zengjian; Cai, Yuxuan; Gao, Mengxia; Gao, Zhenni; Chang, Song; Jiao, Bingqing; Huang, Ruiwang; Liu, Ming

    2017-04-06

    Creativity is thought to require the flexible reconfiguration of multiple brain regions that interact in transient and complex communication patterns. In contrast to prior emphases on searching for specific regions or networks associated with creative performance, we focused on exploring the association between the reconfiguration of dynamic functional connectivity states and creative ability. We hypothesized that a high frequency of dynamic functional connectivity state transitions will be associated with creative ability. To test this hypothesis, we recruited a high-creative group (HCG) and a low-creative group (LCG) of participants and collected resting-state fMRI (R-fMRI) data and Torrance Tests of Creative Thinking (TTCT) scores from each participant. By combining an independent component analysis with a dynamic network analysis approach, we discovered the HCG had more frequent transitions between dynamic functional connectivity (dFC) states than the LCG. Moreover, a confirmatory analysis using multiplication of temporal derivatives also indicated that there were more frequent dFC state transitions in the HCG. Taken together, these results provided empirical evidence for a linkage between the flexible reconfiguration of dynamic functional connectivity states and creative ability. These findings have the potential to provide new insights into the neural basis of creativity.

  11. High transition frequencies of dynamic functional connectivity states in the creative brain

    PubMed Central

    Li, Junchao; Zhang, Delong; Liang, Aiying; Liang, Bishan; Wang, Zengjian; Cai, Yuxuan; Gao, Mengxia; Gao, Zhenni; Chang, Song; Jiao, Bingqing; Huang, Ruiwang; Liu, Ming

    2017-01-01

    Creativity is thought to require the flexible reconfiguration of multiple brain regions that interact in transient and complex communication patterns. In contrast to prior emphases on searching for specific regions or networks associated with creative performance, we focused on exploring the association between the reconfiguration of dynamic functional connectivity states and creative ability. We hypothesized that a high frequency of dynamic functional connectivity state transitions will be associated with creative ability. To test this hypothesis, we recruited a high-creative group (HCG) and a low-creative group (LCG) of participants and collected resting-state fMRI (R-fMRI) data and Torrance Tests of Creative Thinking (TTCT) scores from each participant. By combining an independent component analysis with a dynamic network analysis approach, we discovered the HCG had more frequent transitions between dynamic functional connectivity (dFC) states than the LCG. Moreover, a confirmatory analysis using multiplication of temporal derivatives also indicated that there were more frequent dFC state transitions in the HCG. Taken together, these results provided empirical evidence for a linkage between the flexible reconfiguration of dynamic functional connectivity states and creative ability. These findings have the potential to provide new insights into the neural basis of creativity. PMID:28383052

  12. High-speed Label-free Functional Photoacoustic Microscopy of Mouse Brain in Action

    PubMed Central

    Yao, Junjie; Wang, Lidai; Yang, Joon-Mo; Maslov, Konstantin I.; Wong, Terence T. W.; Li, Lei; Huang, Chih-Hsien; Zou, Jun; Wang, Lihong V.

    2015-01-01

    We present fast functional photoacoustic microscopy (PAM), which is capable of three-dimensional high-resolution high-speed imaging of the mouse brain, complementary to other imaging modalities. A single-wavelength pulse-width-based method was implemented to image blood oxygenation with capillary-level resolution and a one-dimensional imaging rate of 100 kHz. We applied PAM to image the vascular morphology, blood oxygenation, blood flow, and oxygen metabolism in the brain in both resting and stimulated states. PMID:25822799

  13. Filtered Mass Density Function for Design Simulation of High Speed Airbreathing Propulsion Systems

    NASA Technical Reports Server (NTRS)

    Givi, P.; Madnia, C. K.; Gicquel, L. Y. M.; Sheikhi, M. R. H.; Drozda, T. G.

    2002-01-01

    The objective of this research is to improve and implement the filtered mass density function (FDF) methodology for large eddy simulation (LES) of high speed reacting turbulent flows. NASA is interested in the design of various components involved in air breathing propulsion systems such as the scramjet. There is a demand for development of robust tools that can aid in the design procedure. The physics of high speed reactive flows is rich with many complexities. LES is regarded as one of the most promising means of simulating turbulent reacting flows.

  14. Ultra-high field MRI: Advancing systems neuroscience towards mesoscopic human brain function.

    PubMed

    Dumoulin, Serge O; Fracasso, Alessio; van der Zwaag, Wietske; Siero, Jeroen C W; Petridou, Natalia

    2017-01-16

    Human MRI scanners at ultra-high magnetic field strengths of 7 T and higher are increasingly available to the neuroscience community. A key advantage brought by ultra-high field MRI is the possibility to increase the spatial resolution at which data is acquired, with little reduction in image quality. This opens a new set of opportunities for neuroscience, allowing investigators to map the human cortex at an unprecedented level of detail. In this review, we present recent work that capitalizes on the increased signal-to-noise ratio available at ultra-high field and discuss the theoretical advances with a focus on sensory and motor systems neuroscience. Further, we review research performed at sub-millimeter spatial resolution and discuss the limits and the potential of ultra-high field imaging for structural and functional imaging in human cortex. The increased spatial resolution achievable at ultra-high field has the potential to unveil the fundamental computations performed within a given cortical area, ultimately allowing the visualization of the mesoscopic organization of human cortex at the functional and structural level.

  15. Mice lacking functional STAT1 are highly susceptible to lethal infection with Lassa virus.

    PubMed

    Yun, Nadezhda E; Seregin, Alexey V; Walker, David H; Popov, Vsevolod L; Walker, Aida G; Smith, Jeanon N; Miller, Milagros; de la Torre, Juan C; Smith, Jennifer K; Borisevich, Viktoriya; Fair, Joseph N; Wauquier, Nadia; Grant, Donald S; Bockarie, Bayon; Bente, Dennis; Paessler, Slobodan

    2013-10-01

    Lassa fever (LF) is a potentially lethal human disease that is caused by the arenavirus Lassa virus (LASV). Annually, around 300,000 infections with up to 10,000 deaths occur in regions of Lassa fever endemicity in West Africa. Here we demonstrate that mice lacking a functional STAT1 pathway are highly susceptible to infection with LASV and develop lethal disease with pathology similar to that reported in humans.

  16. Rapid assembly of structurally defined and highly functionalized conjugated dienes via tethered enyne metathesis.

    PubMed

    Yao, Q

    2001-06-28

    [reaction: see text] Conjugated dienes are versatile building blocks in organic synthesis, and the development of new methods for their synthesis remains an important topic in modern synthetic organic chemistry. We describe here an expedient synthesis of highly functionalized conjugated dienes through sequential silicon-tethered ring-closing enyne metathesis mediated by Grubbs' Ru carbene catalysts and Tamao oxidation. Notable attributes of this methodology include short synthetic manipulations and the structural complexity it confers on the resulting diene moiety.

  17. Local Release of Highly Loaded Antibodies from Functionalized Nanoporous Support for Cancer Immunotherapy

    SciTech Connect

    Lei, Chenghong; Liu, P.; Chen, Baowei; Mao, Yumeng; Engelmann, Heather E.; Shin, Yongsoon; Jaffar, Jade; Hellstrom, Ingegerd; Liu, Jun; Hellstrom, Karl E.

    2010-05-26

    We report that antibodies can be loaded in functionalized mesoporous silica (FMS) with super-high density to provide long-lasting local release at a given site. Preliminary data indicate that FMS-antibody injected directly into a mouse melanoma induces a greater inhibition of tumor growth than seen in various controls, including the antibody injected intraperitoneally. Our findings introduce a novel approach for local delivery of therapeutically active proteins to tumors and potentially, other diseases.

  18. Social Anxiety in High-Functioning Children and Adolescents with Autism and Asperger Syndrome

    ERIC Educational Resources Information Center

    Kuusikko, Sanna; Pollock-Wurman, Rachel; Jussila, Katja; Carter, Alice S.; Mattila, Marja-Leena; Ebeling, Hanna; Pauls, David L.; Moilanen, Irma

    2008-01-01

    We examined social anxiety and internalizing symptoms using the Social Phobia and Anxiety Inventory for Children (SPAI-C), the Social Anxiety Scale for Children -Revised (SASC-R), and the Child Behavior Checklist (CBCL) in a sample of fifty-four high-functioning subjects with autism or Asperger syndrome (HFA/AS) (M = 11.2 plus or minus 1.7 years)…

  19. Prediction of Functional Outcome in Individuals at Clinical High Risk for Psychosis

    PubMed Central

    Carrión, Ricardo E.; McLaughlin, Danielle; Goldberg, Terry E.; Auther, Andrea M.; Olsen, Ruth H.; Olvet, Doreen M.; Correll, Christoph U.; Cornblatt, Barbara A.

    2014-01-01

    Importance A major public health concern associated with schizophrenia and psychotic disorders is the long-term disability that involves impaired cognition, lack of social support, and an inability to function independently in the community. A critical goal of early detection and intervention studies in psychosis is therefore to understand the factors leading to this often profound impairment. Objective To develop a predictive model of functional (social and role) outcome in a clinical high-risk sample for psychosis. Design Prospective, naturalistic, longitudinal 3- to 5-year follow-up study. Setting The Recognition and Prevention Program in New York, a research clinic located in the Zucker Hillside Hospital in New York. Participants One hundred one treatment-seeking patients at clinical high risk for psychosis. Ninety-two (91%) were followed up prospectively for a mean (SD) of 3 (1.6) years. Intervention Neurocognitive and clinical assessment. Main Outcomes and Measures The primary outcome variables were social and role functioning at the last follow-up visit. Results Poor social outcome was predicted by reduced processing speed (odds ratio [OR], 1.38; 95% CI, 1.050-1.823; P = .02), impaired social functioning at baseline (OR, 1.85; 95% CI, 1.258-2.732; P = .002), and total disorganized symptoms (OR, 5.06; 95% CI, 1.548-16.527; P = .007). Reduced performance on tests for verbal memory (OR, 1.74; 95% CI, 1.169-2.594; P = .006), role functioning at baseline (OR, 1.34; 95% CI, 1.053-1.711; P = .02), and motor disturbances (OR, 1.77; 95% CI, 1.060-2.969; P = .03) predicted role outcome. The areas under the curve for the social and role prediction models were 0.824 (95% CI, 0.736-0.913; P < .001) and 0.77 (95% CI, 0.68-0.87; P < .001), respectively, demonstrating a high discriminative ability. In addition, poor functional outcomes were not entirely dependent on the development of psychosis, because 40.3% and 45.5% of nonconverters at clinical high risk had poor social

  20. Highly regio- and enantioselective multiple oxy- and amino-functionalizations of alkenes by modular cascade biocatalysis

    PubMed Central

    Wu, Shuke; Zhou, Yi; Wang, Tianwen; Too, Heng-Phon; Wang, Daniel I. C.; Li, Zhi

    2016-01-01

    New types of asymmetric functionalizations of alkenes are highly desirable for chemical synthesis. Here, we develop three novel types of regio- and enantioselective multiple oxy- and amino-functionalizations of terminal alkenes via cascade biocatalysis to produce chiral α-hydroxy acids, 1,2-amino alcohols and α-amino acids, respectively. Basic enzyme modules 1–4 are developed to convert alkenes to (S)-1,2-diols, (S)-1,2-diols to (S)-α-hydroxyacids, (S)-1,2-diols to (S)-aminoalcohols and (S)-α-hydroxyacids to (S)-α-aminoacids, respectively. Engineering of enzyme modules 1 & 2, 1 & 3 and 1, 2 & 4 in Escherichia coli affords three biocatalysts over-expressing 4–8 enzymes for one-pot conversion of styrenes to the corresponding (S)-α-hydroxyacids, (S)-aminoalcohols and (S)-α-aminoacids in high e.e. and high yields, respectively. The new types of asymmetric alkene functionalizations provide green, safe and useful alternatives to the chemical syntheses of these compounds. The modular approach for engineering multi-step cascade biocatalysis is useful for developing other new types of one-pot biotransformations for chemical synthesis. PMID:27297777

  1. Attention and written expression in school-age, high-functioning children with autism spectrum disorders.

    PubMed

    Zajic, Matthew C; McIntyre, Nancy; Swain-Lerro, Lindsay; Novotny, Stephanie; Oswald, Tasha; Mundy, Peter

    2016-12-09

    High-functioning children with autism spectrum disorders often find writing challenging. These writing difficulties may be specific to autism spectrum disorder or to a more general clinical effect of attention disturbance, as these children are often comorbid for attention-deficit/hyperactivity disorder (ADHD) symptomatology (and children with attention-deficit/hyperactivity disorder often also find writing challenging). To examine this issue, this study investigated the role of attention disturbance on writing in 155 school-age children across four diagnostic groups: high-functioning autism spectrum disorder (HFASD) with lower ADHD symptoms (HFASD-L), HFASD with higher ADHD symptoms (HFASD-H), ADHD symptoms but no autism spectrum disorder symptoms, and typical development. Both HFASD subgroups and the ADHD group displayed lower word production writing scores than the typical development group, but the clinical groups did not differ. The HFASD-H and ADHD groups had significantly lower theme development and text organization writing scores than the typical development group, but the HFASD-L and typical development groups were not significantly different. The findings support prior research reporting writing problems in children with autism spectrum disorder but also suggest that children with HFASD-H may be at greater risk for writing difficulties than children with HFASD-L. Better understanding the role of attention in writing development could advance methods for assessment and intervention for children with high-functioning autism spectrum disorder at risk for writing difficulties.

  2. Construction Placement and Hardened Properties of Shotcrete with Highly Functional Fly Ash

    NASA Astrophysics Data System (ADS)

    Yuno, Kunihiro; Ishii, Mitsuhiro; Hashimoto, Chikanori; Mizuguchi, Hiroyuki

    Shikoku Electric Power Co., Inc. has developed the technology to manufacture a brand name "Finash" about 12 years ago, by sorting and classifying coal ash generated in coal fired power plants. "Finash" is highly functional fly ash (HFA) is produced by removing irregular coarse particles. It is important for the production of HFA to minimize the variation in quality of coal ash with sophisticated classification technique and extracting good-quality spherical fine particles. It is now widely utilized as concrete admixture for general civil engineering structures and buildings in Japan. When highly functional fly ash (HFA) is used as shotcrete admixture to substitute for fine aggregate of 100kg/m3, the shotcrete has the advantages of decreasing the amount of dust and rebound during spraying operation, improving the hardened properties of concrete, etc. Therefore, it has been applied in many tunnel construction projects. This paper discusses about the various characteristics such as construction placement, strength, neutralization and dry shrinkage of shotcrete using highly functional fly ash (HFA), using the results that is obtained from spray test in an actual road tunnel.

  3. The brains of high functioning autistic individuals do not synchronize with those of others☆

    PubMed Central

    Salmi, J.; Roine, U.; Glerean, E.; Lahnakoski, J.; Nieminen-von Wendt, T.; Tani, P.; Leppämäki, S.; Nummenmaa, L.; Jääskeläinen, I.P.; Carlson, S.; Rintahaka, P.; Sams, M.

    2013-01-01

    Multifaceted and idiosyncratic aberrancies in social cognition characterize autism spectrum disorders (ASDs). To advance understanding of underlying neural mechanisms, we measured brain hemodynamic activity with functional magnetic resonance imaging (fMRI) in individuals with ASD and matched-pair neurotypical (NT) controls while they were viewing a feature film portraying social interactions. Pearson's correlation coefficient was used as a measure of voxelwise similarity of brain activity (InterSubject Correlations—ISCs). Individuals with ASD showed lower ISC than NT controls in brain regions implicated in processing social information including the insula, posterior and anterior cingulate cortex, caudate nucleus, precuneus, lateral occipital cortex, and supramarginal gyrus. Curiously, also within NT group, autism-quotient scores predicted ISC in overlapping areas, including, e.g., supramarginal gyrus and precuneus. In ASD participants, functional connectivity was decreased between the frontal pole and the superior frontal gyrus, angular gyrus, superior parietal lobule, precentral gyrus, precuneus, and anterior/posterior cingulate gyrus. Taken together these results suggest that ISC and functional connectivity measure distinct features of atypical brain function in high-functioning autistic individuals during free viewing of acted social interactions. Our ISC results suggest that the minds of ASD individuals do not ‘tick together’ with others while perceiving identical dynamic social interactions. PMID:24273731

  4. Identification of high-level functional/system requirements for future civil transports

    NASA Technical Reports Server (NTRS)

    Swink, Jay R.; Goins, Richard T.

    1992-01-01

    In order to accommodate the rapid growth in commercial aviation throughout the remainder of this century, the Federal Aviation Administration (FAA) is faced with a formidable challenge to upgrade and/or modernize the National Airspace System (NAS) without compromising safety or efficiency. A recurring theme in both the Aviation System Capital Investment Plan (CIP), which has replaced the NAS Plan, and the new FAA Plan for Research, Engineering, and Development (RE&D) rely on the application of new technologies and a greater use of automation. Identifying the high-level functional and system impacts of such modernization efforts on future civil transport operational requirements, particularly in terms of cockpit functionality and information transfer, was the primary objective of this project. The FAA planning documents for the NAS of the 2005 era and beyond were surveyed; major aircraft functional capabilities and system components required for such an operating environment were identified. A hierarchical structured analysis of the information processing and flows emanating from such functional/system components were conducted and the results documented in graphical form depicting the relationships between functions and systems.

  5. Thalamo-Sensorimotor Functional Connectivity Correlates with World Ranking of Olympic, Elite, and High Performance Athletes.

    PubMed

    Huang, Zirui; Davis Iv, Henry Hap; Wolff, Annemarie; Northoff, Georg

    2017-01-01

    Brain plasticity studies have shown functional reorganization in participants with outstanding motor expertise. Little is known about neural plasticity associated with exceptionally long motor training or of its predictive value for motor performance excellence. The present study utilised resting-state functional magnetic resonance imaging (rs-fMRI) in a unique sample of world-class athletes: Olympic, elite, and internationally ranked swimmers (n = 30). Their world ranking ranged from 1st to 250th: each had prepared for participation in the Olympic Games. Combining rs-fMRI graph-theoretical and seed-based functional connectivity analyses, it was discovered that the thalamus has its strongest connections with the sensorimotor network in elite swimmers with the highest world rankings (career best rank: 1-35). Strikingly, thalamo-sensorimotor functional connections were highly correlated with the swimmers' motor performance excellence, that is, accounting for 41% of the individual variance in best world ranking. Our findings shed light on neural correlates of long-term athletic performance involving thalamo-sensorimotor functional circuits.

  6. Thalamo-Sensorimotor Functional Connectivity Correlates with World Ranking of Olympic, Elite, and High Performance Athletes

    PubMed Central

    Wolff, Annemarie

    2017-01-01

    Brain plasticity studies have shown functional reorganization in participants with outstanding motor expertise. Little is known about neural plasticity associated with exceptionally long motor training or of its predictive value for motor performance excellence. The present study utilised resting-state functional magnetic resonance imaging (rs-fMRI) in a unique sample of world-class athletes: Olympic, elite, and internationally ranked swimmers (n = 30). Their world ranking ranged from 1st to 250th: each had prepared for participation in the Olympic Games. Combining rs-fMRI graph-theoretical and seed-based functional connectivity analyses, it was discovered that the thalamus has its strongest connections with the sensorimotor network in elite swimmers with the highest world rankings (career best rank: 1–35). Strikingly, thalamo-sensorimotor functional connections were highly correlated with the swimmers' motor performance excellence, that is, accounting for 41% of the individual variance in best world ranking. Our findings shed light on neural correlates of long-term athletic performance involving thalamo-sensorimotor functional circuits. PMID:28261504

  7. Simultaneous electropolymerization and electro-click functionalization for highly versatile surface platforms.

    PubMed

    Rydzek, Gaulthier; Terentyeva, Tatyana G; Pakdel, Amir; Golberg, Dmitri; Hill, Jonathan P; Ariga, Katsuhiko

    2014-05-27

    Simple preparation methods of chemically versatile and highly functionalizable surfaces remain rare and present a challenging research objective. Here, we demonstrate a simultaneous electropolymerization and electro-click functionalization process (SEEC) for one-pot self-construction of aniline- and naphthalene-based functional polymer films where both polymerization and click functionalization are triggered by applying electrochemical stimuli. Cyclic voltammetry (CV) can be applied for the simultaneous oxidation of 4-azidoaniline and the reduction of Cu(II) ions, resulting in polymerization of the former, and the Cu(I)-catalyzed alkyne/azide cycloaddition ("click" chemistry). Properties of the films obtained can be tuned by varying their morphology, their chemically "clicked" content, or by postconstruction functionalization. To demonstrate this, the CV scan rates, component monomers, and "clicked" molecules were varied. Covalent postconstruction immobilization of horseradish peroxidase was also performed. Consequently, pseudocapacitance and enzyme activity were affected. SEEC provides surface scientists an easy access to a wide range of functionalization possibilities in several fields including sensors, fuel cells, photovoltaics, and biomaterials.

  8. A specific impairment in cognitive control in individuals with high-functioning autism.

    PubMed

    Barbalat, Guillaume; Leboyer, Marion; Zalla, Tiziana

    2014-11-01

    Although it is largely demonstrated that Autism Spectrum Disorders (ASDs) are characterized by executive dysfunctions, little is known about the fine-grained levels of this impairment. Here, we investigated the hierarchical architecture of control modules in autism using an experimental paradigm based upon a multistage model of executive functions. This model postulates that executive functions are hierarchically organized as a cascade of three different control processes, which are implemented according to information conveyed by sensory signals (sensory control), the immediate perceptual context (contextual control), and the temporal episode in which stimuli occur (episodic control). Sixteen high-functioning adults with autism or Asperger Syndrome (HFA/AS) and sixteen matched comparison participants took part in two distinct visuo-motor association experiments designed to separately vary the demands of sensory and episodic controls (first experiment) and contextual and episodic controls (second experiment). Participants with HFA/AS demonstrated no significant differences in performances with comparison participants when they had to control sensory or contextual information. However, they showed decreased accuracy when having to control information related to episodic signals. Remarkably, performances in episodic control were associated to the autism spectrum quotient in both groups, suggesting that this episodic control impairment might be at the core of ASDs. Those results plead for a specific, rather than generalised, deficit in executive functions in autism. Our study contributes to a better understanding of the impaired cognitive processes that are unique to autism and warrants confirmation using other models of executive functions.

  9. Extra-galactic high-energy transients: event rate density and luminosity function

    NASA Astrophysics Data System (ADS)

    Sun, Hui; Zhang, Bing; Li, Zhuo

    2015-08-01

    Several types of extra-galactic high-energy transients have been discovered, which include high-luminosity and low-luminosity long-duration gamma-ray bursts (GRBs), short-duration GRBs, supernova shock breakouts (SBOs), and tidal disruption events (TDEs) without or with a relativistic jet. In this paper, we apply a unified method to systematically study the reshift-dependent event rate densities and luminosity functions of these extra-galactic high-energy transients. We consider star formation history as the tracer of the redshift distribution for long GRBs and SBOs. For short GRBs, we consider the compact star merger model to introduce several possible merger delay time distribution models. For TDEs, we consider the mass distribution of supermassive black holes as a function of redshift. We derive some empirical formulae for the redshift-dependent event rate density for different types of transients. Based on the observed events, we derive the local specific event rate density, ρ0,L ∝ dρ0/dL for each type of transient, which represents its luminosity function. All the transients are consistent with having a single power law luminosity function, except the high luminosity long GRBs (HL-lGRBs), whose luminosity function can be well described by a broken power law. The total event rate density for a particular transient depends on the luminosity threshold, and we obtain the following values in units of Gpc-3 yr-1: 2.82^{+0.41}_{-0.36} for HL-lGRBs above 4×1049 erg s-1 218^{+130}_{-86} for low luminosity long GRBs above 6×1046 erg s-1 3.18^{+0.88}_{-0.70}, 2.87^{+0.80}_{-0.64}, and 6.25^{+1.73}_{-1.38} above 5×1049 erg s-1 for short GRBs with three different merger delay models (Gaussian, log-normal, and power law); 2.0^{+2.6}_{-1.3}×104 above 9×1043 erg s-1 for SBOs, 3.0^{+1.0}_{-0.8}×105 for normal TDEs above 1042 erg s-1 and 6.2^{+8.2}_{-4.0} above 3×1047 erg s-1for TDE jets as discovered by Swift. Intriguingly, the global specific event rate densities

  10. Impact of therapeutic and high doses of florfenicol on kidney and liver functional indicators in goat

    PubMed Central

    Shah, Jan Muhammad; Qureshi, Toufique Ahmed; Shah, Tahmina; Shah, Qurban Ali; Arain, Muhammad Asif; Bhutto, Zohaib Ahmed; Saeed, Muhammad; Siyal, Farman Ali

    2016-01-01

    Aim: The aim of this study was to evaluate the impact of therapeutic and high doses of florfenicol on kidney and liver functional indicators in goat species. Materials and Methods: Six mature, healthy goats (combine breed and sex) with average weight 25 kg were selected for this study. The therapeutic (20 mg/kg b.w.) and high doses (40 and 60 mg) of florfenicol were administered for 3 days with 24 h interval. Blood samples were collected at 0, 24, 48, 72, 96, and 120 h following the each administered dose. Results: The results showed that the therapeutic dose of florfenicol produced nonsignificant effect on serum urea, creatinine, total protein (TP), alkaline phosphatase (ALP), gamma-glutamyl transferase (GGT) and bilirubin on all timings, and increased (p<0.05) the serum glutamic oxaloacetic transaminase (SGOT) and serum glutamate-pyruvate transaminase (SGPT) levels for 48 h. Whereas the high doses of florfenicol (40 and 60 mg) significantly altered the kidney and liver functional indicators in the blood. In contrast with control, the serum urea level was (p<0.01) increased at all timing points. Creatinine values were altered (p<0.01, <0.05) in increasing manner from 24 to 96 h. The high dose of 40 mg decreased the TP (p<0.05) for 72 h and 60 mg persisted same effect (p<0.01) up to 120 h. The indices of ALP, GGT, SGOT, and SGPT were raised (p<0.01, <0.05) at all timings. The bilirubin indexes also (p<0.05) elevated from 48 to 72. Conclusion: It was concluded that the high doses of florfenicol produced reversible dose-dependent effects on functional indicators of kidney and liver such as urea, creatinine, TP, ALP, SGOT, SGPT, GGT, and bilirubin. PMID:27847425

  11. High Endothelial Venules and Other Blood Vessels: Critical Regulators of Lymphoid Organ Development and Function

    PubMed Central

    Ager, Ann

    2017-01-01

    The blood vasculature regulates both the development and function of secondary lymphoid organs by providing a portal for entry of hemopoietic cells. During the development of lymphoid organs in the embryo, blood vessels deliver lymphoid tissue inducer cells that initiate and sustain the development of lymphoid tissues. In adults, the blood vessels are structurally distinct from those in other organs due to the requirement for high levels of lymphocyte recruitment under non-inflammatory conditions. In lymph nodes (LNs) and Peyer’s patches, high endothelial venules (HEVs) especially adapted for lymphocyte trafficking form a spatially organized network of blood vessels, which controls both the type of lymphocyte and the site of entry into lymphoid tissues. Uniquely, HEVs express vascular addressins that regulate lymphocyte entry into lymphoid organs and are, therefore, critical to the function of lymphoid organs. Recent studies have demonstrated important roles for CD11c+ dendritic cells in the induction, as well as the maintenance, of vascular addressin expression and, therefore, the function of HEVs. Tertiary lymphoid organs (TLOs) are HEV containing LN-like structures that develop inside organized tissues undergoing chronic immune-mediated inflammation. In autoimmune lesions, the development of TLOs is thought to exacerbate disease. In cancerous tissues, the development of HEVs and TLOs is associated with improved patient outcomes in several cancers. Therefore, it is important to understand what drives the development of HEVs and TLOs and how these structures contribute to pathology. In several human diseases and experimental animal models of chronic inflammation, there are some similarities between the development and function of HEVs within LN and TLOs. This review will summarize current knowledge of how hemopoietic cells with lymphoid tissue-inducing, HEV-inducing, and HEV-maintaining properties are recruited from the bloodstream to induce the development and

  12. High-yield expression in Escherichia coli of soluble human MT2A with native functions.

    PubMed

    Yang, Fang; Zhou, Min; He, Zhimin; Liu, Xiaorong; Sun, Lin; Sun, Yu; Chen, Zhuchu

    2007-05-01

    Metallothioneins (MTs) are a family of low molecular weight, cysteine rich heavy metal binding proteins with multifunction, such as metal detoxification and antioxidation, and are involved in a number of cellular processes including gene expression, apoptosis, proliferation and differentiation. However, high yield expression of human MT in Escherichia coli has not been established effectively. To produce large amounts of human MT protein at low cost, recombinant human metallothionein 2A (MT2A) protein with an N-terminal GST tag was successfully expressed at high levels in soluble form in E. coli and high purification of it was established by affinity chromatography under native conditions. The final yield was about 5mg of the recombinant MT2A per liter of bacterial culture with the purity of 97.9%. Chemical and functional characteristics analysis of the recombinant human MT2A exhibited intact metal binding ability, hydroxyl radical scavenging ability and significant protective role against DNA damage caused by UVC radiation. Establishment of highly purified recombinant human MT2A protein with native characteristics at low cost would improve its function study and wide applications in protecting against oxidative damage and UV radiation.

  13. High pressure effects on the structural functionality of condensed globular-protein matrices.

    PubMed

    Savadkoohi, Sobhan; Kasapis, Stefan

    2016-07-01

    High pressure technology is the outcome of consumer demand for better quality control of processed foods. There is great potential to apply HPP to condensed systems of globular proteins for the generation of industry-relevant biomaterials with advanced techno- and biofunctionality. To this end, research demonstrates that application of high hydrostatic pressure generates a coherent structure and preserves the native conformation in condensed globular proteins, which is an entirely unexpected but interesting outcome on both scientific and technological grounds. In microbiological challenge tests, high pressure at conventional commercial conditions, demonstrated to effectively reduce the concentration of typical Gram negative or Gram positive foodborne pathogens, and proteolytic enzymes in high-solid protein samples. This may have industrial significance in relation to the formulation and stabilisation of "functional food" products as well as in protein ingredients and concentrates by replacing spray dried powders with condensed HPP-treated pastes that maintain structure and bioactivity. Fundamental concepts and structural functionality of condensed matrices of globular proteins are the primary interest in this mini-review, which may lead to opportunities for industrial exploitation, but earlier work on low-solid systems is also summarised presently to put recent developments in context of this rapidly growing field.

  14. Scalable Functionalized Graphene Nano-platelets as Tunable Cathodes for High-performance Lithium Rechargeable Batteries

    PubMed Central

    Kim, Haegyeom; Lim, Hee-Dae; Kim, Sung-Wook; Hong, Jihyun; Seo, Dong-Hwa; Kim, Dae-chul; Jeon, Seokwoo; Park, Sungjin; Kang, Kisuk

    2013-01-01

    High-performance and cost-effective rechargeable batteries are key to the success of electric vehicles and large-scale energy storage systems. Extensive research has focused on the development of (i) new high-energy electrodes that can store more lithium or (ii) high-power nano-structured electrodes hybridized with carbonaceous materials. However, the current status of lithium batteries based on redox reactions of heavy transition metals still remains far below the demands required for the proposed applications. Herein, we present a novel approach using tunable functional groups on graphene nano-platelets as redox centers. The electrode can deliver high capacity of ~250 mAh g−1, power of ~20 kW kg−1 in an acceptable cathode voltage range, and provide excellent cyclability up to thousands of repeated charge/discharge cycles. The simple, mass-scalable synthetic route for the functionalized graphene nano-platelets proposed in this work suggests that the graphene cathode can be a promising new class of electrode. PMID:23514953

  15. Neurocognitive functioning and symptom reporting of high school athletes following a single concussion.

    PubMed

    Tsushima, William T; Shirakawa, Nicole; Geling, Olga

    2013-01-01

    The aim of this research was to evaluate the neurocognitive functioning and symptom reporting of high school athletes with the Immediate Post-Concussion Assessment and Cognitive Testing (ImPACT) battery after sustaining a single sports-related concussion. The ImPACT battery was administered to 26 athletes at an average of 6.8 days after their head injury. ImPACT composite scores, including neurocognitive measures of Verbal Memory, Visual Memory, Processing Speed, and Reaction Time, as well as a Total Symptom Score, were also obtained from an equivalent group of 25 nonconcussed football players. The composite scores of the concussed athletes were lower but not statistically different than the nonconcussed athletes. The findings were consistent with previous ImPACT research that reported no differences between concussed and nonconcussed athletes 7 days after a concussion. The symptom scores of the concussed athletes, on the other hand, were significantly higher than those who had no concussion. The similarities and differences in ImPACT test performances of the present sample of concussed high school athletes as compared with previous studies of concussed high school athletes are discussed. This study raises awareness that with high school athletes, symptom complaints may persist, even after cognitive functioning has returned to preinjury levels.

  16. Reduced Volume of the Arcuate Fasciculus in Adults with High-Functioning Autism Spectrum Conditions

    PubMed Central

    Moseley, Rachel L.; Correia, Marta M.; Baron-Cohen, Simon; Shtyrov, Yury; Pulvermüller, Friedemann; Mohr, Bettina

    2016-01-01

    Atypical language is a fundamental feature of autism spectrum conditions (ASC), but few studies have examined the structural integrity of the arcuate fasciculus, the major white matter tract connecting frontal and temporal language regions, which is usually implicated as the main transfer route used in processing linguistic information by the brain. Abnormalities in the arcuate have been reported in young children with ASC, mostly in low-functioning or non-verbal individuals, but little is known regarding the structural properties of the arcuate in adults with ASC or, in particular, in individuals with ASC who have intact language, such as those with high-functioning autism or Asperger syndrome. We used probabilistic tractography of diffusion-weighted imaging to isolate and scrutinize the arcuate in a mixed-gender sample of 18 high-functioning adults with ASC (17 Asperger syndrome) and 14 age- and IQ-matched typically developing controls. Arcuate volume was significantly reduced bilaterally with clearest differences in the right hemisphere. This finding remained significant in an analysis of all male participants alone. Volumetric reduction in the arcuate was significantly correlated with the severity of autistic symptoms as measured by the Autism-Spectrum Quotient. These data reveal that structural differences are present even in high-functioning adults with ASC, who presented with no clinically manifest language deficits and had no reported developmental language delay. Arcuate structural integrity may be useful as an index of ASC severity and thus as a predictor and biomarker for ASC. Implications for future research are discussed. PMID:27242478

  17. Effects of Two Concussions on the Neuropsychological Functioning and Symptom Reporting of High School Athletes.

    PubMed

    Tsushima, William T; Geling, Olga; Arnold, Monica; Oshiro, Ross

    2016-01-01

    To assess the effects of two sports-related concussions on neuropsychological functioning and symptom reporting, the Immediate Post-Concussion Assessment and Cognitive Testing (ImPACT) was administered to 483 high school athletes. Three groups of athletes were determined based on the number of previous concussions: no concussion (n = 409), 1 concussion (n = 58), and 2 concussions (n = 16). The results showed that the three groups did not differ in terms of their ImPACT composite scores (Verbal Memory, Visual Memory, Reaction Time, and Processing Speed) and the Total Symptom Score. As there are only a few studies that have reported the sequelae of 2 concussions in high school athletes, it is premature to declare that a repeated concussion does not have persistent neurocognitive effects on high school athletes.

  18. Multicatalytic colloids with highly scalable, adjustable, and stable functionalities in organic and aqueous media

    NASA Astrophysics Data System (ADS)

    Kim, Donghee; Cheong, Sanghyuk; Ahn, Yun Gyong; Ryu, Sook Won; Kim, Jai-Kyeong; Cho, Jinhan

    2016-03-01

    Despite a large number of developments of noble metal (or metal oxide) NP-based catalysts, it has been a great challenge to prepare high-performance recyclable catalysts with integrated functionalities that can be used in various solvent media. Here, we report on layer-by-layer (LbL) assembled multicatalysts with high catalytic performance, showing high dispersion and recycling stability in organic and aqueous media. The remarkable advantages of our approach are as follows. (i) Various metal or metal oxide NPs with desired catalytic performance can be easily incorporated into multilayered shells, forming densely packed arrays that allow one colloid to be used as a multicatalyst with highly integrated and controllable catalytic properties. (ii) Additionally, the dispersion stability of catalytic colloids in a desired solvent can be determined by the type of ultrathin outermost layer coating each colloid. (iii) Lastly, the covalent bonding between inorganic NPs and dendrimers within multilayer shells enhances the recycling stability of multicatalytic colloids. The resulting core-shell colloids including OA-Fe3O4 NPs, TOABr-Pd NPs, and OA-TiO2 NPs exhibited excellent performance in the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) and photocatalysis in aqueous media and in the Sonogashira coupling reaction (99% yield) in organic media. Given that the catalytic properties of recyclable colloids reported to date have entirely depended on the functionality of a single catalytic NP layer deposited onto colloids in selective solvent media, our approach provides a basis for the design and exploitation of high-performance recyclable colloids with integrated multicatalytic properties and high dispersion stability in a variety of solvents.Despite a large number of developments of noble metal (or metal oxide) NP-based catalysts, it has been a great challenge to prepare high-performance recyclable catalysts with integrated functionalities that can be used in various solvent

  19. Emulation and mimicry in school students with typical development and with high functioning autism.

    PubMed

    Jiménez, Luis; Lorda, María José; Méndez, Cástor

    2014-07-01

    Two samples of participants with typical development (TD) and high functioning autism performed an imitation task where the goal was of high or low salience, and where the modeled action complied with or was contrary to the end-state comfort (ESC) effect. Imitation was affected by the ESC effect in both groups, and participants with autism reproduced high salient goals as frequently as did participants with TD, but they reproduced less of the low salient goals. Participants with autism showed a reduced tendency to reproduce those actions which were relatively inefficient to reach the goals. The results are discussed in terms of either a relative imbalance between emulation and mimicry in autism, or a reduced tendency to overimitate.

  20. Development and Pilot Testing of the Challenge Module: A Proposed Adjunct to the Gross Motor Function Measure for High-Functioning Children with Cerebral Palsy

    ERIC Educational Resources Information Center

    Wilson, Ashlea; Kavanaugh, Abi; Moher, Rosemarie; McInroy, Megan; Gupta, Neena; Salbach, Nancy M.; Wright, F. Virginia

    2011-01-01

    The aim was to develop a Challenge Module (CM) as a proposed adjunct to the Gross Motor Function Measure for children with cerebral palsy who have high-level motor function. Items were generated in a physiotherapist (PT) focus group. Item reduction was based on PTs' ratings of item importance and safety via online surveys. The proposed CM items…

  1. Associations among Symptoms of Autism, Symptoms of Depression and Executive Functions in Children with High-Functioning Autism: A 2 Year Follow-Up Study

    ERIC Educational Resources Information Center

    Andersen, Per Normann; Skogli, Erik Winther; Hovik, Kjell Tore; Egeland, Jens; Øie, Merete

    2015-01-01

    This study investigated the course of and association among changes in autism symptoms, depression symptoms and executive functions (EF) in children with high-functioning autism (HFA). Thirty-four children with HFA and 45 typically developing children (age 9-16) were assessed at baseline and after 2 years. Children with HFA had impaired scores on…

  2. Dengue virus-specific human CD4+ T-lymphocyte responses in a recipient of an experimental live-attenuated dengue virus type 1 vaccine: bulk culture proliferation, clonal analysis, and precursor frequency determination.

    PubMed Central

    Green, S; Kurane, I; Edelman, R; Tacket, C O; Eckels, K H; Vaughn, D W; Hoke, C H; Ennis, F A

    1993-01-01

    We analyzed the CD4+ T-lymphocyte responses to dengue, West Nile, and yellow fever viruses 4 months after immunization of a volunteer with an experimental live-attenuated dengue virus type 1 vaccine (DEN-1 45AZ5). We examined bulk culture proliferation to noninfectious antigens, determined the precursor frequency of specific CD4+ T cells by limiting dilution, and established and analyzed CD4+ T-cell clones. Bulk culture proliferation was predominantly dengue virus type 1 specific with a lesser degree of cross-reactive responses to other dengue virus serotypes, West Nile virus, and yellow fever virus. Precursor frequency determination by limiting dilution in the presence of noninfectious dengue virus antigens revealed a frequency of antigen-reactive cells of 1 in 1,686 peripheral blood mononuclear cells (PBMC) for dengue virus type 1, 1 in 9,870 PBMC for dengue virus type 3, 1 in 14,053 PBMC for dengue virus type 2, and 1 in 17,690 PBMC for dengue virus type 4. Seventeen CD4+ T-cell clones were then established by using infectious dengue virus type 1 as antigen. Two patterns of dengue virus specificity were found in these clones. Thirteen clones were dengue virus type 1 specific, and four clones recognized both dengue virus types 1 and 3. Analysis of human leukocyte antigen (HLA) restriction revealed that five clones are HLA-DRw52 restricted, one clone is HLA-DP3 restricted, and one clone is HLA-DP4 restricted. These results indicate that in this individual, the CD4+ T-lymphocyte responses to immunization with live-attenuated dengue virus type 1 vaccine are predominantly serotype specific and suggest that a multivalent vaccine may be necessary to elicit strong serotype-cross-reactive CD4+ T-lymphocyte responses in such individuals. PMID:8371350

  3. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  4. Inhibitory effects of cardiotonic pills on platelet function in dogs fed a high-fat diet.

    PubMed

    Zhang, Lei; Zheng, Jun; Li, Hui-Min; Meng, Yong-Xia

    2006-06-01

    Insulin resistance and the consequent metabolic disorders are associated with a state of platelet hyperactivity. Oxidative stress is responsible for the persistent platelet activation. We sought to study the inhibitory effect of cardiotonic pills, an oral herbal component, on platelet function in a dog model with insulin resistance induced by high-fat feeding. We fed 18 dogs with a high-fat diet and six dogs with normal chow as control for 6 months. Then, six dogs were fed with a high-fat diet and received additional aspirin (250 mg/day), and another six dogs received additional cardiotonic pills (1,000 mg/day) for 4 months. Time-course changes in metabolic parameters and platelet function were detected. After high-fat feeding for 6 months, 18 dogs developed a series of metabolic disorders including obesity, dyslipidemia, oxidative stress and insulin resistance. In addition, a platelet hyperactivity state, characterized by increased agonist (arachidonic acid, ADP and collagen) induced platelet aggregation, platelet expression of adhesion molecules (P-selectin and GP IIb/IIIa), and platelet intracellular calcium concentration, was indicated. Cardiotonic pills showed a significant antioxidative activity by presenting an increase in plasma superoxide dismutase and decrease in erythrocyte glutathione, as well as a lipid-lowering effect (decrease in both plasma cholesterol and triglyceride). Either aspirin or cardiotonic pills could significantly reverse the platelet hypersensitivity and hyperfunction. Compared with aspirin, cardiotonic pills showed a more exaggerated inhibitory effect on platelet function (a significantly decreased collagen-stimulated platelet aggregation, and expression of adhesion molecules). In conclusion, cardiotonic pills inhibited platelet hyperfunction in dogs with insulin resistance. This inhibitory effect may mainly be explained by antioxidative activity and metabolic control.

  5. Effect of miR-200b on retinal endothelial cell function under high glucose environment.

    PubMed

    Jiang, Qun; Zhao, Fei; Liu, Xinmin; Li, Rongrong; Liu, Jianming

    2015-01-01

    As one of the important complications of diabetes, diabetic retinopathy (DR) presented high incidence worldwide. Hyperglycemia is an important promoting factor for DR occurrence and development. It can damage retinal endothelial cell, resulting in retinal structure and function disorder. Studies have shown that miR-200b may involve in regulating DR occurrence and development, but its specific function and mechanism have not been elucidated. This study aimed to investigate miR-200b effect and mechanism on human retinal endothelial cells (hRECs) under high glucose environment. hRECs were cultured under high glucose or normal environment. Real time PCR was applied to detect miR-200b expression. MiR-200b was transfected to hRECs and MTT was used to detect its effect on hRECs proliferation under high glucose environment. Real time PCR and Western blot were performed to determine VEGF and TGFβ1 expression in the retina endothelial cells. MiR-200b expression decreased significantly under high glucose environment, whereas hRECs proliferated obviously. Compared with normal control, VEGF and TGFβ1 mRNA and protein expression increased markedly (P < 0.05). After miR-200b transfection, miR-200b expression increased, while VEGF and TGFβ1 mRNA and protein expression decreased obviously. Compared with high glucose group, hRECs proliferation was inhibited (P < 0.05). MiR-200b can regulate RECs growth and proliferation by changing VEGF and TGFβ1 expression to delay DR.

  6. A highly expressed miR-101 isomiR is a functional silencing small RNA

    PubMed Central

    2013-01-01

    Background MicroRNAs (miRNAs) are short non-coding regulatory RNAs that control gene expression usually producing translational repression and gene silencing. High-throughput sequencing technologies have revealed heterogeneity at length and sequence level for the majority of mature miRNAs (IsomiRs). Most isomiRs can be explained by variability in either Dicer1 or Drosha cleavage during miRNA biogenesis at 5’ or 3’ of the miRNA (trimming variants). Although isomiRs have been described in different tissues and organisms, their functional validation as modulators of gene expression remains elusive. Here we have characterized the expression and function of a highly abundant miR-101 5’-trimming variant (5’-isomiR-101). Results The analysis of small RNA sequencing data in several human tissues and cell lines indicates that 5’-isomiR-101 is ubiquitously detected and a highly abundant, especially in the brain. 5’-isomiR-101 was found in Ago-2 immunocomplexes and complementary approaches showed that 5’-isomiR-101 interacted with different members of the silencing (RISC) complex. In addition, 5’-isomiR-101 decreased the expression of five validated miR-101 targets, suggesting that it is a functional variant. Both the binding to RISC members and the degree of silencing were less efficient for 5’-isomiR-101 compared with miR-101. For some targets, both miR-101 and 5’-isomiR-101 significantly decreased protein expression with no changes in the respective mRNA levels. Although a high number of overlapping predicted targets suggest similar targeted biological pathways, a correlation analysis of the expression profiles of miR-101 variants and predicted mRNA targets in human brains at different ages, suggest specific functions for miR-101- and 5’-isomiR-101. Conclusions These results suggest that isomiRs are functional variants and further indicate that for a given miRNA, the different isomiRs may contribute to the overall effect as quantitative and

  7. Nuisance Regression of High-Frequency Functional Magnetic Resonance Imaging Data: Denoising Can Be Noisy.

    PubMed

    Chen, Jingyuan E; Jahanian, Hesamoddin; Glover, Gary H

    2017-02-01

    Recently, emerging studies have demonstrated the existence of brain resting-state spontaneous activity at frequencies higher than the conventional 0.1 Hz. A few groups utilizing accelerated acquisitions have reported persisting signals beyond 1 Hz, which seems too high to be accommodated by the sluggish hemodynamic process underpinning blood oxygen level-dependent contrasts (the upper limit of the canonical model is ∼0.3 Hz). It is thus questionable whether the observed high-frequency (HF) functional connectivity originates from alternative mechanisms (e.g., inflow effects, proton density changes in or near activated neural tissue) or rather is artificially introduced by improper preprocessing operations. In this study, we examined the influence of a common preprocessing step-whole-band linear nuisance regression (WB-LNR)-on resting-state functional connectivity (RSFC) and demonstrated through both simulation and analysis of real dataset that WB-LNR can introduce spurious network structures into the HF bands of functional magnetic resonance imaging (fMRI) signals. Findings of present study call into question whether published observations on HF-RSFC are partly attributable to improper data preprocessing instead of actual neural activities.

  8. Low-rank separated representation surrogates of high-dimensional stochastic functions: Application in Bayesian inference

    SciTech Connect

    Validi, AbdoulAhad

    2014-03-01

    This study introduces a non-intrusive approach in the context of low-rank separated representation to construct a surrogate of high-dimensional stochastic functions, e.g., PDEs/ODEs, in order to decrease the computational cost of Markov Chain Monte Carlo simulations in Bayesian inference. The surrogate model is constructed via a regularized alternative least-square regression with Tikhonov regularization using a roughening matrix computing the gradient of the solution, in conjunction with a perturbation-based error indicator to detect optimal model complexities. The model approximates a vector of a continuous solution at discrete values of a physical variable. The required number of random realizations to achieve a successful approximation linearly depends on the function dimensionality. The computational cost of the model construction is quadratic in the number of random inputs, which potentially tackles the curse of dimensionality in high-dimensional stochastic functions. Furthermore, this vector-valued separated representation-based model, in comparison to the available scalar-valued case, leads to a significant reduction in the cost of approximation by an order of magnitude equal to the vector size. The performance of the method is studied through its application to three numerical examples including a 41-dimensional elliptic PDE and a 21-dimensional cavity flow.

  9. Group social skills interventions for adults with high-functioning autism spectrum disorders: A systematic review.

    PubMed

    Spain, Debbie; Blainey, Sarah H

    2015-10-01

    Autism spectrum disorders are characterised by impairments in communication and social interaction. Social skills interventions have been found to ameliorate socio-communication deficits in children and adolescents with autism spectrum disorders. Little is known about the effectiveness of social skills interventions for adults with high-functioning autism spectrum disorders (hf-ASD) - a clinical population who can present with more subtle core deficits, but comparable levels of impairment and secondary difficulties. A systematic review was undertaken to investigate the effectiveness of social skills interventions for adults with high-functioning autism spectrum disorders. Five studies met the pre-specified review inclusion criteria: two quasi-experimental comparative trials and three single-arm interventions. There was a degree of variation in the structure, duration and content of the social skills interventions delivered, as well as several methodological limitations associated with included studies. Nevertheless, narrative analysis tentatively indicates that group social skills interventions may be effective for enhancing social knowledge and understanding, improving social functioning, reducing loneliness and potentially alleviating co-morbid psychiatric symptoms.

  10. Object-directed imitation in children with high-functioning autism: testing the social motivation hypothesis.

    PubMed

    Nielsen, Mark; Slaughter, Virginia; Dissanayake, Cheryl

    2013-02-01

    Children with autism show clear deficits in copying others' bodily oriented actions whereas their capacity for replicating others' object-directed actions appears relatively spared. One explanation is that unlike bodily oriented actions, object-directed actions have tangible, functional outcomes and hence rely far less on social motivations for their production. To investigate this, we compared the performance of a group of children with high-functioning autism (HFA) and a group of typically developing (TD) children on two distinct object-directed tasks that are considered highly social: overimitation and synchronic imitation. Our findings were surprising. The HFA children copied all of a modeling adult's actions, including those that had no function or purpose (i.e. they overimitated), and they entered into extended bouts repeating an arbitrary action along with the adult who had a similar object to play with (i.e. they engaged in synchronic imitation). Moreover, they did so at rates indistinguishable from the TD children. This work demonstrates that the capacity and propensity for overimitation and synchronic imitation are intact in children with HFA, and questions whether socially based imitation should be considered an autism-specific deficit.

  11. Functionalization of quinoxalines by using TMP bases: preparation of tetracyclic heterocycles with high photoluminescene quantum yields.

    PubMed

    Nafe, Julia; Herbert, Simon; Auras, Florian; Karaghiosoff, Konstantin; Bein, Thomas; Knochel, Paul

    2015-01-12

    Tetracyclic heterocycles that exhibit high photoluminescence quantum yields were synthesized by anellation reactions of mono-, di-, and trifunctionalized 2,3-dichloroquinoxalines. Thus, treatment of 2,3-dichloroquinoxaline with TMPLi (TMP = 2,2,6,6-tetramethylpiperidyl) allows a regioselective lithiation in position 5. Quenching with various electrophiles (iodine, (BrCl2 C)2 , allylic bromide, acid chloride, aryl iodide) leads to 5-functionalized 2,3-dichloroquinoxalines. Further functionalization in positions 6 and 8 can be achieved by using TMPLi or TMPMgCl⋅LiCl furnishing a range of new di- and tri-functionalized 2,3-dichloroquinoxalines. The chlorine atoms are readily substituted by anellation with 1,2-diphenols or 1,2-dithiophenols leading to a series of new tetracyclic compounds. These materials exhibit strong, tunable optical absorption and emission in the blue and green spectral region. The substituted O-heterocyclic compounds exhibit particularly high photoluminescence quantum yields of up to 90%, which renders them interesting candidates for fluorescence imaging applications.

  12. High-throughput monitoring of major cell functions by means of lensfree video microscopy

    PubMed Central

    Kesavan, S. Vinjimore; Momey, F.; Cioni, O.; David-Watine, B.; Dubrulle, N.; Shorte, S.; Sulpice, E.; Freida, D.; Chalmond, B.; Dinten, J. M.; Gidrol, X.; Allier, C.

    2014-01-01

    Quantification of basic cell functions is a preliminary step to understand complex cellular mechanisms, for e.g., to test compatibility of biomaterials, to assess the effectiveness of drugs and siRNAs, and to control cell behavior. However, commonly used quantification methods are label-dependent, and end-point assays. As an alternative, using our lensfree video microscopy platform to perform high-throughput real-time monitoring of cell culture, we introduce specifically devised metrics that are capable of non-invasive quantification of cell functions such as cell-substrate adhesion, cell spreading, cell division, cell division orientation and cell death. Unlike existing methods, our platform and associated metrics embrace entire population of thousands of cells whilst monitoring the fate of every single cell within the population. This results in a high content description of cell functions that typically contains 25,000 – 900,000 measurements per experiment depending on cell density and period of observation. As proof of concept, we monitored cell-substrate adhesion and spreading kinetics of human Mesenchymal Stem Cells (hMSCs) and primary human fibroblasts, we determined the cell division orientation of hMSCs, and we observed the effect of transfection of siCellDeath (siRNA known to induce cell death) on hMSCs and human Osteo Sarcoma (U2OS) Cells. PMID:25096726

  13. Porous Functionalized Self-Standing Carbon Fiber Paper Electrodes for High-Performance Capacitive Energy Storage.

    PubMed

    Zhu, Yuanyuan; Cheng, Shuang; Zhou, Weijia; Jia, Jin; Yang, Lufeng; Yao, Minghai; Wang, Mengkun; Wu, Peng; Luo, Haowei; Liu, Meilin

    2017-04-06

    A facile and cost-efficient approach to functionalize raw carbon fiber paper (CFP) used for a self-standing capacitive electrode has been proposed here. Benefiting from the improved specific surface area and surface functional groups, the functionalized CFP (F-CFP) showed much enhanced capacitive performance, 3 orders of magnitude higher than that of the raw CFP. It delivered the areal capacitance of 1275 mF cm(-2) at 5 mA cm(-2) with a rather wide voltage window of 1.4 V (-0.4 to 1 V vs Ag/AgCl) in 0.5 M H2SO4. However, in a neutral 1 M Na2SO4 aqueous solution, although the areal capacitance of 1115 mF cm(-2) at 3 mA cm(-2) is slightly smaller, the potential window is much wider (2 V, -1 to 1 V vs Ag/AgCl), indicating a high overpotential of hydrogen evolution. The areal capacitance was still as high as 722 mF cm(-2) at a very fast charge-discharge current density of 50 mA cm(-2), and about 66% of the initial capacitance (at 3 mA cm(-2)) was remained in Na2SO4, indicating considerable rate capability.

  14. Efficient streptavidin-functionalized nitrogen-doped graphene for the development of highly sensitive electrochemical immunosensor.

    PubMed

    Yang, Zhanjun; Lan, Qingchun; Li, Juan; Wu, Jiajia; Tang, Yan; Hu, Xiaoya

    2017-03-15

    In this work, an efficient and universal streptavidin-functionalized nitrogen-doped graphene (NG) was for the first time proposed and used to develop a highly sensitive electrochemical immunosensor for the detection of tumor markers. Transmission electron microscopy, electrochemical impedance spectrum, static water contact measurement, and cyclic voltammetry were used to characterize the streptavidin-functionalized NG platform and immunosensor. The biofunctionalized NG showed excellent hydrophilicity, larger specific surface area, and high electrochemical activity. These properties of the platform enhanced the loading capacity of proteins, and retained the bioactivity of the immobilized proteins, and thus remarkably improved the sensitivity of the immunosensor. Using carcinoembryonic antigen (CEA) as model analyte, the proposed immunosensor demonstrated a wide linear range of 0.02-12ngmL(-1) with a low detection limit of 0.01ngmL(-1). The CEA immunosensor could be applied to detect human serum samples with satisfactory results. The streptavidin-functionalized NG material provided an universal and promising platform for the electrochemical immunosensing applications.

  15. Development of combustion response functions in a subscale high-pressure transverse combustor

    NASA Astrophysics Data System (ADS)

    Wierman, M.; Pomeroy, B.; Anderson, W.

    2016-07-01

    Combustion response functions describe the magnitude and time lag behavior of a flame in response to unsteady pressure and velocity. By understanding the feedback between unsteady flowfields and heat release, the growth and decay of combustion instability can be better predicted. An automated data isolation and reduction method has been developed to generate meaningful graphical combustion response functions from a combination of pressure amplitude and various image analysis metrics. It was developed and tested using pressure measurements and high-speed imaging of combustion light taken from a single element at the midspan of an unstable high-pressure subscale transverse combustor. The code was used to isolate time slices of near stationary pressure amplitude and to process the corresponding images into combustion response approximated by aggregate intensity, intensity weighted spatial center, Proper Orthogonal Decomposition (POD), and Dynamic Mode Decomposition (DMD). Overall, the generated combustion response functions generally agreed with expected behavior of an element located at a first width (1W) velocity antinode and second width (2W) pressure antinode. Results from both POD and DMD successfully isolated the prominent spatial and temporal light emission behavior.

  16. Analysis of the Radiative Transfer Equation with Highly Asymmetric Phase Function

    NASA Technical Reports Server (NTRS)

    Korkin, Sergey V.; Lyapustin, Alexei I.; Rozanov, Vladimir V.

    2011-01-01

    This paper considers a scalar radiative transfer problem with high scattering anisotropy, Two computational methods are presented based on decomposition of the diffuse light field into a regular and anisotropic part. The first algorithm (DOMAS) singles out the anisotropic radiance in the forward scattering peak using the Small-Angle Modification of RTE. The second algorithm (DOM2+) separates the single scattering radiance as an anisotropic part, which largely defines the fine detail of the total radiance in the backscattering directions. In both cases, the anisotropic part is represented analytically. With anisotropy subtraction, the regular part of the signal. which requires a numerical solution, is essentially smoothed as a function of angles. Further, the transport equation is obtained for the regular part that contains an additional source function from the anisotropic part of the signal. This equation is solved with the discrete ordinates method. A conducted numerical analysis of this work showed that algorithm DOMAS has a strong advantage as compared to the standard discrete ordinates method for simulation of the radiance transmission, and DOM2 + is the best of the three for the reflection computations. Both algorithms offer at least a factor of three acceleration of convergence of the azimuthal series for highly anisotropic phase functions.

  17. Cyanographene and Graphene Acid: Emerging Derivatives Enabling High-Yield and Selective Functionalization of Graphene

    PubMed Central

    2017-01-01

    Efficient and selective methods for covalent derivatization of graphene are needed because they enable tuning of graphene’s surface and electronic properties, thus expanding its application potential. However, existing approaches based mainly on chemistry of graphene and graphene oxide achieve only limited level of functionalization due to chemical inertness of the surface and nonselective simultaneous attachment of different functional groups, respectively. Here we present a conceptually different route based on synthesis of cyanographene via the controllable substitution and defluorination of fluorographene. The highly conductive and hydrophilic cyanographene allows exploiting the complex chemistry of −CN groups toward a broad scale of graphene derivatives with very high functionalization degree. The consequent hydrolysis of cyanographene results in graphene acid, a 2D carboxylic acid with pKa of 5.2, showing excellent biocompatibility, conductivity and dispersibility in water and 3D supramolecular assemblies after drying. Further, the carboxyl groups enable simple, tailored and widely accessible 2D chemistry onto graphene, as demonstrated via the covalent conjugation with a diamine, an aminothiol and an aminoalcohol. The developed methodology represents the most controllable, universal and easy to use approach toward a broad set of 2D materials through consequent chemistries on cyanographene and on the prepared carboxy-, amino-, sulphydryl-, and hydroxy- graphenes. PMID:28208019

  18. Surface functionalization of solid state ultra-high molecular weight polyethylene through chemical grafting

    NASA Astrophysics Data System (ADS)

    Sherazi, Tauqir A.; Rehman, Tayyiba; Naqvi, Syed Ali Raza; Shaikh, Ahson Jabbar; Shahzad, Sohail Anjum; Abbas, Ghazanfar; Raza, Rizwan; Waseem, Amir

    2015-12-01

    The surface of ultra-high molecular weight polyethylene (UHMWPE) powder was functionalized with styrene using chemical grafting technique. The grafting process was initiated through radical generation on base polymer matrix in the solid state by sodium thiosulfate, while peroxides formed at radical sites during this process were dissociated by ceric ammonium nitrate. Various factors were optimized and reasonably high level of monomer grafting was achieved, i.e., 15.6%. The effect of different acids as additive and divinyl benzene (DVB) as a cross-linking agent was also studied. Post-grafting sulfonation was conducted to introduce the ionic moieties to the grafted polymer. Ion-exchange capacity (IEC) was measured experimentally and is found to be 1.04 meq g-1, which is in close agreement with the theoretical IEC values. The chemical structure of grafted and functionalized polymer was characterized by attenuated total reflection infrared spectroscopy (ATR-FTIR) and thermal properties were investigated by thermo gravimetric analysis (TGA) and differential scanning calorimetry (DSC). Thermal analysis depicts that the presence of radicals on the polymer chain accelerates the thermal decomposition process. The results signify that the chemical grafting is an effective tool for substantial surface modification and subsequent functionalization of polyethylene.

  19. Adsorption of Ruthenium, Rhodium and Palladium from Simulated High-Level Liquid Waste by Highly Functional Xerogel - 13286

    SciTech Connect

    Onishi, Takashi; Koyama, Shin-ichi; Mimura, Hitoshi

    2013-07-01

    Fission products are generated by fission reactions in nuclear fuel. Platinum group (Pt-G) elements, such as palladium (Pd), rhodium (Rh) and ruthenium (Ru), are also produced. Generally, Pt-G elements play important roles in chemical and electrical industries. Highly functional xerogels have been developed for recovery of these useful Pt-G elements from high - level radioactive liquid waste (HLLW). An adsorption experiment from simulated HLLW was done by the column method to study the selective adsorption of Pt-G elements, and it was found that not only Pd, Rh and Ru, but also nickel, zirconium and tellurium were adsorbed. All other elements were not adsorbed. Adsorbed Pd was recovered by washing the xerogel-packed column with thiourea solution and thiourea - nitric acid mixed solution in an elution experiment. Thiourea can be a poison for automotive exhaust emission system catalysts, so it is necessary to consider its removal. Thermal decomposition and an acid digestion treatment were conducted to remove sulfur in the recovered Pd fraction. The relative content of sulfur to Pd was decreased from 858 to 0.02 after the treatment. These results will contribute to design of the Pt-G element separation system. (authors)

  20. A method for high-throughput functional imaging of single cells within heterogeneous cell preparations

    PubMed Central

    Neal, Adam S.; Rountree, Austin M.; Radtke, Jared R.; Yin, Jianzhu; Schwartz, Michael W.; Hampe, Christiane S.; Posner, Jonathan D.; Cirulli, Vincenzo; Sweet, Ian R.

    2016-01-01

    Functional characterization of individual cells within heterogeneous tissue preparations is challenging. Here, we report the development of a versatile imaging method that assesses single cell responses of various endpoints in real time, while identifying the individual cell types. Endpoints that can be measured include (but are not limited to) ionic flux (calcium, sodium, potassium and hydrogen), metabolic responsiveness (NAD(P)H, mitochondrial membrane potential), and signal transduction (H2O2 and cAMP). Subsequent to fluorescent imaging, identification of cell types using immunohistochemistry allows for mapping of cell type to their respective functional real time responses. To validate the utility of this method, NAD(P)H responses to glucose of islet alpha versus beta cells generated from dispersed pancreatic islets, followed by the construction of frequency distributions characterizing the variability in the magnitude of each individual cell responses were compared. As expected, no overlap between the glucose response frequency distributions for beta cells versus alpha cells was observed, thereby establishing both the high degree of fidelity and low rate of both false-negatives and false-positives in this approach. This novel method has the ability not only to resolve single cell level functional differences between cell types, but also to characterize functional heterogeneity within a given cell type. PMID:27982116