Sample records for highly regulated developmental

  1. Developmental Localization and Methylesterification of Pectin Epitopes during Somatic Embryogenesis of Banana (Musa spp. AAA)

    PubMed Central

    Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef

    2011-01-01

    Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low- and highly-methyl-esterified HG epitopes are developmentally regulated in diverse embryogenic stages during somatic embryogenesis. This study provides new information about pectin composition, HG methyl-esterification and developmental localization of pectin epitopes during somatic embryogenesis of banana. PMID:21826225

  2. FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

    PubMed Central

    Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

    2011-01-01

    Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

  3. Endocrine regulation of predator-induced phenotypic plasticity.

    PubMed

    Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

    2014-11-01

    Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

  4. Identification of High-Temperature-Responsive Genes in Cereals1[C][W

    PubMed Central

    Hemming, Megan N.; Walford, Sally A.; Fieg, Sarah; Dennis, Elizabeth S.; Trevaskis, Ben

    2012-01-01

    High temperature influences plant development and can reduce crop yields. We examined how ambient temperature influences reproductive development in the temperate cereals wheat (Triticum aestivum) and barley (Hordeum vulgare). High temperature resulted in rapid progression through reproductive development in long days, but inhibited early stages of reproductive development in short days. Activation of the long-day flowering response pathway through day-length-insensitive alleles of the PHOTOPERIOD1 gene, which result in high FLOWERING LOCUS T-like1 transcript levels, did not allow rapid early reproductive development at high temperature in short days. Furthermore, high temperature did not increase transcript levels of FLOWERING LOCUS T-like genes. These data suggest that genes or pathways other than the long-day response pathway mediate developmental responses to high temperature in cereals. Transcriptome analyses suggested a possible role for vernalization-responsive genes in the developmental response to high temperature. The MADS-box floral repressor HvODDSOC2 is expressed at elevated levels at high temperature in short days, and might contribute to the inhibition of early reproductive development under these conditions. FLOWERING PROMOTING FACTOR1-like, RNase-S-like genes, and VER2-like genes were also identified as candidates for high-temperature-responsive developmental regulators. Overall, these data suggest that rising temperatures might elicit different developmental responses in cereal crops at different latitudes or times of year, due to the interaction between temperature and day length. Additionally, we suggest that different developmental regulators might mediate the response to high temperature in cereals compared to Arabidopsis (Arabidopsis thaliana). PMID:22279145

  5. 45 CFR 1385.2 - Purpose of the regulations.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... regulations. These regulations implement the Developmental Disabilities Assistance and Bill of Rights Act as...

  6. Ascorbate metabolism and the developmental demand for tartaric and oxalic acids in ripening grape berries

    PubMed Central

    2009-01-01

    Background Fresh fruits are well accepted as a good source of the dietary antioxidant ascorbic acid (Asc, Vitamin C). However, fruits such as grapes do not accumulate exceptionally high quantities of Asc. Grapes, unlike most other cultivated fruits do however use Asc as a precursor for the synthesis of both oxalic (OA) and tartaric acids (TA). TA is a commercially important product in the wine industry and due to its acidifying effect on crushed juice it can influence the organoleptic properties of the wine. Despite the interest in Asc accumulation in fruits, little is known about the mechanisms whereby Asc concentration is regulated. The purpose of this study was to gain insights into Asc metabolism in wine grapes (Vitis vinifera c.v. Shiraz.) and thus ascertain whether the developmental demand for TA and OA synthesis influences Asc accumulation in the berry. Results We provide evidence for developmentally differentiated up-regulation of Asc biosynthetic pathways and subsequent fluctuations in Asc, TA and OA accumulation. Rapid accumulation of Asc and a low Asc to dehydroascorbate (DHA) ratio in young berries was co-ordinated with up-regulation of three of the primary Asc biosynthetic (Smirnoff-Wheeler) pathway genes. Immature berries synthesised Asc in-situ from the primary pathway precursors D-mannose and L-galactose. Immature berries also accumulated TA in early berry development in co-ordination with up-regulation of a TA biosynthetic gene. In contrast, ripe berries have up-regulated expression of the alternative Asc biosynthetic pathway gene D-galacturonic acid reductase with only residual expression of Smirnoff-Wheeler Asc biosynthetic pathway genes and of the TA biosynthetic gene. The ripening phase was further associated with up-regulation of Asc recycling genes, a secondary phase of increased accumulation of Asc and an increase in the Asc to DHA ratio. Conclusion We demonstrate strong developmental regulation of Asc biosynthetic, recycling and catabolic genes in grape berries. Integration of the transcript, radiotracer and metabolite data demonstrates that Asc and TA metabolism are developmentally regulated in grapevines; resulting in low accumulated levels of the biosynthetic intermediate Asc, and high accumulated levels of the metabolic end-product TA. PMID:19995454

  7. The Developmental Trajectory of Perceived Self-Regulation, Personal Interest, and General Achievement throughout High School: A Longitudinal Study

    ERIC Educational Resources Information Center

    Helle, Laura; Laakkonen, Eero; Tuijula, Tiina; Vermunt, Jan D.

    2013-01-01

    Background: Our interest in perceived self-regulation of learning arose in the context of educational reform. After decades of stability, the Finnish high school system underwent reform in the 1990s, with a significant emphasis being placed on promoting student self-regulation of learning. Aims: The purposes of the study were (1) to evaluate…

  8. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata

    PubMed Central

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomira; Gase, Klaus; Baldwin, Ian T.; Meldau, Stefan

    2016-01-01

    Plant defense metabolites are well-known to be regulated developmentally. The OD theory posits that a tissue’s fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness-value to the plant and therefore their defense allocations should be higher when compared to older leaves. The mechanisms which coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf cytokinin levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different cytokinin classes by using senescence- and chemically-inducible expression of cytokinin biosynthesis genes. Genetically modifying the levels of different cytokinins in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include cytokinins plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. PMID:27557345

  9. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    PubMed

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

  10. Genome wide analysis reveals Zic3 interaction with distal regulatory elements of stage specific developmental genes in zebrafish.

    PubMed

    Winata, Cecilia L; Kondrychyn, Igor; Kumar, Vibhor; Srinivasan, Kandhadayar G; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-10-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches--ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape.

  11. Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

    PubMed

    Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

    2016-02-26

    The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Intra- and Interprotein Phosphorylation between Two-hybrid Histidine Kinases Controls Myxococcus xanthus Developmental Progression*

    PubMed Central

    Schramm, Andreas; Lee, Bongsoo; Higgs, Penelope I.

    2012-01-01

    Histidine-aspartate phosphorelay signaling systems are used to couple stimuli to cellular responses. A hallmark feature is the highly modular signal transmission modules that can form both simple “two-component” systems and sophisticated multicomponent systems that integrate stimuli over time and space to generate coordinated and fine-tuned responses. The deltaproteobacterium Myxococcus xanthus contains a large repertoire of signaling proteins, many of which regulate its multicellular developmental program. Here, we assign an orphan hybrid histidine protein kinase, EspC, to the Esp signaling system that negatively regulates progression through the M. xanthus developmental program. The Esp signal system consists of the hybrid histidine protein kinase, EspA, two serine/threonine protein kinases, and a putative transport protein. We demonstrate that EspC is an essential component of this system because ΔespA, ΔespC, and ΔespA ΔespC double mutants share an identical developmental phenotype. Neither substitution of the phosphoaccepting histidine residue nor deletion of the entire catalytic ATPase domain in EspC produces an in vivo mutant developmental phenotype. In contrast, substitution of the receiver phosphoaccepting residue yields the null phenotype. Although the EspC histidine kinase can efficiently autophosphorylate in vitro, it does not act as a phosphodonor to its own receiver domain. Our in vitro and in vivo analyses suggest the phosphodonor is instead the EspA histidine kinase. We propose EspA and EspC participate in a novel hybrid histidine protein kinase signaling mechanism involving both inter- and intraprotein phosphotransfer. The output of this signaling system appears to be the combined phosphorylated state of the EspA and EspC receiver modules. This system regulates the proteolytic turnover of MrpC, an important regulator of the developmental program. PMID:22661709

  13. Changes in cytokinins are sufficient to alter developmental patterns of defense metabolites in Nicotiana attenuata.

    PubMed

    Brütting, Christoph; Schäfer, Martin; Vanková, Radomíra; Gase, Klaus; Baldwin, Ian T; Meldau, Stefan

    2017-01-01

    Plant defense metabolites are well known to be regulated developmentally. The optimal defense (OD) theory posits that a tssue's fitness values and probability of attack should determine defense metabolite allocations. Young leaves are expected to provide a larger fitness value to the plant, and therefore their defense allocations should be higher when compared with older leaves. The mechanisms that coordinate development with defense remain unknown and frequently confound tests of the OD theory predictions. Here we demonstrate that cytokinins (CKs) modulate ontogeny-dependent defenses in Nicotiana attenuata. We found that leaf CK levels highly correlate with inducible defense expressions with high levels in young and low levels in older leaves. We genetically manipulated the developmental patterns of two different CK classes by using senescence- and chemically inducible expression of CK biosynthesis genes. Genetically modifying the levels of different CKs in leaves was sufficient to alter ontogenic patterns of defense metabolites. We conclude that the developmental regulation of growth hormones that include CKs plays central roles in connecting development with defense and therefore in establishing optimal patterns of defense allocation in plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  14. The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

    PubMed Central

    Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

    2015-01-01

    While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

  15. Have studies of the developmental regulation of behavioral phenotypes revealed the mechanisms of gene-environment interactions?

    PubMed Central

    Hall, F. Scott; Perona, Maria T. G.

    2012-01-01

    This review addresses the recent convergence of our long-standing knowledge of the regulation of behavioral phenotypes by developmental experience with recent advances in our understanding of mechanisms regulating gene expression. This review supports a particular perspective on the developmental regulation of behavioral phenotypes: That the role of common developmental experiences (e.g. maternal interactions, peer interactions, exposure to a complex environment, etc.) is to fit individuals to the circumstances of their lives within bounds determined by long-standing (evolutionary) mechanisms that have shaped responses to critical and fundamental types of experience via those aspects of gene structure that regulate gene expression. The phenotype of a given species is not absolute for a given genotype but rather variable within bounds that are determined by mechanisms regulated by experience (e.g. epigenetic mechanisms). This phenotypic variation is not necessarily random, or evenly distributed along a continuum of description or measurement, but often highly disjointed, producing distinct, even opposing, phenotypes. The potentiality for these varying phenotypes is itself the product of evolution, the potential for alternative phenotypes itself conveying evolutionary advantage. Examples of such phenotypic variation, resulting from environmental or experiential influences, have a long history of study in neurobiology, and a number of these will be discussed in this review: neurodevelopmental experiences that produce phenotypic variation in visual perception, cognitive function, and emotional behavior. Although other examples will be discussed, particular emphasis will be made on the role of social behavior on neurodevelopment and phenotypic determination. It will be argued that an important purpose of some aspects of social behavior is regulation of neurobehavioral phenotypes by experience via genetic regulatory mechanisms. PMID:22643448

  16. doublesex alters aggressiveness as a function of social context and sex in the polyphenic beetle Onthophagus taurus.

    PubMed

    Beckers, Oliver M; Kijimoto, Teiya; Moczek, Armin P

    2017-10-01

    Despite sharing nearly the same genome, individuals within the same species can vary drastically in both morphology and behaviour as a function of developmental stage, sex or developmental plasticity. Thus, regulatory processes must exist that enable the stage-, sex- or environment-specific expression of traits and their integration during ontogeny, yet exactly how trait complexes are co-regulated and integrated is poorly understood. In this study, we explore the developmental genetic basis of the regulation and integration of environment-dependent sexual dimorphism in behaviour and morphology in the horn-polyphenic dung beetle Onthophagus taurus through the experimental manipulation of the transcription factor doublesex (dsx). The gene dsx plays a profound role in the developmental regulation of morphological differences between sexes as well as alternative male morphs by inhibiting horn formation in females but enabling nutrition-responsive horn growth in males. Specifically, we investigated whether experimental downregulation of dsx expression affects male and female aggressive and courtship behaviours in two social contexts: interactions between individuals of the same sex and interactions between males and females. We find that dsx downregulation significantly alters aggressiveness in both males and females, yet does so differently for both sexes as a function of social context: dsx RNAi males exhibited elevated aggression towards males but showed reduced aggression towards females, whereas dsx RNAi females became more aggressive towards males, while their aggressiveness towards other females was unaffected. Moreover, we document unexpectedly high levels of female aggression independent of dsx treatment in both wild-type and control-injected individuals. Lastly, we found no effects of dsx RNAi on courtship and mating behaviours. We discuss the role of dsx in the regulation of sex-specific and plastic behaviours, the unexpectedly high levels of aggression of hornless dsx RNAi males in relation to the well-established description of the hornless sneaker phenotype and the potential ecological function of high female aggression.

  17. Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity.

    PubMed

    Terenzi, Fulvia; Ladd, Andrea N

    2010-01-01

    Muscleblind-like (MBNL) proteins have been shown to regulate pre-mRNA alternative splicing, and MBNL1 has been implicated in regulating fetal-to-adult transitions in alternative splicing in the heart. MBNL1 is highly conserved, exhibiting more than 95% identity at the amino acid level between birds and mammals. To investigate MBNL1 expression during embryonic heart development, we examined MBNL1 transcript and protein expression in the embryonic chicken heart from the formation of the primitive heart tube through cardiac morphogenesis (embryonic days 1.5 through 8). MBNL1 transcript levels remained steady throughout these stages, whereas MBNL1 protein levels increased and exhibited a shift in isoforms. MBNL1 has several alternatively spliced exons. Using RT-PCR, we determined that the inclusion of one of these, exon 5, decreases dramatically during cardiac morphogenesis. This developmental transition is conserved in mice. Functional analyses of MBNL1 isoforms containing or lacking exon 5-encoded sequences revealed that exon 5 is important for the regulation of the subcellular localization, RNA binding affinity, and alternative splicing activity of MBNL1 proteins. A second MBNL protein, MBNL2, is also expressed in the embryonic heart. We found that MBNL2 exon 5, which is paralogous to MBNL1 exon 5, is similarly regulated during embryonic heart development. Analysis of MBNL1 and MBNL2 transcripts in several embryonic tissues in chicken and mouse indicate that exon 5 alternative splicing is highly conserved and tissue-specific. Thus, we propose that conserved developmental stage- and tissue-specific alternative splicing of MBNL transcripts is an important mechanism by which MBNL activity is regulated during embryonic development.

  18. WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

    PubMed

    Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

    2017-03-01

    Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

    PubMed

    Kovacs, Maria; Lopez-Duran, Nestor L

    2012-04-01

    For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

  20. An integrative review of ethnic and cultural variation in socialization and children's self-regulation.

    PubMed

    LeCuyer, Elizabeth A; Zhang, Yi

    2015-04-01

    To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.

  1. Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

    2012-10-01

    This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

  2. Identifying Military and Combat-Specific Risk Factors for Child Adjustment: Comparing High and Low Risk Military Families and Civilian Families

    DTIC Science & Technology

    2013-06-01

    families (N=200) and civilian dual parent families (N=200). The objectives of this study are to: 1) identify and measure developmentally salient skills ...identify and measure developmentally salient skills that are indicators of current adaptation among preschool and early childhood boys and girls of... Skill Achievement i. Preschool Aged children 1. Self regulation: the 36-item Early Childhood Behavior Questionnaire – Very Short Form (CBQ-VSF

  3. Dynamic Organization of lncRNA and Circular RNA Regulators Collectively Controlled Cardiac Differentiation in Humans.

    PubMed

    Li, Yongsheng; Zhang, Jinwen; Huo, Caiqin; Ding, Na; Li, Junyi; Xiao, Jun; Lin, Xiaoyu; Cai, Benzhi; Zhang, Yunpeng; Xu, Juan

    2017-10-01

    Advances in developmental cardiology have increased our understanding of the early aspects of heart differentiation. However, understanding noncoding RNA (ncRNA) transcription and regulation during this process remains elusive. Here, we constructed transcriptomes for both long noncoding RNAs (lncRNAs) and circular RNAs (circRNAs) in four important developmental stages ranging from early embryonic to cardiomyocyte based on high-throughput sequencing datasets, which indicate the high stage-specific expression patterns of two ncRNA types. Additionally, higher similarities of samples within each stage were found, highlighting the divergence of samples collected from distinct cardiac developmental stages. Next, we developed a method to identify numerous lncRNA and circRNA regulators whose expression was significantly stage-specific and shifted gradually and continuously during heart differentiation. We inferred that these ncRNAs are important for the stages of cardiac differentiation. Moreover, transcriptional regulation analysis revealed that the expression of stage-specific lncRNAs is controlled by known key stage-specific transcription factors (TFs). In addition, circRNAs exhibited dynamic expression patterns independent from their host genes. Functional enrichment analysis revealed that lncRNAs and circRNAs play critical roles in pathways that are activated specifically during heart differentiation. We further identified candidate TF-ncRNA-gene network modules for each differentiation stage, suggesting the dynamic organization of lncRNAs and circRNAs collectively controlled cardiac differentiation, which may cause heart-related diseases when defective. Our study provides a foundation for understanding the dynamic regulation of ncRNA transcriptomes during heart differentiation and identifies the dynamic organization of novel key lncRNAs and circRNAs to collectively control cardiac differentiation. Copyright © 2017. Published by Elsevier B.V.

  4. microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach.

    PubMed

    Macchiaroli, Natalia; Cucher, Marcela; Zarowiecki, Magdalena; Maldonado, Lucas; Kamenetzky, Laura; Rosenzvit, Mara Cecilia

    2015-02-06

    microRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in fundamental biological processes such as development and metabolism. The particular developmental and metabolic characteristics of cestode parasites highlight the importance of studying miRNA gene regulation in these organisms. Here, we perform a comprehensive analysis of miRNAs in the parasitic cestode Echinococcus canadensis G7, one of the causative agents of the neglected zoonotic disease cystic echinococcosis. Small RNA libraries from protoscoleces and cyst walls of E. canadensis G7 and protoscoleces of E. granulosus sensu stricto G1 were sequenced using Illumina technology. For miRNA prediction, miRDeep2 core algorithm was used. The output list of candidate precursors was manually curated to generate a high confidence set of miRNAs. Differential expression analysis of miRNAs between stages or species was estimated with DESeq. Expression levels of selected miRNAs were validated using poly-A RT-qPCR. In this study we used a high-throughput approach and found transcriptional evidence of 37 miRNAs thus expanding the miRNA repertoire of E. canadensis G7. Differential expression analysis showed highly regulated miRNAs between life cycle stages, suggesting a role in maintaining the features of each developmental stage or in the regulation of developmental timing. In this work we characterize conserved and novel Echinococcus miRNAs which represent 30 unique miRNA families. Here we confirmed the remarkable loss of conserved miRNA families in E. canadensis, reflecting their low morphological complexity and high adaptation to parasitism. We performed the first in-depth study profiling of small RNAs in the zoonotic parasite E. canadensis G7. We found that miRNAs are the preponderant small RNA silencing molecules, suggesting that these small RNAs could be an essential mechanism of gene regulation in this species. We also identified both parasite specific and divergent miRNAs which are potential biomarkers of infection. This study will provide valuable information for better understanding of the complex biology of this parasite and could help to find new potential targets for therapy and/or diagnosis.

  5. Challenges in Emotional Regulation in Asperger Syndrome and High-Functioning Autism

    ERIC Educational Resources Information Center

    Laurent, Amy C.; Rubin, Emily

    2004-01-01

    As positive outcomes for children and adolescents with either Asperger syndrome or high-functioning autism are related to the development of social communicative competence, recognition of the developmental capacities that contribute to this achievement is essential. Although social communication skills play a central role, developmental…

  6. Developmental Regulation across the Life Span: Toward a New Synthesis

    ERIC Educational Resources Information Center

    Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

    2013-01-01

    How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

  7. FRUITFULL controls SAUR10 expression and regulates Arabidopsis growth and architecture.

    PubMed

    Bemer, Marian; van Mourik, Hilda; Muiño, Jose M; Ferrándiz, Cristina; Kaufmann, Kerstin; Angenent, Gerco C

    2017-06-15

    MADS-domain transcription factors are well known for their roles in plant development and regulate sets of downstream genes that have been uncovered by high-throughput analyses. A considerable number of these targets are predicted to function in hormone responses or responses to environmental stimuli, suggesting that there is a close link between developmental and environmental regulators of plant growth and development. Here, we show that the Arabidopsis MADS-domain factor FRUITFULL (FUL) executes several functions in addition to its noted role in fruit development. Among the direct targets of FUL, we identified SMALL AUXIN UPREGULATED RNA 10 (SAUR10), a growth regulator that is highly induced by a combination of auxin and brassinosteroids and in response to reduced R:FR light. Interestingly, we discovered that SAUR10 is repressed by FUL in stems and inflorescence branches. SAUR10 is specifically expressed at the abaxial side of these branches and this localized activity is influenced by hormones, light conditions and by FUL, which has an effect on branch angle. Furthermore, we identified a number of other genes involved in hormone pathways and light signalling as direct targets of FUL in the stem, demonstrating a connection between developmentally and environmentally regulated growth programs. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  8. Cell identity regulators link development and stress responses in the Arabidopsis root.

    PubMed

    Iyer-Pascuzzi, Anjali S; Jackson, Terry; Cui, Hongchang; Petricka, Jalean J; Busch, Wolfgang; Tsukagoshi, Hironaka; Benfey, Philip N

    2011-10-18

    Stress responses in plants are tightly coordinated with developmental processes, but interaction of these pathways is poorly understood. We used genome-wide assays at high spatiotemporal resolution to understand the processes that link development and stress in the Arabidopsis root. Our meta-analysis finds little evidence for a universal stress response. However, common stress responses appear to exist with many showing cell type specificity. Common stress responses may be mediated by cell identity regulators because mutations in these genes resulted in altered responses to stress. Evidence for a direct role for cell identity regulators came from genome-wide binding profiling of the key regulator SCARECROW, which showed binding to regulatory regions of stress-responsive genes. Coexpression in response to stress was used to identify genes involved in specific developmental processes. These results reveal surprising linkages between stress and development at cellular resolution, and show the power of multiple genome-wide data sets to elucidate biological processes. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. The Development of Self-Regulation across Early Childhood

    PubMed Central

    Montroy, Janelle J.; Bowles, Ryan P.; Skibbe, Lori E.; McClelland, Megan M.; Morrison, Frederick J.

    2016-01-01

    The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of three and seven, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across three diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow three distinct developmental patterns of growth. These three trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds with implications for offering individualized support across children. PMID:27709999

  10. MicroRNA, mRNA, and protein expression link development and aging in human and macaque brain

    PubMed Central

    Somel, Mehmet; Guo, Song; Fu, Ning; Yan, Zheng; Hu, Hai Yang; Xu, Ying; Yuan, Yuan; Ning, Zhibin; Hu, Yuhui; Menzel, Corinna; Hu, Hao; Lachmann, Michael; Zeng, Rong; Chen, Wei; Khaitovich, Philipp

    2010-01-01

    Changes in gene expression levels determine differentiation of tissues involved in development and are associated with functional decline in aging. Although development is tightly regulated, the transition between development and aging, as well as regulation of post-developmental changes, are not well understood. Here, we measured messenger RNA (mRNA), microRNA (miRNA), and protein expression in the prefrontal cortex of humans and rhesus macaques over the species' life spans. We find that few gene expression changes are unique to aging. Instead, the vast majority of miRNA and gene expression changes that occur in aging represent reversals or extensions of developmental patterns. Surprisingly, many gene expression changes previously attributed to aging, such as down-regulation of neural genes, initiate in early childhood. Our results indicate that miRNA and transcription factors regulate not only developmental but also post-developmental expression changes, with a number of regulatory processes continuing throughout the entire life span. Differential evolutionary conservation of the corresponding genomic regions implies that these regulatory processes, although beneficial in development, might be detrimental in aging. These results suggest a direct link between developmental regulation and expression changes taking place in aging. PMID:20647238

  11. Regulation of priority carcinogens and reproductive or developmental toxicants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hooper, K.; LaDou, J.; Rosenbaum, J.S.

    In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies suchmore » as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.« less

  12. Regulation of priority carcinogens and reproductive or developmental toxicants.

    PubMed

    Hooper, K; LaDou, J; Rosenbaum, J S; Book, S A

    1992-01-01

    In California, 370 carcinogens and 112 reproductive/developmental toxicants have been identified as a result of the State's Safe Drinking Water and Toxic Enforcement Act of 1986. They include pesticides, solvents, metals, industrial intermediates, environmental mixtures, and reactive agents. Occupational, environmental, and consumer product exposures that involve these agents are regulated under the Act. At levels of concern, businesses must provide warnings for and limit discharges of those chemicals. The lists of chemicals were compiled following systematic review of published data, including technical reports from the U.S. Public Health Service--National Toxicology Program (NTP), and evaluation of recommendations from authoritative bodies such as the International Agency for Research on Cancer (IARC) and the U.S. Environmental Protection Agency (USEPA). Given the large number of chemicals that are carcinogens or reproductive/developmental toxicants, regulatory concerns should focus on those that have high potential for human exposure, e.g., widely distributed or easily absorbed solvents, metals, environmental mixtures, or reactive agents. In this paper, we present a list of 33 potential priority carcinogens and reproductive/developmental toxicants, including alcoholic beverages, asbestos, benzene, chlorinated solvents, formaldehyde, glycol ethers, lead, tobacco smoke, and toluene.

  13. Brief report: Poor self-regulation as a predictor of individual differences in adaptive functioning in young children with autism spectrum disorder.

    PubMed

    Uljarević, Mirko; Hedley, Darren; Nevill, Rose; Evans, David W; Cai, Ru Ying; Butter, Eric; Mulick, James A

    2018-04-06

    The present study examined the link between poor self-regulation (measured by the child behavior checklist dysregulated profile [DP]) and core autism symptoms, as well as with developmental level, in a sample of 107 children with autism spectrum disorder (ASD) aged 19-46 months. We further examined the utility of DP in predicting individual differences in adaptive functioning, relative to the influence of ASD severity, chronological age (CA), and developmental level. Poor self-regulation was unrelated to CA, developmental level, and severity of ADOS-2 restricted and repetitive behaviors, but was associated with lower ADOS-2 social affect severity. Hierarchical regression identified poor self-regulation as a unique independent predictor of adaptive behavior, with more severe dysregulation predicting poorer adaptive functioning. Results highlight the importance of early identification of deficits in self-regulation, and more specifically, of the utility of DP, when designing individually tailored treatments for young children with ASD. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. This study explored the relationship between poor self-regulation and age, verbal and non-verbal developmental level, severity of autism symptoms and adaptive functioning in 107 children with autism under 4 years of age. Poor self-regulation was unrelated to age, developmental level, and severity of restricted and repetitive behaviors but was associated with lower social affect severity. Importantly, more severe self-regulation deficits predicted poorer adaptive functioning. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.

  14. Profiles of disruptive behavior across early childhood: Contributions of frustration reactivity, physiological regulation, and maternal behavior

    PubMed Central

    Degnan, Kathryn A.; Calkins, Susan D.; Keane, Susan P.; Hill-Soderlund, Ashley L.

    2010-01-01

    Disruptive behavior, including aggression, defiance, and temper tantrums, typically peaks in early toddlerhood and decreases by school entry; however, some children do not show this normative decline. The current study examined disruptive behavior in 318 boys and girls at 2, 4, and 5 years of age and frustration reactivity, physiological regulation, and maternal behavior in the laboratory at 2 years of age. A latent profile analysis (LPA) resulted in 4 longitudinal profiles of disruptive behavior, which were differentiated by interactions between reactivity, regulation, and maternal behavior. A high profile was associated with high reactivity combined with high maternal control or low regulation combined with low maternal control. Results are discussed from a developmental psychopathology perspective. PMID:18826530

  15. Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma

    PubMed Central

    Gilmore, Sarah A.; Voorhies, Mark; Gebhart, Dana; Sil, Anita

    2015-01-01

    Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5’ leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature. PMID:26177267

  16. Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma.

    PubMed

    Gilmore, Sarah A; Voorhies, Mark; Gebhart, Dana; Sil, Anita

    2015-07-01

    Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5' leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature.

  17. The Development of Emotional and Behavioral Self-Regulation and Their Effects on Academic Achievement in Childhood

    ERIC Educational Resources Information Center

    Edossa, Ashenafi Kassahun; Schroeders, Ulrich; Weinert, Sabine; Artelt, Cordula

    2018-01-01

    Self-regulation is an essential ability of children to cope with various developmental challenges. This study examines the developmental interplay between emotional and behavioral self-regulation during childhood and the relationship with academic achievement using data from the longitudinal Millennium Cohort Study (UK). Using cross-lagged panel…

  18. Developmental Origins of Infant Emotion Regulation: Mediation by Temperamental Negativity and Moderation by Maternal Sensitivity

    ERIC Educational Resources Information Center

    Thomas, Jenna C.; Letourneau, Nicole; Campbell, Tavis S.; Tomfohr-Madsen, Lianne; Giesbrecht, Gerald F.

    2017-01-01

    Emotion regulation is essential to cognitive, social, and emotional development and difficulties with emotion regulation portend future socioemotional, academic, and behavioral difficulties. There is growing awareness that many developmental outcomes previously thought to begin their development in the postnatal period have their origins in the…

  19. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  20. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  1. Conservation in the involvement of heterochronic genes and hormones during developmental transitions.

    PubMed

    Faunes, Fernando; Larraín, Juan

    2016-08-01

    Developmental transitions include molting in some invertebrates and the metamorphosis of insects and amphibians. While the study of Caenorhabditis elegans larval transitions was crucial to determine the genetic control of these transitions, Drosophila melanogaster and Xenopus laevis have been classic models to study the role of hormones in metamorphosis. Here we review how heterochronic genes (lin-4, let-7, lin-28, lin-41), hormones (dafachronic acid, ecdysone, thyroid hormone) and the environment regulate developmental transitions. Recent evidence suggests that some heterochronic genes also regulate transitions in higher organisms that they are controlled by hormones involved in metamorphosis. We also discuss evidence demonstrating that heterochronic genes and hormones regulate the proliferation and differentiation of embryonic and neural stem cells. We propose the hypothesis that developmental transitions are regulated by an evolutionary conserved mechanism in which heterochronic genes and hormones interact to control stem/progenitor cells proliferation, cell cycle exit, quiescence and differentiation and determine the proper timing of developmental transitions. Finally, we discuss the relevance of these studies to understand post-embryonic development, puberty and regeneration in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Transcriptomic and functional analyses unveil the role of long non-coding RNAs in anthocyanin biosynthesis during sea buckthorn fruit ripening.

    PubMed

    Zhang, Guoyun; Chen, Daoguo; Zhang, Tong; Duan, Aiguo; Zhang, Jianguo; He, Caiyun

    2018-06-04

    Fruit ripening is a developmental process regulated by a complex network of endogenous and exogenous cues. Sea buckthorn is an excellent material for fruit ripening studies due to its dramatic ripening process and high contents of nutritional and anti-oxidant compounds in berries. Here, the whole transcriptome of sea buckthorn fruit at three development stages were analysed using multiple high-throughput sequencings. We assembled and annotated 9,008 long non-coding RNAs (lncRNAs) in sea buckthorn fruits, and identified 118 differentially expressed lncRNAs (DE-lncRNAs) and 32 differentially expressed microRNAs in fruit developmental process. In addition, we predicted 1,061 cis-regulated and 782 trans-regulated targets of DE-lncRNAs, and these DE-lncRNAs are specifically enriched in the biosynthesis of ascorbic acid, carotenoids and flavonoids. Moreover, the silencing of two lncRNAs (LNC1 and LNC2) in vivo and expression analysis revealed that LNC1 and LNC2 can act as endogenous target mimics of miR156a and miR828a to reduce SPL9 and induce MYB114 expression, respectively, which lead to increased and decreased anthocyanin content as revealed by high-performance liquid chromatography analysis. Our results present the first global functional analysis of lncRNA in sea buckthorn and provide two essential regulators of anthocyanin biosynthesis, which provides new insights into the regulation of fruit quality.

  3. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    PubMed

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  4. The Emotional Foundations of High Moral Intelligence

    ERIC Educational Resources Information Center

    Narvaez, Darcia

    2010-01-01

    Moral intelligence is grounded in emotion and reason. Neuroscientific and clinical research illustrate how early life co-regulation with caregivers influences emotion, cognition, and moral character. Triune ethics theory (Narvaez, 2008) integrates neuroscientific, evolutionary, and developmental findings to explain differences in moral…

  5. Self-Regulation and Math Attitudes: Effects on Academic Performance in Developmental Math Courses at a Community College

    ERIC Educational Resources Information Center

    Otts, Cynthia D.

    2010-01-01

    The purpose of the study was to investigate the relationship among math attitudes, self-regulated learning, and course outcomes in developmental math. Math attitudes involved perceived usefulness of math and math anxiety. Self-regulated learning represented the ability of students to control cognitive, metacognitive, and behavioral aspects of…

  6. Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

    ERIC Educational Resources Information Center

    de Oliveira, Rita F.; Wann, John P.

    2011-01-01

    In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

  7. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    PubMed

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

    2015-08-01

    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  8. Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

    PubMed

    Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

    2015-04-13

    Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

  9. Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

    PubMed

    Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

    2016-02-01

    Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life interventions may be a practical approach to promote physical activity in man.

  10. The development of self-regulation across early childhood.

    PubMed

    Montroy, Janelle J; Bowles, Ryan P; Skibbe, Lori E; McClelland, Megan M; Morrison, Frederick J

    2016-11-01

    The development of early childhood self-regulation is often considered an early life marker for later life successes. Yet little longitudinal research has evaluated whether there are different trajectories of self-regulation development across children. This study investigates the development of behavioral self-regulation between the ages of 3 and 7 years, with a direct focus on possible heterogeneity in the developmental trajectories, and a set of potential indicators that distinguish unique behavioral self-regulation trajectories. Across 3 diverse samples, 1,386 children were assessed on behavioral self-regulation from preschool through first grade. Results indicated that majority of children develop self-regulation rapidly during early childhood, and that children follow 3 distinct developmental patterns of growth. These 3 trajectories were distinguishable based on timing of rapid gains, as well as child gender, early language skills, and maternal education levels. Findings highlight early developmental differences in how self-regulation unfolds, with implications for offering individualized support across children. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  11. Multi-scale computational modeling of developmental biology.

    PubMed

    Setty, Yaki

    2012-08-01

    Normal development of multicellular organisms is regulated by a highly complex process in which a set of precursor cells proliferate, differentiate and move, forming over time a functioning tissue. To handle their complexity, developmental systems can be studied over distinct scales. The dynamics of each scale is determined by the collective activity of entities at the scale below it. I describe a multi-scale computational approach for modeling developmental systems and detail the methodology through a synthetic example of a developmental system that retains key features of real developmental systems. I discuss the simulation of the system as it emerges from cross-scale and intra-scale interactions and describe how an in silico study can be carried out by modifying these interactions in a way that mimics in vivo experiments. I highlight biological features of the results through a comparison with findings in Caenorhabditis elegans germline development and finally discuss about the applications of the approach in real developmental systems and propose future extensions. The source code of the model of the synthetic developmental system can be found in www.wisdom.weizmann.ac.il/~yaki/MultiScaleModel. yaki.setty@gmail.com Supplementary data are available at Bioinformatics online.

  12. Sporulation in Bacteria: Beyond the Standard Model.

    PubMed

    Hutchison, Elizabeth A; Miller, David A; Angert, Esther R

    2014-10-01

    Endospore formation follows a complex, highly regulated developmental pathway that occurs in a broad range of Firmicutes. Although Bacillus subtilis has served as a powerful model system to study the morphological, biochemical, and genetic determinants of sporulation, fundamental aspects of the program remain mysterious for other genera. For example, it is entirely unknown how most lineages within the Firmicutes regulate entry into sporulation. Additionally, little is known about how the sporulation pathway has evolved novel spore forms and reproductive schemes. Here, we describe endospore and internal offspring development in diverse Firmicutes and outline progress in characterizing these programs. Moreover, comparative genomics studies are identifying highly conserved sporulation genes, and predictions of sporulation potential in new isolates and uncultured bacteria can be made from these data. One surprising outcome of these comparative studies is that core regulatory and some structural aspects of the program appear to be universally conserved. This suggests that a robust and sophisticated developmental framework was already in place in the last common ancestor of all extant Firmicutes that produce internal offspring or endospores. The study of sporulation in model systems beyond B. subtilis will continue to provide key information on the flexibility of the program and provide insights into how changes in this developmental course may confer advantages to cells in diverse environments.

  13. Drosophila Protein Kinase CK2: Genetics, Regulatory Complexity and Emerging Roles during Development

    PubMed Central

    Bandyopadhyay, Mohna; Arbet, Scott; Bishop, Clifton P.; Bidwai, Ashok P.

    2016-01-01

    CK2 is a Ser/Thr protein kinase that is highly conserved amongst all eukaryotes. It is a well-known oncogenic kinase that regulates vital cell autonomous functions and animal development. Genetic studies in the fruit fly Drosophila are providing unique insights into the roles of CK2 in cell signaling, embryogenesis, organogenesis, neurogenesis, and the circadian clock, and are revealing hitherto unknown complexities in CK2 functions and regulation. Here, we review Drosophila CK2 with respect to its structure, subunit diversity, potential mechanisms of regulation, developmental abnormalities linked to mutations in the gene encoding CK2 subunits, and emerging roles in multiple aspects of eye development. We examine the Drosophila CK2 “interaction map” and the eye-specific “transcriptome” databases, which raise the prospect that this protein kinase has many additional targets in the developing eye. We discuss the possibility that CK2 functions during early retinal neurogenesis in Drosophila and mammals bear greater similarity than has been recognized, and that this conservation may extend to other developmental programs. Together, these studies underscore the immense power of the Drosophila model organism to provide new insights and avenues to further investigate developmentally relevant targets of this protein kinase. PMID:28036067

  14. Nitric Oxide Regulates Protein Methylation during Stress Responses in Plants.

    PubMed

    Hu, Jiliang; Yang, Huanjie; Mu, Jinye; Lu, Tiancong; Peng, Juli; Deng, Xian; Kong, Zhaosheng; Bao, Shilai; Cao, Xiaofeng; Zuo, Jianru

    2017-08-17

    Methylation and nitric oxide (NO)-based S-nitrosylation are highly conserved protein posttranslational modifications that regulate diverse biological processes. In higher eukaryotes, PRMT5 catalyzes Arg symmetric dimethylation, including key components of the spliceosome. The Arabidopsis prmt5 mutant shows severe developmental defects and impaired stress responses. However, little is known about the mechanisms regulating the PRMT5 activity. Here, we report that NO positively regulates the PRMT5 activity through S-nitrosylation at Cys-125 during stress responses. In prmt5-1 plants, a PRMT5 C125S transgene, carrying a non-nitrosylatable mutation at Cys-125, fully rescues the developmental defects, but not the stress hypersensitive phenotype and the responsiveness to NO during stress responses. Moreover, the salt-induced Arg symmetric dimethylation is abolished in PRMT5 C125S /prmt5-1 plants, correlated to aberrant splicing of pre-mRNA derived from a stress-related gene. These findings define a mechanism by which plants transduce stress-triggered NO signal to protein methylation machinery through S-nitrosylation of PRMT5 in response to environmental alterations. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. 45 CFR 1385.1 - General.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES... the Rights of Individuals with Developmental Disabilities; (c)Projects of National Significance;and (d...

  16. A-to-I RNA editing promotes developmental stage–specific gene and lncRNA expression

    PubMed Central

    Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T.

    2017-01-01

    A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3′ UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. PMID:28031250

  17. Developmental effects on ureide levels are mediated by tissue-specific regulation of allantoinase in Phaseolus vulgaris L.

    PubMed

    Díaz-Leal, Juan Luis; Gálvez-Valdivieso, Gregorio; Fernández, Javier; Pineda, Manuel; Alamillo, Josefa M

    2012-06-01

    The ureides allantoin and allantoate are key molecules in the transport and storage of nitrogen in ureide legumes. In shoots and leaves from Phaseolus vulgaris plants using symbiotically fixed nitrogen as the sole nitrogen source, ureide levels were roughly equivalent to those of nitrate-supported plants during the whole vegetative stage, but they exhibited a sudden increase at the onset of flowering. This rise in the level of ureides, mainly in the form of allantoate, was accompanied by increases in allantoinase gene expression and enzyme activity, consistent with developmental regulation of ureide levels mainly through the tissue-specific induction of allantoate synthesis catalysed by allantoinase. Moreover, surprisingly high levels of ureides were also found in non-nodulated plants fertilized with nitrate, at both early and late developmental stages. The results suggest that remobilized N from lower leaves is probably involved in the sharp rise in ureides in shoots and leaves during early pod filling in N(2)-fixing plants and in the significant amounts of ureides observed in non-nodulated plants.

  18. Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

    PubMed Central

    Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

    2000-01-01

    Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

  19. Tissue-specific regulation of BMP signaling by Drosophila N-glycanase 1.

    PubMed

    Galeone, Antonio; Han, Seung Yeop; Huang, Chengcheng; Hosomi, Akira; Suzuki, Tadashi; Jafar-Nejad, Hamed

    2017-08-04

    Mutations in the human N- glycanase 1 ( NGLY1 ) cause a rare, multisystem congenital disorder with global developmental delay. However, the mechanisms by which NGLY1 and its homologs regulate embryonic development are not known. Here we show that Drosophila Pngl encodes an N -glycanase and exhibits a high degree of functional conservation with human NGLY1. Loss of Pngl results in developmental midgut defects reminiscent of midgut-specific loss of BMP signaling. Pngl mutant larvae also exhibit a severe midgut clearance defect, which cannot be fully explained by impaired BMP signaling. Genetic experiments indicate that Pngl is primarily required in the mesoderm during Drosophila development. Loss of Pngl results in a severe decrease in the level of Dpp homodimers and abolishes BMP autoregulation in the visceral mesoderm mediated by Dpp and Tkv homodimers. Thus, our studies uncover a novel mechanism for the tissue-specific regulation of an evolutionarily conserved signaling pathway by an N -glycanase enzyme.

  20. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    PubMed Central

    2012-01-01

    Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p < E-76) in the set of genes positively regulated by the liver transcription factor HNF4α, as determined in a liver-specific HNF4α knockout mouse model, while genes down regulated during this developmental period showed significant enrichment (p < E-65) for negative regulation by HNF4α. Significant enrichment of the developmentally regulated genes in the set of genes subject to positive and negative regulation by pituitary hormone was also observed. Five sex-specific transcriptional regulators showed sex-specific expression at 4 wk (male-specific Ihh; female-specific Cdx4, Cux2, Tox, and Trim24) and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver. PMID:22475005

  1. 45 CFR 1386.80 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL... Developmental Disabilities Assistance and Bill of Rights Act. This term includes Federal funds provided under...

  2. Somatoform Pain: A developmental theory and translational research review

    PubMed Central

    Landa, Alla; Peterson, Bradley S.; Fallon, Brian A.

    2013-01-01

    Somatoform pain is a highly prevalent, debilitating condition and a tremendous public health problem. Effective treatments for somatoform pain are urgently needed. The etiology of this condition is, however, still unknown. On the basis of a review of recent basic and clinical research, we propose one potential mechanisms of symptom formation in somatoform pain and a developmental theory of its pathogenesis. The emerging evidence from animal and human studies in developmental neurobiology, cognitive-affective neuroscience, psychoneuroimmunology, genetics, epigenetics, and clinical and treatment studies of somatoform pain all point to the existence of a shared physical and social pain neural system. Research findings also show that non-optimal early experiences interact with genetic predispositions to influence the development of this shared system and ability to regulate it in an effective way. Interpersonal affect regulation between infant and caregiver is crucial for the optimal development of these brain circuits. The aberrant development of this shared neural system during infancy, childhood and adolescence, therefore, may ultimately lead to an increased sensitivity to physical and social pain and to problems with their regulation in adulthood. The authors critically review translational research findings that support this theory and discuss its clinical and research implications. Specifically, the proposed theory and reviewed research suggest that psychotherapeutic and/or pharmacologic interventions that foster the development of affect regulation capacities in an interpersonal context will also serve to more effectively modulate aberrantly activated neural pain circuits and thus be of particular benefit in the treatment of somatoform pain. PMID:22929064

  3. Self-Regulated Strategy Instruction in College Developmental Writing

    ERIC Educational Resources Information Center

    MacArthur, Charles A.; Philippakos, Zoi A.; Ianetta, Melissa

    2015-01-01

    The purpose of this study was to evaluate the effects of a curriculum for college developmental writing classes, developed in prior design research and based on self-regulated strategy instruction. Students learned strategies for planning, drafting, and revising compositions with an emphasis on using knowledge of genre organization to guide…

  4. GLUCOCORTICOID RECEPTOR REGULATION IN THE RAT EMBRYO: A POTENTIAL SITE FOR DEVELOPMENTAL TOXICITY?

    EPA Science Inventory

    Glucocorticoid receptor regulation in the rat embryo: a potential site for developmental toxicity?

    Ghosh B, Wood CR, Held GA, Abbott BD, Lau C.

    National Research Council, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina 27711, USA.

  5. Assessment of Reproductive and Developmental Toxicity of Mixtures of Regulated Drinking Water Chlorination By-Products in a Multigenerational Rat Bioassay

    EPA Science Inventory

    Epidemiological and animal toxicity studies have raised concerns regarding possible adverse reproductive and developmental effects of disinfection by-products (DBPs) in drinking water. To address these concerns, we provided mixtures of the regulated trihalomethanes (THMs; chlorof...

  6. Developmental mechanisms regulating secondary growth in woody plants

    Treesearch

    Andrew Groover; Marcel Robischon

    2006-01-01

    Secondary growth results in the radial expansion of woody stems, and requires the coordination of tissue patterning, cell differentiation, and the maintenance of meristematic stem cells within the vascular cambium. Advances are being made towards describing molecular mechanisms that regulate these developmental processes, thanks in part to the application of new...

  7. Developmental College Student Self-Regulation: Results from Two Measures

    ERIC Educational Resources Information Center

    Young, Dawn; Ley, Kathryn

    2005-01-01

    This study compared 34 lower-achieving (developmental) first-time college students' self-reported self-regulation strategies from a Likert scale to those they reported in structured interviews. Likert scales have offered convenient administration and evaluation and have been used to identify what and how learners study. The reported study activity…

  8. The Developmental Regulator SEEDSTICK Controls Structural and Mechanical Properties of the Arabidopsis Seed Coat

    PubMed Central

    Beauzamy, Léna; Caporali, Elisabetta; Koroney, Abdoul-Salam

    2016-01-01

    Although many transcription factors involved in cell wall morphogenesis have been identified and studied, it is still unknown how genetic and molecular regulation of cell wall biosynthesis is integrated into developmental programs. We demonstrate by molecular genetic studies that SEEDSTICK (STK), a transcription factor controlling ovule and seed integument identity, directly regulates PMEI6 and other genes involved in the biogenesis of the cellulose-pectin matrix of the cell wall. Based on atomic force microscopy, immunocytochemistry, and chemical analyses, we propose that structural modifications of the cell wall matrix in the stk mutant contribute to defects in mucilage release and seed germination under water-stress conditions. Our studies reveal a molecular network controlled by STK that regulates cell wall properties of the seed coat, demonstrating that developmental regulators controlling organ identity also coordinate specific aspects of cell wall characteristics. PMID:27624758

  9. The History of Legislation and Regulations Related to Children with Developmental Disabilities: Implications for School Nursing Practice Today

    ERIC Educational Resources Information Center

    Dang, Michelle T.

    2010-01-01

    A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…

  10. MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells

    PubMed Central

    Riepsaame, Joey; van Oudenaren, Adri; den Broeder, Berlinda J. H.; van IJcken, Wilfred F. J.; Pothof, Joris; Leenen, Pieter J. M.

    2013-01-01

    Dendritic cell (DC) maturation is a tightly regulated process that requires coordinated and timed developmental cues. Here we investigate whether microRNAs are involved in this process. We identify microRNAs in mouse GM-CSF-generated, monocyte-related DC (GM-DC) that are differentially expressed during both spontaneous and LPS-induced maturation and characterize M-CSF receptor (M-CSFR), encoded by the Csf1r gene, as a key target for microRNA-mediated regulation in the final step toward mature DC. MicroRNA-22, -34a, and -155 are up-regulated in mature MHCIIhi CD86hi DC and mediate Csf1r mRNA and protein down-regulation. Experimental inhibition of Csf1r-targeting microRNAs in vitro results not only in sustained high level M-CSFR protein expression but also in impaired DC maturation upon stimulation by LPS. Accordingly, over-expression of Csf1r in GM-DC inhibits terminal differentiation. Taken together, these results show that developmentally regulated microRNAs control Csf1r expression, supplementing previously identified mechanisms that regulate its transcription and protein surface expression. Furthermore, our data indicate a novel function for Csf1r in mouse monocyte-derived DC, showing that down-regulation of M-CSFR expression is essential for final DC maturation. PMID:24198819

  11. Oxidative Stress, Unfolded Protein Response, and Apoptosis in Developmental Toxicity

    PubMed Central

    Kupsco, Allison; Schlenk, Daniel

    2016-01-01

    Physiological development requires precise spatiotemporal regulation of cellular and molecular processes. Disruption of these key events can generate developmental toxicity in the form of teratogenesis or mortality. The mechanism behind many developmental toxicants remains unknown. While recent work has focused on the unfolded protein response (UPR), oxidative stress, and apoptosis in the pathogenesis of disease, few studies have addressed their relationship in developmental toxicity. Redox regulation, UPR, and apoptosis are essential for physiological development and can be disturbed by a variety of endogenous and exogenous toxicants to generate lethality and diverse malformations. This review examines the current knowledge of the role of oxidative stress, UPR, and apoptosis in physiological development as well as in developmental toxicity, focusing on studies and advances in vertebrates model systems. PMID:26008783

  12. Neonatal isolation delays the developmental decline of long-term depression in the CA1 region of rat hippocampus.

    PubMed

    Ku, Hsiao-Yun; Huang, Yu-Fei; Chao, Pei-Hsuan; Huang, Chiung-Chun; Hsu, Kuei-Sen

    2008-11-01

    Activity-dependent alterations of synaptic efficacy or connectivity are essential for the development, signal processing, and learning and memory functions of the nervous system. It was observed that, in particular in the CA1 region of the hippocampus, low-frequency stimulation (LFS) became progressively less effective at inducing long-term depression (LTD) with advancing developmental age. The physiological factors regulating this developmental plasticity change, however, have not yet been elucidated. Here we examined the hypothesis that neonatal isolation (once per day for 1 h from postnatal days 1-7) is able to alter processes underlying the developmental decline of LTD. We confirm that the magnitude of LTD induced by LFS (900 stimuli at 1 Hz) protocol correlates negatively with developmental age and illustrates that neonatal isolation delays this developmental decline via the activation of corticotrophin-releasing factor (CRF) system. Furthermore, this modulation appears to be mediated by an increased transcription of N-methyl-D-aspartate receptor NR2B subunits. We also demonstrate that intracerebroventricular injection of CRF postnatally mimicked the effect of neonatal isolation to increase the expression of NR2B subunits and delayed the developmental decline of LTD, which was specifically blocked by CRF receptor 1 antagonist NBI27914 pretreatment. These results suggest a novel role for CRF in regulating developmental events in the hippocampus and indicate that although maternal deprivation is stressful for neonate, appropriate neonatal isolation can serve to promote an endocrine state that may regulate the gradual developmental change in the induction rules for synaptic plasticity in the hippocampal CA1 region.

  13. 45 CFR 1386.33 - Protection of employee's interests.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 1386.33 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Federal Assistance to State Developmental Disabilities...

  14. An epigenetic view of developmental diseases: new targets, new therapies.

    PubMed

    Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

    2016-08-01

    Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

  15. A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

    PubMed

    Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

    2013-11-06

    Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

  16. Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

    PubMed

    Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

    2015-12-22

    Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

  17. Emotion regulation: a theme in search of definition.

    PubMed

    Thompson, R A

    1994-01-01

    Contemporary interest in emotion regulation promises to advance important new views of emotional development as well as offering applications to developmental psychopathology, but these potential contributions are contingent on developmentalists' attention to some basic definitional issues. This essay offers a perspective on these issues by considering how emotion regulation should be defined, the various components of the management of emotion, how emotion regulation strategies fit into the dynamics of social interaction, and how individual differences in emotion regulation should be conceptualized and measured. In the end, it seems clear that emotion regulation is a conceptual rubric for a remarkable range of developmental processes, each of which may have its own catalysts and control processes. Likewise, individual differences in emotion regulation skills likely have multifaceted origins and are also related in complex ways to the person's emotional goals and the immediate demands of the situation. Assessment approaches that focus on the dynamics of emotion are well suited to elucidating these complex developmental and individual differences. In sum, a challenging research agenda awaits those who enter this promising field of study.

  18. Polyphenolic responses of grapevine berries to light, temperature, oxidative stress, abscisic acid and jasmonic acid show specific developmental-dependent degrees of metabolic resilience to perturbation.

    PubMed

    Degu, Asfaw; Ayenew, Biruk; Cramer, Grant R; Fait, Aaron

    2016-12-01

    Grape-berries are exposed to a plethora of abiotic and biotic stimuli during their development. The developmental and temporal regulation of grape berry polyphenol metabolism in response to various cues was investigated using LC-QTOF-MS based metabolite profiling. High light (2500μmolm(-2)s(-1)), high temperature (40°C), jasmonic acid (200μM), menadione (120μM) and abscisic acid (3.026mM) treatments were applied to detached berries. Greater magnitudes of metabolite fluctuations characterize the pre-veraison berries than the veraison stage in response to the treatments. Furthermore, a tighter co-response of metabolic processes was shown at veraison, likely supporting the resilience to change in response to stress. High temperature and ABA treatments led to greater magnitudes of change during the course of the experiment. The present study demonstrates the occurrence of differential patterns of metabolic responses specific to individual cues and berry developmental stage, which in the field are commonly associated and thus hardly discernable. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Development of Civic Engagement: Theoretical and Methodological Issues

    ERIC Educational Resources Information Center

    Lerner, Richard M.; Wang, Jun; Champine, Robey B.; Warren, Daniel J. A.; Erickson, Karl

    2014-01-01

    Within contemporary developmental science, models derived from relational developmental systems (RDS) metatheory emphasize that the basic process of human development involves mutually-influential relations, termed developmental regulations, between the developing individual and his or her complex and changing physical, social, and cultural…

  20. Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)

    EPA Science Inventory

    Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...

  1. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  2. A-to-I RNA editing promotes developmental stage-specific gene and lncRNA expression.

    PubMed

    Goldstein, Boaz; Agranat-Tamir, Lily; Light, Dean; Ben-Naim Zgayer, Orna; Fishman, Alla; Lamm, Ayelet T

    2017-03-01

    A-to-I RNA editing is a conserved widespread phenomenon in which adenosine (A) is converted to inosine (I) by adenosine deaminases (ADARs) in double-stranded RNA regions, mainly noncoding. Mutations in ADAR enzymes in Caenorhabditis elegans cause defects in normal development but are not lethal as in human and mouse. Previous studies in C. elegans indicated competition between RNA interference (RNAi) and RNA editing mechanisms, based on the observation that worms that lack both mechanisms do not exhibit defects, in contrast to the developmental defects observed when only RNA editing is absent. To study the effects of RNA editing on gene expression and function, we established a novel screen that enabled us to identify thousands of RNA editing sites in nonrepetitive regions in the genome. These include dozens of genes that are edited at their 3' UTR region. We found that these genes are mainly germline and neuronal genes, and that they are down-regulated in the absence of ADAR enzymes. Moreover, we discovered that almost half of these genes are edited in a developmental-specific manner, indicating that RNA editing is a highly regulated process. We found that many pseudogenes and other lncRNAs are also extensively down-regulated in the absence of ADARs in the embryo but not in the fourth larval (L4) stage. This down-regulation is not observed upon additional knockout of RNAi. Furthermore, levels of siRNAs aligned to pseudogenes in ADAR mutants are enhanced. Taken together, our results suggest a role for RNA editing in normal growth and development by regulating silencing via RNAi. © 2017 Goldstein et al.; Published by Cold Spring Harbor Laboratory Press.

  3. 29 CFR 1952.384 - Completed developmental steps.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Completed developmental steps. 1952.384 Section 1952.384 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION....384 Completed developmental steps. (a) In accordance with the requirements of § 1952.10, Puerto Rico's...

  4. 29 CFR 1902.33 - Developmental period.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

  5. 29 CFR 1902.33 - Developmental period.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

  6. MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

    PubMed

    Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

    2010-03-01

    Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

  7. Identification of chemicals inducing cardiomyocyte proliferation in developmental stage-specific manner with pluripotent stem cells.

    PubMed

    Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A; Engel, Felix B; Yamashita, Jun K

    2013-12-01

    The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provides therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells. The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse pluripotent stem cell-derived cardiomyocytes and identified 4 chemical compound groups: inhibitors of glycogen synthase kinase-3, p38 mitogen-activated protein kinase, and Ca(2+)/calmodulin-dependent protein kinase II, and activators of extracellular signal-regulated kinase. Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human pluripotent stem cells, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas extracellular signal-regulated kinase activators and Ca(2+)/calmodulin-dependent protein kinase II inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, glycogen synthase kinase-3 and p38 mitogen-activated protein kinase inhibitors substantially and synergistically induced re-entry and progression of cell cycle in neonatal but also as well as adult cardiomyocytes. Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered pluripotent stem cell-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies.

  8. The ULTRAPETALA1 trxG factor contributes to patterning the Arabidopsis adaxial-abaxial leaf polarity axis

    USDA-ARS?s Scientific Manuscript database

    The SAND domain protein ULTRAPETALA1 (ULT1) functions as a trithorax group factor that regulates a variety of developmental processes in Arabidopsis. We have recently shown that ULT1 regulates developmental patterning in the gynoecia and leaves. ULT1 acts together with the KANADI1 (KAN1) transcripti...

  9. Using Formative Assessment and Self-Regulated Learning to Help Developmental Mathematics Students Achieve: A Multi-Campus Program

    ERIC Educational Resources Information Center

    Hudesman, John; Crosby, Sara; Ziehmke, Niesha; Everson, Howard; Issac, Sharlene; Flugman, Bert; Zimmerman, Barry; Moylan, Adam

    2014-01-01

    The authors describe an Enhanced Formative Assessment and Self-Regulated Learning (EFA-SRL) program designed to improve the achievement of community college students enrolled in developmental mathematics courses. Their model includes the use of specially formatted quizzes designed to assess both the students' mathematics and metacognitive skill…

  10. Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

    ERIC Educational Resources Information Center

    Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

    2016-01-01

    The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

  11. The Effects of Self-Regulated Learning Training on Community College Students' Metacognition and Achievement in Developmental Math Courses

    ERIC Educational Resources Information Center

    Bol, Linda; Campbell, Karen D. Y.; Perez, Tony; Yen, Cherng-Jyh

    2016-01-01

    The effects of training in self-regulation on metacognition and math achievement were investigated. The participants were 116 community college students enrolled in developmental math courses. Students enrolled in 16 classrooms were randomly assigned to the treatment and control groups. Participants in the treatment group completed four…

  12. SNAT2 and LAT1 transporter abundance is developmentally regulated in skeletal muscle of neonatal pigs

    USDA-ARS?s Scientific Manuscript database

    Previously, we demonstrated that the insulin and amino acid–induced activation of the mammalian target of rapamycin complex 1 (mTORC1), is developmentally regulated in neonatal pigs. Recent studies have indicated an important role of the System A transporters (SNAT2 and SLC1A5) and the L transporter...

  13. Conscientiousness: Origins in Childhood?

    PubMed Central

    Eisenberg, Nancy; Duckworth, Angela L.; Spinrad, Tracy L.; Valiente, Carlos

    2012-01-01

    In this review, we evaluate developmental and personality research with the aim of determining if the personality trait of conscientiousness can be identified in children and adolescents. After concluding that conscientiousness does emerge in childhood, we discuss the developmental origins of conscientiousness with a specific focus on self-regulation, academic motivation, and internalized compliance/internalization of standards. Based on the accumulated body of evidence, we conclude that self-regulation fosters conscientiousness later in life, both directly and via academic motivation and internalized compliance with norms. We argue that elements of conscientiousness are evident by early childhood, self-regulation skills are likely a core developmental component of conscientiousness, and despite the contribution of heredity to the aforementioned aspects of functioning, environmental factors likely contribute to conscientiousness. PMID:23244405

  14. Endothelium-derived fibronectin regulates neonatal vascular morphogenesis in an autocrine fashion.

    PubMed

    Turner, Christopher J; Badu-Nkansah, Kwabena; Hynes, Richard O

    2017-11-01

    Fibronectin containing alternatively spliced EIIIA and EIIIB domains is largely absent from mature quiescent vessels in adults, but is highly expressed around blood vessels during developmental and pathological angiogenesis. The precise functions of fibronectin and its splice variants during developmental angiogenesis however remain unclear due to the presence of cardiac, somitic, mesodermal and neural defects in existing global fibronectin KO mouse models. Using a rare family of surviving EIIIA EIIIB double KO mice, as well as inducible endothelial-specific fibronectin-deficient mutant mice, we show that vascular development in the neonatal retina is regulated in an autocrine manner by endothelium-derived fibronectin, and requires both EIIIA and EIIIB domains and the RGD-binding α5 and αv integrins for its function. Exogenous sources of fibronectin do not fully substitute for the autocrine function of endothelial fibronectin, demonstrating that fibronectins from different sources contribute differentially to specific aspects of angiogenesis.

  15. Caste development and reproduction: a genome-wide analysis of hallmarks of insect eusociality

    PubMed Central

    Cristino, A S; Nunes, F M F; Lobo, C H; Bitondi, M M G; Simões, Z L P; Da Fontoura Costa, L; Lattorff, H M G; Moritz, R F A; Evans, J D; Hartfelder, K

    2006-01-01

    The honey bee queen and worker castes are a model system for developmental plasticity. We used established expressed sequence tag information for a Gene Ontology based annotation of genes that are differentially expressed during caste development. Metabolic regulation emerged as a major theme, with a caste-specific difference in the expression of oxidoreductases vs. hydrolases. Motif searches in upstream regions revealed group-specific motifs, providing an entry point to cis-regulatory network studies on caste genes. For genes putatively involved in reproduction, meiosis-associated factors came out as highly conserved, whereas some determinants of embryonic axes either do not have clear orthologs (bag of marbles, gurken, torso), or appear to be lacking (trunk) in the bee genome. Our results are the outcome of a first genome-based initiative to provide an annotated framework for trends in gene regulation during female caste differentiation (representing developmental plasticity) and reproduction. PMID:17069641

  16. Single-fiber myosin heavy chain polymorphism during postnatal development: modulation by hypothyroidism

    NASA Technical Reports Server (NTRS)

    di Maso, N. A.; Caiozzo, V. J.; Baldwin, K. M.

    2000-01-01

    The primary objective of this study was to follow the developmental time course of myosin heavy chain (MHC) isoform transitions in single fibers of the rodent plantaris muscle. Hypothyroidism was used in conjunction with single-fiber analyses to better describe a possible linkage between the neonatal and fast type IIB MHC isoforms during development. In contrast to the general concept that developmental MHC isoform transitions give rise to muscle fibers that express only a single MHC isoform, the single-fiber analyses revealed a very high degree of MHC polymorphism throughout postnatal development. In the adult state, MHC polymorphism was so pervasive that the rodent plantaris muscles contained approximately 12-15 different pools of fibers (i.e., fiber types). The degree of polymorphism observed at the single-fiber level made it difficult to determine specific developmental schemes analogous to those observed previously for the rodent soleus muscle. However, hypothyroidism was useful in that it confirmed a possible link between the developmental regulation of the neonatal and fast type IIB MHC isoforms.

  17. Identification of a NAC transcription factor, EPHEMERAL1, that controls petal senescence in Japanese morning glory.

    PubMed

    Shibuya, Kenichi; Shimizu, Keiichi; Niki, Tomoko; Ichimura, Kazuo

    2014-09-01

    In flowering plants, floral longevity is species-specific and is closely linked to reproductive strategy; petal senescence, a type of programmed cell death (PCD), is a highly regulated developmental process. However, little is known about regulatory pathways for cell death in petal senescence, which is developmentally controlled in an age-dependent manner. Here, we show that a NAC transcription factor, designated EPHEMERAL1 (EPH1), positively regulates PCD during petal senescence in the ephemeral flowers of Japanese morning glory (Ipomoea nil). EPH1 expression is induced independently of ethylene signaling, and suppression of EPH1 resulted in Japanese morning glory flowers that are in bloom until the second day. The suppressed expression of EPH1 delays progression of PCD, possibly through suppression of the expression of PCD-related genes, including genes for plant caspase and autophagy in the petals. Our data further suggest that EPH1 is involved in the regulation of ethylene-accelerated petal senescence. In this study, we identified a key regulator of PCD in petal senescence, which will facilitate further elucidation of the regulatory network of petal senescence. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  18. Dynamic and Widespread lncRNA Expression in a Sponge and the Origin of Animal Complexity

    PubMed Central

    Gaiti, Federico; Fernandez-Valverde, Selene L.; Nakanishi, Nagayasu; Calcino, Andrew D.; Yanai, Itai; Tanurdzic, Milos; Degnan, Bernard M.

    2015-01-01

    Long noncoding RNAs (lncRNAs) are important developmental regulators in bilaterian animals. A correlation has been claimed between the lncRNA repertoire expansion and morphological complexity in vertebrate evolution. However, this claim has not been tested by examining morphologically simple animals. Here, we undertake a systematic investigation of lncRNAs in the demosponge Amphimedon queenslandica, a morphologically simple, early-branching metazoan. We combine RNA-Seq data across multiple developmental stages of Amphimedon with a filtering pipeline to conservatively predict 2,935 lncRNAs. These include intronic overlapping lncRNAs, exonic antisense overlapping lncRNAs, long intergenic nonprotein coding RNAs, and precursors for small RNAs. Sponge lncRNAs are remarkably similar to their bilaterian counterparts in being relatively short with few exons and having low primary sequence conservation relative to protein-coding genes. As in bilaterians, a majority of sponge lncRNAs exhibit typical hallmarks of regulatory molecules, including high temporal specificity and dynamic developmental expression. Specific lncRNA expression profiles correlate tightly with conserved protein-coding genes likely involved in a range of developmental and physiological processes, such as the Wnt signaling pathway. Although the majority of Amphimedon lncRNAs appears to be taxonomically restricted with no identifiable orthologs, we find a few cases of conservation between demosponges in lncRNAs that are antisense to coding sequences. Based on the high similarity in the structure, organization, and dynamic expression of sponge lncRNAs to their bilaterian counterparts, we propose that these noncoding RNAs are an ancient feature of the metazoan genome. These results are consistent with lncRNAs regulating the development of animals, regardless of their level of morphological complexity. PMID:25976353

  19. Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

    PubMed Central

    Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

    2013-01-01

    MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

  20. Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

    PubMed Central

    Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

    2013-01-01

    During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939

  1. Cyber "Pokes": Motivational Antidote for Developmental College Readers

    ERIC Educational Resources Information Center

    Bowers-Campbell, Joy

    2008-01-01

    Difficulties characterizing developmental college students are reviewed within the context of motivational theories of learning. The author highlights problems of low self-efficacy and inadequate self-regulated learning for developmental college students. The author argues that the use of Facebook, a widely-used social networking technology, may…

  2. 48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

  3. 48 CFR 206.302-3 - Industrial mobilization, engineering, developmental, or research capability, or expert services.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false Industrial mobilization, engineering, developmental, or research capability, or expert services. 206.302-3 Section 206.302-3 Federal..., engineering, developmental, or research capability, or expert services. ...

  4. Goal Engagement during the School-Work Transition: Beneficial for All, Particularly for Girls

    ERIC Educational Resources Information Center

    Haase, Claudia M.; Heckhausen, Jutta; Koller, Olaf

    2008-01-01

    The school-to-work transition presents a substantial regulatory challenge for youth in modern societies. Based on the action-phase model of developmental regulation, we investigated the effects of goal engagement on transition outcomes in a high-density longitudinal study of noncollege-bound German adolescents (N = 362). Career-related goal…

  5. Identification of Parent-Child Interaction Characteristics of High and Low Achieving Elementary Students.

    ERIC Educational Resources Information Center

    Portes, Pedro R.; And Others

    The present study was designed to identify parent-child interaction patterns that might differentiate bright from below average elementary students in order to test the hypothesis that environmental processes related to regulation of executive processes influence both children's learning and developmental level. Thirty-two mother-child dyads (16…

  6. Executive Functions in Intellectual Disabilities: A Comparison between Williams Syndrome and Down Syndrome

    ERIC Educational Resources Information Center

    Costanzo, Floriana; Varuzza, Cristiana; Menghini, Deny; Addona, Francesca; Gianesini, Tiziana; Vicari, Stefano

    2013-01-01

    Executive functions are a set of high cognitive abilities that control and regulate other functions and behaviors and are crucial for successful adaptation. Deficits in executive functions are frequently described in developmental disorders, which are characterized by disadaptive behavior. However, executive functions are not widely examined in…

  7. Lysophosphatidic acid acts as a nutrient-derived developmental cue to regulate early hematopoiesis

    PubMed Central

    Li, Haisen; Yue, Rui; Wei, Bin; Gao, Ge; Du, Jiulin; Pei, Gang

    2014-01-01

    Primitive hematopoiesis occurs in the yolk sac blood islands during vertebrate embryogenesis, where abundant phosphatidylcholines (PC) are available as important nutrients for the developing embryo. However, whether these phospholipids also generate developmental cues to promote hematopoiesis is largely unknown. Here, we show that lysophosphatidic acid (LPA), a signaling molecule derived from PC, regulated hemangioblast formation and primitive hematopoiesis. Pharmacological and genetic blockage of LPA receptor 1 (LPAR1) or autotoxin (ATX), a secretory lysophospholipase that catalyzes LPA production, inhibited hematopoietic differentiation of mouse embryonic stem cells and impaired the formation of hemangioblasts. Mechanistic experiments revealed that the regulatory effect of ATX-LPA signaling was mediated by PI3K/Akt-Smad pathway. Furthermore, during in vivo embryogenesis in zebrafish, LPA functioned as a developmental cue for hemangioblast formation and primitive hematopoiesis. Taken together, we identified LPA as an important nutrient-derived developmental cue for primitive hematopoiesis as well as a novel mechanism of hemangioblast regulation. PMID:24829209

  8. Lysophosphatidic acid acts as a nutrient-derived developmental cue to regulate early hematopoiesis.

    PubMed

    Li, Haisen; Yue, Rui; Wei, Bin; Gao, Ge; Du, Jiulin; Pei, Gang

    2014-06-17

    Primitive hematopoiesis occurs in the yolk sac blood islands during vertebrate embryogenesis, where abundant phosphatidylcholines (PC) are available as important nutrients for the developing embryo. However, whether these phospholipids also generate developmental cues to promote hematopoiesis is largely unknown. Here, we show that lysophosphatidic acid (LPA), a signaling molecule derived from PC, regulated hemangioblast formation and primitive hematopoiesis. Pharmacological and genetic blockage of LPA receptor 1 (LPAR1) or autotoxin (ATX), a secretory lysophospholipase that catalyzes LPA production, inhibited hematopoietic differentiation of mouse embryonic stem cells and impaired the formation of hemangioblasts. Mechanistic experiments revealed that the regulatory effect of ATX-LPA signaling was mediated by PI3K/Akt-Smad pathway. Furthermore, during in vivo embryogenesis in zebrafish, LPA functioned as a developmental cue for hemangioblast formation and primitive hematopoiesis. Taken together, we identified LPA as an important nutrient-derived developmental cue for primitive hematopoiesis as well as a novel mechanism of hemangioblast regulation. © 2014 The Authors.

  9. De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism

    PubMed Central

    Tanaka, Akemi J.; Cho, Megan T.; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A.; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N.; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K.; Anderson, Ilse J.; Sacoto, Maria J. Guillen; Schnur, Rhonda E.; Chung, Wendy K.

    2017-01-01

    Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 (EBF3) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3. PMID:29162653

  10. Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

    PubMed Central

    Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

    2016-01-01

    Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

  11. 29 CFR 1956.62 - Completion of developmental steps and certification. [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Completion of developmental steps and certification. [Reserved] 1956.62 Section 1956.62 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND... EMPLOYEE PLANS New Jersey § 1956.62 Completion of developmental steps and certification. [Reserved] ...

  12. New Directions in Developmental Emotion Regulation Research across the Life Span: Introduction to the Special Section

    ERIC Educational Resources Information Center

    Zimmermann, Peter; Thompson, Ross A.

    2014-01-01

    Research on the development of emotion regulation has become a prominent topic in developmental science covering a broad age range from infancy to old age because of its theoretical importance and practical implications. This introductory essay of this special section includes reflections on some of the conceptual themes of this research field and…

  13. Abundance of amino acid transporters involved in mTORC1 activation in skeletal muscle of neonatal pigs is developmentally regulated

    USDA-ARS?s Scientific Manuscript database

    Previously we demonstrated that the insulinand amino acid-induced activation of the mammalian target of rapamycin complex 1 (mTORC1) is developmentally regulated in neonatal pigs. Recent studies have indicated that members of the System A transporter (SNAT2), the System N transporter (SNAT3), the Sy...

  14. Medicaid program; mental retardation--definition of "persons with related conditions"--Health Care Financing Administration. Proposed rule.

    PubMed

    1983-02-23

    We propose to amend the 1978 Medicaid regulations on intermediate care facility services for the mentally retarded and persons with related conditions to correct the definition of "persons with related conditions". This definition, because of an inadvertent error in 1978, is currently tied to the definition of developmental disability in the Developmental Disabilities Assistance and Bill of Rights Act (DDABRA) as amended in 1978. The DDABRA, as amended, covers the mentally ill. The 1978 regulations intended to make "no substantive change" to prior Medicaid regulations which did not cover the mentally ill. The cross-reference to the DDABRA produced the unintended result of incorporating into Medicaid regulations the revision to the definition of the developmentally disabled created by the 1978 amendments to the DDABRA and may tend to cause confusion about the kind of care that is covered by the Medicaid program. Therefore, a correction of this drafting error is necessary. To avoid results of this kind in the future this proposal would establish a Medicaid definition of conditions related to mental retardation that would meet specific needs of the Medicaid program and would be independent of the definition of developmental disability in the DDABRA.

  15. Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)

    USGS Publications Warehouse

    Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.

    2003-01-01

    Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance. 

  16. Developmental model of static allometry in holometabolous insects.

    PubMed

    Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W

    2008-08-22

    The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.

  17. The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

    PubMed Central

    2012-01-01

    Background MADS-box genes constitute a large family of transcription factors functioning as key regulators of many processes during plant vegetative and reproductive development. Type II MADS-box genes have been intensively investigated and are mostly involved in vegetative and flowering development. A growing number of studies of Type I MADS-box genes in Arabidopsis, have assigned crucial roles for these genes in gamete and seed development and have demonstrated that a number of Type I MADS-box genes are epigenetically regulated by DNA methylation and histone modifications. However, reports on agronomically important cereals such as barley and wheat are scarce. Results Here we report the identification and characterization of two Type I-like MADS-box genes, from barley (Hordeum vulgare), a monocot cereal crop of high agronomic importance. Protein sequence and phylogenetic analysis showed that the putative proteins are related to Type I MADS-box proteins, and classified them in a distinct cereal clade. Significant differences in gene expression among seed developmental stages and between barley cultivars with varying seed size were revealed for both genes. One of these genes was shown to be induced by the seed development- and stress-related hormones ABA and JA whereas in situ hybridizations localized the other gene to specific endosperm sub-compartments. The genomic organization of the latter has high conservation with the cereal Type I-like MADS-box homologues and the chromosomal position of both genes is close to markers associated with seed quality traits. DNA methylation differences are present in the upstream and downstream regulatory regions of the barley Type I-like MADS-box genes in two different developmental stages and in response to ABA treatment which may be associated with gene expression differences. Conclusions Two barley MADS-box genes were studied that are related to Type I MADS-box genes. Differential expression in different seed developmental stages as well as in barley cultivars with different seed size was evidenced for both genes. The two barley Type I MADS-box genes were found to be induced by ABA and JA. DNA methylation differences in different seed developmental stages and after exogenous application of ABA is suggestive of epigenetic regulation of gene expression. The study of barley Type I-like MADS-box genes extends our investigations of gene regulation during endosperm and seed development in a monocot crop like barley. PMID:22985436

  18. Development and regulation of chloride homeostasis in the central nervous system.

    PubMed

    Watanabe, Miho; Fukuda, Atsuo

    2015-01-01

    γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter of the mature central nervous system (CNS). The developmental switch of GABAergic transmission from excitation to inhibition is induced by changes in Cl(-) gradients, which are generated by cation-Cl(-) co-transporters. An accumulation of Cl(-) by the Na(+)-K(+)-2Cl(-) co-transporter (NKCC1) increases the intracellular Cl(-) concentration ([Cl(-)]i) such that GABA depolarizes neuronal precursors and immature neurons. The subsequent ontogenetic switch, i.e., upregulation of the Cl(-)-extruder KCC2, which is a neuron-specific K(+)-Cl(-) co-transporter, with or without downregulation of NKCC1, results in low [Cl(-)]i levels and the hyperpolarizing action of GABA in mature neurons. Development of Cl(-) homeostasis depends on developmental changes in NKCC1 and KCC2 expression. Generally, developmental shifts (decreases) in [Cl(-)]i parallel the maturation of the nervous system, e.g., early in the spinal cord, hypothalamus and thalamus, followed by the limbic system, and last in the neocortex. There are several regulators of KCC2 and/or NKCC1 expression, including brain-derived neurotrophic factor (BDNF), insulin-like growth factor (IGF), and cystic fibrosis transmembrane conductance regulator (CFTR). Therefore, regionally different expression of these regulators may also contribute to the regional developmental shifts of Cl(-) homeostasis. KCC2 and NKCC1 functions are also regulated by phosphorylation by enzymes such as PKC, Src-family tyrosine kinases, and WNK1-4 and their downstream effectors STE20/SPS1-related proline/alanine-rich kinase (SPAK)-oxidative stress responsive kinase-1 (OSR1). In addition, activation of these kinases is modulated by humoral factors such as estrogen and taurine. Because these transporters use the electrochemical driving force of Na(+) and K(+) ions, topographical interaction with the Na(+)-K(+) ATPase and its modulators such as creatine kinase (CK) should modulate functions of Cl(-) transporters. Therefore, regional developmental regulation of these regulators and modulators of Cl(-) transporters may also play a pivotal role in the development of Cl(-) homeostasis.

  19. Epigenetic mechanisms in heart development and disease.

    PubMed

    Martinez, Shannalee R; Gay, Maresha S; Zhang, Lubo

    2015-07-01

    Suboptimal intrauterine development has been linked to predisposition to cardiovascular disease in adulthood, a concept termed 'developmental origins of health and disease'. Although the exact mechanisms underlying this developmental programming are unknown, a growing body of evidence supports the involvement of epigenetic regulation. Epigenetic mechanisms such as DNA methylation, histone modifications and micro-RNA confer added levels of gene regulation without altering DNA sequences. These modifications are relatively stable signals, offering possible insight into the mechanisms underlying developmental origins of health and disease. This review will discuss the role of epigenetic mechanisms in heart development as well as aberrant epigenetic regulation contributing to cardiovascular disease. Additionally, we will address recent advances targeting epigenetic mechanisms as potential therapeutic approaches to cardiovascular disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi Xiongjie; Graduate School of the Chinese Academy of Sciences, Beijing 100039; Du Yongbing

    2008-07-01

    Perfluorooctanesulfonate (PFOS) is a persistent organic pollutant, the potential toxicity of which is causing great concern. In the present study, we employed zebrafish embryos to investigate the developmental toxicity of this compound. Four-hour post-fertilization (hpf) zebrafish embryos were exposed to 0.1, 0.5, 1, 3 and 5 mg/L PFOS. Hatching was delayed and hatching rates as well as larval survivorship were significantly reduced after the embryos were exposed to 1, 3 and 5 mg/L PFOS until 132 hpf. The fry displayed gross developmental malformations, including epiboly deformities, hypopigmentation, yolk sac edema, tail and heart malformations and spinal curvature upon exposure tomore » PFOS concentrations of 1 mg/L or greater. Growth (body length) was significantly reduced in the 3 and 5 mg/L PFOS-treated groups. To test whether developmental malformation was mediated via apoptosis, flow cytometry analysis of DNA content, acridine orange staining and TUNEL assay was used. These techniques indicated that more apoptotic cells were present in the PFOS-treated embryos than in the control embryos. Certain genes related to cell apoptosis, p53 and Bax, were both significantly up-regulated upon exposure to all the concentrations tested. In addition, we investigated the effects of PFOS on marker genes related to early thyroid development (hhex and pax8) and genes regulating the balance of androgens and estrogens (cyp19a and cyp19b). For thyroid development, the expression of hhex was significantly up-regulated at all concentrations tested, whereas pax8 expression was significantly up-regulated only upon exposure to lower concentrations of PFOS (0.1, 0.5, 1 mg/L). The expression of cyp19a and of cyp19b was significantly down-regulated at all exposure concentrations. The overall results indicated that zebrafish embryos constitute a reliable model for testing the developmental toxicity of PFOS, and the gene expression patterns in the embryos were able to reveal some potential mechanisms of developmental toxicity.« less

  1. Deep sequencing of small RNA libraries reveals dynamic expression patterns of microRNAs in multiple developmental stages of Bactrocera dorsalis.

    PubMed

    Huang, Y; Dou, W; Liu, B; Wei, D; Liao, C Y; Smagghe, G; Wang, J-J

    2014-10-01

    In eukaryotes, microRNAs (miRNAs) are small, conserved, noncoding RNAs that have emerged as critical regulators of gene expression. The oriental fruit fly Bactrocera dorsalis is one of the most economically important fruit fly pests in East Asia and the Pacific. Although transcriptome analyses have greatly enriched our knowledge of its structural genes, little is known about post-transcriptional regulation by miRNAs in this dipteran species. In this study, small RNA libraries corresponding to four B. dorsalis developmental stages (eggs, larvae, pupae and adults) were constructed and sequenced. Approximately 30.7 million reads of 18-30 nucleotides were obtained, with 123 known miRNAs and 60 novel miRNAs identified amongst these libraries. More than half of the miRNAs were stage-specific during the four developmental stages. A set of miRNAs was found to be up- or down-regulated during development by comparison of their reads at different developmental stages. Moreover, a small part of miRNAs owned both miR-#-3p and miR-#-5p types, with enormously variable miR-#-3p/miR-#-5p ratios in the same library and amongst different developmental stages for each miRNA. Taking these findings together, the current study has uncovered a number of miRNAs and provided insights into their possible involvement in developmental regulation by expression profiling of miRNAs. Further analyses of the expression and function of these miRNAs could increase our understanding of regulatory networks in this insect and lead to novel approaches for its control. © 2014 The Royal Entomological Society.

  2. 45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 4 2012-10-01 2012-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES...

  3. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  4. Age-related changes in tree growth and physiology

    Treesearch

    Andrew Groover

    2017-01-01

    Trees pass through specific developmental phases as they age, including juvenile to adult, and vegetative to reproductive phases. The timing of these transitions is regulated genetically but is also highly influenced by the environment. Tree species have evolved different strategies and life histories that affect how they age – for example some pioneer species are fast...

  5. Supporting and Developing Self-Regulatory Behaviours in Early Childhood in Young Children with High Levels of Impulsive Behaviour

    ERIC Educational Resources Information Center

    Dan, Aviva

    2016-01-01

    Deficits in self-regulatory skills underlie or contribute to a range of adverse developmental problems and disorders, including ADHD (Barkley, 1997), eating disorders (Attie & Brooks-Gunn, 1995) and risk -taking behaviour (Cantor & Sanderson 1998; Eisenberg et al., 2005). Self-regulation has been recognised as an important factor in aiding…

  6. Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

    PubMed

    Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

    2016-06-30

    Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage product accumulation (10-16 DAF). The results highlight versatile cellular metabolic activity in the transition phase and strong convergence towards storage product accumulation in the storage phase. Notably, both phases are characterized by particular protective mechanism, such as scavenging of oxidative stress and defence against pathogens, during the transition and the storage phase, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Genome-Wide Association Mapping of Fertility Reduction upon Heat Stress Reveals Developmental Stage-Specific QTLs in Arabidopsis thaliana.

    PubMed

    Bac-Molenaar, Johanna A; Fradin, Emilie F; Becker, Frank F M; Rienstra, Juriaan A; van der Schoot, J; Vreugdenhil, Dick; Keurentjes, Joost J B

    2015-07-01

    For crops that are grown for their fruits or seeds, elevated temperatures that occur during flowering and seed or fruit set have a stronger effect on yield than high temperatures during the vegetative stage. Even short-term exposure to heat can have a large impact on yield. In this study, we used Arabidopsis thaliana to study the effect of short-term heat exposure on flower and seed development. The impact of a single hot day (35°C) was determined in more than 250 natural accessions by measuring the lengths of the siliques along the main inflorescence. Two sensitive developmental stages were identified, one before anthesis, during male and female meiosis, and one after anthesis, during fertilization and early embryo development. In addition, we observed a correlation between flowering time and heat tolerance. Genome-wide association mapping revealed four quantitative trait loci (QTLs) strongly associated with the heat response. These QTLs were developmental stage specific, as different QTLs were detected before and after anthesis. For a number of QTLs, T-DNA insertion knockout lines could validate assigned candidate genes. Our findings show that the regulation of complex traits can be highly dependent on the developmental timing. © 2015 American Society of Plant Biologists. All rights reserved.

  8. Genome-Wide Association Mapping of Fertility Reduction upon Heat Stress Reveals Developmental Stage-Specific QTLs in Arabidopsis thaliana

    PubMed Central

    Bac-Molenaar, Johanna A.; Fradin, Emilie F.; Becker, Frank F.M.; Rienstra, Juriaan A.; van der Schoot, J.; Vreugdenhil, Dick; Keurentjes, Joost J.B.

    2015-01-01

    For crops that are grown for their fruits or seeds, elevated temperatures that occur during flowering and seed or fruit set have a stronger effect on yield than high temperatures during the vegetative stage. Even short-term exposure to heat can have a large impact on yield. In this study, we used Arabidopsis thaliana to study the effect of short-term heat exposure on flower and seed development. The impact of a single hot day (35°C) was determined in more than 250 natural accessions by measuring the lengths of the siliques along the main inflorescence. Two sensitive developmental stages were identified, one before anthesis, during male and female meiosis, and one after anthesis, during fertilization and early embryo development. In addition, we observed a correlation between flowering time and heat tolerance. Genome-wide association mapping revealed four quantitative trait loci (QTLs) strongly associated with the heat response. These QTLs were developmental stage specific, as different QTLs were detected before and after anthesis. For a number of QTLs, T-DNA insertion knockout lines could validate assigned candidate genes. Our findings show that the regulation of complex traits can be highly dependent on the developmental timing. PMID:26163573

  9. IT-25DEVELOPMENTALLY REGULATED ANTIGENS FOR IMMUNOLOGIC TARGETING OF MEDULLOBLASTOMA SUBTYPES

    PubMed Central

    Pham, Christina; Flores, Catherine; Pei, Yanxin; Wechsler-Reya, Robert; Mitchell, Duane

    2014-01-01

    INTRODUCTION: Medulloblastoma (MB) remains incurable in one third of patients despite aggressive multi-modality standard therapies. Immunotherapy presents a promising alternative by specifically targeting cancer cells. To date, there have been no successful immunologic applications targeting MB. Emerging evidence from integrated genomic studies has suggested MB variants arise from deregulation of pathways affecting proliferation of progenitor cell populations within the developing cerebellum. Using total embryonic RNA as a source of tumor rejection antigens is attractive because it can be delivered as a single vaccine, target both known and unknown fetal proteins, and can be refined to preferentially treat distinct MB subtypes. METHODS: We have created two transplantable, syngeneic animal MB models recapitulating human SHH and Group 3 variants to investigate the immunologic targeting of different MB subtypes. We generated T cells specific to the developing mouse cerebellum (P5) and tested their reactivity to target cells pulsed with total RNA from two MB subtypes and the normal brain. Immune responses were evaluated by measuring cytokine secretion following re-stimulation of activated T cells with both normal and tumor cell targets. In vivo antitumor efficacy was also tested in survival studies of intracranial tumor-bearing animals. RESULTS: We generated T cells specific to the developing cerebellum in vitro, confirming the immunogenicity of developmentally regulated antigens. Additionally, we have shown that developmental antigen-specific T cells produce high levels of Th1-type cytokines in response to tumor cells of two immunologically distinct subtypes of MB. Interestingly, developmental antigen specific T cells do not show cross reactivity with the normal brain or subsequent stages of the developing brain after P5. Targeting developmental antigens also conferred a significant survival benefit in a treatment model of Group 3 tumor bearing animals. CONCLUSIONS: Developmental antigens can safely target multiple MB subtypes with equal effectiveness compared to previously established total tumor strategies.

  10. De novo variants in EBF3 are associated with hypotonia, developmental delay, intellectual disability, and autism.

    PubMed

    Tanaka, Akemi J; Cho, Megan T; Willaert, Rebecca; Retterer, Kyle; Zarate, Yuri A; Bosanko, Katie; Stefans, Vikki; Oishi, Kimihiko; Williamson, Amy; Wilson, Golder N; Basinger, Alice; Barbaro-Dieber, Tina; Ortega, Lucia; Sorrentino, Susanna; Gabriel, Melissa K; Anderson, Ilse J; Sacoto, Maria J Guillen; Schnur, Rhonda E; Chung, Wendy K

    2017-11-01

    Using whole-exome sequencing, we identified seven unrelated individuals with global developmental delay, hypotonia, dysmorphic facial features, and an increased frequency of short stature, ataxia, and autism with de novo heterozygous frameshift, nonsense, splice, and missense variants in the Early B-cell Transcription Factor Family Member 3 ( EBF3 ) gene. EBF3 is a member of the collier/olfactory-1/early B-cell factor (COE) family of proteins, which are required for central nervous system (CNS) development. COE proteins are highly evolutionarily conserved and regulate neuronal specification, migration, axon guidance, and dendritogenesis during development and are essential for maintaining neuronal identity in adult neurons. Haploinsufficiency of EBF3 may affect brain development and function, resulting in developmental delay, intellectual disability, and behavioral differences observed in individuals with a deleterious variant in EBF3 . © 2017 Tanaka et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

    PubMed

    Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

    2002-05-01

    Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

  12. The let-7 microRNA interfaces extensively with the translation machinery to regulate cell differentiation

    PubMed Central

    Ding, Xavier C.; Slack, Frank J.; Großhans, Helge

    2010-01-01

    MicroRNAs (miRNAs) are noncoding RNAs that regulate numerous target genes through a posttranscriptional mechanism and thus control major developmental pathways. The phylogenetically conserved let-7 miRNA regulates cell proliferation and differentiation, thus functioning as a key regulator of developmental timing in C. elegans and a tumor suppressor gene in humans. Using a reverse genetic screen, we have identified genetic interaction partners of C. elegans let-7, including known and novel potential target genes. Initial identification of several translation initiation factors as suppressors of a let-7 mutation led us to systematically examine genetic interaction between let-7 and the translational machinery, which we found to be widespread. In the presence of wild-type let-7, depletion of the translation initiation factor eIF3 resulted in precocious cell differentiation, suggesting that developmental timing is translationally regulated, possibly by let-7. As overexpression of eIF3 in humans promotes translation of mRNAs that are also targets of let-7-mediated repression, we suggest that eIF3 may directly or indirectly oppose let-7 activity. This might provide an explanation for the opposite functions of let-7 and eIF3 in regulating tumorigenesis. PMID:18818519

  13. Neuroendocrine Regulation of Maternal Behavior

    PubMed Central

    Bridges, Robert S.

    2015-01-01

    The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

  14. Neuroendocrine regulation of maternal behavior.

    PubMed

    Bridges, Robert S

    2015-01-01

    The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female's lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential processes that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female's lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. GABA-CREB signalling regulates maturation and survival of newly generated neurons in the adult hippocampus

    PubMed Central

    Jagasia, Ravi; Steib, Kathrin; Englberger, Elisabeth; Herold, Sabine; Faus-Kessler, Theresa; Saxe, Michael; Gage, Fred H.; Song, Hongjun; Lie, D. Chichung

    2009-01-01

    Survival and integration of new neurons in the hippocampal circuit are rate-limiting steps in adult hippocampal neurogenesis. Neuronal network activity is a major regulator of these processes, yet little is known about the respective downstream signalling pathways. Here, we investigate the role of CREB signalling in adult hippocampal neurogenesis. CREB is activated in new granule neurons during a distinct developmental period. Loss of CREB function in a cell-autonomous fashion impairs dendritic development, decreases the expression of the neurogenic transcription factor NeuroD and of the neuronal microtubule associated protein, DCX, and compromises the survival of newborn neurons. In addition, GABA-mediated excitation regulates CREB activation at early developmental stages. Importantly, developmental defects following loss of GABA-mediated excitation can be compensated by enhanced CREB signalling. These results indicate that CREB signalling is a central pathway in adult hippocampal neurogenesis, regulating the development and survival of new hippocampal neurons downstream of GABA-mediated excitation. PMID:19553437

  16. A novel interplay between the ubiquitin–proteasome system and serine proteases during Drosophila development.

    PubMed

    Lipinszki, Zoltán; Klement, Eva; Hunyadi-Gulyas, Eva; Medzihradszky, Katalin F; Márkus, Róbert; Pál, Margit; Deák, Péter; Udvardy, Andor

    2013-09-15

    The concentrations of the Drosophila proteasomal and extraproteasomal polyubiquitin receptors fluctuate in a developmentally regulated fashion. This fluctuation is generated by a previously unidentified proteolytic activity. In the present paper, we describe the purification, identification and characterization of this protease (endoproteinase I). Its expression increases sharply at the L1-L2 larval stages, remains high until the second half of the L3 stage, then declines dramatically. This sharp decrease coincides precisely with the increase of polyubiquitin receptor concentrations in late L3 larvae, which suggests a tight developmental co-regulation. RNAi-induced down-regulation of endoproteinase I results in pupal lethality. Interestingly, we found a cross-talk between the 26S proteasome and this larval protease: transgenic overexpression of the in vivo target of endoproteinase I, the C-terminal half of the proteasomal polyubiquitin receptor subunit p54/Rpn10 results in transcriptional down-regulation of endoproteinase I and consequently a lower level of proteolytic elimination of the polyubiquitin receptors. Another larval protease, Jonah65A-IV, which degrades only unfolded proteins and exhibits similar cross-talk with the proteasome has also been purified and characterized. It may prevent the accumulation of polyubiquitylated proteins in larvae contrary to the low polyubiquitin receptor concentration.

  17. Cellular manganese content is developmentally regulated in human dopaminergic neurons

    NASA Astrophysics Data System (ADS)

    Kumar, Kevin K.; Lowe, Edward W., Jr.; Aboud, Asad A.; Neely, M. Diana; Redha, Rey; Bauer, Joshua A.; Odak, Mihir; Weaver, C. David; Meiler, Jens; Aschner, Michael; Bowman, Aaron B.

    2014-10-01

    Manganese (Mn) is both an essential biological cofactor and neurotoxicant. Disruption of Mn biology in the basal ganglia has been implicated in the pathogenesis of neurodegenerative disorders, such as parkinsonism and Huntington's disease. Handling of other essential metals (e.g. iron and zinc) occurs via complex intracellular signaling networks that link metal detection and transport systems. However, beyond several non-selective transporters, little is known about the intracellular processes regulating neuronal Mn homeostasis. We hypothesized that small molecules that modulate intracellular Mn could provide insight into cell-level Mn regulatory mechanisms. We performed a high throughput screen of 40,167 small molecules for modifiers of cellular Mn content in a mouse striatal neuron cell line. Following stringent validation assays and chemical informatics, we obtained a chemical `toolbox' of 41 small molecules with diverse structure-activity relationships that can alter intracellular Mn levels under biologically relevant Mn exposures. We utilized this toolbox to test for differential regulation of Mn handling in human floor-plate lineage dopaminergic neurons, a lineage especially vulnerable to environmental Mn exposure. We report differential Mn accumulation between developmental stages and stage-specific differences in the Mn-altering activity of individual small molecules. This work demonstrates cell-level regulation of Mn content across neuronal differentiation.

  18. Auxin-BR Interaction Regulates Plant Growth and Development

    PubMed Central

    Tian, Huiyu; Lv, Bingsheng; Ding, Tingting; Bai, Mingyi; Ding, Zhaojun

    2018-01-01

    Plants develop a high flexibility to alter growth, development, and metabolism to adapt to the ever-changing environments. Multiple signaling pathways are involved in these processes and the molecular pathways to transduce various developmental signals are not linear but are interconnected by a complex network and even feedback mutually to achieve the final outcome. This review will focus on two important plant hormones, auxin and brassinosteroid (BR), based on the most recent progresses about these two hormone regulated plant growth and development in Arabidopsis, and highlight the cross-talks between these two phytohormones. PMID:29403511

  19. Linking Prenatal Maternal Adversity to Developmental Outcomes in Infants: The Role of Epigenetic Pathways

    PubMed Central

    Monk, Catherine; Spicer, Julie; Champagne, Frances A.

    2013-01-01

    Prenatal exposure to maternal stress, anxiety, and depression can have lasting effects on infant development with consequences for risk of psychopathology. Though the impact of prenatal maternal distress has been well documented, the potential mechanisms through which maternal psychosocial variables shape development have yet to be fully elucidated. Advances in molecular biology have highlighted the role of epigenetic mechanisms in regulating gene activity, neurobiology, and behavior and the potential role of environmentally-induced epigenetic variation in linking early life exposures to long-term biobehavioral outcomes. In this review, we discuss evidence illustrating the association between maternal prenatal distress and both fetal and infant developmental trajectories and the potential role of epigenetic mechanisms in mediating these effects. Postnatal experiences may have a critical moderating influence on prenatal effects, and here we review findings illustrating prenatal-postnatal interplay and the developmental and epigenetic consequences of postnatal mother-infant interactions. The in utero environment is regulated by placental function and there is emerging evidence that the placenta is highly susceptible to maternal distress and a target of epigenetic dysregulation. Integrating studies of prenatal exposures, placental function, and postnatal maternal care with the exploration of epigenetic mechanisms may provide novel insights into the pathophysiology induced by maternal distress. PMID:23062303

  20. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

  1. 45 CFR 1386.103 - Discovery.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS Practice and Procedure for Hearings Pertaining to States...

  2. TRACING THE DEVELOPMENT OF TYPEWRITING SKILLS IN AN ADAPTIVE E-LEARNING ENVIRONMENT.

    PubMed

    van den Bergh, Mattis; Hofman, Abe D; Schmittmann, Verena D; van der Maas, Han L J

    2015-12-01

    Typewriting studies which compare novice and expert typists have suggested that highly trained typing skills involve cognitive process with an inner and outer loop, which regulate keystrokes and words, respectively. The present study investigates these loops longitudinally, using multi-level modeling of 1,091,707 keystroke latencies from 62 children (M age=12.6 yr.) following an online typing course. Using finger movement repetition as indicator of the inner loop and words typed as indicator of the outer loop, practicing keystroke latencies resulted in different developmental curves for each loop. Moreover, based on plateaus in the developmental curves, the inner loop seemed to require less practice to develop than the outer loop.

  3. Morphological, Histobiochemical and Molecular Characterisation of Low Lignin Phloem Fibre (llpf) Mutant of Dark Jute (Corchorus olitorius L.).

    PubMed

    Choudhary, S B; Chowdhury, I; Singh, R K; Pandey, S P; Sharma, H K; Anil Kumar, A; Karmakar, P G; Kumari, N; Souframanien, J; Jambhulkar, S J

    2017-11-01

    Lignin is a versatile plant metabolite challenging high-end industrial applications of several plant products including jute. Application of developmental mutant in regulation of lignification in jute may open up door for much awaited jute based diversified products. In the present study, a novel dark jute (Corchorus olitorius L.) mutant with low lignin (7.23%) in phloem fibre being compared to wild-type JRO 204 (13.7%) was identified and characterised. Unique morphological features including undulated stem, petiole and leaf vein distinguished the mutant in gamma ray irradiated mutant population. Histological and biochemical analysis revealed reduced lignification of phloem fibre cells of the plant. RT-PCR analysis demonstrated temporal transcriptional regulation of CCoAMT1 gene in the mutant. The mutant was found an extremely useful model to study phloem fibre developmental biology in the crop besides acting as a donor genetic stock for low lignin containing jute fibre in dark jute improvement programme.

  4. SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus

    PubMed Central

    Eijlander, Robyn T.; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P.

    2016-01-01

    Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus, whereas this is not observed in Bacillus subtilis. Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus ΔspoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes. PMID:27790204

  5. SpoVT: From Fine-Tuning Regulator in Bacillus subtilis to Essential Sporulation Protein in Bacillus cereus.

    PubMed

    Eijlander, Robyn T; Holsappel, Siger; de Jong, Anne; Ghosh, Abhinaba; Christie, Graham; Kuipers, Oscar P

    2016-01-01

    Sporulation is a highly sophisticated developmental process adopted by most Bacilli as a survival strategy to withstand extreme conditions that normally do not support microbial growth. A complicated regulatory cascade, divided into various stages and taking place in two different compartments of the cell, involves a number of primary and secondary regulator proteins that drive gene expression directed toward the formation and maturation of an endospore. Such regulator proteins are highly conserved among various spore formers. Despite this conservation, both regulatory and phenotypic differences are observed between different species of spore forming bacteria. In this study, we demonstrate that deletion of the regulatory sporulation protein SpoVT results in a severe sporulation defect in Bacillus cereus , whereas this is not observed in Bacillus subtilis . Although spores are initially formed, the process is stalled at a later stage in development, followed by lysis of the forespore and the mother cell. A transcriptomic investigation of B. cereus Δ spoVT shows upregulation of genes involved in germination, potentially leading to premature lysis of prespores formed. Additionally, extreme variation in the expression of species-specific genes of unknown function was observed. Introduction of the B. subtilis SpoVT protein could partly restore the sporulation defect in the B. cereus spoVT mutant strain. The difference in phenotype is thus more than likely explained by differences in promoter targets rather than differences in mode of action of the conserved SpoVT regulator protein. This study stresses that evolutionary variances in regulon members of sporulation regulators can have profound effects on the spore developmental process and that mere protein homology is not a foolproof predictor of similar phenotypes.

  6. Group III mGluR regulation of synaptic transmission at the SC-CA1 synapse is developmentally regulated

    PubMed Central

    Ayala, Jennifer E.; Niswender, Colleen M.; Luo, Qingwei; Banko, Jessica L.; Conn, P. Jeffrey

    2008-01-01

    Summary Group III metabotropic glutamate receptors (mGluRs) reduce synaptic transmission at the Schaffer collateral-CA1 (SC-CA1) synapse in rats by a presynaptic mechanism. Previous studies show that low concentrations of the group III-selective agonist, L-AP4, reduce synaptic transmission in slices from neonatal but not adult rats, whereas high micromolar concentrations reduce transmission in both age groups. L-AP4 activates mGluRs 4 and 8 at much lower concentrations than those required to activate mGluR7, suggesting that the group III mGluR subtype modulating transmission is a high affinity receptor in neonates and a low affinity receptor in adults. The previous lack of subtype selective ligands has made it difficult to test this hypothesis. We have measured fEPSPs in the presence of novel subtype selective agents to address this question. We show that the effects of L-AP4 can be blocked by LY341495 in both neonates and adults, verifying that these effects are mediated by mGluRs. In addition, the selective mGluR8 agonist, DCPG, has a significant effect in slices from neonatal rats but does not reduce synaptic transmission in adult slices. The mGluR4 selective allosteric potentiator, PHCCC, is unable to potentiate the L-AP4-induced effects at either age. Taken together, our data suggest that group III mGluRs regulate transmission at the SC-CA1 synapse throughout development but there is a developmental regulation of the subtypes involved so that that both mGluR8 serves this role in neonates but not adults whereas mGluR7 is involved in regulating transmission at this synapse in throughout postnatal development. PMID:18255102

  7. Metabolomics approach to understand mechanisms of ß-N-Oxalyl-L-a,ß-diaminopropionic Acid (ß-ODAP) biosynthesis in grass pea (Lathyrus sativus L.)

    USDA-ARS?s Scientific Manuscript database

    Grass pea (Lathyrus sativus L.) is an important food crop for human health and food security, however its seed contains high levels of the neurotoxin ß-ODAP. Previous work demonstrated that ß-ODAP content changes during early developmental stages of grass pea. Further, the regulation and mechanisms ...

  8. The histone acetyltransferases CBP and Chameau integrate developmental and DNA replication programs in Drosophila ovarian follicle cells

    PubMed Central

    McConnell, Kristopher H.; Dixon, Michael; Calvi, Brian R.

    2012-01-01

    DNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic location of origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins in concert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarian follicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histone acetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm had relatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of its ortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also binds amplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect on nucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaborate in origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate the developmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of origin epigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integrates differentiation and DNA replication programs. PMID:22951641

  9. Developmental neurotoxicity of industrial chemicals.

    PubMed

    Grandjean, P; Landrigan, P J

    2006-12-16

    Neurodevelopmental disorders such as autism, attention deficit disorder, mental retardation, and cerebral palsy are common, costly, and can cause lifelong disability. Their causes are mostly unknown. A few industrial chemicals (eg, lead, methylmercury, polychlorinated biphenyls [PCBs], arsenic, and toluene) are recognised causes of neurodevelopmental disorders and subclinical brain dysfunction. Exposure to these chemicals during early fetal development can cause brain injury at doses much lower than those affecting adult brain function. Recognition of these risks has led to evidence-based programmes of prevention, such as elimination of lead additives in petrol. Although these prevention campaigns are highly successful, most were initiated only after substantial delays. Another 200 chemicals are known to cause clinical neurotoxic effects in adults. Despite an absence of systematic testing, many additional chemicals have been shown to be neurotoxic in laboratory models. The toxic effects of such chemicals in the developing human brain are not known and they are not regulated to protect children. The two main impediments to prevention of neurodevelopmental deficits of chemical origin are the great gaps in testing chemicals for developmental neurotoxicity and the high level of proof required for regulation. New, precautionary approaches that recognise the unique vulnerability of the developing brain are needed for testing and control of chemicals.

  10. Specification of select hypothalamic circuits and innate behaviors by the embryonic patterning gene Dbx1

    PubMed Central

    Sokolowski, Katie; Esumi, Shigeyuki; Hirata, Tsutomu; Kamal, Yasman; Tran, Tuyen; Lam, Andrew; Oboti, Livio; Brighthaupt, Sherri-Chanelle; Zaghlula, Manar; Martinez, Jennifer; Ghimbovschi, Svetlana; Knoblach, Susan; Pierani, Alessandra; Tamamaki, Nobuaki; Shah, Nirao M; Jones, Kevin S; Corbin, Joshua G

    2015-01-01

    SUMMARY The hypothalamus integrates information required for the production of a variety of innate behaviors such as feeding, mating, aggression and predator avoidance. Despite an extensive knowledge of hypothalamic function, how embryonic genetic programs specify circuits that regulate these behaviors remains unknown. Here, we find that in the hypothalamus the developmentally regulated homeodomain-containing transcription factor Dbx1 is required for the generation of specific subclasses of neurons within the lateral hypothalamic area/zona incerta (LH) and the arcuate (Arc) nucleus. Consistent with this specific developmental role, Dbx1 hypothalamic-specific conditional-knockout mice display attenuated responses to predator odor and feeding stressors but do not display deficits in other innate behaviors such as mating or conspecific aggression. Thus, activity of a single developmentally regulated gene, Dbx1, is a shared requirement for the specification of hypothalamic nuclei governing a subset of innate behaviors. PMID:25864637

  11. Production of systemically circulating Hedgehog by the intestine couples nutrition to growth and development.

    PubMed

    Rodenfels, Jonathan; Lavrynenko, Oksana; Ayciriex, Sophie; Sampaio, Julio L; Carvalho, Maria; Shevchenko, Andrej; Eaton, Suzanne

    2014-12-01

    In Drosophila larvae, growth and developmental timing are regulated by nutrition in a tightly coordinated fashion. The networks that couple these processes are far from understood. Here, we show that the intestine responds to nutrient availability by regulating production of a circulating lipoprotein-associated form of the signaling protein Hedgehog (Hh). Levels of circulating Hh tune the rates of growth and developmental timing in a coordinated fashion. Circulating Hh signals to the fat body to control larval growth. It regulates developmental timing by controlling ecdysteroid production in the prothoracic gland. Circulating Hh is especially important during starvation, when it is also required for mobilization of fat body triacylglycerol (TAG) stores. Thus, we demonstrate that Hh, previously known only for its local morphogenetic functions, also acts as a lipoprotein-associated endocrine hormone, coordinating the response of multiple tissues to nutrient availability. © 2014 Rodenfels et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Evolution of branched regulatory genetic pathways: directional selection on pleiotropic loci accelerates developmental system drift.

    PubMed

    Johnson, Norman A; Porter, Adam H

    2007-01-01

    Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.

  13. Systems theory and cascades in developmental psychopathology.

    PubMed

    Cox, Martha J; Mills-Koonce, Roger; Propper, Cathi; Gariépy, Jean-Louis

    2010-08-01

    In the wake of prominent theoreticians in developmental science, whose contributions we review in this article, many developmental psychologists came to endorse a systems approach to understanding how the individual, as it develops, establishes functional relationships to social ecological contexts that from birth to school entry rapidly increase in complexity. The concept of developmental cascade has been introduced in this context to describe lawful processes by which antecedent conditions may be related with varying probabilities to specified outcomes. These are understood as processes by which function at one level or in one domain of behavior affect the organization of competency in later developing domains of general adaptation. Here we propose a developmental sequence by which the developing child acquires regulative capacities that are key to adjustment to a society that demands considerable control of emotional and cognitive functions early in life. We report empirical evidence showing that the acquisition of regulative capacities may be understood as a cascade of shifts in control parameters induced by the progressive integration of biological, transactional, and socioaffective systems over development. We conclude by suggesting how the developmental process may be accessed for effective intervention in populations deemed "at risk" for later problems of psychosocial adjustment.

  14. Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

    PubMed

    Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

    2015-06-01

    Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. On the Developmental and Environmental Regulation of Secondary Metabolism in Vaccinium spp. Berries

    PubMed Central

    Karppinen, Katja; Zoratti, Laura; Nguyenquynh, Nga; Häggman, Hely; Jaakola, Laura

    2016-01-01

    Secondary metabolites have important defense and signaling roles, and they contribute to the overall quality of developing and ripening fruits. Blueberries, bilberries, cranberries, and other Vaccinium berries are fleshy berry fruits recognized for the high levels of bioactive compounds, especially anthocyanin pigments. Besides anthocyanins and other products of the phenylpropanoid and flavonoid pathways, these berries also contain other metabolites of interest, such as carotenoid derivatives, vitamins and flavor compounds. Recently, new information has been achieved on the mechanisms related with developmental, environmental, and genetic factors involved in the regulation of secondary metabolism in Vaccinium fruits. Especially light conditions and temperature are demonstrated to have a prominent role on the composition of phenolic compounds. The present review focuses on the studies on mechanisms associated with the regulation of key secondary metabolites, mainly phenolic compounds, in Vaccinium berries. The advances in the research concerning biosynthesis of phenolic compounds in Vaccinium species, including specific studies with mutant genotypes in addition to controlled and field experiments on the genotype × environment (G×E) interaction, are discussed. The recently published Vaccinium transcriptome and genome databases provide new tools for the studies on the metabolic routes. PMID:27242856

  16. Worker honey bee pheromone regulation of foraging ontogeny

    NASA Astrophysics Data System (ADS)

    Pankiw, Tanya

    The evolution of sociality has configured communication chemicals, called primer pheromones, which play key roles in regulating the organization of social life. Primer pheromones exert relatively slow effects that fundamentally alter developmental, physiological, and neural systems. Here, I demonstrate how substances extracted from the surface of foraging and young pre-foraging worker bees regulated age at onset of foraging, a developmental process. Hexane-extractable compounds washed from foraging workers increased foraging age compared with controls, whereas extracts of young pre-foraging workers decreased foraging age. This represents the first known direct demonstration of primer pheromone activity derived from adult worker bees.

  17. AGCVIII Kinases: at the crossroads of cellular signaling

    USDA-ARS?s Scientific Manuscript database

    AGCVIII kinases regulate diverse developmental and cellular processes in plants. As putative mediators of secondary messengers, AGCVIII kinases potentially integrate developmental and environmental cues into specific cellular responses through substrate phosphorylation. Here we discuss the functiona...

  18. 45 CFR 1386.19 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights of...

  19. IMMU-22. ADOPTIVE CELL THERAPY AGAINST DIPG USING DEVELOPMENTALLY REGULATED ANTIGENS

    PubMed Central

    Flores, Catherine; Gil, Jorge; Abraham, Rebecca; Pham, Christina; Wildes, Tyler; Moore, Ginger; Drake, Jeffrey; Dyson, Kyle; Mitchell, Duane

    2017-01-01

    Abstract INTRODUCTION: Diffuse intrinsic pontine glioma (DIPG) survival has remained static over decades and DIPG is now the main cause of brain tumor-related deaths in children. Immunotherapy has emerged as a treatment modality with the highest curative potential in patients with refractory malignancies. Our group has pioneered an adoptive cell therapy platform employing total tumor RNA pulsed dendritic cells to generate large amounts of polyclonal antigen-specific T cells in both human and murine systems. As DIPGs are embryonal tumors, our objective in this proposal is to identify a set of developmentally regulated antigens that are overexpressed during oncogenesis of DIPG in order to cause immunological rejection of this tumor without the need for tumor tissue. METHODS: We employ RNA-pulsed bone marrow-derived dendritic cells to ex vivo activate tumor-reactive T cells for use in adoptive cell therapy. Here we use either total RNA isolated from tumor tissue, (TTRNA) or developmental antigens (DevAg) RNA isolated from postnatal day 4 murine brain stem. Either TTRNA-T cells or DevAg-T cells were used in adoptive cell therapy against a preclinical model of DIPG. RESULTS: Pediatric brain tumors are bland relative to peripheral tumors in terms of high expression of immunogenic antigens. Since DIPG antigens remain largely uncharacterized, we used total RNA isolated from tumor cells to generate tumor-specific T cells to use for our therapeutic approach to first demonstrate that immune responses can be generated against this tumor. We also successfully generated immunity against DIPG in a preclinical model using DevAg-T cells for adoptive cell therapy. CONCLUSION: The region- and age- specific nature of DIPG suggests that the underlying pathophysiology likely involves dysregulation of a postnatal neurodevelopmental process which occurs in embryonal tumors. Here we leverage this and demonstrate that DIPG can be effectively treated using adoptive cell therapy against overexpressed developmentally regulated antigens.

  20. Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

    PubMed

    Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

    2017-01-01

    Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

  1. HnRNP-like proteins as post-transcriptional regulators.

    PubMed

    Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

    2014-10-01

    Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Regulation of Expressive Behavior as Reflecting Affect Socialization.

    ERIC Educational Resources Information Center

    Saarni, Carolyn

    Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

  3. 5'-Serial Analysis of Gene Expression studies reveal a transcriptomic switch during fruiting body development in Coprinopsis cinerea

    PubMed Central

    2013-01-01

    Background The transition from the vegetative mycelium to the primordium during fruiting body development is the most complex and critical developmental event in the life cycle of many basidiomycete fungi. Understanding the molecular mechanisms underlying this process has long been a goal of research on basidiomycetes. Large scale assessment of the expressed transcriptomes of these developmental stages will facilitate the generation of a more comprehensive picture of the mushroom fruiting process. In this study, we coupled 5'-Serial Analysis of Gene Expression (5'-SAGE) to high-throughput pyrosequencing from 454 Life Sciences to analyze the transcriptomes and identify up-regulated genes among vegetative mycelium (Myc) and stage 1 primordium (S1-Pri) of Coprinopsis cinerea during fruiting body development. Results We evaluated the expression of >3,000 genes in the two respective growth stages and discovered that almost one-third of these genes were preferentially expressed in either stage. This identified a significant turnover of the transcriptome during the course of fruiting body development. Additionally, we annotated more than 79,000 transcription start sites (TSSs) based on the transcriptomes of the mycelium and stage 1 primoridum stages. Patterns of enrichment based on gene annotations from the GO and KEGG databases indicated that various structural and functional protein families were uniquely employed in either stage and that during primordial growth, cellular metabolism is highly up-regulated. Various signaling pathways such as the cAMP-PKA, MAPK and TOR pathways were also identified as up-regulated, consistent with the model that sensing of nutrient levels and the environment are important in this developmental transition. More than 100 up-regulated genes were also found to be unique to mushroom forming basidiomycetes, highlighting the novelty of fruiting body development in the fungal kingdom. Conclusions We implicated a wealth of new candidate genes important to early stages of mushroom fruiting development, though their precise molecular functions and biological roles are not yet fully known. This study serves to advance our understanding of the molecular mechanisms of fruiting body development in the model mushroom C. cinerea. PMID:23514374

  4. Genome-wide expression profiling of in vivo-derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

    PubMed Central

    Kabani, Sarah; Fenn, Katelyn; Ross, Alan; Ivens, Al; Smith, Terry K; Ghazal, Peter; Matthews, Keith

    2009-01-01

    Background Trypanosomes undergo extensive developmental changes during their complex life cycle. Crucial among these is the transition between slender and stumpy bloodstream forms and, thereafter, the differentiation from stumpy to tsetse-midgut procyclic forms. These developmental events are highly regulated, temporally reproducible and accompanied by expression changes mediated almost exclusively at the post-transcriptional level. Results In this study we have examined, by whole-genome microarray analysis, the mRNA abundance of genes in slender and stumpy forms of T.brucei AnTat1.1 cells, and also during their synchronous differentiation to procyclic forms. In total, five biological replicates representing the differentiation of matched parasite populations derived from five individual mouse infections were assayed, with RNAs being derived at key biological time points during the time course of their synchronous differentiation to procyclic forms. Importantly, the biological context of these mRNA profiles was established by assaying the coincident cellular events in each population (surface antigen exchange, morphological restructuring, cell cycle re-entry), thereby linking the observed gene expression changes to the well-established framework of trypanosome differentiation. Conclusion Using stringent statistical analysis and validation of the derived profiles against experimentally-predicted gene expression and phenotypic changes, we have established the profile of regulated gene expression during these important life-cycle transitions. The highly synchronous nature of differentiation between stumpy and procyclic forms also means that these studies of mRNA profiles are directly relevant to the changes in mRNA abundance within individual cells during this well-characterised developmental transition. PMID:19747379

  5. Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

    PubMed

    Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

    2004-01-01

    This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

  6. 45 CFR 1386.25 - Allowable litigation costs.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ....25 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM FORMULA GRANT PROGRAMS State System for Protection and Advocacy of the Rights...

  7. Signaling molecules involved in the transition of growth to development of Dictyostelium discoideum.

    PubMed

    Mir, Hina A; Rajawat, Jyotika; Pradhan, Shalmali; Begum, Rasheedunnisa

    2007-03-01

    The social amoeba Dictyostelium discoideum, a powerful paradigm provides clear insights into the regulation of growth and development. In addition to possessing complex individual cellular functions like a unicellular eukaryote, D. discoideum cells face the challenge of multicellular development. D. discoideum undergoes a relatively simple differentiation process mainly by cAMP mediated pathway. Despite this relative simplicity, the regulatory signaling pathways are as complex as those seen in metazoan development. However, the introduction of restriction-enzyme-mediated integration (REMI) technique to produce developmental gene knockouts has provided novel insights into the discovery of signaling molecules and their role in D. discoideum development. Cell cycle phase is an important aspect for differentiation of D. discoideum, as cells must reach a specific stage to enter into developmental phase and specific cell cycle regulators are involved in arresting growth phase genes and inducing the developmental genes. In this review, we present an overview of the signaling molecules involved in the regulation of growth to differentiation transition (GDT), molecular mechanism of early developmental events leading to generation of cAMP signal and components of cAMP relay system that operate in this paradigm.

  8. Phenotypic plasticity in blood–oxygen transport in highland and lowland deer mice

    PubMed Central

    Tufts, Danielle M.; Revsbech, Inge G.; Cheviron, Zachary A.; Weber, Roy E.; Fago, Angela; Storz, Jay F.

    2013-01-01

    SUMMARY In vertebrates living at high altitude, arterial hypoxemia may be ameliorated by reversible changes in the oxygen-carrying capacity of the blood (regulated by erythropoiesis) and/or changes in blood–oxygen affinity (regulated by allosteric effectors of hemoglobin function). These hematological traits often differ between taxa that are native to different elevational zones, but it is often unknown whether the observed physiological differences reflect fixed, genetically based differences or environmentally induced acclimatization responses (phenotypic plasticity). Here, we report measurements of hematological traits related to blood–O2 transport in populations of deer mice (Peromyscus maniculatus) that are native to high- and low-altitude environments. We conducted a common-garden breeding experiment to assess whether altitude-related physiological differences were attributable to developmental plasticity and/or physiological plasticity during adulthood. Under conditions prevailing in their native habitats, high-altitude deer mice from the Rocky Mountains exhibited a number of pronounced hematological differences relative to low-altitude conspecifics from the Great Plains: higher hemoglobin concentrations, higher hematocrits, higher erythrocytic concentrations of 2,3-diphosphoglycerate (an allosteric regulator of hemoglobin–oxygen affinity), lower mean corpuscular hemoglobin concentrations and smaller red blood cells. However, these differences disappeared after 6 weeks of acclimation to normoxia at low altitude. The measured traits were also indistinguishable between the F1 progeny of highland and lowland mice, indicating that there were no persistent differences in phenotype that could be attributed to developmental plasticity. These results indicate that the naturally occurring hematological differences between highland and lowland mice are environmentally induced and are largely attributable to physiological plasticity during adulthood. PMID:23239893

  9. The Newborn Individualized Developmental Care and Assessment Program (NIDCAP) with Kangaroo Mother Care (KMC): Comprehensive Care for Preterm Infants

    PubMed Central

    Als, Heidelise; McAnulty, Gloria B.

    2014-01-01

    State-of-the-art Newborn Intensive Care Units (NICUs), instrumental in the survival of high-risk and ever-earlier-born preterm infants, often have costly human repercussions. The developmental sequelae of newborn intensive care are largely misunderstood. Developed countries eager to export their technologies must also transfer the knowledge-base that encompasses all high-risk and preterm infants’ personhood as well as the neuro-essential importance of their parents. Without such understanding, the best medical care, while assuring survival jeopardizes infants’ long-term potential and deprives parents of their critical role. Exchanging the womb for the NICU environment at a time of rapid brain growth compromises preterm infants’ early development, which results in long-term physical and mental health problems and developmental disabilities. The Newborn Individualized Developmental Care and Assessment Program (NIDCAP) aims to prevent the iatrogenic sequelae of intensive care and to maintain the intimate connection between parent and infant, one expression of which is Kangaroo Mother Care. NIDCAP embeds the infant in the natural parent niche, avoids over-stimulation, stress, pain, and isolation while it supports self-regulation, competence, and goal orientation. Research demonstrates that NIDCAP improves brain development, functional competence, health, and life quality. It is cost effective, humane, and ethical, and promises to become the standard for all NICU care. PMID:25473384

  10. The Newborn Individualized Developmental Care and Assessment Program (NIDCAP) with Kangaroo Mother Care (KMC): Comprehensive Care for Preterm Infants.

    PubMed

    Als, Heidelise; McAnulty, Gloria B

    2011-08-01

    State-of-the-art Newborn Intensive Care Units (NICUs), instrumental in the survival of high-risk and ever-earlier-born preterm infants, often have costly human repercussions. The developmental sequelae of newborn intensive care are largely misunderstood. Developed countries eager to export their technologies must also transfer the knowledge-base that encompasses all high-risk and preterm infants' personhood as well as the neuro-essential importance of their parents. Without such understanding, the best medical care, while assuring survival jeopardizes infants' long-term potential and deprives parents of their critical role. Exchanging the womb for the NICU environment at a time of rapid brain growth compromises preterm infants' early development, which results in long-term physical and mental health problems and developmental disabilities. The Newborn Individualized Developmental Care and Assessment Program (NIDCAP) aims to prevent the iatrogenic sequelae of intensive care and to maintain the intimate connection between parent and infant, one expression of which is Kangaroo Mother Care. NIDCAP embeds the infant in the natural parent niche, avoids over-stimulation, stress, pain, and isolation while it supports self-regulation, competence, and goal orientation. Research demonstrates that NIDCAP improves brain development, functional competence, health, and life quality. It is cost effective, humane, and ethical, and promises to become the standard for all NICU care.

  11. Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

    PubMed

    Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

    2014-01-01

    Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

  12. Neuron class-specific requirements for Fragile X Mental Retardation Protein in critical period development of calcium signaling in learning and memory circuitry.

    PubMed

    Doll, Caleb A; Broadie, Kendal

    2016-05-01

    Neural circuit optimization occurs through sensory activity-dependent mechanisms that refine synaptic connectivity and information processing during early-use developmental critical periods. Fragile X Mental Retardation Protein (FMRP), the gene product lost in Fragile X syndrome (FXS), acts as an activity sensor during critical period development, both as an RNA-binding translation regulator and channel-binding excitability regulator. Here, we employ a Drosophila FXS disease model to assay calcium signaling dynamics with a targeted transgenic GCaMP reporter during critical period development of the mushroom body (MB) learning/memory circuit. We find FMRP regulates depolarization-induced calcium signaling in a neuron-specific manner within this circuit, suppressing activity-dependent calcium transients in excitatory cholinergic MB input projection neurons and enhancing calcium signals in inhibitory GABAergic MB output neurons. Both changes are restricted to the developmental critical period and rectified at maturity. Importantly, conditional genetic (dfmr1) rescue of null mutants during the critical period corrects calcium signaling defects in both neuron classes, indicating a temporally restricted FMRP requirement. Likewise, conditional dfmr1 knockdown (RNAi) during the critical period replicates constitutive null mutant defects in both neuron classes, confirming cell-autonomous requirements for FMRP in developmental regulation of calcium signaling dynamics. Optogenetic stimulation during the critical period enhances depolarization-induced calcium signaling in both neuron classes, but this developmental change is eliminated in dfmr1 null mutants, indicating the activity-dependent regulation requires FMRP. These results show FMRP shapes neuron class-specific calcium signaling in excitatory vs. inhibitory neurons in developing learning/memory circuitry, and that FMRP mediates activity-dependent regulation of calcium signaling specifically during the early-use critical period. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Level of NICU Quality of Developmental Care and Neurobehavioral Performance in Very Preterm Infants

    PubMed Central

    Del Prete, Alberto; Bellù, Roberto; Tronick, Ed; Borgatti, Renato

    2012-01-01

    OBJECTIVE: To examine the relation between the neurobehavior of very preterm infants and the level of NICU quality of developmental care. METHODS: The neurobehavior of 178 very preterm infants (gestational age ≤29 weeks and/or birth weight ≤1500 g) from 25 NICUs participating in a large multicenter, longitudinal study (Neonatal Adequate Care for Quality of Life, NEO-ACQUA) was examined with a standardized neurobehavioral assessment, the NICU Network Neurobehavioral Scale (NNNS). A questionnaire, the NEO-ACQUA Quality of Care Checklist was used to evaluate the level of developmental care in each of the NICUs. A factor analyses applied to NEO-ACQUA Quality of Care Checklist produced 2 main factors: (1) the infant-centered care (ICC) index, which measures parents’ involvement in the care of their infant and other developmentally oriented care interventions, and (2) the infant pain management (IPM) index, which measures the NICU approach to and the procedures used for reducing infant pain. The relations between NNNS neurobehavioral scores and the 2 indexes were evaluated. RESULTS: Infants from NICUs with high scores on the ICC evidenced higher attention and regulation, less excitability and hypotonicity, and lower stress/abstinence NNNS scores than infants from low-care units. Infants from NICUs with high scores on the IPM evidenced higher attention and arousal, lower lethargy and nonoptimal reflexes NNNS scores than preterm infants from low-scoring NICUs. CONCLUSIONS: Very preterm infant neurobehavior was associated with higher levels of developmental care both in ICC and in IPM, suggesting that these practices support better neurobehavioral stability. PMID:22492762

  14. Metabolic alterations in developing brain after injury – knowns and unknowns

    PubMed Central

    McKenna, Mary C.; Scafidi, Susanna; Robertson, Courtney L.

    2016-01-01

    Brain development is a highly orchestrated complex process. The developing brain utilizes many substrates including glucose, ketone bodies, lactate, fatty acids and amino acids for energy, cell division and the biosynthesis of nucleotides, proteins and lipids. Metabolism is crucial to provide energy for all cellular processes required for brain development and function including ATP formation, synaptogenesis, synthesis, release and uptake of neurotransmitters, maintaining ionic gradients and redox status, and myelination. The rapidly growing population of infants and children with neurodevelopmental and cognitive impairments and life-long disability resulting from developmental brain injury is a significant public health concern. Brain injury in infants and children can have devastating effects because the injury is superimposed on the high metabolic demands of the developing brain. Acute injury in the pediatric brain can derail, halt or lead to dysregulation of the complex and highly regulated normal developmental processes. This paper provides a brief review of metabolism in developing brain and alterations found clinically and in animal models of developmental brain injury. The metabolic changes observed in three major categories of injury that can result in life-long cognitive and neurological disabilities, including neonatal hypoxia-ischemia, pediatric traumatic brain injury, and brain injury secondary to prematurity are reviewed. PMID:26148530

  15. 45 CFR 1385.5 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.5 Section 1385.5 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

  16. 45 CFR 1385.7 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1385.7 Section 1385.7 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

  17. 45 CFR 1387.1 - General requirements.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false General requirements. 1387.1 Section 1387.1 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

  18. 45 CFR 1388.8 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false [Reserved] 1388.8 Section 1388.8 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES...

  19. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    PubMed

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  20. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    PubMed Central

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

  1. Repression of cell proliferation by miR319-regulated TCP4.

    PubMed

    Schommer, Carla; Debernardi, Juan M; Bresso, Edgardo G; Rodriguez, Ramiro E; Palatnik, Javier F

    2014-10-01

    Leaf development has been extensively studied on a genetic level. However, little is known about the interplay between the developmental regulators and the cell cycle machinery--a link that ultimately affects leaf form and size. miR319 is a conserved microRNA that regulates TCP transcription factors involved in multiple developmental pathways, including leaf development and senescence, organ curvature, and hormone biosynthesis and signaling. Here, we analyze the participation of TCP4 in the control of cell proliferation. A small increase in TCP4 activity has an immediate impact on leaf cell number, by significantly reducing cell proliferation. Plants with high TCP4 levels have a strong reduction in the expression of genes known to be active in G2-M phase of the cell cycle. Part of these effects is mediated by induction of miR396, which represses Growth-Regulating Factor (GRF) transcription factors. Detailed analysis revealed TCP4 to be a direct regulator of MIR396b. However, we found that TCP4 can control cell proliferation through additional pathways, and we identified a direct connection between TCP4 and ICK1/KRP1, a gene involved in the progression of the cell cycle. Our results show that TCP4 can activate different pathways that repress cell proliferation. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

  2. Fascin regulates nuclear actin during Drosophila oogenesis

    PubMed Central

    Kelpsch, Daniel J.; Groen, Christopher M.; Fagan, Tiffany N.; Sudhir, Sweta; Tootle, Tina L.

    2016-01-01

    Drosophila oogenesis provides a developmental system with which to study nuclear actin. During Stages 5–9, nuclear actin levels are high in the oocyte and exhibit variation within the nurse cells. Cofilin and Profilin, which regulate the nuclear import and export of actin, also localize to the nuclei. Expression of GFP-tagged Actin results in nuclear actin rod formation. These findings indicate that nuclear actin must be tightly regulated during oogenesis. One factor mediating this regulation is Fascin. Overexpression of Fascin enhances nuclear GFP-Actin rod formation, and Fascin colocalizes with the rods. Loss of Fascin reduces, whereas overexpression of Fascin increases, the frequency of nurse cells with high levels of nuclear actin, but neither alters the overall nuclear level of actin within the ovary. These data suggest that Fascin regulates the ability of specific cells to accumulate nuclear actin. Evidence indicates that Fascin positively regulates nuclear actin through Cofilin. Loss of Fascin results in decreased nuclear Cofilin. In addition, Fascin and Cofilin genetically interact, as double heterozygotes exhibit a reduction in the number of nurse cells with high nuclear actin levels. These findings are likely applicable beyond Drosophila follicle development, as the localization and functions of Fascin and the mechanisms regulating nuclear actin are widely conserved. PMID:27535426

  3. Vascular Cells in Blood Vessel Wall Development and Disease.

    PubMed

    Mazurek, R; Dave, J M; Chandran, R R; Misra, A; Sheikh, A Q; Greif, D M

    2017-01-01

    The vessel wall is composed of distinct cellular layers, yet communication among individual cells within and between layers results in a dynamic and versatile structure. The morphogenesis of the normal vascular wall involves a highly regulated process of cell proliferation, migration, and differentiation. The use of modern developmental biological and genetic approaches has markedly enriched our understanding of the molecular and cellular mechanisms underlying these developmental events. Additionally, the application of similar approaches to study diverse vascular diseases has resulted in paradigm-shifting insights into pathogenesis. Further investigations into the biology of vascular cells in development and disease promise to have major ramifications on therapeutic strategies to combat pathologies of the vasculature. © 2017 Elsevier Inc. All rights reserved.

  4. Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

    PubMed

    Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

    2016-07-01

    Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

  5. Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

    PubMed Central

    2010-01-01

    Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

  6. Drosophila melanogaster as a model system for assessing development under conditions of microgravity

    NASA Technical Reports Server (NTRS)

    Abbott, M. K.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    More is known about the regulation of early developmental events in Drosophila than any other animal. In addition, its size and short life cycle make it a facile experimental system. Since developmental perturbations have been demonstrated when both oogenesis and embryogenesis occur in the space environment, there is a strong rationale for using this organism for the elucidation of specific gravity-sensitive developmental events.

  7. The never-ending story: from pluripotency to plant developmental plasticity

    PubMed Central

    Gaillochet, Christophe; Lohmann, Jan U.

    2015-01-01

    Plants are sessile organisms, some of which can live for over a thousand years. Unlike most animals, plants employ a post-embryonic mode of development driven by the continuous activity of pluripotent stem cells. Consequently, plants are able to initiate new organs over extended periods of time, and many species can readily replace lost body structures by de novo organogenesis. Classical studies have also shown that plant tissues have a remarkable capacity to undergo de-differentiation and proliferation in vitro, highlighting the fact that plant cell fate is highly plastic. This suggests that the mechanisms regulating fate transitions must be continuously active in most plant cells and that the control of cellular pluripotency lies at the core of diverse developmental programs. Here, we review how pluripotency is established in plant stem cell systems, how it is maintained during development and growth and re-initiated during regeneration, and how these mechanisms eventually contribute to the amazing developmental plasticity of plants. PMID:26130755

  8. ADAM metalloproteases promote a developmental switch in responsiveness to the axonal repellant Sema3A.

    PubMed

    Romi, Erez; Gokhman, Irena; Wong, Eitan; Antonovsky, Niv; Ludwig, Andreas; Sagi, Irit; Saftig, Paul; Tessier-Lavigne, Marc; Yaron, Avraham

    2014-06-05

    During embryonic development, axons can gain and lose sensitivity to guidance cues, and this flexibility is essential for the correct wiring of the nervous system. Yet, the underlying molecular mechanisms are largely unknown. Here we show that receptor cleavage by ADAM (A Disintegrin And Metalloprotease) metalloproteases promotes murine sensory axons loss of responsiveness to the chemorepellant Sema3A. Genetic ablation of ADAM10 and ADAM17 disrupts the developmental downregulation of Neuropilin-1 (Nrp1), the receptor for Sema3A, in sensory axons. Moreover, this is correlated with gain of repulsive response to Sema3A. Overexpression of Nrp1 in neurons reverses axonal desensitization to Sema3A, but this is hampered in a mutant Nrp1 with high susceptibility to cleavage. Lastly, we detect guidance errors of proprioceptive axons in ADAM knockouts that are consistent with enhanced response to Sema3A. Our results provide the first evidence for involvement of ADAMs in regulating developmental switch in responsiveness to axonal guidance cues.

  9. Integrative Analysis of Disease Signatures Shows Inflammation Disrupts Juvenile Experience-Dependent Cortical Plasticity

    PubMed Central

    Smith, Milo R.; Burman, Poromendro

    2016-01-01

    Throughout childhood and adolescence, periods of heightened neuroplasticity are critical for the development of healthy brain function and behavior. Given the high prevalence of neurodevelopmental disorders, such as autism, identifying disruptors of developmental plasticity represents an essential step for developing strategies for prevention and intervention. Applying a novel computational approach that systematically assessed connections between 436 transcriptional signatures of disease and multiple signatures of neuroplasticity, we identified inflammation as a common pathological process central to a diverse set of diseases predicted to dysregulate plasticity signatures. We tested the hypothesis that inflammation disrupts developmental cortical plasticity in vivo using the mouse ocular dominance model of experience-dependent plasticity in primary visual cortex. We found that the administration of systemic lipopolysaccharide suppressed plasticity during juvenile critical period with accompanying transcriptional changes in a particular set of molecular regulators within primary visual cortex. These findings suggest that inflammation may have unrecognized adverse consequences on the postnatal developmental trajectory and indicate that treating inflammation may reduce the burden of neurodevelopmental disorders. PMID:28101530

  10. Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes.

    PubMed

    Zhao, Ying-Tao; Wang, Meng; Fu, San-Xiong; Yang, Wei-Cai; Qi, Cun-Kou; Wang, Xiu-Jie

    2012-02-01

    MicroRNAs (miRNAs) and small interfering RNAs are important regulators of plant development and seed formation, yet their population and abundance in the oil crop Brassica napus are still not well understood, especially at different developmental stages and among cultivars with varied seed oil contents. Here, we systematically analyzed the small RNA expression profiles of Brassica napus seeds at early embryonic developmental stages in high-oil-content and low-oil-content B. napus cultivars, both cultured in two environments. A total of 50 conserved miRNAs and 9 new miRNAs were identified, together with some new miRNA targets. Expression analysis revealed some miRNAs with varied expression levels in different seed oil content cultivars or at different embryonic developmental stages. A large number of 23-nucleotide small RNAs with specific nucleotide composition preferences were also identified, which may present new classes of functional small RNAs.

  11. Identification and Expression Analysis of microRNAs at the Grain Filling Stage in Rice(Oryza sativa L.)via Deep Sequencing

    PubMed Central

    Yi, Rong; Zhu, Zhixuan; Hu, Jihong; Qian, Qian; Dai, Jincheng; Ding, Yi

    2013-01-01

    MicroRNAs (miRNAs) have been shown to play crucial roles in the regulation of plant development. In this study, high-throughput RNA-sequencing technology was used to identify novel miRNAs, and to reveal miRNAs expression patterns at different developmental stages during rice (Oryza sativa L.) grain filling. A total of 434 known miRNAs (380, 402, 390 and 392 at 5, 7, 12 and 17 days after fertilization, respectively.) were obtained from rice grain. The expression profiles of these identified miRNAs were analyzed and the results showed that 161 known miRNAs were differentially expressed during grain development, a high proportion of which were up-regulated from 5 to 7 days after fertilization. In addition, sixty novel miRNAs were identified, and five of these were further validated experimentally. Additional analysis showed that the predicted targets of the differentially expressed miRNAs may participate in signal transduction, carbohydrate and nitrogen metabolism, the response to stimuli and epigenetic regulation. In this study, differences were revealed in the composition and expression profiles of miRNAs among individual developmental stages during the rice grain filling process, and miRNA editing events were also observed, analyzed and validated during this process. The results provide novel insight into the dynamic profiles of miRNAs in developing rice grain and contribute to the understanding of the regulatory roles of miRNAs in grain filling. PMID:23469249

  12. 48 CFR 1852.223-71 - Frequency authorization.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Frequency authorization... obtained by the Contractor or subcontractor in need thereof. (b) For any experimental, developmental, or... device to the Contracting Officer during the initial planning, experimental, or developmental phase of...

  13. 45 CFR 1386.102 - Rights of parties.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Rights of parties. 1386.102 Section 1386.102 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL...

  14. Protective effects of puerarin against tetrabromobisphenol a-induced apoptosis and cardiac developmental toxicity in zebrafish embryo-larvae.

    PubMed

    Yang, Suwen; Wang, Shengrui; Sun, Fengchao; Zhang, Mengmeng; Wu, Fengchang; Xu, Fanfan; Ding, Zhishan

    2015-09-01

    Tetrabromobisphenol A (TBBPA), a brominated flame retardant, is detected commonly in aquatic environments, where it is thought to be highly toxic to the development of aquatic life. In this study, zebrafish embryos and larvae were used to investigate the protective effects of puerarin after exposure to TBBPA. Malformation, blood flow disorders, pericardial edema, and spawn coagulation rates increased, whereas survival decreased significantly after exposure to 0.5 and 1.0 mg L(-1) TBBPA. The measured indices of morphological toxicity improved after treatment with puerarin. TBBPA also induced reactive oxygen species (ROS) production in a dose-dependent manner. Acridine orange staining results revealed that TBBPA exposure caused cardiomyocyte apoptosis and induced the expression of three proapoptotic genes: P53, Bax, and Caspase9. In contrast, the expression of the antiapoptotic gene Bcl2 was down-regulated. When genes related to cardiac development were assessed, the expression of Tbx1, Raldh2, and Bmp2b changed after exposure to the combination of TBBPA and puerarin. These results suggest that TBBPA induces cardiomyocyte apoptosis and ROS production, resulting in cardiac developmental toxicity in zebrafish embryos or larvae. Therefore, puerarin regulates the expression of cardiac developmental genes, such as Tbx1, Bmp2b, and Raldh2 by inhibiting ROS production, and subsequently modulates cardiac development after the exposure of zebrafish larvae to TBBPA. © 2014 Wiley Periodicals, Inc.

  15. Regulation of the epithelial adhesion molecule CEACAM1 is important for palate formation.

    PubMed

    Mima, Junko; Koshino, Aya; Oka, Kyoko; Uchida, Hitoshi; Hieda, Yohki; Nohara, Kanji; Kogo, Mikihiko; Chai, Yang; Sakai, Takayoshi

    2013-01-01

    Cleft palate results from a mixture of genetic and environmental factors and occurs when the bilateral palatal shelves fail to fuse. The objective of this study was to search for new genes involved in mouse palate formation. Gene expression of murine embryonic palatal tissue was analyzed at various developmental stages before, during, and after palate fusion using GeneChip® microarrays. Ceacam1 was one of the highly up-regulated genes during palate formation, and this was confirmed by quantitative real-time PCR. Immunohistochemical staining showed that CEACAM1 was present in prefusion palatal epithelium and was degraded during fusion. To investigate the developmental role of CEACAM1, function-blocking antibody was added to embryonic mouse palate in organ culture. Palatal fusion was inhibited by this function-blocking antibody. To investigate the subsequent developmental role of CEACAM1, we characterized Ceacam1-deficient (Ceacam1(-/-)) mice. Epithelial cells persisted abnormally at the midline of the embryonic palate even on day E16.0, and palatal fusion was delayed in Ceacam1(-/-) mice. TGFβ3 expression, apoptosis, and cell proliferation in palatal epithelium were not affected in the palate of Ceacam1(-/-)mice. However, CEACAM1 expression was retained in the remaining MEE of TGFβ-deficient mice. These results suggest that CEACAM1 has roles in the initiation of palatal fusion via epithelial cell adhesion.

  16. MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

    PubMed Central

    Alsaweed, Mohammed; Hartmann, Peter E.; Geddes, Donna T.; Kakulas, Foteini

    2015-01-01

    Human milk (HM) is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance. PMID:26529003

  17. MRCK-1 drives apical constriction in C. elegans by linking developmental patterning to force generation

    PubMed Central

    Marston, Daniel J.; Higgins, Christopher D.; Peters, Kimberly A.; Cupp, Timothy D.; Dickinson, Daniel J.; Pani, Ariel M.; Moore, Regan P.; Cox, Amanda H.; Kiehart, Daniel P.; Goldstein, Bob

    2016-01-01

    Summary Apical constriction is a change in cell shape that drives key morphogenetic events including gastrulation and neural tube formation. Apical force-producing actomyosin networks drive apical constriction by contracting while connected to cell-cell junctions. The mechanisms by which developmental patterning regulates these actomyosin networks and associated junctions with spatial precision are not fully understood. Here, we identify a myosin light chain kinase MRCK-1 as a key regulator of C. elegans gastrulation that integrates spatial and developmental patterning information. We show that MRCK-1 is required for activation of contractile actomyosin dynamics and elevated cortical tension in the apical cell cortex of endodermal precursor cells. MRCK-1 is apically localized by active Cdc42 at the external, cell-cell contact-free surfaces of apically constricting cells, downstream of cell fate determination mechanisms. We establish that the junctional components α-catenin, β-catenin, and cadherin become highly enriched at the apical junctions of apically-constricting cells, and that MRCK-1 and myosin activity are required in vivo for this enrichment. Taken together, our results define mechanisms that position a myosin activator to a specific cell surface where it both locally increases cortical tension and locally enriches junctional components to facilitate apical constriction. These results reveal crucial links that can tie spatial information to local force generation to drive morphogenesis. PMID:27451898

  18. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  19. Modify the Histone to Win the Battle: Chromatin Dynamics in Plant–Pathogen Interactions

    PubMed Central

    Ramirez-Prado, Juan S.; Piquerez, Sophie J. M.; Bendahmane, Abdelhafid; Hirt, Heribert; Raynaud, Cécile; Benhamed, Moussa

    2018-01-01

    Relying on an immune system comes with a high energetic cost for plants. Defense responses in these organisms are therefore highly regulated and fine-tuned, permitting them to respond pertinently to the attack of a microbial pathogen. In recent years, the importance of the physical modification of chromatin, a highly organized structure composed of genomic DNA and its interacting proteins, has become evident in the research field of plant–pathogen interactions. Several processes, including DNA methylation, changes in histone density and variants, and various histone modifications, have been described as regulators of various developmental and defense responses. Herein, we review the state of the art in the epigenomic aspects of plant immunity, focusing on chromatin modifications, chromatin modifiers, and their physiological consequences. In addition, we explore the exciting field of understanding how plant pathogens have adapted to manipulate the plant epigenomic regulation in order to weaken their immune system and thrive in their host, as well as how histone modifications in eukaryotic pathogens are involved in the regulation of their virulence. PMID:29616066

  20. Interactive contributions of self-regulation deficits and social motivation to psychopathology: Unraveling divergent pathways to aggressive behavior and depressive symptoms

    PubMed Central

    RUDOLPH, KAREN D.; TROOP-GORDON, WENDY; LLEWELLYN, NICOLE

    2015-01-01

    Poor self-regulation has been implicated as a significant risk factor for the development of multiple forms of psychopathology. This research examined the proposition that self-regulation deficits differentially predict aggressive behavior and depressive symptoms, depending on children’s social approach versus avoidance motivation. A prospective, multiple-informant approach was used to test this hypothesis in 419 children (M age = 8.92, SD = 0.36). Parents rated children’s inhibitory control. Children completed measures of social approach–avoidance motivation and depressive symptoms. Teachers rated children’s aggressive behavior. As anticipated, poor inhibitory control predicted aggressive behavior in boys with high but not low approach motivation and low but not high avoidance motivation, whereas poor inhibitory control predicted depressive symptoms in girls with high but not low avoidance motivation. This research supports several complementary theoretical models of psychopathology and provides insight into the differential contributions of poor self-regulation to maladaptive developmental outcomes. The findings suggest the need for targeted intervention programs that consider heterogeneity among children with self-regulatory deficits. PMID:23627953

  1. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    PubMed

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2016-08-01

    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the deleterious late-life cardiovascular effects known to occur with developmental IGF-1 deficiency.

  2. Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.).

    PubMed

    Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

    2017-01-01

    Lettuce ( Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce.

  3. Inflorescence Development and the Role of LsFT in Regulating Bolting in Lettuce (Lactuca sativa L.)

    PubMed Central

    Chen, Zijing; Han, Yingyan; Ning, Kang; Ding, Yunyu; Zhao, Wensheng; Yan, Shuangshuang; Luo, Chen; Jiang, Xiaotang; Ge, Danfeng; Liu, Renyi; Wang, Qian; Zhang, Xiaolan

    2018-01-01

    Lettuce (Lactuca sativa L.) is one of the most important leafy vegetable that is consumed during its vegetative growth. The transition from vegetative to reproductive growth is induced by high temperature, which has significant economic effect on lettuce production. However, the progression of floral transition and the molecular regulation of bolting are largely unknown. Here we morphologically characterized the inflorescence development and functionally analyzed the FLOWERING LOCUS T (LsFT) gene during bolting regulation in lettuce. We described the eight developmental stages during floral transition process. The expression of LsFT was negatively correlated with bolting in different lettuce varieties, and was promoted by heat treatment. Overexpression of LsFT could recover the late-flowering phenotype of ft-2 mutant. Knockdown of LsFT by RNA interference dramatically delayed bolting in lettuce, and failed to respond to high temperature. Therefore, this study dissects the process of inflorescence development and characterizes the role of LsFT in bolting regulation in lettuce. PMID:29403510

  4. Arabidopsis thaliana G2-LIKE FLAVONOID REGULATOR and BRASSINOSTEROID ENHANCED EXPRESSION1 are low-temperature regulators of flavonoid accumulation.

    PubMed

    Petridis, Antonios; Döll, Stefanie; Nichelmann, Lars; Bilger, Wolfgang; Mock, Hans-Peter

    2016-08-01

    Flavonoid synthesis is predominantly regulated at the transcriptional level through the MYB-basic helix-loop-helix (bHLH)-WD40 (MBW) (MYB: transcription factor of the myeloblastosis protein family, WD40: tanscription factor with a short structural motif of 40 amino acids which terminates in an aspartic acid-tryptophan dipeptide) complex, and responds to both environmental and developmental stimuli. Although the developmental regulation of flavonoid accumulation in Arabidopsis thaliana has been examined in great detail, the response of the flavonoid synthesis pathway to abiotic stress (particularly low temperature) remains unclear. A screen of a Dissociation element (Ds) transposon-induced mutation collection identified two lines which exhibited an altered profile of phenylpropanoid accumulation following exposure to low-temperature stress. One of the mutated genes (BRASSINOSTEROID ENHANCED EXPRESSION1 (BEE1)) encoded a brassinosteroid enhanced expression transcription factor, while the other (G2-LIKE FLAVONOID REGULATOR (GFR)) encoded a G2-like flavonoid regulator. Phenylpropanoid-targeted analysis was performed using high-performance LC-MS, and gene expression analysis using quantitative reverse transcription-PCR. In both mutants, the accumulation of quercetins and scopolin was reduced under low-temperature growing conditions, whereas that of anthocyanin was increased. BEE1 and GFR were both shown to negatively regulate anthocyanin accumulation by inhibiting anthocyanin synthesis genes via the suppression of the bHLH (TRANSPARENT TESTA8 (TT8) and GLABROUS3 (GL3)) and/or the MYB (PRODUCTION OF ANTHOCYANIN PIGMENTS2 (PAP2)) components of the MBW complex. Our results provide new insight into the regulatory control of phenylpropanoid metabolism at low temperatures, and reveal that BEE1 and GFR act as important components of the signal transduction chain. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  5. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster

    PubMed Central

    Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O’Connor, Michael B.; Ono, Hajime

    2018-01-01

    Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. PMID:28782527

  6. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

    PubMed

    Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

    2017-10-01

    Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. The Intersection of Emotional and Sociocognitive Competencies with Civic Engagement in Middle Childhood and Adolescence.

    PubMed

    Metzger, Aaron; Alvis, Lauren M; Oosterhoff, Benjamin; Babskie, Elizabeth; Syvertsen, Amy; Wray-Lake, Laura

    2018-03-23

    Civic developmental theory anticipates connections between normative developmental competencies and civic engagement, but little previous research has directly studied such links. The current study sought to contribute to civic development theory by examining associations between emotional and sociocognitive competencies (empathy, emotion regulation, prosocial moral reasoning, future-orientation) and civic engagement (volunteering, informal helping, political behaviors and beliefs, environmental behaviors, social responsibility values, civic skills). Data came from a geographically and racially diverse sample of 2467 youth (M age  = 13.4, Range: 8-20 years, 56% female). The results indicated that empathy and future-orientation significantly predicted nearly all forms of civic engagement, whereas emotion regulation and prosocial moral reasoning were uniquely associated with specific forms of civic engagement. Exploratory multi-group models indicated that empathy and emotion regulation were more strongly associated with civic engagement among younger youth and prosocial moral reasoning and future-orientation were more strongly related to civic engagement among older youth. The findings help to advance developmental theory of youth civic engagement.

  8. Callose homeostasis at plasmodesmata: molecular regulators and developmental relevance

    PubMed Central

    De Storme, Nico; Geelen, Danny

    2014-01-01

    Plasmodesmata are membrane-lined channels that are located in the plant cell wall and that physically interconnect the cytoplasm and the endoplasmic reticulum (ER) of adjacent cells. Operating as controllable gates, plasmodesmata regulate the symplastic trafficking of micro- and macromolecules, such as endogenous proteins [transcription factors (TFs)] and RNA-based signals (mRNA, siRNA, etc.), hence mediating direct cell-to-cell communication and long distance signaling. Besides this physiological role, plasmodesmata also form gateways through which viral genomes can pass, largely facilitating the pernicious spread of viral infections. Plasmodesmatal trafficking is either passive (e.g., diffusion) or active and responses both to developmental and environmental stimuli. In general, plasmodesmatal conductivity is regulated by the controlled build-up of callose at the plasmodesmatal neck, largely mediated by the antagonistic action of callose synthases (CalSs) and β-1,3-glucanases. Here, in this theory and hypothesis paper, we outline the importance of callose metabolism in PD SEL control, and highlight the main molecular factors involved. In addition, we also review other proteins that regulate symplastic PD transport, both in a developmental and stress-responsive framework, and discuss on their putative role in the modulation of PD callose turn-over. Finally, we hypothesize on the role of structural sterols in the regulation of (PD) callose deposition and outline putative mechanisms by which this regulation may occur. PMID:24795733

  9. Developmental control of hypoxia during bud burst in grapevine.

    PubMed

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  10. Major epigenetic development distinguishing neuronal and non-neuronal cells occurs postnatally in the murine hypothalamus

    USDA-ARS?s Scientific Manuscript database

    Prenatal and early postnatal environment can persistently alter one's risk of obesity. Environmental effects on hypothalamic developmental epigenetics constitute a likely mechanism underlying such 'developmental programming' of energy balance regulation. To advance our understanding of these process...

  11. Developmental Social Cognitive Neuroscience: Insights from Deafness

    ERIC Educational Resources Information Center

    Corina, David; Singleton, Jenny

    2009-01-01

    The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…

  12. 29 CFR 1952.221 - Developmental schedule.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...

  13. DNA Replication Control During Drosophila Development: Insights into the Onset of S Phase, Replication Initiation, and Fork Progression

    PubMed Central

    Hua, Brian L.; Orr-Weaver, Terry L.

    2017-01-01

    Proper control of DNA replication is critical to ensure genomic integrity during cell proliferation. In addition, differential regulation of the DNA replication program during development can change gene copy number to influence cell size and gene expression. Drosophila melanogaster serves as a powerful organism to study the developmental control of DNA replication in various cell cycle contexts in a variety of differentiated cell and tissue types. Additionally, Drosophila has provided several developmentally regulated replication models to dissect the molecular mechanisms that underlie replication-based copy number changes in the genome, which include differential underreplication and gene amplification. Here, we review key findings and our current understanding of the developmental control of DNA replication in the contexts of the archetypal replication program as well as of underreplication and differential gene amplification. We focus on the use of these latter two replication systems to delineate many of the molecular mechanisms that underlie the developmental control of replication initiation and fork elongation. PMID:28874453

  14. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    PubMed Central

    Bartley, Glenn E; Ishida, Betty K

    2003-01-01

    Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

  15. The GABA excitatory/inhibitory developmental sequence: a personal journey.

    PubMed

    Ben-Ari, Y

    2014-10-24

    The developing brain is talkative but its language is not that of the adult. Most if not all voltage and transmitter-gated ionic currents follow a developmental sequence and network-driven patterns differ in immature and adult brains. This is best illustrated in studies engaged almost three decades ago in which we observed elevated intracellular chloride (Cl(-))i levels and excitatory GABA early during development and a perinatal excitatory/inhibitory shift. This sequence is observed in a wide range of brain structures and animal species suggesting that it has been conserved throughout evolution. It is mediated primarily by a developmentally regulated expression of the NKCC1 and KCC2 chloride importer and exporter respectively. The GABAergic depolarization acts in synergy with N-methyl-d-aspartate (NMDA) receptor-mediated and voltage-gated calcium currents to enhance intracellular calcium exerting trophic effects on neuritic growth, migration and synapse formation. These sequences can be deviated in utero by genetic or environmental insults leading to a persistence of immature features in the adult brain. This "neuroarcheology" concept paves the way to novel therapeutic perspectives based on the use of drugs that block immature but not adult currents. This is illustrated notably with the return to immature high levels of chloride and excitatory actions of GABA observed in many pathological conditions. This is due to the fact that in the immature brain a down regulation of KCC2 and an up regulation of NKCC1 are seen. Here, I present a personal history of how an unexpected observation led to novel concepts in developmental neurobiology and putative treatments of autism and other developmental disorders. Being a personal account, this review is neither exhaustive nor provides an update of this topic with all the studies that have contributed to this evolution. We all rely on previous inventors to allow science to advance. Here, I present a personal summary of this topic primarily to illustrate why we often fail to comprehend the implications of our own observations. They remind us - and policy deciders - why Science cannot be programed, requiring time, and risky investigations that raise interesting questions before being translated from bench to bed. Discoveries are always on sideways, never on highways. Copyright © 2014 The Author. Published by Elsevier Ltd.. All rights reserved.

  16. CB1 Cannabinoid Receptor Expression in the Striatum: Association with Corticostriatal Circuits and Developmental Regulation

    PubMed Central

    Van Waes, Vincent; Beverley, Joel A.; Siman, Homayoun; Tseng, Kuei Y.; Steiner, Heinz

    2012-01-01

    Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains). We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25) and then progressively decreases toward adolescent (P40) and adult (P70) levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors) tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors) receive inputs from cortical regions with higher expression (medial prefrontal cortex). In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important. PMID:22416230

  17. Ovary transcriptome profiling via artificial intelligence reveals a transcriptomic fingerprint predicting egg quality in striped bass, Morone saxatilis.

    PubMed

    Chapman, Robert W; Reading, Benjamin J; Sullivan, Craig V

    2014-01-01

    Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic "fingerprint". Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness.

  18. Identification of Chemicals Inducing Cardiomyocyte Proliferation in Developmental Stage-Specific Manner with Pluripotent Stem Cells

    PubMed Central

    Uosaki, Hideki; Magadum, Ajit; Seo, Kinya; Fukushima, Hiroyuki; Takeuchi, Ayako; Nakagawa, Yasuaki; Moyes, Kara White; Narazaki, Genta; Kuwahara, Koichiro; Laflamme, Michael; Matsuoka, Satoshi; Nakatsuji, Norio; Nakao, Kazuwa; Kwon, Chulan; Kass, David A.; Engel, Felix B.; Yamashita, Jun K.

    2013-01-01

    Background The proliferation of cardiomyocytes is highly restricted after postnatal maturation, limiting heart regeneration. Elucidation of the regulatory machineries for the proliferation and growth arrest of cardiomyocytes is imperative. Chemical biology is efficient to dissect molecular mechanisms of various cellular events and often provide therapeutic potentials. We have been investigating cardiovascular differentiation with pluripotent stem cells (PSCs). The combination of stem cell and chemical biology can provide novel approaches to investigate the molecular mechanisms and manipulation of cardiomyocyte proliferation. Methods and Results To identify chemicals that regulate cardiomyocyte proliferation, we performed a screening of a defined chemical library based on proliferation of mouse PSC-derived cardiomyocytes and identified 4 chemical compound groups - inhibitors of glycogen synthase kinase-3 (GSK3), p38 mitogen-activated protein kinase (MAPK) and Ca2+/calmodulin-dependent protein kinase II (CaMKII), and activators of extracellular signal-regulated kinase (ERK). Several appropriate combinations of chemicals synergistically enhanced proliferation of cardiomyocytes derived from both mouse and human PSCs, notably up to a 14-fold increase in mouse cardiomyocytes. We also examined the effects of identified chemicals on cardiomyocytes in various developmental stages and species. Whereas ERK activators and CaMKII inhibitors showed proliferative effects only on cardiomyocytes in early developmental stages, GSK3 and p38 MAPK inhibitors substantially and synergistically induced reentry and progression of cell cycle in not only neonatal but also adult cardiomyocytes. Conclusions Our approach successfully uncovered novel molecular targets and mechanisms controlling cardiomyocyte proliferation in distinct developmental stages and offered PSC-derived cardiomyocytes as a potent tool to explore chemical-based cardiac regenerative strategies. PMID:24141057

  19. Optogenetic Examination of Prefrontal-Amygdala Synaptic Development.

    PubMed

    Arruda-Carvalho, Maithe; Wu, Wan-Chen; Cummings, Kirstie A; Clem, Roger L

    2017-03-15

    A brain network comprising the medial prefrontal cortex (mPFC) and amygdala plays important roles in developmentally regulated cognitive and emotional processes. However, very little is known about the maturation of mPFC-amygdala circuitry. We conducted anatomical tracing of mPFC projections and optogenetic interrogation of their synaptic connections with neurons in the basolateral amygdala (BLA) at neonatal to adult developmental stages in mice. Results indicate that mPFC-BLA projections exhibit delayed emergence relative to other mPFC pathways and establish synaptic transmission with BLA excitatory and inhibitory neurons in late infancy, events that coincide with a massive increase in overall synaptic drive. During subsequent adolescence, mPFC-BLA circuits are further modified by excitatory synaptic strengthening as well as a transient surge in feedforward inhibition. The latter was correlated with increased spontaneous inhibitory currents in excitatory neurons, suggesting that mPFC-BLA circuit maturation culminates in a period of exuberant GABAergic transmission. These findings establish a time course for the onset and refinement of mPFC-BLA transmission and point to potential sensitive periods in the development of this critical network. SIGNIFICANCE STATEMENT Human mPFC-amygdala functional connectivity is developmentally regulated and figures prominently in numerous psychiatric disorders with a high incidence of adolescent onset. However, it remains unclear when synaptic connections between these structures emerge or how their properties change with age. Our work establishes developmental windows and cellular substrates for synapse maturation in this pathway involving both excitatory and inhibitory circuits. The engagement of these substrates by early life experience may support the ontogeny of fundamental behaviors but could also lead to inappropriate circuit refinement and psychopathology in adverse situations. Copyright © 2017 the authors 0270-6474/17/372976-10$15.00/0.

  20. Ovary Transcriptome Profiling via Artificial Intelligence Reveals a Transcriptomic Fingerprint Predicting Egg Quality in Striped Bass, Morone saxatilis

    PubMed Central

    2014-01-01

    Inherited gene transcripts deposited in oocytes direct early embryonic development in all vertebrates, but transcript profiles indicative of embryo developmental competence have not previously been identified. We employed artificial intelligence to model profiles of maternal ovary gene expression and their relationship to egg quality, evaluated as production of viable mid-blastula stage embryos, in the striped bass (Morone saxatilis), a farmed species with serious egg quality problems. In models developed using artificial neural networks (ANNs) and supervised machine learning, collective changes in the expression of a limited suite of genes (233) representing <2% of the queried ovary transcriptome explained >90% of the eventual variance in embryo survival. Egg quality related to minor changes in gene expression (<0.2-fold), with most individual transcripts making a small contribution (<1%) to the overall prediction of egg quality. These findings indicate that the predictive power of the transcriptome as regards egg quality resides not in levels of individual genes, but rather in the collective, coordinated expression of a suite of transcripts constituting a transcriptomic “fingerprint”. Correlation analyses of the corresponding candidate genes indicated that dysfunction of the ubiquitin-26S proteasome, COP9 signalosome, and subsequent control of the cell cycle engenders embryonic developmental incompetence. The affected gene networks are centrally involved in regulation of early development in all vertebrates, including humans. By assessing collective levels of the relevant ovarian transcripts via ANNs we were able, for the first time in any vertebrate, to accurately predict the subsequent embryo developmental potential of eggs from individual females. Our results show that the transcriptomic fingerprint evidencing developmental dysfunction is highly predictive of, and therefore likely to regulate, egg quality, a biologically complex trait crucial to reproductive fitness. PMID:24820964

  1. The Two Faces of Temptation: Differing Motives for Self-Control

    ERIC Educational Resources Information Center

    Jensen-Campbell, Lauri A.; Graziano, William G.

    2005-01-01

    Self-regulation is critical to social and personality development in all cultures. Self-regulation may have developmental origins in temperament, yet it also interacts with socialization processes. This research specifically probes children's self-regulation during resistance to temptation. Socialization of self-regulation may be influenced by the…

  2. Developmentally defined forebrain circuits regulate appetitive and aversive olfactory learning.

    PubMed

    Muthusamy, Nagendran; Zhang, Xuying; Johnson, Caroline A; Yadav, Prem N; Ghashghaei, H Troy

    2017-01-01

    Postnatal and adult neurogenesis are region- and modality-specific, but the significance of developmentally distinct neuronal populations remains unclear. We demonstrate that chemogenetic inactivation of a subset of forebrain and olfactory neurons generated at birth disrupts responses to an aversive odor. In contrast, novel appetitive odor learning is sensitive to inactivation of adult-born neurons, revealing that developmentally defined sets of neurons may differentially participate in hedonic aspects of sensory learning.

  3. Calcium-binding proteins and development

    NASA Technical Reports Server (NTRS)

    Beckingham, K.; Lu, A. Q.; Andruss, B. F.; McIntire, L. V. (Principal Investigator)

    1998-01-01

    The known roles for calcium-binding proteins in developmental signaling pathways are reviewed. Current information on the calcium-binding characteristics of three classes of cell-surface developmental signaling proteins (EGF-domain proteins, cadherins and integrins) is presented together with an overview of the intracellular pathways downstream of these surface receptors. The developmental roles delineated to date for the universal intracellular calcium sensor, calmodulin, and its targets, and for calcium-binding regulators of the cytoskeleton are also reviewed.

  4. Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

    PubMed Central

    2010-01-01

    Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

  5. Tumorigenic Properties of Drosophila Epithelial Cells Mutant for lethal giant larvae.

    PubMed

    Calleja, Manuel; Morata, Ginés; Casanova, Jordi

    2016-08-01

    Mutations in Drosophila tumor suppressor genes (TSGs) lead to the formation of invasive tumors in the brain and imaginal discs. Here we studied the tumorigenic properties of imaginal discs mutant for the TSG gene lethal giant larvae (lgl). lgl mutant cells display the characteristic features of mammalian tumor cells: they can proliferate indefinitely, induce additional tracheogenesis (an insect counterpart of vasculogenesis) and invade neighboring tissues. Lgl mutant tissues exhibit high apoptotic levels, which lead to the activation of the Jun-N-Terminal Kinase (JNK) pathway. We propose that JNK is a key factor in the acquisition of these tumorigenic properties; it promotes cell proliferation and induces high levels of Mmp1 and confers tumor cells capacity to invade wild-type tissue. Noteworthy, lgl RNAi-mediated down-regulation does not produce similar transformations in the central nervous system (CNS), thereby indicating a fundamental difference between the cells of developing imaginal discs and those of differentiated organs. We discuss these results in the light of the "single big-hit origin" of some human pediatric or developmental cancers. Down-regulation of lgl in imaginal discs is sufficient to enhance tracheogenesis and to promote invasion and colonization of other larval structures including the CNS. Developmental Dynamics 245:834-843, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Regulation of mouse lung development by the extracellular calcium-sensing receptor, CaR

    PubMed Central

    Finney, Brenda A; del Moral, Pierre M; Wilkinson, William J; Cayzac, Sebastien; Cole, Martin; Warburton, David; Kemp, Paul J; Riccardi, Daniela

    2008-01-01

    Postnatal lung function is critically dependent upon optimal embryonic lung development. As the free ionized plasma calcium concentration ([Ca2+]o) of the fetus is higher than that of the adult, the process of lung development occurs in a hypercalcaemic environment. In the adult, [Ca2+]o is monitored by the G-protein coupled, extracellular calcium-sensing receptor (CaR), but neither its ontogeny nor its potential role in lung development are known. Here, we demonstrate that CaR is expressed in the mouse lung epithelium, and that its expression is developmentally regulated, with a peak of expression at embryonic day 12.5 (E12.5) and a subsequent decrease by E18, after which the receptor is absent. Experiments carried out using the lung explant culture model in vitro show that lung branching morphogenesis is sensitive to [Ca2+]o, being maximal at physiological adult [Ca2+]o (i.e. 1.0–1.3 mm) and lowest at the higher, fetal (i.e. 1.7 mm) [Ca2+]o. Administration of the specific CaR positive allosteric modulator, the calcimimetic R-568, mimics the suppressive effects of high [Ca2+]o on branching morphogenesis while both phospholipase C and PI3 kinase inhibition reverse these effects. CaR activation suppresses cell proliferation while it enhances intracellular calcium signalling, lung distension and fluid secretion. Conditions which are restrictive either to branching or to secretion can be rescued by manipulating [Ca2+]o in the culture medium. In conclusion, fetal Cao2+, acting through a developmentally regulated CaR, is an important extrinsic factor that modulates the intrinsic lung developmental programme. Our observations support a novel role for the CaR in preventing hyperplastic lung disease in utero. PMID:18955379

  7. Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

    PubMed Central

    Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

    2017-01-01

    Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

  8. Developmental regulation of myeloerythroid progenitor function by the Lin28b–let-7–Hmga2 axis

    PubMed Central

    Rowe, R. Grant; Wang, Leo D.; Coma, Silvia; Pearson, Daniel S.; Nguyen, Phi T.; Wagers, Amy J.

    2016-01-01

    For appropriate development, tissue and organ system morphogenesis and maturation must occur in synchrony with the overall developmental requirements of the host. Mistiming of such developmental events often results in disease. The hematopoietic system matures from the fetal state, characterized by robust erythrocytic output that supports prenatal growth in the hypoxic intrauterine environment, to the postnatal state wherein granulocytes predominate to provide innate immunity. Regulation of the developmental timing of these myeloerythroid states is not well understood. In this study, we find that expression of the heterochronic factor Lin28b decreases in common myeloid progenitors during hematopoietic maturation to adulthood in mice. This decrease in Lin28b coincides with accumulation of mature let-7 microRNAs, whose biogenesis is regulated by Lin28 proteins. We find that inhibition of let-7 in the adult hematopoietic system recapitulates fetal erythroid-dominant hematopoiesis. Conversely, deletion of Lin28b or ectopic activation of let-7 microRNAs in the fetal state induces a shift toward adult-like myeloid-dominant output. Furthermore, we identify Hmga2 as an effector of this genetic switch. These studies provide the first detailed analysis of the roles of endogenous Lin28b and let-7 in the timing of hematopoietic states during development. PMID:27401346

  9. Mitochondrial Dysfunction Plus High-Sugar Diet Provokes a Metabolic Crisis That Inhibits Growth.

    PubMed

    Kemppainen, Esko; George, Jack; Garipler, Görkem; Tuomela, Tea; Kiviranta, Essi; Soga, Tomoyoshi; Dunn, Cory D; Jacobs, Howard T

    2016-01-01

    The Drosophila mutant tko25t exhibits a deficiency of mitochondrial protein synthesis, leading to a global insufficiency of respiration and oxidative phosphorylation. This entrains an organismal phenotype of developmental delay and sensitivity to seizures induced by mechanical stress. We found that the mutant phenotype is exacerbated in a dose-dependent fashion by high dietary sugar levels. tko25t larvae were found to exhibit severe metabolic abnormalities that were further accentuated by high-sugar diet. These include elevated pyruvate and lactate, decreased ATP and NADPH. Dietary pyruvate or lactate supplementation phenocopied the effects of high sugar. Based on tissue-specific rescue, the crucial tissue in which this metabolic crisis initiates is the gut. It is accompanied by down-regulation of the apparatus of cytosolic protein synthesis and secretion at both the RNA and post-translational levels, including a novel regulation of S6 kinase at the protein level.

  10. Mitochondrial Dysfunction Plus High-Sugar Diet Provokes a Metabolic Crisis That Inhibits Growth

    PubMed Central

    Kemppainen, Esko; George, Jack; Garipler, Görkem; Tuomela, Tea; Kiviranta, Essi; Soga, Tomoyoshi; Dunn, Cory D.; Jacobs, Howard T.

    2016-01-01

    The Drosophila mutant tko25t exhibits a deficiency of mitochondrial protein synthesis, leading to a global insufficiency of respiration and oxidative phosphorylation. This entrains an organismal phenotype of developmental delay and sensitivity to seizures induced by mechanical stress. We found that the mutant phenotype is exacerbated in a dose-dependent fashion by high dietary sugar levels. tko25t larvae were found to exhibit severe metabolic abnormalities that were further accentuated by high-sugar diet. These include elevated pyruvate and lactate, decreased ATP and NADPH. Dietary pyruvate or lactate supplementation phenocopied the effects of high sugar. Based on tissue-specific rescue, the crucial tissue in which this metabolic crisis initiates is the gut. It is accompanied by down-regulation of the apparatus of cytosolic protein synthesis and secretion at both the RNA and post-translational levels, including a novel regulation of S6 kinase at the protein level. PMID:26812173

  11. Plasmodesmata: channels for intercellular signaling during plant growth and development.

    PubMed

    Sevilem, Iris; Yadav, Shri Ram; Helariutta, Ykä

    2015-01-01

    Plants have evolved strategies for short- and long-distance communication to coordinate plant development and to adapt to changing environmental conditions. Plasmodesmata (PD) are intercellular nanochannels that provide an effective pathway for both selective and nonselective movement of various molecules that function in diverse biological processes. Numerous non-cell-autonomous proteins (NCAP) and small RNAs have been identified that have crucial roles in cell fate determination and organ patterning during development. Both the density and aperture size of PD are developmentally regulated, allowing formation of spatial symplastic domains for establishment of tissue-specific developmental programs. The PD size exclusion limit (SEL) is controlled by reversible deposition of callose, as well as by some PD-associated proteins. Although a large number of PD-associated proteins have been identified, many of their functions remain unknown. Despite the fact that PD are primarily membranous structures, surprisingly very little is known about their lipid composition. Thus, future studies in PD biology will provide deeper insights into the high-resolution structure and tightly regulated functions of PD and the evolution of PD-mediated cell-to-cell communication in plants.

  12. Do Hassles and Uplifts Change with Age? Longitudinal Findings from the VA Normative Aging Study

    PubMed Central

    Aldwin, Carolyn M.; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

    2014-01-01

    To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed three scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Growth based modelling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative non-linear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. PMID:24660796

  13. Do hassles and uplifts change with age? Longitudinal findings from the VA normative aging study.

    PubMed

    Aldwin, Carolyn M; Jeong, Yu-Jin; Igarashi, Heidi; Spiro, Avron

    2014-03-01

    To examine emotion regulation in later life, we contrasted the modified hedonic treadmill theory with developmental theories, using hassles and uplifts to assess emotion regulation in context. The sample was 1,315 men from the VA Normative Aging Study aged 53 to 85 years, who completed 3,894 observations between 1989 and 2004. We computed 3 scores for both hassles and uplifts: intensity (ratings reflecting appraisal processes), exposure (count), and summary (total) scores. Growth curves over age showed marked differences in trajectory patterns for intensity and exposure scores. Although exposure to hassles and uplifts decreased in later life, intensity scores increased. Group-based modeling showed individual differences in patterns of hassles and uplifts intensity and exposure, with relative stability in uplifts intensity, normative nonlinear changes in hassles intensity, and complex patterns of individual differences in exposure for both hassles and uplifts. Analyses with the summary scores showed that emotion regulation in later life is a function of both developmental change and contextual exposure, with different patterns emerging for hassles and uplifts. Thus, support was found for both hedonic treadmill and developmental change theories, reflecting different aspects of emotion regulation in late life. (c) 2014 APA, all rights reserved.

  14. H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

    PubMed

    Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

    1996-03-01

    H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

  15. H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

    PubMed Central

    Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

    1996-01-01

    H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

  16. Environmental Toxicants and Developmental Disabilities: A Challenge for Psychologists

    ERIC Educational Resources Information Center

    Koger, Susan M.; Schettler, Ted; Weiss, Bernard

    2005-01-01

    Developmental, learning, and behavioral disabilities are a significant public health problem. Environmental chemicals can interfere with brain development during critical periods, thereby impacting sensory, motor, and cognitive function. Because regulation in the United States is based on limited testing protocols and essentially requires proof of…

  17. Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

    USDA-ARS?s Scientific Manuscript database

    A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

  18. Developmental palaeobiology of trilobite eyes and its evolutionary significance

    NASA Astrophysics Data System (ADS)

    Thomas, A. T.

    2005-06-01

    Understanding of the calcified composite eyes of trilobites, the oldest preserved visual system, has advanced greatly in recent decades. Three types of trilobite eye occur, the more derived abathochroal and schizochroal types having evolved neotenically from holochroal eyes. Comparative morphology and phylogenetic considerations suggest that all three eye-types were underlain by common developmental systems. So far, understanding of these systems has been based entirely on morphological data from fossils, particularly the way the visual surface grew and the patterning of lens emplacement. Lenses characteristically form a hexagonal array comprising horizontal rows and, conspicuously in schizochroal eyes, dorso-ventral files. Because individual trilobites sometimes have eyes with different numbers of files, file number must reflect the operation of a developmental programme rather than being under immediate genetic control. An empirical developmental model has been devised to describe trilobite eye development, with separate rules dealing with the initiation of lens emplacement, growth and differentiation of the visual surface, and the termination of lens emplacement. Rarely, trilobites may have visual surfaces of normal size, but which lack lenses. This confirms that visual surface growth must have been regulated separately from lens emplacement, and is a feature that cannot be accounted for by the existing developmental model. Such a developmental separation is one of a number of similarities shared with Drosophila, the modern arthropod in which eye development is best understood. Many aspects of eye development are conserved in the Euarthropoda, and in bilaterian metazoans in general. A revised model for trilobite eye development is proposed using extant phylogenetic bracketing, interpreting morphological data from the fossils in the context of the hierarchy of developmental controls now becoming known from living animals. This new model suggests that overall eye shape and size did not require differential growth of the generative zone, as previously thought, and that no separate instruction was needed to specify the termination of lens emplacement. Instead, these features were regulated directly, by controlling the proliferation of cells making up the nascent visual surface. A process documented from Drosophila, which involves the selective inhibition of cells in front of a wave-like front of differentiation, and that is regulated by widely conserved genes, can be used to explain how the trilobite visual surface became differentiated. The model implies also that changes in hormonally regulated developmental pathways known from recent arthropods may have been responsible for the development of abathochroal and schizochroal eyes, and for heterochronic secondary eye reduction and blindness in trilobites.

  19. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  20. Targeting Developmental Pathways: The Achilles Heel of Cancer?

    PubMed

    Dempke, Wolfram C M; Fenchel, Klaus; Uciechowski, Peter; Chevassut, Timothy

    2017-01-01

    Developmental pathways (e.g., Notch, Hippo, Hedgehog, Wnt, and TGF-β/BMP/FGF) are networks of genes that act co-ordinately to establish the body plan, and disruptions of genes in one pathway can have effects in related pathways and may result in serious dysmorphogenesis or cancer. Interestingly, all developmental pathways are highly conserved cell signalling systems present in almost all multicellular organisms. In addition, they have a crucial role in cell proliferation, apoptosis, differentiation, and finally in organ development. Of note, almost all of these pathways promote oncogenesis through synergistic associations with the Hippo signalling pathway, and several lines of evidence have also indicated that these pathways (e.g., Wnt/β-catenin) may be implicated in checkpoint inhibitor resistance (e.g., CTLA-4, PD-1, and PD-L1). Since Notch inhibition in vivo results in partial loss of its stemness features such as self-renewal, chemoresistance, invasive and migratory potential, and tumorigenesis, these highly conserved developmental pathways are regarded as being critical for regulation of self-renewal in both embryonic and adult stem cells and hence are likely to be implicated in the maintenance of cancer stem cells. Many small molecules are currently in preclinical and early clinical development, and only two compounds are approved for treatment of advanced or metastatic basal cell carcinoma (vismodegib and sonidegib). Furthermore, therapeutic targeting of cancer stem cells using drugs that disrupt activated developmental pathways may also represent an attractive strategy that is potentially relevant to many types of malignancy, notably blood cancers, where the evidence for leukaemia stem cells is well established. Future work will hopefully pave the way for the development of new strategies for targeting these pervasive oncogenic pathways. © 2017 S. Karger AG, Basel.

  1. Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

    PubMed Central

    Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

    2007-01-01

    Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

  2. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  3. Markers of Developmentally Regulated Programmed Cell Death and Their Analysis in Cereal Seeds.

    PubMed

    Domínguez, Fernando; Cejudo, Francisco Javier

    2018-01-01

    Programmed cell death (PCD) is a key process for the development and differentiation of multicellular organisms, which is characterized by well-defined morphological and biochemical features. These include chromatin condensation, DNA degradation and nuclear fragmentation, with nucleases and proteases playing a relevant function in these processes. In this chapter we describe methods routinely used for the analysis of hallmarks of developmentally regulated PCD in cereal seed tissues, which are based on agarose and polyacrylamide gel electrophoresis, in situ staining of DNA fragmentation, and cell-free assays of relevant enzymatic activities.

  4. A Rhodium(III) Complex as an Inhibitor of Neural Precursor Cell Expressed, Developmentally Down-Regulated 8-Activating Enzyme with in Vivo Activity against Inflammatory Bowel Disease.

    PubMed

    Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang

    2017-01-12

    We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.

  5. Inference of developmental gene regulatory networks beyond classical model systems: new approaches in the post-genomic era.

    PubMed

    Fernandez-Valverde, Selene L; Aguilera, Felipe; Ramos-Díaz, René Alexander

    2018-06-18

    The advent of high-throughput sequencing technologies has revolutionized the way we understand the transformation of genetic information into morphological traits. Elucidating the network of interactions between genes that govern cell differentiation through development is one of the core challenges in genome research. These networks are known as developmental gene regulatory networks (dGRNs) and consist largely of the functional linkage between developmental control genes, cis-regulatory modules and differentiation genes, which generate spatially and temporally refined patterns of gene expression. Over the last 20 years, great advances have been made in determining these gene interactions mainly in classical model systems, including human, mouse, sea urchin, fruit fly, and worm. This has brought about a radical transformation in the fields of developmental biology and evolutionary biology, allowing the generation of high-resolution gene regulatory maps to analyse cell differentiation during animal development. Such maps have enabled the identification of gene regulatory circuits and have led to the development of network inference methods that can recapitulate the differentiation of specific cell-types or developmental stages. In contrast, dGRN research in non-classical model systems has been limited to the identification of developmental control genes via the candidate gene approach and the characterization of their spatiotemporal expression patterns, as well as to the discovery of cis-regulatory modules via patterns of sequence conservation and/or predicted transcription-factor binding sites. However, thanks to the continuous advances in high-throughput sequencing technologies, this scenario is rapidly changing. Here, we give a historical overview on the architecture and elucidation of the dGRNs. Subsequently, we summarize the approaches available to unravel these regulatory networks, highlighting the vast range of possibilities of integrating multiple technical advances and theoretical approaches to expand our understanding on the global of gene regulation during animal development in non-classical model systems. Such new knowledge will not only lead to greater insights into the evolution of molecular mechanisms underlying cell identity and animal body plans, but also into the evolution of morphological key innovations in animals.

  6. Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera.

    PubMed

    Barchuk, Angel R; Cristino, Alexandre S; Kucharski, Robert; Costa, Luciano F; Simões, Zilá L P; Maleszka, Ryszard

    2007-06-18

    In honeybees, differential feeding of female larvae promotes the occurrence of two different phenotypes, a queen and a worker, from identical genotypes, through incremental alterations, which affect general growth, and character state alterations that result in the presence or absence of specific structures. Although previous studies revealed a link between incremental alterations and differential expression of physiometabolic genes, the molecular changes accompanying character state alterations remain unknown. By using cDNA microarray analyses of >6,000 Apis mellifera ESTs, we found 240 differentially expressed genes (DEGs) between developing queens and workers. Many genes recorded as up-regulated in prospective workers appear to be unique to A. mellifera, suggesting that the workers' developmental pathway involves the participation of novel genes. Workers up-regulate more developmental genes than queens, whereas queens up-regulate a greater proportion of physiometabolic genes, including genes coding for metabolic enzymes and genes whose products are known to regulate the rate of mass-transforming processes and the general growth of the organism (e.g., tor). Many DEGs are likely to be involved in processes favoring the development of caste-biased structures, like brain, legs and ovaries, as well as genes that code for cytoskeleton constituents. Treatment of developing worker larvae with juvenile hormone (JH) revealed 52 JH responsive genes, specifically during the critical period of caste development. Using Gibbs sampling and Expectation Maximization algorithms, we discovered eight overrepresented cis-elements from four gene groups. Graph theory and complex networks concepts were adopted to attain powerful graphical representations of the interrelation between cis-elements and genes and objectively quantify the degree of relationship between these entities. We suggest that clusters of functionally related DEGs are co-regulated during caste development in honeybees. This network of interactions is activated by nutrition-driven stimuli in early larval stages. Our data are consistent with the hypothesis that JH is a key component of the developmental determination of queen-like characters. Finally, we propose a conceptual model of caste differentiation in A. mellifera based on gene-regulatory networks.

  7. Molecular determinants of caste differentiation in the highly eusocial honeybee Apis mellifera

    PubMed Central

    Barchuk, Angel R; Cristino, Alexandre S; Kucharski, Robert; Costa, Luciano F; Simões, Zilá LP; Maleszka, Ryszard

    2007-01-01

    Background In honeybees, differential feeding of female larvae promotes the occurrence of two different phenotypes, a queen and a worker, from identical genotypes, through incremental alterations, which affect general growth, and character state alterations that result in the presence or absence of specific structures. Although previous studies revealed a link between incremental alterations and differential expression of physiometabolic genes, the molecular changes accompanying character state alterations remain unknown. Results By using cDNA microarray analyses of >6,000 Apis mellifera ESTs, we found 240 differentially expressed genes (DEGs) between developing queens and workers. Many genes recorded as up-regulated in prospective workers appear to be unique to A. mellifera, suggesting that the workers' developmental pathway involves the participation of novel genes. Workers up-regulate more developmental genes than queens, whereas queens up-regulate a greater proportion of physiometabolic genes, including genes coding for metabolic enzymes and genes whose products are known to regulate the rate of mass-transforming processes and the general growth of the organism (e.g., tor). Many DEGs are likely to be involved in processes favoring the development of caste-biased structures, like brain, legs and ovaries, as well as genes that code for cytoskeleton constituents. Treatment of developing worker larvae with juvenile hormone (JH) revealed 52 JH responsive genes, specifically during the critical period of caste development. Using Gibbs sampling and Expectation Maximization algorithms, we discovered eight overrepresented cis-elements from four gene groups. Graph theory and complex networks concepts were adopted to attain powerful graphical representations of the interrelation between cis-elements and genes and objectively quantify the degree of relationship between these entities. Conclusion We suggest that clusters of functionally related DEGs are co-regulated during caste development in honeybees. This network of interactions is activated by nutrition-driven stimuli in early larval stages. Our data are consistent with the hypothesis that JH is a key component of the developmental determination of queen-like characters. Finally, we propose a conceptual model of caste differentiation in A. mellifera based on gene-regulatory networks. PMID:17577409

  8. Association of Transition Readiness to Intentional Self-Regulation and Hopeful Future Expectations in Youth With Illness.

    PubMed

    Hart, Laura C; Pollock, McLean; Hill, Sherika; Maslow, Gary

    Little is known about how transition readiness relates to other developmental skills of adolescence in youth with chronic illness. Better understanding of how transition readiness relates to these other developmental skills could lead to a broader array of tools to improve transition readiness. Intentional self-regulation (ISR) and hopeful future expectations (HFE) are 2 developmental skills of adolescence that improve with participation in developmental programming and thus are modifiable. We explored associations between transition readiness, as measured by the Transition Readiness Assessment Questionnaire 29 (TRAQ-29) and ISR and HFE in youth with chronic illness recruited from a variety of subspecialty clinics from a major southeast medical center. A total of 71 adolescents with chronic illness were included in the analysis. The TRAQ-29 Self-Advocacy domain showed positive associations to both ISR (P = .03) and HFE (P = .009). In addition, the TRAQ-29 overall had positive associations to HFE (P = .04). The significant associations between TRAQ-29 Self-Advocacy domain scores and ISR and HFE suggest that transition readiness is developing within the context of other developmental areas in adolescence. More work is needed to see if the programming that improves these other developmental skills might also improve transition readiness. Copyright © 2016 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

  9. Working Memory and Mathematics: A Review of Developmental, Individual Difference, and Cognitive Approaches

    ERIC Educational Resources Information Center

    Raghubar, Kimberly P.; Barnes, Marcia A.; Hecht, Steven A.

    2010-01-01

    Working memory refers to a mental workspace, involved in controlling, regulating, and actively maintaining relevant information to accomplish complex cognitive tasks (e.g. mathematical processing). Despite the potential relevance of a relation between working memory and math for understanding developmental and individual differences in…

  10. Motivational Selectivity Prospectively Predicts Couples' Realization of Their Goal to Have a Child

    ERIC Educational Resources Information Center

    Rauers, Antje; Böhnke, Anja; Riediger, Michaela

    2013-01-01

    Developmental theories have emphasized that motivational selectivity--focusing on a few goals instead of "wanting it all"--regulates development in individuals, dyads, or groups. We provide first evidence that this motivational strategy predicts an objective, goal-related developmental outcome years later. We followed up on initially…

  11. STAGE- AND SPECIES- SPECIFIC DEVELOPMENTAL TOXICITY OF ALL-TRANS RETINOIC ACID IN FOUR NATIVE NORTH AMERICAN RANIDS AND XENOPUS LAEVIS

    EPA Science Inventory

    Within the last decade there have been increasing reports of malformed amphibians across North America. Recently, it has been suggested that hindlimb malformations are a consequence of xenobiotic disruption of developmental pathways regulated by retinoids. To assess the validity ...

  12. Between and within Ethnic Differences in Strategic Learning: A Study of Developmental Mathematics Students

    ERIC Educational Resources Information Center

    Fong, Carlton J.; Zientek, Linda Reichwein; Yetkiner Ozel, Zeynep Ebrar; Phelps, Julie M.

    2015-01-01

    The present study investigated developmental mathematics students' efficacy beliefs for motivational, self-regulated learning, resource management, and cognitive strategies and which of these beliefs most differentiated European American, African American and Hispanic students in terms of their mathematics achievement. The diverse sample consisted…

  13. 45 CFR 1386.32 - Periodic reports: Federal assistance to State Developmental Disabilities Councils.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Periodic reports: Federal assistance to State Developmental Disabilities Councils. 1386.32 Section 1386.32 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE...

  14. An Atypical Phr Peptide Regulates the Developmental Switch Protein RapH ▿ †

    PubMed Central

    Mirouze, Nicolas; Parashar, Vijay; Baker, Melinda D.; Dubnau, David A.; Neiditch, Matthew B.

    2011-01-01

    Under conditions of nutrient limitation and high population density, the bacterium Bacillus subtilis can initiate a variety of developmental pathways. The signaling systems regulating B. subtilis differentiation are tightly controlled by switch proteins called Raps, named after the founding members of the family, which were shown to be response regulator aspartate phosphatases. A phr gene encoding a secreted pentapeptide that regulates the activity of its associated Rap protein was previously identified downstream of 8 of the chromosomally encoded rap genes. We identify and validate here the sequence of an atypical Phr peptide, PhrH, by in vivo and in vitro analyses. Using a luciferase reporter bioassay combined with in vitro experiments, we found that PhrH is a hexapeptide (TDRNTT), in contrast to the other characterized Phr pentapeptides. We also determined that phrH expression is driven by a promoter lying within rapH. Unlike the previously identified dedicated σH-driven phr promoters, it appears that phrH expression most likely requires σA. Furthermore, we show that PhrH can antagonize both of the known activities of RapH: the dephosphorylation of Spo0F and the sequestration of ComA, thus promoting the development of spores and the competent state. Finally, we propose that PhrH is the prototype of a newly identified class of Phr signaling molecules consisting of six amino acids. This class likely includes PhrI, which regulates RapI and the expression, excision, and transfer of the mobile genetic element ICEBs1. PMID:21908671

  15. Parental influences on children's self-regulation of energy intake: Insights from developmental literature on emotion regulation

    USDA-ARS?s Scientific Manuscript database

    This article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to childre...

  16. Socialization of Self-Regulation: Continuity and Discontinuity Over Age and Context.

    ERIC Educational Resources Information Center

    Brownell, Celia A.; Etheridge, Wendy; Hungerford, Anne; Kelley, Sue

    Self-regulation is a major developmental accomplishment that begins in infancy and continues throughout childhood. This study focused on early socialization of self-regulation, and examined whether there was a common core of self-regulation in young children cutting across contexts and age, and whether the same maternal behaviors operate similarly…

  17. Role of the pre- and post-natal environment in developmental programming of health and productivity.

    PubMed

    Reynolds, Lawrence P; Caton, Joel S

    2012-05-06

    The concept that developmental insults (for example, poor pre- or postnatal nutrition) can have long-term consequences on health and well-being of the offspring has been termed developmental programming. In livestock, developmental programming affects production traits, including growth, body composition, and reproduction. Although low birth weight was used as a proxy for compromised fetal development in the initial epidemiological studies, based on controlled studies using livestock and other animal models in the last two decades we now know that developmental programming can occur independently of any effects on birth weight. Studies in humans, rodents, and livestock also have confirmed the critical role of the placenta in developmental programming. In addition, the central role of epigenetic regulation in developmental programming has been confirmed. Lastly, relatively simple therapeutic/management strategies designed to 'rescue' placental development and function are being developed to minimize the effects of developmental programming on health and productivity of humans, livestock, and other mammals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  18. Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

    PubMed Central

    Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

    2015-01-01

    Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

  19. Superenhancer reprogramming drives a B-cell–epithelial transition and high-risk leukemia

    PubMed Central

    Hu, Yeguang; Zhang, Zhihong; Kashiwagi, Mariko; Yoshida, Toshimi; Joshi, Ila; Jena, Nilamani; Somasundaram, Rajesh; Emmanuel, Akinola Olumide; Sigvardsson, Mikael; Fitamant, Julien; El-Bardeesy, Nabeel; Gounari, Fotini; Van Etten, Richard A.; Georgopoulos, Katia

    2016-01-01

    IKAROS is required for the differentiation of highly proliferative pre-B-cell precursors, and loss of IKAROS function indicates poor prognosis in precursor B-cell acute lymphoblastic leukemia (B-ALL). Here we show that IKAROS regulates this developmental stage by positive and negative regulation of superenhancers with distinct lineage affiliations. IKAROS defines superenhancers at pre-B-cell differentiation genes together with B-cell master regulators such as PAX5, EBF1, and IRF4 but is required for a highly permissive chromatin environment, a function that cannot be compensated for by the other transcription factors. IKAROS is also highly enriched at inactive enhancers of genes normally expressed in stem–epithelial cells. Upon IKAROS loss, expression of pre-B-cell differentiation genes is attenuated, while a group of extralineage transcription factors that are directly repressed by IKAROS and depend on EBF1 relocalization at their enhancers for expression is induced. LHX2, LMO2, and TEAD–YAP1, normally kept separate from native B-cell transcription regulators by IKAROS, now cooperate directly with them in a de novo superenhancer network with its own feed-forward transcriptional reinforcement. Induction of de novo superenhancers antagonizes Polycomb repression and superimposes aberrant stem–epithelial cell properties in a B-cell precursor. This dual mechanism of IKAROS regulation promotes differentiation while safeguarding against a hybrid stem–epithelial–B-cell phenotype that underlies high-risk B-ALL. PMID:27664237

  20. Cumulative-Genetic Plasticity, Parenting and Adolescent Self-Regulation

    ERIC Educational Resources Information Center

    Belsky, Jay; Beaver, Kevin M.

    2011-01-01

    Background: The capacity to control or regulate one's emotions, cognitions and behavior is central to competent functioning, with limitations in these abilities associated with developmental problems. Parenting appears to influence such self-regulation. Here the differential-susceptibility hypothesis is tested that the more putative "plasticity…

  1. The Paradox of Regulations: A Commentary.

    ERIC Educational Resources Information Center

    Taylor, Steven J.

    1992-01-01

    This response to previous symposium papers (EC 604 155-161) concerning regulations and quality assurance in Intermediate Care Facilities for the Mentally Retarded (ICF/MR) sees regulations as the bureaucratization of values, identifies paradoxes implicit in regulatory controls, and urges reform of the current developmental disability service…

  2. Concise review: Pax6 transcription factor contributes to both embryonic and adult neurogenesis as a multifunctional regulator.

    PubMed

    Osumi, Noriko; Shinohara, Hiroshi; Numayama-Tsuruta, Keiko; Maekawa, Motoko

    2008-07-01

    Pax6 is a highly conserved transcription factor among vertebrates and is important in various developmental processes in the central nervous system (CNS), including patterning of the neural tube, migration of neurons, and formation of neural circuits. In this review, we focus on the role of Pax6 in embryonic and postnatal neurogenesis, namely, production of new neurons from neural stem/progenitor cells, because Pax6 is intensely expressed in these cells from the initial stage of CNS development and in neurogenic niches (the subgranular zone of the hippocampal dentate gyrus and the subventricular zone of the lateral ventricle) throughout life. Pax6 is a multifunctional player regulating proliferation and differentiation through the control of expression of different downstream molecules in a highly context-dependent manner.

  3. Proteomic Analysis of Fetal Ovary Reveals That Ovarian Developmental Potential Is Greater in Meishan Pigs than in Yorkshire Pigs

    PubMed Central

    Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De

    2015-01-01

    Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for the low reproductive efficiency reported in other obese breeds. The ovarian developmental potential was found to be greater in Meishan pigs than in Yorkshire pigs. PMID:26305539

  4. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  5. RNAseq Analysis of the Parasitic Nematode Strongyloides stercoralis Reveals Divergent Regulation of Canonical Dauer Pathways

    PubMed Central

    Stoltzfus, Jonathan D.; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J.; Lok, James B.

    2012-01-01

    The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies. PMID:23145190

  6. RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

    PubMed

    Stoltzfus, Jonathan D; Minot, Samuel; Berriman, Matthew; Nolan, Thomas J; Lok, James B

    2012-01-01

    The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i). The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP) signaling, insulin/IGF-1-like signaling (IIS), transforming growth factor β (TGFβ) signaling, and biosynthesis of dafachronic acid (DA) ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between the two species. Understanding the mechanisms governing L3i development may lead to novel treatment and control strategies.

  7. Understanding entrepreneurial intent in late adolescence: the role of intentional self-regulation and innovation.

    PubMed

    Geldhof, G John; Weiner, Michelle; Agans, Jennifer P; Mueller, Megan K; Lerner, Richard M

    2014-01-01

    Entrepreneurship represents a form of adaptive developmental regulation through which both entrepreneurs and their ecologies benefit. We describe entrepreneurship from the perspective of relational developmental systems theory, and examine the joint role of personal attributes, contextual attributes, and characteristics of person-context relationships in predicting entrepreneurial intent in a sample 3,461 college students enrolled in colleges and universities in the United States (60 % female; 61 % European American). Specifically, we tested whether personal characteristics (i.e., gender, intentional self-regulation skills, innovation orientation) and contextual factors (i.e., entrepreneurial parents) predicted college students' intentions to pursue an entrepreneurial career. Our findings suggest that self-regulation, innovation orientation, and having entrepreneurial role models (i.e., parents) predict entrepreneurial intent. Limitations and future directions for the study of youth entrepreneurship are discussed.

  8. Cellular Auxin Homeostasis under High Temperature Is Regulated through a SORTING NEXIN1–Dependent Endosomal Trafficking Pathway[C][W

    PubMed Central

    Hanzawa, Taiki; Shibasaki, Kyohei; Numata, Takahiro; Kawamura, Yukio; Gaude, Thierry; Rahman, Abidur

    2013-01-01

    High-temperature-mediated adaptation in plant architecture is linked to the increased synthesis of the phytohormone auxin, which alters cellular auxin homeostasis. The auxin gradient, modulated by cellular auxin homeostasis, plays an important role in regulating the developmental fate of plant organs. Although the signaling mechanism that integrates auxin and high temperature is relatively well understood, the cellular auxin homeostasis mechanism under high temperature is largely unknown. Using the Arabidopsis thaliana root as a model, we demonstrate that under high temperature, roots counterbalance the elevated level of intracellular auxin by promoting shootward auxin efflux in a PIN-FORMED2 (PIN2)-dependent manner. Further analyses revealed that high temperature selectively promotes the retrieval of PIN2 from late endosomes and sorts them to the plasma membrane through an endosomal trafficking pathway dependent on SORTING NEXIN1. Our results demonstrate that recycling endosomal pathway plays an important role in facilitating plants adaptation to increased temperature. PMID:24003052

  9. Environmental perception and epigenetic memory: mechanistic insight through FLC

    PubMed Central

    Berry, Scott; Dean, Caroline

    2015-01-01

    Chromatin plays a central role in orchestrating gene regulation at the transcriptional level. However, our understanding of how chromatin states are altered in response to environmental and developmental cues, and then maintained epigenetically over many cell divisions, remains poor. The floral repressor gene FLOWERING LOCUS C (FLC) in Arabidopsis thaliana is a useful system to address these questions. FLC is transcriptionally repressed during exposure to cold temperatures, allowing studies of how environmental conditions alter expression states at the chromatin level. FLC repression is also epigenetically maintained during subsequent development in warm conditions, so that exposure to cold may be remembered. This memory depends on molecular complexes that are highly conserved among eukaryotes, making FLC not only interesting as a paradigm for understanding biological decision-making in plants, but also an important system for elucidating chromatin-based gene regulation more generally. In this review, we summarize our understanding of how cold temperature induces a switch in the FLC chromatin state, and how this state is epigenetically remembered. We also discuss how the epigenetic state of FLC is reprogrammed in the seed to ensure a requirement for cold exposure in the next generation. Significance Statement FLOWERING LOCUS C (FLC) regulation provides a paradigm for understanding how chromatin can be modulated to determine gene expression in a developmental context. This review describes our current mechanistic understanding of how FLC expression is genetically specified and epigenetically regulated throughout the plant life cycle, and how this determines plant life-history strategy. PMID:25929799

  10. A systems biology approach toward understanding seed composition in soybean.

    PubMed

    Li, Ling; Hur, Manhoi; Lee, Joon-Yong; Zhou, Wenxu; Song, Zhihong; Ransom, Nick; Demirkale, Cumhur Yusuf; Nettleton, Dan; Westgate, Mark; Arendsee, Zebulun; Iyer, Vidya; Shanks, Jackie; Nikolau, Basil; Wurtele, Eve Syrkin

    2015-01-01

    The molecular, biochemical, and genetic mechanisms that regulate the complex metabolic network of soybean seed development determine the ultimate balance of protein, lipid, and carbohydrate stored in the mature seed. Many of the genes and metabolites that participate in seed metabolism are unknown or poorly defined; even more remains to be understood about the regulation of their metabolic networks. A global omics analysis can provide insights into the regulation of seed metabolism, even without a priori assumptions about the structure of these networks. With the future goal of predictive biology in mind, we have combined metabolomics, transcriptomics, and metabolic flux technologies to reveal the global developmental and metabolic networks that determine the structure and composition of the mature soybean seed. We have coupled this global approach with interactive bioinformatics and statistical analyses to gain insights into the biochemical programs that determine soybean seed composition. For this purpose, we used Plant/Eukaryotic and Microbial Metabolomics Systems Resource (PMR, http://www.metnetdb.org/pmr, a platform that incorporates metabolomics data to develop hypotheses concerning the organization and regulation of metabolic networks, and MetNet systems biology tools http://www.metnetdb.org for plant omics data, a framework to enable interactive visualization of metabolic and regulatory networks. This combination of high-throughput experimental data and bioinformatics analyses has revealed sets of specific genes, genetic perturbations and mechanisms, and metabolic changes that are associated with the developmental variation in soybean seed composition. Researchers can explore these metabolomics and transcriptomics data interactively at PMR.

  11. Mechanisms linking energy balance and reproduction: impact of prenatal environment.

    PubMed

    Rhinehart, Erin M

    2016-01-01

    The burgeoning field of metabolic reproduction regulation has been gaining momentum due to highly frequent discoveries of new neuroendocrine factors regulating both energy balance and reproduction. Universally throughout the animal kingdom, energy deficits inhibit the reproductive axis, which demonstrates that reproduction is acutely sensitive to fuel availability. Entrainment of reproductive efforts with energy availability is especially critical for females because they expend large amounts of energy on gestation and lactation. Research has identified an assortment of both central and peripheral factors involved in the metabolic regulation of reproduction. From an evolutionary perspective, these mechanisms likely evolved to optimize reproductive fitness in an environment with an unpredictable food supply and regular bouts of famine. To be effective, however, the mechanisms responsible for the metabolic regulation of reproduction must also retain developmental plasticity to allow organisms to adapt their reproductive strategies to their particular niche. In particular, the prenatal environment has emerged as a critical developmental window for programming the mechanisms responsible for the metabolic control of reproduction. This review will discuss the current knowledge about hormonal and molecular mechanisms that entrain reproduction with prevailing energy availability. In addition, it will provide an evolutionary, human life-history framework to assist in the interpretation of findings on gestational programming of the female reproductive function, with a focus on pubertal timing as an example. Future research should aim to shed light on mechanisms underlying the prenatal modulation of the adaptation to an environment with unstable resources in a way that optimizes reproductive fitness.

  12. Developmental conditioning of endothelium-derived hyperpolarizing factor-mediated vasorelaxation

    PubMed Central

    Stead, Rebecca; Musa, Moji G.; Bryant, Claire L.; Lanham, Stuart A.; Johnston, David A.; Reynolds, Richard; Torrens, Christopher; Fraser, Paul A.; Clough, Geraldine F.

    2016-01-01

    Objectives: The endothelium maintains vascular homeostasis through the release of endothelium-derived relaxing factors (EDRF) and endothelium-derived hyperpolarization (EDH). The balance in EDH : EDRF is disturbed in cardiovascular disease and may also be susceptible to developmental conditioning through exposure to an adverse uterine environment to predispose to later risk of hypertension and vascular disease. Methods: Developmentally conditioned changes in EDH : EDRF signalling pathways were investigated in cremaster arterioles (18–32 μm diameter) and third-order mesenteric arteries of adult male mice offspring of dams fed either a fat-rich (high fat, HF, 45% energy from fat) or control (C, 10% energy from fat) diet. After weaning, offspring either continued on high fat or were placed on control diets to give four dietary groups (C/C, HF/C, C/HF, and HF/HF) and studied at 15 weeks of age. Results: EDH via intermediate (IKCa) and small (SKca) conductance calcium-activated potassium channels contributed less than 10% to arteriolar acetylcholine-induced relaxation in in-situ conditioned HF/C offspring compared with ∼60% in C/C (P < 0.01). The conditioned reduction in EDH signalling in HF/C offspring was reversed in offspring exposed to a high-fat diet both before and after weaning (HF/HF, 55%, P < 0.01 vs. HF/C). EDH signalling was unaffected in arterioles from C/HF offspring. The changes in EDH : EDRF were associated with altered endothelial cell expression and localization of IKCa channels. Conclusion: This is the first evidence that EDH-mediated microvascular relaxation is susceptible to an adverse developmental environment through down-regulation of the IKCa signalling pathway. Conditioned offspring exposed to a ‘second hit’ (HF/HF) exhibit adaptive vascular mechanisms to preserve dilator function. PMID:26682783

  13. Developmental conditioning of endothelium-derived hyperpolarizing factor-mediated vasorelaxation.

    PubMed

    Stead, Rebecca; Musa, Moji G; Bryant, Claire L; Lanham, Stuart A; Johnston, David A; Reynolds, Richard; Torrens, Christopher; Fraser, Paul A; Clough, Geraldine F

    2016-03-01

    The endothelium maintains vascular homeostasis through the release of endothelium-derived relaxing factors (EDRF) and endothelium-derived hyperpolarization (EDH). The balance in EDH : EDRF is disturbed in cardiovascular disease and may also be susceptible to developmental conditioning through exposure to an adverse uterine environment to predispose to later risk of hypertension and vascular disease. Developmentally conditioned changes in EDH : EDRF signalling pathways were investigated in cremaster arterioles (18-32  μm diameter) and third-order mesenteric arteries of adult male mice offspring of dams fed either a fat-rich (high fat, HF, 45% energy from fat) or control (C, 10% energy from fat) diet. After weaning, offspring either continued on high fat or were placed on control diets to give four dietary groups (C/C, HF/C, C/HF, and HF/HF) and studied at 15 weeks of age. EDH via intermediate (IKCa) and small (SKca) conductance calcium-activated potassium channels contributed less than 10% to arteriolar acetylcholine-induced relaxation in in-situ conditioned HF/C offspring compared with ∼60% in C/C (P < 0.01). The conditioned reduction in EDH signalling in HF/C offspring was reversed in offspring exposed to a high-fat diet both before and after weaning (HF/HF, 55%, P < 0.01 vs. HF/C). EDH signalling was unaffected in arterioles from C/HF offspring. The changes in EDH : EDRF were associated with altered endothelial cell expression and localization of IKCa channels. This is the first evidence that EDH-mediated microvascular relaxation is susceptible to an adverse developmental environment through down-regulation of the IKCa signalling pathway. Conditioned offspring exposed to a 'second hit' (HF/HF) exhibit adaptive vascular mechanisms to preserve dilator function.

  14. MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

    PubMed Central

    Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

    2015-01-01

    MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

  15. Developmental regulation of fear learning and anxiety behavior by endocannabinoids

    PubMed Central

    Lee, Tiffany T.-Y.; Hill, Matthew N.; Lee, Francis S.

    2015-01-01

    The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic endocannabinoid signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that endocannabinoid signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic endocannabinoid signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the endocannabinoid system and discuss clinical and rodent models demonstrating endocannabinoid regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the endocannabinoid system in the central nervous system, and models of pharmacological augmentation of endocannabinoid signaling during development in the context of fear learning and anxiety. PMID:26419643

  16. Identification of pathways directly regulated by SHORT VEGETATIVE PHASE during vegetative and reproductive development in Arabidopsis

    PubMed Central

    2013-01-01

    Background MADS-domain transcription factors play important roles during plant development. The Arabidopsis MADS-box gene SHORT VEGETATIVE PHASE (SVP) is a key regulator of two developmental phases. It functions as a repressor of the floral transition during the vegetative phase and later it contributes to the specification of floral meristems. How these distinct activities are conferred by a single transcription factor is unclear, but interactions with other MADS domain proteins which specify binding to different genomic regions is likely one mechanism. Results To compare the genome-wide DNA binding profile of SVP during vegetative and reproductive development we performed ChIP-seq analyses. These ChIP-seq data were combined with tiling array expression analysis, induction experiments and qRT-PCR to identify biologically relevant binding sites. In addition, we compared genome-wide target genes of SVP with those published for the MADS domain transcription factors FLC and AP1, which interact with SVP during the vegetative and reproductive phases, respectively. Conclusions Our analyses resulted in the identification of pathways that are regulated by SVP including those controlling meristem development during vegetative growth and flower development whereas floral transition pathways and hormonal signaling were regulated predominantly during the vegetative phase. Thus, SVP regulates many developmental pathways, some of which are common to both of its developmental roles whereas others are specific to only one of them. PMID:23759218

  17. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  18. Early development of rostrum saw-teeth in a fossil ray tests classical theories of the evolution of vertebrate dentitions.

    PubMed

    Smith, Moya Meredith; Riley, Alex; Fraser, Gareth J; Underwood, Charlie; Welten, Monique; Kriwet, Jürgen; Pfaff, Cathrin; Johanson, Zerina

    2015-10-07

    In classical theory, teeth of vertebrate dentitions evolved from co-option of external skin denticles into the oral cavity. This hypothesis predicts that ordered tooth arrangement and regulated replacement in the oral dentition were also derived from skin denticles. The fossil batoid ray Schizorhiza stromeri (Chondrichthyes; Cretaceous) provides a test of this theory. Schizorhiza preserves an extended cartilaginous rostrum with closely spaced, alternating saw-teeth, different from sawfish and sawsharks today. Multiple replacement teeth reveal unique new data from micro-CT scanning, showing how the 'cone-in-cone' series of ordered saw-teeth sets arrange themselves developmentally, to become enclosed by the roots of pre-existing saw-teeth. At the rostrum tip, newly developing saw-teeth are present, as mineralized crown tips within a vascular, cartilaginous furrow; these reorient via two 90° rotations then relocate laterally between previously formed roots. Saw-tooth replacement slows mid-rostrum where fewer saw-teeth are regenerated. These exceptional developmental data reveal regulated order for serial self-renewal, maintaining the saw edge with ever-increasing saw-tooth size. This mimics tooth replacement in chondrichthyans, but differs in the crown reorientation and their enclosure directly between roots of predecessor saw-teeth. Schizorhiza saw-tooth development is decoupled from the jaw teeth and their replacement, dependent on a dental lamina. This highly specialized rostral saw, derived from diversification of skin denticles, is distinct from the dentition and demonstrates the potential developmental plasticity of skin denticles. © 2015 The Authors.

  19. Brg1 modulates enhancer activation in mesoderm lineage commitment

    DOE PAGES

    Alexander, Jeffrey M.; Hota, Swetansu K.; He, Daniel; ...

    2015-03-26

    The interplay between different levels of gene regulation in modulating developmental transcriptional programs, such as histone modifications and chromatin remodeling, is not well understood. Here, we show that the chromatin remodeling factor Brg1 is required for enhancer activation in mesoderm induction. In an embryonic stem cell-based directed differentiation assay, the absence of Brg1 results in a failure of cardiomyocyte differentiation and broad deregulation of lineage-specific gene expression during mesoderm induction. We find that Brg1 co-localizes with H3K27ac at distal enhancers and is required for robust H3K27 acetylation at distal enhancers that are activated during mesoderm induction. Brg1 is also requiredmore » to maintain Polycomb-mediated repression of non-mesodermal developmental regulators, suggesting cooperativity between Brg1 and Polycomb complexes. Thus, Brg1 is essential for modulating active and repressive chromatin states during mesoderm lineage commitment, in particular the activation of developmentally important enhancers. In conclusion, these findings demonstrate interplay between chromatin remodeling complexes and histone modifications that, together, ensure robust and broad gene regulation during crucial lineage commitment decisions.« less

  20. Epigenetics and the Developmental Origins of Health and ...

    EPA Pesticide Factsheets

    Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

  1. Light-Mediated Hormonal Regulation of Plant Growth and Development.

    PubMed

    de Wit, Mieke; Galvão, Vinicius Costa; Fankhauser, Christian

    2016-04-29

    Light is crucial for plant life, and perception of the light environment dictates plant growth, morphology, and developmental changes. Such adjustments in growth and development in response to light conditions are often established through changes in hormone levels and signaling. This review discusses examples of light-regulated processes throughout a plant's life cycle for which it is known how light signals lead to hormonal regulation. Light acts as an important developmental switch in germination, photomorphogenesis, and transition to flowering, and light cues are essential to ensure light capture through architectural changes during phototropism and the shade avoidance response. In describing well-established links between light perception and hormonal changes, we aim to give insight into the mechanisms that enable plants to thrive in variable light environments.

  2. [The principle of the energy minimum in ontogeny and the channeling of developmental processes].

    PubMed

    Ozerniuk, N D

    1989-01-01

    The principle of minimum of energy in ontogenesis has been formulated on the basis of data concerning age changes in energetic metabolism, as well as the influence of ecological factors on this process. According to this principle the smallest expenditures of energy are observed in the zone of the most favorable developmental conditions. The minimal level of energetic metabolism at every developmental stage that corresponds to the most stable state of organism is treated as homeostasis and the developmental stability is treated as homeorrhesis. Regulation mechanisms of energetic metabolism during ontogenesis and under the influence of environmental factors are analyzed.

  3. Insulin/Insulin-like growth factor signaling controls non-Dauer developmental speed in the nematode Caenorhabditis elegans.

    PubMed

    Ruaud, Anne-Françoise; Katic, Iskra; Bessereau, Jean-Louis

    2011-01-01

    Identified as a major pathway controlling entry in the facultative dauer diapause stage, the DAF-2/Insulin receptor (InsR) signaling acts in multiple developmental and physiological regulation events in Caenorhabditis elegans. Here we identified a role of the insulin-like pathway in controlling developmental speed during the C. elegans second larval stage. This role relies on the canonical DAF-16/FOXO-dependent branch of the insulin-like signaling and is largely independent of dauer formation. Our studies provide further evidence for broad conservation of insulin/insulin-like growth factor (IGF) functions in developmental speed control.

  4. Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

    PubMed Central

    Chandra, Govind; Chater, Keith F

    2014-01-01

    To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

  5. 45 CFR 1386.90 - Notice of hearing or opportunity for hearing.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Notice of hearing or opportunity for hearing. 1386.90 Section 1386.90 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES THE ADMINISTRATION ON DEVELOPMENTAL DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM...

  6. Lifespan Development of Neuromodulation of Adaptive Control and Motivation as an Ontogenetic Mechanism for Developmental Niche Construction

    ERIC Educational Resources Information Center

    Li, Shu-Chen

    2013-01-01

    Instead of viewing organisms and individuals as passive recipients of their biological, ecological, and cultural inheritances, the developmental niche construction theory and the biocultural co-construction framework both emphasize that the individual's agency plays a key role in regulating how environmental and sociocontextual influences may…

  7. Developmental Conditions of Adaptive Self-Stabilization in Adolescence: An Exploratory Study

    ERIC Educational Resources Information Center

    Greve, Werner; Thomsen, Tamara

    2013-01-01

    In a cross-sectional study with 541 German students (mean age: 12.61 yrs) and (for a subsample of N = 350) one of their parents, developmental conditions for a particular resource of self-regulation ("Flexibility of Goal Adjustment"; Brandtstadter & Renner, 1990) are investigated. Theoretical ¨ arguments and empirical results from…

  8. Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

    PubMed

    Deschamps, Cícero; Simon, James E

    2010-01-01

    Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

  9. Progranulin regulates neurogenesis in the developing vertebrate retina.

    PubMed

    Walsh, Caroline E; Hitchcock, Peter F

    2017-09-01

    We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

  10. Self-Regulation Processes and Thriving in Childhood and Adolescence: A View of the Issues

    ERIC Educational Resources Information Center

    Lerner, Richard M.; Lerner, Jacqueline V.; Bowers, Edmond P.; Lewin-Bizan, Selva; Gestsdottir, Steinunn; Urban, Jennifer Brown

    2011-01-01

    Both organismic and intentional self-regulation processes must be integrated across childhood and adolescence for adaptive developmental regulations to exist and for the developing person to thrive, both during the first two decades of life and through the adult years. To date, such an integrated, life-span approach to self-regulation during…

  11. Relating empathy and emotion regulation: do deficits in empathy trigger emotion dysregulation?

    PubMed

    Schipper, Marc; Petermann, Franz

    2013-01-01

    Emotion regulation is a crucial skill in adulthood; its acquisition represents one of the key developmental tasks in early childhood. Difficulties with adaptive emotion regulation increase the risk of psychopathology in childhood and adulthood. This is, for instance, shown by a relation between emotion regulation and aggressive behavior in childhood age, indicating emotion dysregulation as an important risk factor of aggressive behavior and potential precursor of psychopathology. Based on (1) interrelations between emotion processes and social information processing (maladaptive emotion regulation and social information processing are associated with higher levels of aggression) and (2) recent neuroscientific findings showing that empathy deficits might not only result in difficulties labeling others' emotions but one's own emotions too, we suggest that empathy deficits might serve as potential trigger of emotion dysregulation. Different studies investigating the relation between empathy and emotion regulation are presented and discussed. Discussions are based on the assumed potential of empathy deficits triggering emotion dysregulation. Furthermore, developmental neuroscientific findings on empathy and emotion regulation are highlighted which provide further insights on how these processes might relate. Finally, possible directions for future research are presented.

  12. Nature and autonomy: an organizational view of social and neurobiological aspects of self-regulation in behavior and development.

    PubMed

    Ryan, R M; Kuhl, J; Deci, E L

    1997-01-01

    The concepts of self-regulation and autonomy are examined within an organizational framework. We begin by retracing the historical origins of the organizational viewpoint in early debates within the field of biology between vitalists and reductionists, from which the construct of self-regulation emerged. We then consider human autonomy as an evolved behavioral, developmental, and experiential phenomenon that operates at both neurobiological and psychological levels and requires very specific supports within higher order social organizations. We contrast autonomy or true self-regulation with controlling regulation (a nonautonomous form of intentional behavior) in phenomenological and functional terms, and we relate the forms of regulation to the developmental processes of intrinsic motivation and internalization. Subsequently, we describe how self-regulation versus control may be characterized by distinct neurobiological underpinnings, and we speculate about some of the adaptive advantages that may underlie the evolution of autonomy. Throughout, we argue that disturbances of autonomy, which have both biological and psychological etiologies, are central to many forms of psychopathology and social alienation.

  13. In vivo imaging of Dauer-specific neuronal remodeling in C. elegans.

    PubMed

    Schroeder, Nathan E; Flatt, Kristen M

    2014-09-04

    The mechanisms controlling stress-induced phenotypic plasticity in animals are frequently complex and difficult to study in vivo. A classic example of stress-induced plasticity is the dauer stage of C. elegans. Dauers are an alternative developmental larval stage formed under conditions of low concentrations of bacterial food and high concentrations of a dauer pheromone. Dauers display extensive developmental and behavioral plasticity. For example, a set of four inner-labial quadrant (IL2Q) neurons undergo extensive reversible remodeling during dauer formation. Utilizing the well-known environmental pathways regulating dauer entry, a previously established method for the production of crude dauer pheromone from large-scale liquid nematode cultures is demonstrated. With this method, a concentration of 50,000 - 75,000 nematodes/ml of liquid culture is sufficient to produce a highly potent crude dauer pheromone. The crude pheromone potency is determined by a dose-response bioassay. Finally, the methods used for in vivo time-lapse imaging of the IL2Qs during dauer formation are described.

  14. The Development of the Basal Ganglia in Capuchin Monkeys (Cebus apella)

    PubMed Central

    Phillips, Kimberley A.; Sobieski, Courtney A.; Gilbert, Valerie R.; Chiappini-Williamson, Christine; Sherwood, Chet C.; Strick, Peter L.

    2010-01-01

    The basal ganglia are subcortical structures involved in the planning, initiation and regulation of movement as well as a variety of non-motor, cognitive and affective functions. Capuchin monkeys share several important characteristics of development with humans, including a prolonged infancy and juvenile period, a long lifespan, and complex manipulative abilities. This makes capuchins important comparative models for understanding age-related neuroanatomical changes in these structures. Here we report developmental volumetric data on the three subdivisions of the basal ganglia, the caudate, putamen and globus pallidus in brown capuchin monkeys (Cebus apella). Based on a cross-sectional sample, we describe brain development in 28 brown capuchin monkeys (male n = 17, female n = 11; age range = 2 months – 20 years) using high-resolution structural MRI. We found that the raw volumes of the putamen and caudate varied significantly with age, decreasing in volume from birth through early adulthood. Notably, developmental changes did not differ between sexes. Because these observed developmental patterns are similar to humans, our results suggest that capuchin monkeys may be useful animal models for investigating neurodevelopmental disorders of the basal ganglia. PMID:20227397

  15. Emotion Regulation and the Transdiagnostic Role of Repetitive Negative Thinking in Adolescents with Social Anxiety and Depression.

    PubMed

    Klemanski, David H; Curtiss, Joshua; McLaughlin, Katie A; Nolen-Hoeksema, Susan

    2017-04-01

    Social anxiety and depression are common mental health problems among adolescents and are frequently comorbid. Primary aims of this study were to (1) elucidate the nature of individual differences in specific emotion regulation deficits among adolescents with symptoms of social anxiety and depression, and (2) determine whether repetitive negative thinking (RNT) functions as a transdiagnostic factor. A diverse sample of adolescents (N = 1065) completed measures assessing emotion regulation and symptoms of social anxiety and depression. Results indicated that adolescents with high levels of social anxiety and depression symptoms reported decreased emotional awareness, dysregulated emotion expression, and reduced use of emotion management strategies. The hypothesized structural model in which RNT functions as a transdiagnostic factor exhibited a better fit than an alternative model in which worry and rumination function as separate predictors of symptomatology. Findings implicate emotion regulation deficits and RNT in the developmental psychopathology of youth anxiety and mood disorders.

  16. Square cell packing in the Drosophila embryo through spatiotemporally regulated EGF receptor signaling

    PubMed Central

    Tamada, Masako; Zallen, Jennifer A.

    2015-01-01

    Summary Cells display dynamic and diverse morphologies during development, but the strategies by which differentiated tissues achieve precise shapes and patterns are not well understood. Here we identify a developmental program that generates a highly ordered square cell grid in the Drosophila embryo through sequential and spatially regulated cell alignment, oriented cell division, and apicobasal cell elongation. The basic leucine zipper transcriptional regulator Cnc is necessary and sufficient to produce a square cell grid in the presence of a midline signal provided by the EGF receptor ligand, Spitz. Spitz orients cell divisions through a Pins/LGN-dependent spindle positioning mechanism and controls cell shape and alignment through a transcriptional pathway that requires the Pointed ETS domain protein. These results identify a strategy for producing ordered square cell packing configurations in epithelia and reveal a molecular mechanism by which organized tissue structure is generated through spatiotemporally regulated responses to EGF receptor activation. PMID:26506305

  17. Relationships between Parent and Child Emotion Regulation Strategy Use: A Brief Report

    ERIC Educational Resources Information Center

    Bariola, Emily; Hughes, Elizabeth K.; Gullone, Eleonora

    2012-01-01

    We examined the direct relationships between parent and child emotion regulation (ER) strategy use during the transitionary and understudied developmental periods of middle childhood through to adolescence. Three hundred and seventy-nine participants aged between 9 and 19 years, completed the Emotion Regulation Questionnaire for Children and…

  18. Differences in Kindergartners' Participation and Regulation Strategies across Time and Instructional Contexts

    ERIC Educational Resources Information Center

    Neitzel, Carin; Connor, Lisa

    2017-01-01

    This study addressed questions about the function of children's various participation and regulation strategies in different instructional contexts and at different points in time in school. The developmental trajectories of kindergartners' academic participation and regulation strategy selection and use across the school year in teacher-directed…

  19. Focus on Preschool Aquatics: Child Care Regulations.

    ERIC Educational Resources Information Center

    Sayre, Nancy E.

    This paper proposes state regulations for the training of child care staff members in developmentally appropriate safe aquatic practices, outlines required features of any pools that children visit, and suggests safe practices for water-related activities at child care centers and swimming pools. The staff training regulation suggestions include…

  20. Activity-dependent regulation of NMDAR1 immunoreactivity in the developing visual cortex.

    PubMed

    Catalano, S M; Chang, C K; Shatz, C J

    1997-11-01

    NMDA receptors have been implicated in activity-dependent synaptic plasticity in the developing visual cortex. We examined the distribution of immunocytochemically detectable NMDAR1 in visual cortex of cats and ferrets from late embryonic ages to adulthood. Cortical neurons are initially highly immunostained. This level declines gradually over development, with the notable exception of cortical layers 2/3, where levels of NMDAR1 immunostaining remain high into adulthood. Within layer 4, the decline in NMDAR1 immunostaining to adult levels coincides with the completion of ocular dominance column formation and the end of the critical period for layer 4. To determine whether NMDAR1 immunoreactivity is regulated by retinal activity, animals were dark-reared or retinal activity was completely blocked in one eye with tetrodotoxin (TTX). Dark-rearing does not cause detectable changes in NMDAR1 immunoreactivity. However, 2 weeks of monocular TTX administration decreases NMDAR1 immunoreactivity in layer 4 of the columns of the blocked eye. Thus, high levels of NMDAR1 immunostaining within the visual cortex are temporally correlated with ocular dominance column formation and developmental plasticity; the persistence of staining in layers 2/3 also correlates with the physiological plasticity present in these layers in the adult. In addition, visual experience is not required for the developmental changes in the laminar pattern of NMDAR1 levels, but the presence of high levels of NMDAR1 in layer 4 during the critical period does require retinal activity. These observations are consistent with a central role for NMDA receptors in promoting and ultimately limiting synaptic rearrangements in the developing neocortex.

  1. Aspp2 negatively regulates body growth but not developmental timing by modulating IRS signaling in zebrafish embryos.

    PubMed

    Liu, Chengdong; Luan, Jing; Bai, Yan; Li, Yun; Lu, Ling; Liu, Yunzhang; Hakuno, Fumihiko; Takahashi, Shin-Ichiro; Duan, Cunming; Zhou, Jianfeng

    2014-02-01

    The growth and developmental rate of developing embryos and fetus are tightly controlled and coordinated to maintain proper body shape and size. The insulin receptor substrate (IRS) proteins, key intracellular transducers of insulin and insulin-like growth factor signaling, play essential roles in the regulation of growth and development. A short isoform of apoptosis-stimulating protein of p53 2 (ASPP2) was recently identified as a binding partner of IRS-1 and IRS-2 in mammalian cells in vitro. However, it is unclear whether ASPP2 plays any role in vertebrate embryonic growth and development. Here, we show that zebrafish Aspp2a and Aspp2b negatively regulate embryonic growth without affecting developmental rate. Human ASPP2 had similar effects on body growth in zebrafish embryos. Aspp2a and 2b inhibit Akt signaling. This inhibition was reversed by coinjection of myr-Akt1, a constitutively active form of Akt1. Zebrafish Aspp2a and Aspp2b physically bound with Irs-1, and the growth inhibitory effects of ASPP2/Aspp2 depend on the presence of their ankyrin repeats and SH3 domains. These findings uncover a novel role of Aspp2 in regulating vertebrate embryonic growth. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Berry skin development in Norton grape: distinct patterns of transcriptional regulation and flavonoid biosynthesis.

    PubMed

    Ali, Mohammad B; Howard, Susanne; Chen, Shangwu; Wang, Yechun; Yu, Oliver; Kovacs, Laszlo G; Qiu, Wenping

    2011-01-10

    The complex and dynamic changes during grape berry development have been studied in Vitis vinifera, but little is known about these processes in other Vitis species. The grape variety 'Norton', with a major portion of its genome derived from Vitis aestivalis, maintains high levels of malic acid and phenolic acids in the ripening berries in comparison with V. vinifera varieties such as Cabernet Sauvignon. Furthermore, Norton berries develop a remarkably high level of resistance to most fungal pathogens while Cabernet Sauvignon berries remain susceptible to those pathogens. The distinct characteristics of Norton and Cabernet Sauvignon merit a comprehensive analysis of transcriptional regulation and metabolite pathways. A microarray study was conducted on transcriptome changes of Norton berry skin during the period of 37 to 127 days after bloom, which represents berry developmental phases from herbaceous growth to full ripeness. Samples of six berry developmental stages were collected. Analysis of the microarray data revealed that a total of 3,352 probe sets exhibited significant differences at transcript levels, with two-fold changes between at least two developmental stages. Expression profiles of defense-related genes showed a dynamic modulation of nucleotide-binding site-leucine-rich repeat (NBS-LRR) resistance genes and pathogenesis-related (PR) genes during berry development. Transcript levels of PR-1 in Norton berry skin clearly increased during the ripening phase. As in other grapevines, genes of the phenylpropanoid pathway were up-regulated in Norton as the berry developed. The most noticeable was the steady increase of transcript levels of stilbene synthase genes. Transcriptional patterns of six MYB transcription factors and eleven structural genes of the flavonoid pathway and profiles of anthocyanins and proanthocyanidins (PAs) during berry skin development were analyzed comparatively in Norton and Cabernet Sauvignon. Transcriptional patterns of MYB5A and MYB5B were similar during berry development between the two varieties, but those of MYBPA1 and MYBPA2 were strikingly different, demonstrating that the general flavonoid pathways are regulated under different MYB factors. The data showed that there were higher transcript levels of the genes encoding flavonoid-3'-O-hydroxylase (F3'H), flavonoid-3',5'-hydroxylase (F3'5'H), leucoanthocyanidin dioxygenase (LDOX), UDP-glucose:flavonoid 3'-O-glucosyltransferase (UFGT), anthocyanidin reductase (ANR), leucoanthocyanidin reductase (LAR) 1 and LAR2 in berry skin of Norton than in those of Cabernet Sauvignon. It was also found that the total amount of anthocyanins was markedly higher in Norton than in Cabernet Sauvignon berry skin at harvest, and five anthocyanin derivatives and three PA compounds exhibited distinctive accumulation patterns in Norton berry skin. This study provides an overview of the transcriptome changes and the flavonoid profiles in the berry skin of Norton, an important North American wine grape, during berry development. The steady increase of transcripts of PR-1 and stilbene synthase genes likely contributes to the developmentally regulated resistance during ripening of Norton berries. More studies are required to address the precise role of each stilbene synthase gene in berry development and disease resistance. Transcriptional regulation of MYBA1, MYBA2, MYB5A and MYBPA1 as well as expression levels of their putative targets F3'H, F3'5'H, LDOX, UFGT, ANR, LAR1, and LAR2 are highly correlated with the characteristic anthocyanin and PA profiles in Norton berry skin. These results reveal a unique pattern of the regulation of transcription and biosynthesis pathways underlying the viticultural and enological characteristics of Norton grape, and yield new insights into the understanding of the flavonoid pathway in non-vinifera grape varieties.

  3. Berry skin development in Norton grape: Distinct patterns of transcriptional regulation and flavonoid biosynthesis

    PubMed Central

    2011-01-01

    Background The complex and dynamic changes during grape berry development have been studied in Vitis vinifera, but little is known about these processes in other Vitis species. The grape variety 'Norton', with a major portion of its genome derived from Vitis aestivalis, maintains high levels of malic acid and phenolic acids in the ripening berries in comparison with V. vinifera varieties such as Cabernet Sauvignon. Furthermore, Norton berries develop a remarkably high level of resistance to most fungal pathogens while Cabernet Sauvignon berries remain susceptible to those pathogens. The distinct characteristics of Norton and Cabernet Sauvignon merit a comprehensive analysis of transcriptional regulation and metabolite pathways. Results A microarray study was conducted on transcriptome changes of Norton berry skin during the period of 37 to 127 days after bloom, which represents berry developmental phases from herbaceous growth to full ripeness. Samples of six berry developmental stages were collected. Analysis of the microarray data revealed that a total of 3,352 probe sets exhibited significant differences at transcript levels, with two-fold changes between at least two developmental stages. Expression profiles of defense-related genes showed a dynamic modulation of nucleotide-binding site-leucine-rich repeat (NBS-LRR) resistance genes and pathogenesis-related (PR) genes during berry development. Transcript levels of PR-1 in Norton berry skin clearly increased during the ripening phase. As in other grapevines, genes of the phenylpropanoid pathway were up-regulated in Norton as the berry developed. The most noticeable was the steady increase of transcript levels of stilbene synthase genes. Transcriptional patterns of six MYB transcription factors and eleven structural genes of the flavonoid pathway and profiles of anthocyanins and proanthocyanidins (PAs) during berry skin development were analyzed comparatively in Norton and Cabernet Sauvignon. Transcriptional patterns of MYB5A and MYB5B were similar during berry development between the two varieties, but those of MYBPA1 and MYBPA2 were strikingly different, demonstrating that the general flavonoid pathways are regulated under different MYB factors. The data showed that there were higher transcript levels of the genes encoding flavonoid-3'-O-hydroxylase (F3'H), flavonoid-3',5'-hydroxylase (F3'5'H), leucoanthocyanidin dioxygenase (LDOX), UDP-glucose:flavonoid 3'-O-glucosyltransferase (UFGT), anthocyanidin reductase (ANR), leucoanthocyanidin reductase (LAR) 1 and LAR2 in berry skin of Norton than in those of Cabernet Sauvignon. It was also found that the total amount of anthocyanins was markedly higher in Norton than in Cabernet Sauvignon berry skin at harvest, and five anthocyanin derivatives and three PA compounds exhibited distinctive accumulation patterns in Norton berry skin. Conclusions This study provides an overview of the transcriptome changes and the flavonoid profiles in the berry skin of Norton, an important North American wine grape, during berry development. The steady increase of transcripts of PR-1 and stilbene synthase genes likely contributes to the developmentally regulated resistance during ripening of Norton berries. More studies are required to address the precise role of each stilbene synthase gene in berry development and disease resistance. Transcriptional regulation of MYBA1, MYBA2, MYB5A and MYBPA1 as well as expression levels of their putative targets F3'H, F3'5'H, LDOX, UFGT, ANR, LAR1, and LAR2 are highly correlated with the characteristic anthocyanin and PA profiles in Norton berry skin. These results reveal a unique pattern of the regulation of transcription and biosynthesis pathways underlying the viticultural and enological characteristics of Norton grape, and yield new insights into the understanding of the flavonoid pathway in non-vinifera grape varieties. PMID:21219654

  4. Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

    PubMed

    Stiles, Kari A; Van Volkenburgh, Elizabeth

    2002-07-01

    Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

  5. Children in Foster Care and the Development of Favorable Outcomes

    PubMed Central

    Fisher, Philip A.

    2011-01-01

    Young foster children have invariably faced a variety of risks that are strongly linked to long-term deficits in functioning across multiple developmental domains. Despite these risks, however, some children demonstrate more favorable outcomes and exhibit adaptation and the development of assets. In the present study, the relationship of early childhood factors (e.g., maltreatment history, placement history, parenting practices, environmental stress, developmental status, and attachment behavior) to the development of favorable outcomes in middle childhood were examined in a sample of foster children who had been in foster care in preschool (N = 35). Favorable outcomes were defined as demonstrations of emotion regulation and school adjustment in during middle childhood. Developmental status (particularly attention and executive functioning) and a lack of environmental stress during early childhood foster care experiences had a significant positive relationship with the development of emotion regulation and school adjustment in middle childhood. PMID:21987598

  6. Early environments and the ecology of inflammation

    PubMed Central

    McDade, Thomas W.

    2012-01-01

    Recent research has implicated inflammatory processes in the pathophysiology of a wide range of chronic degenerative diseases, although inflammation has long been recognized as a critical line of defense against infectious disease. However, current scientific understandings of the links between chronic low-grade inflammation and diseases of aging are based primarily on research in high-income nations with low levels of infectious disease and high levels of overweight/obesity. From a comparative and historical point of view, this epidemiological situation is relatively unique, and it may not capture the full range of ecological variation necessary to understand the processes that shape the development of inflammatory phenotypes. The human immune system is characterized by substantial developmental plasticity, and a comparative, developmental, ecological framework is proposed to cast light on the complex associations among early environments, regulation of inflammation, and disease. Recent studies in the Philippines and lowland Ecuador reveal low levels of chronic inflammation, despite higher burdens of infectious disease, and point to nutritional and microbial exposures in infancy as important determinants of inflammation in adulthood. By shaping the regulation of inflammation, early environments moderate responses to inflammatory stimuli later in life, with implications for the association between inflammation and chronic diseases. Attention to the eco-logics of inflammation may point to promising directions for future research, enriching our understanding of this important physiological system and informing approaches to the prevention and treatment of disease. PMID:23045646

  7. Evolution and development of the vertebrate ear

    NASA Technical Reports Server (NTRS)

    Fritzsch, B.; Beisel, K. W.

    2001-01-01

    This review outlines major aspects of development and evolution of the ear, specifically addressing issues of cell fate commitment and the emerging molecular governance of these decisions. Available data support the notion of homology of subsets of mechanosensors across phyla (proprioreceptive mechanosensory neurons in insects, hair cells in vertebrates). It is argued that this conservation is primarily related to the specific transducing environment needed to achieve mechanosensation. Achieving this requires highly conserved transcription factors that regulate the expression of the relevant structural genes for mechanosensory transduction. While conserved at the level of some cell fate assignment genes (atonal and its mammalian homologue), the ear has also radically reorganized its development by implementing genes used for cell fate assignment in other parts of the developing nervous systems (e.g., neurogenin 1) and by evolving novel sets of genes specifically associated with the novel formation of sensory neurons that contact hair cells (neurotrophins and their receptors). Numerous genes have been identified that regulate morphogenesis, but there is only one common feature that emerges at the moment: the ear appears to have co-opted genes from a large variety of other parts of the developing body (forebrain, limbs, kidneys) and establishes, in combination with existing transcription factors, an environment in which those genes govern novel, ear-related morphogenetic aspects. The ear thus represents a unique mix of highly conserved developmental elements combined with co-opted and newly evolved developmental elements.

  8. A network of epigenetic regulators guides developmental haematopoiesis in vivo.

    PubMed

    Huang, Hsuan-Ting; Kathrein, Katie L; Barton, Abby; Gitlin, Zachary; Huang, Yue-Hua; Ward, Thomas P; Hofmann, Oliver; Dibiase, Anthony; Song, Anhua; Tyekucheva, Svitlana; Hide, Winston; Zhou, Yi; Zon, Leonard I

    2013-12-01

    The initiation of cellular programs is orchestrated by key transcription factors and chromatin regulators that activate or inhibit target gene expression. To generate a compendium of chromatin factors that establish the epigenetic code during developmental haematopoiesis, a large-scale reverse genetic screen was conducted targeting orthologues of 425 human chromatin factors in zebrafish. A set of chromatin regulators was identified that target different stages of primitive and definitive blood formation, including factors not previously implicated in haematopoiesis. We identified 15 factors that regulate development of primitive erythroid progenitors and 29 factors that regulate development of definitive haematopoietic stem and progenitor cells. These chromatin factors are associated with SWI/SNF and ISWI chromatin remodelling, SET1 methyltransferase, CBP-p300-HBO1-NuA4 acetyltransferase, HDAC-NuRD deacetylase, and Polycomb repressive complexes. Our work provides a comprehensive view of how specific chromatin factors and their associated complexes play a major role in the establishment of haematopoietic cells in vivo.

  9. Biotype Characterization, Developmental Profiling, Insecticide Response and Binding Property of Bemisia tabaci Chemosensory Proteins: Role of CSP in Insect Defense

    PubMed Central

    Liu, Guoxia; Ma, Hongmei; Xie, Hongyan; Xuan, Ning; Guo, Xia; Fan, Zhongxue; Rajashekar, Balaji; Arnaud, Philippe; Offmann, Bernard; Picimbon, Jean-François

    2016-01-01

    Chemosensory proteins (CSPs) are believed to play a key role in the chemosensory process in insects. Sequencing genomic DNA and RNA encoding CSP1, CSP2 and CSP3 in the sweet potato whitefly Bemisia tabaci showed strong variation between B and Q biotypes. Analyzing CSP-RNA levels showed not only biotype, but also age and developmental stage-specific expression. Interestingly, applying neonicotinoid thiamethoxam insecticide using twenty-five different dose/time treatments in B and Q young adults showed that Bemisia CSP1, CSP2 and CSP3 were also differentially regulated over insecticide exposure. In our study one of the adult-specific gene (CSP1) was shown to be significantly up-regulated by the insecticide in Q, the most highly resistant form of B. tabaci. Correlatively, competitive binding assays using tryptophan fluorescence spectroscopy and molecular docking demonstrated that CSP1 protein preferentially bound to linoleic acid, while CSP2 and CSP3 proteins rather associated to another completely different type of chemical, i.e. α-pentyl-cinnamaldehyde (jasminaldehyde). This might indicate that some CSPs in whiteflies are crucial to facilitate the transport of fatty acids thus regulating some metabolic pathways of the insect immune response, while some others are tuned to much more volatile chemicals known not only for their pleasant odor scent, but also for their potent toxic insecticide activity. PMID:27167733

  10. Control of Maize Vegetative and Reproductive Development, Fertility, and rRNAs Silencing by HISTONE DEACETYLASE 108

    PubMed Central

    Forestan, Cristian; Farinati, Silvia; Rouster, Jacques; Lassagne, Hervé; Lauria, Massimiliano; Dal Ferro, Nicola; Varotto, Serena

    2018-01-01

    Histone deacetylases (HDACs) catalyze the removal of acetyl groups from acetylated histone tails that consequently interact more closely with DNA, leading to chromatin state refractory to transcription. Zea mays HDA108 belongs to the Rpd3/HDA1 HDAC family and is ubiquitously expressed during development. The newly isolated hda108/hda108 insertional mutant exhibited many developmental defects: significant reduction in plant height, alterations of shoot and leaf development, and alterations of inflorescence patterning and fertility. Western blot analyses and immunolocalization experiments revealed an evident increase in histone acetylation, accompanied by a marked reduction in H3K9 dimethylation, in mutant nuclei. The DNA methylation status, in the CHG sequence context, and the transcript level of ribosomal sequences were also affected in hda108 mutants, while enrichment in H3 and H4 acetylation characterizes both repetitive and nonrepetitive transcriptional up-regulated loci. RNA-Seq of both young leaf and anthers indicated that transcription factor expression is highly affected and that the pollen developmental program is disrupted in hda108 mutants. Crosses between hda108/hda108 and epiregulator mutants did not produce any double mutant progeny indicating possible genetic interactions of HDA108 with distinct epigenetic pathways. Our findings indicate that HDA108 is directly involved in regulation of maize development, fertility, and epigenetic regulation of genome activity. PMID:29382649

  11. Core Promoter Functions in the Regulation of Gene Expression of Drosophila Dorsal Target Genes*

    PubMed Central

    Zehavi, Yonathan; Kuznetsov, Olga; Ovadia-Shochat, Avital; Juven-Gershon, Tamar

    2014-01-01

    Developmental processes are highly dependent on transcriptional regulation by RNA polymerase II. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters consist of core promoter motifs, e.g. the initiator, TATA box, and the downstream core promoter element (DPE), which confer specific properties to the core promoter. Here, we explored the importance of core promoter functions in the dorsal-ventral developmental gene regulatory network. This network includes multiple genes that are activated by different nuclear concentrations of Dorsal, an NFκB homolog transcription factor, along the dorsal-ventral axis. We show that over two-thirds of Dorsal target genes contain DPE sequence motifs, which is significantly higher than the proportion of DPE-containing promoters in Drosophila genes. We demonstrate that multiple Dorsal target genes are evolutionarily conserved and functionally dependent on the DPE. Furthermore, we have analyzed the activation of key Dorsal target genes by Dorsal, as well as by another Rel family transcription factor, Relish, and the dependence of their activation on the DPE motif. Using hybrid enhancer-promoter constructs in Drosophila cells and embryo extracts, we have demonstrated that the core promoter composition is an important determinant of transcriptional activity of Dorsal target genes. Taken together, our results provide evidence for the importance of core promoter composition in the regulation of Dorsal target genes. PMID:24634215

  12. Variants of the Xenopus laevis ribosomal transcription factor xUBF are developmentally regulated by differential splicing.

    PubMed

    Guimond, A; Moss, T

    1992-07-11

    XUBF is a Xenopus ribosomal transcription factor of the HMG-box family which contains five tandemly disposed homologies to the HMG1 & 2 DNA binding domains. XUBF has been isolated as a protein doublet and two cDNAs encoding the two molecular weight variants have been characterised. The major two forms of xUBF identified differ by the presence or absence of a 22 amino acid segment lying between HMG-boxes 3 and 4. Here we show that the mRNAs for these two forms of xUBF are regulated during development and differentiation over a range of nearly 20 fold. By isolating two of the xUBF genes, it was possible to show that both encoded the variable 22 amino acid segment in exon 12. Oocyte splicing assays and the sequencing of PCR-generated cDNA fragments, demonstrated that the transcripts from one of these genes were differentially spliced in a developmentally regulated manner. Transcripts from the second gene were found to be predominantly or exclusively spliced to produce the lower molecular weight form of xUBF. Expression of a high molecular weight form from yet a third gene was also detected. Although the intron-exon structures of the Xenopus and mouse UBF genes were found to be essentially identical, the differential splicing of exon 8 found in mammals, was not detected in Xenopus.

  13. Regulation of water, salinity, and cold stress responses by salicylic acid

    PubMed Central

    Miura, Kenji; Tada, Yasuomi

    2014-01-01

    Salicylic acid (SA) is a naturally occurring phenolic compound. SA plays an important role in the regulation of plant growth, development, ripening, and defense responses. The role of SA in the plant–pathogen relationship has been extensively investigated. In addition to defense responses, SA plays an important role in the response to abiotic stresses, including drought, low temperature, and salinity stresses. It has been suggested that SA has great agronomic potential to improve the stress tolerance of agriculturally important crops. However, the utility of SA is dependent on the concentration of the applied SA, the mode of application, and the state of the plants (e.g., developmental stage and acclimation). Generally, low concentrations of applied SA alleviate the sensitivity to abiotic stresses, and high concentrations of applied induce high levels of oxidative stress, leading to a decreased tolerance to abiotic stresses. In this article, the effects of SA on the water stress responses and regulation of stomatal closure are reviewed. PMID:24478784

  14. Emotion Regulation from Early Adolescence to Emerging Adulthood and Middle Adulthood: Age Differences, Gender Differences, and Emotion-Epecific Developmental Variations

    ERIC Educational Resources Information Center

    Zimmermann, Peter; Iwanski, Alexandra

    2014-01-01

    Despite the growing research on emotion regulation, the empirical evidence for normative age-related emotion regulation patterns is rather divergent. From a life-span perspective, normative age changes in emotion regulation may be more salient applying the same methodological approach on a broad age range examining both growth and decline during…

  15. Challenges to Developmental Regulation across the Life Course: What Are They and Which Individual Differences Matter?

    ERIC Educational Resources Information Center

    Heckhausen, Jutta; Wrosch, Carsten

    2016-01-01

    We discuss the major processes involved in individuals' motivation and self-regulation of goal striving throughout the life course. While much is regulated based on the biological and societal scaffolding of lifespan development, certain challenges for motivation and self-regulation are more substantial and need to be managed by the individual,…

  16. Getting Back to the Woods: Familial Perspectives on Culture and Preschoolers' Acquisition of Self-Regulation and Emotion Regulation

    ERIC Educational Resources Information Center

    Boyer, Wanda

    2013-01-01

    Discourse on culture is vital to early childhood educators' understanding of the young child in various socio-cultural experiences in family and community settings. In this article, the author will present a contemporary definition of culture. This article will then discuss the developmental constructs of self-regulation and emotion regulation and…

  17. Promoting Positive Youth Development in the Face of Contextual Changes and Challenges: The Roles of Individual Strengths and Ecological Assets

    ERIC Educational Resources Information Center

    Lerner, Richard M.; Bowers, Edmond P.; Geldhof, G. John; Gestsdottir, Steinunn; DeSouza, Lisette

    2012-01-01

    Contemporary developmental theory is framed by relational developmental systems models that emphasize that change across life occurs through mutually regulative relations between individuals and their contexts (represented as individual [left arrow][right arrow] context relations). Within these models, all contextual levels are involved in these…

  18. A Testosterone-Related Structural Brain Phenotype Predicts Aggressive Behavior From Childhood to Adulthood

    PubMed Central

    Nguyen, Tuong-Vi; McCracken, James T; Albaugh, Matthew D; Botteron, Kelly N.; Hudziak, James J; Ducharme, Simon

    2015-01-01

    Structural covariance, the examination of anatomic correlations between brain regions, has emerged recently as a valid and useful measure of developmental brain changes. Yet the exact biological processes leading to changes in covariance, and the relation between such covariance and behavior, remain largely unexplored. The steroid hormone testosterone represents a compelling mechanism through which this structural covariance may be developmentally regulated in humans. Although steroid hormone receptors can be found throughout the central nervous system, the amygdala represents a key target for testosterone-specific effects, given its high density of androgen receptors. In addition, testosterone has been found to impact cortical thickness (CTh) across the whole brain, suggesting that it may also regulate the structural relationship, or covariance, between the amygdala and CTh. Here we examined testosterone-related covariance between amygdala volumes and whole-brain CTh, as well as its relationship to aggression levels, in a longitudinal sample of children, adolescents, and young adults 6 to 22 years old. We found: (1) testosterone-specific modulation of the covariance between the amygdala and medial prefrontal cortex (mPFC); (2) a significant relationship between amygdala-mPFC covariance and levels of aggression; and (3) mediation effects of amygdala-mPFC covariance on the relationship between testosterone and aggression. These effects were independent of sex, age, pubertal stage, estradiol levels and anxious-depressed symptoms. These findings are consistent with prior evidence that testosterone targets the neural circuits regulating affect and impulse regulation, and show, for the first time in humans, how androgen-dependent organizational effects may regulate a very specific, aggression-related structural brain phenotype from childhood to young adulthood. PMID:26431805

  19. A testosterone-related structural brain phenotype predicts aggressive behavior from childhood to adulthood.

    PubMed

    Nguyen, Tuong-Vi; McCracken, James T; Albaugh, Matthew D; Botteron, Kelly N; Hudziak, James J; Ducharme, Simon

    2016-01-01

    Structural covariance, the examination of anatomic correlations between brain regions, has emerged recently as a valid and useful measure of developmental brain changes. Yet the exact biological processes leading to changes in covariance, and the relation between such covariance and behavior, remain largely unexplored. The steroid hormone testosterone represents a compelling mechanism through which this structural covariance may be developmentally regulated in humans. Although steroid hormone receptors can be found throughout the central nervous system, the amygdala represents a key target for testosterone-specific effects, given its high density of androgen receptors. In addition, testosterone has been found to impact cortical thickness (CTh) across the whole brain, suggesting that it may also regulate the structural relationship, or covariance, between the amygdala and CTh. Here, we examined testosterone-related covariance between amygdala volumes and whole-brain CTh, as well as its relationship to aggression levels, in a longitudinal sample of children, adolescents, and young adults 6-22 years old. We found: (1) testosterone-specific modulation of the covariance between the amygdala and medial prefrontal cortex (mPFC); (2) a significant relationship between amygdala-mPFC covariance and levels of aggression; and (3) mediation effects of amygdala-mPFC covariance on the relationship between testosterone and aggression. These effects were independent of sex, age, pubertal stage, estradiol levels and anxious-depressed symptoms. These findings are consistent with prior evidence that testosterone targets the neural circuits regulating affect and impulse regulation, and show, for the first time in humans, how androgen-dependent organizational effects may regulate a very specific, aggression-related structural brain phenotype from childhood to young adulthood. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Deep Sequencing of the Medicago truncatula Root Transcriptome Reveals a Massive and Early Interaction between Nodulation Factor and Ethylene Signals1[OPEN

    PubMed Central

    Larrainzar, Estíbaliz; Riely, Brendan K.; Kim, Sang Cheol; Carrasquilla-Garcia, Noelia; Yu, Hee-Ju; Hwang, Hyun-Ju; Oh, Mijin; Kim, Goon Bo; Surendrarao, Anandkumar K.; Chasman, Deborah; Siahpirani, Alireza F.; Penmetsa, Ramachandra V.; Lee, Gang-Seob; Kim, Namshin; Roy, Sushmita; Mun, Jeong-Hwan; Cook, Douglas R.

    2015-01-01

    The legume-rhizobium symbiosis is initiated through the activation of the Nodulation (Nod) factor-signaling cascade, leading to a rapid reprogramming of host cell developmental pathways. In this work, we combine transcriptome sequencing with molecular genetics and network analysis to quantify and categorize the transcriptional changes occurring in roots of Medicago truncatula from minutes to days after inoculation with Sinorhizobium medicae. To identify the nature of the inductive and regulatory cues, we employed mutants with absent or decreased Nod factor sensitivities (i.e. Nodulation factor perception and Lysine motif domain-containing receptor-like kinase3, respectively) and an ethylene (ET)-insensitive, Nod factor-hypersensitive mutant (sickle). This unique data set encompasses nine time points, allowing observation of the symbiotic regulation of diverse biological processes with high temporal resolution. Among the many outputs of the study is the early Nod factor-induced, ET-regulated expression of ET signaling and biosynthesis genes. Coupled with the observation of massive transcriptional derepression in the ET-insensitive background, these results suggest that Nod factor signaling activates ET production to attenuate its own signal. Promoter:β-glucuronidase fusions report ET biosynthesis both in root hairs responding to rhizobium as well as in meristematic tissue during nodule organogenesis and growth, indicating that ET signaling functions at multiple developmental stages during symbiosis. In addition, we identified thousands of novel candidate genes undergoing Nod factor-dependent, ET-regulated expression. We leveraged the power of this large data set to model Nod factor- and ET-regulated signaling networks using MERLIN, a regulatory network inference algorithm. These analyses predict key nodes regulating the biological process impacted by Nod factor perception. We have made these results available to the research community through a searchable online resource. PMID:26175514

  1. Developmental changes rather than repeated administration drive paracetamol glucuronidation in neonates and infants.

    PubMed

    Krekels, Elke H J; van Ham, Saskia; Allegaert, Karel; de Hoon, Jan; Tibboel, Dick; Danhof, Meindert; Knibbe, Catherijne A J

    2015-09-01

    Based on recovered metabolite ratios in urine, it has been concluded that paracetamol glucuronidation may be up-regulated upon multiple dosing. This study investigates paracetamol clearance in neonates and infants after single and multiple dosing using a population modelling approach. A population pharmacokinetic model was developed in NONMEM VI, based on paracetamol plasma concentrations from 54 preterm and term neonates and infants, and on paracetamol, paracetamol-glucuronide and paracetamol-sulphate amounts in urine from 22 of these patients. Patients received either a single intravenous propacetamol dose or up to 12 repeated doses. Paracetamol and metabolite disposition was best described with one-compartment models. The formation clearance of paracetamol-sulphate was 1.46 mL/min/kg(1.4), which was about 5.5 times higher than the formation clearance of the glucuronide of 0.266 mL/min/kg. The renal excretion rate constants of both metabolites was estimated to be 11.4 times higher than the excretion rate constant of unchanged paracetamol, yielding values of 0.580 mL/min/kg. Developmental changes were best described by bodyweight in linear relationships on the distribution volumes, the formation of paracetamol-glucuronide and the unchanged excretion of paracetamol, and in an exponential relationship on the formation of paracetamol-sulphate. There was no evidence for up-regulation or other time-varying changes in any of the model parameters. Simulations with this model illustrate how paracetamol-glucuronide recovery in urine increases over time due to the slower formation of this metabolite and in the absence of up-regulation. Developmental changes, described by bodyweight-based functions, rather than up-regulation, explain developmental changes in paracetamol disposition in neonates and infants.

  2. Comparison of a teratogenic transcriptome-based predictive test based on human embryonic versus inducible pluripotent stem cells.

    PubMed

    Shinde, Vaibhav; Perumal Srinivasan, Sureshkumar; Henry, Margit; Rotshteyn, Tamara; Hescheler, Jürgen; Rahnenführer, Jörg; Grinberg, Marianna; Meisig, Johannes; Blüthgen, Nils; Waldmann, Tanja; Leist, Marcel; Hengstler, Jan Georg; Sachinidis, Agapios

    2016-12-30

    Human embryonic stem cells (hESCs) partially recapitulate early embryonic three germ layer development, allowing testing of potential teratogenic hazards. Because use of hESCs is ethically debated, we investigated the potential for human induced pluripotent stem cells (hiPSCs) to replace hESCs in such tests. Three cell lines, comprising hiPSCs (foreskin and IMR90) and hESCs (H9) were differentiated for 14 days. Their transcriptome profiles were obtained on day 0 and day 14 and analyzed by comprehensive bioinformatics tools. The transcriptomes on day 14 showed that more than 70% of the "developmental genes" (regulated genes with > 2-fold change on day 14 compared to day 0) exhibited variability among cell lines. The developmental genes belonging to all three cell lines captured biological processes and KEGG pathways related to all three germ layer embryonic development. In addition, transcriptome profiles were obtained after 14 days of exposure to teratogenic valproic acid (VPA) during differentiation. Although the differentially regulated genes between treated and untreated samples showed more than 90% variability among cell lines, VPA clearly antagonized the expression of developmental genes in all cell lines: suppressing upregulated developmental genes, while inducing downregulated ones. To quantify VPA-disturbed development based on developmental genes, we estimated the "developmental potency" (D p ) and "developmental index" (D i ). Despite differences in genes deregulated by VPA, uniform D i values were obtained for all three cell lines. Given that the D i values for VPA were similar for hESCs and hiPSCs, D i can be used for robust hazard identification, irrespective of whether hESCs or hiPSCs are used in the test systems.

  3. A Computational Model Predicting Disruption of Blood Vessel Development

    EPA Science Inventory

    Vascular development is a complex process regulated by dynamic biological networks that vary in topology and state across different tissues and developmental stages. Signals regulating de novo blood vessel formation (vasculogenesis) and remodeling (angiogenesis) come from a varie...

  4. Lipid phosphate phosphatase 3 regulates adipocyte sphingolipid synthesis, but not developmental adipogenesis or diet-induced obesity in mice.

    PubMed

    Federico, Lorenzo; Yang, Liping; Brandon, Jason; Panchatcharam, Manikandan; Ren, Hongmei; Mueller, Paul; Sunkara, Manjula; Escalante-Alcalde, Diana; Morris, Andrew J; Smyth, Susan S

    2018-01-01

    Dephosphorylation of phosphatidic acid (PA) is the penultimate step in triglyceride synthesis. Adipocytes express soluble intracellular PA-specific phosphatases (Lipins) and broader specificity membrane-associated lipid phosphate phosphatases (LPPs) that can also dephosphorylate PA. Inactivation of lipin1 causes lipodystrophy in mice due to defective developmental adipogenesis. Triglyceride synthesis is diminished but not ablated by inactivation of lipin1 in differentiated adipocytes implicating other PA phosphatases in this process. To investigate the possible role of LPPs in adipocyte lipid metabolism and signaling we made mice with adipocyte-targeted inactivation of LPP3 encoded by the Plpp3(Ppap2b) gene. Adipocyte LPP3 deficiency resulted in blunted ceramide and sphingomyelin accumulation during diet-induced adipose tissue expansion, accumulation of the LPP3 substrate sphingosine 1- phosphate, and reduced expression of serine palmitoyl transferase. However, adiposity was unaffected by LPP3 deficiency on standard, high fat diet or Western diets, although Western diet-fed mice with adipocyte LPP3 deficiency exhibited improved glucose tolerance. Our results demonstrate functional compartmentalization of lipid phosphatase activity in adipocytes and identify an unexpected role for LPP3 in the regulation of diet-dependent sphingolipid synthesis that may impact on insulin signaling.

  5. Serotonin homeostasis and serotonin receptors as actors of cortical construction: special attention to the 5-HT3A and 5-HT6 receptor subtypes

    PubMed Central

    Vitalis, Tania; Ansorge, Mark S.; Dayer, Alexandre G.

    2013-01-01

    Cortical circuits control higher-order cognitive processes and their function is highly dependent on their structure that emerges during development. The construction of cortical circuits involves the coordinated interplay between different types of cellular processes such as proliferation, migration, and differentiation of neural and glial cell subtypes. Among the multiple factors that regulate the assembly of cortical circuits, 5-HT is an important developmental signal that impacts on a broad diversity of cellular processes. 5-HT is detected at the onset of embryonic telencephalic formation and a variety of serotonergic receptors are dynamically expressed in the embryonic developing cortex in a region and cell-type specific manner. Among these receptors, the ionotropic 5-HT3A receptor and the metabotropic 5-HT6 receptor have recently been identified as novel serotonergic targets regulating different aspects of cortical construction including neuronal migration and dendritic differentiation. In this review, we focus on the developmental impact of serotonergic systems on the construction of cortical circuits and discuss their potential role in programming risk for human psychiatric disorders. PMID:23801939

  6. Maternal Prenatal Stress and Infant Regulatory Capacity in Mexican Americans

    PubMed Central

    Lin, Betty; Crnic, Keith A.; Luecken, Linda J.; Gonzales, Nancy A.

    2014-01-01

    The early postpartum period lays important groundwork for later self-regulation as infants' dispositional traits interact with caregivers' co-regulatory behaviors to produce the earliest forms of self-regulation. Although emerging literature suggests that fetal exposure to maternal stress may be integral in determining child self-regulatory capacity, the complex pathways that characterize these early developmental processes remain unclear. The current study considers these complex, transactional processes in a low income, Mexican American sample. Data were collected from 295 Mexican American infants and their mothers during prenatal, 6- and 12-week postpartum home interviews. Mother reports of stress were obtained prenatally, and mother reports of infant temperament were obtained at 6 weeks. Observer ratings of maternal sensitivity and infant regulatory behaviors were obtained at the 6- and 12-week time points. Study results indicate that prenatal stress predicts higher levels of infant negativity and surgency, both of which directly or interactively predict later engagement in regulatory behaviors. Unexpectedly, prenatal stress also predicted more engagement in orienting, but not self-comforting behaviors. Advancing understandings about the nature of these developmental pathways may have significant implications for targets of early intervention in this high risk population. PMID:25113917

  7. Development and Symbiosis Establishment in the Cnidarian Endosymbiosis Model Aiptasia sp.

    PubMed Central

    Bucher, Madeline; Wolfowicz, Iliona; Voss, Philipp A.; Hambleton, Elizabeth A.; Guse, Annika

    2016-01-01

    Symbiosis between photosynthetic algae and heterotrophic organisms is widespread. One prominent example of high ecological relevance is the endosymbiosis between dinoflagellate algae of the genus Symbiodinium and reef-building corals, which typically acquire symbionts anew each generation during larval stages. The tropical sea anemone Aiptasia sp. is a laboratory model system for this endosymbiosis and, similar to corals, produces non-symbiotic larvae that establish symbiosis by phagocytosing Symbiodinium from the environment into the endoderm. Here we generate the first overview of Aiptasia embryogenesis and larval development and establish in situ hybridization to analyze expression patterns of key early developmental regulators. Next, we quantify morphological changes in developing larvae and find a substantial enlargement of the gastric cavity over time. Symbiont acquisition starts soon after mouth formation and symbionts occupy a major portion of the host cell in which they reside. During the first 14 days of development, infection efficiency remains constant while in contrast, localization of phagocytosed symbionts changes, indicating that the occurrence of functional phagocytosing cells may be developmentally regulated. Taken together, here we provide the essential framework to further develop Aiptasia as a model system for the analysis of symbiosis establishment in cnidarian larvae at the molecular level. PMID:26804034

  8. Development and Symbiosis Establishment in the Cnidarian Endosymbiosis Model Aiptasia sp.

    PubMed

    Bucher, Madeline; Wolfowicz, Iliona; Voss, Philipp A; Hambleton, Elizabeth A; Guse, Annika

    2016-01-25

    Symbiosis between photosynthetic algae and heterotrophic organisms is widespread. One prominent example of high ecological relevance is the endosymbiosis between dinoflagellate algae of the genus Symbiodinium and reef-building corals, which typically acquire symbionts anew each generation during larval stages. The tropical sea anemone Aiptasia sp. is a laboratory model system for this endosymbiosis and, similar to corals, produces non-symbiotic larvae that establish symbiosis by phagocytosing Symbiodinium from the environment into the endoderm. Here we generate the first overview of Aiptasia embryogenesis and larval development and establish in situ hybridization to analyze expression patterns of key early developmental regulators. Next, we quantify morphological changes in developing larvae and find a substantial enlargement of the gastric cavity over time. Symbiont acquisition starts soon after mouth formation and symbionts occupy a major portion of the host cell in which they reside. During the first 14 days of development, infection efficiency remains constant while in contrast, localization of phagocytosed symbionts changes, indicating that the occurrence of functional phagocytosing cells may be developmentally regulated. Taken together, here we provide the essential framework to further develop Aiptasia as a model system for the analysis of symbiosis establishment in cnidarian larvae at the molecular level.

  9. Differential expression of calcium-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit

    USDA-ARS?s Scientific Manuscript database

    Calcium has been shown to increase stress tolerance, enhance fruit firmness and reduce decay. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also resp...

  10. The histone demethylase Jarid1b ensures faithful mouse development by protecting developmental genes from aberrant H3K4me3.

    PubMed

    Albert, Mareike; Schmitz, Sandra U; Kooistra, Susanne M; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C; Johansen, Jens V; Abarrategui, Iratxe; Helin, Kristian

    2013-04-01

    Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications.

  11. The Histone Demethylase Jarid1b Ensures Faithful Mouse Development by Protecting Developmental Genes from Aberrant H3K4me3

    PubMed Central

    Kooistra, Susanne M.; Malatesta, Martina; Morales Torres, Cristina; Rekling, Jens C.; Johansen, Jens V.; Abarrategui, Iratxe; Helin, Kristian

    2013-01-01

    Embryonic development is tightly regulated by transcription factors and chromatin-associated proteins. H3K4me3 is associated with active transcription and H3K27me3 with gene repression, while the combination of both keeps genes required for development in a plastic state. Here we show that deletion of the H3K4me2/3 histone demethylase Jarid1b (Kdm5b/Plu1) results in major neonatal lethality due to respiratory failure. Jarid1b knockout embryos have several neural defects including disorganized cranial nerves, defects in eye development, and increased incidences of exencephaly. Moreover, in line with an overlap of Jarid1b and Polycomb target genes, Jarid1b knockout embryos display homeotic skeletal transformations typical for Polycomb mutants, supporting a functional interplay between Polycomb proteins and Jarid1b. To understand how Jarid1b regulates mouse development, we performed a genome-wide analysis of histone modifications, which demonstrated that normally inactive genes encoding developmental regulators acquire aberrant H3K4me3 during early embryogenesis in Jarid1b knockout embryos. H3K4me3 accumulates as embryonic development proceeds, leading to increased expression of neural master regulators like Pax6 and Otx2 in Jarid1b knockout brains. Taken together, these results suggest that Jarid1b regulates mouse development by protecting developmental genes from inappropriate acquisition of active histone modifications. PMID:23637629

  12. Developmental regulation of fear learning and anxiety behavior by endocannabinoids.

    PubMed

    Lee, T T-Y; Hill, M N; Lee, F S

    2016-01-01

    The developing brain undergoes substantial maturation into adulthood and the development of specific neural structures occurs on differing timelines. Transient imbalances between developmental trajectories of corticolimbic structures, which are known to contribute to regulation over fear learning and anxiety, can leave an individual susceptible to mental illness, particularly anxiety disorders. There is a substantial body of literature indicating that the endocannabinoid (eCB) system critically regulates stress responsivity and emotional behavior throughout the life span, making this system a novel therapeutic target for stress- and anxiety-related disorders. During early life and adolescence, corticolimbic eCB signaling changes dynamically and coincides with different sensitive periods of fear learning, suggesting that eCB signaling underlies age-specific fear learning responses. Moreover, perturbations to these normative fluctuations in corticolimbic eCB signaling, such as stress or cannabinoid exposure, could serve as a neural substrate contributing to alterations to the normative developmental trajectory of neural structures governing emotional behavior and fear learning. In this review, we first introduce the components of the eCB system and discuss clinical and rodent models showing eCB regulation of fear learning and anxiety in adulthood. Next, we highlight distinct fear learning and regulation profiles throughout development and discuss the ontogeny of the eCB system in the central nervous system, and models of pharmacological augmentation of eCB signaling during development in the context of fear learning and anxiety. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  13. Contributions of mRNA abundance, ribosome loading, and post- or peri-translational effects to temporal repression of C. elegans heterochronic miRNA targets

    PubMed Central

    Stadler, Michael; Artiles, Karen; Pak, Julia; Fire, Andrew

    2012-01-01

    miRNAs are post-transcriptional regulators of gene activity that reduce protein accumulation from target mRNAs. Elucidating precise molecular effects that animal miRNAs have on target transcripts has proven complex, with varied evidence indicating that miRNA regulation may produce different molecular outcomes in different species, systems, and/or physiological conditions. Here we use high-throughput ribosome profiling to analyze detailed translational parameters for five well-studied targets of miRNAs that regulate C. elegans developmental timing. For two targets of the miRNA lin-4 (lin-14 and lin-28), functional down-regulation was associated with decreases in both overall mRNA abundance and ribosome loading; however, these changes were of substantially smaller magnitude than corresponding changes observed in protein abundance. For three functional targets of the let-7 miRNA family for which down-regulation is critical in temporal progression of the animal (daf-12, hbl-1, and lin-41), we observed only modest changes in mRNA abundance and ribosome loading. lin-41 provides a striking example in that populations of ribosome-protected fragments from this gene remained essentially unchanged during the L3–L4 time interval when lin-41 activity is substantially down-regulated by let-7. Spectra of ribosomal positions were also examined for the five lin-4 and let-7 target mRNAs as a function of developmental time, with no indication of miRNA-induced ribosomal drop-off or significant pauses in translation. These data are consistent with models in which physiological regulation by this set of C. elegans miRNAs derives from combinatorial effects including suppressed recruitment/activation of translational machinery, compromised stability of target messages, and post- or peri-translational effects on lifetimes of polypeptide products. PMID:22855835

  14. Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf.

    PubMed

    Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

    2017-12-15

    Black rice ( Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3-10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf.

  15. Transcriptional regulation of anthocyanin biosynthesis in ripening fruits of grapevine under seasonal water deficit.

    PubMed

    Castellarin, Simone D; Pfeiffer, Antonella; Sivilotti, Paolo; Degan, Mirko; Peterlunger, Enrico; DI Gaspero, Gabriele

    2007-11-01

    Anthocyanin biosynthesis is strongly up-regulated in ripening fruit of grapevines (Vitis vinifera L.) grown under drought conditions. We investigated the effects of long-term water deficit on the expression of genes coding for flavonoid and anthocyanin biosynthetic enzymes and related transcription factors, genes sensitive to endogenous [sugars, abscisic acid (ABA)] and environmental (light) stimuli connected to drought stress, and genes developmentally regulated in ripening berries. Total anthocyanin content has increased at harvest in water-stressed (WS) fruits by 37-57% in two consecutive years. At least 84% of the total variation in anthocyanin content was explained by the linear relationship between the integral of mRNA accumulation of the specific anthocyanin biosynthetic gene UDP-glucose : flavonoid 3-O-glucosyltransferase (UFGT) and metabolite content during time series from véraison through ripening. Chalcone synthase (CHS2, CHS3) and flavanone 3-hydroxylase (F3H) genes of the flavonoid pathway showed high correlation as well. Genes coding for flavonoid 3',5'-hydroxylase (F3'5'H) and O-methyltransferase (OMT) were also up-regulated in berries from dehydrated plants in which anthocyanin composition enriched in more hydroxylated and more methoxylated derivatives such as malvidin and peonidin, the grape anthocyanins to which human gastric bilitranslocase displays the highest affinity. The induction in WS plants of structural and regulatory genes of the flavonoid pathway and of genes that trigger brassinosteroid hormonal onset of maturation suggested that the interrelationships between developmental and environmental signalling pathways were magnified by water deficit which actively promoted fruit maturation and, in this context, anthocyanin biosynthesis.

  16. Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

    2000-01-01

    beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

  17. MicroRNA-276 promotes egg-hatching synchrony by up-regulating brm in locusts

    PubMed Central

    He, Jing; Chen, Qianquan; Wei, Yuanyuan; Jiang, Feng; Yang, Meiling; Hao, Shuguang; Guo, Xiaojiao; Chen, Dahua; Kang, Le

    2016-01-01

    Developmental synchrony, the basis of uniform swarming, migration, and sexual maturation, is an important strategy for social animals to adapt to variable environments. However, the molecular mechanisms underlying developmental synchrony are largely unexplored. The migratory locust exhibits polyphenism between gregarious and solitarious individuals, with the former displaying more synchronous sexual maturation and migration than the latter. Here, we found that the egg-hatching time of gregarious locusts was more uniform compared with solitarious locusts and that microRNA-276 (miR-276) was expressed significantly higher in both ovaries and eggs of gregarious locusts than in solitarious locusts. Interestingly, inhibiting miR-276 in gregarious females and overexpressing it in solitarious females, respectively, caused more heterochronic and synchronous hatching of progeny eggs. Moreover, miR-276 directly targeted a transcription coactivator gene, brahma (brm), resulting in its up-regulation. Knockdown of brm not only resulted in asynchronous egg hatching in gregarious locusts but also impaired the miR-276–induced synchronous egg hatching in solitarious locusts. Mechanistically, miR-276 mediated brm activation in a manner that depended on the secondary structure of brm, namely, a stem-loop around the binding site of miR-276. Collectively, our results unravel a mechanism by which miR-276 enhances brm expression to promote developmental synchrony and provide insight into regulation of developmental homeostasis and population sustaining that are closely related to biological synchrony. PMID:26729868

  18. 29 CFR 1952.201 - Developmental schedule.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

  19. 29 CFR 1952.201 - Developmental schedule.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

  20. 29 CFR 1952.201 - Developmental schedule.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

  1. 29 CFR 1952.201 - Developmental schedule.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

  2. 29 CFR 1952.201 - Developmental schedule.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... legislation, August 1, 1973; (d) Regulations on variances, August 1973; (e) Management information system... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... schedule. (a) Retraining of present occupational safety and health personnel during March-May 1973; (b...

  3. Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

    PubMed

    Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

    2012-07-01

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

  4. Toy Age-Labeling: An Overview for Pediatricians of How Toys Receive Their Age Safety and Developmental Designations.

    PubMed

    Kulak, Shuli; Stein, Ruth E K

    2016-07-01

    Injuries related to toys continue to cause significant childhood morbidity and mortality, despite considerable government regulation of the toy industry. Recent controversy related to toys that contain strong magnets demonstrate the dangers they pose to children. The pediatric community is often unaware of how toys receive their developmental and safety labeling and the degree to which age-labeling on toys can be discretionary. Toy labeling has 2 basic manifestations. The first, safety labeling for hazards like small parts, balloons, or small balls that may present a choking risk, is mandatory. The second, "developmental" age-labeling, describes the age of the children for which the toy is intended, and sometimes has discretionary components. This article provides a review of the regulations governing toy age-safety standards and how they are reflected on toy packaging to help pediatric practitioners apply safety advice across settings and patient characteristics. We review the existing age-labeling regulations and processes and discuss the major areas where children remain vulnerable despite labeling. Finally, we list some recommendations for counseling parents about toy safety. Copyright © 2016 by the American Academy of Pediatrics.

  5. A role for post-transcriptional control of endoplasmic reticulum dynamics and function in C. elegans germline stem cell maintenance.

    PubMed

    Maheshwari, Richa; Pushpa, Kumari; Subramaniam, Kuppuswamy

    2016-09-01

    Membrane-bound receptors, which are crucial for mediating several key developmental signals, are synthesized on endoplasmic reticulum (ER). The functional integrity of ER must therefore be important for the regulation of at least some developmental programs. However, the developmental control of ER function is not well understood. Here, we identify the C. elegans protein FARL-11, an ortholog of the mammalian STRIPAK complex component STRIP1/2 (FAM40A/B), as an ER protein. In the C. elegans embryo, we find that FARL-11 is essential for the cell cycle-dependent morphological changes of ER and for embryonic viability. In the germline, FARL-11 is required for normal ER morphology and for membrane localization of the GLP-1/Notch receptor involved in germline stem cell (GSC) maintenance. Furthermore, we provide evidence that PUF-8, a key translational regulator in the germline, promotes the translation of farl-11 mRNA. These findings reveal that ER form and function in the C. elegans germline are post-transcriptionally regulated and essential for the niche-GSC signaling mediated by GLP-1. © 2016. Published by The Company of Biologists Ltd.

  6. Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

    PubMed

    Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

    2012-01-01

    Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

  7. Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

    PubMed Central

    Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

    2012-01-01

    Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

  8. Developmental Changes in Anger Expression and Attention Focus: Learning to Wait

    ERIC Educational Resources Information Center

    Cole, Pamela M.; Tan, Patricia Z.; Hall, Sarah E.; Zhang, Yiyun; Crnic, Keith A.; Blair, Clancy B.; Li, Runze

    2011-01-01

    Being able to wait is an essential part of self-regulation. In the present study, the authors examined the developmental course of changes in the latency to and duration of target-waiting behaviors by following 65 boys and 55 girls from rural and semirural economically strained homes from ages 18 months to 48 months. Age-related changes in latency…

  9. Travelling within the fetal gut: simple rules for an arduous journey

    PubMed Central

    2014-01-01

    The complex physiology of the gastrointestinal tract is regulated by intricate neural networks embedded within the gut wall. How neural crest cells colonize the intestine to form the enteric nervous system is of great interest to developmental biologists, but also highly relevant for understanding gastrointestinal disorders. A recent paper in BMC Biology addresses this issue with live imaging of gut explants from mouse embryos. See research article: http://www.biomedcentral.com/1741-7007/12/23. PMID:25184534

  10. RNA Deep Sequencing Reveals Differential MicroRNA Expression during Development of Sea Urchin and Sea Star

    PubMed Central

    Kadri, Sabah; Hinman, Veronica F.; Benos, Panayiotis V.

    2011-01-01

    microRNAs (miRNAs) are small (20–23 nt), non-coding single stranded RNA molecules that act as post-transcriptional regulators of mRNA gene expression. They have been implicated in regulation of developmental processes in diverse organisms. The echinoderms, Strongylocentrotus purpuratus (sea urchin) and Patiria miniata (sea star) are excellent model organisms for studying development with well-characterized transcriptional networks. However, to date, nothing is known about the role of miRNAs during development in these organisms, except that the genes that are involved in the miRNA biogenesis pathway are expressed during their developmental stages. In this paper, we used Illumina Genome Analyzer (Illumina, Inc.) to sequence small RNA libraries in mixed stage population of embryos from one to three days after fertilization of sea urchin and sea star (total of 22,670,000 reads). Analysis of these data revealed the miRNA populations in these two species. We found that 47 and 38 known miRNAs are expressed in sea urchin and sea star, respectively, during early development (32 in common). We also found 13 potentially novel miRNAs in the sea urchin embryonic library. miRNA expression is generally conserved between the two species during development, but 7 miRNAs are highly expressed in only one species. We expect that our two datasets will be a valuable resource for everyone working in the field of developmental biology and the regulatory networks that affect it. The computational pipeline to analyze Illumina reads is available at http://www.benoslab.pitt.edu/services.html. PMID:22216218

  11. Affect regulation, brain development, and behavioral/emotional health in adolescence.

    PubMed

    Dahl, R E

    2001-01-01

    This paper addresses the importance of affect regulation (AR) in relation to a broad range of behavioral and emotional health problems that emerge during adolescence. AR is defined as the adaptive modulation of emotional experience to serve a goal or purpose. This conceptualization of AR emphasizes the use of cognitive skills to guide, inhibit, or modify emotion and behavior, including the expression of emotional responses, in learned, strategic ways-skills that ultimately underpin adult levels of social maturity and the ability to show "responsible" behavior across a range of emotional situations. Neurobehavioral systems that subserve these AR skills include areas of the inferior and orbital prefrontal cortex (PFC), with rich interconnections to several limbic structures and other cortical areas, including the dorsolateral PFC. Adolescence represents an important developmental period in the functional maturation of adult AR skills; it is also a critical time in the development of clinical disorders of AR (eg, rates of depression increase dramatically and gender differences in depression emerge). Maturational changes in AR that occur during adolescence-particularly with respect to the role of emotions influencing responsible decision making-are also relevant to understanding key aspects of the developmental pathways of some behavioral health problems, such as alcohol use and nicotine dependence. A strong case is made for developmental research in affective neuroscience aimed at this important maturational period, particularly the kind of transdisciplinary research leading toward mechanistic understanding of the development of adolescent-onset disorders. Improving understanding in these areas could ultimately lead to the development of early interventions in targeted high-risk populations, and has enormous clinical and social policy relevance.

  12. The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development.

    PubMed

    Teichert, Ines; Nowrousian, Minou; Pöggeler, Stefanie; Kück, Ulrich

    2014-01-01

    Filamentous fungi are excellent experimental systems due to their short life cycles as well as easy and safe manipulation in the laboratory. They form three-dimensional structures with numerous different cell types and have a long tradition as genetic model organisms used to unravel basic mechanisms underlying eukaryotic cell differentiation. The filamentous ascomycete Sordaria macrospora is a model system for sexual fruiting body (perithecia) formation. S. macrospora is homothallic, i.e., self-fertile, easily genetically tractable, and well suited for large-scale genomics, transcriptomics, and proteomics studies. Specific features of its life cycle and the availability of a developmental mutant library make it an excellent system for studying cellular differentiation at the molecular level. In this review, we focus on recent developments in identifying gene and protein regulatory networks governing perithecia formation. A number of tools have been developed to genetically analyze developmental mutants and dissect transcriptional profiles at different developmental stages. Protein interaction studies allowed us to identify a highly conserved eukaryotic multisubunit protein complex, the striatin-interacting phosphatase and kinase complex and its role in sexual development. We have further identified a number of proteins involved in chromatin remodeling and transcriptional regulation of fruiting body development. Furthermore, we review the involvement of metabolic processes from both primary and secondary metabolism, and the role of nutrient recycling by autophagy in perithecia formation. Our research has uncovered numerous players regulating multicellular development in S. macrospora. Future research will focus on mechanistically understanding how these players are orchestrated in this fungal model system. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. NUP-1 Is a Large Coiled-Coil Nucleoskeletal Protein in Trypanosomes with Lamin-Like Functions

    PubMed Central

    DuBois, Kelly N.; Alsford, Sam; Holden, Jennifer M.; Buisson, Johanna; Swiderski, Michal; Bart, Jean-Mathieu; Ratushny, Alexander V.; Wan, Yakun; Bastin, Philippe; Barry, J. David; Navarro, Miguel; Horn, David; Aitchison, John D.; Rout, Michael P.; Field, Mark C.

    2012-01-01

    A unifying feature of eukaryotic nuclear organization is genome segregation into transcriptionally active euchromatin and transcriptionally repressed heterochromatin. In metazoa, lamin proteins preserve nuclear integrity and higher order heterochromatin organization at the nuclear periphery, but no non-metazoan lamin orthologues have been identified, despite the likely presence of nucleoskeletal elements in many lineages. This suggests a metazoan-specific origin for lamins, and therefore that distinct protein elements must compose the nucleoskeleton in other lineages. The trypanosomatids are highly divergent organisms and possess well-documented but remarkably distinct mechanisms for control of gene expression, including polycistronic transcription and trans-splicing. NUP-1 is a large protein localizing to the nuclear periphery of Trypanosoma brucei and a candidate nucleoskeletal component. We sought to determine if NUP-1 mediates heterochromatin organization and gene regulation at the nuclear periphery by examining the influence of NUP-1 knockdown on morphology, chromatin positioning, and transcription. We demonstrate that NUP-1 is essential and part of a stable network at the inner face of the trypanosome nuclear envelope, since knockdown cells have abnormally shaped nuclei with compromised structural integrity. NUP-1 knockdown also disrupts organization of nuclear pore complexes and chromosomes. Most significantly, we find that NUP-1 is required to maintain the silenced state of developmentally regulated genes at the nuclear periphery; NUP-1 knockdown results in highly specific mis-regulation of telomere-proximal silenced variant surface glycoprotein (VSG) expression sites and procyclin loci, indicating a disruption to normal chromatin organization essential to life-cycle progression. Further, NUP-1 depletion leads to increased VSG switching and therefore appears to have a role in control of antigenic variation. Thus, analogous to vertebrate lamins, NUP-1 is a major component of the nucleoskeleton with key roles in organization of the nuclear periphery, heterochromatin, and epigenetic control of developmentally regulated loci. PMID:22479148

  14. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    PubMed Central

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  15. Effects of the biosynthesis and signaling pathway of ecdysterone on silkworm (Bombyx mori) following exposure to titanium dioxide nanoparticles.

    PubMed

    Li, Fanchi; Gu, Zhiya; Wang, Binbin; Xie, Yi; Ma, Lie; Xu, Kaizun; Ni, Min; Zhang, Hua; Shen, Weide; Li, Bing

    2014-08-01

    Silkworm (Bombyx mori), a model Lepidoptera insect, is economically important. Its growth and development are regulated by endogenous hormones. During the process of transition from larvae to pupae, 20-hydroxyecdysone (20E) plays an important role. The recent surge in consumer products and applications using metallic nanoparticles has increased the possibility of human or ecosystem exposure due to their unintentional release into the environment. We investigated the effects of exposure to titanium dioxide nanoparticles (TiO2 NPs) on the action of 20E in B. mori. Titanium dioxide nanoparticle treatment shortened the molting duration by 8 hr and prolonged the molting peak period by 10 %. Solexa sequencing profiled the changes in gene expression in the brain of fifth-instar B. mori in response to TiO2NPS exposure for 72 hr, to address the effects on hormone metabolism and regulation. Thirty one genes were differentially expressed. The transcriptional levels of pi3k and P70S6K, which are involved in the target of the rapamycin (TOR) signaling pathway, were up-regulated. Transcriptional levels of four cytochrome P450 genes, which are involved in 20E biosynthesis, at different developmental stages (48, 96, 144, and 192 hr) at 5th instars of all displayed trends of increasing expression. Simultaneously, the ecdysterone receptors, also displayed increasing trends. The 20E titers at four developmental stages during the 5th instar were 1.26, 1.23, 1.72, and 2.16 fold higher, respectively, than the control group. These results indicate that feeding B. mori with TiO2 NPs stimulates 20E biosynthesis, shortens the developmental progression, and reduces the duration of molting. Thus, application of TiO2 NPs is of high significance for saving the labor force in sericulture, and our research provides a reference for the ecological problems in the field of Lepidoptera exposured to titanium dioxide nanoparticles.

  16. Developmental and Evolutionary History Affect Survival in Stressful Environments

    PubMed Central

    Hopkins, Gareth R.; Brodie, Edmund D.; French, Susannah S.

    2014-01-01

    The world is increasingly impacted by a variety of stressors that have the potential to differentially influence life history stages of organisms. Organisms have evolved to cope with some stressors, while with others they have little capacity. It is thus important to understand the effects of both developmental and evolutionary history on survival in stressful environments. We present evidence of the effects of both developmental and evolutionary history on survival of a freshwater vertebrate, the rough-skinned newt (Taricha granulosa) in an osmotically stressful environment. We compared the survival of larvae in either NaCl or MgCl2 that were exposed to salinity either as larvae only or as embryos as well. Embryonic exposure to salinity led to greater mortality of newt larvae than larval exposure alone, and this reduced survival probability was strongly linked to the carry-over effect of stunted embryonic growth in salts. Larval survival was also dependent on the type of salt (NaCl or MgCl2) the larvae were exposed to, and was lowest in MgCl2, a widely-used chemical deicer that, unlike NaCl, amphibian larvae do not have an evolutionary history of regulating at high levels. Both developmental and evolutionary history are critical factors in determining survival in this stressful environment, a pattern that may have widespread implications for the survival of animals increasingly impacted by substances with which they have little evolutionary history. PMID:24748021

  17. Cognitive Modeling and Self-Regulation of Learning in Instructional Settings

    ERIC Educational Resources Information Center

    White, Marie C.

    2017-01-01

    Self-regulation of cognition and behavior is an important aspect of student learning and academic performance in the 21st-century classroom. The purpose of the chapter is to present how an integrated framework of cyclical phases and developmental levels of self-regulated learning play a significant role in modeling and self-regulatory learning as…

  18. Contextual Emotion-Regulation Therapy for Childhood Depression: Description and Pilot Testing of a New Intervention

    ERIC Educational Resources Information Center

    Kovacs, Maria; Sherrill, Joel; George, Charles J.; Pollock, Myrna; Tumuluru, Rameshwari V.; Ho, Vincent

    2006-01-01

    Objective: To pilot test the acceptability and efficacy of contextual emotion-regulation therapy (CERT), a new, developmentally appropriate intervention for childhood depression, which focuses on the self-regulation of dysphoria. Method: Two samples of convenience (n = 29, n = 2) served to verify some CERT constructs; it was then operationalized…

  19. Developmental Consequences of Early Parenting Experiences: Self-Recognition and Self-Regulation in Three Cultural Communities

    ERIC Educational Resources Information Center

    Keller, Heidi; Yovsi, Relindis; Borke, Joern; Krtner, Joscha; Jensen, Henning; Papaligoura, Zaira

    2004-01-01

    This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of…

  20. System-Level and Granger Network Analysis of Integrated Proteomic and Metabolomic Dynamics Identifies Key Points of Grape Berry Development at the Interface of Primary and Secondary Metabolism.

    PubMed

    Wang, Lei; Sun, Xiaoliang; Weiszmann, Jakob; Weckwerth, Wolfram

    2017-01-01

    Grapevine is a fruit crop with worldwide economic importance. The grape berry undergoes complex biochemical changes from fruit set until ripening. This ripening process and production processes define the wine quality. Thus, a thorough understanding of berry ripening is crucial for the prediction of wine quality. For a systemic analysis of grape berry development we applied mass spectrometry based platforms to analyse the metabolome and proteome of Early Campbell at 12 stages covering major developmental phases. Primary metabolites involved in central carbon metabolism, such as sugars, organic acids and amino acids together with various bioactive secondary metabolites like flavonols, flavan-3-ols and anthocyanins were annotated and quantified. At the same time, the proteomic analysis revealed the protein dynamics of the developing grape berries. Multivariate statistical analysis of the integrated metabolomic and proteomic dataset revealed the growth trajectory and corresponding metabolites and proteins contributing most to the specific developmental process. K-means clustering analysis revealed 12 highly specific clusters of co-regulated metabolites and proteins. Granger causality network analysis allowed for the identification of time-shift correlations between metabolite-metabolite, protein- protein and protein-metabolite pairs which is especially interesting for the understanding of developmental processes. The integration of metabolite and protein dynamics with their corresponding biochemical pathways revealed an energy-linked metabolism before veraison with high abundances of amino acids and accumulation of organic acids, followed by protein and secondary metabolite synthesis. Anthocyanins were strongly accumulated after veraison whereas other flavonoids were in higher abundance at early developmental stages and decreased during the grape berry developmental processes. A comparison of the anthocyanin profile of Early Campbell to other cultivars revealed similarities to Concord grape and indicates the strong effect of genetic background on metabolic partitioning in primary and secondary metabolism.

  1. System-Level and Granger Network Analysis of Integrated Proteomic and Metabolomic Dynamics Identifies Key Points of Grape Berry Development at the Interface of Primary and Secondary Metabolism

    PubMed Central

    Wang, Lei; Sun, Xiaoliang; Weiszmann, Jakob; Weckwerth, Wolfram

    2017-01-01

    Grapevine is a fruit crop with worldwide economic importance. The grape berry undergoes complex biochemical changes from fruit set until ripening. This ripening process and production processes define the wine quality. Thus, a thorough understanding of berry ripening is crucial for the prediction of wine quality. For a systemic analysis of grape berry development we applied mass spectrometry based platforms to analyse the metabolome and proteome of Early Campbell at 12 stages covering major developmental phases. Primary metabolites involved in central carbon metabolism, such as sugars, organic acids and amino acids together with various bioactive secondary metabolites like flavonols, flavan-3-ols and anthocyanins were annotated and quantified. At the same time, the proteomic analysis revealed the protein dynamics of the developing grape berries. Multivariate statistical analysis of the integrated metabolomic and proteomic dataset revealed the growth trajectory and corresponding metabolites and proteins contributing most to the specific developmental process. K-means clustering analysis revealed 12 highly specific clusters of co-regulated metabolites and proteins. Granger causality network analysis allowed for the identification of time-shift correlations between metabolite-metabolite, protein- protein and protein-metabolite pairs which is especially interesting for the understanding of developmental processes. The integration of metabolite and protein dynamics with their corresponding biochemical pathways revealed an energy-linked metabolism before veraison with high abundances of amino acids and accumulation of organic acids, followed by protein and secondary metabolite synthesis. Anthocyanins were strongly accumulated after veraison whereas other flavonoids were in higher abundance at early developmental stages and decreased during the grape berry developmental processes. A comparison of the anthocyanin profile of Early Campbell to other cultivars revealed similarities to Concord grape and indicates the strong effect of genetic background on metabolic partitioning in primary and secondary metabolism. PMID:28713396

  2. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NSF patent policy. 2527.7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL... Department of Commerce in all its funding agreements for the performance of experimental, developmental, or...

  3. Larval crowding accelerates C. elegans development and reduces lifespan.

    PubMed

    Ludewig, Andreas H; Gimond, Clotilde; Judkins, Joshua C; Thornton, Staci; Pulido, Dania C; Micikas, Robert J; Döring, Frank; Antebi, Adam; Braendle, Christian; Schroeder, Frank C

    2017-04-01

    Environmental conditions experienced during animal development are thought to have sustained impact on maturation and adult lifespan. Here we show that in the model organism C. elegans developmental rate and adult lifespan depend on larval population density, and that this effect is mediated by excreted small molecules. By using the time point of first egg laying as a marker for full maturity, we found that wildtype hermaphrodites raised under high density conditions developed significantly faster than animals raised in isolation. Population density-dependent acceleration of development (Pdda) was dramatically enhanced in fatty acid β-oxidation mutants that are defective in the biosynthesis of ascarosides, small-molecule signals that induce developmental diapause. In contrast, Pdda is abolished by synthetic ascarosides and steroidal ligands of the nuclear hormone receptor DAF-12. We show that neither ascarosides nor any known steroid hormones are required for Pdda and that another chemical signal mediates this phenotype, in part via the nuclear hormone receptor NHR-8. Our results demonstrate that C. elegans development is regulated by a push-pull mechanism, based on two antagonistic chemical signals: chemosensation of ascarosides slows down development, whereas population-density dependent accumulation of a different chemical signal accelerates development. We further show that the effects of high larval population density persist through adulthood, as C. elegans larvae raised at high densities exhibit significantly reduced adult lifespan and respond differently to exogenous chemical signals compared to larvae raised at low densities, independent of density during adulthood. Our results demonstrate how inter-organismal signaling during development regulates reproductive maturation and longevity.

  4. Larval crowding accelerates C. elegans development and reduces lifespan

    PubMed Central

    Ludewig, Andreas H.; Gimond, Clotilde; Judkins, Joshua C.; Thornton, Staci; Pulido, Dania C.; Micikas, Robert J.; Döring, Frank; Antebi, Adam; Braendle, Christian; Schroeder, Frank C.

    2017-01-01

    Environmental conditions experienced during animal development are thought to have sustained impact on maturation and adult lifespan. Here we show that in the model organism C. elegans developmental rate and adult lifespan depend on larval population density, and that this effect is mediated by excreted small molecules. By using the time point of first egg laying as a marker for full maturity, we found that wildtype hermaphrodites raised under high density conditions developed significantly faster than animals raised in isolation. Population density-dependent acceleration of development (Pdda) was dramatically enhanced in fatty acid β-oxidation mutants that are defective in the biosynthesis of ascarosides, small-molecule signals that induce developmental diapause. In contrast, Pdda is abolished by synthetic ascarosides and steroidal ligands of the nuclear hormone receptor DAF-12. We show that neither ascarosides nor any known steroid hormones are required for Pdda and that another chemical signal mediates this phenotype, in part via the nuclear hormone receptor NHR-8. Our results demonstrate that C. elegans development is regulated by a push-pull mechanism, based on two antagonistic chemical signals: chemosensation of ascarosides slows down development, whereas population-density dependent accumulation of a different chemical signal accelerates development. We further show that the effects of high larval population density persist through adulthood, as C. elegans larvae raised at high densities exhibit significantly reduced adult lifespan and respond differently to exogenous chemical signals compared to larvae raised at low densities, independent of density during adulthood. Our results demonstrate how inter-organismal signaling during development regulates reproductive maturation and longevity. PMID:28394895

  5. Developmental Expression of Violaxanthin De-Epoxidase in Leaves of Tobacco Growing under High and Low Light1

    PubMed Central

    Bugos, Robert C.; Chang, Sue-Hwei; Yamamoto, Harry Y.

    1999-01-01

    Violaxanthin de-epoxidase (VDE) is a lumen-localized enzyme that catalyzes the de-epoxidation of violaxanthin in the thylakoid membrane upon formation of a transthylakoid pH gradient. We investigated the developmental expression of VDE in leaves of mature tobacco (Nicotiana tabacum) plants grown under high-light conditions (in the field) and low-light conditions (in a growth chamber). The difference in light conditions was evident by the increased pool size (violaxanthin + antheraxanthin + zeaxanthin, VAZ) throughout leaf development in field-grown plants. VDE activity based on chlorophyll or leaf area was low in the youngest leaves, with the levels increasing with increasing leaf age in both high- and low-light-grown plants. However, in high-light-grown plants, the younger leaves in early leaf expansion showed a more rapid increase in VDE activity and maintained higher levels of VDE transcript in more leaves, indicating that high light may induce greater levels of VDE. VDE transcript levels decreased substantially in leaves of mid-leaf expansion, while the levels of enzyme continued to increase, suggesting that the VDE enzyme does not turn over rapidly. The level of VDE changed in an inverse, nonlinear relationship with respect to the VAZ pool, suggesting that enzyme levels could be indirectly regulated by the VAZ pool. PMID:10482676

  6. Developmental expression of violaxanthin de-epoxidase in leaves of tobacco growing under high and low light.

    PubMed

    Bugos, R C; Chang, S H; Yamamoto, H Y

    1999-09-01

    Violaxanthin de-epoxidase (VDE) is a lumen-localized enzyme that catalyzes the de-epoxidation of violaxanthin in the thylakoid membrane upon formation of a transthylakoid pH gradient. We investigated the developmental expression of VDE in leaves of mature tobacco (Nicotiana tabacum) plants grown under high-light conditions (in the field) and low-light conditions (in a growth chamber). The difference in light conditions was evident by the increased pool size (violaxanthin + antheraxanthin + zeaxanthin, VAZ) throughout leaf development in field-grown plants. VDE activity based on chlorophyll or leaf area was low in the youngest leaves, with the levels increasing with increasing leaf age in both high- and low-light-grown plants. However, in high-light-grown plants, the younger leaves in early leaf expansion showed a more rapid increase in VDE activity and maintained higher levels of VDE transcript in more leaves, indicating that high light may induce greater levels of VDE. VDE transcript levels decreased substantially in leaves of mid-leaf expansion, while the levels of enzyme continued to increase, suggesting that the VDE enzyme does not turn over rapidly. The level of VDE changed in an inverse, nonlinear relationship with respect to the VAZ pool, suggesting that enzyme levels could be indirectly regulated by the VAZ pool.

  7. Sucrose affects the developmental transition of rhizomes in Oryza longistaminata.

    PubMed

    Bessho-Uehara, Kanako; Nugroho, Jovano Erris; Kondo, Hirono; Angeles-Shim, Rosalyn B; Ashikari, Motoyuki

    2018-05-08

    Oryza longistaminata, the African wild rice, can propagate vegetatively through rhizomes. Rhizomes elongate horizontally underground as sink organs, however, they undergo a developmental transition that shifts their growth to the surface of the ground to become aerial stems. This particular stage is essential for the establishment of new ramets. While several determinants such as abiotic stimuli and plant hormones have been reported as key factors effecting developmental transition in aerial stem, the cause of this phenomenon in rhizome remains elusive. This study shows that depletion of nutrients, particularly sucrose, is the key stimulus that induces the developmental transition in rhizomes, as indicated by the gradient of sugars from the base to the tip of the rhizome. Sugar treatments revealed that sucrose specifically represses the developmental transition from rhizome to aerial stem by inhibiting the expression of sugar metabolism and hormone synthesis genes at the bending point. Sucrose depletion affected several factors contributing to the developmental transition of rhizome including signal transduction, transcriptional regulation and plant hormone balance.

  8. Comprehensive transcriptional map of primate brain development

    PubMed Central

    Bakken, Trygve E.; Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A.; Ng, Lydia; Szafer, Aaron; Dalley, Rachel A.; Royall, Joshua J.; Lemon, Tracy; Shapouri, Sheila; Aiona, Kaylynn; Arnold, James; Bennett, Jeffrey L.; Bertagnolli, Darren; Bickley, Kristopher; Boe, Andrew; Brouner, Krissy; Butler, Stephanie; Byrnes, Emi; Caldejon, Shiella; Carey, Anita; Cate, Shelby; Chapin, Mike; Chen, Jefferey; Dee, Nick; Desta, Tsega; Dolbeare, Tim A.; Dotson, Nadia; Ebbert, Amanda; Fulfs, Erich; Gee, Garrett; Gilbert, Terri L.; Goldy, Jeff; Gourley, Lindsey; Gregor, Ben; Gu, Guangyu; Hall, Jon; Haradon, Zeb; Haynor, David R.; Hejazinia, Nika; Hoerder-Suabedissen, Anna; Howard, Robert; Jochim, Jay; Kinnunen, Marty; Kriedberg, Ali; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Luong, Lon; Mastan, Naveed; May, Ryan; Melchor, Jose; Mosqueda, Nerick; Mott, Erika; Ngo, Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana; Pendergraft, Julie; Potekhina, Lydia; Reding, Melissa; Riley, Zackery L.; Roberts, Tyson; Rogers, Brandon; Roll, Kate; Rosen, David; Sandman, David; Sarreal, Melaine; Shapovalova, Nadiya; Shi, Shu; Sjoquist, Nathan; Sodt, Andy J.; Townsend, Robbie; Velasquez, Lissette; Wagley, Udi; Wakeman, Wayne B.; White, Cassandra; Bennett, Crissa; Wu, Jennifer; Young, Rob; Youngstrom, Brian L.; Wohnoutka, Paul; Gibbs, Richard A.; Rogers, Jeffrey; Hohmann, John G.; Hawrylycz, Michael J.; Hevner, Robert F.; Molnár, Zoltán; Phillips, John W.; Dang, Chinh; Jones, Allan R.; Amaral, David G.; Bernard, Amy; Lein, Ed S.

    2017-01-01

    The transcriptional underpinnings of brain development remain poorly understood, particularly in humans and closely related non-human primates. We describe a high resolution transcriptional atlas of rhesus monkey brain development that combines dense temporal sampling of prenatal and postnatal periods with fine anatomical parcellation of cortical and subcortical regions associated with human neuropsychiatric disease. Gene expression changes more rapidly before birth, both in progenitor cells and maturing neurons, and cortical layers and areas acquire adult-like molecular profiles surprisingly late postnatally. Disparate cell populations exhibit distinct developmental timing but also unexpected synchrony of processes underlying neural circuit construction including cell projection and adhesion. Candidate risk genes for neurodevelopmental disorders including primary microcephaly, autism spectrum disorder, intellectual disability, and schizophrenia show disease-specific spatiotemporal enrichment within developing neocortex. Human developmental expression trajectories are more similar to monkey than rodent, and approximately 9% of genes show human-specific regulation with evidence for prolonged maturation or neoteny. PMID:27409810

  9. Current progress in orchid flowering/flower development research

    PubMed Central

    Wang, Hsin-Mei; Tong, Chii-Gong

    2017-01-01

    ABSTRACT Genetic pathways relevant to flowering of Arabidopsis are under the control of environmental cues such as day length and temperatures, and endogenous signals including phytohormones and developmental aging. However, genes and even regulatory pathways for flowering identified in crops show divergence from those of Arabidopsis and often do not have functional equivalents to Arabidopsis and/or existing species- or genus-specific regulators and show modified or novel pathways. Orchids are the largest, most highly evolved flowering plants, and form an extremely peculiar group of plants. Here, we briefly summarize the flowering pathways of Arabidopsis, rice and wheat and present them alongside recent discoveries/progress in orchid flowering and flower developmental processes including our transgenic Phalaenopsis orchids for LEAFY overexpression. Potential biotechnological applications in flowering/flower development of orchids with potential target genes are also discussed from an interactional and/or comparative viewpoint. PMID:28448202

  10. Insights into skeletal muscle development and applications in regenerative medicine.

    PubMed

    Tran, T; Andersen, R; Sherman, S P; Pyle, A D

    2013-01-01

    Embryonic and postnatal development of skeletal muscle entails highly regulated processes whose complexity continues to be deconstructed. One key stage of development is the satellite cell, whose niche is composed of multiple cell types that eventually contribute to terminally differentiated myotubes. Understanding these developmental processes will ultimately facilitate treatments of myopathies such as Duchenne muscular dystrophy (DMD), a disease characterized by compromised cell membrane structure, resulting in severe muscle wasting. One theoretical approach is to use pluripotent stem cells in a therapeutic setting to help replace degenerated muscle tissue. This chapter discusses key myogenic developmental stages and their regulatory pathways; artificial myogenic induction in pluripotent stem cells; advantages and disadvantages of DMD animal models; and therapeutic approaches targeting DMD. Furthermore, skeletal muscle serves as an excellent paradigm for understanding general cell fate decisions throughout development. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Monitoring, metacognition, and executive function: elucidating the role of self-reflection in the development of self-regulation.

    PubMed

    Lyons, Kristen E; Zelazo, Philip David

    2011-01-01

    While an abundance of research has investigated the development of the automatic and controlled processes through which individuals control their thoughts, emotions, and actions, less research has emphasized the role of the self in self-regulation. This chapter synthesizes four literatures that have examined the mechanisms through which the individual acts in a managerial role, evaluating the current status of the system and initiating regulatory actions as necessary. Taken together, these literatures (on executive function, error monitoring, metacognition, and uncertainty monitoring) suggest that self-reflection plays a critical role in self-regulation, and that developmental improvements in self-reflection (via increasing levels of conscious awareness and enhanced calibration of monitoring systems) may serve as driving forces underlying developmental improvement (and temperamental individual differences) in children's ability to control their thoughts and actions.

  12. Membrane-tethered transcription factors provide a connection between stress response and developmental pathways

    PubMed Central

    Slabaugh, Erin

    2011-01-01

    Membrane-tethered transcription factors (MTTFs) are proteins that are targeted to membranes and are capable of regulating gene expression. In this way, they are physically restrained from entering the nucleus and are innately dormant. Upon specific signal recognition cues, MTTFs are activated through cleavage by a protease that releases the transcription factor domain into the cytosol thus allowing it to translocate to the nucleus where it can regulate gene expression. MTTFs are classically thought to provide an advantage to an organism by allowing for rapid signal transduction in response to cellular and environmental stresses. However, recent findings suggest that MTTFs may not only act as a means to respond quickly to stress but also are able to regulate developmental pathways, illustrating a point of interaction between stress and development. PMID:21758012

  13. A Gestational High Protein Diet Affects the Abundance of Muscle Transcripts Related to Cell Cycle Regulation throughout Development in Porcine Progeny

    PubMed Central

    Oster, Michael; Murani, Eduard; Metges, Cornelia C.; Ponsuksili, Siriluck; Wimmers, Klaus

    2012-01-01

    Background In various animal models pregnancy diets have been shown to affect offspring phenotype. Indeed, the underlying programming of development is associated with modulations in birth weight, body composition, and continual diet-dependent modifications of offspring metabolism until adulthood, producing the hypothesis that the offspring's transcriptome is permanently altered depending on maternal diet. Methodology/Principal Findings To assess alterations of the offspring's transcriptome due to gestational protein supply, German Landrace sows were fed isoenergetic diets containing protein levels of either 30% (high protein - HP) or 12% (adequate protein - AP) throughout their pregnancy. Offspring muscle tissue (M. longissimus dorsi) was collected at 94 days post conception (dpc), and 1, 28, and 188 days post natum (dpn) for use with Affymetrix GeneChip Porcine Genome Arrays and subsequent statistical and Ingenuity pathway analyses. Numerous transcripts were found to have altered abundance at 94 dpc and 1 dpn; at 28 dpn no transcripts were altered, and at 188 dpn only a few transcripts showed a different abundance between diet groups. However, when assessing transcriptional changes across developmental time points, marked differences were obvious among the dietary groups. Depending on the gestational dietary exposure, short- and long-term effects were observed for mRNA expression of genes related to cell cycle regulation, energy metabolism, growth factor signaling pathways, and nucleic acid metabolism. In particular, the abundance of transcripts related to cell cycle remained divergent among the groups during development. Conclusion Expression analysis indicates that maternal protein supply induced programming of the offspring's genome; early postnatal compensation of the slight growth retardation obvious at birth in HP piglets resulted, as did a permanently different developmental alteration and responsiveness to the common environment of the transcriptome. The transcriptome modulations are interpreted as the molecular equivalent of developmental plasticity of the offspring that necessitates adaptation and maintenance of the organismal phenotype. PMID:22496824

  14. Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

    PubMed Central

    Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

    2014-01-01

    Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

  15. Characterization of promoter of EgPAL1, a novel PAL gene from the oil palm Elaeis guineensis Jacq.

    PubMed

    Yusuf, Chong Yu Lok; Abdullah, Janna Ong; Shaharuddin, Noor Azmi; Abu Seman, Idris; Abdullah, Mohd Puad

    2018-02-01

    The oil palm EgPAL1 gene promoter and its regulatory region were functional as a promoter in the heterologous system of Arabidopsis according to the cis-acting elements present in that region. The promoter was developmentally regulated, vascular tissue specific and responsive to water stress agents. Phenylalanine ammonia lyase (PAL, EC 4.3.1.24) is the key enzyme of the phenylpropanoid pathway which plays important roles in plant development and adaptation. To date, there is no report on the study of PAL from oil palm (Elaeis guineensis), an economically important oil crop. In this study, the 5' regulatory sequence of a highly divergent oil palm PAL gene (EgPAL1) was isolated and fused with GUS in Arabidopsis to create two transgenic plants carrying the minimal promoter with (2302 bp) and without its regulatory elements (139 bp). The regulatory sequence contained cis-acting elements known to be important for plant development and stress response including the AC-II element for lignin biosynthesis and several stress responsive elements. The promoter and its regulatory region were fully functional in Arabidopsis. Its activities were characterised by two common fundamental features of PAL which are responsive to plant internal developmental programme and external factors. The promoter was developmentally regulated in certain organs; highly active in young organs but less active or inactive in mature organs. The presence of the AC elements and global activity of the EgPAL1 promoter in all organs resembled the property of lignin-related genes. The existence of the MBS element and enhancement of the promoter activity by PEG reflected the behaviour of drought-responsive genes. Our findings provide a platform for evaluating oil palm gene promoters in the heterologous system of Arabidopsis and give insights into the activities of EgPAL1 promoter in oil palm.

  16. Longitudinal associations between physically abusive parents' emotional expressiveness and children's self-regulation.

    PubMed

    Milojevich, Helen M; Haskett, Mary E

    2018-03-01

    The present study took a developmental psychopathology approach to examine the longitudinal association between parents' emotional expressiveness and children's self-regulation. Data collection spanned from 2004 to 2008. Ninety-two physically abusive parents completed yearly assessments of their emotional expressiveness, as well as their children's self-regulation abilities. Observational and behavioral measures were also obtained yearly to capture both parents' emotional expressiveness and children's self-regulation. Specifically, parents participated in a parent-child interaction task, which provided insight into their levels of flat affect. A puzzle box task was completed by each child to assess self-regulation. Results indicated, first, that greater parental expression of negative emotions predicted poorer self-regulation in children, both concurrently and across time. Second, parental expressions of positive emotions and parents' flat affect were unrelated to children's self-regulation. Findings inform our understanding of parental socialization of self-regulation and provide insight into the roles of distinct components of emotional expressiveness. Moreover, findings have crucial implications for understanding emotional expressiveness in high-risk samples and increase our understanding of within-group functioning among maltreating families that may serve as a means to direct intervention efforts. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

    PubMed

    Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

    2017-02-28

    Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

  18. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  19. Developmental Stage, Muscle and Genetic Type Modify Muscle Transcriptome in Pigs: Effects on Gene Expression and Regulatory Factors Involved in Growth and Metabolism.

    PubMed

    Ayuso, Miriam; Fernández, Almudena; Núñez, Yolanda; Benítez, Rita; Isabel, Beatriz; Fernández, Ana I; Rey, Ana I; González-Bulnes, Antonio; Medrano, Juan F; Cánovas, Ángela; López-Bote, Clemente J; Óvilo, Cristina

    2016-01-01

    Iberian pig production includes purebred (IB) and Duroc-crossbred (IBxDU) pigs, which show important differences in growth, fattening and tissue composition. This experiment was conducted to investigate the effects of genetic type and muscle (Longissimus dorsi (LD) vs Biceps femoris (BF)) on gene expression and transcriptional regulation at two developmental stages. Nine IB and 10 IBxDU piglets were slaughtered at birth, and seven IB and 10 IBxDU at four months of age (growing period). Carcass traits and LD intramuscular fat (IMF) content were measured. Muscle transcriptome was analyzed on LD samples with RNA-Seq technology. Carcasses were smaller in IB than in IBxDU neonates (p < 0.001), while growing IB pigs showed greater IMF content (p < 0.05). Gene expression was affected (p < 0.01 and Fold change > 1.5) by the developmental stage (5,812 genes), muscle type (135 genes), and genetic type (261 genes at birth and 113 at growth). Newborns transcriptome reflected a highly proliferative developmental stage, while older pigs showed upregulation of catabolic and muscle functioning processes. Regarding the genetic type effect, IBxDU newborns showed enrichment of gene pathways involved in muscle growth, in agreement with the higher prenatal growth observed in these pigs. However, IB growing pigs showed enrichment of pathways involved in protein deposition and cellular growth, supporting the compensatory gain experienced by IB pigs during this period. Moreover, newborn and growing IB pigs showed more active glucose and lipid metabolism than IBxDU pigs. Moreover, LD muscle seems to have more active muscular and cell growth, while BF points towards lipid metabolism and fat deposition. Several regulators controlling transcriptome changes in both genotypes were identified across muscles and ages (SIM1, PVALB, MEFs, TCF7L2 or FOXO1), being strong candidate genes to drive expression and thus, phenotypic differences between IB and IBxDU pigs. Many of the identified regulators were known to be involved in muscle and adipose tissues development, but others not previously associated with pig muscle growth were also identified, as PVALB, KLF1 or IRF2. The present study discloses potential molecular mechanisms underlying phenotypic differences observed between IB and IBxDU pigs and highlights candidate genes implicated in these molecular mechanisms.

  20. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    PubMed Central

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  1. Wash functions downstream of Rho1 GTPase in a subset of Drosophila immune cell developmental migrations

    PubMed Central

    Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.

    2015-01-01

    Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458

  2. Children with borderline intellectual functioning and autism spectrum disorder: developmental trajectories from 4 to 11 years of age

    PubMed Central

    Barnevik Olsson, Martina; Holm, Anette; Westerlund, Joakim; Lundholm Hedvall, Åsa; Gillberg, Christopher; Fernell, Elisabeth

    2017-01-01

    Background Studies on autism have tended to focus either on those with intellectual disability (ie, those with intellectual quotient [IQ] under 70) or on the group that is referred to as “high-functioning”, that is, those with borderline, average or above average IQ. The literature on cognition and daily functioning in autism spectrum disorder combined specifically with borderline intellectual functioning (IQ 70–84) is limited. Methods From a representative group of 208 preschool children diagnosed with autism spectrum disorder, those 50 children in the group with borderline intellectual functioning at ages 4.5–6.5 years were targeted for follow-up at a median age of 10 years. A new cognitive test was carried out in 30 children. Parents were interviewed with a semi-structured interview together with the Vineland Adaptive Behavior Scales (n=41) and the Autism-Tics, attention-deficit/hyperactivity disorder (AD/HD) and other comorbidities inventory (A-TAC) (n=36). Results Most children of interviewed parents presented problems within several developmental areas. According to A-TAC and the clinical interview, there were high rates of attention deficits and difficulties with regulating activity level and impulsivity. Vineland Adaptive Behavior Scales composite scores showed that at school age, a majority of the children had declined since the previous assessment at ages between 4.5 and 6.5 years. Almost half the tested group had shifted in their IQ level, to below 70 or above 84. Conclusion None of the children assessed was without developmental/neuropsychiatric problems at school-age follow-up. The results support the need for comprehensive follow-up of educational, medical and developmental/neuropsychiatric needs, including a retesting of cognitive functions. There is also a need for continuing parent/family follow-up and support. PMID:29042781

  3. Intranuclear DNA density affects chromosome condensation in metazoans

    PubMed Central

    Hara, Yuki; Iwabuchi, Mari; Ohsumi, Keita; Kimura, Akatsuki

    2013-01-01

    Chromosome condensation is critical for accurate inheritance of genetic information. The degree of condensation, which is reflected in the size of the condensed chromosomes during mitosis, is not constant. It is differentially regulated in embryonic and somatic cells. In addition to the developmentally programmed regulation of chromosome condensation, there may be adaptive regulation based on spatial parameters such as genomic length or cell size. We propose that chromosome condensation is affected by a spatial parameter called the chromosome amount per nuclear space, or “intranuclear DNA density.” Using Caenorhabditis elegans embryos, we show that condensed chromosome sizes vary during early embryogenesis. Of importance, changing DNA content to haploid or polyploid changes the condensed chromosome size, even at the same developmental stage. Condensed chromosome size correlates with interphase nuclear size. Finally, a reduction in nuclear size in a cell-free system from Xenopus laevis eggs resulted in reduced condensed chromosome sizes. These data support the hypothesis that intranuclear DNA density regulates chromosome condensation. This suggests an adaptive mode of chromosome condensation regulation in metazoans. PMID:23783035

  4. 29 CFR 1956.61 - Developmental Schedule.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... steps as provided in the plan: (a) Adopt standards identical to or at least as effective as all existing OSHA standards within one year after plan approval. (b) Adopt amendments to regulations regarding... 1908 within three years after plan approval. (f) Adopt amendments to regulations regarding...

  5. Early-life nutritional effects on the female reproductive system.

    PubMed

    Chan, K A; Tsoulis, M W; Sloboda, D M

    2015-02-01

    There is now considerable epidemiological and experimental evidence indicating that early-life environmental conditions, including nutrition, affect subsequent development in later life. These conditions induce highly integrated responses in endocrine-related homeostasis, resulting in persistent changes in the developmental trajectory producing an altered adult phenotype. Early-life events trigger processes that prepare the individual for particular circumstances that are anticipated in the postnatal environment. However, where the intrauterine and postnatal environments differ markedly, such modifications to the developmental trajectory may prove maladaptive in later life. Reproductive maturation and function are similarly influenced by early-life events. This should not be surprising, because the primordial follicle pool is established early in life and is thus vulnerable to early-life events. Results of clinical and experimental studies have indicated that early-life adversity is associated with a decline in ovarian follicular reserve, changes in ovulation rates, and altered age at onset of puberty. However, the underlying mechanisms regulating the relationship between the early-life developmental environment and postnatal reproductive development and function are unclear. This review examines the evidence linking early-life nutrition and effects on the female reproductive system, bringing together clinical observations in humans and experimental data from targeted animal models. © 2015 Society for Endocrinology.

  6. Genes and networks regulating root anatomy and architecture.

    PubMed

    Wachsman, Guy; Sparks, Erin E; Benfey, Philip N

    2015-10-01

    The root is an excellent model for studying developmental processes that underlie plant anatomy and architecture. Its modular structure, the lack of cell movement and relative accessibility to microscopic visualization facilitate research in a number of areas of plant biology. In this review, we describe several examples that demonstrate how cell type-specific developmental mechanisms determine cell fate and the formation of defined tissues with unique characteristics. In the last 10 yr, advances in genome-wide technologies have led to the sequencing of thousands of plant genomes, transcriptomes and proteomes. In parallel with the development of these high-throughput technologies, biologists have had to establish computational, statistical and bioinformatic tools that can deal with the wealth of data generated by them. These resources provide a foundation for posing more complex questions about molecular interactions, and have led to the discovery of new mechanisms that control phenotypic differences. Here we review several recent studies that shed new light on developmental processes, which are involved in establishing root anatomy and architecture. We highlight the power of combining large-scale experiments with classical techniques to uncover new pathways in root development. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  7. Serial analysis of gene expression in the silkworm, Bombyx mori.

    PubMed

    Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

    2005-08-01

    The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

  8. Mitochondrial dysfunction in alveolar and white matter developmental failure in premature infants

    PubMed Central

    Ten, Vadim S.

    2017-01-01

    At birth, some organs in premature infants are not developed enough to meet challenges of the extra-uterine life. Although growth and maturation continues after premature birth, postnatal organ development may become sluggish or even arrested, leading to organ dysfunction. There is no clear mechanistic concept of this postnatal organ developmental failure in premature neonates. This review introduces a concept-forming hypothesis: Mitochondrial bioenergetic dysfunction is a fundamental mechanism of organs maturation failure in premature infants. Data collected in support of this hypothesis are relevant to two major diseases of prematurity: white matter injury and broncho-pulmonary dysplasia. In these diseases, totally different clinical manifestations are defined by the same biological process, developmental failure of the main functional units—alveoli in the lungs and axonal myelination in the brain. Although molecular pathways regulating alveolar and white matter maturation differ, proper bioenergetic support of growth and maturation remains critical biological requirement for any actively developing organ. Literature analysis suggests that successful postnatal pulmonary and white matter development highly depends on mitochondrial function which can be inhibited by sublethal postnatal stress. In premature infants, sublethal stress results mostly in organ maturation failure without excessive cellular demise. PMID:27901512

  9. Mitochondrial dysfunction in alveolar and white matter developmental failure in premature infants.

    PubMed

    Ten, Vadim S

    2017-02-01

    At birth, some organs in premature infants are not developed enough to meet challenges of the extra-uterine life. Although growth and maturation continues after premature birth, postnatal organ development may become sluggish or even arrested, leading to organ dysfunction. There is no clear mechanistic concept of this postnatal organ developmental failure in premature neonates. This review introduces a concept-forming hypothesis: Mitochondrial bioenergetic dysfunction is a fundamental mechanism of organs maturation failure in premature infants. Data collected in support of this hypothesis are relevant to two major diseases of prematurity: white matter injury and broncho-pulmonary dysplasia. In these diseases, totally different clinical manifestations are defined by the same biological process, developmental failure of the main functional units-alveoli in the lungs and axonal myelination in the brain. Although molecular pathways regulating alveolar and white matter maturation differ, proper bioenergetic support of growth and maturation remains critical biological requirement for any actively developing organ. Literature analysis suggests that successful postnatal pulmonary and white matter development highly depends on mitochondrial function which can be inhibited by sublethal postnatal stress. In premature infants, sublethal stress results mostly in organ maturation failure without excessive cellular demise.

  10. Developmental Control of Cell-Cycle Compensation Provides a Switch for Patterned Mitosis at the Onset of Chordate Neurulation.

    PubMed

    Ogura, Yosuke; Sasakura, Yasunori

    2016-04-18

    During neurulation of chordate ascidians, the 11th mitotic division within the epidermal layer shows a posterior-to-anterior wave that is precisely coordinated with the unidirectional progression of the morphogenetic movement. Here we show that the first sign of this patterned mitosis is an asynchronous anterior-to-posterior S-phase length and that mitotic synchrony is reestablished by a compensatory asynchronous G2-phase length. Live imaging combined with genetic experiments demonstrated that compensatory G2-phase regulation requires transcriptional activation of the G2/M regulator cdc25 by the patterning genes GATA and AP-2. The downregulation of GATA and AP-2 at the onset of neurulation leads to loss of compensatory G2-phase regulation and promotes the transition to patterned mitosis. We propose that such developmentally regulated cell-cycle compensation provides an abrupt switch to spatially patterned mitosis in order to achieve the coordination between mitotic timing and morphogenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Behavioral Assessment of Emotion Discrimination, Emotion Regulation, and Cognitive Control in Childhood, Adolescence, and Adulthood

    PubMed Central

    Tottenham, Nim; Hare, Todd A.; Casey, B. J.

    2011-01-01

    Emotion discrimination, emotion regulation, and cognitive control are three related, yet separable processes that emerge over the course of development. The current study tested 100 children, adolescents, and adults on an Emotional Go/Nogo task, illustrating the ability of this paradigm to identify the unique developmental patterns for each of these three processes in the context of both positive (happy) and negative emotions (fear, sad, and anger), across three different age groups. Consistent with previous literature, our findings show that emotion discrimination and regulatory abilities (both cognitive control and emotion regulation) improve steadily for each age group, with each age group showing unique patterns of performance. The findings suggest that emotion regulation is constructed from basic cognition control and emotion discrimination skills. The patterns of behavior from the Emotional Go/Nogo task provide normative benchmark data across a wide range of emotions that can be used for future behavioral and neuroimaging studies that examine the developmental construction of emotion regulatory processes. PMID:21716604

  12. Mutations in THAP11 cause an inborn error of cobalamin metabolism and developmental abnormalities.

    PubMed

    Quintana, Anita M; Yu, Hung-Chun; Brebner, Alison; Pupavac, Mihaela; Geiger, Elizabeth A; Watson, Abigail; Castro, Victoria L; Cheung, Warren; Chen, Shu-Huang; Watkins, David; Pastinen, Tomi; Skovby, Flemming; Appel, Bruce; Rosenblatt, David S; Shaikh, Tamim H

    2017-08-01

    CblX (MIM309541) is an X-linked recessive disorder characterized by defects in cobalamin (vitamin B12) metabolism and other developmental defects. Mutations in HCFC1, a transcriptional co-regulator which interacts with multiple transcription factors, have been associated with cblX. HCFC1 regulates cobalamin metabolism via the regulation of MMACHC expression through its interaction with THAP11, a THAP domain-containing transcription factor. The HCFC1/THAP11 complex potentially regulates genes involved in diverse cellular functions including cell cycle, proliferation, and transcription. Thus, it is likely that mutation of THAP11 also results in biochemical and other phenotypes similar to those observed in patients with cblX. We report a patient who presented with clinical and biochemical phenotypic features that overlap cblX, but who does not have any mutations in either MMACHC or HCFC1. We sequenced THAP11 by Sanger sequencing and discovered a potentially pathogenic, homozygous variant, c.240C > G (p.Phe80Leu). Functional analysis in the developing zebrafish embryo demonstrated that both THAP11 and HCFC1 regulate the proliferation and differentiation of neural precursors, suggesting important roles in normal brain development. The loss of THAP11 in zebrafish embryos results in craniofacial abnormalities including the complete loss of Meckel's cartilage, the ceratohyal, and all of the ceratobranchial cartilages. These data are consistent with our previous work that demonstrated a role for HCFC1 in vertebrate craniofacial development. High throughput RNA-sequencing analysis reveals several overlapping gene targets of HCFC1 and THAP11. Thus, both HCFC1 and THAP11 play important roles in the regulation of cobalamin metabolism as well as other pathways involved in early vertebrate development. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. A steroid-controlled global switch in sensitivity to apoptosis during Drosophila development.

    PubMed

    Kang, Yunsik; Bashirullah, Arash

    2014-02-01

    Precise control over activation of the apoptotic machinery is critical for development, tissue homeostasis and disease. In Drosophila, the decision to trigger apoptosis--whether in response to developmental cues or to DNA damage--converges on transcription of inhibitor of apoptosis protein (IAP) antagonists reaper, hid and grim. Here we describe a parallel process that regulates the sensitivity to, rather than the execution of, apoptosis. This process establishes developmental windows that are permissive or restrictive for triggering apoptosis, where the status of cells determines their capacity to die. We characterize one switch in the sensitivity to apoptotic triggers, from restrictive to permissive, that occurs during third-instar larval (L3) development. Early L3 animals are highly resistant to induction of apoptosis by expression of IAP-antagonists, DNA-damaging agents and even knockdown of the IAP diap1. This resistance to apoptosis, however, is lost in wandering L3 animals after acquiring a heightened sensitivity to apoptotic triggers. This switch in sensitivity to death activators is mediated by a change in mechanisms available for activating endogenous caspases, from an apoptosome-independent to an apoptosome-dependent pathway. This switch in apoptotic pathways is regulated in a cell-autonomous manner by the steroid hormone ecdysone, through changes in expression of critical pro-, but not anti-, apoptotic genes. This steroid-controlled switch defines a novel, physiologically-regulated, mechanism for controlling sensitivity to apoptosis and provides new insights into the control of apoptosis during development. © 2013 Published by Elsevier Inc.

  14. Evolution of predetermined germ cells in vertebrate embryos: implications for macroevolution.

    PubMed

    Johnson, Andrew D; Drum, Matthew; Bachvarova, Rosemary F; Masi, Thomas; White, Mary E; Crother, Brian I

    2003-01-01

    The germ line is established in animal embryos with the formation of primordial germ cells (PGCs), which give rise to gametes. Therefore, the need to form PGCs can act as a developmental constraint by inhibiting the evolution of embryonic patterning mechanisms that compromise their development. Conversely, events that stabilize the PGCs may liberate these constraints. Two modes of germ cell determination exist in animal embryos: (a) either PGCs are predetermined by the inheritance of germ cell determinants (germ plasm) or (b) PGCs are formed by inducing signals secreted by embryonic tissues (i.e., regulative determination). Surprisingly, among the major extant amphibian lineages, one mechanism is found in urodeles and the other in anurans. In anuran amphibians PGCs are predetermined by germ plasm; in urodele amphibians PGCs are formed by inducing signals. To determine which mechanism is ancestral to the tetrapod lineage and to understand the pattern of inheritance in higher vertebrates, we used a phylogenetic approach to analyze basic morphological processes in both groups and correlated these with mechanisms of germ cell determination. Our results indicate that regulative germ cell determination is a property of embryos retaining ancestral embryological processes, whereas predetermined germ cells are found in embryos with derived morphological traits. These correlations suggest that regulative germ cell formation is an important developmental constraint in vertebrate embryos, acting before the highly conserved pharyngula stage. Moreover, our analysis suggests that germ plasm has evolved independently in several lineages of vertebrate embryos.

  15. Control of Retrograde Signaling by Rapid Turnover of GENOMES UNCOUPLED11[OPEN

    PubMed Central

    Chalvin, Camille; Wu, Xu Na

    2018-01-01

    The exchange of signals between cellular compartments coordinates development and differentiation, modulates metabolic pathways, and triggers responses to environmental conditions. The proposed central regulator of plastid-to-nucleus retrograde signaling, GENOMES UNCOUPLED1 (GUN1), is present at very low levels, which has hampered the discovery of its precise molecular function. Here, we show that the Arabidopsis (Arabidopsis thaliana) GUN1 protein accumulates to detectable levels only at very early stages of leaf development, where it functions in the regulation of chloroplast biogenesis. GUN1 mRNA is present at high levels in all tissues, but GUN1 protein undergoes rapid degradation (with an estimated half-life of ∼4 h) in all tissues where chloroplast biogenesis has been completed. The rapid turnover of GUN1 is controlled mainly by the chaperone ClpC1, suggesting degradation of GUN1 by the Clp protease. Degradation of GUN1 slows under stress conditions that alter retrograde signaling, thus ensuring that the plant has sufficient GUN1 protein. We also find that the pentatricopeptide repeat motifs of GUN1 are important determinants of GUN1 stability. Moreover, overexpression of GUN1 causes an early flowering phenotype, suggesting a function of GUN1 in developmental phase transitions beyond chloroplast biogenesis. Taken together, our results provide new insight into the regulation of GUN1 by proteolytic degradation, uncover its function in early chloroplast biogenesis, and suggest a role in developmental phase transitions. PMID:29367233

  16. Metabolic Profiles in Ovine Carotid Arteries with Developmental Maturation and Long-Term Hypoxia

    PubMed Central

    Goyal, Ravi; Longo, Lawrence D.

    2015-01-01

    Background Long-term hypoxia (LTH) is an important stressor related to health and disease during development. At different time points from fetus to adult, we are exposed to hypoxic stress because of placental insufficiency, high-altitude residence, smoking, chronic anemia, pulmonary, and heart disorders, as well as cancers. Intrauterine hypoxia can lead to fetal growth restriction and long-term sequelae such as cognitive impairments, hypertension, cardiovascular disorders, diabetes, and schizophrenia. Similarly, prolonged hypoxic exposure during adult life can lead to acute mountain sickness, chronic fatigue, chronic headache, cognitive impairment, acute cerebral and/or pulmonary edema, and death. Aim LTH also can lead to alteration in metabolites such as fumarate, 2-oxoglutarate, malate, and lactate, which are linked to epigenetic regulation of gene expression. Importantly, during the intrauterine life, a fetus is under a relative hypoxic environment, as compared to newborn or adult. Thus, the changes in gene expression with development from fetus to newborn to adult may be as a consequence of underlying changes in the metabolic profile because of the hypoxic environment along with developmental maturation. To examine this possibility, we examined the metabolic profile in carotid arteries from near-term fetus, newborn, and adult sheep in both normoxic and long-term hypoxic acclimatized groups. Results Our results demonstrate that LTH differentially regulated glucose metabolism, mitochondrial metabolism, nicotinamide cofactor metabolism, oxidative stress and antioxidants, membrane lipid hydrolysis, and free fatty acid metabolism, each of which may play a role in genetic-epigenetic regulation. PMID:26110419

  17. PROTON GRADIENT REGULATION5 Is Essential for Proper Acclimation of Arabidopsis Photosystem I to Naturally and Artificially Fluctuating Light Conditions[W

    PubMed Central

    Suorsa, Marjaana; Järvi, Sari; Grieco, Michele; Nurmi, Markus; Pietrzykowska, Malgorzata; Rantala, Marjaana; Kangasjärvi, Saijaliisa; Paakkarinen, Virpi; Tikkanen, Mikko; Jansson, Stefan; Aro, Eva-Mari

    2012-01-01

    In nature, plants are challenged by constantly changing light conditions. To reveal the molecular mechanisms behind acclimation to sometimes drastic and frequent changes in light intensity, we grew Arabidopsis thaliana under fluctuating light conditions, in which the low light periods were repeatedly interrupted with high light peaks. Such conditions had only marginal effect on photosystem II but induced damage to photosystem I (PSI), the damage being most severe during the early developmental stages. We showed that PROTON GRADIENT REGULATION5 (PGR5)–dependent regulation of electron transfer and proton motive force is crucial for protection of PSI against photodamage, which occurred particularly during the high light phases of fluctuating light cycles. Contrary to PGR5, the NAD(P)H dehydrogenase complex, which mediates cyclic electron flow around PSI, did not contribute to acclimation of the photosynthetic apparatus, particularly PSI, to rapidly changing light intensities. Likewise, the Arabidopsis pgr5 mutant exhibited a significantly higher mortality rate compared with the wild type under outdoor field conditions. This shows not only that regulation of PSI under natural growth conditions is crucial but also the importance of PGR5 in PSI protection. PMID:22822205

  18. The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development

    PubMed Central

    Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne

    2004-01-01

    Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937

  19. Emotional Self-Regulation, Peer Rejection, and Antisocial Behavior: Developmental Associations from Early Childhood to Early Adolescence

    ERIC Educational Resources Information Center

    Trentacosta, Christopher J.; Shaw, Daniel S.

    2009-01-01

    This study examined relations among emotional self-regulation, peer rejection, and antisocial behavior in a sample of 122 boys from low-income families who participated in a summer camp and were followed longitudinally from early childhood to early adolescence. Emotional self-regulation strategies were coded in early childhood from a waiting task,…

  20. Dynamics of DNA methylomes underlie oyster development

    PubMed Central

    Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

    2017-01-01

    DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes. PMID:28594821

  1. Dynamics of DNA methylomes underlie oyster development.

    PubMed

    Riviere, Guillaume; He, Yan; Tecchio, Samuele; Crowell, Elizabeth; Gras, Michaël; Sourdaine, Pascal; Guo, Ximing; Favrel, Pascal

    2017-06-01

    DNA methylation is a critical epigenetic regulator of development in mammals and social insects, but its significance in development outside these groups is not understood. Here we investigated the genome-wide dynamics of DNA methylation in a mollusc model, the oyster Crassostrea gigas, from the egg to the completion of organogenesis. Large-scale methylation maps reveal that the oyster genome displays a succession of methylated and non methylated regions, which persist throughout development. Differentially methylated regions (DMRs) are strongly regulated during cleavage and metamorphosis. The distribution and levels of methylated DNA within genomic features (exons, introns, promoters, repeats and transposons) show different developmental lansdscapes marked by a strong increase in the methylation of exons against introns after metamorphosis. Kinetics of methylation in gene-bodies correlate to their transcription regulation and to distinct functional gene clusters, and DMRs at cleavage and metamorphosis bear the genes functionally related to these steps, respectively. This study shows that DNA methylome dynamics underlie development through transcription regulation in the oyster, a lophotrochozoan species. To our knowledge, this is the first demonstration of such epigenetic regulation outside vertebrates and ecdysozoan models, bringing new insights into the evolution and the epigenetic regulation of developmental processes.

  2. Distinct emotion regulation skills explain psychopathology and problems in social relationships following childhood emotional abuse and neglect.

    PubMed

    Berzenski, Sara R

    2018-03-22

    Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.

  3. Emotion Regulation and the Transdiagnostic Role of Repetitive Negative Thinking in Adolescents with Social Anxiety and Depression

    PubMed Central

    Curtiss, Joshua; McLaughlin, Katie A.; Nolen-Hoeksema, Susan

    2016-01-01

    Social anxiety and depression are common mental health problems among adolescents and are frequently comorbid. Primary aims of this study were to (1) elucidate the nature of individual differences in specific emotion regulation deficits among adolescents with symptoms of social anxiety and depression, and (2) determine whether repetitive negative thinking (RNT) functions as a transdiagnostic factor. A diverse sample of adolescents (N = 1065) completed measures assessing emotion regulation and symptoms of social anxiety and depression. Results indicated that adolescents with high levels of social anxiety and depression symptoms reported decreased emotional awareness, dysregulated emotion expression, and reduced use of emotion management strategies. The hypothesized structural model in which RNT functions as a transdiagnostic factor exhibited a better fit than an alternative model in which worry and rumination function as separate predictors of symptomatology. Findings implicate emotion regulation deficits and RNT in the developmental psychopathology of youth anxiety and mood disorders. PMID:28579659

  4. Inwardly rectifying potassium channels influence Drosophila wing morphogenesis by regulating Dpp release.

    PubMed

    Dahal, Giri Raj; Pradhan, Sarala Joshi; Bates, Emily Anne

    2017-08-01

    Loss of embryonic ion channel function leads to morphological defects, but the underlying reason for these defects remains elusive. Here, we show that inwardly rectifying potassium (Irk) channels regulate release of the Drosophila bone morphogenetic protein Dpp in the developing fly wing and that this is necessary for developmental signaling. Inhibition of Irk channels decreases the incidence of distinct Dpp-GFP release events above baseline fluorescence while leading to a broader distribution of Dpp-GFP. Work by others in different cell types has shown that Irk channels regulate peptide release by modulating membrane potential and calcium levels. We found calcium transients in the developing wing, and inhibition of Irk channels reduces the duration and amplitude of calcium transients. Depolarization with high extracellular potassium evokes Dpp release. Taken together, our data implicate Irk channels as a requirement for regulated release of Dpp, highlighting the importance of the temporal pattern of Dpp presentation for morphogenesis of the wing. © 2017. Published by The Company of Biologists Ltd.

  5. Regulation of rice root development by a retrotransposon acting as a microRNA sponge.

    PubMed

    Cho, Jungnam; Paszkowski, Jerzy

    2017-08-26

    It is well documented that transposable elements (TEs) can regulate the expression of neighbouring genes. However, their ability to act in trans and influence ectopic loci has been reported rarely. We searched in rice transcriptomes for tissue-specific expression of TEs and found them to be regulated developmentally. They often shared sequence homology with co-expressed genes and contained potential microRNA-binding sites, which suggested possible contributions to gene regulation. In fact, we have identified a retrotransposon that is highly transcribed in roots and whose spliced transcript constitutes a target mimic for miR171. miR171 destabilizes mRNAs encoding the root-specific family of SCARECROW-Like transcription factors. We demonstrate that retrotransposon-derived transcripts act as decoys for miR171, triggering its degradation and thus results in the root-specific accumulation of SCARECROW-Like mRNAs. Such transposon-mediated post-transcriptional control of miR171 levels is conserved in diverse rice species.

  6. Linking Learning Contexts: The Relationship between Students’ Civic and Political Experiences and Their Self-Regulation in School

    PubMed Central

    Malafaia, Carla; Teixeira, Pedro M.; Neves, Tiago; Menezes, Isabel

    2016-01-01

    This paper considers the relationship between self-regulation strategies and youth civic and political experiences, assuming that out-of-school learning can foster metacognition. The study is based on a sample of 732 Portuguese students from grades 8 and 11. Results show that the quality of civic and political participation experiences, together with academic self-efficacy, are significant predictors of young people’s self-regulation, particularly regarding cognitive and metacognitive strategies (elaboration and critical thinking). Such effects surpass even the weight of family cultural and school variables, such as the sense of school belonging. Therefore, we argue that the pedagogical value of non-formal civic and political experiences is related to learning in formal pedagogical contexts. This is because civic and political participation with high developmental quality can stimulate higher-order cognitive engagement and, thus, contribute to the development of learning strategies that promote academic success. PMID:27199812

  7. Repulsive Guidance Molecules (RGMs) and Neogenin in Bone Morphogenetic Protein (BMP) signaling

    PubMed Central

    Tian, Chenxi; Liu, Jun

    2015-01-01

    Summary Bone morphogenetic proteins (BMPs) belong to the transforming growth factor-beta (TGFβ) superfamily. BMPs mediate a highly conserved signal transduction cascade through the type I and type II serine/threonine kinase receptors and intracellular Smad proteins. The BMP pathway regulates multiple developmental and homeostatic processes. Mutations in this pathway can cause various diseases in humans, such as skeletal disorders, cardiovascular diseases and various cancers. Multiple levels of regulation, including extracellular regulation, help to ensure proper spatiotemporal control of BMP signaling in the right cellular context. The family of repulsive guidance molecules (RGMs) and the type I trans-membrane protein neogenin, a paralog of DCC (Deleted in Colorectal Cancer), have been implicated in modulating the BMP pathway. In this review, we discuss the properties and functions of RGM proteins and neogenin, focusing on their roles in the modulation of BMP signal transduction. PMID:23740870

  8. Hypoxia-driven angiogenesis: role of tip cells and extracellular matrix scaffolding.

    PubMed

    Germain, Stéphane; Monnot, Catherine; Muller, Laurent; Eichmann, Anne

    2010-05-01

    Angiogenesis is a highly coordinated tissue remodeling process leading to blood vessel formation. Hypoxia triggers angiogenesis via induction of expression of growth factors such as vascular endothelial growth factor (VEGF). VEGF instructs endothelial cells to form tip cells, which lead outgrowing capillary sprouts, whereas Notch signaling inhibits sprout formation. Basement membrane deposition and mechanical cues from the extracellular matrix (ECM) induced by hypoxia may participate to coordinated vessel sprouting in conjunction with the VEGF and Notch signaling pathways. Hypoxia regulates ECM composition, deposition, posttranslational modifications and rearrangement. In particular, hypoxia-driven vascular remodeling is dynamically regulated through modulation of ECM-modifying enzyme activities that eventually affect both matricellular proteins and growth factor availability. Better understanding of the complex interplay between endothelial cells and soluble growth factors and mechanical factors from the ECM will certainly have significant implications for understanding the regulation of developmental and pathological angiogenesis driven by hypoxia.

  9. Oxidative Stress, Bone Marrow Failure, and Genome Instability in Hematopoietic Stem Cells

    PubMed Central

    Richardson, Christine; Yan, Shan; Vestal, C. Greer

    2015-01-01

    Reactive oxygen species (ROS) can be generated by defective endogenous reduction of oxygen by cellular enzymes or in the mitochondrial respiratory pathway, as well as by exogenous exposure to UV or environmental damaging agents. Regulation of intracellular ROS levels is critical since increases above normal concentrations lead to oxidative stress and DNA damage. A growing body of evidence indicates that the inability to regulate high levels of ROS leading to alteration of cellular homeostasis or defective repair of ROS-induced damage lies at the root of diseases characterized by both neurodegeneration and bone marrow failure as well as cancer. That these diseases may be reflective of the dynamic ability of cells to respond to ROS through developmental stages and aging lies in the similarities between phenotypes at the cellular level. This review summarizes work linking the ability to regulate intracellular ROS to the hematopoietic stem cell phenotype, aging, and disease. PMID:25622253

  10. Linking Learning Contexts: The Relationship between Students' Civic and Political Experiences and Their Self-Regulation in School.

    PubMed

    Malafaia, Carla; Teixeira, Pedro M; Neves, Tiago; Menezes, Isabel

    2016-01-01

    This paper considers the relationship between self-regulation strategies and youth civic and political experiences, assuming that out-of-school learning can foster metacognition. The study is based on a sample of 732 Portuguese students from grades 8 and 11. Results show that the quality of civic and political participation experiences, together with academic self-efficacy, are significant predictors of young people's self-regulation, particularly regarding cognitive and metacognitive strategies (elaboration and critical thinking). Such effects surpass even the weight of family cultural and school variables, such as the sense of school belonging. Therefore, we argue that the pedagogical value of non-formal civic and political experiences is related to learning in formal pedagogical contexts. This is because civic and political participation with high developmental quality can stimulate higher-order cognitive engagement and, thus, contribute to the development of learning strategies that promote academic success.

  11. N-cadherin prodomain processing regulates synaptogenesis.

    PubMed

    Reinés, Analía; Bernier, Louis-Philippe; McAdam, Robyn; Belkaid, Wiam; Shan, Weisong; Koch, Alexander W; Séguéla, Philippe; Colman, David R; Dhaunchak, Ajit S

    2012-05-02

    Classical cadherins, which are adhesion molecules functioning at the CNS synapse, are synthesized as adhesively inactive precursor proteins in the endoplasmic reticulum (ER). Signal sequence and prodomain cleavage in the ER and Golgi apparatus, respectively, activates their adhesive properties. Here, we provide the first evidence for sorting of nonadhesive precursor N-cadherin (ProN) to the neuronal surface, where it coexists with adhesively competent mature N-cadherin (N-cad), generating a spectrum of adhesive strengths. In cultured hippocampal neurons, a high ProN/N-cad ratio downregulates synapse formation. Neurons expressing genetically engineered uncleavable ProN make markedly fewer synapses. The synapse number can be rescued to normality by depleting surface ProN levels through prodomain cleavage by an exogenous protease. Finally, prodomain processing is developmentally regulated in the rat hippocampus. We conclude that it is the ProN/N-cad ratio and not mature N-cad alone that is critical for regulation of adhesion during synaptogenesis.

  12. Early developmental gene regulation in Strongylocentrotus purpuratus embryos in response to elevated CO₂ seawater conditions.

    PubMed

    Hammond, LaTisha M; Hofmann, Gretchen E

    2012-07-15

    Ocean acidification, or the increased uptake of CO(2) by the ocean due to elevated atmospheric CO(2) concentrations, may variably impact marine early life history stages, as they may be especially susceptible to changes in ocean chemistry. Investigating the regulatory mechanisms of early development in an environmental context, or ecological development, will contribute to increased understanding of potential organismal responses to such rapid, large-scale environmental changes. We examined transcript-level responses to elevated seawater CO(2) during gastrulation and the initiation of spiculogenesis, two crucial developmental processes in the purple sea urchin, Strongylocentrotus purpuratus. Embryos were reared at the current, accepted oceanic CO(2) concentration of 380 microatmospheres (μatm), and at the elevated levels of 1000 and 1350 μatm, simulating predictions for oceans and upwelling regions, respectively. The seven genes of interest comprised a subset of pathways in the primary mesenchyme cell gene regulatory network (PMC GRN) shown to be necessary for the regulation and execution of gastrulation and spiculogenesis. Of the seven genes, qPCR analysis indicated that elevated CO(2) concentrations only had a significant but subtle effect on two genes, one important for early embryo patterning, Wnt8, and the other an integral component in spiculogenesis and biomineralization, SM30b. Protein levels of another spicule matrix component, SM50, demonstrated significant variable responses to elevated CO(2). These data link the regulation of crucial early developmental processes with the environment that these embryos would be developing within, situating the study of organismal responses to ocean acidification in a developmental context.

  13. Control of asgE Expression during Growth and Development of Myxococcus xanthus

    PubMed Central

    Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

    2000-01-01

    One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

  14. Hormonal interactions and gene regulation can link monoecy and environmental plasticity to the evolution of dioecy in plants.

    PubMed

    Golenberg, Edward M; West, Nicholas W

    2013-06-01

    Most models for dioecy in flowering plants assume that dioecy arises directly from hermaphroditism through a series of independent feminizing and masculinizing mutations that become chromosomally linked. However, dioecy appears to evolve most frequently through monoecious grades. The major genetic models do not explain the evolution of unisexual flowers in monoecious and submonoecious populations, nor do they account for environmentally induced sexual plasticity. In this review, we explore the roles of environmental stress and hormones on sex determination, and propose a model that can explain the evolution of dioecy through monoecy, and the mechanisms of environmental sex determination. Environmental stresses elicit hormones that allow plants to mediate the negative effects of the stresses. Many of these same hormones are involved in the regulation of floral developmental genes. Recent studies have elucidated the mechanisms whereby these hormones interact and can act as switchpoints in regulatory pathways. Consequently, differential concentrations of plant hormones can regulate whole developmental pathways, providing a mechanism for differential development within isogenic individuals such as seen in monoecious plants. Sex-determining genes in such systems will evolve to generate clusters of coexpressed suites. Coexpression rather than coinheritance of gender-specific genes will define the sexual developmental fate. Therefore, selection for gender type will drive evolution of the regulatory sequences of such genes rather than their synteny. Subsequent mutations to hyper- or hyposensitive alleles within the hormone response pathway can result in segregating dioecious populations. Simultaneously, such developmental systems will remain sensitive to external stimuli that modify hormone responses.

  15. A Developmental Neuroscience of Borderline Pathology: Emotion Dysregulation and Social Baseline Theory

    ERIC Educational Resources Information Center

    Hughes, Amy E.; Crowell, Sheila E.; Uyeji, Lauren; Coan, James A.

    2012-01-01

    Theoretical and empirical research has linked poor emotion regulation abilities with dysfunctional frontolimbic circuitry. Consistent with this, research on borderline personality disorder (BPD) finds that frontolimbic dysfunction is a predominant neural substrate underlying the disorder. Emotion regulation is profoundly compromised in BPD.…

  16. 75 FR 56115 - Center for Scientific Review; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-15

    ... Processes Integrated Review Group, Biobehavioral Regulation, Learning and Ethology Study Section. Date..., Biobehavioral Regulation, Learning and Ethology. Date: October 8, 2010. Time: 9 a.m. to 10 a.m. Agenda: To..., Cellular and Developmental Neuroscience Integrated Review Group, Biophysics of Neural Systems Study Section...

  17. Developmental programming of energy balance regulation: Is physical activity more "programmable" than food intake

    USDA-ARS?s Scientific Manuscript database

    Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mecha...

  18. A Conserved Core of Programmed Cell Death Indicator Genes Discriminates Developmentally and Environmentally Induced Programmed Cell Death in Plants.

    PubMed

    Olvera-Carrillo, Yadira; Van Bel, Michiel; Van Hautegem, Tom; Fendrych, Matyáš; Huysmans, Marlies; Simaskova, Maria; van Durme, Matthias; Buscaill, Pierre; Rivas, Susana; Coll, Nuria S.; Coppens, Frederik; Maere, Steven; Nowack, Moritz K.

    2015-12-01

    A plethora of diverse programmed cell death (PCD) processes has been described in living organisms. In animals and plants, different forms of PCD play crucial roles in development, immunity, and responses to the environment. While the molecular control of some animal PCD forms such as apoptosis is known in great detail, we still know comparatively little about the regulation of the diverse types of plant PCD. In part, this deficiency in molecular understanding is caused by the lack of reliable reporters to detect PCD processes. Here, we addressed this issue by using a combination of bioinformatics approaches to identify commonly regulated genes during diverse plant PCD processes in Arabidopsis (Arabidopsis thaliana). Our results indicate that the transcriptional signatures of developmentally controlled cell death are largely distinct from the ones associated with environmentally induced cell death. Moreover, different cases of developmental PCD share a set of cell death-associated genes. Most of these genes are evolutionary conserved within the green plant lineage, arguing for an evolutionary conserved core machinery of developmental PCD. Based on this information, we established an array of specific promoter-reporter lines for developmental PCD in Arabidopsis. These PCD indicators represent a powerful resource that can be used in addition to established morphological and biochemical methods to detect and analyze PCD processes in vivo and in planta. © 2015 American Society of Plant Biologists. All Rights Reserved.

  19. A DNA damage checkpoint pathway coordinates the division of dikaryotic cells in the ink cap mushroom Coprinopsis cinerea.

    PubMed

    de Sena-Tomás, Carmen; Navarro-González, Mónica; Kües, Ursula; Pérez-Martín, José

    2013-09-01

    The fungal fruiting body or mushroom is a multicellular structure essential for sexual reproduction. It is composed of dikaryotic cells that contain one haploid nucleus from each mating partner sharing the same cytoplasm without undergoing nuclear fusion. In the mushroom, the pileus bears the hymenium, a layer of cells that includes the specialized basidia in which nuclear fusion, meiosis, and sporulation occur. Coprinopsis cinerea is a well-known model fungus used to study developmental processes associated with the formation of the fruiting body. Here we describe that knocking down the expression of Atr1 and Chk1, two kinases shown to be involved in the response to DNA damage in a number of eukaryotic organisms, dramatically impairs the ability to develop fruiting bodies in C. cinerea, as well as other developmental decisions such as sclerotia formation. These developmental defects correlated with the impairment in silenced strains to sustain an appropriated dikaryotic cell cycle. Dikaryotic cells in which chk1 or atr1 genes were silenced displayed a higher level of asynchronous mitosis and as a consequence aberrant cells carrying an unbalanced dose of nuclei. Since fruiting body initiation is dependent on the balanced mating-type regulator doses present in the dikaryon, we believe that the observed developmental defects were a consequence of the impaired cell cycle in the dikaryon. Our results suggest a connection between the DNA damage response cascade, cell cycle regulation, and developmental processes in this fungus.

  20. Developmental regulation of neuroligin genes in Japanese ricefish (Oryzias latipes) embryogenesis maintains the rhythm during ethanol-induced fetal alcohol spectrum disorder.

    PubMed

    Haron, Mona H; Khan, Ikhlas A; Dasmahapatra, Asok K

    2014-01-01

    Although prenatal alcohol exposure is the potential cause of fetal alcohol spectrum disorder (FASD) in humans, the molecular mechanism(s) of FASD is yet unknown. We have used Japanese ricefish (Oryzias latipes) embryogenesis as an animal model of FASD and reported that this model has effectively generated several phenotypic features in the cardiovasculature and neurocranial cartilages by developmental ethanol exposure which is analogous to human FASD phenotypes. As FASD is a neurobehavioral disorder, we are searching for a molecular target of ethanol that alters neurological functions. In this communication, we have focused on neuroligin genes (nlgn) which are known to be active at the postsynaptic side of both excitatory and inhibitory synapses of the central nervous system. There are six human NLGN homologs of Japanese ricefish reported in public data bases. We have partially cloned these genes and analyzed their expression pattern during normal development and also after exposing the embryos to ethanol. Our data indicate that the expression of all six nlgn genes in Japanese ricefish embryos is developmentally regulated. Although ethanol is able to induce developmental abnormalities in Japanese ricefish embryogenesis comparable to the FASD phenotypes, quantitative real-time PCR (qPCR) analysis of nlgn mRNAs indicate unresponsiveness of these genes to ethanol. We conclude that the disruption of the developmental rhythm of Japanese ricefish embryogenesis by ethanol that leads to FASD may not affect the nlgn gene expression at the message level. © 2013.

  1. Modeling activity and target-dependent developmental cell death of mouse retinal ganglion cells ex vivo.

    PubMed

    Voyatzis, Sylvie; Muzerelle, Aude; Gaspar, Patricia; Nicol, Xavier

    2012-01-01

    Programmed cell death is widespread during the development of the central nervous system and serves multiple purposes including the establishment of neural connections. In the mouse retina a substantial reduction of retinal ganglion cells (RGCs) occurs during the first postnatal week, coinciding with the formation of retinotopic maps in the superior colliculus (SC). We previously established a retino-collicular culture preparation which recapitulates the progressive topographic ordering of RGC projections during early post-natal life. Here, we questioned whether this model could also be suitable to examine the mechanisms underlying developmental cell death of RGCs. Brn3a was used as a marker of the RGCs. A developmental decline in the number of Brn3a-immunolabelled neurons was found in the retinal explant with a timing that paralleled that observed in vivo. In contrast, the density of photoreceptors or of starburst amacrine cells increased, mimicking the evolution of these cell populations in vivo. Blockade of neural activity with tetrodotoxin increased the number of surviving Brn3a-labelled neurons in the retinal explant, as did the increase in target availability when one retinal explant was confronted with 2 or 4 collicular slices. Thus, this ex vivo model reproduces the developmental reduction of RGCs and recapitulates its regulation by neural activity and target availability. It therefore offers a simple way to analyze developmental cell death in this classic system. Using this model, we show that ephrin-A signaling does not participate to the regulation of the Brn3a population size in the retina, indicating that eprhin-A-mediated elimination of exuberant projections does not involve developmental cell death.

  2. Developmental Timing of the Effects of Maternal Care on Gene Expression and Epigenetic Regulation of Hormone Receptor Levels in Female Rats

    PubMed Central

    Peña, Catherine Jensen; Neugut, Y. Dana

    2013-01-01

    Maternal care experienced during postnatal development has enduring effects on neuroendocrine function and behavior. Previous studies in rats have illustrated the effect of maternal licking/grooming (LG) on hormone receptors and maternal behavior of adult female offspring associated with altered DNA methylation. However, the developmental timing of these effects, which provide insight into the cellular and molecular pathways through which early experience alters later behavior, had not been explored. Here, we demonstrate the developmental emergence of these outcomes and use cross-fostering to identify sensitive periods for these effects. Estrogen receptor (ER)α and ERβ mRNA levels within the medial preoptic area (MPOA) of the hypothalamus were increased by postnatal day (PN)21 in female offspring of high LG dams; LG-associated increases in oxytocin receptor mRNA levels were observed beyond the weaning period. Quantification of ERα-immunoreactivity indicated a high degree of neuroanatomical specificity of LG effects within the MPOA that were observed by PN6. Reduced DNA methylation and histone 3 lysine 9 tri-methylation and increased histone 3 lysine 4 tri-methylation at the ERα gene promoter (Esr1) were detected at PN21 in high LG female offspring. Latency to engage in maternal behavior toward donor pups was significantly shorter among high LG females. Cross-fostering revealed that maternal sensitization and MPOA ERα levels are sensitive to maternal care experienced before but not after PN10. Differential windows of plasticity were identified for ERβ and oxytocin receptor mRNA levels. These studies contribute significantly to our understanding of the molecular, neurobiological, and behavioral pathways through which variation in maternal behavior is transmitted from one generation to the next. PMID:24002038

  3. Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.

    PubMed

    Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

    2016-02-01

    Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.

  4. Developmental link between sex and nutrition; doublesex regulates sex-specific mandible growth via juvenile hormone signaling in stag beetles.

    PubMed

    Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J; Lavine, Laura C; Miura, Toru

    2014-01-01

    Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters.

  5. Developmental Link between Sex and Nutrition; doublesex Regulates Sex-Specific Mandible Growth via Juvenile Hormone Signaling in Stag Beetles

    PubMed Central

    Gotoh, Hiroki; Miyakawa, Hitoshi; Ishikawa, Asano; Ishikawa, Yuki; Sugime, Yasuhiro; Emlen, Douglas J.; Lavine, Laura C.; Miura, Toru

    2014-01-01

    Sexual dimorphisms in trait expression are widespread among animals and are especially pronounced in ornaments and weapons of sexual selection, which can attain exaggerated sizes. Expression of exaggerated traits is usually male-specific and nutrition sensitive. Consequently, the developmental mechanisms generating sexually dimorphic growth and nutrition-dependent phenotypic plasticity are each likely to regulate the expression of extreme structures. Yet we know little about how either of these mechanisms work, much less how they might interact with each other. We investigated the developmental mechanisms of sex-specific mandible growth in the stag beetle Cyclommatus metallifer, focusing on doublesex gene function and its interaction with juvenile hormone (JH) signaling. doublesex genes encode transcription factors that orchestrate male and female specific trait development, and JH acts as a mediator between nutrition and mandible growth. We found that the Cmdsx gene regulates sex differentiation in the stag beetle. Knockdown of Cmdsx by RNA-interference in both males and females produced intersex phenotypes, indicating a role for Cmdsx in sex-specific trait growth. By combining knockdown of Cmdsx with JH treatment, we showed that female-specific splice variants of Cmdsx contribute to the insensitivity of female mandibles to JH: knockdown of Cmdsx reversed this pattern, so that mandibles in knockdown females were stimulated to grow by JH treatment. In contrast, mandibles in knockdown males retained some sensitivity to JH, though mandibles in these individuals did not attain the full sizes of wild type males. We suggest that moderate JH sensitivity of mandibular cells may be the default developmental state for both sexes, with sex-specific Dsx protein decreasing sensitivity in females, and increasing it in males. This study is the first to demonstrate a causal link between the sex determination and JH signaling pathways, which clearly interact to determine the developmental fates and final sizes of nutrition-dependent secondary-sexual characters. PMID:24453990

  6. Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

    PubMed Central

    Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

    2015-01-01

    ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

  7. Developmentally regulated expression of APG-1, a member of heat shock protein 110 family in murine male germ cells.

    PubMed

    Kaneko, Y; Kimura, T; Nishiyama, H; Noda, Y; Fujita, J

    1997-04-07

    Apg-1 encodes a heat shock protein belonging to the heat shock protein 110 family, and is inducible by a 32 degrees C to 39 degrees C heat shock. Northern blot analysis of the testis from immature and adult mice, and of the purified germ cells revealed the quantitative change of the apg-1 transcripts during germ cell development. By in situ hybridization histochemistry the expressions of the apg-1 transcripts were detected in germ cells at specific stages of development including spermatocytes and spermatids. Although heat-induction of the apg-1 transcripts was observed in W/Wv mutant testis lacking germ cells, it was not detected in wild-type testis nor in the purified germ cells. Thus, the apg-1 expression is not heat-regulated but developmentally regulated in germ cells, suggesting that APG-1 plays a role in normal development of germ cells.

  8. Paradigm shift in consciousness research: the child's self-awareness and abnormalities in autism, ADHD and schizophrenia.

    PubMed

    Lou, Hans C

    2012-02-01

    Self-awareness is a pivotal component of any conscious experience and conscious self-regulation of behaviour. A paralimbic network is active, specific and causal in self-awareness. Its regions interact by gamma synchrony. Gamma synchrony develops throughout infancy, childhood and adolescence into adulthood and is regulated by dopamine and other neurotransmitters via GABA interneurons. Major derailments of this network and self-awareness occur in developmental disorders of conscious self-regulation like autism, attention deficit hyperactivity disorder (ADHD) and schizophrenia. Recent research on conscious experience is no longer limited to the study of neural 'correlations' but is increasingly lending itself to the study of causality. This paradigm shift opens new perspectives for understanding the neural mechanisms of the developing self and the causal effects of their disturbance in developmental disorders. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  9. Zinc and Zinc Transporters: Novel Regulators of Ventricular Myocardial Development.

    PubMed

    Lin, Wen; Li, Deqiang

    2018-06-01

    Ventricular myocardial development is a well-orchestrated process involving different cardiac structures, multiple signal pathways, and myriad proteins. Dysregulation of this important developmental event can result in cardiomyopathies, such as left ventricle non-compaction, which affect the pediatric population and the adults. Human and mouse studies have shed light upon the etiology of some cardiomyopathy cases and highlighted the contribution of both genetic and environmental factors. However, the regulation of ventricular myocardial development remains incompletely understood. Zinc is an essential trace metal with structural, enzymatic, and signaling function. Perturbation of zinc homeostasis has resulted in developmental and physiological defects including cardiomyopathy. In this review, we summarize several mechanisms by which zinc and zinc transporters can impact the regulation of ventricular myocardial development. Based on our review, we propose that zinc deficiency and mutations of zinc transporters may underlie some cardiomyopathy cases especially those involving ventricular myocardial development defects.

  10. Plant hormone signaling lightens up: integrators of light and hormones.

    PubMed

    Lau, On Sun; Deng, Xing Wang

    2010-10-01

    Light is an important environmental signal that regulates diverse growth and developmental processes in plants. In these light-regulated processes, multiple hormonal pathways are often modulated by light to mediate the developmental changes. Conversely, hormone levels in plants also serve as endogenous cues in influencing light responsiveness. Although interactions between light and hormone signaling pathways have long been observed, recent studies have advanced our understanding by identifying signaling integrators that connect the pathways. These integrators, namely PHYTOCHROME-INTERACTING FACTOR 3 (PIF3), PIF4, PIF3-LIKE 5 (PIL5)/PIF1 and LONG HYPOCOTYL 5 (HY5), are key light signaling components and they link light signals to the signaling of phytohormones, such as gibberellin (GA), abscisic acid (ABA), auxin and cytokinin, in regulating seedling photomorphogenesis and seed germination. This review focuses on these integrators in illustrating how light and hormone interact. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. DELAY OF GERMINATION1 (DOG1) regulates both seed dormancy and flowering time through microRNA pathways

    PubMed Central

    Huo, Heqiang; Wei, Shouhui; Bradford, Kent J.

    2016-01-01

    Seed germination and flowering, two critical developmental transitions in plant life cycles, are coordinately regulated by genetic and environmental factors to match plant establishment and reproduction to seasonal cues. The DELAY OF GERMINATION1 (DOG1) gene is involved in regulating seed dormancy in response to temperature and has also been associated genetically with pleiotropic flowering phenotypes across diverse Arabidopsis thaliana accessions and locations. Here we show that DOG1 can regulate seed dormancy and flowering times in lettuce (Lactuca sativa, Ls) and Arabidopsis through an influence on levels of microRNAs (miRNAs) miR156 and miR172. In lettuce, suppression of LsDOG1 expression enabled seed germination at high temperature and promoted early flowering in association with reduced miR156 and increased miR172 levels. In Arabidopsis, higher miR156 levels resulting from overexpression of the MIR156 gene enhanced seed dormancy and delayed flowering. These phenotypic effects, as well as conversion of MIR156 transcripts to miR156, were compromised in DOG1 loss-of-function mutant plants, especially in seeds. Overexpression of MIR172 reduced seed dormancy and promoted early flowering in Arabidopsis, and the effect on flowering required functional DOG1. Transcript levels of several genes associated with miRNA processing were consistently lower in dry seeds of Arabidopsis and lettuce when DOG1 was mutated or its expression was reduced; in contrast, transcript levels of these genes were elevated in a DOG1 gain-of-function mutant. Our results reveal a previously unknown linkage between two critical developmental phase transitions in the plant life cycle through a DOG1–miR156–miR172 interaction. PMID:27035986

  12. The Arabidopsis phytohormone crosstalk network involves a consecutive metabolic route and circular control units of transcription factors that regulate enzyme-encoding genes.

    PubMed

    Yue, Xun; Li, Xing Guo; Gao, Xin-Qi; Zhao, Xiang Yu; Dong, Yu Xiu; Zhou, Chao

    2016-09-02

    Phytohormone synergies and signaling interdependency are important topics in plant developmental biology. Physiological and genetic experimental evidence for phytohormone crosstalk has been accumulating and a genome-scale enzyme correlation model representing the Arabidopsis metabolic pathway has been published. However, an integrated molecular characterization of phytohormone crosstalk is still not available. A novel modeling methodology and advanced computational approaches were used to construct an enzyme-based Arabidopsis phytohormone crosstalk network (EAPCN) at the biosynthesis level. The EAPCN provided the structural connectivity architecture of phytohormone biosynthesis pathways and revealed a surprising result; that enzymes localized at the highly connected nodes formed a consecutive metabolic route. Furthermore, our analysis revealed that the transcription factors (TFs) that regulate enzyme-encoding genes in the consecutive metabolic route formed structures, which we describe as circular control units operating at the transcriptional level. Furthermore, the downstream TFs in phytohormone signal transduction pathways were found to be involved in the circular control units that included the TFs regulating enzyme-encoding genes. In addition, multiple functional enzymes in the EAPCN were found to be involved in ion and pH homeostasis, environmental signal perception, cellular redox homeostasis, and circadian clocks. Last, publicly available transcriptional profiles and a protein expression map of the Arabidopsis root apical meristem were used as a case study to validate the proposed framework. Our results revealed multiple scales of coupled mechanisms in that hormonal crosstalk networks that play a central role in coordinating internal developmental processes with environmental signals, and give a broader view of Arabidopsis phytohormone crosstalk. We also uncovered potential key regulators that can be further analyzed in future studies.

  13. Proteomic Analysis Reveals Coordinated Regulation of Anthocyanin Biosynthesis through Signal Transduction and Sugar Metabolism in Black Rice Leaf

    PubMed Central

    Chen, Linghua; Huang, Yining; Xu, Ming; Cheng, Zuxin; Zheng, Jingui

    2017-01-01

    Black rice (Oryza sativa L.) is considered to be a healthy food due to its high content of anthocyanins in the pericarp. The synthetic pathway of anthocyanins in black rice grains has been identified, however, the proteomic profile of leaves during grain development is still unclear. Here, isobaric Tags Relative and Absolute Quantification (iTRAQ) MS/MS was carried out to identify statistically significant changes of leaf proteome in the black rice during grain development. Throughout three sequential developmental stages, a total of 3562 proteins were detected and 24 functional proteins were differentially expressed 3–10 days after flowering (DAF). The detected proteins are known to be involved in various biological processes and most of these proteins were related to gene expression regulatory (33.3%), signal transduction (16.7%) and developmental regulation and hormone-like proteins (12.5%). The coordinated changes were consistent with changes in regulatory proteins playing a leading role in leaves during black rice grain development. This indicated that signal transduction between leaves and grains may have an important role in anthocyanin biosynthesis and accumulation during grain development of black rice. In addition, four identified up-regulated proteins associated with starch metabolism suggested that the remobilization of nutrients for starch synthesis plays a potential role in anthocyanin biosynthesis of grain. The mRNA transcription for eight selected proteins was validated with quantitative real-time PCR. Our results explored the proteomics of the coordination between leaf and grain in anthocyanins biosynthesis of grain, which might be regulated by signal transduction and sugar metabolism in black rice leaf. PMID:29244752

  14. Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/β-catenin signaling

    PubMed Central

    Amen, Melanie; Espinoza, Herbert M.; Cox, Carol; Liang, Xiaowen; Wang, Jianbo; Link, Todd M. E.; Brennan, Richard G.; Martin, James F.; Amendt, Brad A.

    2008-01-01

    Homeodomain (HD) transcriptional activities are tightly regulated during embryogenesis and require protein interactions for their spatial and temporal activation. The chromatin-associated high mobility group protein (HMG-17) is associated with transcriptionally active chromatin, however its role in regulating gene expression is unclear. This report reveals a unique strategy in which, HMG-17 acts as a molecular switch regulating HD transcriptional activity. The switch utilizes the Wnt/β-catenin signaling pathway and adds to the diverse functions of β-catenin. A high-affinity HMG-17 interaction with the PITX2 HD protein inhibits PITX2 DNA-binding activity. The HMG-17/PITX2 inactive complex is concentrated to specific nuclear regions primed for active transcription. β-Catenin forms a ternary complex with PITX2/HMG-17 to switch it from a repressor to an activator complex. Without β-catenin, HMG-17 can physically remove PITX2 from DNA to inhibit its transcriptional activity. The PITX2/HMG-17 regulatory complex acts independently of promoter targets and is a general mechanism for the control of HD transcriptional activity. HMG-17 is developmentally regulated and its unique role during embryogenesis is revealed by the early embryonic lethality of HMG-17 homozygous mice. This mechanism provides a new role for canonical Wnt/β-catenin signaling in regulating HD transcriptional activity during development using HMG-17 as a molecular switch. PMID:18045789

  15. Social Crowding during Development Causes Changes in GnRH1 DNA Methylation.

    PubMed

    Alvarado, Sebastian G; Lenkov, Kapa; Williams, Blake; Fernald, Russell D

    2015-01-01

    Gestational and developmental cues have important consequences for long-term health, behavior and adaptation to the environment. In addition, social stressors cause plastic molecular changes in the brain that underlie unique behavioral phenotypes that also modulate fitness. In the adult African cichlid, Astatotilapia burtoni, growth and social status of males are both directly regulated by social interactions in a dynamic social environment, which causes a suite of plastic changes in circuits, cells and gene transcription in the brain. We hypothesized that a possible mechanism underlying some molecular changes might be DNA methylation, a reversible modification made to cytosine nucleotides that is known to regulate gene function. Here we asked whether changes in DNA methylation of the GnRH1 gene, the central regulator of the reproductive axis, were altered during development of A. burtoni. We measured changes in methylation state of the GnRH1 gene during normal development and following the gestational and developmental stress of social crowding. We found differential DNA methylation within developing juveniles between 14-, 28- and 42-day-old. Following gestational crowding of mouth brooding mothers, we saw differential methylation and transcription of GnRH1 in their offspring. Taken together, our data provides evidence for social control of GnRH1 developmental responses to gestational cues through DNA methylation.

  16. Mindfulness training for adolescents: A neurodevelopmental perspective on investigating modifications in attention and emotion regulation using event-related brain potentials.

    PubMed

    Sanger, Kevanne Louise; Dorjee, Dusana

    2015-09-01

    Mindfulness training is increasingly being introduced in schools, yet studies examining its impact on the developing brain have been scarce. A neurodevelopmental perspective on mindfulness has been advocated as a powerful tool to enhance our understanding of underlying neurocognitive changes that have implications for developmental well-being research and the implementation of mindfulness in education. To stimulate more research in the developmental cognitive neuroscience of mindfulness, this article outlines possible indexes of mindfulness-based change in adolescence, with a focus on event-related brain potential (ERP) markers. We provide methodological recommendations for future studies and offer examples of research paradigms. We also discuss how mindfulness practice could impact on the development of prefrontal brain structures and enhance attention control and emotion regulation skills in adolescents, impacting in turn on their self-regulation and coping skills. We highlight advantages of the ERP methodology in neurodevelopmental research of mindfulness. It is proposed that research using established experimental tasks targeting ERP components such as the contingent negative variability, N200, error-related negativity and error positivity, P300, and late positive potential could elucidate developmentally salient shifts in the neural plasticity of the adolescent brain induced by mindfulness practice.

  17. Evolution of the Plant Reproduction Master Regulators LFY and the MADS Transcription Factors: The Role of Protein Structure in the Evolutionary Development of the Flower.

    PubMed

    Silva, Catarina S; Puranik, Sriharsha; Round, Adam; Brennich, Martha; Jourdain, Agnès; Parcy, François; Hugouvieux, Veronique; Zubieta, Chloe

    2015-01-01

    Understanding the evolutionary leap from non-flowering (gymnosperms) to flowering (angiosperms) plants and the origin and vast diversification of the floral form has been one of the focuses of plant evolutionary developmental biology. The evolving diversity and increasing complexity of organisms is often due to relatively small changes in genes that direct development. These "developmental control genes" and the transcription factors (TFs) they encode, are at the origin of most morphological changes. TFs such as LEAFY (LFY) and the MADS-domain TFs act as central regulators in key developmental processes of plant reproduction including the floral transition in angiosperms and the specification of the male and female organs in both gymnosperms and angiosperms. In addition to advances in genome wide profiling and forward and reverse genetic screening, structural techniques are becoming important tools in unraveling TF function by providing atomic and molecular level information that was lacking in purely genetic approaches. Here, we summarize previous structural work and present additional biophysical and biochemical studies of the key master regulators of plant reproduction - LEAFY and the MADS-domain TFs SEPALLATA3 and AGAMOUS. We discuss the impact of structural biology on our understanding of the complex evolutionary process leading to the development of the bisexual flower.

  18. Regulatory states in the developmental control of gene expression.

    PubMed

    Peter, Isabelle S

    2017-09-01

    A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  19. Flexible Goal Adjustment from Late Childhood to Late Adolescence: Developmental Differences and Relations to Cognitive Coping and Emotion Regulation

    ERIC Educational Resources Information Center

    Thomsen, Tamara

    2016-01-01

    One way to avert negative influences on well-being when confronted with blocked goals is the flexible adjustment of one's goals to the given situation. This study examines developmental differences in flexible goal adjustment (FGA) regarding age and gender in a sample of N = 815 participants (10 to 20 years; M = 13.63, SD = 2.60, 48.5% male).…

  20. Effects of environmental disturbance on phenotypic variation: an integrated assessment of canalization, developmental stability, modularity, and allometry in lizard head shape.

    PubMed

    Lazić, Marko M; Carretero, Miguel A; Crnobrnja-Isailović, Jelka; Kaliontzopoulou, Antigoni

    2015-01-01

    When populations experience suboptimal conditions, the mechanisms involved in the regulation of phenotypic variation can be challenged, resulting in increased phenotypic variance. This kind of disturbance can be diagnosed by using morphometric tools to study morphological patterns at different hierarchical levels and evaluate canalization, developmental stability, integration, modularity, and allometry. We assess the effect of urbanization on phenotypic variation in the common wall lizard (Podarcis muralis) by using geometric morphometrics to assess disturbance to head shape development. The head shapes of urban lizards were more variable and less symmetric, suggesting that urban living is more likely to disturb development. Head shape variation was congruent within and across individuals, which indicated that canalization and developmental stability are two related phenomena in these organisms. Furthermore, urban lizards exhibited smaller mean head sizes, divergent size-shape allometries, and increased deviation from within-group allometric lines. This suggests that mechanisms regulating head shape allometry may also be disrupted. The integrated evaluation of several measures of developmental instability at different hierarchical levels, which provided in this case congruent results, can be a powerful methodological guide for future studies, as it enhances the detection of environmental disturbances on phenotypic variation and aids biological interpretation of the results.

  1. Diverse Developmental Disorders from The One Ring: Distinct Molecular Pathways Underlie the Cohesinopathies

    PubMed Central

    Horsfield, Julia A.; Print, Cristin G.; Mönnich, Maren

    2012-01-01

    The multi-subunit protein complex, cohesin, is responsible for sister chromatid cohesion during cell division. The interaction of cohesin with DNA is controlled by a number of additional regulatory proteins. Mutations in cohesin, or its regulators, cause a spectrum of human developmental syndromes known as the “cohesinopathies.” Cohesinopathy disorders include Cornelia de Lange Syndrome and Roberts Syndrome. The discovery of novel roles for chromatid cohesion proteins in regulating gene expression led to the idea that cohesinopathies are caused by dysregulation of multiple genes downstream of mutations in cohesion proteins. Consistent with this idea, Drosophila, mouse, and zebrafish cohesinopathy models all show altered expression of developmental genes. However, there appears to be incomplete overlap among dysregulated genes downstream of mutations in different components of the cohesion apparatus. This is surprising because mutations in all cohesion proteins would be predicted to affect cohesin’s roles in cell division and gene expression in similar ways. Here we review the differences and similarities between genetic pathways downstream of components of the cohesion apparatus, and discuss how such differences might arise, and contribute to the spectrum of cohesinopathy disorders. We propose that mutations in different elements of the cohesion apparatus have distinct developmental outcomes that can be explained by sometimes subtly different molecular effects. PMID:22988450

  2. Genome-wide dynamics of alternative polyadenylation in rice

    PubMed Central

    Fu, Haihui; Yang, Dewei; Su, Wenyue; Ma, Liuyin; Shen, Yingjia; Ji, Guoli; Ye, Xinfu; Wu, Xiaohui

    2016-01-01

    Alternative polyadenylation (APA), in which a transcript uses one of the poly(A) sites to define its 3′-end, is a common regulatory mechanism in eukaryotic gene expression. However, the potential of APA in determining crop agronomic traits remains elusive. This study systematically tallied poly(A) sites of 14 different rice tissues and developmental stages using the poly(A) tag sequencing (PAT-seq) approach. The results indicate significant involvement of APA in developmental and quantitative trait loci (QTL) gene expression. About 48% of all expressed genes use APA to generate transcriptomic and proteomic diversity. Some genes switch APA sites, allowing differentially expressed genes to use alternate 3′ UTRs. Interestingly, APA in mature pollen is distinct where differential expression levels of a set of poly(A) factors and different distributions of APA sites are found, indicating a unique mRNA 3′-end formation regulation during gametophyte development. Equally interesting, statistical analyses showed that QTL tends to use APA for regulation of gene expression of many agronomic traits, suggesting a potential important role of APA in rice production. These results provide thus far the most comprehensive and high-resolution resource for advanced analysis of APA in crops and shed light on how APA is associated with trait formation in eukaryotes. PMID:27733415

  3. Long-Range Control of Gene Expression: Emerging Mechanisms and Disruption in Disease

    PubMed Central

    Kleinjan, Dirk A.; van Heyningen, Veronica

    2005-01-01

    Transcriptional control is a major mechanism for regulating gene expression. The complex machinery required to effect this control is still emerging from functional and evolutionary analysis of genomic architecture. In addition to the promoter, many other regulatory elements are required for spatiotemporally and quantitatively correct gene expression. Enhancer and repressor elements may reside in introns or up- and downstream of the transcription unit. For some genes with highly complex expression patterns—often those that function as key developmental control genes—the cis-regulatory domain can extend long distances outside the transcription unit. Some of the earliest hints of this came from disease-associated chromosomal breaks positioned well outside the relevant gene. With the availability of wide-ranging genome sequence comparisons, strong conservation of many noncoding regions became obvious. Functional studies have shown many of these conserved sites to be transcriptional regulatory elements that sometimes reside inside unrelated neighboring genes. Such sequence-conserved elements generally harbor sites for tissue-specific DNA-binding proteins. Developmentally variable chromatin conformation can control protein access to these sites and can regulate transcription. Disruption of these finely tuned mechanisms can cause disease. Some regulatory element mutations will be associated with phenotypes distinct from any identified for coding-region mutations. PMID:15549674

  4. The heterochronic gene Lin28 regulates amphibian metamorphosis through disturbance of thyroid hormone function.

    PubMed

    Faunes, Fernando; Gundermann, Daniel G; Muñoz, Rosana; Bruno, Renzo; Larraín, Juan

    2017-05-15

    Metamorphosis is a classic example of developmental transition, which involves important morphological and physiological changes that prepare the organism for the adult life. It has been very well established that amphibian metamorphosis is mainly controlled by Thyroid Hormone (TH). Here, we show that the heterochronic gene Lin28 is downregulated during Xenopus laevis metamorphosis. Lin28 overexpression before activation of TH signaling delays metamorphosis and inhibits the expression of TH target genes. The delay in metamorphosis is rescued by incubation with exogenous TH, indicating that Lin28 works upstream or parallel to TH. High-throughput analyses performed before any delay on metamorphosis or change in TH signaling showed that overexpression of Lin28 reduces transcript levels of several hormones secreted by the pituitary, including the Thyroid-Stimulating Hormone (TSH), and regulates the expression of proteins involved in TH transport, metabolism and signaling, showing that Lin28 disrupts TH function at different levels. Our data demonstrates that the role of Lin28 in controlling developmental transitions is evolutionary conserved and establishes a functional interaction between Lin28 and thyroid hormone function introducing a new regulatory step in perinatal development with implications for our understanding of endocrine disorders. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Neuropilins are positive regulators of Hedgehog signal transduction

    PubMed Central

    Hillman, R. Tyler; Feng, Brian Y.; Ni, Jun; Woo, Wei-Meng; Milenkovic, Ljiljana; Hayden Gephart, Melanie G.; Teruel, Mary N.; Oro, Anthony E.; Chen, James K.; Scott, Matthew P.

    2011-01-01

    The Hedgehog (Hh) pathway is essential for vertebrate embryogenesis, and excessive Hh target gene activation can cause cancer in humans. Here we show that Neuropilin 1 (Nrp1) and Nrp2, transmembrane proteins with roles in axon guidance and vascular endothelial growth factor (VEGF) signaling, are important positive regulators of Hh signal transduction. Nrps are expressed at times and locations of active Hh signal transduction during mouse development. Using cell lines lacking key Hh pathway components, we show that Nrps mediate Hh transduction between activated Smoothened (Smo) protein and the negative regulator Suppressor of Fused (SuFu). Nrp1 transcription is induced by Hh signaling, and Nrp1 overexpression increases maximal Hh target gene activation, indicating the existence of a positive feedback circuit. The regulation of Hh signal transduction by Nrps is conserved between mammals and bony fish, as we show that morpholinos targeting the Nrp zebrafish ortholog nrp1a produce a specific and highly penetrant Hh pathway loss-of-function phenotype. These findings enhance our knowledge of Hh pathway regulation and provide evidence for a conserved nexus between Nrps and this important developmental signaling system. PMID:22051878

  6. 48 CFR 1852.227-11 - Patent Rights-Retention by the Contractor (Short Form).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... of tier, for experimental, developmental, research, design, or engineering work to be performed by... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Patent Rights-Retention by the Contractor (Short Form). 1852.227-11 Section 1852.227-11 Federal Acquisition Regulations System...

  7. IN VITRO TO IN VIVO SCREENING OF THYROID HORMONE RECEPTOR DISRUPTING CHEMICALS

    EPA Science Inventory

    Upon completion of these studies, we will have established the predictive value of the GH3.TRE-LUC cell line to detect chemicals that can impact TH regulated gene expression and TH regulated developmental events in vivo. These studies have excellent potential to discover new c...

  8. 48 CFR 3027.304-1 - General.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 7 2013-10-01 2012-10-01 true General. 3027.304-1 Section 3027.304-1 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY... subcontracts for experimental, developmental, or research work (FAR) 48 CFR 27.304-1(e)(2)(ii) may be submitted...

  9. Drosulfakinin activates CCKLR-17D1 and promotes larval locomotion and escape response in Drosophila

    USDA-ARS?s Scientific Manuscript database

    Neuropeptides are ubiquitous in both mammals and invertebrates and play essential roles in regulation and modulation of many developmental and physiological processes through activation of G-protein-coupled-receptors (GPCRs). However, the mechanisms by which many of the neuropeptides regulate speci...

  10. College Student Binge Eating: Insecure Attachment and Emotion Regulation

    ERIC Educational Resources Information Center

    Han, Suejung; Pistole, M. Carole

    2014-01-01

    Because college students who have accomplished developmental tasks less effectively may be at risk for detrimental behavior such as binge eating, we examined emotion regulation as a mediator of attachment insecurity and binge eating. Based on undergraduate and graduate student responses to a Web-based survey ("N" = 381), structural…

  11. Brassinosteroid and Gibberellin control of seedling traits in maize (Zea mays L.)

    USDA-ARS?s Scientific Manuscript database

    Brassinosteroids (BRs) and gibberellins (GAs) are two major plant hormones regulating various plant developmental processes. In maize, BRs and GAs have been shown to regulate field traits such as plant height and sex determination. This study used 207 doubled haploid maize lines and measured respons...

  12. Early Childhood Profiles of Sleep Problems and Self-Regulation Predict Later School Adjustment

    ERIC Educational Resources Information Center

    Williams, Kate E.; Nicholson, Jan M.; Walker, Sue; Berthelsen, Donna

    2016-01-01

    Background: Children's sleep problems and self-regulation problems have been independently associated with poorer adjustment to school, but there has been limited exploration of longitudinal early childhood profiles that include both indicators. Aims: This study explores the normative developmental pathway for sleep problems and self-regulation…

  13. Insecure Attachment and Eating Pathology in Early Adolescence: Role of Emotion Regulation

    ERIC Educational Resources Information Center

    van Durme, Kim; Braet, Caroline; Goossens, Lien

    2015-01-01

    The present study investigated whether associations exist between attachment dimensions toward mother and different forms of eating pathology (EP) in a group of early adolescent boys and girls, and whether these associations were mediated by maladaptive emotion regulation (ER) strategies. Developmentally appropriate self-report questionnaires were…

  14. Emotion Regulation in the Brain: Conceptual Issues and Directions for Developmental Research

    ERIC Educational Resources Information Center

    Lewis, Marc D.; Stieben, Jim

    2004-01-01

    Emotion regulation cannot be temporally distinguished from emotion in the brain, but activation patterns in prefrontal cortex appear to mediate cognitive control during emotion episodes. Frontal event-related potentials (ERPs) can tap cognitive control hypothetically mediated by the anterior cingulate cortex, and developmentalists have used these…

  15. Mechanisms of specificity in neuronal activity-regulated gene transcription

    PubMed Central

    Lyons, Michelle R.; West, Anne E.

    2011-01-01

    The brain is a highly adaptable organ that is capable of converting sensory information into changes in neuronal function. This plasticity allows behavior to be accommodated to the environment, providing an important evolutionary advantage. Neurons convert environmental stimuli into long-lasting changes in their physiology in part through the synaptic activity-regulated transcription of new gene products. Since the neurotransmitter-dependent regulation of Fos transcription was first discovered nearly 25 years ago, a wealth of studies have enriched our understanding of the molecular pathways that mediate activity-regulated changes in gene transcription. These findings show that a broad range of signaling pathways and transcriptional regulators can be engaged by neuronal activity to sculpt complex programs of stimulus-regulated gene transcription. However, the shear scope of the transcriptional pathways engaged by neuronal activity raises the question of how specificity in the nature of the transcriptional response is achieved in order to encode physiologically relevant responses to divergent stimuli. Here we summarize the general paradigms by which neuronal activity regulates transcription while focusing on the molecular mechanisms that confer differential stimulus-, cell-type-, and developmental-specificity upon activity-regulated programs of neuronal gene transcription. In addition, we preview some of the new technologies that will advance our future understanding of the mechanisms and consequences of activity-regulated gene transcription in the brain. PMID:21620929

  16. Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni.

    PubMed

    Neumann, S; Ziv, E; Lantner, F; Schechter, I

    1993-03-01

    Analyses of RNA from different developmental stages of Schistosoma mansoni showed stage-specific expression of heat-shock protein 70 (hsp70), which is regulated by a developmental program and by stress. The developmental program, common to hsp70 and other genes (e.g. paramyosin), refers to constitutive expression in miracidia sporocyst and adult worm but not in cercariae, and to the termination of hsp70 gene transcription during sporocyst/cercaria transformation. Stress induction, specific to hsp70, refers to transient accumulation of high levels of hsp70 mRNA during cercariae/schistosomula transformation and in adult worms after heat shock (42 degrees C). Cercariae/schistosomula transformation can be visualized as a physiological stress involving shifts in temperature (23-37 degrees C) and in salt concentration (from water to isotonic medium), as well as removal of tails from cercariae to yield isolated bodies that transform into schistosomula. It was found that temperature is an important factor, but not sufficient for strong induction of the hsp70 genes of schistosomula. Tail removal is an obligatory step for full induction of the hsp70 genes of schistosomula, in response to a temperature shift from 23-37 degrees C. The hsp70 genes in cercariae and isolated tails do not respond to stimuli (salt and temperature increases) that strongly activate the genes in isolated bodies (i.e., schistosomula). We speculate that the hsp70 genes in intact cercariae are not inducible because the tails can produce inhibitory signals that diffuse to the bodies and suppress their hsp70 genes. This hypothesis is useful to explain the termination of hsp70 gene transcription during sporocyst/cercaria transformation by the inhibitory effect of the growing tail.

  17. Laminar-specific and developmental expression of aquaporin-4 in the mouse hippocampus

    PubMed Central

    Hsu, Mike S.; Seldin, Marcus; Lee, Darrin J.; Seifert, Gerald; Steinhäuser, Christian; Binder, Devin K.

    2011-01-01

    Mice deficient in the water channel AQP4 demonstrate increased seizure duration in response to hippocampal stimulation as well as impaired extracellular K+ clearance. However, the expression of AQP4 in the hippocampus is not well described. In this study, we investigated i) the developmental, laminar and cell-type specificity of AQP4 expression in the hippocampus; ii) the effect of Kir4.1 deletion on AQP4 expression; and iii) performed Western blot and RT-PCR analyses. AQP4 immunohistochemistry on coronal sections from WT or Kir4.1-/- mice revealed a developmentally-regulated and laminar-specific pattern, with highest expression in the CA1 stratum lacunosummoleculare (SLM) and the molecular layer (ML) of the dentate gyrus (DG). AQP4 was colocalized with the glial markers GFAP and S100ß in the hippocampus, and was also ubiquitously expressed on astrocytic endfeet around blood vessels. No difference in AQP4 immunoreactivity was observed in Kir4.1-/- mice. Electrophysiological and postrecording RT-PCR analyses of individual cells revealed that AQP4 and Kir4.1 were co-expressed in nearly all CA1 astrocytes. In NG2 cells, AQP4 was also expressed at the transcript level. This study is the first to examine subregional AQP4 expression during development of the hippocampus. The strikingly high expression of AQP4 in the CA1 SLM and DG ML identifies these regions as potential sites of astrocytic K+ and H2O regulation. These results begin to delineate the functional capabilities of hippocampal subregions and cell types for K+ and H2O homeostasis, which is critical to excitability and serves as a potential target for modulation in diverse diseases. PMID:21256195

  18. Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

    PubMed

    Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

    2017-02-01

    Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Predictors of Developmental Outcomes of High-Risk and Developmentally Delayed Infants and Children Enrolled in a State Early Childhood Intervention Program

    ERIC Educational Resources Information Center

    Giannoni, Peggy P.; Kass, Philip H.

    2012-01-01

    A retrospective cohort study was conducted to identify child, maternal, family, and community factors associated with rate of developmental disability among children enrolled in the California Early Start Program. The cohort included 8,987 children considered at high risk for developmental disability due to medical risks and/or developmental…

  20. Influence of Kernel Age on Fumonisin B1 Production in Maize by Fusarium moniliforme

    PubMed Central

    Warfield, Colleen Y.; Gilchrist, David G.

    1999-01-01

    Production of fumonisins by Fusarium moniliforme on naturally infected maize ears is an important food safety concern due to the toxic nature of this class of mycotoxins. Assessing the potential risk of fumonisin production in developing maize ears prior to harvest requires an understanding of the regulation of toxin biosynthesis during kernel maturation. We investigated the developmental-stage-dependent relationship between maize kernels and fumonisin B1 production by using kernels collected at the blister (R2), milk (R3), dough (R4), and dent (R5) stages following inoculation in culture at their respective field moisture contents with F. moniliforme. Highly significant differences (P ≤ 0.001) in fumonisin B1 production were found among kernels at the different developmental stages. The highest levels of fumonisin B1 were produced on the dent stage kernels, and the lowest levels were produced on the blister stage kernels. The differences in fumonisin B1 production among kernels at the different developmental stages remained significant (P ≤ 0.001) when the moisture contents of the kernels were adjusted to the same level prior to inoculation. We concluded that toxin production is affected by substrate composition as well as by moisture content. Our study also demonstrated that fumonisin B1 biosynthesis on maize kernels is influenced by factors which vary with the developmental age of the tissue. The risk of fumonisin contamination may begin early in maize ear development and increases as the kernels reach physiological maturity. PMID:10388675

  1. Reciprocal expression of integration host factor and HU in the developmental cycle and infectivity of Legionella pneumophila.

    PubMed

    Morash, Michael G; Brassinga, Ann Karen C; Warthan, Michelle; Gourabathini, Poornima; Garduño, Rafael A; Goodman, Steven D; Hoffman, Paul S

    2009-04-01

    Legionella pneumophila is an intracellular parasite of protozoa that differentiates late in infection into metabolically dormant cysts that are highly infectious. Regulation of this process is poorly understood. Here we report that the small DNA binding regulatory proteins integration host factor (IHF) and HU are reciprocally expressed over the developmental cycle, with HU expressed during exponential phase and IHF expressed postexponentially. To assess the role of these regulatory proteins in development, chromosomal deletions were constructed. Single (ihfA or ihfB) and double deletion (Deltaihf) IHF mutants failed to grow in Acanthamoeba castellanii unless complemented in trans when expressed temporally from the ihfA promoter but not under P(tac) (isopropyl-beta-d-thiogalactopyranoside). In contrast, IHF mutants were infectious for HeLa cells, though electron microscopic examination revealed defects in late-stage cyst morphogenesis (thickened cell wall, intracytoplasmic membranes, and inclusions of poly-beta-hydroxybutyrate), and were depressed for the developmental marker MagA. Green fluorescent protein promoter fusion assays indicated that IHF and the stationary-phase sigma factor RpoS were required for full postexponential expression of magA. Finally, defects in cyst morphogenesis noted for Deltaihf mutants in HeLa cells correlated with a loss of both detergent resistance and hyperinfectivity compared with results for wild-type cysts. These studies establish IHF and HU as markers of developmental stages and show that IHF function is required for both differentiation and full virulence of L. pneumophila in natural amoebic hosts.

  2. Modulation of Food Reward by Endocrine and Environmental Factors: Update and Perspective.

    PubMed

    Figlewicz, Dianne P

    2015-01-01

    Palatable foods are frequently high in energy density. Chronic consumption of high-energy density foods can contribute to the development of cardiometabolic pathology including obesity, diabetes, and cardiovascular disease. This article reviews the contributions of extrinsic and intrinsic factors that influence the reward components of food intake. A narrative review was conducted to determine the behavioral and central nervous system (CNS) related processes involved in the reward components of high-energy density food intake. The rewarding aspects of food, particularly palatable and preferred foods, are regulated by CNS circuitry. Overlaying this regulation is modulation by intrinsic endocrine systems and metabolic hormones relating to energy homeostasis, developmental stage, or gender. It is now recognized that extrinsic or environmental factors, including ambient diet composition and the provocation of stress or anxiety, also contribute substantially to the expression of food reward behaviors such as motivation for, and seeking of, preferred foods. High-energy density food intake is influenced by both physiological and pathophysiological processes. Contextual, behavioral, and psychological factors and CNS-related processes represent potential targets for multiple types of therapeutic intervention.

  3. Supporting Optimal Neurodevelopmental Outcomes in Infants and Children With Congenital Heart Disease.

    PubMed

    Peterson, Jennifer K

    2018-06-01

    Improved survival has led to increased recognition of developmental delays in infants and children with congenital heart disease. Risk factors for developmental delays in congenital heart disease survivors may not be modifiable; therefore, it is important that lifesaving, high-technology critical care interventions be combined with nursing interventions that are also developmentally supportive. Implementing developmental care in a pediatric cardiac intensive care unit requires change implementation strategies and widespread support from all levels of health care professionals. This manuscript reviews developmentally supportive interventions such as massage, developmentally supportive positioning, kangaroo care, cue-based feeding, effective pain/anxiety management, and procedural preparation and identifies strategies to implement developmentally supportive interventions in the care of infants and children with congenital heart disease. Improving developmental support for these infants and children at high risk for developmental delay may improve their outcomes and help promote family-centered care. ©2018 American Association of Critical-Care Nurses.

  4. What Predicts Participation in Developmental Education among Recent High School Graduates at Community College? Lessons from Oregon. REL 2015-081

    ERIC Educational Resources Information Center

    Hodara, Michelle

    2015-01-01

    This study examines the extent of developmental education participation among Oregon high school graduates students who attend community college and the relationship between high school experiences and subsequent developmental education course-taking. An analysis of state and national data from more than 101,000 Oregon public high school graduates…

  5. Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats.

    PubMed

    Beaudin, Stephane A; Strupp, Barbara J; Strawderman, Myla; Smith, Donald R

    2017-02-01

    Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1-21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230-237; http://dx.doi.org/10.1289/EHP258.

  6. Early Postnatal Manganese Exposure Causes Lasting Impairment of Selective and Focused Attention and Arousal Regulation in Adult Rats

    PubMed Central

    Beaudin, Stephane A.; Strupp, Barbara J.; Strawderman, Myla; Smith, Donald R.

    2016-01-01

    Background: Studies in children and adolescents have associated early developmental manganese (Mn) exposure with inattention, impulsivity, hyperactivity, and oppositional behaviors, but causal inferences are precluded by the correlational nature of the data and generally limited control for potential confounders. Objectives: To determine whether early postnatal oral Mn exposure causes lasting attentional and impulse control deficits in adulthood, and whether continued lifelong Mn exposure exacerbates these effects, using a rat model of environmental Mn exposure. Methods: Neonates were exposed orally to 0, 25 or 50 mg Mn/kg/day during early postnatal life (PND 1–21) or throughout life from PND 1 until the end of the study. In adulthood, the animals were tested on a series of learning and attention tasks using the five-choice serial reaction time task. Results: Early postnatal Mn exposure caused lasting attentional dysfunction due to impairments in attentional preparedness, selective attention, and arousal regulation, whereas associative ability (learning) and impulse control were spared. The presence and severity of these deficits varied with the dose and duration of Mn exposure. Conclusions: This study is the first to show that developmental Mn exposure can cause lasting impairments in focused and selective attention and arousal regulation, and to identify the specific nature of the impairments. Given the importance of attention and arousal regulation in cognitive functioning, these findings substantiate concerns about the adverse effects of developmental Mn exposure in humans. Citation: Beaudin SA, Strupp BJ, Strawderman M, Smith DR. 2017. Early postnatal manganese exposure causes lasting impairment of selective and focused attention and arousal regulation in adult rats. Environ Health Perspect 125:230–237; http://dx.doi.org/10.1289/EHP258 PMID:27384154

  7. High-throughput Screening of ToxCast" Phase I Chemicals in an Embryonic Stem Cell Assay Reveals Potential Disruption of a Critical Developmental Signaling Pathway

    EPA Science Inventory

    Little is known about the developmental toxicity of the expansive chemical landscape in existence today. Significant efforts are being made to apply novel methods to predict developmental activity of chemicals utilizing high-throughput screening (HTS) and high-content screening (...

  8. What We Know about Developmental Education Outcomes. Research Overview

    ERIC Educational Resources Information Center

    Jaggars, Shanna Smith; Stacey, Georgia West

    2014-01-01

    Many recent high school graduates who enter community college are required to take remedial or developmental education courses before enrolling in college-level courses. Developmental courses essentially reteach high school- and junior high school-level content in reading, writing, and math. In some cases, students are referred to two or even…

  9. α5-GABAA receptors negatively regulate MYC-amplified medulloblastoma growth

    PubMed Central

    Sengupta, Soma; Weeraratne, Shyamal Dilhan; Sun, Hongyu; Phallen, Jillian; Rallapalli, Sundari K.; Teider, Natalia; Kosaras, Bela; Amani, Vladimir; Pierre-Francois, Jessica; Tang, Yujie; Nguyen, Brian; Yu, Furong; Schubert, Simone; Balansay, Brianna; Mathios, Dimitris; Lechpammer, Mirna; Archer, Tenley C.; Tran, Phuoc; Reimer, Richard J.; Cook, James M.; Lim, Michael; Jensen, Frances E.; Pomeroy, Scott L.; Cho, Yoon-Jae

    2013-01-01

    Neural tumors often express neurotransmitter receptors as markers of their developmental lineage. Although these receptors have been well characterized in electrophysiological, developmental and pharmacological settings, their importance in the maintenance and progression of brain tumors, and importantly, the effect of their targeting in brain cancers remains obscure. Here, we demonstrate high levels of GABR5, which encodes the α-subunit of the GABAA receptor complex, in aggressive MYC-driven, “Group 3” medulloblastomas. We hypothesized that modulation of α-GABAA receptors alters medulloblastoma cell survival and monitored biological and electrophysiological responses of GABR5-expressing medulloblastoma cells upon pharmacological targeting of the GABAA receptor. While antagonists, inverse agonists and non-specific positive allosteric modulators had limited effects on medulloblastoma cells, a highly specific and potent α5-GABAA receptor agonist, QHii066, resulted in marked membrane depolarization and a significant decrease in cell survival. This effect was GABR5 dependent and mediated through the induction of apoptosis as well as accumulation of cells in S and G2 phases of the cell cycle. Chemical genomic profiling of QHii066-treated medulloblastoma cells confirmed inhibition of MYC-related transcriptional activity and revealed an enrichment of HOX5 target gene expression. siRNA-mediated knockdown of HOX5 markedly blunted the response of medulloblastoma cells to QHii066. Furthermore, QHii066 sensitized GABR5 positive medulloblastoma cells to radiation and chemotherapy consistent with the role of HOX5 in directly regulating p53 expression and inducing apoptosis. Thus, our results provide novel insights into the synthetic lethal nature of α5-GABAA receptor activation in MYC-driven/Group 3 medulloblastomas and propose its targeting as a novel strategy for the management of this highly aggressive tumor. PMID:24196163

  10. Glycogen synthase kinase-3 levels and phosphorylation undergo large fluctuations in mouse brain during development

    PubMed Central

    Beurel, Eléonore; Mines, Marjelo A; Song, Ling; Jope, Richard S

    2012-01-01

    Objectives Dysregulated glycogen synthase kinase-3 (GSK3) may contribute to the pathophysiology of mood disorders and other diseases, and appears to be a target of certain therapeutic drugs. The growing recognition of heightened vulnerability during development to many psychiatric diseases, including mood disorders, led us to test if there are developmental changes in mouse brain GSK3 and its regulation by phosphorylation and by therapeutic drugs. Methods GSK3 levels and phosphorylation were measured at seven ages of development in mouse cerebral cortex and hippocampus. Results Two periods of rapid transitions in GSK3 levels were identified, a large rise between postnatal day 1 and two to three weeks of age, where GSK3 levels were as high as four-fold adult mouse brain levels, and a rapid decline between two to four and eight weeks of age, when adult levels were reached. Inhibitory serine-phosphorylation of GSK3, particularly GSK3β, was extremely high in one-day postnatal mouse brain, and rapidly declined thereafter. These developmental changes in GSK3 were equivalent in male and female cerebral cortex, and differed from other signaling kinases, including Akt, ERK1/2, JNK, and p38 levels and phosphorylation. In contrast to adult mouse brain, where administration of lithium or fluoxetine rapidly and robustly increased serine-phosphorylation of GSK3, in young mice these responses were blunted or absent. Conclusions High brain levels of GSK3 and large fluctuations in its levels and phosphorylation in juvenile and adolescent mouse brain raise the possibility that they may contribute to destabilized mood regulation induced by environmental and genetic factors. PMID:23167932

  11. Developmental roles of 21 Drosophila transcription factors are determined by quantitative differences in binding to an overlapping set of thousands of genomic regions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi

    2009-05-15

    BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of functionmore » and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.« less

  12. Maternal high-fat diet and obesity compromise fetal hematopoiesis

    PubMed Central

    Kamimae-Lanning, Ashley N.; Krasnow, Stephanie M.; Goloviznina, Natalya A.; Zhu, Xinxia; Roth-Carter, Quinn R.; Levasseur, Peter R.; Jeng, Sophia; McWeeney, Shannon K.; Kurre, Peter; Marks, Daniel L.

    2014-01-01

    Objective Recent evidence indicates that the adult hematopoietic system is susceptible to diet-induced lineage skewing. It is not known whether the developing hematopoietic system is subject to metabolic programming via in utero high-fat diet (HFD) exposure, an established mechanism of adult disease in several organ systems. We previously reported substantial losses in offspring liver size with prenatal HFD. As the liver is the main hematopoietic organ in the fetus, we asked whether the developmental expansion of the hematopoietic stem and progenitor cell (HSPC) pool is compromised by prenatal HFD and/or maternal obesity. Methods We used quantitative assays, progenitor colony formation, flow cytometry, transplantation, and gene expression assays with a series of dietary manipulations to test the effects of gestational high-fat diet and maternal obesity on the day 14.5 fetal liver hematopoietic system. Results Maternal obesity, particularly when paired with gestational HFD, restricts physiological expansion of fetal HSPCs while promoting the opposing cell fate of differentiation. Importantly, these effects are only partially ameliorated by gestational dietary adjustments for obese dams. Competitive transplantation reveals compromised repopulation and myeloid-biased differentiation of HFD-programmed HSPCs to be a niche-dependent defect, apparent in HFD-conditioned male recipients. Fetal HSPC deficiencies coincide with perturbations in genes regulating metabolism, immune and inflammatory processes, and stress response, along with downregulation of genes critical for hematopoietic stem cell self-renewal and activation of pathways regulating cell migration. Conclusions Our data reveal a previously unrecognized susceptibility to nutritional and metabolic developmental programming in the fetal HSPC compartment, which is a partially reversible and microenvironment-dependent defect perturbing stem and progenitor cell expansion and hematopoietic lineage commitment. PMID:25685687

  13. Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

    PubMed Central

    Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

    2011-01-01

    Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and physico-metabolic pathways in C. sinensis that presented in this study will guide further studies to identify novel drug targets and diagnostic antigens. PMID:21738807

  14. The Impact of Developmental Advising for High-Achieving Minority Students.

    ERIC Educational Resources Information Center

    Novels, Alphonse N.; Ender, Steven C.

    1988-01-01

    The impact of developmental advising activities with high-achieving Black students at Indiana University of Pennsylvania was investigated. Results indicate that involvement in developmental advising had a positive impact on participating students' cumulative grade point average. (Author/MLW)

  15. Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

    PubMed Central

    2016-01-01

    During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garige, Mamatha; Walters, Eric, E-mail: ewalters@howard.edu

    The molecular basis for nutraceutical properties of the polyphenol curcumin (Curcuma longa, Turmeric) is complex, affecting multiple factors that regulate cell signaling and homeostasis. Here, we report the effect of curcumin on cellular and developmental mechanisms in the eukaryotic model, Dictyostelium discoideum. Dictyostelium proliferation was inhibited in the presence of curcumin, which also suppressed the prestarvation marker, discoidin I, members of the yakA-mediated developmental signaling pathway, and expression of the extracellular matrix/cell adhesion proteins (DdCAD and csA). This resulted in delayed chemotaxis, adhesion, and development of the organism. In contrast to the inhibitory effects on developmental genes, curcumin induced gstAmore » gene expression, overall GST activity, and generated production of reactive oxygen species. These studies expand our knowledge of developmental and biochemical signaling influenced by curcumin, and lends greater consideration of GST enzyme function in eukaryotic cell signaling, development, and differentiation.« less

  17. OsMADS26 Negatively Regulates Resistance to Pathogens and Drought Tolerance in Rice1[OPEN

    PubMed Central

    Khong, Giang Ngan; Richaud, Frédérique; Parizot, Boris; Mai, Chung Duc; Bès, Martine; Bourrié, Isabelle; Meynard, Donaldo; Beeckman, Tom; Selvaraj, Michael Gomez; Manabu, Ishitani; Brugidou, Christophe; Nang Do, Vinh; Guiderdoni, Emmanuel; Morel, Jean-Benoit; Gantet, Pascal

    2015-01-01

    Functional analyses of MADS-box transcription factors in plants have unraveled their role in major developmental programs (e.g. flowering and floral organ identity) as well as stress-related developmental processes, such as abscission, fruit ripening, and senescence. Overexpression of the rice (Oryza sativa) MADS26 gene in rice has revealed a possible function related to stress response. Here, we show that OsMADS26-down-regulated plants exhibit enhanced resistance against two major rice pathogens: Magnaporthe oryzae and Xanthomonas oryzae. Despite this enhanced resistance to biotic stresses, OsMADS26-down-regulated plants also displayed enhanced tolerance to water deficit. These phenotypes were observed in both controlled and field conditions. Interestingly, alteration of OsMADS26 expression does not have a strong impact on plant development. Gene expression profiling revealed that a majority of genes misregulated in overexpresser and down-regulated OsMADS26 lines compared with control plants are associated to biotic or abiotic stress response. Altogether, our data indicate that OsMADS26 acts as an upstream regulator of stress-associated genes and thereby, a hub to modulate the response to various stresses in the rice plant. PMID:26424158

  18. How does mindfulness modulate self-regulation in pre-adolescent children? An integrative neurocognitive review.

    PubMed

    Kaunhoven, Rebekah Jane; Dorjee, Dusana

    2017-03-01

    Pre-adolescence is a key developmental period in which complex intrinsic volitional methods of self-regulation are acquired as a result of rapid maturation within the brain networks underlying the self-regulatory processes of attention control and emotion regulation. Fostering adaptive self-regulation skills during this stage of development has strong implications for physical health, emotional and socio-economic outcomes during adulthood. There is a growing interest in mindfulness-based programmes for pre-adolescents with initial findings suggesting self-regulation improvements, however, neurodevelopmental studies on mindfulness with pre-adolescents are scarce. This analytical review outlines an integrative neuro-developmental approach, which combines self-report and behavioural assessments with event related brain potentials (ERPs) to provide a systemic multilevel understanding of the neurocognitive mechanisms of mindfulness in pre-adolescence. We specifically focus on the N2, error related negativity (ERN), error positivity (Pe), P3a, P3b and late positive potential (LPP) ERP components as indexes of mindfulness related modulations in non-volitional bottom-up self-regulatory processes (salience detection, stimulus driven orienting and mind wandering) and volitional top-down self-regulatory processes (endogenous orienting and executive attention). Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  19. Nitric Oxide Analyzer Quantification of Plant S-Nitrosothiols.

    PubMed

    Hussain, Adil; Yun, Byung-Wook; Loake, Gary J

    2018-01-01

    Nitric oxide (NO) is a small diatomic molecule that regulates multiple physiological processes in animals, plants, and microorganisms. In animals, it is involved in vasodilation and neurotransmission and is present in exhaled breath. In plants, it regulates both plant immune function and numerous developmental programs. The high reactivity and short half-life of NO and cross-reactivity of its various derivatives make its quantification difficult. Different methods based on calorimetric, fluorometric, and chemiluminescent detection of NO and its derivatives are available, but all of them have significant limitations. Here we describe a method for the chemiluminescence-based quantification of NO using ozone-chemiluminescence technology in plants. This approach provides a sensitive, robust, and flexible approach for determining the levels of NO and its signaling products, protein S-nitrosothiols.

  20. Seq-ing answers: uncovering the unexpected in global gene regulation.

    PubMed

    Otto, George Maxwell; Brar, Gloria Ann

    2018-04-19

    The development of techniques for measuring gene expression globally has greatly expanded our understanding of gene regulatory mechanisms in depth and scale. We can now quantify every intermediate and transition in the canonical pathway of gene expression-from DNA to mRNA to protein-genome-wide. Employing such measurements in parallel can produce rich datasets, but extracting the most information requires careful experimental design and analysis. Here, we argue for the value of genome-wide studies that measure multiple outputs of gene expression over many timepoints during the course of a natural developmental process. We discuss our findings from a highly parallel gene expression dataset of meiotic differentiation, and those of others, to illustrate how leveraging these features can provide new and surprising insight into fundamental mechanisms of gene regulation.

  1. Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

    PubMed Central

    Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

    2006-01-01

    Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

  2. Hydroxylated PBDEs induce developmental arrest in zebrafish

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu

    The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was notmore » observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.« less

  3. Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer.

    PubMed

    Gelmedin, Verena; Brodigan, Thomas; Gao, Xin; Krause, Michael; Wang, Zhu; Hawdon, John M

    2011-01-01

    Parasitic hookworms and the free-living model nematode Caenorhabtidis elegans share a developmental arrested stage, called the dauer stage in C. elegans and the infective third-stage larva (L3) in hookworms. One of the key transcription factors that regulate entrance to and exit from developmental arrest is the forkhead transcription factor DAF-16/FoxO. During the dauer stage, DAF-16 is activated and localized in the nucleus. DAF-16 is negatively regulated by phosphorylation by the upstream kinase AKT, which causes DAF-16 to localize out of the nucleus and the worm to exit from dauer. DAF-16 is conserved in hookworms, and hypothesized to control recovery from L3 arrest during infection. Lacking reverse genetic techniques for use in hookworms, we used C. elegans complementation assays to investigate the function of Ancylostoma caninum DAF-16 during entrance and exit from L3 developmental arrest. We performed dauer switching assays and observed the restoration of the dauer phenotype when Ac-DAF-16 was expressed in temperature-sensitive dauer defective C. elegans daf-2(e1370);daf-16(mu86) mutants. AKT phosphorylation site mutants of Ac-DAF-16 were also able to restore the dauer phenotype, but surprisingly allowed dauer exit when temperatures were lowered. We used fluorescence microscopy to localize DAF-16 during dauer and exit from dauer in C. elegans DAF-16 mutant worms expressing Ac-DAF-16, and found that Ac-DAF-16 exited the nucleus during dauer exit. Surprisingly, Ac-DAF-16 with mutated AKT phosphorylation sites also exited the nucleus during dauer exit. Our results suggest that another mechanism may be involved in the regulation DAF-16 nuclear localization during recovery from developmental arrest.

  4. Function and regulation of heat shock factor 2 during mouse embryogenesis

    PubMed Central

    Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

    1997-01-01

    The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

  5. Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

    PubMed

    Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

    2018-05-07

    Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

  6. Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride

    PubMed Central

    Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E.; Staege, Martin S.; Emmer, Alexander

    2018-01-01

    Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS. PMID:29515560

  7. Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

    PubMed

    Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

    2018-01-01

    Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

  8. Deep Sequencing of the Medicago truncatula Root Transcriptome Reveals a Massive and Early Interaction between Nodulation Factor and Ethylene Signals.

    PubMed

    Larrainzar, Estíbaliz; Riely, Brendan K; Kim, Sang Cheol; Carrasquilla-Garcia, Noelia; Yu, Hee-Ju; Hwang, Hyun-Ju; Oh, Mijin; Kim, Goon Bo; Surendrarao, Anandkumar K; Chasman, Deborah; Siahpirani, Alireza F; Penmetsa, Ramachandra V; Lee, Gang-Seob; Kim, Namshin; Roy, Sushmita; Mun, Jeong-Hwan; Cook, Douglas R

    2015-09-01

    The legume-rhizobium symbiosis is initiated through the activation of the Nodulation (Nod) factor-signaling cascade, leading to a rapid reprogramming of host cell developmental pathways. In this work, we combine transcriptome sequencing with molecular genetics and network analysis to quantify and categorize the transcriptional changes occurring in roots of Medicago truncatula from minutes to days after inoculation with Sinorhizobium medicae. To identify the nature of the inductive and regulatory cues, we employed mutants with absent or decreased Nod factor sensitivities (i.e. Nodulation factor perception and Lysine motif domain-containing receptor-like kinase3, respectively) and an ethylene (ET)-insensitive, Nod factor-hypersensitive mutant (sickle). This unique data set encompasses nine time points, allowing observation of the symbiotic regulation of diverse biological processes with high temporal resolution. Among the many outputs of the study is the early Nod factor-induced, ET-regulated expression of ET signaling and biosynthesis genes. Coupled with the observation of massive transcriptional derepression in the ET-insensitive background, these results suggest that Nod factor signaling activates ET production to attenuate its own signal. Promoter:β-glucuronidase fusions report ET biosynthesis both in root hairs responding to rhizobium as well as in meristematic tissue during nodule organogenesis and growth, indicating that ET signaling functions at multiple developmental stages during symbiosis. In addition, we identified thousands of novel candidate genes undergoing Nod factor-dependent, ET-regulated expression. We leveraged the power of this large data set to model Nod factor- and ET-regulated signaling networks using MERLIN, a regulatory network inference algorithm. These analyses predict key nodes regulating the biological process impacted by Nod factor perception. We have made these results available to the research community through a searchable online resource. © 2015 American Society of Plant Biologists. All Rights Reserved.

  9. Heat stress differentially modifies ethylene biosynthesis and signaling in pea floral and fruit tissues.

    PubMed

    Savada, Raghavendra P; Ozga, Jocelyn A; Jayasinghege, Charitha P A; Waduthanthri, Kosala D; Reinecke, Dennis M

    2017-10-01

    Ethylene biosynthesis is regulated in reproductive tissues in response to heat stress in a manner to optimize resource allocation to pollinated fruits with developing seeds. High temperatures during reproductive development are particularly detrimental to crop fruit/seed production. Ethylene plays vital roles in plant development and abiotic stress responses; however, little is known about ethylene's role in reproductive tissues during development under heat stress. We assessed ethylene biosynthesis and signaling regulation within the reproductive and associated tissues of pea during the developmental phase that sets the stage for fruit-set and seed development under normal and heat-stress conditions. The transcript abundance profiles of PsACS [encode enzymes that convert S-adenosyl-L-methionine to 1-aminocyclopropane-1-carboxylic acid (ACC)] and PsACO (encode enzymes that convert ACC to ethylene), and ethylene evolution were developmentally, environmentally, and tissue-specifically regulated in the floral/fruit/pedicel tissues of pea. Higher transcript abundance of PsACS and PsACO in the ovaries, and PsACO in the pedicels was correlated with higher ethylene evolution and ovary senescence and pedicel abscission in fruits that were not pollinated under control temperature conditions. Under heat-stress conditions, up-regulation of ethylene biosynthesis gene expression in pre-pollinated ovaries was also associated with higher ethylene evolution and lower retention of these fruits. Following successful pollination and ovule fertilization, heat-stress modified PsACS and PsACO transcript profiles in a manner that suppressed ovary ethylene evolution. The normal ethylene burst in the stigma/style and petals following pollination was also suppressed by heat-stress. Transcript abundance profiles of ethylene receptor and signaling-related genes acted as qualitative markers of tissue ethylene signaling events. These data support the hypothesis that ethylene biosynthesis is regulated in reproductive tissues in response to heat stress to modulate resource allocation dynamics.

  10. Computational synchronization of microarray data with application to Plasmodium falciparum.

    PubMed

    Zhao, Wei; Dauwels, Justin; Niles, Jacquin C; Cao, Jianshu

    2012-06-21

    Microarrays are widely used to investigate the blood stage of Plasmodium falciparum infection. Starting with synchronized cells, gene expression levels are continually measured over the 48-hour intra-erythrocytic cycle (IDC). However, the cell population gradually loses synchrony during the experiment. As a result, the microarray measurements are blurred. In this paper, we propose a generalized deconvolution approach to reconstruct the intrinsic expression pattern, and apply it to P. falciparum IDC microarray data. We develop a statistical model for the decay of synchrony among cells, and reconstruct the expression pattern through statistical inference. The proposed method can handle microarray measurements with noise and missing data. The original gene expression patterns become more apparent in the reconstructed profiles, making it easier to analyze and interpret the data. We hypothesize that reconstructed gene expression patterns represent better temporally resolved expression profiles that can be probabilistically modeled to match changes in expression level to IDC transitions. In particular, we identify transcriptionally regulated protein kinases putatively involved in regulating the P. falciparum IDC. By analyzing publicly available microarray data sets for the P. falciparum IDC, protein kinases are ranked in terms of their likelihood to be involved in regulating transitions between the ring, trophozoite and schizont developmental stages of the P. falciparum IDC. In our theoretical framework, a few protein kinases have high probability rankings, and could potentially be involved in regulating these developmental transitions. This study proposes a new methodology for extracting intrinsic expression patterns from microarray data. By applying this method to P. falciparum microarray data, several protein kinases are predicted to play a significant role in the P. falciparum IDC. Earlier experiments have indeed confirmed that several of these kinases are involved in this process. Overall, these results indicate that further functional analysis of these additional putative protein kinases may reveal new insights into how the P. falciparum IDC is regulated.

  11. Remodeling of the postsynaptic plasma membrane during neural development.

    PubMed

    Tulodziecka, Karolina; Diaz-Rohrer, Barbara B; Farley, Madeline M; Chan, Robin B; Di Paolo, Gilbert; Levental, Kandice R; Waxham, M Neal; Levental, Ilya

    2016-11-07

    Neuronal synapses are the fundamental units of neural signal transduction and must maintain exquisite signal fidelity while also accommodating the plasticity that underlies learning and development. To achieve these goals, the molecular composition and spatial organization of synaptic terminals must be tightly regulated; however, little is known about the regulation of lipid composition and organization in synaptic membranes. Here we quantify the comprehensive lipidome of rat synaptic membranes during postnatal development and observe dramatic developmental lipidomic remodeling during the first 60 postnatal days, including progressive accumulation of cholesterol, plasmalogens, and sphingolipids. Further analysis of membranes associated with isolated postsynaptic densities (PSDs) suggests the PSD-associated postsynaptic plasma membrane (PSD-PM) as one specific location of synaptic remodeling. We analyze the biophysical consequences of developmental remodeling in reconstituted synaptic membranes and observe remarkably stable microdomains, with the stability of domains increasing with developmental age. We rationalize the developmental accumulation of microdomain-forming lipids in synapses by proposing a mechanism by which palmitoylation of the immobilized scaffold protein PSD-95 nucleates domains at the postsynaptic plasma membrane. These results reveal developmental changes in lipid composition and palmitoylation that facilitate the formation of postsynaptic membrane microdomains, which may serve key roles in the function of the neuronal synapse. © 2016 Tulodziecka et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  12. Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.

    PubMed

    Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko

    2018-02-13

    With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.

  13. Adolescent Family Adversity and Mental Health Problems: The Role of Adaptive Self-Regulation Capacities. The TRAILS Study

    ERIC Educational Resources Information Center

    Bakker, Martin Paul; Ormel, Johan; Verhulst, Frank C.; Oldehinkel, Albertine J.

    2011-01-01

    Adolescent family adversity is a considerable adaptive challenge in an increasingly turbulent developmental period. Using data from a prospective population cohort of 2230 Dutch adolescents, we tested risk-buffering interactions between adolescent family adversity and self-regulation capacities on mental health. We used two adaptive…

  14. The Emotion Regulation Questionnaire for Children and Adolescents (ERQ-CA): A Psychometric Evaluation

    ERIC Educational Resources Information Center

    Gullone, Eleonora; Taffe, John

    2012-01-01

    Despite the recognized importance of emotion regulation (ER) for healthy psychological development, ER research has focused predominantly on the developmental periods of infancy, early childhood, and adulthood, while the middle childhood to adolescence years have been relatively neglected. An obstacle to ER research during these periods is the…

  15. Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal mouse tissues.

    EPA Science Inventory

    PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induce...

  16. A Combinatorial Interplay Among the 1-Aminocyclopropane-1-carboxylate Isoforms Regulates Ethylene Biosynthesis in Arabidopsis thaliana

    USDA-ARS?s Scientific Manuscript database

    Ethylene (C2H4) is a unique plant-signaling molecule that regulates numerous developmental processes. The key enzyme in the two-step biosynthetic pathway of ethylene is 1-aminocyclopropane-1-carboxylate synthase (ACS), which catalyzes the conversion of Sadenosyl-methionine (AdoMet) to ACC, the precu...

  17. The Promotion of Self-Regulation through Parenting Interventions

    ERIC Educational Resources Information Center

    Sanders, Matthew R.; Mazzucchelli, Trevor G.

    2013-01-01

    The capacity for a parent to self-regulate their own performance is argued to be a fundamental process underpinning the maintenance of positive, nurturing, non-abusive parenting practices that promote good developmental and health outcomes in children. Deficits in self-regulatory capacity, which have their origins in early childhood, are common in…

  18. Emotional Reactivity, Regulation and Childhood Stuttering: A Behavioral and Electrophysiological Study

    ERIC Educational Resources Information Center

    Arnold, Hayley S.; Conture, Edward G.; Key, Alexandra P. F.; Walden, Tedra

    2011-01-01

    The purpose of this preliminary study was to assess whether behavioral and psychophysiological correlates of emotional reactivity and regulation are associated with developmental stuttering, as well as determine the feasibility of these methods in preschool-age children. Nine preschool-age children who stutter (CWS) and nine preschool-age children…

  19. The Populus homeobox gene ARBORKNOX2 regulates cell differentiation during secondary growth

    Treesearch

    Juan Du; Shawn D. Mansfield; Andrew T. Groover

    2009-01-01

    The stem cells of the vascular cambium divide to produce daughter cells, which in turn divide before undergoing differentiation during the radial growth of woody stems. The genetic regulation of these developmental events is poorly understood, however. We report here the cloning and functional characterization of a Populus class-I KNOX...

  20. Disorders of Regulation of Cognitive Activity in Autistic Children.

    ERIC Educational Resources Information Center

    Adrien, Jean Louis; And Others

    1995-01-01

    This study compared the regulation of cognitive activity in 30 children (ages 15 to 95 months) with autism or mental retardation matched for global, verbal, and nonverbal developmental ages. Testing on tasks of object permanence indicated that the autistic children had a pervasive difficulty in maintenance set, made more perseverative errors, and…

Top